index
int64
0
1,000k
blob_id
stringlengths
40
40
code
stringlengths
7
10.4M
21,700
c7975f7f7bf86f8a96237e9cab4e2b148b177f42
def create_user(first_name: str, last_name: str, age: int = 42, **kwargs): return { "name": first_name, "surname": last_name, "age": age, "extra": kwargs } print(create_user("John", "Doe")) print(create_user("Bill", "Gates", age=65)) print(create_user("Marie", "Curie", age=66, occupation="physicist", won_nobel=True))
21,701
43ddd0a7c866eb0e6dd2b5704a19fe2654ab7bc5
#-*- coding:utf-8 -*- #!/usr/bin/env python import time import json from fabric.api import * from fabric.colors import * env.use_ssh_config = True def uploadFiles(s, d): with settings(warn_only=True): result = put(s, d) if result.failed and not confirm("put tar file failed, Continue[Y/N]"): abort("aborting file put: %s-----%s" % (s, d)) else: print green("Successfully put " + s + " to dir " + d) def setFirewall(): run('sudo iptables -F') def uploadPackage(): local('zip -r ./ss-node.zip .') with settings(warn_only=True): run('rm ~/ss-node.zip') uploadFiles('./ss-node.zip', '~/') local('rm ss-node.zip') run('rm -rf ~/ss-node') run('unzip ~/ss-node.zip -d ss-node && cd ~/ss-node') def deploy(): uploadPackage() run('cd ~/ss-node && docker build -t ss-node .') setFirewall() def setup_server(): run('rpm -iUvh http://dl.fedoraproject.org/pub/epel/6/x86_64/epel-release-6-8.noarch.rpm \ && yum update -y \ && yum -y install docker-io \ && service docker start \ && chkconfig docker on \ && sudo yum install unzip -y \ ')
21,702
f5b491310ece7ab98d62f1297dfeb5d1f5f6caae
import math def KeyPairs(string): Char1 = string[0:1] Char2 = string[1:] Bintemp1 = bin(ord(Char1)) Bintemp2 = bin(ord(Char2)) Bin1 = (Bintemp1[0:1] + Bintemp1[2:]) Bin2 = (Bintemp2[0:1] + Bintemp2[2:]) while len(Bin1) < 8: Bin1 = '0' + Bin1 while len(Bin2) < 8: Bin2 = '0' + Bin2 BinaryString = (Bin1 + Bin2) return BinaryString def ConvertToTable(BinaryString): #Joe says I should make a comment #No-one listens to Joe anyway KeyBinDict = {} i = 0 a = 0 while not i == 4: TempKeyList = [] while not a == 4: TempKeyList.append((BinaryString[a:(a+1)])) a = a + 1 KeyBinDict[i] = TempKeyList a = 0 i = i + 1 return KeyBinDict
21,703
be0aef74fa1c34e8fc1bf537303041092e125b9b
def build_model(cluserting_model, data, labels): model = clustering_model(data) print("homo\tcompl\tv-meas\tARI\tAMI\tsilhouette') print(50 * "-") print('%.3f\t%.3f\t%.3f\t%.3f\t%.3f\t%.3f\t' %(metrics.homogeneity_score(labels, model.labels_), %(metrics.completeness_score(labels,model.labels_), %(metrics.v_measure_score(labels,model.labels_), %(metrics.adjusted_rand_score(labels,model.labels_), %(metrics.adjusted_mutual_info_score(labels,labels_), %(metrics.silhouette(data,model.labels_))) def k_means(data,n_clusters=3,max_iter=1000): model = KMeans(n_clusters=n_clusters, max_iter=max_iter).fit(data) return model
21,704
f3c0e4b781856b133a0ea806b19661d6a262fa3a
def list_sort(list_to_sort): for i in range(len(list_to_sort)): min_id = i for j in range(i+1,len(list_to_sort)): if list_to_sort[min_id] < list_to_sort[j]: min_id = j list_to_sort[i], list_to_sort[min_id] = list_to_sort[min_id], list_to_sort[i] if __name__ == "__main__": list_raw=[] i = 0 n = input("Nhap so luong: ") n = int(n) while i < n: temp = input("Nhap n[{0}]: ".format(i)) list_raw.append(temp) i=i+1 list_sort(list_raw) print(list_raw)
21,705
771c9512047a3062a57afe2779ac81f75a4c4354
from django.conf.urls import patterns, include, url from django.contrib.auth.decorators import login_required as auth from django.contrib import admin admin.autodiscover() from links.views import LinkListView from links.views import aboutus, participate, detailnews, sharenews, thanksharing, voteup, votedown from links.views import UserProfileDetailView from links.views import UserProfileEditView urlpatterns = patterns('', url(r'^admin/', include(admin.site.urls)), url(r'^$', LinkListView.as_view(), name='home'), url(r"^aboutus/$", aboutus, name="aboutus"), url(r"^participate/$", participate, name="participate"), url(r"^detailnews/(.+)/$", detailnews, name="detailnews"), url(r"^sharenews/(.+)/$", sharenews, name="sharenews"), url(r"^thanksharing/(.+)/$", thanksharing, name="thanksharing"), url(r"^vote/up/(.+)/$", voteup, name="voteup"), url(r"^vote/down/(.+)/$", votedown, name="votedown"), url(r"^login/$", "django.contrib.auth.views.login", {"template_name": "login.html"}, name="login"), url(r"^logout/$", "django.contrib.auth.views.logout_then_login", name="logout"), url(r"^accounts/", include("registration.backends.simple.urls")), url(r"^users/(?P<slug>\w+)/$", UserProfileDetailView.as_view(), name="profile"), url(r"edit_profile/$", auth(UserProfileEditView.as_view()), name="edit_profile") )
21,706
ac07c58a3c1be86c8d9c92c2600b0215e5c66d07
from sd1.dogs import listBreeds if __name__ == "__main__": listBreeds()
21,707
f1d4b74f79f7ace3e31d75fc2889277fc198db66
from flask import Flask from flask_restplus import Api, Resource, fields from route_tienda import Tienda, TiendaById from route_productos import Productos, ProductosById, CantidadProductos app = Flask(__name__) api = Api(app) api.add_resource(Tienda,"/api/V01/tienda") api.add_resource(Productos,"/api/V01/productos") api.add_resource(TiendaById,"/api/V01/tienda/<int:id>") api.add_resource(ProductosById,"/api/V01/productos/<int:sku>") api.add_resource(CantidadProductos,"/api/V01/productos/cantidad/<int:sku>") if __name__ == "__main__": app.run(debug = True)
21,708
456fe3b42211ac4f2ff9d91206083b4614bde09c
#!/usr/bin/env python3 import binascii import os import time import struct import unittest import bootloader_utils from bootloader_utils import MessageType, ResponseCode def open_serial_port(): if not 'SYNTH_SERIAL_PORT' in os.environ: raise KeyError('Environment variable SYNTH_SERIAL_PORT not set.') ser = bootloader_utils.BootloaderSerial(os.environ['SYNTH_SERIAL_PORT']) return ser class BootloaderTestCase(unittest.TestCase): def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.blser = None def setUp(self): self.blser = open_serial_port() def tearDown(self): self.blser.close() def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.addTypeEqualityFunc(bytes, self.assertBytesEqual) self.addTypeEqualityFunc(bytearray, self.assertBytesEqual) def assertBytesEqual(self, a, b, msg=None): if a == b: return standardMsg = '{} != {}'.format(a.hex(), b.hex()) self.fail(self._formatMessage(msg, standardMsg)) class TestSerialErrors(BootloaderTestCase): def test_packet_with_invalid_crc(self): send = bytes.fromhex('01 ff ff ff ff') send = bootloader_utils.cobs_encode(send) + b'\0' self.blser.write(send) self.blser.assert_response(ResponseCode.PACKET_CRC_FAIL) def test_packet_with_invalid_cobs(self): send = bytes.fromhex('01 ff ff ff ff 00') self.blser.write(send) self.blser.assert_response(ResponseCode.COBS_DECODE_FAIL) def test_packet_timeout(self): send = bytes.fromhex('05 ff ff ff ff') self.blser.write(send) # No data should be received before the 50 ms timeout. with self.assertRaises(TimeoutError): self.blser.read_packet(timeout=0.040) # Write some more bytes to reset timeout self.blser.write(send) # No data should be received before the 50 ms timeout. with self.assertRaises(TimeoutError): self.blser.read_packet(timeout=0.040) # Should receive timeout error packet immediately after 50 ms has # elapsed. self.blser.assert_response(ResponseCode.TIMEOUT) def test_packet_too_short(self): MIN_PACKET_LEN = 5 for packet_len in range(1, MIN_PACKET_LEN): send = (b'\01' * packet_len) + b'\x00' self.blser.write(send) self.blser.assert_response(ResponseCode.PACKET_TOO_SHORT) def test_packet_too_long(self): MAX_DATA_LENGTH = 2048 packet_data = b'\xcc' * (MAX_DATA_LENGTH + 1) self.blser.write_packet(packet_data) self.blser.assert_response(ResponseCode.PACKET_TOO_LONG) class TestMessageErrors(BootloaderTestCase): def test_invalid_message_type(self): send = b'\xFF' self.blser.write_packet(send) self.blser.assert_response(ResponseCode.INVALID_TYPE) class TestDeviceInfoMessage(BootloaderTestCase): def test_device_info_extra_bytes_in_request(self): request = bytes([MessageType.REQUEST_DEVICE_INFO, 0xAB]) self.blser.write_packet(request) self.blser.assert_response(ResponseCode.DATA_TOO_LONG) def test_valid_request(self): # This will raise an exception if device info is not received # successfully. self.blser.get_device_info() class TestEraseFlash(BootloaderTestCase): def test_message_too_short(self): # Requires 9 bytes, but only 8 are sent. packet_data = bytes.fromhex('01 00 00 10 00 00 00 18') self.blser.write_packet(packet_data) self.blser.assert_response(ResponseCode.DATA_TOO_SHORT) def test_message_too_long(self): # Requires 9 bytes, but 10 are sent. packet_data = bytes.fromhex('01 00 00 10 00 00 00 18 00 FF') self.blser.write_packet(packet_data) self.blser.assert_response(ResponseCode.DATA_TOO_LONG) def test_start_address_too_low(self): self.blser.send_erase( start=0x800, end=0x2000, response=ResponseCode.ADDR_OUT_OF_RANGE) def test_end_address_too_high(self): self.blser.send_erase( start=0x1800, end=0x16000, response=ResponseCode.ADDR_OUT_OF_RANGE) def test_start_address_bad_alignment(self): self.blser.send_erase( start=0x2400, end=0x15800, response=ResponseCode.BAD_ALIGNMENT) def test_end_address_bad_alignment(self): self.blser.send_erase( start=0x1800, end=0x12400, response=ResponseCode.BAD_ALIGNMENT) class TestVerify(BootloaderTestCase): def test_message_too_short(self): # Requires 13 bytes, but only 12 are sent. packet_data = bytes([MessageType.VERIFY] + [1] * 11) self.blser.write_packet(packet_data) self.blser.assert_response(ResponseCode.DATA_TOO_SHORT) def test_message_too_long(self): # Requires 13 bytes, but 14 are sent. packet_data = bytes([MessageType.VERIFY] + [1] * 13) self.blser.write_packet(packet_data) self.blser.assert_response(ResponseCode.DATA_TOO_LONG) def test_end_address_too_high(self): self.blser.send_verify( start=0x1800, end=0x1000002, crc=0x0, response=ResponseCode.ADDR_OUT_OF_RANGE) def test_start_address_bad_alignment(self): self.blser.send_verify( start=0x1801, end=0x1000000, crc=0x0, response=ResponseCode.BAD_ALIGNMENT) def test_end_address_bad_alignment(self): self.blser.send_verify( start=0x1800, end=0x0FFFFFF, crc=0x0, response=ResponseCode.BAD_ALIGNMENT) def test_start_address_too_high(self): self.blser.send_verify( start=0x1800, end=0x1000, crc=0x0, response=ResponseCode.ADDR_OUT_OF_RANGE) class TestEraseVerify(BootloaderTestCase): def test_erase_verify_one_page(self): # Erase a section of flash so that it has a known CRC self.blser.send_erase(start=0x1000, end=0x1800) # Calculate the expected CRC for erased flash data = b'\xFF\xFF\xFF\x00' * 0x400 expected_crc = binascii.crc32(data) # Send the verify command self.blser.send_verify( start=0x1000, end=0x1800, crc=expected_crc) def test_erase_verify_all_app_flash(self): # Erase a section of flash so that it has a known CRC self.blser.send_erase(start=0x1000, end=0x15800) # Calculate the expected CRC for erased flash data = b'\xFF\xFF\xFF\x00' * (0x14800 >> 1) expected_crc = binascii.crc32(data) # Send the verify command self.blser.send_verify(start=0x1000, end=0x15800, crc=expected_crc) class TestWriteDoubleWord(BootloaderTestCase): def test_message_too_short(self): # Requires 13 bytes, but only 12 are sent. packet_data = bytes([MessageType.WRITE_DWORD] + [1] * 11) self.blser.write_packet(packet_data) self.blser.assert_response(ResponseCode.DATA_TOO_SHORT) def test_message_too_long(self): # Requires 13 bytes, but 14 are sent. packet_data = bytes([MessageType.WRITE_DWORD] + [1] * 13) self.blser.write_packet(packet_data) self.blser.assert_response(ResponseCode.DATA_TOO_LONG) def test_start_address_too_high(self): self.blser.send_write_dword( start=0x15800, data=bytes.fromhex('ABCDEF00CAFECA00'), response=ResponseCode.ADDR_OUT_OF_RANGE) def test_start_address_bad_alignment(self): self.blser.send_write_dword( start=0x1570A, data=bytes.fromhex('ABCDEF00CAFECA00'), response=ResponseCode.BAD_ALIGNMENT) def test_start_address_too_low(self): self.blser.send_write_dword( start=0x0F0C, data=bytes.fromhex('ABCDEF00CAFECA00'), response=ResponseCode.ADDR_OUT_OF_RANGE) def test_erase_write_double_word_verify(self): # Erase a page of flash self.blser.send_erase(start=0x2000, end=0x2800) # Write a double-word to flash. data = bytes.fromhex('ABCDEF00CAFECA00') self.blser.send_write_dword(start=0x2000, data=data) # Calculate the expected CRC for newly written flash. expected_crc = binascii.crc32(data) # Send the verify command self.blser.send_verify(start=0x2000, end=0x2004, crc=expected_crc) class TestWriteRow(BootloaderTestCase): def test_message_too_short(self): # Requires 517 bytes, but only 516 are sent. packet_data = bytes([MessageType.WRITE_ROW] + [1] * 515) self.blser.write_packet(packet_data) self.blser.assert_response(ResponseCode.DATA_TOO_SHORT) def test_message_too_long(self): # Requires 517 bytes, but 518 are sent. packet_data = bytes([MessageType.WRITE_ROW] + [1] * 517) self.blser.write_packet(packet_data) self.blser.assert_response(ResponseCode.DATA_TOO_LONG) def test_start_address_too_high(self): data = b'\x00' * 512 self.blser.send_write_row( start=0x15800, data=data, response=ResponseCode.ADDR_OUT_OF_RANGE) def test_start_address_bad_alignment(self): data = b'\x00' * 512 self.blser.send_write_row( start=0x01080, data=data, response=ResponseCode.BAD_ALIGNMENT) def test_start_address_too_low(self): data = b'\x00' * 512 self.blser.send_write_row( start=0x00F00, data=data, response=ResponseCode.ADDR_OUT_OF_RANGE) def test_erase_write_row_verify(self): # Erase a section of flash self.blser.send_erase(start=0x4000, end=0x4800) # Write a row to flash data = b'\xEF\xCD\xAB\x00' * 128 self.blser.send_write_row(start=0x4000, data=data) # Calculate the expected CRC for newly written flash. expected_crc = binascii.crc32(data) # Send the verify command self.blser.send_verify( start=0x4000, end=0x4100, crc=expected_crc)
21,709
13da5c9ea35fbc10958d4eea0576ca7a700be991
import sys import re def compute_simple(line): fields = line.split(' ') N = (len(fields) - 1) // 2 n = int(fields.pop(0)) for i in range(0, N): op = fields.pop(0) val = int(fields.pop(0)) if op == '+': n += val else: n *= val return (n) def compute_complex(line): addition_re = re.compile(r'(.*?)(\d+)\s\+\s(\d+)(.*)') while m := addition_re.match(line): line = m.group(1) + str(int(m.group(2)) + int(m.group(3))) + m.group(4) return compute_simple(line) def both_parts(filename, part): bracket_re = re.compile(r'(.*?)\(([^()]+)\)(.*)') sum_ = 0 with open(filename, 'r') as f: for line in f: line = line.rstrip() while m := bracket_re.match(line): if part == 'a': v = compute_simple(m.group(2)) else: v = compute_complex(m.group(2)) line = m.group(1) + '{}'.format(v) + m.group(3) if part == 'a': sum_ += compute_simple(line) else: sum_ += compute_complex(line) return sum_ def part_a(filename): return(both_parts(filename, 'a')) def part_b(filename): return(both_parts(filename, 'b')) def entry(): if 'a' in sys.argv: print(part_a('data/day18.txt')) if 'b' in sys.argv: print(part_b('data/day18.txt')) if __name__ == "__main__": entry()
21,710
b7236670f039e5b53ca61814a26d53bdc7fc4d3a
# # See the documentation for more details on how this works # # The idea here is you provide a simulation object that overrides specific # pieces of WPILib, and modifies motors/sensors accordingly depending on the # state of the simulation. An example of this would be measuring a motor # moving for a set period of time, and then changing a limit switch to turn # on after that period of time. This can help you do more complex simulations # of your robot code without too much extra effort. # from pyfrc.physics import motor_cfgs, tankmodel from pyfrc.physics.units import units class PhysicsEngine(object): def __init__(self, physics_controller): """ :param physics_controller: `pyfrc.physics.core.PhysicsInterface` object to communicate simulation effects to """ self.physics_controller = physics_controller self.position = 0 # Change these parameters to fit your robot! bumper_width = 3.25 * units.inch # fmt: off self.drivetrain = tankmodel.TankModel.theory( motor_cfgs.MOTOR_CFG_CIM, # motor configuration 110 * units.lbs, # robot mass 10.71, # drivetrain gear ratio 3, # motors per side 23 * units.inch, # robot wheelbase 28 * units.inch + bumper_width * 2, # robot width 32 * units.inch + bumper_width * 2, # robot length 6 * units.inch, # wheel diameter ) # fmt: on def update_sim(self, hal_data, now, tm_diff): """ Called when the simulation parameters for the program need to be updated. :param now: The current time as a float :param tm_diff: The amount of time that has passed since the last time that this function was called """ try: _ = hal_data["CAN"][3] except (KeyError, IndexError): # talon must not be initialized yet return # Simulate the drivetrain l_motor = hal_data["CAN"][1]["value"] r_motor = hal_data["CAN"][4]["value"] x, y, angle = self.drivetrain.get_distance(l_motor, r_motor, tm_diff) self.physics_controller.distance_drive(x, y, angle) # Sorta simulate the elevator talon_data = hal_data["CAN"][7] speed = int(4096 * 4 * talon_data["value"] * tm_diff) talon_data["quad_position"] += speed talon_data["quad_velocity"] = speed
21,711
8da957c4d66a171fefa650046898cd9d6a6fda88
# coding=utf-8 import myorg from myorg import a print(1+1) print("xxx".__add__(str(1))) print(__name__) a=1 b=2 print(dir(myorg.a)) print(__builtins__) #print(dir()) #print(__package__) #print(__path__) #print(__file__) # 类型和地址 c=2 d=2 print(type(c)) print(id(c),id(d)) # 交换 e=1 f=2 e,f=f,e print(e,f) # 元组 tuple f=(1,"xxx",44) (id,name,age)=f print(id,name,age) print(type(f)) # 数组 g=[1,2,3,4] g[3]=2 #修改下标为3的值 print(g) print(g[0:2]) # map h={"name":"xxx","age":12} print(type(h)) print(h) print(name) # set 不能改,只能加 Set无序 #j={}默认为map,若想为Set,则j=Set{} j={1,2,3,4} j.add(8) print(j) # 去重 h=[1,3,5,3,2] print(set(h))
21,712
5c6e9a6ac8bbe5441fccb752a4e9983d83108d31
distancia = float(input("Distancia total percorrida")) cg = float(input("combustivel gasto")) texto = ("km/l") total = distancia / cg print(round(total, 3)) print(texto)
21,713
4e85b35ac869b7757fa6063234f20510768f5373
""" test. """ from time import sleep from helpers.logger import LOGGER from helpers.queues import INBOUND_QUEUE def test_inbound_put(): """ bleh. """ count = 0 while count < 600: count += 1 INBOUND_QUEUE.put(f'Another item - {count}') sleep(.5) def test_inbound_get(): """ bleh. """ count = 0 while count < 600: count += 1 next_item = INBOUND_QUEUE.get() LOGGER.info(f'Next Item: {next_item}')
21,714
a5b507d413a6737bb568ee0c2b5740074d996fb2
# Copyright 2016 Google Inc. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Check if all public modules are included in our docs.""" from __future__ import print_function import os import sys import warnings from sphinx.ext.intersphinx import fetch_inventory BASE_DIR = os.path.abspath( os.path.join(os.path.dirname(__file__), '..')) DOCS_DIR = os.path.join(BASE_DIR, 'docs') OBJECT_INVENTORY_RELPATH = os.path.join('_build', 'html', 'objects.inv') IGNORED_PREFIXES = ('test_', '_') IGNORED_MODULES = frozenset([ 'gcloud.__init__', 'gcloud.bigquery.__init__', 'gcloud.bigtable.__init__', 'gcloud.datastore.__init__', 'gcloud.dns.__init__', 'gcloud.iterator', 'gcloud.logging.__init__', 'gcloud.logging.handlers.__init__', 'gcloud.logging.handlers.transports.__init__', 'gcloud.monitoring.__init__', 'gcloud.pubsub.__init__', 'gcloud.resource_manager.__init__', 'gcloud.storage.__init__', 'gcloud.streaming.__init__', 'gcloud.streaming.buffered_stream', 'gcloud.streaming.exceptions', 'gcloud.streaming.http_wrapper', 'gcloud.streaming.stream_slice', 'gcloud.streaming.transfer', 'gcloud.streaming.util', 'gcloud.translate.__init__', ]) class SphinxApp(object): """Mock app to interact with Sphinx helpers.""" warn = warnings.warn srcdir = DOCS_DIR def is_valid_module(filename): """Determines if a filename is a valid Python module. Assumes if is just the end of a path (i.e. does not contain ``os.path.sep``. :type filename: string :param filename: The name of a file. :rtype: bool :returns: Flag indicating if the filename is valid. """ if not filename.endswith('.py'): return False if filename == '__init__.py': return True for prefix in IGNORED_PREFIXES: if filename.startswith(prefix): return False return True def get_public_modules(path, base_package=None): """Get list of all public modules relative to a path. :type path: string :param path: The path containing the python modules. :type base_package: string :param base_package: (Optional) A package to prepend in front of the path. :rtype: list :returns: List of all modules found. """ result = [] for subdir, _, files in os.walk(path): # Skip folders that start with _. if any([part.startswith('_') for part in subdir.split(os.path.sep)]): continue _, rel_dir = subdir.split(path) rel_dir = rel_dir.lstrip(os.path.sep) for filename in files: if is_valid_module(filename): mod_name, _ = os.path.splitext(filename) rel_path = os.path.join(rel_dir, mod_name) if base_package is not None: rel_path = os.path.join(base_package, rel_path) # Turn into a Python module rather than a file path. result.append(rel_path.replace(os.path.sep, '.')) return result def main(): """Main script to verify modules included.""" mock_uri = '' inventory = fetch_inventory(SphinxApp, mock_uri, OBJECT_INVENTORY_RELPATH) sphinx_mods = set(inventory['py:module'].keys()) library_dir = os.path.join(BASE_DIR, 'gcloud') public_mods = get_public_modules(library_dir, base_package='gcloud') public_mods = set(public_mods) if not sphinx_mods <= public_mods: unexpected_mods = sphinx_mods - public_mods message = ['Unexpected error. There were modules referenced by ' 'Sphinx that are not among the public modules.'] message.extend(['- %s' % (mod,) for mod in unexpected_mods]) print('\n'.join(message), file=sys.stderr) sys.exit(1) undocumented_mods = public_mods - sphinx_mods # Remove ignored modules. undocumented_mods -= IGNORED_MODULES if undocumented_mods: message_parts = ['Found undocumented public modules:'] message_parts.extend(['- ' + mod_name for mod_name in sorted(undocumented_mods)]) print('\n'.join(message_parts), file=sys.stderr) sys.exit(1) if __name__ == '__main__': main()
21,715
d1c08d6a6a2e5b6b3441d0bdf4b9c28b61f0ef80
"""Setup API for Peewee ORM models.""" import random import string from pathlib import Path from muffin import ResponseText from muffin_rest import API from muffin_rest.peewee import PWRESTHandler from .models import Pet from .schemas import PetSchema api = API(version="0.0.0", title="PetStore API", description="Example Petstore API") @api.authorization async def authorization(request): """Setup authorization for whole API. Can be redefined for an endpoint. --- # OpenAPI Authorization Specs Auth: type: http scheme: bearer description: Use any value """ # Decode tokens, load/check users and etc # ... # in the example we just ensure that the authorization header exists return request.headers.get("authorization", "") @api.route("/token") async def token(request) -> ResponseText: """A simple endpoint to get current API token. By default authorization is only awailable for class based endpoints. So the endpoint supports anonimous access. If you would like to use API authorization for the simple endpoints, you have to call it explicitly: res = await api.auth(request) if not res: ... --- # OpenAPI Specs # Mark the method as anonymous get: security: [] """ return ResponseText( "".join(random.choices(string.ascii_uppercase + string.digits, k=42)) # noqa: S311 ) @api.route class Pets(PWRESTHandler): """Everything about your Pets.""" class Meta: """Tune the endpoint.""" # ORM Model model = Pet # Schema for serialization (it can be created automatically) Schema = PetSchema # Pagination limit = 10 # Avalable sort params sorting = ("id", {"default": "desc"}), "name" # Available filters filters = "status", "category" @PWRESTHandler.route("/pet/{id}/uploadImage", methods="post") async def upload_image(self, request, *, resource: Pet): """Uploads an image. --- requestBody: required: true content: multipart/form-data: schema: type: object properties: file: type: string format: binary """ formdata = await request.form(upload_to=Path(__file__).parent) resource.image = formdata["file"].name resource.save() return resource.image
21,716
058394ad050443be2172ce0b2c04b178913c536a
#!/usr/bin/env python import gbrand def main(): C = 1000000 N = 5 grid = [] for i in xrange( N ): grid.append( [ 0 ] * N ) for i in xrange( C ): list = gbrand.badShuffle( N ) for j in xrange( N ): grid[j][list[j]] += 1 for i in xrange( len( grid ) ): for j in xrange( len( grid[i] ) ): grid[i][j] *= float( N ) / C grid[i][j] = int( grid[i][j] * 100 ) / 100.0 print "%d: %r" % (i, grid[i] ) main()
21,717
a496187b545a7156f2ae20a61ac4341b07b0f698
class GridIsFullException(Exception): pass
21,718
237d53ff6f287da34894f4c9283e758f2e27d562
import matplotlib.pyplot as plt import pandas as pd import numpy as np for i in range(0, 1000): df = pd.read_hdf("LAr_Env.h5", key='data') time = np.array(df['Time'], dtype=float) time = time/60 plt.figure(0) press = np.array(df['Pressure (arb)'], dtype=float) plt.plot(time, press, color='blue') plt.xlabel("Time (min)") plt.ylabel("Pressure (arb)") plt.figure(2) flow = np.array(df['Flow (L)'], dtype=float) flow = 1000*(flow/784) print("Liquid Volume: ", flow[-1]) plt.plot(time, flow) plt.figure(3) temp = np.array(df['Temperature (K)'], dtype=float) plt.ylabel("Temperature (K)") plt.xlabel("Time (min)") plt.plot(time, df['Temperature (K)'], color='blue') #plt.pause(30) plt.show() ''' plt.figure(2) print(df.columns) press = np.array(df['Pressure (arb)']) print(press[-40:]) plt.plot(df['Pressure (arb)']) ''' plt.show()
21,719
4c08763dbdcfe46971af66b8bfec474be6c0d27c
import torch from utils.config import * from utils.data_utils import * from utils.evaluate_utils import * from torch.utils.data import SequentialSampler,DataLoader import logging import random from models.model import transformer_model from transformers import AutoTokenizer from utils.io_utils import write_results,convert_to_slide_format from tqdm import tqdm def dev(model, dev_dataloader): all_pred_labels, all_gold_labels, all_label_lens= [], [],[] pbar = tqdm(enumerate(dev_dataloader), total=len(dev_dataloader), ncols=80) for i,batch in pbar: sents_tokens, sents_len, tokens_start, labels, sents_other_feats = \ batch['sents_tokens'].cuda(), batch['sents_len'].cuda(), batch['sents_tokens_start'].cuda(), batch['sents_label'].cuda(), batch[ 'sents_other_feats'].cuda() # Telling the model not to compute or store gradients, saving memory and speeding up validation with torch.no_grad(): output = model(sents_tokens, tokens_start, sents_other_feats, sents_len, labels) _, pred_labels = output pred_labels = pred_labels.detach().cpu().numpy() labels = labels.detach().cpu().numpy() pred_labels, labels = fix_padding(pred_labels, labels, sents_len) all_pred_labels.extend(pred_labels) all_gold_labels.extend(labels) all_label_lens.extend(sents_len.detach().cpu().numpy()) return all_pred_labels, all_gold_labels,all_label_lens if __name__=="__main__": #Logger Setting logging.basicConfig(format='%(asctime)s - %(levelname)s - %(name)s - %(message)s', datefmt='%m/%d/%Y %H:%M:%S', level=logging.INFO) logger = logging.getLogger(__name__) fileHandler = logging.FileHandler(os.path.join(args.log_file)) logger.addHandler(fileHandler) logger.info(args) # CUDA setup device = torch.device("cuda" if torch.cuda.is_available() and not args.no_cuda else "cpu") n_gpu = torch.cuda.device_count() #Set Random Seed random.seed(args.seed) np.random.seed(args.seed) torch.manual_seed(args.seed) if n_gpu > 0: torch.cuda.manual_seed_all(args.seed) torch.backends.cudnn.deterministic = True torch.backends.cudnn.benchmark = False #Loading data all_pred_labels, gold_labels, label_lens=[],[],None if args.bert_test_model_list is not None: tokenizer = AutoTokenizer.from_pretrained('xlnet-large-cased') dev_data, dev_words_id, dev_words = read_data(args.dev_file, tokenizer) dev_dataset = Data(dev_data, tokenizer) dev_dataloader = DataLoader(dev_dataset, sampler=SequentialSampler(dev_dataset), collate_fn=dev_dataset.collate_fn, batch_size=args.batch_size, num_workers=8) logger.info('Data Loaded') for i, model_name in enumerate(args.bert_test_model_list): model=transformer_model('xlnet-large-cased', device, args.dropout_prob).to(device) model.load_state_dict(torch.load(os.path.join(args.model_save_dir, model_name))) model.eval() pred_labels, gold_labels, label_lens= dev(model,dev_dataloader) all_pred_labels.append(pred_labels) if args.xlm_test_model_list is not None: tokenizer = AutoTokenizer.from_pretrained('xlm-roberta-large') dev_data, dev_words_id, dev_words = read_data(args.dev_file, tokenizer) dev_dataset = Data(dev_data, tokenizer) dev_dataloader = DataLoader(dev_dataset, sampler=SequentialSampler(dev_dataset), collate_fn=dev_dataset.collate_fn, batch_size=args.batch_size, num_workers=8) logger.info('Data Loaded') for i, model_name in enumerate(args.xlm_test_model_list): model=transformer_model('xlm-roberta-large', device, args.dropout_prob).to(device) model.load_state_dict(torch.load(os.path.join(args.model_save_dir, model_name))) model.eval() pred_labels, gold_labels, label_lens= dev(model,dev_dataloader) all_pred_labels.append(pred_labels) mean_pred_label=np.mean(all_pred_labels,axis=0) mean_pred_label, _ = fix_padding(mean_pred_label,mean_pred_label,label_lens) score_m = match_m(mean_pred_label, gold_labels) score_avg = np.mean(list(score_m.values())) logger.info("Evaluation Accuracy: ") logger.info("1:{:0.4f} 5:{:0.4f} 10:{:0.4f}".format(score_m[1], score_m[5], score_m[10])) logger.info("Average: {:0.4f}".format(score_avg))
21,720
f4b3a08821509c2c5145e9856eb12e3c759a1053
# Method overriding in inheritance:- # in case of inheritance when one class acquires # the property of another class and the property of will be same # name the derived class will override the property of base class # it is method overloading. # Example:- class A: def Data(self): print('class A member called') class B(A): def Data(self): print('class B member called') obj=B() obj.Data() print('\n\n\n') #solution:- class A: def Data(self): print('class A member called') class B(A): def Data(self): super(B,self).Data() print('class B member called') obj=B() obj.Data()
21,721
282feb0a5ce3658f1c4f8202104a37ca02d2883c
def run(): LIMITE=1000 contador=0 potencia_2= 2**contador while(potencia_2<LIMITE): print('2 elevado a la '+ str(contador) + ' es '+str(potencia_2)) contador=contador+1 potencia_2=2**contador if __name__== '__main__': run()
21,722
203fc5555b14758e15cd1f0ecb4f0ee18c28a189
# Generated by Django 2.1.1 on 2018-10-04 17:52 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('index', '0003_addr_handler'), ] operations = [ migrations.AddField( model_name='addr_handler', name='basic_tel', field=models.CharField(default=None, max_length=20), preserve_default=False, ), ]
21,723
89d2ee7dbdcd8869762c287572c5c79f04d069b2
#!/usr/bin/env python import roslib; roslib.load_manifest('grasp_pipeline') import sys import rospy from moveit_commander import RobotCommander, PlanningSceneInterface, roscpp_initialize, roscpp_shutdown from geometry_msgs.msg import PoseStamped from gazebo_msgs.msg import ModelStates from grasp_pipeline.srv import * import roslib.packages as rp pkg_path = rp.get_pkg_dir('grasp_pipeline') #To do: change this file to a ros server to load different objects. class ManageSceneInMoveit: def __init__(self): rospy.init_node('manage_moveit_scene_node') self.use_sim = rospy.get_param('~use_sim', False) self.set_table_box_properties() self.table_box_exist = False def set_table_box_properties(self): if self.use_sim: self.box_len_x = 0.9125 self.box_len_y = 0.61 self.box_len_z = 0.59 self.box_pose = PoseStamped() self.box_pose.header.frame_id = 'world' self.box_pose.pose.position.x = 0. self.box_pose.pose.position.y = -0.8 self.box_pose.pose.position.z = 0.295 self.box_pose.pose.orientation.x = 0. self.box_pose.pose.orientation.y = 0. self.box_pose.pose.orientation.z = 0. self.box_pose.pose.orientation.w = 1. else: self.box_pose = PoseStamped() self.box_pose.header.frame_id = 'world' # Change table collision box model position for the new robot arm pose self.box_pose.pose.position.x = 0. self.box_pose.pose.position.y = -0.88 self.box_pose.pose.position.z = 0.59 + 0.015 self.box_pose.pose.orientation.x = 0. self.box_pose.pose.orientation.y = 0. self.box_pose.pose.orientation.z = 0. self.box_pose.pose.orientation.w = 1. self.box_len_x = 1.4 self.box_len_y = 1.4 self.box_len_z = 0.015 # self.wall_pose = PoseStamped() # self.wall_pose.header.frame_id = 'world' # # Change table collision wall model position for the new robot arm pose # self.wall_pose.pose.position.x = 0. # self.wall_pose.pose.position.y = -1. # self.wall_pose.pose.position.z = 0. # self.wall_pose.pose.orientation.x = 0. # self.wall_pose.pose.orientation.y = 0. # self.wall_pose.pose.orientation.z = 0. # self.wall_pose.pose.orientation.w = 1. # self.wall_len_x = 5. # self.wall_len_y = 0.01 # self.wall_len_z = 5. def handle_create_moveit_scene(self, req): scene = PlanningSceneInterface() rospy.sleep(0.5) #Add a box for the table. if not self.table_box_exist: scene.add_box('table_box', self.box_pose, (self.box_len_x, self.box_len_y, self.box_len_z)) self.table_box_exist = True print req.object_mesh_path scene.add_mesh('obj_mesh', req.object_pose_world, req.object_mesh_path) # if self.use_sim: # scene.add_mesh('obj_mesh', req.object_pose_world, req.object_mesh_path) # else: # # scene.add_box('wall', self.wall_pose, # # (self.wall_len_x, self.wall_len_y, self.wall_len_z)) # scene.add_box('obj_box', req.object_pose_world, # (req.obj_seg.width, req.obj_seg.height, req.obj_seg.depth)) # scene.add_box('obj_box', req.object_pose_world, # (0.02, 0.02, req.obj_seg.depth)) rospy.sleep(0.5) response = ManageMoveitSceneResponse() response.success = True return response def create_moveit_scene_server(self): rospy.Service('create_moveit_scene', ManageMoveitScene, self.handle_create_moveit_scene) rospy.loginfo('Service create_scene:') rospy.loginfo('Ready to create the moveit_scene.') def handle_clean_moveit_scene(self, req): scene = PlanningSceneInterface() rospy.sleep(1) # clean the scene #scene.remove_world_object('table_box') scene.remove_world_object('obj_mesh') response = ManageMoveitSceneResponse() response.success = True return response def clean_moveit_scene_server(self): rospy.Service('clean_moveit_scene', ManageMoveitScene, self.handle_clean_moveit_scene) rospy.loginfo('Service clean_scene:') rospy.loginfo('Ready to clean the moveit_scene.') if __name__=='__main__': ms = ManageSceneInMoveit() ms.create_moveit_scene_server() ms.clean_moveit_scene_server() rospy.spin()
21,724
555a84b29de8053c96f8346ad5f374ad49bcf9b7
__author__ = 'Andy' # import webapp2 from google.appengine.api import users import jinja2 import os import logging template_dir = os.path.join(os.path.dirname(__file__), '../templates') #path to template_dir, __file__(dir of cur file) #set up jinja_env w/ template dir jinja_env = jinja2.Environment(loader=jinja2.FileSystemLoader(template_dir), autoescape=True) class Handler(webapp2.RequestHandler): def write(self, *a, **kw): self.response.out.write(*a, **kw) def render_str(self, template, **params): t = jinja_env.get_template(template) return t.render(params) def render(self, template, **kw): self.write(self.render_str(template, **kw)) class MainHandler(Handler): def get(self): self.render("map.html") class AboutHandler(Handler): def get(self): self.render("about.html") class testingHandler(Handler): def get(self): user = users.get_current_user() if user: greeting = ('Welcome, %s! (<a href="%s">sign out</a>)' % (user.nickname(), users.create_logout_url('/'))) else: greeting = ('<a href="%s">Sign in or register</a>.' % users.create_login_url('/')) self.response.out.write("<html><body>%s</body></html>" % greeting)
21,725
d7c7457052ebeec7398a486ea588982681dfcc24
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """ @author: hanabillings """ """ Calculates GC content of FASTA formatted sequence data. Returns the ID of the sequence and its GC content """ import re def getGCcontent(): # /Users/hanabillings/Desktop/rosalind.txt on my computer lol fileLocation = input("please input your data file location") data = open(fileLocation) text = data.read() text = text.replace('\n','') txtRegex= re.compile(r'(Rosalind[_]\d+)') data = txtRegex.findall(text) GCRegex = re.compile(r'Rosalind[_]\d+(\w+)') GCdata = GCRegex.findall(text) GCcontentDict = {} i = 0 for sequence in GCdata: C_amt = 0 G_amt = 0 for NU in sequence: if NU == "C": C_amt +=1 elif NU =="G": G_amt +=1 GCcontent = ((C_amt + G_amt)/len(sequence))*100 GCcontentDict[data[i]] = GCcontent maxGC = max(GCcontentDict, key=GCcontentDict.get) print(maxGC, "%.6f" % GCcontentDict[maxGC], "%") getGCcontent()
21,726
5ede08b600af0196a5ea147576bec39373e1bc6c
from pprint import pprint def parse_ranges(tekst): rangess = tekst.split(",") for r in rangess: if "->" in r: (out, seper,prawa) = r.partition("->") yield int(out) elif "-" in r: tablica = r.split("-") rang = range(int(tablica[0]),int(tablica[1])+1) for i in rang: yield i else: yield int(r) if __name__ == "__main__": pprint(list(parse_ranges('1-2,4-4,8-10'))) pprint(list(parse_ranges('0-0, 4-8, 20-20, 43-45'))) pprint(list(parse_ranges('0,4-8,20,43-45'))) pprint(list(parse_ranges('0, 4-8, 20->exit, 43-45')))
21,727
1cc51355cb50f632ae010776439528356128b337
"""Validation exceptions and managers.""" import pytz import traceback import contextlib import datetime import iso639 import widetime def make_validator(validator=None): return validator or ValidationManager() def valid_color(color): color = str(color).lower().strip() if len(color) != 6: return False for j in [color[i:i+2] for i in range(0,5,2)]: try: j = int(j,16) except ValueError, e: return False return True def valid_url(url): return url.startswith('http') def valid_tz(tz): return pytz.timezone(tz) def valid_language(lang): return iso639.get_language(lang) def valid_int(value, vmin=None, vmax=None, empty=False): # Allow empty string if empty=True if value == '' and empty: return True try: value = int(value) except ValueError, e: return False if vmin is not None and value < vmin: return False if vmax is not None and value > vmax: return False return True def valid_float(value, vmin=None, vmax=None, empty=False): # Allow empty string if empty=True if value == '' and empty: return True try: value = float(value) except ValueError, e: return False if vmin is not None and value < vmin: return False if vmax is not None and value > vmax: return False return True def valid_in(value, within): return value in within def valid_bool(value, empty=False): if value == '' and empty: return True try: value = int(value) except ValueError, e: return False return value in [0,1] def valid_date(value, empty=False): if not value and empty: return True if len(value) != 8: return False try: datetime.datetime.strptime(value, '%Y%m%d') except ValueError, e: return False return True def valid_widetime(value): if len(value.split(':')) != 3: return False if len(value) < 7: return False if len(value) > 8: return False try: widetime.WideTime.from_string(value) except ValueError: return False return True def valid_point(point): if len(point) != 2: return False lon, lat = point if not (-180 <= lon <= 180): return False if not (-90 <= lat <= 90): return False return True ##### Validation Exceptions ##### class ValidationException(Exception): def __init__(self, message, source=None): super(ValidationException, self).__init__(message) self.source = source class ValidationError(ValidationException): """Base validation error.""" pass class ValidationWarning(ValidationException): """Validation warning.""" pass class ValidationInfo(ValidationException): """Validation info.""" pass ##### Validation Managers ##### class ValidationManager(object): def __init__(self): # List of exceptions generated self.exceptions = [] # Source of ValidationError self.source = None def __call__(self, source=None): self.source = source return self def __enter__(self): return self def __exit__(self, etype, value, traceback): self.source = None return def report(self): print "Validation report:" for e in self.exceptions: print "%s: %s"%(e.source, e.message) class ValidationReport(ValidationManager): def __exit__(self, etype, value, traceback): # Unset the source from this context. s = self.source self.source = None if not etype: return if issubclass(etype, AssertionError): etype = ValidationError if issubclass(etype, ValidationException): self.exceptions.append(etype(value, source=s)) return True
21,728
95f403c445cfaf01c3ef4458e0b52d5261db2aaa
class Set: def __init__(self, n): self.__parent = [0 for i in range(n+1)] self.__rank = [0 for i in range(n+1)] def MakeSet(self ,i): self.__parent[i] = i self.__rank[i] = 0 def Find(self, i): if i != self.__parent[i]: self.__parent[i] = self.Find(self.__parent[i]) return self.__parent[i] def Union(self, i, j): i_id = self.Find(i) j_id = self.Find(j) if i_id == j_id: return i_id, i_id, j_id if self.__rank[i_id] > self.__rank[j_id]: self.__parent[j_id] = i_id return i_id, i_id, j_id else: self.__parent[i_id] = j_id if self.__rank[i_id] == self.__rank[j_id]: self.__rank[j_id] += 1 return j_id, i_id, j_id #временно! n, m = map(int, input().split(' ')) t = list(map(int, input().split(' '))) tables_size = [max(t)] tables_size.extend(t) path = [] s = Set(n) for i in range(1,n + 1): s.MakeSet(i) for i in range(m): dst, src = map(int, input().split(' ')) root, i_id, j_id = s.Union(dst, src) if i_id != j_id: tables_size[root] = tables_size[i_id] + tables_size[j_id] tables_size[0] = tables_size[root] if tables_size[root] > tables_size[0] else tables_size[0] print(tables_size[0])
21,729
bcd106d60ecc79dc564334a45b3c3627ad12c51d
# ------------------------------------------------------------------------------------------ # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License (MIT). See LICENSE in the repo root for license information. # ------------------------------------------------------------------------------------------ import logging import os from pathlib import Path from typing import Any, Dict, Optional, Union import torch from torch.optim.optimizer import Optimizer from torch.optim.rmsprop import RMSprop from InnerEye.Azure.azure_util import RUN_CONTEXT from InnerEye.ML.common import ModelExecutionMode from InnerEye.ML.config import ModelArchitectureConfig, PaddingMode, SegmentationModelBase, \ basic_size_shrinkage from InnerEye.ML.deep_learning_config import OptimizerType from InnerEye.ML.model_config_base import ModelConfigBase from InnerEye.ML.model_training_steps import get_scalar_model_inputs_and_labels from InnerEye.ML.models.architectures.base_model import BaseModel, CropSizeConstraints from InnerEye.ML.models.architectures.complex import ComplexModel from InnerEye.ML.models.architectures.unet_2d import UNet2D from InnerEye.ML.models.architectures.unet_3d import UNet3D from InnerEye.ML.models.layers.basic import BasicLayer from InnerEye.ML.models.parallel.data_parallel import DataParallelModel from InnerEye.ML.scalar_config import ScalarModelBase from InnerEye.ML.sequence_config import SequenceModelBase from InnerEye.ML.utils.device_aware_module import DeviceAwareModule from InnerEye.ML.utils.metrics_constants import LoggingColumns from InnerEye.ML.utils.ml_util import RandomStateSnapshot from InnerEye.ML.utils.temperature_scaling import ModelWithTemperature from InnerEye.ML.visualizers.model_summary import ModelSummary class ModelAndInfo: """ This class contains the model and optional associated information, as well as methods to create models and optimizers, move these to GPU and load state from checkpoints. Attributes are: config: the model configuration information model: the model created based on the config optimizer: the optimizer created based on the config and associated with the model checkpoint_path: the path load load checkpoint from, can be None mean_teacher_model: the mean teacher model, if and as specified by the config is_model_adjusted: whether model adjustments (which cannot be done twice) have been applied to model is_mean_teacher_model_adjusted: whether model adjustments (which cannot be done twice) have been applied to the mean teacher model checkpoint_epoch: the training epoch this model was created, if loaded from disk model_execution_mode: mode this model will be run in """ MODEL_STATE_DICT_KEY = 'state_dict' OPTIMIZER_STATE_DICT_KEY = 'opt_dict' MEAN_TEACHER_STATE_DICT_KEY = 'mean_teacher_state_dict' EPOCH_KEY = 'epoch' def __init__(self, config: ModelConfigBase, model_execution_mode: ModelExecutionMode, checkpoint_path: Optional[Path] = None): """ :param config: the model configuration information :param model_execution_mode: mode this model will be run in :param checkpoint_path: the path load load checkpoint from, can be None """ self.config = config self.checkpoint_path = checkpoint_path self.model_execution_mode = model_execution_mode self._model = None self._mean_teacher_model = None self._optimizer = None self.checkpoint_epoch = None self.is_model_adjusted = False self.is_mean_teacher_model_adjusted = False @property def model(self) -> DeviceAwareModule: if not self._model: raise ValueError("Model has not been created.") return self._model @property def optimizer(self) -> Optimizer: if not self._optimizer: raise ValueError("Optimizer has not been created.") return self._optimizer @property def mean_teacher_model(self) -> Optional[DeviceAwareModule]: if not self._mean_teacher_model and self.config.compute_mean_teacher_model: raise ValueError("Mean teacher model has not been created.") return self._mean_teacher_model @staticmethod def read_checkpoint(path_to_checkpoint: Path, use_gpu: bool) -> Dict[str, Any]: # For model debugging, allow loading a GPU trained model onto the CPU. This will clearly only work # if the model is small. map_location = None if use_gpu else 'cpu' checkpoint = torch.load(str(path_to_checkpoint), map_location=map_location) return checkpoint @classmethod def _load_checkpoint(cls, model: DeviceAwareModule, checkpoint_path: Path, key_in_state_dict: str, use_gpu: bool) -> int: """ Loads a checkpoint of a model, may be the model or the mean teacher model. Assumes the model has already been created, and the checkpoint exists. This does not set checkpoint epoch. This method should not be called externally. Use instead try_load_checkpoint_for_model or try_load_checkpoint_for_mean_teacher_model :param model: model to load weights :param checkpoint_path: Path to checkpoint :param key_in_state_dict: the key for the model weights in the checkpoint state dict :param reader: Function which takes the path and returns a dict with model and optimizer states :return checkpoint epoch from the state dict """ logging.info(f"Loading checkpoint {checkpoint_path}") checkpoint = ModelAndInfo.read_checkpoint(checkpoint_path, use_gpu) try: state_dict = checkpoint[key_in_state_dict] except KeyError: logging.error(f"Key {key_in_state_dict} not found in checkpoint") return False if isinstance(model, torch.nn.DataParallel): result = model.module.load_state_dict(state_dict, strict=False) else: result = model.load_state_dict(state_dict, strict=False) if result.missing_keys: logging.warning(f"Missing keys in model checkpoint: {result.missing_keys}") if result.unexpected_keys: logging.warning(f"Unexpected keys in model checkpoint: {result.unexpected_keys}") return checkpoint[ModelAndInfo.EPOCH_KEY] @classmethod def _adjust_for_gpus(cls, model: DeviceAwareModule, config: ModelConfigBase, model_execution_mode: ModelExecutionMode) -> DeviceAwareModule: """ Updates a torch model so that input mini-batches are parallelized across the batch dimension to utilise multiple gpus. If model parallel is set to True and execution is in test mode, then model is partitioned to perform full volume inference. This assumes the model has been created, that the optimizer has not yet been created, and the the model has not been adjusted twice. This method should not be called externally. Use instead adjust_model_for_gpus or adjust_mean_teacher_model_for_gpus :returns Adjusted model """ if config.use_gpu: model = model.cuda() logging.info("Adjusting the model to use mixed precision training.") # If model parallel is set to True, then partition the network across all available gpus. if config.use_model_parallel: devices = config.get_cuda_devices() assert devices is not None # for mypy model.partition_model(devices=devices) # type: ignore else: logging.info("Making no adjustments to the model because no GPU was found.") # Update model related config attributes (After Model Parallel Activated) config.adjust_after_mixed_precision_and_parallel(model) # DataParallel enables running the model with multiple gpus by splitting samples across GPUs # If the model is used in training mode, data parallel is activated by default. # Similarly, if model parallel is not activated, data parallel is used as a backup option use_data_parallel = (model_execution_mode == ModelExecutionMode.TRAIN) or (not config.use_model_parallel) if config.use_gpu and use_data_parallel: logging.info("Adjusting the model to use DataParallel") # Move all layers to the default GPU before activating data parallel. # This needs to happen even though we put the model to the GPU at the beginning of the method, # but we may have spread it across multiple GPUs later. model = model.cuda() model = DataParallelModel(model, device_ids=config.get_cuda_devices()) return model def create_model(self) -> None: """ Creates a model (with temperature scaling) according to the config given. """ self._model = create_model_with_temperature_scaling(self.config) def try_load_checkpoint_for_model(self) -> bool: """ Loads a checkpoint of a model. The provided model checkpoint must match the stored model. :return True if checkpoint exists and was loaded, False otherwise. """ if self._model is None: raise ValueError("Model must be created before it can be adjusted.") if not self.checkpoint_path: raise ValueError("No checkpoint provided") if not self.checkpoint_path.is_file(): logging.warning(f'No checkpoint found at {self.checkpoint_path} current working dir {os.getcwd()}') return False epoch = ModelAndInfo._load_checkpoint(model=self._model, checkpoint_path=self.checkpoint_path, key_in_state_dict=ModelAndInfo.MODEL_STATE_DICT_KEY, use_gpu=self.config.use_gpu) logging.info(f"Loaded model from checkpoint (epoch: {epoch})") self.checkpoint_epoch = epoch return True def adjust_model_for_gpus(self) -> None: """ Updates the torch model so that input mini-batches are parallelized across the batch dimension to utilise multiple gpus. If model parallel is set to True and execution is in test mode, then model is partitioned to perform full volume inference. """ if self._model is None: raise ValueError("Model must be created before it can be adjusted.") # Adjusting twice causes an error. if self.is_model_adjusted: logging.debug("model_and_info.is_model_adjusted is already True") if self._optimizer: raise ValueError("Create an optimizer only after creating and adjusting the model.") self._model = ModelAndInfo._adjust_for_gpus(model=self._model, config=self.config, model_execution_mode=self.model_execution_mode) self.is_model_adjusted = True logging.debug("model_and_info.is_model_adjusted set to True") def create_summary_and_adjust_model_for_gpus(self) -> None: """ Generates the model summary, which is required for model partitioning across GPUs, and then moves the model to GPU with data parallel/model parallel by calling adjust_model_for_gpus. """ if self._model is None: raise ValueError("Model must be created before it can be adjusted.") if self.config.is_segmentation_model: summary_for_segmentation_models(self.config, self._model) # Prepare for mixed precision training and data parallelization (no-op if already done). # This relies on the information generated in the model summary. self.adjust_model_for_gpus() def try_create_model_and_load_from_checkpoint(self) -> bool: """ Creates a model as per the config, and loads the parameters from the given checkpoint path. Also updates the checkpoint_epoch. :return True if checkpoint exists and was loaded, False otherwise. """ self.create_model() if self.checkpoint_path: # Load the stored model. If there is no checkpoint present, return immediately. return self.try_load_checkpoint_for_model() return True def try_create_model_load_from_checkpoint_and_adjust(self) -> bool: """ Creates a model as per the config, and loads the parameters from the given checkpoint path. The model is then adjusted for data parallelism and mixed precision. Also updates the checkpoint_epoch. :return True if checkpoint exists and was loaded, False otherwise. """ success = self.try_create_model_and_load_from_checkpoint() self.create_summary_and_adjust_model_for_gpus() return success def create_mean_teacher_model(self) -> None: """ Creates a model (with temperature scaling) according to the config given. """ self._mean_teacher_model = create_model_with_temperature_scaling(self.config) def try_load_checkpoint_for_mean_teacher_model(self) -> bool: """ Loads a checkpoint of a model. The provided model checkpoint must match the stored model. :return True if checkpoint exists and was loaded, False otherwise. """ if self._mean_teacher_model is None: raise ValueError("Mean teacher model must be created before it can be adjusted.") if not self.checkpoint_path: raise ValueError("No checkpoint provided") if not self.checkpoint_path.is_file(): logging.warning(f'No checkpoint found at {self.checkpoint_path} current working dir {os.getcwd()}') return False epoch = ModelAndInfo._load_checkpoint(model=self._mean_teacher_model, checkpoint_path=self.checkpoint_path, key_in_state_dict=ModelAndInfo.MEAN_TEACHER_STATE_DICT_KEY, use_gpu=self.config.use_gpu) logging.info(f"Loaded mean teacher model from checkpoint (epoch: {epoch})") self.checkpoint_epoch = epoch return True def adjust_mean_teacher_model_for_gpus(self) -> None: """ Updates the torch model so that input mini-batches are parallelized across the batch dimension to utilise multiple gpus. If model parallel is set to True and execution is in test mode, then model is partitioned to perform full volume inference. """ if self._mean_teacher_model is None: raise ValueError("Mean teacher model must be created before it can be adjusted.") # Adjusting twice causes an error. if self.is_mean_teacher_model_adjusted: logging.debug("model_and_info.is_mean_teacher_model_adjusted is already True") self._mean_teacher_model = ModelAndInfo._adjust_for_gpus(model=self._mean_teacher_model, config=self.config, model_execution_mode=self.model_execution_mode) self.is_mean_teacher_model_adjusted = True logging.debug("model_and_info.is_mean_teacher_model_adjusted set to True") def create_summary_and_adjust_mean_teacher_model_for_gpus(self) -> None: """ Generates the model summary, which is required for model partitioning across GPUs, and then moves the model to GPU with data parallel/model parallel by calling adjust_model_for_gpus. """ if self._mean_teacher_model is None: raise ValueError("Mean teacher model must be created before it can be adjusted.") if self.config.is_segmentation_model: summary_for_segmentation_models(self.config, self._mean_teacher_model) # Prepare for mixed precision training and data parallelization (no-op if already done). # This relies on the information generated in the model summary. self.adjust_mean_teacher_model_for_gpus() def try_create_mean_teacher_model_and_load_from_checkpoint(self) -> bool: """ Creates a model as per the config, and loads the parameters from the given checkpoint path. Also updates the checkpoint_epoch. :return True if checkpoint exists and was loaded, False otherwise. """ self.create_mean_teacher_model() if self.checkpoint_path: # Load the stored model. If there is no checkpoint present, return immediately. return self.try_load_checkpoint_for_mean_teacher_model() return True def try_create_mean_teacher_model_load_from_checkpoint_and_adjust(self) -> bool: """ Creates a model as per the config, and loads the parameters from the given checkpoint path. The model is then adjusted for data parallelism and mixed precision. Also updates the checkpoint_epoch. :return True if checkpoint exists and was loaded, False otherwise. """ success = self.try_create_mean_teacher_model_and_load_from_checkpoint() self.create_summary_and_adjust_mean_teacher_model_for_gpus() return success def create_optimizer(self) -> None: """ Creates a torch optimizer for the given model, and stores it as an instance variable in the current object. """ # Make sure model is created before we create optimizer if self._model is None: raise ValueError("Model checkpoint must be created before optimizer checkpoint can be loaded.") # Select optimizer type if self.config.optimizer_type in [OptimizerType.Adam, OptimizerType.AMSGrad]: self._optimizer = torch.optim.Adam(self._model.parameters(), self.config.l_rate, self.config.adam_betas, self.config.opt_eps, self.config.weight_decay, amsgrad=self.config.optimizer_type == OptimizerType.AMSGrad) elif self.config.optimizer_type == OptimizerType.SGD: self._optimizer = torch.optim.SGD(self._model.parameters(), self.config.l_rate, self.config.momentum, weight_decay=self.config.weight_decay) elif self.config.optimizer_type == OptimizerType.RMSprop: self._optimizer = RMSprop(self._model.parameters(), self.config.l_rate, self.config.rms_alpha, self.config.opt_eps, self.config.weight_decay, self.config.momentum) else: raise NotImplementedError(f"Optimizer type {self.config.optimizer_type.value} is not implemented") def try_load_checkpoint_for_optimizer(self) -> bool: """ Loads a checkpoint of an optimizer. :return True if the checkpoint exists and optimizer state loaded, False otherwise """ if self._optimizer is None: raise ValueError("Optimizer must be created before optimizer checkpoint can be loaded.") if not self.checkpoint_path: logging.warning("No checkpoint path provided.") return False if not self.checkpoint_path.is_file(): logging.warning(f'No checkpoint found at {self.checkpoint_path} current working dir {os.getcwd()}') return False logging.info(f"Loading checkpoint {self.checkpoint_path}") checkpoint = ModelAndInfo.read_checkpoint(self.checkpoint_path, self.config.use_gpu) try: state_dict = checkpoint[ModelAndInfo.OPTIMIZER_STATE_DICT_KEY] except KeyError: logging.error(f"Key {ModelAndInfo.OPTIMIZER_STATE_DICT_KEY} not found in checkpoint") return False self._optimizer.load_state_dict(state_dict) logging.info(f"Loaded optimizer from checkpoint (epoch: {checkpoint[ModelAndInfo.EPOCH_KEY]})") self.checkpoint_epoch = checkpoint[ModelAndInfo.EPOCH_KEY] return True def try_create_optimizer_and_load_from_checkpoint(self) -> bool: """ Creates an optimizer and loads its state from a checkpoint. :return True if the checkpoint exists and optimizer state loaded, False otherwise """ self.create_optimizer() if self.checkpoint_path: return self.try_load_checkpoint_for_optimizer() return True def save_checkpoint(self, epoch: int) -> Path: """ Saves a checkpoint of the current model and optimizer_type parameters in the specified folder and uploads it to the output blob storage of the current run context. The checkpoint's name for epoch 123 would be 123_checkpoint.pth.tar. :param epoch: The last epoch used to train the model. :return: The full path of the checkpoint file. """ logging.getLogger().disabled = True model_state_dict = self.model.module.state_dict() \ if isinstance(self.model, torch.nn.DataParallel) else self.model.state_dict() checkpoint_file_path = self.config.get_path_to_checkpoint(epoch) checkpoint_file_path.parent.mkdir(exist_ok=True, parents=True) info_to_store = { ModelAndInfo.EPOCH_KEY: epoch, ModelAndInfo.MODEL_STATE_DICT_KEY: model_state_dict, ModelAndInfo.OPTIMIZER_STATE_DICT_KEY: self.optimizer.state_dict() } if self.config.compute_mean_teacher_model: assert self.mean_teacher_model is not None # for mypy, getter has this built in mean_teacher_model_state_dict = self.mean_teacher_model.module.state_dict() \ if isinstance(self.mean_teacher_model, torch.nn.DataParallel) \ else self.mean_teacher_model.state_dict() info_to_store[ModelAndInfo.MEAN_TEACHER_STATE_DICT_KEY] = mean_teacher_model_state_dict torch.save(info_to_store, checkpoint_file_path) logging.getLogger().disabled = False logging.info(f"Saved model checkpoint for epoch {epoch} to {checkpoint_file_path}") return checkpoint_file_path def init_weights(m: Union[torch.nn.Conv3d, torch.nn.BatchNorm3d]) -> None: """ Initialize the weights of a Pytorch module. :param m: A PyTorch module. Only Conv3d and BatchNorm3d are initialized. """ import torch if isinstance(m, torch.nn.Conv3d): torch.nn.init.normal_(m.weight, 0, 0.01) elif isinstance(m, torch.nn.BatchNorm3d): torch.nn.init.constant_(m.weight, 1) torch.nn.init.constant_(m.bias, 0) # noinspection PyTypeChecker def build_net(args: SegmentationModelBase) -> BaseModel: """ Build network architectures :param args: Network configuration arguments """ full_channels_list = [args.number_of_image_channels, *args.feature_channels, args.number_of_classes] initial_fcn = [BasicLayer] * 2 residual_blocks = [[BasicLayer, BasicLayer]] * 3 basic_network_definition = initial_fcn + residual_blocks # type: ignore # no dilation for the initial FCN and then a constant 1 neighbourhood dilation for the rest residual blocks basic_dilations = [1] * len(initial_fcn) + [2, 2] * len(basic_network_definition) # Crop size must be at least 29 because all architectures (apart from UNets) shrink the input image by 28 crop_size_constraints = CropSizeConstraints(minimum_size=basic_size_shrinkage + 1) run_weight_initialization = True network: BaseModel if args.architecture == ModelArchitectureConfig.Basic: network_definition = basic_network_definition network = ComplexModel(args, full_channels_list, basic_dilations, network_definition, crop_size_constraints) # type: ignore elif args.architecture == ModelArchitectureConfig.UNet3D: network = UNet3D(input_image_channels=args.number_of_image_channels, initial_feature_channels=args.feature_channels[0], num_classes=args.number_of_classes, kernel_size=args.kernel_size) run_weight_initialization = False elif args.architecture == ModelArchitectureConfig.UNet2D: network = UNet2D(input_image_channels=args.number_of_image_channels, initial_feature_channels=args.feature_channels[0], num_classes=args.number_of_classes, padding_mode=PaddingMode.Edge) run_weight_initialization = False else: raise ValueError(f"Unknown model architecture {args.architecture}") network.validate_crop_size(args.crop_size, "Training crop size") network.validate_crop_size(args.test_crop_size, "Test crop size") # type: ignore # Initialize network weights if run_weight_initialization: network.apply(init_weights) # type: ignore return network def summary_for_segmentation_models(config: ModelConfigBase, model: DeviceAwareModule) -> None: """ Generates a human readable summary of the present segmentation model, writes it to logging.info, and stores the ModelSummary object inside the argument `model`. :param config: The configuration for the model. :param model: The instantiated Pytorch model. """ assert isinstance(model, BaseModel) crop_size = config.crop_size if isinstance(crop_size, int): crop_size = (crop_size, crop_size, crop_size) try: model.generate_model_summary(crop_size, log_summaries_to_files=config.log_summaries_to_files) except AttributeError as e: logging.warning(f"summary_for_segmentation_models failed with exception {e}") def generate_and_print_model_summary(config: ModelConfigBase, model: DeviceAwareModule) -> None: """ Writes a human readable summary of the present model to logging.info, and logs the number of trainable parameters to AzureML. :param config: The configuration for the model. :param model: The instantiated Pytorch model. """ random_state = RandomStateSnapshot.snapshot_random_state() # There appears to be a bug in apex, where previous use (in training for example) causes problems # when another model is later built on the CPU (for example, before loading from a checkpoint) # https://github.com/NVIDIA/apex/issues/694 # Hence, move the model to the GPU before doing model summary. if config.use_gpu: model = model.cuda() if isinstance(config, ScalarModelBase): # To generate the model summary, read the first item of the dataset. Then use the model's own # get_model_input function to convert the dataset item to input tensors, and feed them through the model. train_dataset = config.get_torch_dataset_for_inference(ModelExecutionMode.TRAIN) train_item_0 = next(iter(train_dataset.as_data_loader(shuffle=False, batch_size=1, num_dataload_workers=0))) model_inputs = get_scalar_model_inputs_and_labels(config, model, train_item_0).model_inputs # The model inputs may already be converted to float16, assuming that we would do mixed precision. # However, the model is not yet converted to float16 when this function is called, hence convert back to float32 summary = ModelSummary(model) summary.generate_summary(input_tensors=model_inputs, log_summaries_to_files=config.log_summaries_to_files) elif config.is_segmentation_model: summary_for_segmentation_models(config, model) assert model.summarizer summary = model.summarizer # type: ignore else: raise ValueError("Don't know how to generate a summary for this type of model?") RUN_CONTEXT.log(LoggingColumns.NumTrainableParameters, summary.n_trainable_params) random_state.restore_random_state() def create_model_with_temperature_scaling(config: ModelConfigBase) -> Any: """ Create a model with temperature scaling by wrapping the result of config.create_model with ModelWithTemperature, if temperature scaling config has been provided, otherwise return the result of config.create_model """ # wrap the model around a temperature scaling model if required model = config.create_model() if isinstance(config, SequenceModelBase) and config.temperature_scaling_config: model = ModelWithTemperature(model, config.temperature_scaling_config) return model
21,730
22e592053e6fcacca896b1da0fe22bb7cf98904b
import os import tensorflow as tf import io from object_detection.utils import dataset_util from PIL import Image from time import time #cwd = os.getcwd() # new a tensorflow model sess = tf.Session() # make a placeholder more flexible encoded_jpg_ph = tf.placeholder(tf.string, shape=[]) # set resize layer height = 256 width = 256 # resizing the image here decoded_image = tf.image.decode_jpeg(encoded_jpg_ph) decoded_image_resized = tf.image.resize_images(decoded_image, [height, width]) # this returns float32 decoded_image_resized_uint = tf.cast(decoded_image_resized, tf.uint8) resize_image = tf.image.encode_jpeg(decoded_image_resized_uint) # expects uint8 # reset all variables sess.run(tf.global_variables_initializer()) def create_cat_tf_example(label, label_text, img_path, img_name): """Creates a tf.Example proto from sample cat image. Args: encoded_cat_image_data: The jpg encoded data of the cat image. Returns: example: The created tf.Example. """ with tf.gfile.FastGFile(img_path + img_name, 'rb') as fid: encoded_image = fid.read() encoded_image_data = sess.run(resize_image, {encoded_jpg_ph: encoded_image}) # I think this may not be the right way of doing this b_filename = str.encode(img_name) image_format = b'jpg' xmins = [10.0 / width] xmaxs = [(width - 10) / width] ymins = [10.0 / height] ymaxs = [(height - 10.0) / height] # classes_text = [str.encode(label_text)] classes_text = [] if label_text: classes_text.append(label_text.encode('utf8')) classes = [] # if label == 1: classes.append(int(label)) # print(classes_text, classes, b_filename) tf_example = tf.train.Example(features=tf.train.Features(feature={ 'image/height': dataset_util.int64_feature(height), 'image/width': dataset_util.int64_feature(width), 'image/filename': dataset_util.bytes_feature(b_filename), 'image/source_id': dataset_util.bytes_feature(b_filename), 'image/encoded': dataset_util.bytes_feature(encoded_image_data), # 'image/encoded': dataset_util.bytes_feature(encoded_jpg), 'image/format': dataset_util.bytes_feature(image_format), 'image/object/bbox/xmin': dataset_util.float_list_feature(xmins), 'image/object/bbox/xmax': dataset_util.float_list_feature(xmaxs), 'image/object/bbox/ymin': dataset_util.float_list_feature(ymins), 'image/object/bbox/ymax': dataset_util.float_list_feature(ymaxs), 'image/object/class/text': dataset_util.bytes_list_feature(classes_text), 'image/object/class/label': dataset_util.int64_list_feature(classes), })) return tf_example if __name__ == '__main__': start_time = time() each_batch_time = time() # collect the dirs mode_list = ["train", "eval"] for mode in mode_list: cwd = "C:/Users/VIPLAB/Desktop/dog_vs_cat_detection/dataset/self_divide/" + mode + "/" # classes = ["cat", "dog"] classes = ["dog", "cat"] writer = tf.python_io.TFRecordWriter("C:/Users/VIPLAB/Desktop/dog_vs_cat_detection/dataset/TFRECORD/" + mode + ".tfrecords") for index, name in enumerate(classes): class_path = cwd + name + "/" for img_count, img_name in enumerate(os.listdir(class_path)): if (img_count % 100 == 0): output_str = mode + " step -- " + str(img_count) print(output_str, " compute 100 image _ batch time = ", time() - each_batch_time) print("id =", int(index+1),name, img_name, class_path) each_batch_time = time() # sess.close() # # reset session otherwise it will run slowly # tf.reset_default_graph() # sess = tf.Session() # img_path = class_path + img_name each_record = create_cat_tf_example(label = index + 1 , label_text = name, img_path = class_path, img_name = img_name) # if(name == "dog"): # each_record = create_cat_tf_example(label = 1, label_text = name, img_path = class_path, img_name = img_name) # else: # each_record = create_cat_tf_example(label = None, label_text = None, img_path = class_path, img_name = img_name) writer.write(each_record.SerializeToString()) #序列化为字符串 writer.close() print(mode , "is finished.") sess.close() print("cost time =", time() - start_time)
21,731
2530111f35244bbc5ef29d200439aacd50c7a4db
""" Videos module: fetches a list of playable streams (assets) or categories (channels) """ # main imports import sys import os import xbmc import xbmcgui import xbmcplugin import re import urllib import MpTVConnector class _Info: def __init__( self, *args, **kwargs ): self.__dict__.update( kwargs ) class Main: # base paths BASE_PATH = os.getcwd().replace( ";", "" ) _handle = int(sys.argv[ 1 ]) def __init__( self ): print "[tvserver] handle=" + str(self._handle) self._path = sys.argv[ 0 ] if self._handle == -1: print "[tvserver] Invalid handle." self._is_playing = False self._get_xbmc_version() self._get_settings() try: server_host = str(self.settings["mptvserver"]) server_port = int(self.settings["mptvport"]) except: print "[tvserver] Error retrieving host and port settings. Using default 'localhost:9596'" server_host = "localhost" server_port = 9596 # init the connection self._conn = MpTVConnector.MpTVConnector() self._conn.connect(server_host, server_port) showshift = False if sys.argv[ 2 ]: chanUrl = sys.argv[ 2 ] print "[tvserver] chanUrl: " + chanUrl if chanUrl.startswith("?G"): # this is a group print "[tvserver] get_channel: " + chanUrl[ 3: ] ok = self.get_channel(chanUrl[ 3: ]) showshift = True elif chanUrl.startswith("?C"): print "[tvserver] choose_channel: " + chanUrl[ 3: ] ok = self.choose_channel(chanUrl[ 3: ]) showshift = True elif chanUrl.startswith("?K"): ok = self.stop_timeshift() showshift = True elif chanUrl.startswith("?S"): xbmc.output("[tvserver] Choose_show: " + chanUrl[ 3: ]) print "[tvserver] choose_show: " + chanUrl[ 3: ] ok = self.choose_show(showUrl[ 3: ]) elif chanUrl.startswith("?D"): print "[tvserver] delete show: " + chanUrl[ 3: ] ok = self.delete_show(chanUrl[ 3: ]) elif chanUrl.startswith("?R"): xbmc.output("[tvserver] Container.Refresh") xbmc.executebuiltin("Container.Refresh") ok = True elif chanUrl.startswith("?PS"): # play shows xbmc.output("[tvserver] TVServer play shows") ok = self.get_shows() elif chanUrl.startswith("?PL"): # play live TV print "[tvserver] play live tv" ok = self.get_groups() showshift = True else: print "Unknown path : ", chanUrl else: ok = self.main_menu() if ok: if showshift: curShift = self._conn.isTimeshifting(); if curShift[0] == "True": try: curProgram = curShift[3] + " - " + curShift[4] + " [" + curShift[5] + "]" listitem = xbmcgui.ListItem("Current Timeshift: " + curProgram, iconImage = "DefaultFolder.png") # give the item a stop timeshift context menu listitem.addContextMenuItems([("Stop Timeshifting", "XBMC.RunPlugin(%s?K)" % (self._path))]) #print "[tvserver] before addDirectoryItem handle=" + str(self._handle) ok = xbmcplugin.addDirectoryItem( handle=self._handle, url=curShift[1], listitem=listitem, isFolder=False) # also add a separate stop timeshift entry listitem = xbmcgui.ListItem("Stop Timeshift: " + curProgram, iconImage = "DefaultFolder.png") print "url=%s?K" % (self._path) ok = xbmcplugin.addDirectoryItem( handle=self._handle, url="%s?K" % (self._path), listitem=listitem, isFolder=False) except: print "[tvserver] error getting curShift" # send notification we're finished, successfully or unsuccessfully xbmcplugin.endOfDirectory( handle=self._handle, succeeded=ok, cacheToDisc=False ) def _get_settings( self ): self.settings = {} if self.VERSION_XBMC >= 30000: # Starting from XBMC PRE 10.x, getSetting has 2 arguments print "[tvserver] handle=" + str(self._handle) self.settings["mptvserver"] = xbmcplugin.getSetting(self._handle, "mptvserver") self.settings["mptvport"] = xbmcplugin.getSetting(self._handle, "mptvport") self.settings["mprecplayback"] = xbmcplugin.getSetting(self._handle, "mprecplayback") self.settings["mpsharename"] = xbmcplugin.getSetting(self._handle, "mpsharename") self.settings["extsort"] = ( xbmcplugin.getSetting(self._handle, "extsort") == "true" ) else: self.settings["mptvserver" ] = xbmcplugin.getSetting("mptvserver") self.settings["mptvport" ] = xbmcplugin.getSetting("mptvport") self.settings["mprecplayback"] = xbmcplugin.getSetting("mprecplayback") self.settings["mpsharename"] = xbmcplugin.getSetting("mpsharename") self.settings["extsort" ] = ( xbmcplugin.getSetting("extsort") == "true" ) def _get_xbmc_version( self ): try: buildVersion = xbmc.getInfoLabel("System.BuildVersion") if buildVersion.startswith('PRE-10.') or buildVersion.startswith('10.') or buildVersion.startswith('9.') or buildVersion.startswith('UNKNOWN'): # XBMC with revision info rXXXXX xbmc.output ("[tvserver] XBMC BuildVersion: " + buildVersion) try: rev_re = re.compile(' r(\d+)') self.VERSION_XBMC = int(rev_re.search(buildVersion).group(1)) except: if buildVersion.startswith('PRE-10.') or buildVersion.startswith('10.'): self.VERSION_XBMC = 30000 else: self.VERSION_XBMC = 0 elif buildVersion.startswith('0.9.'): # Boxee betas xbmc.output ("[tvserver] BOXEE BuildVersion: " + buildVersion) rev_re = re.compile('0\.9\.\d+\.(\d+)') self.VERSION_BOXEE = int (rev_re.search(buildVersion).group(1)) self.VERSION_XBMC = 0 xbmc.output ("[tvserver] initial version of BOXEE: %d" % (VERSION_BOXEE,)) else: # Plex ? xbmc.output ("[tvserver] XBMC BuildVersion: " + buildVersion) self.VERSION_XBMC = 0 except: xbmc.output ("[tvserver] init except: %s" % (sys.exc_info()[0],)) self.VERSION_XBMC = 0 #return VERSION_XBMC def get_groups ( self ): try: groups = self._conn.getGroups() icon = "DefaultFolder.png" for group in groups: listitem = xbmcgui.ListItem(group, iconImage = icon) url = '%s?G?%s' % (self._path, group) ok = xbmcplugin.addDirectoryItem( handle=self._handle, url=url, listitem=listitem, isFolder=True, totalItems=len(groups) ) if ( not ok ): raise except: print sys.exc_info()[ 1 ] ok = False return ok def main_menu ( self ): try: listitem = xbmcgui.ListItem("Live TV", iconImage = "DefaultFolder.png") ok = xbmcplugin.addDirectoryItem( handle=self._handle, url="%s?PL" % (self._path), listitem=listitem, isFolder=True) listitem = xbmcgui.ListItem("Recorded Shows", iconImage = "DefaultFolder.png") ok = xbmcplugin.addDirectoryItem( handle=self._handle, url="%s?PS" % (self._path), listitem=listitem, isFolder=True) except: print sys.exc_info()[ 1 ] ok = False return ok def get_channel ( self, group ): try: channels = self._conn.getChannels(group) icon = "DefaultFolder.png" for channel in channels: channelStr = channel[1] if channel[2] != "": channelStr += " - " + channel[2] if channel[3] != "": channelStr += " [" + channel[3] + "]" listitem = xbmcgui.ListItem(channelStr, iconImage = icon) url = '%s?C?%s' % (self._path, channel[0]) #print channel[1] + " " + url ok = xbmcplugin.addDirectoryItem( handle=self._handle, url=url, listitem=listitem, isFolder=False, totalItems=len(channels) ) if ( not ok ): raise except: print "[tvserver]" + sys.exc_info()[ 1 ] ok = False return ok def choose_channel ( self, chanId ): # we start the time shift, and mplayer it? ok = True print "[tvserver] choose_channel: " + chanId + " before try" try: xbmc.Player().stop() print "[tvserver] xbmc.Player().stop() succesful" #if self._conn.isTimeshifting()[0] == "True": # self_.conn.stopTimeshift() print "[tvserver] Timeshifting channel : " + chanId result = self._conn.timeshiftChannel(chanId) print "[tvserver] self._conn.startTimeshift returned: " + result # results is rtsp://MACHINE/stream, we want to replace machine with IP #result = re.sub("rtsp://([^\/]+)/", "rtsp://" + SERVER_HOST + "/", result) # disabled - server now resolves for us. #print "TVServer after replace: " + result if result.startswith("[ERROR]"): # handle the error xbmcgui.Dialog().ok("Error", "Error timeshifting channel\n" + result) else: print "[tvserver] just before play: " + result xbmc.Player().play(result) print "[tvserver] after play: " + result except: print "[tvserver] choose_channel: " + chanId + " failed" ok = False self._is_playing = ok return ok def stop_timeshift (self ): try: result = self._conn.stopTimeshift() xbmc.executebuiltin("Container.Refresh") except: return False return False def get_shows ( self ): extended_sort = False ok = True try: shows = self._conn.getShows() icon = "DefaultFolder.png" server_host = str(self.settings["mptvserver"]) sharepath = str(self.settings["mpsharename"]) hostIp = str(server_host) extended_sort = self.settings["extsort"] recording_playback = int(self.settings["mprecplayback"]) baseurl = xbmc.translatePath("smb://" + hostIp + "/" + sharepath + "/") # check for show list where the only entry is blank # and if so, empty the list if len(shows) == 1: if len(shows[0][0]) == 0: shows=() for show in shows: recID = show[0] title = show[1] # limit the length of descr as it's used in the URL descr = show[2]#[0:1023] genre = show[3] seen = show[4] start = show[5] end = show[6] fname = show[7] chan = show[8] # later versions provide more info if len(show)>=10: runtime = str(int(show[9]) / 60) streamURL = show[10] else: runtime = "" streamURL = "" xbmc.output("[tvserver] Show: " + recID + "|" + title + "|" + descr + "|" + fname + "|" + streamURL + "|" + chan) # clean up descr for adding to title, as it may have embedded newlines descrShort=descr.replace('\n',' ') if len(descrShort)>128: descrShort=descrShort[0:128] if recording_playback==0: # smb share playback # construct the smb:// URL from the # original filename and the configured # sharename # TODO: make this a configurable format # like the XBMCMythTV scripts do try: basename = str(fname).rsplit('\\',1)[1] except: basename = "" smbName = baseurl + basename try: size = os.path.getsize(smbName) except: size = 0 elif recording_playback==1: try: size = os.path.getsize(fname) except: size = 0 smbName = fname elif recording_playback==2: # use the RTSP URL if streamURL != "": smbName=streamURL size = 0 # MP doesn't give us a channel name, # so we fudge it from the filename try: chan=basename.split(' - ',3)[1] except: chan="" studio = chan # we use the filename (less the extension) as the title if len(chan)>0: showStr = chan + " - " + title + " [" + start.split(" ")[0] +"] "#basename.rsplit('.',1)[0] + ' - ' + descrShort else: showStr = title + " [" + start.split(" ")[0] +"] "#basename.rsplit('.',1)[0] + ' - ' + descrShort listitem = xbmcgui.ListItem(showStr, iconImage = icon) # get date "31:01:2008" from start "1/31/2008 3:25:01 PM" try: startdate=start.split(" ")[0].split("/") if len(startdate[0]) == 1: startdate[0] = "0" + startdate[0] date = startdate[1]+":"+startdate[0]+":"+startdate[2] except: try: startdate=start.split(" ")[0].split("-") if len(startdate[1]) == 1: startdate[1] = "0" + startdate[1] date = startdate[0]+":"+startdate[1]+":"+startdate[2] except: date = "" # add "Delete <name of show>" to context menu # get "Delete" string from locale index 117 if len(title) > 24: deleteLabel = xbmc.getLocalizedString(117) + " " + title[0:23] + "..." else: deleteLabel = xbmc.getLocalizedString(117) + " " + title listitem.addContextMenuItems([ (deleteLabel, "XBMC.RunPlugin(%s?D&%s&%s)"%(sys.argv[0],recID,title)) ]) # we'll need "url" this when we start calling choose_show() # but for now we go straight to the player by using the smb name # TODO: encode only the recID, and have choose_show() get the info itself #url = '%s?S?%s&%s&%s&%s' % (self._path, urllib.quote(smbName),urllib.quote(title),urllib.quote(genre),urllib.quote(descr)) #ok = xbmcplugin.addDirectoryItem( handle=int( self._handle ), url=url, listitem=listitem, isFolder=False, totalItems=len(shows) ) listitem.setInfo( type="Video", infoLabels={ "Title": showStr, #title, "Tvshowtitle": title, "Genre": genre, "Plot": descr, #"Plotoutline": descr, "Size": size, "Studio": studio, "Date": date, "Year": int(startdate[2]), "Playcount": int(seen), "Count": 1, } ) if runtime != "": listitem.setInfo( type="Video", infoLabels={ "Duration": runtime } ) ok = xbmcplugin.addDirectoryItem( handle=self._handle, url=smbName, listitem=listitem, isFolder=False, totalItems=len(shows) ) if ( not ok ): raise except: print sys.exc_info()[ 1 ] ok = False if ( ok and extended_sort ): xbmcplugin.addSortMethod( handle=int( sys.argv[ 1 ] ), sortMethod=xbmcplugin.SORT_METHOD_DATE ) xbmcplugin.addSortMethod( handle=int( sys.argv[ 1 ] ), sortMethod=xbmcplugin.SORT_METHOD_LABEL ) xbmcplugin.addSortMethod( handle=int( sys.argv[ 1 ] ), sortMethod=xbmcplugin.SORT_METHOD_VIDEO_TITLE ) xbmcplugin.addSortMethod( handle=int( sys.argv[ 1 ] ), sortMethod=xbmcplugin.SORT_METHOD_SIZE ) xbmcplugin.addSortMethod( handle=int( sys.argv[ 1 ] ), sortMethod=xbmcplugin.SORT_METHOD_STUDIO ) xbmcplugin.addSortMethod( handle=int( sys.argv[ 1 ] ), sortMethod=xbmcplugin.SORT_METHOD_GENRE ) xbmcplugin.addSortMethod( handle=int( sys.argv[ 1 ] ), sortMethod=xbmcplugin.SORT_METHOD_PROGRAM_COUNT ) xbmcplugin.addSortMethod( handle=int( sys.argv[ 1 ] ), sortMethod=xbmcplugin.SORT_METHOD_EPISODE ) xbmcplugin.addSortMethod( handle=int( sys.argv[ 1 ] ), sortMethod=xbmcplugin.SORT_METHOD_FILE ) return ok def delete_show ( self, args ): # we get the file ID and title and request its deletion # Note: still in beta ok = True try: args=args.split("&",2) recID=urllib.unquote(args[0]) title=urllib.unquote(args[1]) print "[tvserver] delete_show: " + title + " (" + recID + ")" if xbmcgui.Dialog().yesno("Delete", "Delete "+title+"?"): result = self._conn.deleteShow(recID) if result.startswith("[ERROR]"): # handle the error, or maybe we can just "raise" xbmcgui.Dialog().ok("Error", "Error deleting " + title + "\n" + result) ok = False else: # we probably need to refresh the list, somehow # or remove the listitem, or navigate back xbmc.executebuiltin("Container.Refresh") ok = True except: print "[tvserver] delete failed" xbmcgui.Dialog().ok("Error", "An error ocurred deleting the selected show") ok = False raise return ok def choose_show ( self, args ): # NOTE: ***** not used yet ***** # we get the filename and add to the playlist ok = True try: args=args.split("&",4) smbName=urllib.unquote(args[0]) print "[tvserver] choose_show: Playing show: " + smbName title=urllib.unquote(args[1]) genre=urllib.unquote(args[2]) descr=urllib.unquote(args[3]) print "[tvserver] playing " + smbName thumbnail = xbmc.getInfoImage( "ListItem.Thumb" ) filesize = os.path.getsize(smbName) playlist = xbmc.PlayList( xbmc.PLAYLIST_VIDEO ) # clear any possible entries playlist.clear() # set the default icon icon = "DefaultVideo.png" # only need to add label, icon and thumbnail, setInfo() and addSortMethod() takes care of label2 listitem = xbmcgui.ListItem( title, iconImage=icon, thumbnailImage=thumbnail ) # set the key information listitem.setInfo( "video", { "Title": title, "Tvshowtitle": title, "Genre": genre, "Plotoutline": descr, "Size": filesize, } ) # add item to our playlist playlist.add( smbName, listitem ) player = xbmc.Player() player.play( playlist ) except: print "[tvserver] playing failed" xbmcgui.Dialog().ok("Error", "An error ocurred playing the selected show") ok = False raise # set some sort methods if ( ok ): xbmcplugin.addSortMethod( handle=self._handle, sortMethod=xbmcplugin.SORT_METHOD_DATE ) xbmcplugin.addSortMethod( handle=self._handle, sortMethod=xbmcplugin.SORT_METHOD_LABEL ) xbmcplugin.addSortMethod( handle=self._handle, sortMethod=xbmcplugin.SORT_METHOD_VIDEO_TITLE ) xbmcplugin.addSortMethod( handle=self._handle, sortMethod=xbmcplugin.SORT_METHOD_SIZE ) xbmcplugin.addSortMethod( handle=self._handle, sortMethod=xbmcplugin.SORT_METHOD_STUDIO ) xbmcplugin.addSortMethod( handle=self._handle, sortMethod=xbmcplugin.SORT_METHOD_PROGRAM_COUNT ) xbmcplugin.addSortMethod( handle=self._handle, sortMethod=xbmcplugin.SORT_METHOD_EPISODE ) xbmcplugin.addSortMethod( handle=self._handle, sortMethod=xbmcplugin.SORT_METHOD_FILE ) # saw this in the MythTV plug-in xbmcplugin.endOfDirectory( handle=self._handle, succeeded=ok ) return ok def stop_playing (self ): # not used yet try: result = self._conn.stopPlaying() except: return False return False
21,732
24afc1718036392002dc0851372105f65045656a
# -*- encoding:utf-8 -*- class AdminException(Exception): pass
21,733
210a384c84113169509d183ecbdcecba36beb517
#import RPi.GPIO as GPIO import time from threading import Timer class Unlock: def __init__(self): self.relay = 3 #pin GPIO self.isLocked = True # GPIO.setmode(GPIO.BOARD) # GPIO.setwarnings(False) # GPIO.setup(self.relay, GPIO.OUT) def unlock(self): print("[INFO] unlock") if(self.isLocked): #GPIO.output(self.relay, GPIO.LOW) self.isLocked = False def lock(self): print("[INFO] lock") if(self.isLocked == False): #GPIO.output(self.relay, GPIO.HIGH) self.isLocked = True
21,734
02f43ad8d89e80e54f5deb398a705f017868ce2f
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. # import os import time import argparse import logging import math import random import numpy as np import mxnet as mx from core.model import get_model from core.dataset import NCFTrainData logging.basicConfig(level=logging.DEBUG) parser = argparse.ArgumentParser(description="Run model optimizer.", formatter_class=argparse.ArgumentDefaultsHelpFormatter) parser.add_argument('--path', nargs='?', default='./data/', help='Input data path.') parser.add_argument('--dataset', nargs='?', default='ml-20m', help='The dataset name.') parser.add_argument('--model-prefix', type=str, default='./model/ml-20m/neumf') parser.add_argument('--epoch', type=int, default=7, help='parameters epoch') parser.add_argument('--model-type', type=str, default='neumf', choices=['neumf', 'gmf', 'mlp'], help="mdoel type") parser.add_argument('--layers', default='[256, 256, 128, 64]', help="list of number hiddens of fc layers in mlp model.") parser.add_argument('--factor-size-gmf', type=int, default=64, help="outdim of gmf embedding layers.") parser.add_argument('--num-hidden', type=int, default=1, help="num-hidden of neumf fc layer") head = '%(asctime)-15s %(message)s' logging.basicConfig(level=logging.INFO, format=head) # arg parser args = parser.parse_args() logging.info(args) model_prefix = args.model_prefix model_type = args.model_type model_layers = eval(args.layers) factor_size_gmf = args.factor_size_gmf factor_size_mlp = int(model_layers[0]/2) num_hidden = args.num_hidden train_dataset = NCFTrainData((args.path + args.dataset + '/train-ratings.csv'), nb_neg=4) net = get_model(model_type, factor_size_mlp, factor_size_gmf, model_layers, num_hidden, train_dataset.nb_users, train_dataset.nb_items, opt=True) raw_params, _ = mx.model.load_params(model_prefix, args.epoch) fc_0_weight_split = mx.nd.split(raw_params['fc_0_weight'], axis=1, num_outputs=2) fc_0_left = fc_0_weight_split[0] fc_0_right = fc_0_weight_split[1] user_weight_fusion = mx.nd.FullyConnected(data = raw_params['mlp_user_weight'], weight=fc_0_left, bias=raw_params['fc_0_bias'], no_bias=False, num_hidden=model_layers[0]) item_weight_fusion = mx.nd.FullyConnected(data = raw_params['mlp_item_weight'], weight=fc_0_right, no_bias=True, num_hidden=model_layers[0]) opt_params = raw_params del opt_params['mlp_user_weight'] del opt_params['mlp_item_weight'] del opt_params['fc_0_bias'] opt_params['fused_mlp_user_weight'] = user_weight_fusion opt_params['fused_mlp_item_weight'] = item_weight_fusion mx.model.save_checkpoint(model_prefix + '-opt', args.epoch, net, opt_params, {})
21,735
79fd4a51bec57eb8e039ce95de0dfd5bf1121b42
######################## Base imports ################################# from dataiku.code_env_resources import clear_all_env_vars from dataiku.code_env_resources import set_env_path ######################## Download FLAIR Models ########################### # Clear all environment variables defined by a previously run script clear_all_env_vars() # Set Flair cache directory set_env_path("FLAIR_CACHE_ROOT", "flair") from flair.models import SequenceTagger # Download pretrained model: automatically managed by Flair, # does not download anything if model is already in FLAIR_CACHE_ROOT SequenceTagger.load('flair/ner-english-fast@3d3d35790f78a00ef319939b9004209d1d05f788') # Add any other models you want to download, check https://huggingface.co/flair for examples # E.g. SequenceTagger.load('flair/ner-french') # Make sure to modify the model used in recipe.py if you want to use a different model
21,736
e77560311753d623e6b4545ad9c06fe89ec4d50c
""" Exercício 19 Nome: Praticando: Listas/For (Loop) Objetivo: Praticar a criação e a leitura básica de listas com números e textos. Dificuldade: Intermediário 1 - Crie uma lista com alguns números inseridos manualmente (não há necessidade do usuário inserí-los). 2 - Crie um for que varra cada elemento da lista e exiba-o no console. 3 - Declare um novo for que exiba apenas os números maiores que 3. 4 - Declare um outro for que exiba apenas os números pares. 5 - Exiba na tela a soma de todos os elementos da lista sem a utilização de funções extras. 6 - Exiba a soma de todos os elementos utilizando a função sum(). 7 - Crie uma nova lista a partir de números digitados pelo usuário, faça com que o usuário insira 10 números, porém, utilize o 'for' para isso, em vez de declarar 10 vezes o input de entrada de informação, declare apenas UMA vez e faça com que ele seja executado 10 vezes. A cada atualização da lista, exiba a quantidade de elementos que ela possui. 8 - Exiba apenas os três primeiros elementos da lista no console. 9 - Exiba apenas os três últimos elementos da lista no console. 10 - Declare uma nova lista vazia chamada 'nomes' e armazene 3 nomes digitados pelo usuário, ordene esses nomes por ordem alfabética e exiba-os na tela, um de cada vez. """ # Item 1 print("\n1 - Crie uma lista.") lista = [1, 5, 2, 7, 9, 3, 58] print(lista) a = 0 lista2 = [] # Item 2 print("\n2 - Crie um for que varra cada elemento da lista e exiba-o no console.") for i in range(len(lista)): print(f"lista[{i}] = {lista[i]}") print("\n") # Item 3 print("3 - Declare um novo for que exiba apenas os números maiores que 3.") for i in range(len(lista)): if lista[i] > 3: print(f"lista[{i}] = {lista[i]}") print("\n") # Item 4 print("4 - Declare um outro for que exiba apenas os números pares.") for i in range(len(lista)): if lista[i] % 2 == 0: print(f"lista[{i}] = {lista[i]}") print("\n") # Item 5 print("5 - Exiba na tela a soma de todos os elementos da lista sem a utilização de funções extras.") for i in range(len(lista)): a += lista[i] print(f"\n{a}") # Item 6 print("\n6 - Exiba a soma de todos os elementos utilizando a função sum().\n") for i in range(len(lista)): print(sum(lista)) break # Item 7 print("\nDigite 10 números e a cada número novo na lista, exiba a quantidade de elementos que ela possui.") def usuario(msg): num = int(input(msg)) return num for i in range (10): ent = usuario("Digite um número: ") lista2.append(ent) print(lista2) b = [] # Item 8 print("\n8 - Exiba apenas os três primeiros elementos da lista no console.") print(f"\nOs três primeiros valores da lista são: {lista2[0:3]}") # Item 9 print("\n9 - Exiba apenas os três últimos elementos da lista no console.") print(f"\nOs três últimos valores da lista são: {lista2[7:10]}") # Item 10 print("\n10 - Digite 3 nomes , ordene esses nomes por ordem alfabética e exiba-os na tela, um de cada vez.") e = [] def nome(msg): nomes = input(msg) return nomes for i in range(3): en = nome(f"Digite o {i+1}° nome: ").title() e.append(en) e.sort() print("\n") print(*e, sep='\n')
21,737
fc93070a29b8573bb4a16ce0ff8ecabc7802d907
from script import Screen class gender_struct: def __init__(self, gender): is_female = gender == "female" self.he_she = 'she' if is_female else 'he' self.him_her = 'her' if is_female else 'him' self.his_her = 'her' if is_female else 'his' # This is where the intro story will be told def intro_story(player): pronouns = gender_struct(player.gender) intro = f"\tThere was smoke coming from over the hill...... That was strange to {player.name} because it wasn't time " \ f"for dinner and it was too hot to just have a fire going. {player.name}'s mind started to race thinking maybe the " \ f"Bandits have come back? No, no {pronouns.he_she} gave them a good beating last time. It was too far for {pronouns.him_her} " \ f"to run due to the large deer on {pronouns.his_her} back. {pronouns.he_she.capitalize()} reassured {pronouns.him_her}self that other " \ f"people in the village would keep {pronouns.his_her} village safe. But when {player.name} finally made it over the " \ f"hill {pronouns.he_she} didn't believe {pronouns.his_her} eyes........." Screen.display(intro)
21,738
e00222a21aa969616e1d01cbed1d72526268e4be
from textblob import TextBlob from vaderSentiment.vaderSentiment import SentimentIntensityAnalyzer import flask from flask import request, jsonify import mysql.connector import time from flask_cors import CORS try: conexion_db = mysql.connector.connect( host="localhost", user="alex", passwd="Hola1234.", database="ia2proyectos") print("--- Conexión a DB exitosa ---") except: print("Error en la Conexión a la DB") listaObras = {"asphalted": "asfaltado", "asphalt": "asfaltado", "lighting": "alumbrado", "paved": "empedrado", "hospital": "hospital", "post": "posta", "potholes": "baches", "bridge": "puente", "school": "colegio", "Park": "parque", "sewerage": "alcantarillado", "Water": "agua", "distributor": "distribuidor", "traffic light": "semaforo", "court": "cancha", "soccer": "futbol", "highway": "carretera", "avenue": "avenida", "terminal": "terminal", "train": "tren", "irrigation": "riego" } def analizador(texto): analisisDeTexto = TextBlob(texto) traduccionDeTexto = analisisDeTexto.translate(to='en') analizadorDeSentimientos = SentimentIntensityAnalyzer() resultadosDeSentimientos = analizadorDeSentimientos.polarity_scores( traduccionDeTexto) return resultadosDeSentimientos def insertar_calificacion(comentario, proyectoid): consulta = "INSERT INTO estado (positivo, neutral, negativo, fecha, proyectos_id) VALUES (%s, %s, %s, %s, %s)" cursor = conexion_db.cursor(buffered=True) positivo = neutral = negativo = 0 fecha = time.strftime('%Y-%m-%d %H:%M:%S') resultados = analizador(comentario) positivo = resultados['pos'] negativo = resultados['neg'] neutral = resultados['neu'] datos = (positivo, neutral, negativo, fecha, proyectoid) cursor.execute(consulta, datos) conexion_db.commit() cursor.close() return resultados def obtener_resumenCalif(proyectoid): consulta = "SELECT positivo, negativo, neutral, fecha FROM estado WHERE proyectos_id="+str(proyectoid) # + \ print(consulta) cursor = conexion_db.cursor(buffered=True) cursor.execute(consulta) resultados = cursor.fetchall() print(resultados) consultaNombre = "SELECT nombre FROM proyectos WHERE proyectos_id={}".format( proyectoid) cursor.execute(consultaNombre) nombre = cursor.fetchone()[0] jsonificado = {"proyectoid": proyectoid, "proyectonombre": nombre, "datos": []} for dato in resultados: jsonificado['datos'].append({"fecha": dato[3].strftime( '%Y-%m-%d %H:%M:%S'), "calificaciones": {"pos": dato[0], "neg": dato[1], "neu": dato[2]}}) cursor.close() return jsonificado def clasificarPedido(pedido, localidad): pedidoBlob = TextBlob(pedido) pedidoTraducido = pedidoBlob.translate(to='en') print(pedidoTraducido) clasificacionNouns = (sustantivo for sustantivo, tag in pedidoTraducido.tags if tag == 'NN') listaNouns = [] for item in clasificacionNouns: listaNouns.append(item) for item in listaNouns: if(listaObras.get(item) != None): anadirPedido(item, localidad) def anadirPedido(pedido, localidad): consulta = "INSERT INTO pedidos (pedido, localidad, fecha) VALUES (%s, %s, %s)" cursor = conexion_db.cursor(buffered=True) pedido = listaObras.get(pedido) fecha = time.strftime('%Y-%m-%d %H:%M:%S') datos = (pedido, localidad, fecha) cursor.execute(consulta, datos) conexion_db.commit() cursor.close() def getPedido(): cursor = conexion_db.cursor(buffered=True) consultaPedidos = "SELECT pedido,localidad,fecha, COUNT(pedido) AS total FROM pedidos GROUP BY Month(fecha), pedido" cursor.execute(consultaPedidos) resultados = cursor.fetchall() respuesta = {"pedidos": []} for dato in resultados: respuesta['pedidos'].append({"pedido": dato[0], "localidad": dato[1], "mes": int( dato[2].strftime('%m')), "total": dato[3]}) return respuesta app = flask.Flask(__name__) cors = CORS(app, resources=r'/api/*') app.config["DEBUG"] = True @ app.route('/api/calificacion', methods=['POST']) def api_calificacion(): textoRecibido = request.get_json()['comentario'] proyectoid = request.get_json()['proyectoid'] if ('comentario' in request.get_json()) & ('proyectoid' in request.get_json()): textoAnalizado = insertar_calificacion(textoRecibido, proyectoid) else: return "Error: parámetro 'comentario' o 'proyectoid' no provisto. Por favor especificalos." return jsonify(textoAnalizado) @ app.route('/api/calificacion/resumen', methods=['POST']) def api_calResumen(): proyectoid = request.get_json()['proyectoid'] if 'proyectoid' in request.get_json(): resultados = obtener_resumenCalif(proyectoid) else: return "Error: parámetro 'proyectoid' no provisto. Por favor especifica un id de proyecto." return jsonify(resultados) @ app.route('/api/pedidos', methods=['POST']) def api_pedidos(): if 'pedido' in request.get_json(): pedido = request.get_json()['pedido'] localidad = request.get_json()['localidad'] clasificarPedido(pedido, localidad) else: return "Error: parámetro 'pedido' no provisto. Por favor especifica un pedido de obra." return jsonify('Realizado Exitosamente') @ app.route('/api/pedidos/resumen', methods=['GET']) def api_getPedidos(): respuesta = getPedido() return jsonify(respuesta) app.run()
21,739
5336f56ecf64c48d762cbdb164b22847759ff99f
import os.path import pandas as pd from .config.cache import CACHE_FILE from .exceptions import DataNotScrappedError class Singleton(type): _instances = {} def __call__(cls, *args, **kwargs): if cls not in cls._instances: cls._instances[cls] = super(Singleton, cls).__call__( *args, **kwargs) return cls._instances[cls] class Cacher(metaclass=Singleton): def ___cache_data(self, games): df = pd.DataFrame(games, columns=['category', 'name']) df.to_csv(CACHE_FILE) async def save(self, res: dict): """Save data with games to file :param res: :return: """ self.___cache_data(res['games']) def __get_data(self, filters): """Get data from cached file and filter it :param filter: :return: """ if not os.path.exists(CACHE_FILE): raise DataNotScrappedError() df = pd.read_csv(CACHE_FILE) if not filters: return list(df.T.to_dict().values()) filtered_df = df[df['name'] == filters][['category', 'name']] return list(filtered_df.T.to_dict().values()) async def get(self, filters: dict = None): """Get data from cached file""" res = self.__get_data(filters) return res
21,740
d9de1ea582e065026daf8a812bcf9054ced24d96
class Solution(object): def largestPerimeter(self, A): A.sort() ans = 0 for i in xrange(len(A) - 2): if A[i] + A[i+1] > A[i+2]: ans = A[i] + A[i+1] + A[i+2] return ans
21,741
759720d9525f4e8f4709726dd254434271809007
from datetime import timedelta from airflow import DAG from airflow.operators.dummy_operator import DummyOperator from airflow.contrib.operators.kubernetes_pod_operator import KubernetesPodOperator from airflow.utils.dates import days_ago default_args = { 'owner': 'orix.auyeung', 'depends_on_past': False, 'email': ['orix.auyeung@hkmci.com'], 'email_on_failure': False, 'email_on_retry': False, 'retries': 20, 'retry_delay': timedelta(minutes=3), 'concurrency': 100, # 'queue': 'bash_queue', # 'pool': 'backfill', # 'priority_weight': 10, # 'end_date': datetime(2016, 1, 1), # 'wait_for_downstream': False, # 'dag': dag, # 'sla': timedelta(hours=2), # 'execution_timeout': timedelta(seconds=300), # 'on_failure_callback': some_function, # 'on_success_callback': some_other_function, # 'on_retry_callback': another_function, # 'sla_miss_callback': yet_another_function, # 'trigger_rule': 'all_success' } common_pod_args = { "is_delete_operator_pod": True, "image_pull_policy": "Always", "get_logs": False, } crawler_pod_args = { "affinity": { 'nodeAffinity': { 'requiredDuringSchedulingIgnoredDuringExecution': { 'nodeSelectorTerms': [{ 'matchExpressions': [{ 'key': 'cloud.google.com/gke-nodepool', 'operator': 'In', 'values': ['crawler-pool'] }] }] } }, 'podAntiAffinity': { 'requiredDuringSchedulingIgnoredDuringExecution': [{ 'labelSelector': { 'matchExpressions': [{ 'key': 'pod-type', 'operator': 'In', 'values': ['crawler-pod'] }] }, 'topologyKey': 'kubernetes.io/hostname' }] } }, "labels": { 'pod-type': 'crawler-pod', 'redis-client': 'true' }, } dag = DAG( 'domain_upload_pipeline', default_args=default_args, description='Minio-triggered domain analytics pipeline', schedule_interval=None, start_date=days_ago(2), tags=['analytics', 'external trigger'], ) domain_queuer = KubernetesPodOperator( namespace='airflow', image="gcr.io/smartone-gcp-1/domain-queuer:latest", env_vars={ "RUN_ID": "{{ dag_run.conf['runId'] }}", "FILENAME": "{{ dag_run.conf['minioObject'] }}" }, labels={"redis-client": "true"}, name="domain-queuer", task_id="domain-queuer", dag=dag, **common_pod_args, ) # def landingpage_worker(worker_id): # return KubernetesPodOperator(namespace='airflow', # image="gcr.io/smartone-gcp-1/domain-landingpage-parser:latest", # name="domain-landingpage-worker-{}".format(worker_id), # task_id="domain-landingpage-worker-{}".format(worker_id), # dag=dag, # resources={ # "request_memory": "512Mi", # "request_cpu": "100m", # }, # **common_pod_args, # **crawler_pod_args,) # # # def webshrinker_worker(worker_id): # return KubernetesPodOperator(namespace='airflow', # image="gcr.io/smartone-gcp-1/domain-webshrinker-worker:latest", # name="domain-webshrinker-worker-{}".format(worker_id), # task_id="domain-webshrinker-worker-{}".format(worker_id), # dag=dag, # resources={ # "request_memory": "512Mi", # "request_cpu": "100m", # }, # **common_pod_args, # **crawler_pod_args,) def googlesearch_worker(worker_id): return KubernetesPodOperator(namespace='airflow', image="gcr.io/smartone-gcp-1/domain-googlesearch-parser:latest", name="domain-googlesearch-worker-{}".format(worker_id), task_id="domain-googlesearch-worker-{}".format(worker_id), dag=dag, resources={ "request_memory": "512Mi", "request_cpu": "100m", }, **common_pod_args, **crawler_pod_args,) dag.doc_md = __doc__ domain_queuer.doc_md = """\ #### Task Documentation You can document your task using the attributes `doc_md` (markdown), `doc` (plain text), `doc_rst`, `doc_json`, `doc_yaml` which gets rendered in the UI's Task Instance Details page. ![img](http://montcs.bloomu.edu/~bobmon/Semesters/2012-01/491/import%20soul.png) """ start = DummyOperator(task_id="start", dag=dag) end = DummyOperator(task_id="end", dag=dag) domain_googlesearch = DummyOperator(task_id="domain-googlesearch", dag=dag) # domain_landingpage = DummyOperator(task_id="domain-landingpage", dag=dag) # domain_webshrinker = DummyOperator(task_id="domain-webshrinker", dag=dag) domain_googlesearch_workers = [googlesearch_worker(x) for x in range(40)] # domain_landingpage_workers = [landingpage_worker(x) for x in range(3)] # domain_webshrinker_workers = [webshrinker_worker(x) for x in range(3)] domain_googlesearch_reporter = KubernetesPodOperator(namespace='airflow', image="gcr.io/smartone-gcp-1/reporter:latest", labels={"redis-client": "true"}, name="domain-googlesearch-reporter", task_id="domain-googlesearch-reporter", dag=dag, env_vars={ "RUN_ID": "{{ dag_run.conf['runId'] }}", "RUN_FLOW": "googlesearch", "OUTPUT_VOLUME_PATH": ".", }, resources={ "request_memory": "1024Mi", "request_cpu": "1000m", "request_ephemeral_storage": "20Gi", }, **common_pod_args,) # domain_landingpage_reporter = KubernetesPodOperator(namespace='airflow', # image="gcr.io/smartone-gcp-1/reporter:latest", # labels={"redis-client": "true"}, # name="domain-landingpage-reporter", # task_id="domain-landingpage-reporter", # dag=dag, # env_vars={ # "RUN_ID": "{{ dag_run.conf['runId'] }}", # "RUN_FLOW": "landingpage", # "OUTPUT_VOLUME_PATH": ".", # }, # resources={ # "request_memory": "1024Mi", # "request_cpu": "1000m", # "request_ephemeral_storage": "20Gi", # }, # **common_pod_args,) # domain_webshrinker_reporter = KubernetesPodOperator(namespace='airflow', # image="gcr.io/smartone-gcp-1/reporter:latest", # labels={"redis-client": "true"}, # name="domain-webshrinker-reporter", # task_id="domain-webshrinker-reporter", # dag=dag, # env_vars={ # "RUN_ID": "{{ dag_run.conf['runId'] }}", # "RUN_FLOW": "webshrinker", # "OUTPUT_VOLUME_PATH": ".", # }, # resources={ # "request_memory": "1024Mi", # "request_cpu": "1000m", # "request_ephemeral_storage": "20Gi", # }, # **common_pod_args,) start.set_downstream(domain_queuer) # domain_queuer.set_downstream([domain_googlesearch, domain_landingpage, domain_webshrinker]) domain_queuer.set_downstream([domain_googlesearch]) domain_googlesearch.set_downstream(domain_googlesearch_workers) # domain_landingpage.set_downstream(domain_landingpage_workers) # domain_webshrinker.set_downstream(domain_webshrinker_workers) domain_googlesearch_reporter.set_upstream(domain_googlesearch_workers) # domain_landingpage_reporter.set_upstream(domain_landingpage_workers) # domain_webshrinker_reporter.set_upstream(domain_webshrinker_workers) # end.set_upstream([domain_googlesearch_reporter, domain_landingpage_reporter, domain_webshrinker_reporter]) end.set_upstream([domain_googlesearch_reporter])
21,742
f2271c5e4b2d44ae333a175ab56efc85b5b23847
#!/usr/bin/env python # coding: utf-8 # In[ ]: import matplotlib # Force matplotlib to not use any Xwindows backend. matplotlib.use('Agg') import matplotlib.pyplot as plt from keras.models import Sequential, model_from_json, load_model from keras.layers.core import Dense, Dropout, Flatten, Activation, SpatialDropout2D, Reshape, Lambda from keras.layers.normalization import BatchNormalization from keras.layers.advanced_activations import ELU, PReLU, LeakyReLU from keras.layers.convolutional import Conv1D from keras.layers.convolutional import Convolution1D from keras import layers from keras.layers import LSTM ,Embedding ,SimpleRNN,CuDNNLSTM from keras.optimizers import SGD from keras.callbacks import ModelCheckpoint from scipy.io import wavfile import pdb import scipy.io # import librosa import os from os.path import join as ojoin # os.environ["CUDA_VISIBLE_DEVICES"]="1" import time import numpy as np import numpy.matlib import argparse import random # import theano # import theano.tensor as T import tensorflow as tf from keras.callbacks import TensorBoard import keras.backend.tensorflow_backend as KTF from keras.backend.tensorflow_backend import set_session #設定使用GPU 檢查是否有抓到 config = tf.ConfigProto() config.gpu_options.per_process_gpu_memory_fraction = 0.99 #使用45%記憶體 set_session(tf.Session(config=config)) if tf.test.gpu_device_name(): print('GPU found') else: print("No GPU found") ##定義讀檔路徑function def get_filepaths(directory): """ This function will generate the file names in a directory tree by walking the tree either top-down or bottom-up. For each directory in the tree rooted at directory top (including top itself), it yields a 3-tuple (dirpath, dirnames, filenames). """ file_paths = [] # List which will store all of the full filepaths. # Walk the tree. for root, directories, files in os.walk(directory): for filename in files: if filename.endswith('.wav'): # Join the two strings in order to form the full filepath. filepath = os.path.join(root, filename) file_paths.append(filepath) # Add it to the list. # pdb.set_trace() file_paths.sort() return file_paths mixed_file=get_filepaths('mixed_all_snr/') cleaned_file=get_filepaths('clean') ##切割data and test from sklearn.model_selection import train_test_split X_train, X_test, y_train, y_test = train_test_split(mixed_file, cleaned_file, test_size=0.33, random_state=42) Train_Noisy_lists=X_train Train_Clean_paths= y_train Test_Noisy_lists = X_test Test_Clean_paths = y_test Num_testdata=len(Test_Noisy_lists) Num_traindata=len(Train_Noisy_lists) def train_data_generator(noisy_list, clean_path): index=0 while True: rate, noisy = wavfile.read(noisy_list[index]) noisy=noisy.astype('float32') if len(noisy.shape)==2: noisy=(noisy[:,0]+noisy[:,1])/2 noisy=np.reshape(noisy,(1,np.shape(noisy)[0],1)) rate, clean = wavfile.read(clean_path[index]) clean=clean.astype('float32') clean=clean/2**15 clean=np.reshape(clean,(1,np.shape(clean)[0],1)) index += 1 if index == len(noisy_list): index = 0 yield noisy, clean def val_data_generator(noisy_list, clean_path): index=0 while True: rate, noisy = wavfile.read(noisy_list[index]) noisy=noisy.astype('float32') if len(noisy.shape)==2: noisy=(noisy[:,0]+noisy[:,1])/2 noisy=np.reshape(noisy,(1,np.shape(noisy)[0],1)) rate, clean = wavfile.read(clean_path[index]) clean=clean.astype('float32') if len(clean.shape)==2: clean=(clean[:,0]+clean[:,1])/2 clean=clean/2**15 clean=np.reshape(clean,(1,np.shape(clean)[0],1)) index += 1 if index == len(noisy_list): index = 0 yield noisy, clean ##建立模型 start_time = time.time() model = Sequential() model.add(CuDNNLSTM(32,return_sequences=True,input_shape=(None,1))) model.add(CuDNNLSTM(32,return_sequences=True)) # 返回维度为 32 的向量序列 model.add(Dense(1,activation='tanh')) model.summary() ##訓練開始 epoch=5 batch_size=1 model.compile(loss='mse', optimizer='adam') with open('{}.json'.format('firsttry'),'w') as f: # save the model f.write(model.to_json()) checkpointer = ModelCheckpoint(filepath='{}.hdf5'.format('firsttry'), verbose=1, save_best_only=True, mode='min') print ('training...') g1 = train_data_generator(Train_Noisy_lists, Train_Clean_paths) print() g2 = val_data_generator(Test_Noisy_lists, Test_Clean_paths) tbCallBack = TensorBoard(log_dir='./logs', # log 目录 histogram_freq=0, # 按照何等频率(epoch)来计算直方图,0为不计算 # batch_size=32, # 用多大量的数据计算直方图 write_graph=True, # 是否存储网络结构图 write_grads=True, # 是否可视化梯度直方图 write_images=True,# 是否可视化参数 embeddings_freq=0, embeddings_layer_names=None, embeddings_metadata=None) hist=model.fit_generator(g1, samples_per_epoch=Num_traindata, epochs=epoch, verbose=1, validation_data=g2, nb_val_samples=Num_testdata, max_q_size=1, nb_worker=16, use_multiprocessing=True ) ##畫Loss圖 # # plotting the learning curve TrainERR=hist.history['loss'] ValidERR=hist.history['val_loss'] print ('@%f, Minimun error:%f, at iteration: %i' % (hist.history['val_loss'][epoch-1], np.min(np.asarray(ValidERR)),np.argmin(np.asarray(ValidERR))+1)) # print 'drawing the training process...' plt.figure(4) plt.plot(range(1,epoch+1),TrainERR,'b',label='TrainERR') plt.plot(range(1,epoch+1),ValidERR,'r',label='ValidERR') plt.xlim([1,epoch]) plt.legend() plt.xlabel('epoch') plt.ylabel('error') plt.grid(True) plt.show() plt.savefig('Learning_curve_{}.png'.format('FCN_firsttry'), dpi=150) end_time = time.time() print ('The code for this file ran for %.2fm' % ((end_time - start_time) / 60.))
21,743
dc794eb05e10d80c0da2da5c9852f2c749a1df72
import serial from time import sleep as wait from struct import pack, unpack from collections import namedtuple handshake = 0x77 end_flag = 0x33 drive_flag = 0x45 left_flag = 0x36 right_flag = 0x35 lights_flag = 0x30 ir_read_flag = 0x27 ir_pos_flag = 0x28 class Robot: def __init__(self, file, baud): self.location = file self.port = serial.Serial() self.port.baudrate = baud self.port.port = file self.port.timeout = 1 self.port.dtr = 0 self.port.open() wait(3) self.port.write(chr(handshake)) wait(1) while self.port.read() != chr(0x77): print("Waiting for handshake") def shutdown(self): self.halt() self.port.close() def map_short(self, num): #where num is a num 0 - 100 temp = (num * 32767)/100 if temp > 32767: return 32767 elif temp < -32767: return -32767 return int(temp) def pack_short(self,num): return pack("h", int(num)) def send_cmd(self,flag, data): self.port.write(chr(flag)) self.port.write(self.pack_short(self.map_short(data))) def lights_on(self): self.send_cmd(lights_flag, 0x01) def lights_off(self): self.send_cmd(lights_flag, 0x00) def halt(self): self.send_cmd(drive_flag, 0) def turn(self, speed, seconds=None): self.send_cmd(left_flag, -speed) self.send_cmd(right_flag, speed) if seconds != None: wait(seconds) self.halt() return def drive_forward(self, speed, adjust=None, seconds=None): if adjust == None: self.send_cmd(drive_flag, speed) else: self.send_cmd(left_flag, speed) adjusted = speed+adjust if adjusted > 100: self.send_cmd(right_flag, 100) elif adjusted < 0: self.send_cmd(right_flag, 0) else: self.send_cmd(right_flag, speed+adjust) if seconds == None: return wait(seconds) self.halt() def drive_backward(self, speed, adjust=None, seconds=None): if adjust == None: self.send_cmd(drive_flag, -speed) else: self.send_cmd(left_flag, -speed) adjusted = speed+adjust if adjusted > 100: self.send_cmd(right_flag, -100) elif adjusted < 0: self.send_cmd(right_flag, -0) else: self.send_cmd(right_flag, -speed+adjust) if seconds == None: return wait(seconds) self.halt() def drive_right_wheel(self, speed): self.send_cmd(right_flag, -speed) def drive_left_wheel(self, speed): self.send_cmd(left_flag, -speed) def get_ir_distance(self): self.send_cmd(ir_read_flag, 1) data = self.port.read(2) dist = unpack(">H", data) return dist[0] def set_ir_position(self, angle): self.send_cmd(ir_pos_flag, angle)
21,744
7146e9142997b062c52895c421d66c8b9b8294c9
import timeit as timer # Function argument decorator def wrapper(func, *args, **kwargs): def wrapped(): return func(*args, **kwargs) return wrapped # Measure the time of a func, then print it def timer_function(func_args, name="Current function", niter = 30): t = timer.timeit(func_args, number=niter) print(f"{t} seconds ({name} , n_iter = {niter})") def timer_wrap(func, args, niter): t = timer_function(wrapper(func, *args), name=func.__name__, niter=niter)
21,745
1b50d5fd3a58d09a16eb728cee6b4d9d305b69d0
import subprocess from getpass import getpass def run_ls(): command = "ls -la".split() cmd = subprocess.run( command, stdout=subprocess.PIPE ) output = cmd.stdout.decode() print(cmd.stdout) print(output) def run_ls_as_sudo(): #pwd = getpass("password: ") command = "sudo -S ls -la".split() cmd = subprocess.run( command, stdout=subprocess.PIPE, encoding="ascii" ) #output = cmd.stdout.decode() print(cmd.stdout) #print(output) if __name__ == '__main__': #run_ls() run_ls_as_sudo() #cmd = subprocess.run( # ls, stdout=subprocess.PIPE, input=getpass("password: "), encoding="ascii", #)
21,746
614c4157f947e294c7b1fd451b11517866aff7e8
""" Solution to Prime Factors task on Exercism https://exercism.org/tracks/python/exercises/prime-factors """ def is_prime(value: int) -> bool: """Check if value is prime""" if value == 1: return False if value <= 0: raise ValueError("Value must be greater than zero") for i in range(2, int(value**(1/2)) + 1): if value % i == 0: return False return True def factors(value: int) -> list: """Get all prime factors of the given value""" prime_factors: list = [] for i in range(2, value + 1): if i > 2 and i % 2 == 0 or not is_prime(i): continue while value % i == 0: value = int(value / i) prime_factors.append(i) if value == 1: break return prime_factors
21,747
57ef1d9a74ee0e0e8ae4a5057d4496970779b388
import numpy as np import pandas as pd import os from sklearn.model_selection import train_test_split from keras.utils import to_categorical DATA_PATH = "sentiment_analysis.xlsx" def read_file(DATA_PATH): ''' reads the file provided: DATA_PATH : The path of the file. Returns: y : The target vector of the dataset. bangla_text: The text of the comments. ''' df=pd.read_excel(DATA_PATH) feature_column_name=['text'] predicted_class_name=['score'] y=df[predicted_class_name].values bangla_text=df[feature_column_name].values return y, bangla_text def char_to_utf(bangla_text): ''' function: Converts bangla characters to it's corresponding utf numbers. bangla_text: Text of the comments; Returns: utf_all: Numpy array of the utf numbers. ''' utf_all=[] for text in bangla_text: for string in text: utf=[] for char in string: number=ord(char) utf.append(number) utf=np.asarray(utf) # if utf.shape[0]>100: utf=utf[:100] else: pad_width=100-utf.shape[0] utf=np.pad(utf,pad_width=(0,pad_width),mode='constant') # utf_all.append(utf) utf_all=np.asarray(utf_all) return utf_all def maximum_length(utf_all): ''' utf_all: The numpy array which holds the utf of all the characters. Returns: The maximum length of the comments in the dataset. ''' length=0 for utf in utf_all: shape= utf.shape[0] if length<shape: length=shape return length def padding(utf_all,max_len): ''' utf_all: The numpy array which holds the utf of all the characters. max_len: The maximum length we want to take from a sentence. Returns: The padded array of the sequence of utf numbers. ''' for utf in utf_all: if utf.shape[0]>max_len: utf=utf[:max_len] #print("Cut: ", utf) else: pad_width=max_len-utf.shape[0] utf=np.pad(utf,pad_width=(0,pad_width),mode='constant') #print("Padded: ", utf) np.save("utf_all.npy", utf_all) #print(utf_all) return utf_all def train_test_set(): ''' Return x_train, x_test, y_train, y_test ''' y, bangla_text=read_file(DATA_PATH) utf_all=char_to_utf(bangla_text) print(utf_all.shape) x= padding(utf_all,100) y=np.asarray(y) y=to_categorical(y) #print(y.shape) #print(x.shape) #print(x) x_train, x_test, y_train, y_test= train_test_split(x,y, test_size=0.2, random_state=42) return x_train, x_test, y_train, y_test if __name__ == '__main__': x_train, x_test, y_train, y_test=train_test_set()
21,748
8d8223162a36d931ed61888fcbcb6598a9f53e14
# -*- coding: utf-8 -*- fmi_edit = {"menu_id": "edit_menu_item", "menu_text": "Pas aan", "route": "edit", "flags": ["id_required"]} fmi_delete = {"menu_id": "delete_menu_item", "menu_text": "Verwijder", "route": "delete", "message" : "Zeker dat u dit item wil verwijderen", "flags": ["id_required", "confirm_before_delete"]} fmi_copy = {"menu_id": "copy_menu_item", "menu_text": "Kopieer van", "route": "add", "flags": ["id_required"]} fmi_add = {"menu_id": "add_menu_item", "menu_text": "Voeg toe", "route": "add", "flags": []} fmi_view = {"menu_id": "view_menu_item", "menu_text": "Details", "route": "view", "flags": ["id_required"]} fmi_change_pwd = {"menu_id": "change_pwd_menu_item", "menu_text": "Verander paswoord", "route": "change_pwd","flags": ["id_required"]} fmi_update_rfid = {"menu_id": "update_rfid_menu_item", "menu_text": "Nieuwe code", "route": "new_rfid","flags": ["bootbox_single"]} fmi_delete_rfid = {"menu_id": "delete_rfid_item", "menu_text": "Verwijder code", "route": "delete_rfid", "message" : "Zeker dat u deze rfid code wil verwijderen?", "flags": ["confirm_before_delete"]} fmi_delete_time_ran = {"menu_id": "delete_time_ran_menu_item", "menu_text": "verwijder gelopen tijd", "route": "delete_time_ran", "message" : "Zeker dat u deze tijd wil verwijderen?","flags": ["confirm_before_delete"]} default_menu_config = [ fmi_edit, fmi_copy, fmi_add, fmi_view, fmi_delete ] user_menu_config = [ fmi_edit, fmi_change_pwd ] admin_menu_config = [ fmi_edit, fmi_copy, fmi_add, fmi_view, fmi_delete, fmi_change_pwd ] offence_menu_config = [ fmi_delete ] register_runner_menu_config = [ fmi_update_rfid, fmi_delete_rfid, fmi_delete_time_ran ]
21,749
33c79c962224d647b7fe829e737e739737e34082
import rl.tools.dds as dds import ctypes from data.enums import CMAP from multiprocessing import Pool import numpy as np def convert_card(n): return CMAP[n % 13], n//13 def convert_hand(hand): cards = [[], [], [], []] for c in hand: card, color = convert_card(c) cards[color] += card res = [] for c in cards: c.reverse() res.append("".join(c)) return ".".join(res) def hands_to_pbn(hands): south = convert_hand(hands[:13]) west = convert_hand(hands[13:26]) north = convert_hand(hands[26:39]) east = convert_hand(hands[39:]) res = "N:{north} {east} {south} {west}".format(north=north, east=east, south=south, west=west) return bytes(res, 'utf8') """ North South East West NT 0 0 0 0 S 0 0 0 0 H 0 0 0 0 D 0 0 0 0 C 0 0 0 0 """ def convert_table(myTable): l = list(map(list,myTable.contents.resTable)) t = [[0,0,0,0], [0,0,0,0], [0,0,0,0], [0,0,0,0], [0,0,0,0]] t[0][0] = l[0][4] t[0][1] = l[2][4] t[0][2] = l[1][4] t[0][3] = l[3][4] for suit in range(4): t[suit+1][0] = l[0][suit] t[suit+1][1] = l[2][suit] t[suit+1][2] = l[1][suit] t[suit+1][3] = l[3][suit] return t def solve_pbn(pbn): tableDealPBN = dds.ddTableDealPBN() table = dds.ddTableResults() myTable = ctypes.pointer(table) tableDealPBN.cards = pbn res = dds.CalcDDtablePBN(tableDealPBN, myTable) return convert_table(myTable) def solve_deal(hands): pbn = hands_to_pbn(hands) return solve_pbn(pbn) class Solver(object): def __init__(self): dds.InitStart(2, 4) self.tableDealPBN = dds.ddTableDealPBN() self.table = dds.ddTableResults() self.myTable = ctypes.pointer(self.table) def score1(self, trump, north, south, we): hands = np.concatenate((north, we[:13], south, we[13:])) s = self.solve(hands) return max([s[i][0] for i in range(5)]) - s[trump][0] def score2(self, north, south, we): hands = np.concatenate((north, we[:13], south, we[13:])) s = self.solve(hands) return np.max(s) - s def mean_score2(self, n, north, south, we): res = [self.score2(north, south, np.random.permutation(we)) for _ in range(n)] return sum(res)/n def mean_score(self, n, trump, north, south, we): res = [self.score1(trump, north, south, np.random.permutation(we)) for _ in range(n)] return sum(res)/n def solve(self, hands): hands = [int(k) for k in hands] self.tableDealPBN = dds.ddTableDealPBN() self.table = dds.ddTableResults() self.myTable = ctypes.pointer(self.table) self.tableDealPBN.cards = hands_to_pbn(hands) res = dds.CalcDDtablePBN(self.tableDealPBN, self.myTable) return convert_table(self.myTable)
21,750
5c82437b51c89dc43d9af0a56039e311822c6723
#imports import sqlite3 as sqlite import pandas as pd import csv import json class dbdump: def __init__ (self, path): self.con = sqlite.connect(path) self.metadata = {} def __close__ (self): self.con.close() def createdump(self): cursor = self.con.cursor() cursor.execute("SELECT name FROM sqlite_master WHERE type = 'table';") tables = cursor.fetchall() for table in tables: table_name = table[0] cursor.execute("SELECT * FROM %s" % table_name) data = [description[0] for description in cursor.description] data_dict = [{data}]
21,751
bcc84d47e52c54a561468b44c9fd0de144ac1d88
import numpy import matplotlib.pyplot as plt class MyOVBox(OVBox): def __init__(self): OVBox.__init__(self) self.signalHeader = None def process(self): global numpyBuffer1 global numpyBuffer2 global numpyBuffer3 global numpyBuffer1_list #numpyBuffer1 = [] #numpyBuffer2 = [] #numpyBuffer3 = [] for chunkIndex in range( len(self.input[0]) ): if(type(self.input[0][chunkIndex]) == OVSignalHeader): self.signalHeader = self.input[0].pop() outputHeader = OVSignalHeader( self.signalHeader.startTime, self.signalHeader.endTime, [1, self.signalHeader.dimensionSizes[1]], ['Mean']+self.signalHeader.dimensionSizes[1]*[''], self.signalHeader.samplingRate) self.output[0].append(outputHeader) numpyBuffer1 = numpy.zeros(tuple(self.signalHeader.dimensionSizes)) numpyBuffer2 = numpy.zeros(tuple(self.signalHeader.dimensionSizes)) numpyBuffer3 = numpy.zeros(tuple(self.signalHeader.dimensionSizes)) numpyBuffer1_list = [] elif(type(self.input[0][chunkIndex]) == OVSignalBuffer): chunk = self.input[0].pop() numpyBuffer = numpy.array(chunk).reshape(tuple(self.signalHeader.dimensionSizes)) #numpyBuffer = numpyBuffer.mean(axis=0) if((chunk.startTime > 0) &(chunk.endTime <= 20)): numpyBuffer1 = numpy.hstack((numpyBuffer1, numpyBuffer)) print('1') if((chunk.startTime > 20) &(chunk.endTime <= 40)): numpyBuffer2 = numpy.hstack((numpyBuffer2, numpyBuffer)) print('2') if((chunk.startTime > 40) &(chunk.endTime <= 55)): numpyBuffer3 = numpy.hstack((numpyBuffer3, numpyBuffer)) print('3') if((chunk.startTime > 56)): print('baseline: ', numpy.mean(numpyBuffer1)) print('relaxed: ',numpy.mean(numpyBuffer2)) print('attentive: ', numpy.mean(numpyBuffer3)) numpyBuffer2 = numpyBuffer2 + 0.5 numpyBuffer3 = numpyBuffer3 + 1 chunk = OVSignalBuffer(chunk.startTime, chunk.endTime, numpyBuffer.tolist()) self.output[0].append(chunk) elif(type(self.input[0][chunkIndex]) == OVSignalEnd): self.output[0].append(self.input[0].pop()) def uninitialize(self): plt.hist([numpyBuffer1[0,:], numpyBuffer2[0,:], numpyBuffer3[0,:]], density=True) #numpy.save('C:\\Users\\Chris\\Documents\\3_Uni\\1_MSc Neuroengineering\\Semester 4\\NISE\\NISE\\Python\\buffer.npy', numpyBuffer1) plt.show() box = MyOVBox()
21,752
5c6e4a2a5a9566ea61c072566bd7482a76432cb2
from eval.Answer import Answer from eval.Question import Question from eval.USP import USP
21,753
39622fa1392850bf761baf32558e80c5dc1f40e5
from Node import * from Debugger import * # init the debugger debug = Debugger() debug.enable() class BinarySearchTree(object): """A Binary Search Tree Implementation: Attributes: name: A string representing the BST's name. Root: A root node which gets initialized to None. """ def __init__(self, name): """Create the root node of the BST. """ debug.printMsg("We Initiated a BST with no root node") self.name = name self.root = None self.size = 0 def length(self): """Returns the length of the BST """ return self.length def __contains__(self,key): """overload the *in* operator. credit@interactivepython.org """ if self.recursiveLookup(key,self.root): return True else: return False def __len__(self): """internal function returns length """ return self.size def __iter__(self): return self.root.__iter__() def __setitem__(self,k,v): """Allows to override how we insert things""" self.insert(k,v) def insert(self, key, data): """This function will insert data into the BST using a log_2(n) algorithm """ debug.printMsg('Insert for "' + key + '" With data: ' + str(data) ) # if there is no root node if not self.root: debug.printMsg("No root was found, create one") self.root = Node(key, data) else: debug.printMsg("Root was found, starting recursive insert") self.recursiveInsert(key, data, self.root) # increment the size of the BST debug.printMsg("Incrementing size of BST") self.size = self.size + 1 def recursiveInsert(self, key, data, curr): """This is the main algorithm for insert """ debug.printMsg("Entered recursiveInsert") # check if the key is greater than current node key # we will go right debug.printMsg("checking whether we go right or left") if key > curr.key: debug.printMsg("we go right") # now check if there is a right node already debug.printMsg("checking if we have available space") if curr.hasRightChild(): debug.printMsg("nope, calling recursiveInsert again") # well, we're shit out of luck and need to go further self.recursiveInsert(key, data, curr.right) else: debug.printMsg("yep, we'll insert it here") # we found an empty spot curr.right = Node(key, data, curr) else: debug.printMsg("we go left") # now check if there is a left node already if curr.hasLeftChild(): debug.printMsg("checking if we have available space") # well, we're shit out of luck and need to go further self.recursiveInsert(key, data, curr.left) else: # we found an empty spot debug.printMsg("yep, we'll insert it here") curr.left = Node(key, data, curr) def lookup(self, key): """Gets a specific key from the BST """ # check that this tree actually has a root node debug.printMsg("Call made to Lookup") debug.printMsg("checking if we have a BST") if self.root: debug.printMsg("Calling Recursive Lookup") (result, err) = self.recursiveLookup(key, self.root) # if we did not find anything if err: debug.printMsg("Oops, we couldn't find anything") return None else: # we found a result debug.printMsg("we found: ") return result else: debug.printMsg("Oops, the BST seems to not exist") # root doesnt exist return None def recursiveLookup(self, key, curr): """Recusrisvely searched the BST using log_2(n) algorithm to find the key is there is """ # basically repeat insert debug.printMsg("Entered recursiveLookup") # if we found a match break debug.printMsg('Checking base condition: ' + key + ' = ' + curr.key) if key == curr.key: debug.printMsg("Success, found") return (curr, None) # if the key is larger than curr elif key > curr.key: debug.printMsg("Nope, now checking if we should go right") debug.printMsg("yep") debug.printMsg("Check if we still have room to search") if curr.hasRightChild(): debug.printMsg("Moving further right") # move onto the next node along the search path return self.recursiveLookup(key, curr.right) else: debug.printMsg("Nope, ran out of search path. bummer") # hit the end and there was no match return (None, True) else: debug.printMsg("Nope, we're going left") debug.printMsg("Check if we still have room to search") if curr.hasLeftChild(): debug.printMsg("Moving further left") return self.recursiveLookup(key, curr.left) else: debug.printMsg("Shit balls, we ran out of search path") return (None, True)
21,754
2d7e394611d2fd2bff113235a0bd17df057a809e
from typing import List class Solution: def largestAltitude(self, gain: List[int]) -> int: res=[0]*(len(gain)+1) for i in range(1,len(gain)+1): res[i]=res[i-1]+gain[i-1] return max(res) n = int(input()) list = [] for i in range(0,n): a = int(input()) list.append(a) print(largestAltitude(1, list))
21,755
451d42a6b347de622429587860c09c09a6d0f483
from flask import Flask import pymysql app = Flask(__name__) conn = pymysql.connect( host= 'vcu-eras-application.cqdbzahrxvgz.us-east-1.rds.amazonaws.com', port= 3306, user= 'admin', password ='vcueras1!', db = 'VCU_ERAS', ) @app.route('/') def hello_world(): return 'Hello World!' @app.route('/surgeries', methods=['GET']) def get_info(): cur = conn.cursor() cur.execute("SELECT SurgeryInfo FROM Surgeries WHERE SurgeryName = 'Reconstructive Brest Surgery' ") details = cur.fetchall() print(details[0][0]) return(details[0][0]) if __name__ == '__main__': app.run()
21,756
01f1abc1f8517f54c0bfd74d9912c88a671c9b26
file=open("18.txt", "r") a=[[int(val) for val in line.split()] for line in file.readlines()] file.close() b=a[-1] c=size=a.__len__()-1 for i in range(size-1, -1, -1): for j in range(0, c, 1): if (a[i][j]+b[j]>a[i][j]+b[j+1]): b[j]=a[i][j]+b[j] else: b[j]=a[i][j]+b[j+1] c-=1 print(b[0])
21,757
587a683ae681d19de5fda19576a3e986beca45d3
from keras.models import Sequential, Model from keras.layers.core import Dense, Dropout, Activation, Flatten #from keras.layers.convolutional import Conv2D, MaxPooling2D, AveragePooling2D #from keras.layers.advanced_activations import LeakyReLU, PReLU from keras.utils import np_utils, generic_utils, to_categorical from sklearn.utils import shuffle import keras import sys #from keras import regularizers #from keras.regularizers import l2 import numpy as np from keras import backend as K #K.set_image_dim_ordering('th') from keras.layers import Input import os from PIL import Image from skimage.transform import resize from keras.applications.vgg16 import VGG16 from keras.layers import GlobalAveragePooling2D from keras import optimizers nb_classes = 10 img_channels = 3 img_rows = 112 img_cols = 112 if len(sys.argv)>1: train = sys.argv[1] else: train = 'sub_imagenet/train' img_folders = os.listdir(train) data = [] labels = [] for i in range(len(img_folders)): images = os.listdir(train+"/"+img_folders[i]) for img in images: image = Image.open(train+"/"+img_folders[i]+"/"+img) image = np.array(image, dtype='uint8') data.append(resize(image, (224,224,3))) labels.append(i) X_train = np.array(data) Y_train = np.array(labels) Y_train = to_categorical(Y_train, nb_classes) print('X_train shape:', X_train.shape) print(X_train.shape[0], 'train samples') print('Y_train shape:', Y_train.shape) X_train,Y_train = shuffle(X_train,Y_train) image_input = Input(shape=(224,224,3)) model = VGG16(include_top=False, weights='imagenet', input_tensor=image_input, pooling=None,classes=nb_classes) for layer in model.layers[:9]: layer.trainable = False output = model.output output = Flatten()(output) output = Dense(1024, activation="relu")(output) predictions = Dense(10, activation="softmax")(output) model_final = Model(input = model.input, output = predictions) #keras.utils.multi_gpu_model(model, gpus=2, cpu_merge=False, cpu_relocation=False) #opt = keras.optimizers.Adamax(lr=0.001, beta_1=0.9, beta_2=0.99, decay=1e-6)# best one opt = optimizers.SGD(lr=0.0001,momentum=0.9) model_final.compile(loss='categorical_crossentropy', optimizer=opt, metrics=['accuracy']) def train(): model_final.fit(X_train, Y_train, batch_size=32, epochs=20, shuffle=True) if len(sys.argv)>1: model_final.save(sys.argv[2]) else: model_save('model.h5') train()
21,758
fda50928f8fcd9ff258380b12c41035607dc025f
# coding: utf-8 import matplotlib matplotlib.use("Agg") from ecell4 import * util.decorator.SEAMLESS_RATELAW_SUPPORT = True import numpy as np import pandas as pd import itertools as itr import sys import seaborn as sns import matplotlib.pylab as plt from ribo6 import makedir ## liner chart csvdir = "results/ribo6/csv/liner" drugNames = ["Streptmycin", "Chloramphenicol"] imgdir = "results/ribo6/images" makedir(imgdir) ## normal for drugName in drugNames: normal = pd.read_csv("{}/{}_0.csv".format(csvdir, drugName)) Lambda_0 = normal["single"][0] plt.plot(np.linspace(0, 100, 101), list(map(lambda x: x / Lambda_0, list(normal["single"]))), label="single") plt.plot(np.linspace(0, 100, 101), list(map(lambda x: x / Lambda_0, list(normal["double"]))), label="double") plt.legend() plt.xlabel("Dose", fontsize=20) plt.ylabel("Growth Rate", fontsize=20) plt.tight_layout() plt.savefig("{}/{}_normal.png".format(imgdir, drugName), dpi=300) plt.close() ## change for drugName in drugNames: change = pd.read_csv("{}/{}_1.csv".format(csvdir, drugName)) Lambda_0 = change["single"][0] plt.plot(np.linspace(0, 100, 101), list(map(lambda x: x / Lambda_0, list(change["single"]))), label="single") plt.plot(np.linspace(0, 100, 101), list(map(lambda x: x / Lambda_0, list(change["double"]))), label="double") plt.legend() plt.xlabel("Dose", fontsize=20) plt.ylabel("Growth Rate", fontsize=20) plt.tight_layout() plt.savefig("{}/{}_change.png".format(imgdir, drugName), dpi=300)
21,759
01b94dec10b4cffa519d6dbae4d808482bd2a354
'项目失败,推到重来' life is short , i use python
21,760
39e6656a9f6c5ee5b929aca3d969470006816c96
######################################### # groupe MPCI 4 # Elive DIPOKO # Ali GOUMANE # Marie PHILIBERT # Stalin SIVASANGAR #https://github.com/uvsq21916121/projet_incendie.git ######################################### #importation des bibliothèques import tkinter as tk import random as rd #DEFINITION DES CONSTANTES HAUTEUR = 600 LARGEUR = 600 color_font = "white" type_de_terrain = ["blue", "green" , "yellow"] largeur_parcelle = LARGEUR //100 hauteur_parcelle = HAUTEUR // 100 DUREE_FEU = 1 #DUREE_CENDRE = 500 etat= 100*[0] for i in range(0,100): etat[i] = 100*[0] #DEFINITION DES FONCTIONS def choix_du_terrain(): """initialisation du terrain """ for i in range(100): for j in range(100): color = rd.choice(type_de_terrain) canvas.create_rectangle((i*largeur_parcelle, j*hauteur_parcelle),((i+1)*largeur_parcelle, (j+1)*hauteur_parcelle), fill=color) if (color == "blue"): etat[i][j] = 2 if (color =="yellow"): etat[i][j] = 0 if (color == "green"): etat[i][j] = 1 print (etat[0][0]) return #PROGRAMME PRINCIPAL racine = tk.Tk() canvas = tk.Canvas (racine ,width =LARGEUR, height = HAUTEUR , bg = color_font) bouton = tk.Button(racine , text ="Démarrer" ,command = choix_du_terrain, font = ("helvetica",30)) bouton.grid (column = 1,row = 6) canvas.grid(column = 1 ,row = 1 ,rowspan = 5) racine.mainloop()
21,761
5769fa347a1fa606d39b07a5f58040c0812d0c71
#coding: utf-8 # Admin manager from oi.projects.models import Project,Spec,Bid,PromotedProject,ProjectACL,Release from django.contrib import admin from django.utils.translation import ugettext as _ class SpecInline(admin.TabularInline): model = Spec extra = 0 class ACLInline(admin.TabularInline): model = ProjectACL extra = 0 class ProjectAdmin(admin.ModelAdmin): list_display=('__unicode__','parent','master','public') list_per_page = 200 list_editable = ('public',) date_hierarchy = 'created' actions = ['compute_descendants'] search_fields = ['title'] # list_filter = ('is_staff', 'company') raw_id_fields = ('parent',) radio_fields = {'state':admin.HORIZONTAL} inlines = [SpecInline,ACLInline] def compute_descendants(self, request, prjqueryset): for prj in prjqueryset: for task in prj.descendants.all(): task.save() self.message_user(request, "OK") compute_descendants.short_description = _("Recompute all descendants") admin.site.register(Project, ProjectAdmin) admin.site.register(Spec) admin.site.register(Bid) admin.site.register(PromotedProject) admin.site.register(Release)
21,762
80af258777f49a28d9251f6f3a0ef9c09dcb4537
import sys import logging from logging import handlers import os, os.path import cherrypy from cherrypy import _cplogging from cherrypy.lib import httputil #Docker conatiner didn't like daemonizing the app #from cherrypy.process.plugins import Daemonizer class Server(object): def __init__(self, options): #configure app paths self.base_dir = os.path.normpath(os.path.abspath(options.basedir)) self.conf_path = os.path.join(self.base_dir, "conf") log_dir = os.path.join(self.base_dir, "logs") if not os.path.exists(log_dir): os.mkdir(log_dir) # app configurations cherrypy.config.update(os.path.join(self.conf_path, "server.cfg")) cherrypy.config.update(os.path.join(self.conf_path, "db.cfg")) cherrypy.config.update({'error_page.default': self.on_error}) engine = cherrypy.engine sys.path.insert(0, self.base_dir) #import services #from webapp.messages import RestMessages #events = RestMessages() #configure sqlalchemy DB plugin from lib.data.saplugin import SAEnginePlugin SAEnginePlugin(cherrypy.engine, cherrypy.config['Database']['dbdriver'] + "://" + cherrypy.config['Database']['dbuser'] + ":" + cherrypy.config['Database']['dbpassword'] + "@" + cherrypy.config['Database']['dbhost'] + "/" + cherrypy.config['Database']['dbname']).subscribe() from lib.data.satool import SATool cherrypy.tools.db = SATool() conf = { '/' : { 'request.dispatch': cherrypy.dispatch.MethodDispatcher(), 'tools.response_headers.on': True, #Will probably make these JSON 'tools.response_headers.headers': [('Content-Type', 'application/json')], 'tools.proxy.on': True, 'tools.db.on': True } } #app = cherrypy.tree.mount(events, '/events',conf) def run(self): #Starting and running the cherrypy engine and daemonizing engine = cherrypy.engine #d = Daemonizer(engine) #d.subscribe() if hasattr(engine, "signal_handler"): engine.signal_handler.subscribe() if hasattr(engine, "console_control_handler"): engine.console_control_handler.subscribe() engine.start() engine.block() def on_error(self, status, message, traceback, version): #Least of my concerns at the moment return traceback if __name__ == '__main__': from optparse import OptionParser def parse_commandline(): curdir = os.path.normpath(os.path.abspath(os.path.curdir)) parser = OptionParser() parser.add_option("-b","--base-dir", dest="basedir",help="Base directory in which the server "\ "is launched (default: %s)" % curdir) parser.set_defaults(basedir=curdir) (options, args) = parser.parse_args() return options Server(parse_commandline()).run()
21,763
6dcea788a6f7b5fd5fb53196b04ebcb10d601d8a
class TestCaseObject: mutationlist = [] # list of precomputed edits def _init_(self, testcase, mutatorid): self.testcase = testcase self.mutatorid = mutatorid self.synthesis = None def set_synthesis_target(syn): self.synthesis = syn def append_mutator(mutator_obj): mutationlist.append(mutator_obj) #List of custom methods in test case. class MutatorObject: #list of data objects that stores relevant information #ctype: type of code (with limited ability to identify syntax information) #code: code #line: line number of code def _init_(self, ctype, code, line): self.ctype = cytype self.code = code self.line = line #testcase class MutatorOperatorSet: #mutator_operator_list: list of MutatorOperatorObjects for parsing. mutator_operator_list = [] def _init_(self): self.mutator_operator_list = [] def import_list(mutator_operator_list): self.mutator_operator_list = mutator_operator_list def append_mutator_operators(mutator_operator): self.mutator_operator_list.append(mutator_operator) class MutatorOperatorObject: #mutator_operator: operators as string literals, '<=','<','>',>=' #mutator_re: set of regular expressions that identify corresponding def_init(self, mutator_operator, mutator_re): self.mutator_operator = mutator_operators self.mutator_re = mutator_re
21,764
c5798d780b5db751469a5b8cc08a120ab67f2946
import time import math import xlsxwriter import openpyxl from selenium import webdriver from selenium.common.exceptions import NoSuchElementException, StaleElementReferenceException, WebDriverException from selenium.webdriver.common.keys import Keys workbook = xlsxwriter.Workbook('tgtcat.xlsx') worksheet = workbook.add_worksheet() row=0 col=0 inputstr = ["tgtcggcggttcgctttttcttttttgtcgg","tgtcggtacaaaatggcacagcatttgtcgg", "tgtcggaagtcaaataacaaatctttgtcgg", "tgtcggcgatgcaattattgtcttttgtcgg", "tgtctctgtctc", "tgtcaagtgtcaa", "tgtcaaatgtcaa", "tgtcaactgtcaa", "tgtcaattgtcaa", "tgtcattgtcat", "tgtcagattgtcag", "tgtcacttgtcac", "tgtcacgtgtcac", "tgtctaatgtcta", "tgtctttgtctt", "tgtctgtttgtctg", "tgtcgctggttgctgtcgc","tgtcgagtgtcga", "tgtcgttgtcgt", "tgtccattgtcca", "tgtccttatagtccatcacaacggttcatgtcct", "tgtccttcttttctgcttctttgtcct", "tgtccttgtcct"]; MPS = "TCACTATATATAGGAAGTTCATTTCATTTGGAATGGACACGTGTTGTCATTTCTCAACAATTACCAACAACAACAAACAACAAACAACATTATACAATTACTATTTACAATTACATCTAGATAAACAATGGCTTCCTCC" for string in inputstr: worksheet.write(row, col, string) row+=1 driver = webdriver.PhantomJS() driver.get('http://consite.genereg.net/cgi-bin/consite?rm=t_input_single') driver.find_element_by_name("seq1").send_keys(string + MPS) elem = driver.find_element_by_name("submit").click() elem = driver.find_element_by_name(".submit").click() elem = driver.find_element_by_name("Image4").click() rows = driver.find_elements_by_xpath("/html/body/table/tbody/tr/td[2]/div/table/tbody/tr/td/table/tbody/tr/td[1]") for a in rows: worksheet.write(row, col, a.text) row+=1 row=0 col+=1 workbook.close()
21,765
8cf25fef1b991814c1102e11a79fd17cf6ba4e5c
#!/usr/bin/env python class Solution(object): def __init__(self): self.nums_t = [] def min_heap(self, i, l): L = i * 2 R = i * 2 + 1 large = i # print "** = ", self.nums_t[i-1] if L <= l and self.nums_t[L-1] < self.nums_t[i-1]: # print "L>", self.nums_t[L-1] large = L if R <= l and self.nums_t[R-1] < self.nums_t[large-1]: # print "R>", self.nums_t[R-1] large = R # print "i = " , i , " large = ", large if large != i: tp = self.nums_t[large-1] self.nums_t[large-1] = self.nums_t[i-1] self.nums_t[i-1] = tp self.min_heap(large, l) def build_min_heap(self): l = len(self.nums_t) for i in range(l/2, 0, -1): self.min_heap(i, l) def findKthLargest(self, nums, k): self.nums_t = nums[0:k] # print self.nums_t self.build_min_heap() nums_leave = nums[k:] LL = len(nums_leave) for i in range(0, LL): if nums_leave[i] > self.nums_t[0]: self.nums_t[0] = nums_leave[i] self.min_heap(1, len(self.nums_t)) return self.nums_t[0] def findKthLargest1(self, nums, k): L = len(nums) if L == 1: return nums[0] left = [] right = [] for i in range(1,L): if nums[i] < nums[0]: left.append(nums[i]) else: right.append(nums[i]) new_L = len(right) if new_L >= k: return self.findKthLargest1(right, k) elif new_L == k - 1: return nums[0] else: return self.findKthLargest1(left, k - new_L - 1) if __name__ == '__main__': nums = [4,1,3,2,16,9,10,14,8,7] l = 5 s = Solution() ans = s.findKthLargest1(nums, l) print "ans : ", ans # for i in range(0,l): # print s.nums_t[i]
21,766
84604e20659d33ecbcd8e2455b0b936aa4dedee2
# 该文件用来管理所有会使用到的Flask扩展 from flask_bcrypt import Bcrypt from flask_pagedown import PageDown from flask_login import LoginManager from flask_openid import OpenID from flask_principal import Principal, Permission, RoleNeed from flask_celery import Celery from flask_mail import Mail from flask_assets import Environment, Bundle from flask_admin import Admin from flask_ckeditor import CKEditor # 创建bcrypt实例 bcrypt = Bcrypt() # 创建pagedown实例 pagedown = PageDown() # 创建flask-celery-helper flask_celery = Celery() openid = OpenID() # 创建flask-login的实例 login_manager = LoginManager() # 创建Flask-Mail的实例 mail = Mail() # 创建flask-assets的实例 assets_env = Environment() main_css = Bundle( 'css/bootstrap.css', 'css/bootstrap-theme.css', filters='cssmin', output='assets/css/common.css') main_js = Bundle( 'js/bootstrap.js', filters='jsmin', output='assets/js/common.js') # 创建flask-admin的实例 flask_admin = Admin() # 设置login的参数 # 设置登录的视图函数 login_manager.login_view = "main.login" # 一旦cookie被盗,重新登录 login_manager.session_protection = "strong" #指定提供登录的文案 login_manager.login_message = "Pless login to access this page." #指定登录信息的类别为info login_manager.login_message_category = "info" ckeditor = CKEditor() @login_manager.user_loader def load_user(user_id): """在用户登录并调用login_user时,根据user_id找到对应的user,如果没找到,返回none,此时的user_id将会自动从session中移除,如能找到user,则user_id会被继续保存""" from .models import User return User.query.filter_by(id=user_id).first() # 创建principal实例 principals = Principal() # 设置3种权限 admin_permission = Permission(RoleNeed('admin')) poster_permission = Permission(RoleNeed('poster')) default_permission = Permission(RoleNeed('default'))
21,767
0705400f6d33f3ba48f23b9f5e30342e34d0dae7
from airflow import DAG from airflow.operators.bash_operator import BashOperator from airflow.operators.python_operator import PythonOperator, BranchPythonOperator from airflow.models import Variable, BaseOperator from datetime import datetime import json import random # отправляем xcom значение def producer(*args, **kwargs): kwargs['ti'].xcom_push('key', 'World') print('Send half text') # принимаем xcom параметр def consumer(*args, **kwargs): req = kwargs['ti'].xcom_pull(task_ids='Second', key='key') print('Hello, {}'.format(req)) # ветвление выбираем между тасками. Можно было бы реализовать сложный пример с передачей xcom значения так же рандомно. # Например, producer отправляет одно из значений ['Second', 'Fourth'], тут принимаем значение и дальше выбираем. Но в # целом пример получается полноценным def branch(**context): # выбираем рандомно любой таск из нашего списка _tasks: [] = ['Second', 'Fourth'] return random.choice(_tasks) def create_dag(_dag_name: str, _default_args: dict) -> DAG: """ Создаем DAG динамически. :param _dag_name: название DAG :param _default_args: аргументы DAG :return: новый DAG """ _dag = DAG(_dag_name, default_args=_default_args, schedule_interval='@once') return _dag def create_task( _dag: DAG, _task_id: str, _trigger_rule: str, _operator_type: str, _command: str, _params: dict = None ) -> BashOperator: """ Создаем таски :param _dag: DAG :param _trigger_rule: триггер :param _operator_type: тип оператора :param _task_id: имя таска :param _command: команда для таска :param _params: перменные для заполнения Jinja шаблонов :return: BashOperator """ _task = None if _operator_type.lower() == 'bash': _task = BashOperator( task_id=_task_id, bash_command=_command, trigger_rule=_trigger_rule, params=_params, dag=_dag, ) elif _operator_type.lower() == 'python': _task = PythonOperator( task_id=_task_id, python_callable=globals()[_command], trigger_rule=_trigger_rule, dag=_dag, provide_context=True ) elif _operator_type.lower() == 'branch': _task = BranchPythonOperator( task_id=_task_id, python_callable=globals()[_command], trigger_rule=_trigger_rule, dag=_dag, ) return _task def read_meta_file(_meta_file_path: str) -> dict: """ Загружаем из переменной среды путь до файла с meta данными. :param: путь к файлу метаданных :return: сериализованный json """ with open(_meta_file_path, 'r') as f: f = json.load(f) return f def parse_dag_meta_json(_data: dict) -> tuple: """ Парсим метаданные для DAG :param: данные json :return: dag_name, default_args, tasks """ _dag_name: str = _data.get('dag_name') _default_args: dict = _data.get('default_args') _tasks: [] = _data.get('tasks') _dependencies: [] = _data.get('dependencies') return _dag_name, _default_args, _tasks, _dependencies # импортируем Airflow переменную с ссылкой до метаданных meta_file_path = Variable.get("meta_path2") # считываем файл с метданными data = read_meta_file(meta_file_path) # возвращаем кортеж с данными dag_name, default_args, tasks, dependencies = parse_dag_meta_json(data) # настраиваем когфигурацию ДАГа default_args = { "owner": default_args["owner"], "start_date": datetime.strptime(default_args["start_date"], "%d%m%Y") } # создаем DAG для простого-прямого примера связывания dag = create_dag(dag_name, default_args) # будем записывать Таски в dict, что бы свзать их по именам task1: {str: BaseOperator} = {} for task in tasks: task1[task['task_id']] = create_task(dag, task['task_id'], task['trigger_rule'], task['operator_type'], task['command']) # связываем такси между собой вытаскивая из коллекции по именам for dep in dependencies: task1[dep['task_id_from']].set_downstream(task1[dep['task_id_to']])
21,768
6b36a574ceb07bb3e888da134a2def3ce8c41c4d
#百度翻译的appid与secretKey appid = 'your appid' secretKey = 'your secretkey' #发送与接收设置 #其中rss源为rsshub的router #格式list[ [rsshub源1,[接收者1,接收者2,接收者3],True(翻译与否)] , [rss源2,[接收者2,接收者4,接收者5]] ] #例子[ ['twitter/user/ichika_mo',[123456,456789],True], # ['twitter/user/shirakamifubuki',[123456,456789],False] ] QQ_Group = [] QQ_Private = [] #CQHttp的控制 access_token = 'your access_token' secret = 'your secret' api_root = '酷Qhttp运行的地址' #http
21,769
b9fef26853954a0c2e8da6ca694c7aec6105f24b
import sq.interfaces.http try: from .endpoints import urlpatterns except ImportError: urlpatterns = None class WSGIApplication(sq.interfaces.http.WSGIApplication): def __init__(self, logger=None, is_operational=None): super(WSGIApplication, self).__init__(urlpatterns=urlpatterns, logger=logger, is_operational=is_operational) # pylint: skip-file # !!! SG MANAGED FILE -- DO NOT EDIT !!!
21,770
bcc5fed0c35defb3ab38211138eb87602e75e47a
from visual_mpc.envs.robot_envs import GripperInterface import intera_interface import time class SawyerDefaultGripper(GripperInterface): def __init__(self): self._gripper_control = intera_interface.Gripper("right") self._gripper_control.calibrate() self._gripper_control.set_velocity(self._gripper_control.MIN_VELOCITY) self._gripper_control.open() def get_gripper_state(self, integrate_force=False): # returns gripper joint angle, force reading (none if no force) return self._gripper_control.get_position(), self._gripper_control.get_force() def set_gripper(self, position, wait=False): self._gripper_control.set_position(position) # just busy wait since the gripper is pretty fast while wait and self._gripper_control.is_moving(): time.sleep(0.1) @property def GRIPPER_CLOSE(self): return self._gripper_control.MIN_POSITION @property def GRIPPER_OPEN(self): return self._gripper_control.MAX_POSITION def set_gripper_speed(self, new_speed): assert self._gripper_control.MIN_VELOCITY <= new_speed <= self._gripper_control.MAX_VELOCITY self._gripper_control.set_velocity(new_speed)
21,771
fa1afd0d496370fd9e1ae396d8a1cd8c3c7fe77c
from django.forms import ModelForm from .models import Blog class BlogForm(ModelForm): class Meta: model = Blog fields = ['title', 'description'] #fields = '__all__' # user if you want to use all the fields from the model in the form #exclude = ['title'] # if you want to user all the fields from the model, but the title
21,772
6070c62bd6c28fd0c52ad77396baeb3a71c73558
import time def inputProcess(file): aFile = open(file, "r") setWord = set([]) for line in aFile: setWord.add(line.strip()) aFile.close() dictWords = {} for word in setWord: dictWords[word] = randomnizeWord(word, setWord) return dictWords def isLinked(word1, word2): count = 0 if word1==word2: return False for i in range(4): if word1[i] != word2[i]: count += 1 if count == 1: return True else: return False def randomnizeWord(word, setWord): listWord = [] for index in range(len(word)): for replace in "ABCDEFGHIJKLMNOPQRSTUVWXYZ": newWord = word[:index]+replace+word[index+1:] if newWord in setWord and newWord!=word: listWord.append(newWord) return listWord def transform(begin, end, dictWords): visited = [] return transformWordBFS(begin, end, dictWords, visited) def transformWordBFS(begin,end, dictWords, visited): begin = begin.upper() end = end.upper() if begin not in dictWords: print("The starting word is not in the dictionary") return None elif end not in dictWords: print("The ending word is not in the dictionary") return None visited.append(begin) aQueue = [begin] parent = {} while aQueue: for word in dictWords[aQueue[0]]: if word not in visited and similarity(word,end): visited.append(word) aQueue.append(word) parent[word] = aQueue[0] # potential_ans.append(word) if word==end: return findingRoute(parent,begin,end) aQueue = aQueue[1:] def findingRoute(parent, start, end): path = [end] # print(parent) while path[-1] != start: path.append(parent[path[-1]]) path.reverse() return path def similarity(word1, word2): for i in range(4): if word1[i]==word2[i]: return True return False if __name__ == '__main__': dictWords = inputProcess("fourletterwords.txt") # print(dictWords["LOWS"]) # print(dictWords["COAT"]) # # print(dictWords["CHAT"]) # print(dictWords["CHAP"]) # # print(dictWords["CHIP"]) # print(dictWords) begin = time.time() print(transform("boat","ship",dictWords)) print(time.time()-begin)
21,773
c5a5f47999cc4b73882dd2ccbc81890f7ad3d468
import requests import argparse import urllib3 #disable ssl warning urllib3.disable_warnings(urllib3.exceptions.InsecureRequestWarning) #如果报错ssl.SSLError: [SSL: UNSUPPORTED_PROTOCOL] unsupported protocol (_ssl.c:852) #修改/etc/ssl/openssl.cnf,将TLSv1.2改为TLSv1.0 #参考链接:https://stackoverflow.com/questions/59408646/ssl-sslerror-ssl-unsupported-protocol-unsupported-protocol-ssl-c852-in-d ENDPOINT = '/ui/vropspluginui/rest/services/uploadova' def banner(): print( """ _______ ________ ___ ___ ___ __ ___ __ ___ ______ ___ / ____\\ \\ / / ____| |__ \\ / _ \\__ \\/_ | |__ \\/_ |/ _ \\____ |__ \\ | | \\ \\ / /| |__ ______ ) | | | | ) || |______ ) || | (_) | / / ) | | | \\ \\/ / | __|______/ /| | | |/ / | |______/ / | |\\__, | / / / / | |____ \\ / | |____ / /_| |_| / /_ | | / /_ | | / / / / / /_ \\_____| \\/ |______| |____|\\___/____||_| |____||_| /_/ /_/ |____| Author: ybdt """ ); def check(ip): try: if "https://" in ip: r = requests.get(ip + ENDPOINT, verify=False, timeout=10); else: r = requests.get('https://' + ip + ENDPOINT, verify=False, timeout=10) except requests.exceptions.ConnectTimeout: print('[-] ' + ip + ' ConnectTimeout'); return False; except requests.exceptions.ReadTimeout: print('[-] ' + ip + ' ReadTimeout'); return False; except requests.exceptions.ConnectionError: print('[-] ' + ip + ' ConnectionError'); return False; if r.status_code == 405: print('[+] ' + ip + ' vulnerable to CVE-2021-21972!') return True else: print('[-] ' + ip + ' not vulnerable to CVE-2021-21972. Response code: ' + str(r.status_code) + '.') return False def main(): banner(); parser = argparse.ArgumentParser() parser.add_argument("-i", "--inputfile", help="The file contains ips, one per line", required=True); args = parser.parse_args() with open(args.inputfile, "r") as f_r: with open("vulnerable.txt", "w") as f_w: lines = f_r.readlines(); for line in lines: line = line.strip("\n").strip("\r\n"); vulnerable = check(line); if vulnerable: f_w.write(line + "\n"); main();
21,774
e50bbe5d506ac6bf6ab9aef3b5de530de468688f
# -- coding: utf-8 -- from selenium import webdriver import time import math from selenium.webdriver.support import expected_conditions def calc(x): return str(math.log(abs(12*math.sin(int(x))))) try: link = "http://suninjuly.github.io/explicit_wait2.html" browser = webdriver.Chrome() browser.get(link) #wait = WebDriverWait(driver, 12) inpPrice = wait.until(expected_conditions.text_to_be_present_in_element((By.Id, 'price'), '$100')) button = browser.find_element_by_css_selector("button.btn.btn-primary") button.click() time.sleep(2) alert = browser.switch_to.alert alert.accept() finally: # ��������� ������� ����� ���� ����������� browser.quit()
21,775
9257ee4d586645241340b92650f3b01bc601b1b4
# ToDo: Create a top level container for different measurement programs at the probe station
21,776
ccf8144f1f489dbb7f91fc861252d2c5096ed061
import requests import json # url = "http://localhost:5000/watchlist/toggle_add" url = "http://13.229.107.243:5001/watchlist/toggle_add" data = { "user_id": "Bob", "product": "TSLA" } response = requests.post(url, data = json.dumps(data)) print(response.text)
21,777
b728ed8056d5df78830e87857b9cced8e06b410b
from unittest import TestCase try: from unittest.mock import Mock, call except ImportError: from mock import Mock, call from argparse import ArgumentParser from munch import munchify from cloud_cleaner.config import CloudCleanerConfig from cloud_cleaner.resources.fip import Fip FLOATING_IPS = [ # THESE ARE ATTACHED, AND SHOULDN'T BE DELETED, BY DEFAULT munchify({ 'attached': True, 'fixed_ip_address': '191.168.1.1', 'floating_ip_address': '10.0.0.1', 'id': '1', 'status': 'ACTIVE' }), munchify({ 'attached': True, 'fixed_ip_address': '172.16.0.2', 'floating_ip_address': '10.0.0.2', 'id': '2', 'status': 'ACTIVE' }), munchify({ 'attached': True, 'fixed_ip_address': '192.168.10.22', 'floating_ip_address': '8.9.10.3', 'id': '3', 'status': 'ACTIVE' }), # THESE ARE NOT ATTACHED AND SHOULD BE DELETED, BY DEFAULT munchify({ 'attached': False, 'fixed_ip_address': '192.168.1.20', 'floating_ip_address': '10.0.0.20', 'id': '20', 'status': 'DOWN' }), munchify({ 'attached': False, 'fixed_ip_address': '172.16.0.21', 'floating_ip_address': '10.0.0.21', 'id': '21', 'status': 'DOWN' }), munchify({ 'attached': False, 'fixed_ip_address': '192.168.10.22', 'floating_ip_address': '8.9.10.22', 'id': '22', 'status': 'DOWN' }) ] class TestFip(TestCase): def __test_with_calls(self, args, calls): conn = Mock() conn.list_floating_ips = Mock(return_value=FLOATING_IPS) conn.delete_floating_ip = Mock() calls = [call(i) for i in calls] config = CloudCleanerConfig(args=args) config.get_conn = Mock(return_value=conn) fip = Fip() fip.register(config) config.parse_args() fip.process() fip.clean() self.assertEqual(conn.delete_floating_ip.call_args_list, calls) def test_resource_type(self): # pylint: disable=no-self-use parser = ArgumentParser() config = CloudCleanerConfig(parser=parser, args=["--os-auth-url", "http://no.com", "fip"]) config.add_subparser = Mock() fip = Fip() fip.register(config) config.add_subparser.assert_called_once_with(Fip.type_name) def test_resource_handled_from_args(self): parser = ArgumentParser() config = CloudCleanerConfig(parser=parser, args=["--os-auth-url", "httpp://no.com", Fip.type_name]) fip = Fip() # If config hasn't yet been registered, then there will be an error # from within this method, as intended with self.assertRaises(AttributeError): fip.process() fip.register(config) config.parse_args() self.assertEqual(Fip.type_name, config.get_resource()) def test_default_filters_active(self): args = ["--os-auth-url", "http://no.com", "fip"] calls = ['20', '21', '22'] self.__test_with_calls(args, calls) def test_force_delete_attached(self): args = ["--os-auth-url", "http://no.com", "fip", "--with-attached"] calls = ['1', '2', '3', '20', '21', '22'] self.__test_with_calls(args, calls) def test_delete_by_subnet(self): args = ['--os-auth-url', 'http://no.com', 'fip', '--floating-subnet', '10.0.0.0/8'] calls = ['20', '21'] self.__test_with_calls(args, calls) def test_delete_by_static_subnet(self): args = ['--os-auth-url', 'http://no.com', 'fip', '--static-subnet', '192.168.0.0/16'] calls = ['20', '22'] self.__test_with_calls(args, calls)
21,778
8f7224fcc7642a795e0534914243d7aead634153
""" File with commands and supported databases by dumpyme """ # Dict with types and commands to create dumps # {0} - database name # {1} - folder with dump dump_commands = { "mongodb": "mongodump --db {0} --out {1}", } """ POSTGRESQL : pg_dump -d database -U user/owner > file.sql variações: --table=nome_da_tabela --table=nome_da_tabela --table=nome_da_outra_tabela --exclude=nome_da_tabela --exclude=nome_da_tabela --exclude=nome_da_outra_tabela """ # const with list of supported database types SUPPORTED = dump_commands.keys()
21,779
0a4a242012ed9ba91e6caec48cc36c95b2143c1f
# -*- coding: utf-8 -*- # Form implementation generated from reading ui file 'C:\Users\zhou\Desktop\Client\Shangke.ui' # # Created by: PyQt5 UI code generator 5.11.3 # # WARNING! All changes made in this file will be lost! from PyQt5 import QtCore, QtGui, QtWidgets class Ui_Shangke(object): def setupUi(self, Shangke): Shangke.setObjectName("Shangke") Shangke.resize(923, 568) self.centralWidget = QtWidgets.QWidget(Shangke) self.centralWidget.setObjectName("centralWidget") self.Img_lable = QtWidgets.QLabel(self.centralWidget) self.Img_lable.setGeometry(QtCore.QRect(249, 40, 371, 271)) self.Img_lable.setObjectName("Img_lable") self.label = QtWidgets.QLabel(self.centralWidget) self.label.setGeometry(QtCore.QRect(33, 50, 61, 20)) self.label.setObjectName("label") self.label_2 = QtWidgets.QLabel(self.centralWidget) self.label_2.setGeometry(QtCore.QRect(33, 150, 61, 20)) self.label_2.setObjectName("label_2") self.label_3 = QtWidgets.QLabel(self.centralWidget) self.label_3.setGeometry(QtCore.QRect(33, 200, 61, 20)) self.label_3.setObjectName("label_3") self.label_5 = QtWidgets.QLabel(self.centralWidget) self.label_5.setGeometry(QtCore.QRect(33, 100, 61, 20)) self.label_5.setObjectName("label_5") self.label_6 = QtWidgets.QLabel(self.centralWidget) self.label_6.setGeometry(QtCore.QRect(33, 250, 61, 21)) self.label_6.setObjectName("label_6") self.lineEdit = QtWidgets.QLineEdit(self.centralWidget) self.lineEdit.setGeometry(QtCore.QRect(100, 50, 113, 20)) self.lineEdit.setReadOnly(True) self.lineEdit.setObjectName("lineEdit") self.lineEdit_2 = QtWidgets.QLineEdit(self.centralWidget) self.lineEdit_2.setGeometry(QtCore.QRect(100, 100, 113, 20)) self.lineEdit_2.setReadOnly(True) self.lineEdit_2.setObjectName("lineEdit_2") self.lineEdit_3 = QtWidgets.QLineEdit(self.centralWidget) self.lineEdit_3.setGeometry(QtCore.QRect(100, 150, 113, 20)) self.lineEdit_3.setReadOnly(True) self.lineEdit_3.setObjectName("lineEdit_3") self.lineEdit_4 = QtWidgets.QLineEdit(self.centralWidget) self.lineEdit_4.setGeometry(QtCore.QRect(100, 200, 113, 20)) self.lineEdit_4.setReadOnly(True) self.lineEdit_4.setObjectName("lineEdit_4") self.lineEdit_6 = QtWidgets.QLineEdit(self.centralWidget) self.lineEdit_6.setGeometry(QtCore.QRect(100, 250, 113, 20)) self.lineEdit_6.setReadOnly(True) self.lineEdit_6.setObjectName("lineEdit_6") self.Add_new_class_button = QtWidgets.QPushButton(self.centralWidget) self.Add_new_class_button.setGeometry(QtCore.QRect(20, 320, 191, 51)) self.Add_new_class_button.setObjectName("Add_new_class_button") self.Output_CWA_excel_Now_button = QtWidgets.QPushButton(self.centralWidget) self.Output_CWA_excel_Now_button.setGeometry(QtCore.QRect(20, 390, 191, 51)) self.Output_CWA_excel_Now_button.setObjectName("Output_CWA_excel_Now_button") self.Exit_button = QtWidgets.QPushButton(self.centralWidget) self.Exit_button.setGeometry(QtCore.QRect(20, 460, 191, 51)) self.Exit_button.setObjectName("Exit_button") self.Off_class_button = QtWidgets.QPushButton(self.centralWidget) self.Off_class_button.setGeometry(QtCore.QRect(690, 460, 191, 51)) self.Off_class_button.setObjectName("Off_class_button") self.textEdit = QtWidgets.QTextEdit(self.centralWidget) self.textEdit.setGeometry(QtCore.QRect(240, 350, 421, 161)) self.textEdit.setObjectName("textEdit") self.label_4 = QtWidgets.QLabel(self.centralWidget) self.label_4.setGeometry(QtCore.QRect(240, 320, 131, 31)) font = QtGui.QFont() font.setPointSize(15) font.setBold(True) font.setWeight(75) self.label_4.setFont(font) self.label_4.setObjectName("label_4") self.Start_CWA_button = QtWidgets.QPushButton(self.centralWidget) self.Start_CWA_button.setGeometry(QtCore.QRect(690, 380, 191, 51)) self.Start_CWA_button.setObjectName("Start_CWA_button") self.rec_label_7 = QtWidgets.QLabel(self.centralWidget) self.rec_label_7.setGeometry(QtCore.QRect(660, 20, 211, 161)) self.rec_label_7.setObjectName("rec_label_7") self.stu_pic_label_7 = QtWidgets.QLabel(self.centralWidget) self.stu_pic_label_7.setGeometry(QtCore.QRect(710, 200, 121, 151)) self.stu_pic_label_7.setObjectName("stu_pic_label_7") Shangke.setCentralWidget(self.centralWidget) self.retranslateUi(Shangke) QtCore.QMetaObject.connectSlotsByName(Shangke) def retranslateUi(self, Shangke): _translate = QtCore.QCoreApplication.translate Shangke.setWindowTitle(_translate("Shangke", "Shangke")) self.Img_lable.setText(_translate("Shangke", "Img")) self.label.setText(_translate("Shangke", "科 目:")) self.label_2.setText(_translate("Shangke", "节 次:")) self.label_3.setText(_translate("Shangke", "教师工号:")) self.label_5.setText(_translate("Shangke", "班 级:")) self.label_6.setText(_translate("Shangke", "上课日期:")) self.Add_new_class_button.setText(_translate("Shangke", "新增上课信息")) self.Output_CWA_excel_Now_button.setText(_translate("Shangke", "打印当前节次考勤报表")) self.Exit_button.setText(_translate("Shangke", "退出")) self.Off_class_button.setText(_translate("Shangke", "下课")) self.label_4.setText(_translate("Shangke", "签到情况:")) self.Start_CWA_button.setText(_translate("Shangke", "开始考勤")) self.rec_label_7.setText(_translate("Shangke", "TextLabel")) self.stu_pic_label_7.setText(_translate("Shangke", "TextLabel")) if __name__ == "__main__": import sys app = QtWidgets.QApplication(sys.argv) Shangke = QtWidgets.QMainWindow() ui = Ui_Shangke() ui.setupUi(Shangke) Shangke.show() sys.exit(app.exec_())
21,780
aa1a39d8ce6fcb7eb877731fa0dbf1baae491151
#Python STD package import time from pytz import timezone from datetime import datetime import random from pprint import pprint as print import os import logging from logging.handlers import RotatingFileHandler import sys #Installed packages import pytz import requests fmt_date = '%Y-%m-%d' fmt_hour = '%H:%M:%S' fmt_hour_round = '%H.%M' utc = pytz.utc eastern = timezone('America/Montreal') def get_log_formatter(): # https://tutorialedge.net/python/python-logging-best-practices/ log_formatter = logging.Formatter('%(asctime)s %(levelname)-8s [%(filename)s:%(funcName)s:%(lineno)d] %(message)s') logFile = './log.log' my_handler = RotatingFileHandler( logFile, mode='a', maxBytes=5*1024*1024, backupCount=2, encoding=None, delay=0) my_handler.setFormatter(log_formatter) my_handler.setLevel(logging.INFO) app_log = logging.getLogger('root') app_log.setLevel(logging.INFO) app_log.addHandler(my_handler) return app_log if __name__ == '__main__': pass
21,781
a06ff55feead3e13366397a56b4b9a74af7b0e9d
def aplicar_funcion_str(): n_caracteres = input('Texto: ') fun = input('Función a aplicar: ') return getattr(str, fun)(n_caracteres) if __name__ == '__main__': print(aplicar_funcion_str())
21,782
a3b5fdc1fb7e8b7a83b07acdd36f9e75b031570f
#创建一个单例 ''' 需求 原来每创建一个对象,会指向一个内存空间。 而单例不管创建多少个对象,都会指向同一块内存空间 只让__init__方法初始化一次对象(也就是以后一直就是初始化的那个对象) ''' class Dog(object): __instance = None #常见一个私有属性(可以理解为变量) __init_flag = False def __new__(cls,name): #name在这里暂时用不上,主要是防止创建时传参报错 if cls.__instance == None: cls.__instance = object.__new__(cls) #将创建对象的引用赋值给__instance return cls.__instance else: #return上一次创建的对象的引用 return cls.__instance def __init__(self,name): if Dog.__init_flag == False: self.name = name Dog.__init_flag = True a = Dog("旺财") print (id(a)) print (a.name) b = Dog("哮天犬") print (id(b)) print (b.name) ''' 结果:两个对象的name都是旺财 2019567346240 旺财 2019567346240 旺财 '''
21,783
f596accdea1771aa06db16b10799cd2f8c8104e6
from typing import List, Optional, Deque from cuckoo_filter import CuckooFilterBit from collections import deque from read import Read from copy import deepcopy import sys class CuckooBitTree: def __init__(self, theta, k, num_buckets, fp_size, bucket_size, max_iter): """ Wrapper around the Node structure of tree for inserting, querying :param theta: Parameter to determine strictness of querying :param k: Size of kmer :param num_buckets: Parameter for CuckooFilter :param fp_size: Parameter for CuckooFilter :param bucket_size: Parameter for CuckooFilter :param max_iter: Parameter for CuckooFilter """ self.root: Optional[Node] = None self.theta: float = theta self.k: int = k self.num_buckets = num_buckets self.fp_size = fp_size self.bucket_size = bucket_size self.max_iter = max_iter self.aggregate_size = self.get_insternal_size() def insert(self, dataset: List[Read]) -> bool: """ Creates a new node from this read and adds it into the tree :param dataset: the dataset reads :return: None """ node_to_insert = Node(self.k, self.num_buckets, self.fp_size, self.bucket_size, self.max_iter) node_to_insert.populate_dataset_info(dataset) self.aggregate_size += node_to_insert.get_size() if self.root is None: self.root = node_to_insert return True parent = None current = self.root while current: if current.num_children() == 0: """ current is a leaf representing a dataset, so create a new parent that contains node_to_insert and current as children """ new_parent = Node(self.k, self.num_buckets, self.fp_size, self.bucket_size, self.max_iter) self.aggregate_size += new_parent.get_size() new_parent.parent = parent # Kmers from existing and new leaf new_parent.filter = deepcopy(current.filter) new_parent.insert_kmers_from_dataset(dataset) # Set appropriate parent/child pointers current.parent = new_parent node_to_insert.parent = new_parent new_parent.children.append(current) new_parent.children.append(node_to_insert) # Special case where root is a leaf if parent is None: # current is root -> new_parent is now root self.root = new_parent return True # Set new_parent as child of old parent idx = parent.children.index(current) parent.children[idx] = new_parent return True elif current.num_children() == 1: # insert kmers current.insert_kmers_from_dataset(dataset) # we found an empty slot to insert into current.children.append(node_to_insert) return True elif current.num_children() == 2: # insert kmers current.insert_kmers_from_dataset(dataset) # select "best" child score_0 = current.children[0].score(dataset) score_1 = current.children[1].score(dataset) best_child = 0 if score_0 < score_1 else 1 # recur parent = current current = current.children[best_child] raise Exception("Did not insert successfully!") def query(self, query: str) -> List[str]: """ Perform a DFS of the tree and collects reads that pass similarity test. :param query: The query string to be broken into kmers :return: The list of read_ids that "match" """ nodes_to_explore: Deque[Node] = deque() nodes_to_explore.append(self.root) out: List[str] = [] while nodes_to_explore: current = nodes_to_explore.popleft() total_kmers_found = 0 total_kmers = 0 for kmer in kmers_in_string(query, self.k): if current.filter.contains(kmer): total_kmers_found += 1 total_kmers += 1 if total_kmers_found >= self.theta * total_kmers: for child in current.children: nodes_to_explore.append(child) if current.num_children() == 0: out.append(current.dataset_id) return out def contains(self, query): """ A wrapper for backward comptibility with other data structure implementations """ return self.query(query) def get_insternal_size(self): """ Returns the total number of bytes occupied by the filter object """ return ( sys.getsizeof(self.theta) + sys.getsizeof(self.num_buckets) + sys.getsizeof(self.k) + sys.getsizeof(self.fp_size) + sys.getsizeof(self.max_iter) + sys.getsizeof(self.bucket_size) ) class Node: def __init__(self, k, num_buckets, fp_size, bucket_size, max_iter): """ Represents a single node of Cuckoo Tree. """ self.children: List[Node] = [] self.parent: Optional[Node] = None self.filter = CuckooFilterBit(num_buckets, fp_size, bucket_size, max_iter) self.dataset_id: Optional[str] = None self.k = k def populate_dataset_info(self, dataset: List[Read]) -> None: self.dataset_id = dataset[0].filename self.insert_kmers_from_dataset(dataset) def insert_kmers_from_dataset(self, dataset: List[Read]) -> None: for read in dataset: for kmer in read.kmers(self.k): self.filter.insert_no_duplicates(kmer) def num_children(self) -> int: return len(self.children) def score(self, dataset: List[Read]) -> int: """ "Hamming distance" score where lower is better :param dataset: The dataset to compare against :return: """ kmers_in_common = 0 for read in dataset: for kmer in read.kmers(self.k): if self.filter.contains(kmer): kmers_in_common += 1 return self.filter.num_items_in_filter - kmers_in_common def get_size(self): """ Returns the total number of bytes occupied by the filter object """ return ( sys.getsizeof(self.children) + sys.getsizeof(self.parent) + sys.getsizeof(self.dataset_id) + sys.getsizeof(self.k) + self.filter.get_size() ) def kmers_in_string(string: str, k): for i in range(len(string) - k + 1): yield string[i:i + k]
21,784
a5c158adce8f1f3e119a7788c42c45f68b493ae1
import os import re import subprocess import time def isBoot(wait_count=60): print 'check the device boot status' time.sleep(1) waitcount = 0 while waitcount <= wait_count: if os.popen('adb shell getprop dev.bootcomplete').read().strip() == '1': print 'boot complete,start skip google security' return True else: print 'device offline,wait for boot' time.sleep(1) waitcount += 1 return False def installApk(): print 'start install apk for device' time.sleep(1) subprocess.Popen('adb install ./runner/flash/lib/JIO.apk', shell=True) def checkLog(timeout=60): print 'start ckeck logcat for vending window' time.sleep(1) timeinit = 0 while timeinit <= timeout: if re.search('{com\.android\.vending/com\.google\.android\.finsky\.verifier\.impl\.ConsentDialog}*', os.popen('adb shell logcat -d |grep activity').read()): print 'find the google vending window,start click' time.sleep(1) for i in range(10): os.system('adb shell input tap 1176 593') time.sleep(1) print 'skip succuess' break print 'not find the window,waiting....' timeinit += 5 time.sleep(5) def startSkip(): if isBoot(): installApk() checkLog() else: print 'skip failed, no devices boot'
21,785
227931c5e88a707904f6e4aa11fa305b56f5b600
class Node(object): def __init__(self, data=None, next_node=None): self.data = data self.next = next_node def print_node(self): print "data = " + str(self.data) def main(): node_1 = Node(1) node_2 = Node(2) node_3 = Node(3) node_1.next = node_2 node_2.next = node_3 head = node_1 print "original data" node_1.print_node() head.print_node() node_1.data = 0 print"changed data" node_1.print_node() head.print_node() main()
21,786
d120e9713e65d4693fbff8f993ade4e5c521ac17
import numpy as np import matplotlib.pyplot as plt from random import shuffle # INITIALIZING GLOBAL VARIABLES global layers global ERROR global number_of_neurons_by_layer layers = [] ERROR = [] def logistic(x): return 1/(1+np.exp(-x)) def dlogistic(x): return logistic(x)*(1-logistic(x)) def init(layers_size): global number_of_neurons_by_layer number_of_neurons_by_layer = layers_size """ "number_of_neurons_by_layer" is a list that counts the number of neurons from the input to the output layer "y" is the concatenation of "1" and "v", the first layer has only this parameter; "v" is the flow vector; "weigths" are the concatenation of a column of biases followed by columns of weigths; "biases" are the first column of "weigths"; "delta" is the lower-case delta from class notes (derivative of squared error with respect to "v"); "Delta_w" is the upper-case Delta from class notes (the step for updating the weigths: it need one more parameter, the length-step of gradient descent method, the parameter <eta> from class notes); "error" is the error vector between the desired and the obtained outputs, it is stored only at the last layer; "error2" is the summation of squared errors calculated at the vector "error", it is also stored only at the last layer; """ layers.clear() for i in range(len(number_of_neurons_by_layer)): if i == 0: y = np.ones((number_of_neurons_by_layer[i]+1, 1)) d = {"y": y} layers.append(d) continue w = np.random.normal(0, 1, ( number_of_neurons_by_layer[i], number_of_neurons_by_layer[i-1]+1 )) b = w[:, 0] y = np.ones((number_of_neurons_by_layer[i]+1, 1)) v = y[1:, :] delta = np.zeros(v.shape) Delta_w = np.zeros(w.shape) d = {"weigths": w, "biases": b, "y": y, "v": v, "delta": delta, "Delta_w": Delta_w} layers.append(d) layers[-1]["error"] = 0*layers[-1]["y"][1:, :].copy() layers[-1]["error2"] = 0 # END: INITIALIZING THE LAYERS def flow(input_): """ it makes the flow of a given input through the network, all data are stored in the layers "y" and "v" """ global number_of_neurons_by_layer if len(input_) != number_of_neurons_by_layer[0]: raise IndexError( f"\033[91mInput length is incorrect. It must be {number_of_neurons_by_layer[0]}.\033[m") layers[0]["y"][1:] = np.array(input_).flatten().reshape(len(input_), 1) for i_lay in range(1, len(layers)): layers[i_lay]["v"][:] = logistic( layers[i_lay]["weigths"] @ layers[i_lay-1]["y"] ) def error(input_, output): """ it computes the error vector between desired and obtained output, stored at the last layer """ global number_of_neurons_by_layer if len(output) != number_of_neurons_by_layer[-1]: raise IndexError( f"\033[91mDesired output length is incorrect. It must be {number_of_neurons_by_layer[-1]}.\033[m") output = np.array(output).reshape(len(output), 1) flow(input_) layers[-1]["error"] = output - layers[-1]["v"] def error2(input_, output): """ it computes the sum of quadratic error of a given input, stored at the last layer """ error(input_, output) layers[-1]["error2"] = layers[-1]["error"].T @ layers[-1]["error"] def backpropagate(eta, momentum): """ it computes "delta" and "Delta_w" """ for i_lay in range(len(layers)-1, 0, -1): lay = layers[i_lay] if i_lay == len(layers)-1: lay["delta"] = lay["error"] * dlogistic(lay["v"]) else: lay["delta"] = (layers[i_lay+1]["weigths"][:, 1:].T @ layers[i_lay+1] ["delta"]) * dlogistic(lay["v"]) lay["Delta_w"] = eta * lay["delta"] @ layers[i_lay - 1]["y"].T +\ momentum * lay["Delta_w"] def updateweigths(): """ once you have "Delta_w", it makes $ w <- w + Delta_w """ for i_lay in range(1, len(layers)): layers[i_lay]["weigths"] += layers[i_lay]["Delta_w"] def getweigths(): """ it gets the list of weigths """ ls = [] for i_lay in range(1, len(layers)): ls.append(layers[i_lay]["weigths"]) return ls def get_Delta_weigths(): """ it gets the list of "Delta_w" """ ls = [] for i_lay in range(1, len(layers)): ls.append(layers[i_lay]["Delta_w"]) return ls def setweigths(ls): """ it sets the list of "weigths": they must be of the same type of data (numpy.array) and same dimension. """ for i_lay in range(1, len(layers)): layers[i_lay]["weigths"] = ls[i_lay-1] def set_Delta_weigths(ls): """ it sets the list of "Delta_w": they must be of the same type of data (numpy.array) and same dimension. """ for i_lay in range(1, len(layers)): layers[i_lay]["Delta_w"] = ls[i_lay-1] def train_cyclic(inputs, outputs, eta=0.55, maxit=1000, momentum=0.1, plot=False): """ it performs the cyclic mode of training """ global ERROR ERROR.clear() min_error = 100 ins_outs = list(zip(inputs, outputs)) counter = 0 while counter <= maxit: counter += 1 shuffle(ins_outs) for pair in ins_outs: i, o = pair error2(i, o) ERROR.append(layers[-1]["error2"].item()) try: if ERROR[-1] < min_error: min_error = ERROR[-1] optimal_w = getweigths() min_error_counter = counter print( f"Minimum error found = {min_error}, at counter = {min_error_counter}", end="\r") except: pass backpropagate(eta, momentum) updateweigths() setweigths(optimal_w) print(f"\vMinimum error reached at the {min_error_counter}st cycle") if plot: plt.plot(np.arange(len(ERROR)), ERROR, "b*-") plt.xlabel("Number of cycles") plt.ylabel("Sum of quadratic errors") plt.title("CYCLIC MODE\nERROR vs CYCLES") plt.grid() plt.show() def train_batch(inputs, outputs, eta=0.55, maxit=1000, momentum=0.1, plot=False): """ it performs the batch mode of training """ global ERROR ERROR.clear() min_error = 100 ins_outs = list(zip(inputs, outputs)) counter = 0 while counter <= maxit: counter += 1 shuffle(ins_outs) Dws = [] errors = [] for pair in ins_outs: i, o = pair error2(i, o) errors.append(layers[-1]["error2"].item()) ws = getweigths() backpropagate(eta, momentum) Dws.append(get_Delta_weigths()) setweigths(ws) ERROR.append(sum(errors)) try: if ERROR[-1] < min_error: min_error = ERROR[-1] optimal_w = getweigths() min_error_counter = counter print( f"Minimum error found = {min_error}, at counter = {min_error_counter}", end="\r") except: pass Delta_w = [] for ws in range(len(Dws[0])): Delta_w.append( sum( [Dws[pattern][ws] for pattern in range(len(ins_outs))] ) ) set_Delta_weigths(Delta_w) updateweigths() setweigths(optimal_w) print(f"\vMinimum error reached at the {min_error_counter}st cycle") if plot: plt.plot(np.arange(len(ERROR)), ERROR, "b*-") plt.xlabel("Number of cycles") plt.ylabel("Sum of quadratic errors") plt.title("BATCH MODE:\nERROR vs CYCLES") plt.grid() plt.show() def test(inputs, outputs, plot=False, tolerance=1e-4): print("-"*10, "BEGINNING OF THE TEST", "-"*10) ins_outs = list(zip(inputs, outputs)) output_obtained = [] errors = [] successes, failures = 0, 0 for io in ins_outs: i, o = io error2(i, o) errors.append(layers[-1]["error2"].item()) output_obtained.append(layers[-1]["v"].flatten().tolist()) if errors[-1] < tolerance: successes += 1 else: failures += 1 if plot: plt.plot(np.arange(len(errors)), errors, "b*-") plt.xlabel("pattern to test") plt.ylabel("Sum of quadratic errors") plt.title("ERROR vs PATTERN") plt.grid() plt.show() mean = sum(errors)/len(errors) print(f"TEST SAYS: Mean square error is {mean}.") print("TEST STATISTICS: \ttolerance is", tolerance) print("\033[94mSuccesses:\t{:8d},\t {:.2f}%".format( successes, 100*successes/len(ins_outs))) print("\033[91mFailures:\t{:8d},\t {:.2f}%\033[m".format( failures, 100*failures/len(ins_outs))) print("\033[95mThe mean of quadratic error is {:.6g}.\033[m".format(mean)) print("Quadratic errors:\n", errors, "\n") print("Outputs:\n", output_obtained, "\n") print("-"*10, "END OF THE TEST", "-"*10) return errors, mean def save(filename): W = getweigths() file = open(filename, "w") file.write("import numpy as np\n\n") file.write("weigths = [\n") for w in W: file.write("np.") file.write(w.__repr__()+",\n") file.write("]\n\n") file.close()
21,787
738a63bd37055b13caebd6e21b74228018586093
# -*- coding: utf-8 -*- """ Created on Wed Jun 17 12:12:14 2015 @author: Meredith """
21,788
27ad5db6d2358edfda5f7ff81155978f023dc6d6
import os from flask import Flask from flask_sqlalchemy import SQLAlchemy from flask_migrate import Migrate app = Flask(__name__) app.config['SECRET_KEY'] = 'aisehi' basedir = os.path.abspath(os.path.dirname(__file__)) app.config['SQLALCHEMY_DATABASE_URI'] = 'sqlite:///'+os.path.join(basedir,'data.sqlite') app.config['SQLALCHEMY_TRACK_MODIFICATIONS'] = False db = SQLAlchemy(app) Migrate(app,db) from my_project.pokemons.views import pokemon_blueprint from my_project.trainers.views import trainer_blueprint from my_project.matches.views import match_blueprint app.register_blueprint(pokemon_blueprint,url_prefix='/pokemons') app.register_blueprint(trainer_blueprint,url_prefix='/trainers') app.register_blueprint(match_blueprint,url_prefix='/matches')
21,789
31ec22a2b8ddcb5a630718f25f36119b2b908f7f
#-*- coding: euc-kr -*- import maya.cmds as cmds def addCustomAttribute(main_=None): if main_ is None: main_ = cmds.ls(sl=1) else: main_ = cmds.ls(main_) for x in main_: name_ = '.Add__Ctr__' if cmds.objExists(x+name_)== False: cmds.addAttr (x, ln = 'Add__Ctr__' ,nn = "Add__Ctr__",at = "enum",en = "___________:") cmds.setAttr (x+name_,e=1,keyable = 1) cmds.setAttr (x+name_,lock = 1) else: cmds.setAttr ('%s.Add__Ctr__'%x,e=1,keyable = 1) def makeOwnGRP(lonelyNode, style='Pos'): if type(lonelyNode) == list: lonelyNode = lonelyNode[0] cmds.select(cl=True) if style == 'Pos': grp = cmds.group(em=True, n=lonelyNode+'_Pos') elif style == 'GRP': grp = cmds.group(em=True, n=lonelyNode+'_GRP') cmds.select(lonelyNode, r=1) cmds.select(grp, add=1) cmds.delete(cmds.parentConstraint(mo=0, sr="none", st="none")) cmds.parent(lonelyNode, grp) return grp def getRoot(nodType, sel=None): if sel is None: cmds.select(sl=True, r=True) else: cmds.select(sel, r=True) sel = cmds.ls(sl=True, l=True)[0].split('|') cmds.select(cl=True) for i, j in enumerate(sel): if cmds.nodeType(sel[i+1]) == str(nodType): root = sel[i+1] return root def controllerColor(ctrl, color): if type(ctrl) == list: ctrl = ctrl[0] colorSet = {'yellow':17, 'red':13, 'default':5, 'pink':9, 'white':16, 'blue':6} color = colorSet.get(color, 'darkblue') cmds.setAttr("{0}.overrideEnabled".format(ctrl), True) cmds.setAttr("{0}.overrideColor".format(ctrl), color) def makeController(selec, parent=False, shape='circle', addName=None, scale=1, newName=None, pointConst=False, normalPlane='yz'): ctrlList = [] if selec is None: selec = cmds.ls(sl=True) if type(selec) != list: selec = selec.split() for j in range(len(selec)): #if name is None: if '_joint' in selec[j]: name = selec[j].replace('_joint', '') if '_end' in name: name = name.replace('_end', '') else: name = selec[j] if addName != None: name = name + addName if newName != None: name = newName if normalPlane == 'yz': normalPlane = (1, 0, 0) elif normalPlane == 'xz': normalPlane = (0, 1, 0) elif normalPlane == 'xy': normalPlane = (0, 0, 1) if shape == 'circle': ctrl = cmds.circle(nr=normalPlane, c=(0, 0, 0), r=2, n=name+'_ctrl') elif shape=='star': ctrl = cmds.circle(nr=normalPlane, c=(0, 0, 0), r=2, n=name+'_ctrl') cmds.select(cl=True) for i in [1, 3, 5, 7]: cmds.select(ctrl[0]+'.cv['+str(i)+']', add=True) cmds.scale(2, 2, 2, r=True, ocp=True) elif shape=='cube': ctrl = cmds.curve(d=1, p=[(0.5, 0.5, 0.5), (0.5, 0.5, -0.5), (-0.5, 0.5, -0.5), (-0.5, 0.5, 0.5), (0.5, 0.5, 0.5), (0.5, -0.5, 0.5), (0.5, -0.5, -0.5), (0.5, 0.5, -0.5), (-0.5, 0.5, -0.5), (-0.5, -0.5, -0.5), (0.5, -0.5, -0.5), (0.5, -0.5, 0.5), (-0.5, -0.5, 0.5), (-0.5, 0.5, 0.5), (-0.5, 0.5, -0.5), (-0.5, -0.5, -0.5), (-0.5, -0.5, 0.5)], k=[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], n=name+'_ctrl') elif shape=='cross': ctrl = cmds.curve(d=1, p=[(-0.0959835, 0, -0.751175), (-0.0959835, 0, -0.0987656), (-0.751175, 0, -0.0987656), (-0.751175, 0, -0.336638), (-1.001567, 0, 0), (-0.751175, 0, 0.336638), (-0.751175, 0, 0.0987656), (-0.0959835, 0, 0.0987656), (-0.0959835, 0, 0.751175), (-0.336638, 0, 0.751175), (0, 0, 1.001567), (0.336638, 0, 0.751175), (0.0959835, 0, 0.751175), (0.0959835, 0, 0.0987656), (0.751175, 0, 0.0987656), (0.751175, 0, 0.336638), (1.001567, 0, 0), (0.751175, 0, -0.336638), (0.751175, 0, -0.0987656), (0.0959835, 0, -0.0987656), (0.0959835, 0, -0.751175), (0.336638, 0, -0.751175), (0, 0, -1.001567), (-0.336638, 0, -0.751175), (-0.0959835, 0, -0.751175)], k=[0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24], n=name+'_ctrl') if scale != 1: cmds.select(cl=True) if type(ctrl) != list: ctrl = ctrl.split() spans = cmds.getAttr(ctrl[0]+'.spans') if shape=='cube' or shape=='cross': spans += 1 for i in range(spans): cmds.select(ctrl[0]+'.cv['+str(i)+']', add=True) cmds.scale(scale, scale, scale, r=True, ocp=True) cmds.select(cl=True) posGrp = cmds.group(ctrl, n=name+'_Pos') cmds.group(ctrl, n=name+'_Const') if pointConst is True: cmds.delete(cmds.pointConstraint(selec[j], posGrp)) else: cmds.delete(cmds.parentConstraint(selec[j], posGrp)) if parent is True: cmds.parent(selec[j], ctrl[0]) ctrlList.append(ctrl[0]) return ctrlList def aligner(driven, driver, Const=False): cmds.select(driver, r=1) cmds.select(driven, add=1) if Const == 'parent': cmds.delete(cmds.parentConstraint(mo=False, sr="none", st="none")) elif Const == 'orient': cmds.delete(cmds.orientConstraint(mo=False)) elif Const == 'point': cmds.delete(cmds.pointConstraint(mo=False)) def limbsSetUp(initialSelec): #++ functions ++# def makeIKRibbon(selectedName): rollNamingFirst = '_roll_1_skin_joint' rollNamingEnd = '_roll_end_joint' selecRollFirst = selectedName+rollNamingFirst selecRollEnd = selectedName+rollNamingEnd if cmds.objExists('spik_GRP') is False: spikGRP = cmds.group(empty=True, w=True, n='spik_GRP') else: spikGRP = cmds.ls('spik_GRP')[0] #!!!!!!!!! sideName = selectedName if selectedName.split('_')[0] == 'shoulder': sideName = sideName.replace('shoulder', 'arm') elif selectedName.split('_')[0] == 'elbow': sideName = sideName.replace('elbow', 'arm') elif selectedName.split('_')[0] == 'thigh': sideName = sideName.replace('thigh', 'leg') elif selectedName.split('_')[0] == 'knee': sideName = sideName.replace('knee', 'leg') sideName = sideName.replace('_joint', '') #!!!!!!!!! spikHandle = cmds.ikHandle(sj=selecRollFirst, ee=selecRollEnd, sol='ikSplineSolver', pcv=False, ns=4, n=selectedName + '_spik_handle') spikCRV = selectedName+'_spik_curve' cmds.rename('curve1', spikCRV) curvePoint = cmds.pointOnCurve(spikCRV, p=True) jointNum = 1 spikJNTList = [] for i in range(7): spikJntPos = cmds.pointPosition(spikCRV+'.cv['+str(i)+']') cmds.select(cl=True) if i != 1 and i != 5: spikJNT = cmds.joint(p=spikJntPos, n=selectedName+'_spik_'+str(jointNum)+'_joint', rad=2) cmds.hide(spikJNT) if i == 6: aligner(spikJNT, selecRollEnd, Const='orient') else: aligner(spikJNT, selecRollFirst, Const='orient') cmds.makeIdentity(spikJNT, apply=True, t=0, r=1, s=0, n=1, pn=1) spikJNTList.append(spikJNT) jointNum += 1 cmds.select(spikJNTList, r=True) cmds.select(spikCRV, add=True) cmds.skinCluster(tsb=True, dr=4.0) spikCtrlList = makeController(spikJNTList, parent=True, ) crvInfoNode = cmds.createNode('curveInfo', n=spikCRV+'_crvINFO') cmds.connectAttr(spikCRV+'.worldSpace[0]', crvInfoNode+'.inputCurve') mdNode1 = cmds.createNode('multiplyDivide', n=spikCRV+'_MD1') cmds.setAttr(mdNode1+'.operation', 2) mdNode2 = cmds.createNode('multiplyDivide', n=spikCRV+'_MD2') cmds.setAttr(mdNode2+'.operation', 2) crvLength = cmds.getAttr(crvInfoNode+'.arcLength') cmds.setAttr(mdNode2+'.input2X', crvLength) cmds.connectAttr(crvInfoNode+'.arcLength', mdNode1+'.input1X') cmds.connectAttr(mdNode1+'.outputX', mdNode2+'.input1X') rollList = cmds.listRelatives(selecRollFirst, c=True, ad=True, type='joint') list.reverse(rollList) rollList.insert(0, selecRollFirst) for i in range(len(rollList)): cmds.connectAttr(mdNode2+'.outputX', rollList[i]+'.scaleX') val1 = 0.75 val2 = 0.25 for i in range(1,4): cmds.select(spikCtrlList[0], r=True) cmds.select(spikCtrlList[-1], add=True) ctrlConst = cmds.listRelatives(spikCtrlList[i], parent=True)[0] cmds.select(ctrlConst, add=True) cmds.pointConstraint(mo=False, weight=1) cmds.setAttr(ctrlConst+'_pointConstraint1.'+spikCtrlList[0]+'W0', val1) cmds.setAttr(ctrlConst+'_pointConstraint1.'+spikCtrlList[-1]+'W1', val2) val1 -= 0.25 val2 += 0.25 rotJNT1 = cmds.duplicate(rollList[0], po=True, n=selectedName+'_rot_1_ik_joint') rotJNT2 = cmds.duplicate(rollList[-1], po=True, n=selectedName+'_rot_2_ik_joint') cmds.parent(rotJNT1, w=True) cmds.parent(rotJNT2, rotJNT1) rotSCik = cmds.ikHandle(sj=rotJNT1[0], ee=rotJNT2[0], sol='ikSCsolver', n=selectedName + '_rot_SCik_handle') cmds.parent(selectedName + '_rot_SCik_handle', spikCtrlList[-1]) rotGRP = cmds.group(empty=True, n=selectedName+'_rot_GRP', w=True) aligner(rotGRP, spikCtrlList[0], Const='parent') for i in range(1,4): spikCtrlPos = cmds.listRelatives(cmds.listRelatives(spikCtrlList[i], ap=True, p=True), p=True) cmds.parent(spikCtrlPos, rotGRP) cmds.select(rotJNT1, r=True) cmds.select(rotGRP, add=True) cmds.orientConstraint(mo=True) cmds.parent(rotJNT1, spikCtrlList[0]) cmds.hide(rotJNT1) cmds.hide(rotSCik) cmds.hide(spikHandle[0]) #!!!!!!!!! if cmds.objExists(sideName+'_spik_GRP') is False: sidespikGRP = cmds.group(empty=True, w=True, n=sideName+'_spik_GRP') else: sidespikGRP = cmds.ls(sideName+'_spik_GRP')[0] #!!!!!!!!! selectedspikGRP = cmds.group(empty=True, w=True, n=selectedName+'_spik_GRP') cmds.parent(spikHandle[0], spikCRV, selectedspikGRP) cmds.parent(selectedspikGRP, sidespikGRP) return spikCtrlList #++ MAIN ++# print(initialSelec) side = initialSelec.split('_')[1] selecFirst = initialSelec selecSecond = (cmds.listRelatives(selecFirst, c=True))[0] selecThird = (cmds.listRelatives(selecSecond, c=True))[0] #* make IK set dup = cmds.duplicate(initialSelec, renameChildren=True, n=initialSelec.replace('_joint', '_IK_joint')) cmds.rename(dup[1], dup[1].replace('_joint1', '_IK_joint')) cmds.rename(dup[2], dup[2].replace('_joint1', '_IK_joint')) #* make FK set dup = cmds.duplicate(initialSelec, renameChildren=True, n=initialSelec.replace('_joint', '_FK_joint')) cmds.rename(dup[1], dup[1].replace('_joint1', '_FK_joint')) cmds.rename(dup[2], dup[2].replace('_joint1', '_FK_joint')) selectedIKFirst = initialSelec.replace('_joint', '_IK_joint') selectedIKMiddle = (cmds.listRelatives(selectedIKFirst, c=True))[0] selectedIKLast = (cmds.listRelatives(selectedIKMiddle, c=True))[0] selectedFKFirst = initialSelec.replace('_joint', '_FK_joint') selectedFKMiddle = (cmds.listRelatives(selectedFKFirst, c=True))[0] selectedFKLast = (cmds.listRelatives(selectedFKMiddle, c=True))[0] selectedName1 = selecFirst.replace('_joint', '') ribbonCtrls1 = makeIKRibbon(selectedName1) selectedName2 = selecSecond.replace('_joint', '') ribbonCtrls2 = makeIKRibbon(selectedName2) selectedName3 = selecThird.replace('_joint', '') #++ get Side GRP name ++# sideGRPName = initialSelec if initialSelec.split('_')[0] == 'shoulder': sideGRPName = sideGRPName.replace('shoulder', 'arm') elif initialSelec.split('_')[0] == 'thigh': sideGRPName = sideGRPName.replace('thigh', 'leg') sideGRPName = sideGRPName.replace('_joint', '') #++ initial classify +## rollShoulderGRP = makeOwnGRP(selectedName1+'_roll_1_skin_joint', style='GRP') rollElbowGRP = makeOwnGRP(selectedName2+'_roll_1_skin_joint', style='GRP') skinJointGRP = cmds.group(empty=True, p='joint_GRP', n=sideGRPName+'_joint_GRP') # cmds.parent(rollShoulderGRP, rollElbowGRP, skinJointGRP) if cmds.objExists('global_GRP') is False: globalGRP = cmds.group(empty=True, w=True, n='global_GRP') else: globalGRP = cmds.ls('global_GRP')[0] if cmds.objExists('Extras') is False: extras = cmds.group(empty=True, w=True, n='Extras') else: extras = cmds.ls('Extras')[0] #!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! cmds.select(cl=True) cmds.select(globalGRP, hi=True) check = cmds.ls(sl=True) if ('joint_GRP' in check) is False: cmds.parent('joint_GRP', globalGRP) cmds.parent('spik_GRP', extras) #!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! #++ func ELbow Lock ++# upCtrlPosLast = selecFirst.replace('_joint', '_spik_5_Pos') lowCtrlPosFirst = selecSecond.replace('_joint', '_spik_1_Pos') lockGRP = cmds.group(empty=True, n=selectedName2+'_lock_ctrl_GRP') aligner(lockGRP, lowCtrlPosFirst, Const='parent') lockCtrl = makeController(lockGRP, shape='star') cmds.parent(upCtrlPosLast, lowCtrlPosFirst, lockGRP) # cmds.delete(lockGRP) addCustomAttribute(lockCtrl) cmds.addAttr(lockCtrl, ln='Sub_Controller_Visibility', nn="Sub Controller Visibility", at="enum", en="Off:On") cmds.setAttr(lockCtrl[0]+'.Sub_Controller_Visibility', e=1, keyable=1) cmds.connectAttr(lockCtrl[0]+'.Sub_Controller_Visibility', ribbonCtrls1[-1]+'.visibility') cmds.connectAttr(lockCtrl[0]+'.Sub_Controller_Visibility', ribbonCtrls2[0]+'.visibility') # cmds.parentConstraint(lockCtrl[0], lockGRP, mo=True) #++ Follow Codes Belongs Main ++# lockCtrlPos = getRoot(nodType='transform', sel=lockCtrl) cmds.parentConstraint(selectedIKMiddle, lockCtrlPos, mo=True) cmds.parentConstraint(selectedIKFirst, getRoot(nodType='transform', sel=ribbonCtrls1[0])) cmds.parentConstraint(selectedIKLast, getRoot(nodType='transform', sel=ribbonCtrls2[-1])) #:: Main classify ::# sideIKGRP = cmds.group(empty=True, w=True, n=sideGRPName+'_IK_GRP') ribbonCtrlPos1 = getRoot(nodType='transform', sel=ribbonCtrls1[0]) ribbonCtrlPos2 = getRoot(nodType='transform', sel=ribbonCtrls1[1]) ribbonCtrlPos4 = getRoot(nodType='transform', sel=ribbonCtrls2[-2]) ribbonCtrlPos5 = getRoot(nodType='transform', sel=ribbonCtrls2[-1]) sideBendctrlGRP = cmds.group(empty=True, w=True, n=sideGRPName+'_bend_ctrl_GRP') cmds.parent(ribbonCtrlPos2, ribbonCtrlPos4, sideBendctrlGRP) #++ Make IK controller ++# wristIKsubCtrl = makeController(selectedIKLast, shape='star', addName='_sub', scale=0.8) wristIKmainCtrl = makeController(selectedIKLast, shape='star', addName='_main', scale=1.1) cmds.parent(getRoot(sel=wristIKsubCtrl, nodType='transform'), wristIKmainCtrl) shoulderIKCtrl = makeController(selectedIKFirst, shape='star') rpIKHandle = cmds.ikHandle(sj=selectedIKFirst, ee=selectedIKLast, sol='ikRPsolver', n=selectedName1+'_IK_handle') cmds.parent(rpIKHandle[0], wristIKsubCtrl) cmds.hide(rpIKHandle) controllerColor(shoulderIKCtrl, 'red') controllerColor(wristIKmainCtrl, 'red') controllerColor(wristIKsubCtrl, 'red') cmds.parent(getRoot(sel=wristIKmainCtrl, nodType='transform'), sideIKGRP) cmds.parent(getRoot(sel=shoulderIKCtrl, nodType='transform'), sideIKGRP) #++ make FK Controllers ++# shoulderFKctrl = makeController(selectedFKFirst, scale=1.2) controllerColor(shoulderFKctrl, 'yellow') shoulderFKctrlPos = getRoot(sel=shoulderFKctrl, nodType='transform') addCustomAttribute(shoulderFKctrl) cmds.addAttr(shoulderFKctrl, ln='stretch', nn='stretch', at='float', minValue=0, defaultValue=1) cmds.setAttr(shoulderFKctrl[0]+'.stretch', e=1, keyable=1) elbowFKctrl = makeController(selectedFKMiddle, scale=1.2) controllerColor(elbowFKctrl, 'yellow') elbowFKctrlPos = getRoot(sel=elbowFKctrl, nodType='transform') addCustomAttribute(elbowFKctrl) cmds.addAttr(elbowFKctrl, ln='stretch', nn='stretch', at='float', minValue=0, defaultValue=1) cmds.setAttr(elbowFKctrl[0]+'.stretch', e=1, keyable=1) wristFKctrl = makeController(selectedFKLast, scale=1.2) controllerColor(wristFKctrl, 'yellow') wristFKctrlPos = getRoot(sel=wristFKctrl, nodType='transform') sideFKGRP = cmds.group(empty=True, w=True, n=sideGRPName+'_FK_GRP') cmds.parent(shoulderFKctrlPos, elbowFKctrlPos, wristFKctrlPos, sideFKGRP) #++ make fk connections ++# cmds.parentConstraint(selectedFKMiddle, lockCtrlPos, mo=True) cmds.parentConstraint(selectedFKLast, ribbonCtrlPos5, mo=True) cmds.parentConstraint(selectedFKFirst, ribbonCtrlPos1, mo=True) cmds.parentConstraint(selectedIKMiddle, rollElbowGRP, mo=True) cmds.parentConstraint(selectedFKMiddle, rollElbowGRP, mo=True) cmds.parentConstraint(shoulderFKctrl, selectedFKFirst, mo=True) cmds.orientConstraint(elbowFKctrl, selectedFKMiddle) cmds.pointConstraint(selectedFKLast, cmds.listRelatives(wristFKctrl, p=True)[0], mo=True) cmds.pointConstraint(selectedFKMiddle, cmds.listRelatives(elbowFKctrl, p=True)[0]) #* fk shoulder controller drives elbow controller GRP by orient Constraining cmds.orientConstraint(shoulderFKctrl, cmds.listRelatives(elbowFKctrl, p=True)[0], mo=True) cmds.orientConstraint(elbowFKctrl, cmds.listRelatives(wristFKctrl, p=True)[0], mo=True) #* fk shoulder and elbow stretch connections cmds.connectAttr(shoulderFKctrl[0]+'.stretch', selectedFKFirst+'.scaleX') cmds.connectAttr(elbowFKctrl[0]+'.stretch', selectedFKMiddle+'.scaleX') #++ hands and finger setUp ++# wristRootJNT = selectedName3+'_root_joint' wristRootGRP = makeOwnGRP(wristRootJNT, style='GRP') cmds.parent(wristRootGRP, 'joint_GRP') cmds.pointConstraint(selectedIKLast, wristRootGRP, mo=True) cmds.pointConstraint(selectedFKLast, wristRootGRP, mo=True) #++ Set Orientation Buffer Locators ++# ikWristLoc = cmds.spaceLocator(n=selectedName3+'_ik_loc') aligner(ikWristLoc, wristIKsubCtrl, Const='parent') cmds.parent(ikWristLoc, wristIKsubCtrl) fkWristLoc = cmds.spaceLocator(n=selectedName3+'_fk_loc') aligner(fkWristLoc, wristFKctrl, Const='parent') cmds.parent(fkWristLoc, wristFKctrl) cmds.orientConstraint(ikWristLoc, fkWristLoc, wristRootGRP, mo=True) #++ pole Vector Controller ++# polVecCtrl = makeController(selectedIKMiddle, addName='_poleVector', shape='cube', scale=1.1) controllerColor(polVecCtrl, 'pink') poleVecPoly = cmds.polyCreateFacet(p=[cmds.xform(selectedIKFirst, q=True, t=True, ws=True), cmds.xform(selectedIKMiddle, q=True, t=True, ws=True), cmds.xform(selectedIKLast, q=True, t=True, ws=True)], ch=True, tx=1, n='poleVecPoly') cmds.select(cl=True) poleVtx = '{0}.vtx[1]'.format(poleVecPoly[0]) poleVecPos = getRoot(sel=polVecCtrl, nodType='transform') cmds.normalConstraint(poleVtx, poleVecPos) cmds.delete(poleVecPoly) cmds.poleVectorConstraint(polVecCtrl, rpIKHandle[0]) cmds.parent(poleVecPos, sideIKGRP) def fingerSetUp(side, sidectrlGRP): #++ make FK finger Controllers ++# fingerFKJNTLists = cmds.ls('finger_*'+side+'*_FK_joint', type='joint') fingerFKJNTLists = list(filter(lambda x: 'end' not in x, fingerFKJNTLists)) #* or -> [f for f in fingerFKJNTLists if '_end_' not in f] fingerAllCtrlLists = makeController(selec=fingerFKJNTLists, scale=0.3) for i in fingerAllCtrlLists: controllerColor(i, 'yellow') for i in range(len(fingerFKJNTLists)): cmds.parentConstraint(fingerAllCtrlLists[i], fingerFKJNTLists[i], mo=True) #* separate finger Controller Lists by 3 then make child the later(-1) to the former(-2) fingerCtrlLists = list(filter(lambda x: 'root' not in x and '0' not in x, fingerAllCtrlLists)) fingerCtrlLists = [fingerCtrlLists[f:f+3] for f in range(0, len(fingerCtrlLists), 3)] cmds.parent(getRoot(sel=fingerCtrlLists[0][-1], nodType='transform'), fingerCtrlLists[0][-2]) cmds.parent(getRoot(sel=fingerCtrlLists[0][-2], nodType='transform'), fingerCtrlLists[0][-3]) cmds.parent(getRoot(sel=fingerCtrlLists[1][-1], nodType='transform'), fingerCtrlLists[1][-2]) cmds.parent(getRoot(sel=fingerCtrlLists[1][-2], nodType='transform'), fingerCtrlLists[1][-3]) cmds.parent(getRoot(sel=fingerCtrlLists[2][-1], nodType='transform'), fingerCtrlLists[2][-2]) cmds.parent(getRoot(sel=fingerCtrlLists[2][-2], nodType='transform'), fingerCtrlLists[2][-3]) cmds.parent(getRoot(sel=fingerCtrlLists[3][-1], nodType='transform'), fingerCtrlLists[3][-2]) cmds.parent(getRoot(sel=fingerCtrlLists[3][-2], nodType='transform'), fingerCtrlLists[3][-3]) cmds.parent(getRoot(sel=fingerCtrlLists[4][-1], nodType='transform'), fingerCtrlLists[4][-2]) # cmds.parent(getRoot(sel=fingerCtrlLists[4][-2], nodType='transform'), fingerCtrlLists[4][-3]) if filter(lambda x: '0' in x, fingerAllCtrlLists) is not 0: #fingerAllCtrlLists = [fingerAllCtrlLists[f:f+4] for f in range(0, len(fingerAllCtrlLists), 4)] cmds.parent(getRoot(sel=fingerCtrlLists[0][-3], nodType='transform'), fingerAllCtrlLists[0]) cmds.parent(getRoot(sel=fingerCtrlLists[1][-3], nodType='transform'), fingerAllCtrlLists[4]) cmds.parent(getRoot(sel=fingerCtrlLists[2][-3], nodType='transform'), fingerAllCtrlLists[8]) cmds.parent(getRoot(sel=fingerCtrlLists[3][-3], nodType='transform'), fingerAllCtrlLists[13]) cmds.parent(getRoot(sel=fingerCtrlLists[4][-2], nodType='transform'), fingerAllCtrlLists[18]) if filter(lambda x: 'root' in x, fingerAllCtrlLists) is not 0: cmds.parent(getRoot(sel=fingerAllCtrlLists[8], nodType='transform'), fingerAllCtrlLists[12]) cmds.parent(getRoot(sel=fingerAllCtrlLists[13], nodType='transform'), fingerAllCtrlLists[17]) cmds.parent(getRoot(sel=fingerAllCtrlLists[12], nodType='transform'), fingerAllCtrlLists[17]) fingerFKctrlGRP = cmds.group(empty=True, w=True, n='finger_FK_ctrl_GRP') aligner(fingerFKctrlGRP, wristRootJNT, Const='parent') if cmds.objExists('finger_'+side+'_ctrl_GRP') is False: fingerCtrlGRP = cmds.group(empty=True, w=True, n='finger_'+side+'_ctrl_GRP') aligner(fingerCtrlGRP, wristRootJNT, Const='parent') else: fingerCtrlGRP = cmds.ls('finger_'+side+'_ctrl_GRP')[0] cmds.parent(getRoot(sel=fingerCtrlLists[0][0], nodType='transform'), fingerFKctrlGRP) cmds.parent(getRoot(sel=fingerCtrlLists[1][0], nodType='transform'), fingerFKctrlGRP) cmds.parent(getRoot(sel=fingerCtrlLists[2][0], nodType='transform'), fingerFKctrlGRP) # cmds.parent(getRoot(sel=fingerCtrlLists[3][0], nodType='transform'), fingerFKctrlGRP) cmds.parent(getRoot(sel=fingerCtrlLists[4][0], nodType='transform'), fingerFKctrlGRP) cmds.parent(fingerFKctrlGRP, fingerCtrlGRP) cmds.parentConstraint(wristRootJNT, fingerCtrlGRP, mo=True) #++ make IK finger Controllers ++# fingerIKJNTLists = cmds.ls('finger_*'+side+'*_IK_joint', type='joint') fingerIKJNTLists = [f for f in fingerIKJNTLists if '_0_' not in f] fingerIKJNTLists = [fingerIKJNTLists[f:f+4] for f in range(0, len(fingerIKJNTLists), 4)] fingerIKhandle1 = cmds.ikHandle(sj=fingerIKJNTLists[0][0], ee=fingerIKJNTLists[0][-1], solver='ikSCsolver', n=fingerIKJNTLists[0][0].split('_')[1]+side+'_IK_handle') fingerIKhandle2 = cmds.ikHandle(sj=fingerIKJNTLists[1][0], ee=fingerIKJNTLists[1][-1], solver='ikSCsolver', n=fingerIKJNTLists[1][0].split('_')[1]+side+'_IK_handle') fingerIKhandle3 = cmds.ikHandle(sj=fingerIKJNTLists[2][0], ee=fingerIKJNTLists[2][-1], solver='ikSCsolver', n=fingerIKJNTLists[2][0].split('_')[1]+side+'_IK_handle') fingerIKhandle4 = cmds.ikHandle(sj=fingerIKJNTLists[3][0], ee=fingerIKJNTLists[3][-1], solver='ikSCsolver', n=fingerIKJNTLists[3][0].split('_')[1]+side+'_IK_handle') fingerIKhandle5 = cmds.ikHandle(sj=fingerIKJNTLists[4][0], ee=fingerIKJNTLists[4][-1], solver='ikSCsolver', n=fingerIKJNTLists[4][0].split('_')[1]+side+'_IK_handle') cmds.hide(fingerIKhandle1[0]) cmds.hide(fingerIKhandle2[0]) cmds.hide(fingerIKhandle3[0]) cmds.hide(fingerIKhandle4[0]) cmds.hide(fingerIKhandle5[0]) for i in range(0, 5): for j in range(len(fingerIKJNTLists[i])-1): cmds.connectAttr(fingerIKJNTLists[i][j]+'.rotate', cmds.listRelatives(fingerCtrlLists[i][j], p=True)[0]+'.rotate') fingerIKctrl1 = makeController(fingerIKJNTLists[0][-1], shape='cube', scale=0.6) controllerColor(fingerIKctrl1, 'red') fingerIKctrl2 = makeController(fingerIKJNTLists[1][-1], shape='cube', scale=0.6) controllerColor(fingerIKctrl2, 'red') fingerIKctrl3 = makeController(fingerIKJNTLists[2][-1], shape='cube', scale=0.6) controllerColor(fingerIKctrl3, 'red') fingerIKctrl4 = makeController(fingerIKJNTLists[3][-1], shape='cube', scale=0.6) controllerColor(fingerIKctrl4, 'red') fingerIKctrl5 = makeController(fingerIKJNTLists[4][-1], shape='cube', scale=0.6) controllerColor(fingerIKctrl5, 'red') cmds.parent(fingerIKhandle1[0], fingerIKctrl1) cmds.parent(fingerIKhandle2[0], fingerIKctrl2) cmds.parent(fingerIKhandle3[0], fingerIKctrl3) cmds.parent(fingerIKhandle4[0], fingerIKctrl4) cmds.parent(fingerIKhandle5[0], fingerIKctrl5) fingerIKctrlGRP = cmds.group(empty=True, w=True, n='finger_IK_ctrl_GRP') aligner(fingerIKctrlGRP, wristRootJNT, Const='parent') cmds.parent(getRoot(sel=fingerIKctrl1[0], nodType='transform'), fingerIKctrlGRP) cmds.parent(getRoot(sel=fingerIKctrl2[0], nodType='transform'), fingerIKctrlGRP) cmds.parent(getRoot(sel=fingerIKctrl3[0], nodType='transform'), fingerIKctrlGRP) cmds.parent(getRoot(sel=fingerIKctrl4[0], nodType='transform'), fingerIKctrlGRP) cmds.parent(getRoot(sel=fingerIKctrl5[0], nodType='transform'), fingerIKctrlGRP) cmds.parent(fingerIKctrlGRP, fingerCtrlGRP) cmds.parent(fingerCtrlGRP, sidectrlGRP) #++ make Twist SetUp ++# twistJNT = cmds.duplicate(selecFirst, parentOnly=True, n=selectedName1+'_twist_joint') twistEndJNT = cmds.duplicate(selecSecond, parentOnly=True, n=selectedName1+'_twist_end_joint') twistRotJNT = cmds.duplicate(selecFirst, parentOnly=True, n=selectedName1+'_twist_rot_joint') cmds.parent(twistJNT, w=True) cmds.parent(twistEndJNT, twistJNT) upTwistJNTGRP = makeOwnGRP(twistJNT, style='GRP') upTwistikHandle = cmds.ikHandle(sj=twistJNT[0], ee=twistEndJNT[0], solver='ikRPsolver', n=twistJNT[0].replace('_joint', '_ik_handle')) upTwistikHandleGRP = makeOwnGRP(upTwistikHandle[0], style='GRP') cmds.setAttr(upTwistikHandle[0]+'.poleVectorX', 0) cmds.setAttr(upTwistikHandle[0]+'.poleVectorY', 0) cmds.setAttr(upTwistikHandle[0]+'.poleVectorZ', 0) cmds.pointConstraint(selectedIKFirst, upTwistJNTGRP, mo=True) cmds.pointConstraint(selectedFKFirst, upTwistJNTGRP, mo=True) cmds.pointConstraint(selectedIKMiddle, upTwistikHandleGRP, mo=True) cmds.pointConstraint(selectedFKMiddle, upTwistikHandleGRP, mo=True) cmds.parent(twistRotJNT, w=True) upTwistRotGRP = makeOwnGRP(twistRotJNT, style='GRP') cmds.parentConstraint(selectedIKFirst, upTwistRotGRP, mo=True) cmds.parentConstraint(selectedFKFirst, upTwistRotGRP, mo=True) cmds.orientConstraint(twistJNT, twistRotJNT, mo=True) uptwistMD = cmds.createNode('multiplyDivide', n=twistJNT[0]+'_MD') if side == 'R': cmds.setAttr(uptwistMD+'.input2X', 1) else: cmds.setAttr(uptwistMD+'.input2X', -1) cmds.connectAttr(twistRotJNT[0]+'.rotateX', uptwistMD+'.input1X') cmds.connectAttr(uptwistMD+'.outputX', selectedName1+'_spik_handle.twist') #* Make Wrist Twist SetUp from here wristTwistJNT = cmds.duplicate(wristRootJNT, po=True, n=wristRootJNT.replace('_root_joint', '_twist_root_joint')) wristTwistRotJNT = cmds.duplicate(wristRootJNT, po=True, n=wristRootJNT.replace('_root_joint', '_rot_joint')) wristTwistEndJNT = cmds.duplicate(wristRootJNT.replace('_root_joint', '_end_joint'), po=True, n=wristRootJNT.replace('_end_joint', '_twist_end_joint')) cmds.parent(wristTwistJNT, w=True) cmds.parent(wristTwistEndJNT, wristTwistJNT) lowTwistikHandle = cmds.ikHandle(sj=wristTwistJNT[0], ee=wristTwistEndJNT[0], solver='ikRPsolver', n=wristTwistJNT[0].replace('_root_joint', '_ik_handle')) cmds.setAttr(lowTwistikHandle[0]+'.poleVectorX', 0) cmds.setAttr(lowTwistikHandle[0]+'.poleVectorY', 0) cmds.setAttr(lowTwistikHandle[0]+'.poleVectorZ', 0) lowTwistikHandleGRP = makeOwnGRP(lowTwistikHandle[0], style='GRP') cmds.parentConstraint(wristIKsubCtrl, lowTwistikHandleGRP, mo=True) cmds.parentConstraint(wristFKctrl, lowTwistikHandleGRP, mo=True) wristTwistJNTGRP = makeOwnGRP(wristTwistJNT, style='GRP') wristTwistRotJNTGRP = makeOwnGRP(wristTwistRotJNT, style='GRP') cmds.pointConstraint(selectedIKLast, wristTwistJNTGRP, mo=True) cmds.pointConstraint(selectedFKLast, wristTwistJNTGRP, mo=True) cmds.parentConstraint(wristRootJNT, wristTwistRotJNTGRP, mo=True) cmds.orientConstraint(wristTwistJNT, wristTwistRotJNT, mo=True) lowtwistMD = cmds.createNode('multiplyDivide', n=wristTwistJNT[0]+'_MD') cmds.setAttr(lowtwistMD+'.input2X', -1) cmds.connectAttr(wristTwistRotJNT[0]+'.rotateX', lowtwistMD+'.input1X') cmds.connectAttr(lowtwistMD+'.outputX', selectedName2+'_spik_handle.twist') #* classify hierarchy and make lowArm fk controlls whole lowArmtwist System to prevent double transform upJNTsGRP = cmds.group(empty=True, w=True, n=selectedName1+'_joint_GRP') lowJNTsGRP = cmds.group(empty=True, w=True, n=selectedName2+'_joint_GRP') aligner(lowJNTsGRP, selectedFKMiddle, Const='parent') cmds.parent(upTwistJNTGRP, upJNTsGRP) cmds.parent(upTwistRotGRP, upJNTsGRP) cmds.parent(rollShoulderGRP, upJNTsGRP) cmds.parent(rollElbowGRP, lowJNTsGRP) cmds.parent(wristTwistJNTGRP, lowJNTsGRP) cmds.parent(wristRootGRP, lowJNTsGRP) cmds.parent(wristTwistRotJNTGRP, lowJNTsGRP) cmds.parent(upJNTsGRP, skinJointGRP) cmds.parent(lowJNTsGRP, skinJointGRP) cmds.parentConstraint(selectedIKMiddle, lowJNTsGRP, mo=True) cmds.parentConstraint(selectedFKMiddle, lowJNTsGRP, mo=True) #++ make ik fk Switcher ++# ikfkSwitcher = makeController(selectedIKLast, shape='cube', addName='_FK_switch', scale=1.1) addCustomAttribute(ikfkSwitcher) cmds.addAttr(ikfkSwitcher, ln='IKFK', nn="IKFK", at="float", maxValue=1, minValue=0) cmds.setAttr(ikfkSwitcher[0]+'.IKFK', e=1, keyable=1) controllerColor(ikfkSwitcher, 'white') IKFKswitchREV = cmds.createNode('reverse', n='IKFKswitchREV') cmds.connectAttr('{0}.IKFK'.format(ikfkSwitcher[0]), '{0}.inputX'.format(IKFKswitchREV)) #* ik - fk visibility cmds.connectAttr('{0}.outputX'.format(IKFKswitchREV), '{0}.visibility'.format(sideIKGRP)) cmds.connectAttr('{0}.outputX'.format(IKFKswitchREV), '{0}.visibility'.format(selectedIKFirst)) cmds.connectAttr('{0}.IKFK'.format(ikfkSwitcher[0]), '{0}.visibility'.format(sideFKGRP)) cmds.connectAttr('{0}.IKFK'.format(ikfkSwitcher[0]), '{0}.visibility'.format(selectedFKFirst)) #* ik connections cmds.connectAttr(IKFKswitchREV+'.outputX', ribbonCtrlPos1+'_parentConstraint1.'+selectedIKFirst+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', lockCtrlPos+'_parentConstraint1.'+selectedIKMiddle+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', ribbonCtrlPos5+'_parentConstraint1.'+selectedIKLast+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', rollElbowGRP+'_parentConstraint1.'+selectedIKMiddle+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', wristRootGRP+'_orientConstraint1.'+ikWristLoc[0]+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', wristRootGRP+'_pointConstraint1.'+selectedIKLast+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', lowJNTsGRP+'_parentConstraint1.'+selectedIKMiddle+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', wristTwistJNTGRP+'_pointConstraint1.'+selectedIKLast+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', lowTwistikHandleGRP+'_parentConstraint1.'+wristIKsubCtrl[0]+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', upTwistJNTGRP+'_pointConstraint1.'+selectedIKFirst+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', upTwistikHandleGRP+'_pointConstraint1.'+selectedIKMiddle+'W0') cmds.connectAttr(IKFKswitchREV+'.outputX', upTwistRotGRP+'_parentConstraint1.'+selectedIKFirst+'W0') #* fk connections cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', rollElbowGRP+'_parentConstraint1.'+selectedFKMiddle+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', ribbonCtrlPos1+'_parentConstraint1.'+selectedFKFirst+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', lockCtrlPos+'_parentConstraint1.'+selectedFKMiddle+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', ribbonCtrlPos5+'_parentConstraint1.'+selectedFKLast+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', wristRootGRP+'_orientConstraint1.'+fkWristLoc[0]+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', wristRootGRP+'_pointConstraint1.'+selectedFKLast+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', lowJNTsGRP+'_parentConstraint1.'+selectedFKMiddle+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', wristTwistJNTGRP+'_pointConstraint1.'+selectedFKLast+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', lowTwistikHandleGRP+'_parentConstraint1.'+wristFKctrl[0]+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', upTwistJNTGRP+'_pointConstraint1.'+selectedFKFirst+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', upTwistikHandleGRP+'_pointConstraint1.'+selectedFKMiddle+'W1') cmds.connectAttr(ikfkSwitcher[0]+'.IKFK', upTwistRotGRP+'_parentConstraint1.'+selectedFKFirst+'W1') #++ IK stretch SetUp ++# lenCRV = cmds.curve(d=1, p=[cmds.xform(selectedIKFirst, query=True, t=True, ws=True), cmds.xform(selectedIKMiddle, query=True, t=True, ws=True), cmds.xform(selectedIKLast, query=True, t=True, ws=True)], k=(0, 1, 2), n=selectedName1+'_arcLength_curve') cmds.select(clear=True) cmds.select(selectedIKFirst, r=True) cmds.select(selectedIKMiddle, selectedIKLast, add=True) cmds.select(lenCRV, add=True) arcLenSkinCluster = cmds.skinCluster(tsb=True, dr=4.0) cmds.skinPercent(arcLenSkinCluster[0], lenCRV+'.cv[0]', transformValue=[(selectedIKFirst, 1)]) cmds.skinPercent(arcLenSkinCluster[0], lenCRV+'.cv[1]', transformValue=[(selectedIKMiddle, 1)]) cmds.skinPercent(arcLenSkinCluster[0], lenCRV+'.cv[2]', transformValue=[(selectedIKLast, 1)]) arcLen = cmds.arclen(lenCRV) distanceNode = cmds.createNode('distanceBetween', n=selectedIKFirst+'_DIST') cmds.connectAttr(shoulderIKCtrl[0]+'.worldMatrix', distanceNode+'.inMatrix1') cmds.connectAttr(wristIKsubCtrl[0]+'.worldMatrix', distanceNode+'.inMatrix2') distanceMD = cmds.createNode('multiplyDivide', n='stretchIK_Dist_MD') cmds.setAttr(distanceMD+'.operation', 2) cmds.connectAttr(distanceNode+'.distance', distanceMD+'.input1X') distanceCOND = cmds.createNode('condition', n='stretchIK_Dist_COND') cmds.setAttr(distanceCOND+'.operation', 2) cmds.connectAttr(distanceMD+'.outputX', distanceCOND+'.firstTerm') cmds.connectAttr(distanceMD+'.outputX', distanceCOND+'.colorIfTrueR') cmds.setAttr(distanceCOND+'.secondTerm', arcLen) cmds.setAttr(distanceCOND+'.colorIfFalseR', arcLen) distanceMD2 = cmds.createNode('multiplyDivide', n='stretchIK_Dist_MD2') cmds.setAttr(distanceMD2+'.operation', 2) cmds.setAttr(distanceMD2+'.input2X', arcLen) cmds.delete(lenCRV) #* Add ik stretch OnOff Attribute to ik wrist Controller addCustomAttribute(wristIKmainCtrl) cmds.addAttr(wristIKmainCtrl[0], ln='Stretch_On_Off', nn="Stretch_On_Off", at="float", maxValue=1, minValue=0, defaultValue=0) cmds.addAttr(wristIKmainCtrl[0], ln='Up_Stretch', nn="Up_Stretch", at="float", minValue=0, defaultValue=1) cmds.addAttr(wristIKmainCtrl[0], ln='Low_Stretch', nn="Low_Stretch", at="float", minValue=0, defaultValue=1) cmds.setAttr(wristIKmainCtrl[0]+'.Stretch_On_Off', e=1, keyable=1) cmds.setAttr(wristIKmainCtrl[0]+'.Up_Stretch', e=1, keyable=1) cmds.setAttr(wristIKmainCtrl[0]+'.Low_Stretch', e=1, keyable=1) stretchBLND = cmds.createNode('blendColors', n='stretchIK_BLND') cmds.connectAttr(distanceCOND+'.outColorR', stretchBLND+'.color1R') cmds.setAttr(stretchBLND+'.color2R', arcLen) cmds.connectAttr(stretchBLND+'.outputR', distanceMD2+'.input1X') cmds.connectAttr(wristIKmainCtrl[0]+'.Stretch_On_Off', stretchBLND+'.blender') stretchUpMD = cmds.createNode('multiplyDivide', n='stretch_IK_Up_MD') stretchLowMD = cmds.createNode('multiplyDivide', n='stretch_IK_Low_MD') cmds.setAttr(stretchUpMD+'.operation', 1) cmds.setAttr(stretchLowMD+'.operation', 1) cmds.connectAttr(wristIKmainCtrl[0]+'.Up_Stretch', stretchUpMD+'.input1X') cmds.connectAttr(wristIKmainCtrl[0]+'.Low_Stretch', stretchLowMD+'.input1X') cmds.connectAttr(distanceMD2+'.outputX', stretchUpMD+'.input2X') cmds.connectAttr(distanceMD2+'.outputX', stretchLowMD+'.input2X') #* Now Connects to joint's scaleX cmds.connectAttr(stretchUpMD+'.outputX', selectedIKFirst+'.scaleX') cmds.connectAttr(stretchLowMD+'.outputX', selectedIKMiddle+'.scaleX') #* Add poleVector Twist Attribute addCustomAttribute(wristIKmainCtrl) cmds.addAttr(wristIKmainCtrl[0], ln='Twist', nn="Twist", at="float", defaultValue=0) cmds.setAttr(wristIKmainCtrl[0]+'.Twist', e=1, keyable=1) cmds.connectAttr(wristIKmainCtrl[0]+'.Twist', rpIKHandle[0]+'.twist') #++ later classify ++# if cmds.objExists('ctrl_GRP') is False: ctrlGRP = cmds.group(empty=True, w=True, n='ctrl_GRP') cmds.parent(ctrlGRP, globalGRP) else: ctrlGRP = cmds.ls('ctrl_GRP')[0] bendRootGRP = cmds.group(empty=True, w=True, n=sideGRPName+'_bend_root_GRP') sidectrlGRP = cmds.group(empty=True, w=True, n=sideGRPName+'_ctrl_GRP') sideTwistIKhandleGRP = cmds.group(empty=True, w=True, n=sideGRPName+'_twist_ik_handle_GRP') if cmds.objExists('twist_ik_handle_GRP') is False: twistIKhandleGRP = cmds.group(empty=True, w=True, n='twist_ik_handle_GRP') cmds.parent(twistIKhandleGRP, extras) else: twistIKhandleGRP = cmds.ls('twist_ik_handle_GRP')[0] if cmds.objExists('twist_ik_handle_GRP') is False: twistIKhandleGRP = cmds.group(empty=True, w=True, n='twist_ik_handle_GRP') cmds.parent(twistIKhandleGRP, extras) else: twistIKhandleGRP = cmds.ls('twist_ik_handle_GRP')[0] cmds.parent(sideGRPName+'_spik_GRP', 'spik_GRP') cmds.parent(lockGRP, lockCtrl) cmds.parent(ribbonCtrlPos5, ribbonCtrlPos1, bendRootGRP) cmds.parent(bendRootGRP, sideBendctrlGRP) cmds.parent(sideIKGRP, sideFKGRP, getRoot(nodType='transform', sel=ikfkSwitcher), sidectrlGRP) cmds.parent(sideBendctrlGRP, sidectrlGRP) cmds.parent(lockCtrlPos, sidectrlGRP) cmds.parent(sidectrlGRP, ctrlGRP) cmds.parent(upTwistikHandleGRP, sideTwistIKhandleGRP) cmds.parent(lowTwistikHandleGRP, sideTwistIKhandleGRP) cmds.parent(sideTwistIKhandleGRP, twistIKhandleGRP) #++ Do finger SetUp if finger exists ++# for i in cmds.listRelatives(wristRootJNT, children=True): if 'finger' == i.split('_')[0]: print('fingerGRP Found') fingerSetUp(side, sidectrlGRP) def doLimbsSetUp(): initialSelecList = cmds.ls(sl=True) for i in initialSelecList: limbsSetUp(i) #++ hide Extras ++# cmds.hide('Extras') def doSpineSetUp(): #++ Spine SetUp ++# waistJNTs = cmds.ls('waist_*') cmds.hide(waistJNTs) waistMidJNT = waistJNTs.pop(0) waistJNTs.insert(1, waistMidJNT) spineJNTs = cmds.ls('spine_*') chestJNTs = [f for f in cmds.ls('chest_*') if not '_IK_' in f] chestRootJNT = chestJNTs.pop(1) chestJNTs.insert(0, chestRootJNT) hipJNTs = cmds.ls('hip_*')[::-1] spineIKhandle = cmds.ikHandle(sj=spineJNTs[0], ee=spineJNTs[-1], sol='ikSplineSolver', pcv=False, ns=4, n='spine_spik_handle') spineIKCRV = cmds.rename(spineIKhandle[-1], 'spine_spik_curve') cmds.skinCluster(waistJNTs, spineIKCRV, toSelectedBones=True, dropoffRate=4.0) waistMidctrl = makeController(selec=waistJNTs[1], pointConst=True, normalPlane='xz') waistRootctrl = makeController(selec=waistJNTs[0], pointConst=True, normalPlane='xz') chestLowctrl = makeController(selec=waistJNTs[2], newName='chest_Low', pointConst=True, normalPlane='xz') hipctrl = makeController(selec=waistJNTs[0], shape='cube', newName='hip', scale=7, pointConst=True, normalPlane='xz') pelvisctrl = makeController(selec=waistJNTs[0], newName='pelvis', scale=3, pointConst=True, normalPlane='xz') chestUpctrl = makeController(selec=chestJNTs[1], newName='chest_Up', pointConst=True, normalPlane='xz') waistIKctrl = makeController(selec=waistJNTs[1], shape='cross', addName='_IK', pointConst=True, scale=6, parent=True, normalPlane='xz') waistIKctrlGRP = getRoot(sel=waistIKctrl, nodType='transform') controllerColor(waistIKctrl, color='red') controllerColor(pelvisctrl, color='blue') controllerColor(hipctrl, color='yellow') controllerColor(waistRootctrl, color='default') controllerColor(waistMidctrl, color='default') controllerColor(chestLowctrl, color='default') controllerColor(chestUpctrl, color='default') cmds.parentConstraint(waistJNTs[0], waistJNTs[2], waistIKctrlGRP, mo=True) cmds.parent(waistIKctrlGRP, waistMidctrl) cmds.parent(getRoot(sel=chestLowctrl, nodType='transform'), waistMidctrl) cmds.parent(getRoot(sel=waistMidctrl, nodType='transform'), waistRootctrl) cmds.parent(waistJNTs[2], chestLowctrl) cmds.parent(getRoot(sel=chestUpctrl, nodType='transform'), chestLowctrl) waistRootJNT_GRP = cmds.group(empty=True, w=True, n=waistJNTs[0]+'_GRP') waistRootJNT_Pos = makeOwnGRP(waistRootJNT_GRP, style='Pos') aligner(waistRootJNT_Pos, waistJNTs[0], Const='point') cmds.connectAttr(waistRootctrl[0]+'.translate', waistRootJNT_GRP+'.translate') cmds.connectAttr(waistRootctrl[0]+'.rotate', waistRootJNT_GRP+'.rotate') cmds.parent(waistJNTs[0], waistRootJNT_GRP) cmds.parent(waistRootJNT_Pos, hipctrl) cmds.parentConstraint(hipctrl, hipJNTs[0], mo=True) #* Add hip rotation offset Attribute to hip controller addCustomAttribute(hipctrl) cmds.addAttr(hipctrl, ln='Rotation_OffSet', nn="Rotation_OffSet", at="float", defaultValue=0) cmds.setAttr(hipctrl[0]+'.Rotation_OffSet', e=1, keyable=1) hipRotOffset_MD = cmds.createNode('multiplyDivide', n='hip_Rot_Offset_MD') cmds.connectAttr(hipctrl[0]+'.rotateX', hipRotOffset_MD+'.input1X') cmds.connectAttr(hipctrl[0]+'.rotateY', hipRotOffset_MD+'.input1Y') cmds.connectAttr(hipctrl[0]+'.rotateZ', hipRotOffset_MD+'.input1Z') cmds.connectAttr(hipctrl[0]+'.Rotation_OffSet', hipRotOffset_MD+'.input2X') cmds.connectAttr(hipctrl[0]+'.Rotation_OffSet', hipRotOffset_MD+'.input2Y') cmds.connectAttr(hipctrl[0]+'.Rotation_OffSet', hipRotOffset_MD+'.input2Z') cmds.connectAttr(hipRotOffset_MD+'.outputX', waistJNTs[0]+'.rotateX') cmds.connectAttr(hipRotOffset_MD+'.outputY', waistJNTs[0]+'.rotateY') cmds.connectAttr(hipRotOffset_MD+'.outputZ', waistJNTs[0]+'.rotateZ') #* chest SetUp chestIKhandle = cmds.ikHandle(sj=chestJNTs[0], ee=chestJNTs[-1], solver='ikSplineSolver', pcv=False, ns=4, n='chest_spik_handle') chestIKCRV = cmds.rename(chestIKhandle[-1], 'chest_spik_curve') chestIKJNTs = cmds.ls('chest_*_IK_joint') chestIKJNTs.reverse() cmds.skinCluster(chestIKJNTs, chestIKCRV, toSelectedBones=True, dropoffRate=4.0) #* more classify cmds.parent(getRoot(sel=waistRootctrl, nodType='transform'), pelvisctrl) cmds.parent(getRoot(sel=hipctrl, nodType='transform'), pelvisctrl) bodySpikGRP = cmds.group(empty=True, w=True, n='body_spik_GRP') cmds.parent(chestIKhandle[0], chestIKCRV, bodySpikGRP) cmds.parent(spineIKhandle[0], spineIKCRV, bodySpikGRP) cmds.setAttr(waistMidctrl[0]+'.rotateOrder', 1) cmds.setAttr(waistRootctrl[0]+'.rotateOrder', 1) cmds.setAttr(chestLowctrl[0]+'.rotateOrder', 1) cmds.setAttr(hipctrl[0]+'.rotateOrder', 1) cmds.setAttr(pelvisctrl[0]+'.rotateOrder', 1) cmds.setAttr(chestUpctrl[0]+'.rotateOrder', 1) cmds.setAttr(waistIKctrl[0]+'.rotateOrder', 1) cmds.parentConstraint(chestLowctrl, cmds.listRelatives(chestRootJNT, parent=True)[0], mo=True) cmds.parent(bodySpikGRP, 'Extras') #* waist Twist SetUp waistTwistPMA = cmds.createNode('plusMinusAverage', n='waistTwist_PMA') waistTwistMD = cmds.createNode('multiplyDivide', n='waistTwist_MD') hipTwistMD = cmds.createNode('multiplyDivide', n='hipTwist_MD') cmds.addAttr(waistRootctrl, ln='Twist_Offset', nn="Twist_Offset", at="float", minValue=0, defaultValue=1) cmds.setAttr(waistRootctrl[0]+'.Twist_Offset', e=1, keyable=1) cmds.addAttr(waistMidctrl, ln='Twist_Offset', nn="Twist_Offset", at="float", minValue=0, defaultValue=1) cmds.setAttr(waistMidctrl[0]+'.Twist_Offset', e=1, keyable=1) cmds.addAttr(chestLowctrl, ln='Twist_Offset', nn="Twist_Offset", at="float", minValue=0, defaultValue=1) cmds.setAttr(chestLowctrl[0]+'.Twist_Offset', e=1, keyable=1) cmds.connectAttr(waistRootctrl[0]+'.rotateY', waistTwistMD+'.input1X') cmds.connectAttr(waistMidctrl[0]+'.rotateY', waistTwistMD+'.input1Y') cmds.connectAttr(chestLowctrl[0]+'.rotateY', waistTwistMD+'.input1Z') cmds.connectAttr(hipctrl[0]+'.rotateY', hipTwistMD+'.input1X') cmds.connectAttr(waistRootctrl[0]+'.Twist_Offset', waistTwistMD+'.input2X') cmds.connectAttr(waistMidctrl[0]+'.Twist_Offset', waistTwistMD+'.input2Y') cmds.connectAttr(chestLowctrl[0]+'.Twist_Offset', waistTwistMD+'.input2Z') cmds.connectAttr(waistTwistMD+'.outputX', waistTwistPMA+'.input2D[0].input2Dx') cmds.connectAttr(waistTwistMD+'.outputY', waistTwistPMA+'.input2D[1].input2Dx') cmds.connectAttr(waistTwistMD+'.outputZ', waistTwistPMA+'.input2D[2].input2Dx') cmds.connectAttr(hipTwistMD+'.outputX', waistTwistPMA+'.input2D[3].input2Dx') cmds.connectAttr(waistTwistPMA+'.output2Dx', spineIKhandle[0]+'.twist') #* reverse Twist SetUp #++ set all constraints .interpType to 2 allOrientList = cmds.ls('*orientConstraint1') allParentList = cmds.ls('*parentConstraint1') for o in allOrientList: cmds.setAttr('{0}.interpType'.format(o), 2) for p in allParentList: cmds.setAttr('{0}.interpType'.format(p), 2) #++ progressBar ++#
21,790
e534dc7a58e216a8bfbfd86330623bbf1f99ce68
import threading from wsgiref.simple_server import make_server from leap.soledad.common.couch import CouchServerState from leap.soledad.server import SoledadApp from leap.soledad.server.gzip_middleware import GzipMiddleware from leap.soledad.server.auth import SoledadTokenAuthMiddleware from util import log class SoledadServerThread(threading.Thread): def __init__(self, server): threading.Thread.__init__(self) self._server = server def run(self): self._server.serve_forever() def stop(self): self._server.shutdown() @property def port(self): return self._server.server_port def make_soledad_server_thread(couch_port): state = CouchServerState( 'http://127.0.0.1:%d' % couch_port, 'shared', 'tokens') application = GzipMiddleware( SoledadTokenAuthMiddleware(SoledadApp(state))) server = make_server('', 0, application) t = SoledadServerThread(server) return t def get_soledad_server(couchdb_port): log("Starting soledad server... ", line_break=False) soledad_server = make_soledad_server_thread(couchdb_port) soledad_server.start() log("soledad server started on port %d." % soledad_server.port) return soledad_server
21,791
7e5f5ff5a28efe59f4ac8b7c4354a542c7931635
import pygame from pygame.locals import * from pygame.color import * import os, sys sys.path.insert(0, os.path.join(os.getcwd(), "pymunk-4.0.0")) import pymunk from pymunk import Vec2d import math from sounds import * #################################### # Common sharing helper functions #################################### def rotateImage(p0, p1, image): x0, y0 = p0 x1, y1 = p1 if x1 < x0: angle = math.atan((y1 - y0)/(x0 - x1)) elif x1 > x0: angle = -math.atan((y0 - y1)/(x0 - x1)) image = pygame.transform.flip(image, True, False) else: if y1 < y0: angle = -1/2 * math.pi elif y1 > y0: angle = 1/2 * math.pi else: angle = 0 angle = radian2degree(angle) image = pygame.transform.rotate(image, angle) return image def radian2degree(angle): degree = 180 return angle/math.pi * degree def getDistance(x1, y1, x0, y0): distance = ((x1 - x0) ** 2 + (y1 - y0) ** 2) ** (1/2) return distance def getPygameCoords(coordinate, data): # convert the given coordinate in pymunk to pygame return int(coordinate.x), int(data.height-coordinate.y) def drawTemp(screen, x, y, image): x -= image.get_width()/2 y -= image.get_height()/2 screen.blit(image, (x, y)) def getImpulse(distance, data): if distance >= data.launchRadius: distance = data.launchRadius horizontal, vertical = 100, 0 impulse = distance * Vec2d(horizontal, vertical) impulse[0] = round(impulse[0], 10) return impulse def getLaunchAngle(data): if data.x1 < data.x0: angle = math.atan((data.y1 - data.y0)/(data.x0 - data.x1)) elif data.x1 > data.x0: angle = math.pi - math.atan((data.y0 - data.y1)/(data.x0 - data.x1)) else: if data.y1 < data.y0: angle = -1/2 * math.pi elif data.y1 > data.y0: angle = 1/2 * math.pi else: angle = 0 return round(angle, 10) def existObstacles(data, obj1, obj2): existRect = existRectObstacles(data, obj1, obj2) existCircle = existCircleObstacles(data, obj1, obj2) return existRect or existCircle def existRectObstacles(data, obj1, obj2): try: p1 = (x1, y1) = obj1.body.position except: p1 = (obj1.x, obj1.y) try: p2 = (x2, y2) = obj2.body.position except: p2 = (obj2.x, obj2.y) for target in data.bricks: rect = (left, top, right, bot) = target.getBounds() result = rectBetweenPoints(p1, p2, rect) if result != False: return result return False def existCircleObstacles(data, obj1, obj2): try: p1 = (x1, y1) = obj1.body.position except: p1 = (obj1.x, obj1.y) try: p2 = (x2, y2) = obj2.body.position except: p2 = (obj2.x, obj2.y) for target in data.objects: if type(target) == Stone: cx, cy = target.body.position radius = target.radius circle = (cx, cy, radius) result = circleBetweenPoints(p1, p2, circle) if result != False: return result return False def rectBetweenPoints(p1, p2, rect): left, top, right, bot = rect diag1 = ((left, top), (right, bot)) diag2 = ((left, bot), (right, top)) line = (p1, p2) return linesIntersect(line, diag1) or linesIntersect(line, diag2) def circleBetweenPoints(p1, p2, circle): cx, cy, radius = circle point = (cx, cy) line = (p1, p2) perpendicularLength = solvePerpendicular(point, line) return radius >= perpendicularLength def solvePerpendicular(point, line): # solve the length of the perpendicular segment given a point and a line # first, solve the perpendicular function x, y = point slope1, intercept1 = lineToFunction(line) if slope1 == 0: slope1 = 10**(-10) slope2 = -1/slope1 intercept2 = y - slope2 * x xi = (intercept2 - intercept1)/(slope1 - slope2) yi = slope2 * xi + intercept2 distance = getDistance(x, y, xi, yi) return distance def linesIntersect(line1, line2): # compute the intersect point slope1, intercept1 = lineToFunction(line1) slope2, intercept2 = lineToFunction(line2) # if parallel if slope1 == slope2: return False # then solve the intersect x = (intercept2 - intercept1)/(slope1 - slope2) # judge if it is in the range (x1, y1), (x2, y2) = line1 (x3, y3), (x4, y4) = line2 return (min(x1, x2) <= x <= max(x1, x2)) and \ (min(x3, x4) <= x <= max(x3, x4)) def lineToFunction(line): (x1, y1), (x2, y2) = line slope = (y1 - y2)/(x1 - x2) intercept = y1 - (y1 - y2)/(x1 - x2) * x1 return slope, intercept #################################### # Game Class Definition #################################### class Bird(object): def __init__(self, x, y, impulse, angle, data): # this __init__ function is inspired by: # http://www.pymunk.org/en/latest/pymunk.html#pymunk.Body # http://www.pymunk.org/en/latest/pymunk.html#pymunk.Circle # http://github.com/estevaofon/angry-birds-python/blob/master # /src/characters.py self.mass = 5 self.radius = 16 self.moment = pymunk.moment_for_circle(self.mass, 0, self.radius, (0,0)) self.body = pymunk.Body(self.mass, self.moment) self.body.position = x, data.height - y self.angle = angle self.impulse = impulse.rotated(self.angle) self.body.apply_impulse(self.impulse) self.shape = pymunk.Circle(self.body, self.radius, (0, 0)) self.shape.elasticity = 0.95 self.currImpulse = self.impulse self.disappearing = False self.disappeared = False self.disappearTime = 100 data.space.add(self.body, self.shape) self.fallPlayed = False self.flyPlayed = False def rebound(self, data): x, y = self.body.position r = self.radius for brick in data.bricks: left, top, right, bot = brick.getBounds() # collide at 8 different regions: # collide at left or right if (left - r <= x <= left and bot <= y <= top) or \ (right <= x <= right + r and bot <= y <= top): self.currImpulse = Vec2d(-data.coeff * self.currImpulse[0], data.coeff * self.currImpulse[1]) self.body.apply_impulse(self.currImpulse) # collide at top or bottom if (left <= x <= right and top <= y <= top + r) or \ (left <= x <= right and bot - r <= y <= bot): self.currImpulse = Vec2d(data.coeff * self.currImpulse[0], -data.coeff * self.currImpulse[1]) self.body.apply_impulse(self.currImpulse) # collide at top-left corner if x <= left and y >= top: distance = getDistance(x, y, left, top) if distance <= r: self.currImpulse = Vec2d(-data.coeff * self.currImpulse[0], -data.coeff * self.currImpulse[1]) self.body.apply_impulse(self.currImpulse) # collide at top-right corner if x >= right and y >= top: distance = getDistance(x, y, right, top) if distance <= r: self.currImpulse = Vec2d(-data.coeff * self.currImpulse[0], -data.coeff * self.currImpulse[1]) self.body.apply_impulse(self.currImpulse) # collide at left-bot corner if x <= left and y <= bot: distance = getDistance(x, y, left, bot) if distance <= r: self.currImpulse = Vec2d(-data.coeff * self.currImpulse[0], -data.coeff * self.currImpulse[1]) self.body.apply_impulse(self.currImpulse) # collide at right-bot corner if x >= right and y <= bot: distance = getDistance(x, y, right, bot) if distance <= r: self.currImpulse = Vec2d(-data.coeff * self.currImpulse[0], -data.coeff * self.currImpulse[1]) self.body.apply_impulse(self.currImpulse) def draw(self, screen, data): phase1, phase2, phase3, step = 100, 70, 40, 20 screenCoord = getPygameCoords(self.body.position, data) x = screenCoord[0] - self.image.get_width()/2 y = screenCoord[1] - self.image.get_height()/2 if self.disappearing: if self.disappearTime > 0: self.disappearTime -= step if phase2 <= self.disappearTime < phase1: screen.blit(data.phase1, (x, y)) if phase3 <= self.disappearTime < phase2: screen.blit(data.phase2, (x, y)) if 0 <= self.disappearTime < phase3: screen.blit(data.phase3, (x, y)) if self.disappearTime <= 0: self.disappeared = True else: if self.name in data.paths: path = data.paths[self.name] if len(path) > 1: x1, y1 = path[-1] x2, y2 = path[-2] if x2 < x1: angle = math.atan((y2-y1)/(x2-x1)) image = self.image elif x1 < x2: angle = math.atan((y2-y1)/(x2-x1)) image = pygame.transform.flip(self.image, True, False) else: if y2 < y1: angle = -1/2 * math.pi elif y2 > y1: angle = 1/2 * math.pi else: angle = 0 image = self.image angle = radian2degree(angle) image = pygame.transform.rotate(image, angle) screen.blit(image, (x, y)) else: p0 = (data.x0, data.y0) p1 = (data.x1, data.y1) image = rotateImage(p0, p1, self.image) screen.blit(image, (x, y)) def sounds(self): if self.flyPlayed == False: playSounds("sounds/fly.ogg") self.flyPlayed = True if self.disappearing: if self.fallPlayed == False: playSounds("sounds/fall.ogg") self.fallPlayed = True class RedBird(Bird): def __init__(self, x, y, impulse, angle, data, image): super().__init__(x, y, impulse, angle, data) self.image = image self.cost = 2 class YellowBird(Bird): def __init__(self, x, y, impulse, angle, data, image): super().__init__(x, y, impulse, angle, data) self.image = image self.accelerated = False self.cost = 3 self.initImpulse = impulse def accelerate(self, accAngle): if self.accelerated == False: ratio = 1.5 self.impulse *= ratio self.accAngle = math.pi - accAngle self.body.apply_impulse(self.initImpulse.rotated(self.accAngle)) self.accelerated = True class BlueBird(Bird): def __init__(self, x, y, impulse, angle, data, image): super().__init__(x, y, impulse, angle, data) self.initImpulse = impulse self.image = image self.tripled = False self.cost = 5 def scatterShot(self, angle, data): if self.tripled == False: units = 18 x, y = self.body.position upperAngle = math.pi - (angle + math.pi/units) lowerAngle = math.pi - (angle - math.pi/units) upperBird = BlueBirdCopy(x, y, self.initImpulse, upperAngle, data, self.image) birdID = "bird" + str(data.birdID) + "upperCopy" upperBird.name = birdID data.objects.append(upperBird) lowerBird = BlueBirdCopy(x, y, self.initImpulse, lowerAngle, data, self.image) birdID = "bird" + str(data.birdID) + "lowerCopy" lowerBird.name = birdID data.objects.append(lowerBird) self.tripled = True class BlueBirdCopy(BlueBird): def __init__(self, x, y, impulse, angle, data, image): super().__init__(x, y, impulse, angle, data, image) self.body.position.y = data.height - self.body.position.y self.cost = 0 self.tripled = True def sounds(self): pass class GreenBird(Bird): def __init__(self, x, y, impulse, angle, data, image): super().__init__(x, y, impulse, angle, data) self.image = image self.cost = 8 self.callBacked = False def callBack(self, data): if self.callBacked == False: coeff = 20 x, y = self.body.position distance = getDistance(data.launchCx, data.launchCy, x, y) dx = data.launchCx - x dy = data.launchCy - y # adjust impluse if distance > coeff: distance = coeff # apply impulse self.currImpulse = Vec2d(dx, dy) * distance - self.currImpulse self.body.apply_impulse(self.currImpulse) self.callBacked = True class WhiteBird(Bird): def __init__(self, x, y, impulse, angle, data, image): super().__init__(x, y, impulse, angle, data) self.image = image self.cost = 15 self.exploded = False def explode(self, data): self.explosionRadius = 300 x0, y0 = self.body.position units = 50 if self.exploded == False: for target in data.objects: if isinstance(target, Pig): x1, y1 = target.body.position distance = getDistance(x0, y0, x1, y1) if (distance <= self.explosionRadius) and \ (not existObstacles(data, self, target)): coeff = (self.explosionRadius - distance) impulseUnit = Vec2d((x1 - x0)/units, (y1 - y0)/units) impulse = impulseUnit * coeff target.body.apply_impulse(impulse) playSounds("sounds/tnt.ogg") self.exploded = True self.disappearing = True def draw(self, screen, data): phase0, phase1, phase2, phase3, step = 100, 80, 60, 40, 20 screenCoord = getPygameCoords(self.body.position, data) x = screenCoord[0] - self.image.get_width()/2 y = screenCoord[1] - self.image.get_height()/2 if self.disappearing: if self.disappearTime > 0: self.disappearTime -= step if phase1 <= self.disappearTime < phase0: screen.blit(data.phase0, (x, y)) if phase2 <= self.disappearTime < phase1: screen.blit(data.phase1, (x, y)) if phase3 <= self.disappearTime < phase2: screen.blit(data.phase2, (x, y)) if 0 <= self.disappearTime < phase3: screen.blit(data.phase3, (x, y)) if self.disappearTime <= 0: self.disappeared = True else: super().draw(screen, data) class Pig(object): def __init__(self, x, y, radius, image, data): self.image = image self.mass = 1 self.radius = radius self.moment = pymunk.moment_for_circle(self.mass, 0, self.radius, (0,0)) self.body = pymunk.Body(self.mass, self.moment) self.body.position = x, y self.shape = pymunk.Circle(self.body, self.radius, (0, 0)) self.shape.elasticity = 0.95 self.pts = 15 self.disappearing = False self.disappeared = False self.disappearTime = 100 data.space.add(self.body, self.shape) self.fallPlayed = False def draw(self, screen, data): phase1, phase2, phase3, step = 100, 70, 40, 20 screenCoord = getPygameCoords(self.body.position, data) x = screenCoord[0] - self.image.get_width()/2 y = screenCoord[1] - self.image.get_height()/2 if self.disappearing: if self.disappearTime > 0: self.disappearTime -= step if phase2 <= self.disappearTime < phase1: screen.blit(data.phase1, (x, y)) if phase3 <= self.disappearTime < phase2: screen.blit(data.phase2, (x, y)) if 0 <= self.disappearTime < phase3: screen.blit(data.phase3, (x, y)) if self.disappearTime <= 0: self.disappeared = True else: screen.blit(self.image, (x, y)) def sounds(self): if self.disappearing: if self.fallPlayed == False: playSounds("sounds/fall.ogg") self.fallPlayed = True class Stone(object): def __init__(self, x, y, image, data): self.image = image self.mass = 50 self.radius = 18 self.moment = pymunk.moment_for_circle(self.mass, 0, self.radius, (0,0)) self.body = pymunk.Body(self.mass, self.moment) self.body.position = x, y self.shape = pymunk.Circle(self.body, self.radius, (0, 0)) self.shape.elasticity = 0.95 self.crushed = False self.disappearing = False self.disappeared = False self.disappearTime = 100 data.space.add(self.body, self.shape) self.fallPlayed = False def crush(self, data): if not self.crushed: x0, y0 = self.body.position for target in data.objects: if isinstance(target, Pig): x1, y1 = target.body.position distance = getDistance(x0, y0, x1, y1) threshold = self.radius + target.radius if distance <= threshold: target.disappearing = True self.crushed = True self.disappearing = True return def draw(self, screen, data): phase1, phase2, phase3, step = 100, 70, 40, 20 screenCoord = getPygameCoords(self.body.position, data) x = screenCoord[0] - self.image.get_width()/2 y = screenCoord[1] - self.image.get_height()/2 if self.disappearing: if self.disappearTime > 0: self.disappearTime -= step if phase2 <= self.disappearTime < phase1: screen.blit(data.phase1, (x, y)) if phase3 <= self.disappearTime < phase2: screen.blit(data.phase2, (x, y)) if 0 <= self.disappearTime < phase3: screen.blit(data.phase3, (x, y)) if self.disappearTime <= 0: self.disappeared = True else: screen.blit(self.image, (x, y)) def sounds(self): if self.disappearing: if self.fallPlayed == False: playSounds("sounds/fall.ogg") self.fallPlayed = True class Brick(object): def __init__(self, x, y, width, height, image, data): self.image = image self.body = pymunk.Body() self.body.position = (x, y) self.left = -width//2 self.right = width//2 self.height = height self.brick = pymunk.Segment(self.body, (self.left, 0), (self.right, 0), self.height) data.space.add(self.brick) def getBounds(self): cx, cy = self.body.position left, right = cx + self.left, cx + self.right top, bot = cy + self.height, cy - self.height return left, top, right, bot def draw(self, screen, data): screenCoord = getPygameCoords(self.body.position, data) x = screenCoord[0] - self.image.get_width()/2 y = screenCoord[1] - self.image.get_height()/2 screen.blit(self.image, (x, y)) class vBrick(Brick): def __init__(self, x, y, width, height, image, data): self.image = image self.body = pymunk.Body() self.body.position = (x, y) self.top = height//2 self.bot = -height//2 self.width = width self.brick = pymunk.Segment(self.body, (0, self.top), (0, self.bot), self.width) data.space.add(self.brick) def getBounds(self): cx, cy = self.body.position left, right = cx - self.width, cx + self.width top, bot = cy + self.top, cy + self.bot return left, top, right, bot class Seesaw(object): # this classed is created by following the pymunk official tutorial: # http://www.pymunk.org/en/latest/pymunk.html#pymunk.Segment # http://www.pymunk.org/en/latest/tutorials/SlideAndPinJoint.html def __init__(self, x, y, width, height, image, data): self.mass = 10 self.moment = 100000 self.fence = 20 self.width = width self.height = height self.limit = 25 self.distance = 100 self.centerBody = pymunk.Body() self.centerBody.position = (x, y) self.limitBody = pymunk.Body() self.limitBody.position = (x - self.distance, y) self.mainBody = pymunk.Body(self.mass, self.moment) self.mainBody.position = (x, y) self.seesaw = pymunk.Segment(self.mainBody, (-self.width//2, 0), (self.width//2, 0), self.height) self.centerBody = pymunk.PinJoint(self.mainBody, self.centerBody, (0, 0), (0, 0)) self.limitBody = pymunk.SlideJoint(self.mainBody, self.limitBody, (-self.distance, 0), (0, 0), 0, self.limit) data.space.add(self.seesaw, self.mainBody, self.centerBody, self.limitBody) self.image = image def draw(self, screen, data): angle = radian2degree(self.seesaw.body.angle) image = pygame.transform.rotate(self.image, angle) x, y = getPygameCoords(self.seesaw.body.position, data) x -= image.get_width()//2 y -= image.get_height()//2 screen.blit(image, (x, y)) class Wormhole(object): def __init__(self, x, y, image, data, hScope=0, vScope=0): self.x = x self.y = y self.dx = 5 self.dy = 5 self.image = image self.radius = 30 self.hScope = hScope self.vScope = vScope self.leftBound = self.x - hScope self.rightBound = self.x + hScope self.lowerBound = self.y - vScope self.upperBound = self.y + vScope self.ejecting = False self.soundsPlayed = False def move(self): if self.hScope != 0: if self.x <= self.leftBound\ or self.x >= self.rightBound: self.dx *= -1 self.x += self.dx if self.vScope != 0: if self.y <= self.lowerBound\ or self.y >= self.upperBound: self.dy *= -1 self.y += self.dy def link(self, other): self.port = other other.port = self def detect(self, data): x0, y0 = self.x, self.y for target in data.objects: if isinstance(target, Bird): if target.name == "bird" + str(data.birdID): x1, y1 = target.body.position distance = getDistance(x0, y0, x1, y1) threshold = self.radius + target.radius if not self.ejecting: if distance <= threshold: self.port.ejecting = True self.transfer(target, data) self.soundsPlayed = False else: if distance > threshold: self.ejecting = False def transfer(self, target, data): exit = self.port target.body.position = exit.x, exit.y if self.soundsPlayed == False: playSounds("sounds/wormhole.ogg") self.soundsPlayed = True def draw(self, screen, data): x, y = self.x, data.height - self.y x -= self.image.get_width()//2 y -= self.image.get_height()//2 screen.blit(self.image, (x, y)) class Blackhole(object): def __init__(self, x, y, affectRadius, image, hScope=0, vScope=0): self.x = x self.y = y self.dx = 5 self.dy = 5 self.radius = 20 self.affectRadius = affectRadius self.image = image self.activated = True self.timeCountDown = 100 self.hScope = hScope self.vScope = vScope self.leftBound = self.x - hScope self.rightBound = self.x + hScope self.lowerBound = self.y - vScope self.upperBound = self.y + vScope def attract(self, data): if self.activated: x0, y0 = self.x, self.y for target in data.objects: x1, y1 = target.body.position distance = getDistance(x0, y0, x1, y1) if distance <= self.affectRadius: data.objectsToRemove.append(target) def activationCountDown(self): step = 2 reset = 100 if self.timeCountDown != 0: self.timeCountDown -= step if self.timeCountDown <= 0: self.timeCountDown = reset self.activated = not self.activated def move(self): if self.activated: if self.hScope != 0: if self.x <= self.leftBound\ or self.x >= self.rightBound: self.dx *= -1 self.x += self.dx if self.vScope != 0: if self.y <= self.lowerBound\ or self.y >= self.upperBound: self.dy *= -1 self.y += self.dy def draw(self, screen, data): if self.activated: x, y = self.x, data.height - self.y x -= self.image.get_width()/2 y -= self.image.get_height()/2 screen.blit(self.image, (x, y)) class Bomb(object): def __init__(self, x, y, affectRadius, image): self.x = x self.y = y self.radius = 25 self.explosionRadius = affectRadius self.disappearing = False self.triggered = False self.disappeared = False self.image = image self.disappearTime = 100 self.explodePlayed = False def trigger(self, data): if not self.triggered: for target in data.objects: x, y = target.body.position distance = getDistance(self.x, self.y, x, y) if distance <= self.radius + target.radius: self.triggered = True def explode(self, data): x0, y0 = self.x, self.y units = 60 if self.triggered: if self.explodePlayed == False: playSounds("sounds/tnt.ogg") self.explodePlayed = True for target in data.objects: x1, y1 = target.body.position distance = getDistance(x0, y0, x1, y1) if (distance <= self.explosionRadius) and \ (not existObstacles(data, self, target)): coeff = (self.explosionRadius - distance) impulseUnit = Vec2d((x1 - x0)/units, (y1 - y0)/units) impulse = impulseUnit * coeff target.body.apply_impulse(impulse) self.disappearing = True def draw(self, screen, data): phase0, phase1, phase2, phase3, step = 100, 80, 60, 40, 20 x = self.x - self.image.get_width()/2 y = data.height - self.y - self.image.get_height()/2 if self.disappearing: if self.disappearTime > 0: self.disappearTime -= step if phase1 <= self.disappearTime < phase0: screen.blit(data.phase0, (x, y)) if phase2 <= self.disappearTime < phase1: screen.blit(data.phase1, (x, y)) if phase3 <= self.disappearTime < phase2: screen.blit(data.phase2, (x, y)) if 0 <= self.disappearTime < phase3: screen.blit(data.phase3, (x, y)) if self.disappearTime <= 0: self.disappeared = True else: screen.blit(self.image, (x, y))
21,792
0714f2b5b0ceab7d42879bb861bd5be10b95618e
# -*- coding: utf-8 -*- """ Copyright 2016 cocoatomo Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ from setuptools import setup, find_packages from setuptools.command.test import test as TestCommand import os, sys version='0.5.0' long_description = '\n'.join([ open(os.path.join('.', 'README.rst')).read(), ]) classifiers = [ 'Development Status :: 4 - Beta', 'License :: OSI Approved :: Apache Software License', 'Programming Language :: Python', 'Programming Language :: Python :: 2.7', 'Programming Language :: Python :: 3.5', 'Programming Language :: Python :: 3.6', 'Topic :: Documentation', ] setup( name='pygments-dmdl', version=version, description='DMDL lexer and highlighter for Pygments', long_description=long_description, classifiers=classifiers, keywords=[], author='cocoatomo', author_email='cocoatomo77@gmail.com', url='https://github.com/cocoatomo/pygments-dmdl', license='Apache License (2.0)', namespace_packages=['dmdl'], packages=find_packages('.'), package_dir={'': '.'}, include_package_data=True, install_requires=[], entry_points=""" [pygments.lexers] dmdl = dmdl.lexer:DmdlLexer """, zip_safe=False, setup_requires=['pytest-runner'], tests_require=['pytest'], cmdclass={}, )
21,793
6a7254c7a99f7bdb1f3be078772146c9442e0371
from django.conf.urls import url from . import views urlpatterns = [ url(r'^$', views.index, name='index'), url(r'^about/', views.about, name='about'), url(r'^code/', views.code, name='code'), url(r'^model_description/', views.model_description, name='model_description'), url(r'^dashboard/', views.dashboard, name='dashboard'), ]
21,794
48cc6aa19a6313e783143b47e63518027c98d9ae
raio = float(input()) pi = 3.14159 volume = (4/3 * pi * raio**(3)) print('VOLUME = %.3f' % volume)
21,795
dd6e4a17aff314a300f3107c797b0474ff4b71cf
import tkinter as tk from tkinter import ttk from tkinter import messagebox from Clases.calendarioExamenes import CalendarioExamenes from tkcalendar import Calendar, DateEntry import datetime from datetime import date,timedelta from Clases.jsonConverter import jsonConverter import showCalendars as sW import threading from tkinter.ttk import Progressbar class SubWindow(tk.Toplevel): def __init__(self, master, *argv): super().__init__(master) self._second_window = None self.grupo = argv[0][1] self.title("Generar Excel del {}".format(self.grupo)) for i in range(3): self.columnconfigure(i, weight=1) self.rowconfigure(i, weight=1) self.calendario = argv[0][0] self.txts = ["" for x in range(6)] # Change what happens when you click the X button # This is done so changes also reflect in the main window class self.protocol('WM_DELETE_WINDOW', master.close) self.lbl1 = ttk.Label(self, text="Parcial 1") self.lbl1.grid(column=0, row=0,sticky="nsew", padx=10, pady=5) self.lbl2 = ttk.Label(self, text="Parcial 2") self.lbl2.grid(column=0, row=1,sticky="nsew", padx=10, pady=5) self.lbl3 = ttk.Label(self, text="Parcial 3") self.lbl3.grid(column=0, row=2,sticky="nsew", padx=10, pady=5) self.txts[0] = ttk.Entry(self, text="") self.txts[0].grid(column = 1, row = 0,columnspan=2) self.txts[1] = ttk.Entry(self, text="") self.txts[1].grid(column = 1, row = 1,columnspan=2) self.txts[2] = ttk.Entry(self, text="") self.txts[2].grid(column = 1, row = 2,columnspan=2) self.lbl4 = ttk.Label(self, text="Fecha ordinario") self.lbl4.grid(column=3, row=0,sticky=tk.W, padx=5) self.lbl5 = ttk.Label(self, text="Fecha extraordinario 1") self.lbl5.grid(column=3, row=1, padx=5) self.lbl6 = ttk.Label(self, text="Fecha extraordinario 2") self.lbl6.grid(column=3, row=2, padx=5) self.txts[3] = ttk.Entry(self, text="") self.txts[3].grid(column = 4, row = 0,columnspan=2, padx=10, pady=5) self.txts[4] = ttk.Entry(self, text="") self.txts[4].grid(column = 4, row = 1,columnspan=2, padx=10, pady=5) self.txts[5] = ttk.Entry(self, text="") self.txts[5].grid(column = 4, row = 2,columnspan=2, padx=10, pady=5) self.btn = ttk.Button(self, text="Generar Excel", command= lambda : self.generateExcel()) self.btn.grid(column= 4, row=3,sticky="nsew", columnspan=2, padx=5, pady=5, ipadx=5, ipady=5) self.progress = ttk.Progressbar(self, orient=tk.HORIZONTAL,length=100, mode='indeterminate') now = datetime.datetime.now() self.dia =now.day self.mes =now.month self.anio =now.year for i in range(6): self.txts[i].bind("<Button-1>", self.tkinterCalendar) def tkinterCalendar(self, event): # respuesta = tk.messagebox.askquestion(parent=self, message="¿Cuenta con la fecha especifica? \n\n Conteste NO para guardar como PENDIENTE", title="Agregar fecha",icon = 'info') # if respuesta == 'yes': def print_sel(): f = (cal.selection_get()).weekday() if f < 5: event.widget.config(state="normal") self.updateDate(cal.selection_get()) event.widget.delete(0, tk.END) event.widget.insert(0, cal.selection_get()) event.widget.config(state="disabled") top.destroy() else: tk.messagebox.showerror(parent=top, message="Por favor elija un dia valido", title="Seleccionar fecha") def print_pendiente(): event.widget.config(state="normal") self.updateDate(cal.selection_get()) event.widget.delete(0, tk.END) event.widget.insert(0, 'Pediente') event.widget.config(state="disabled") top.destroy() top = tk.Toplevel(self) cal = Calendar(top, font="Arial 14", selectmode='day', cursor="hand1", year=self.anio, month=self.mes, day=self.dia) cal.pack(fill="both", expand=True) ttk.Button(top, text="ok", command=print_sel).pack(expand=True, fill=tk.BOTH, ipadx=10, ipady=10, pady=2) ttk.Button(top, text="Guardar como pendiente", command= print_pendiente).pack(expand=True, fill=tk.BOTH, ipadx=10, ipady=10, pady=2) # else: def updateDate(self, date): self.dia = date.day self.mes = date.month self.anio = date.year def generateExcel(self): def real_traitement(): self.progress.grid(row=4,column=0,columnspan=6, sticky="nsew") self.progress.start() json = jsonConverter() fechas = json.getFechas(self) calendariosExamenes = [] fechaInicio= [] fechaFinal = [] listaMateriasNoAplicadas = [] listaMateriasNoAplicadas2 = [] for i in range(6): fecha = self.txts[i].get() if fecha == None or fecha == '' or fecha == 'Pediente': fechaInicio.append('Pendiente') fechaFinal.append('Pendiente') calendariosExamenes.append( 'Pendiente' ) else: array = json.getCalendario(self, self.grupo) fecha = fecha.split('-') objCalendarioExamenes = CalendarioExamenes(array, self.grupo, fechas, fecha) if i < 4: examenes = objCalendarioExamenes.crearCalendarioExmanes() else: examenes = objCalendarioExamenes.crearCalendarioExamenesExtraordinarios() fechaInicio.append(objCalendarioExamenes.fechaInicio) fechaFinal.append(fecha) calendariosExamenes.append( examenes ) listaMateriasNoAplicadas.append( objCalendarioExamenes.listaMateriasNoAplicadas ) listaMateriasNoAplicadas2.append( objCalendarioExamenes.listaMateriasNoAplicadas ) array = json.getCalendario(self, self.grupo) self.new_window(calendariosExamenes, array, fechaInicio, self.grupo, fechaFinal, listaMateriasNoAplicadas, listaMateriasNoAplicadas2) self.progress.stop() self.progress.grid_forget() threading.Thread(target=real_traitement).start() def new_window(self, *argv): # This prevents multiple clicks opening multiple windows if self._second_window is not None: return self._second_window = sW.SubWindow(self, argv) def close(self): # Destory the 2nd window and reset the value to None if self._second_window is not None: self._second_window.destroy() self._second_window = None
21,796
6c0a01b772c299eb6773c67b16c2d654bcc2e218
import connexion import six from openapi_server.models.cargo_response import CargoResponse # noqa: E501 from openapi_server.models.door_response import DoorResponse # noqa: E501 from openapi_server.models.humidity_response import HumidityResponse # noqa: E501 from openapi_server.models.inline_object19 import InlineObject19 # noqa: E501 from openapi_server.models.inline_object20 import InlineObject20 # noqa: E501 from openapi_server.models.inline_object21 import InlineObject21 # noqa: E501 from openapi_server.models.inline_object22 import InlineObject22 # noqa: E501 from openapi_server.models.inline_object23 import InlineObject23 # noqa: E501 from openapi_server.models.inline_object24 import InlineObject24 # noqa: E501 from openapi_server.models.inline_response2008 import InlineResponse2008 # noqa: E501 from openapi_server.models.sensor_history_response import SensorHistoryResponse # noqa: E501 from openapi_server.models.temperature_response import TemperatureResponse # noqa: E501 from openapi_server import util def get_sensors(access_token, group_param): # noqa: E501 """/sensors/list Get sensor objects. This method returns a list of the sensor objects in the Samsara Cloud and information about them. # noqa: E501 :param access_token: Samsara API access token. :type access_token: str :param group_param: :type group_param: dict | bytes :rtype: InlineResponse2008 """ if connexion.request.is_json: group_param = InlineObject23.from_dict(connexion.request.get_json()) # noqa: E501 return 'do some magic!' def get_sensors_cargo(access_token, sensor_param): # noqa: E501 """/sensors/cargo Get cargo monitor status (empty / full) for requested sensors. # noqa: E501 :param access_token: Samsara API access token. :type access_token: str :param sensor_param: :type sensor_param: dict | bytes :rtype: CargoResponse """ if connexion.request.is_json: sensor_param = InlineObject19.from_dict(connexion.request.get_json()) # noqa: E501 return 'do some magic!' def get_sensors_door(access_token, sensor_param): # noqa: E501 """/sensors/door Get door monitor status (closed / open) for requested sensors. # noqa: E501 :param access_token: Samsara API access token. :type access_token: str :param sensor_param: :type sensor_param: dict | bytes :rtype: DoorResponse """ if connexion.request.is_json: sensor_param = InlineObject20.from_dict(connexion.request.get_json()) # noqa: E501 return 'do some magic!' def get_sensors_history(access_token, history_param): # noqa: E501 """/sensors/history Get historical data for specified sensors. This method returns a set of historical data for the specified sensors in the specified time range and at the specified time resolution. # noqa: E501 :param access_token: Samsara API access token. :type access_token: str :param history_param: :type history_param: dict | bytes :rtype: SensorHistoryResponse """ if connexion.request.is_json: history_param = InlineObject21.from_dict(connexion.request.get_json()) # noqa: E501 return 'do some magic!' def get_sensors_humidity(access_token, sensor_param): # noqa: E501 """/sensors/humidity Get humidity for requested sensors. This method returns the current relative humidity for the requested sensors. # noqa: E501 :param access_token: Samsara API access token. :type access_token: str :param sensor_param: :type sensor_param: dict | bytes :rtype: HumidityResponse """ if connexion.request.is_json: sensor_param = InlineObject22.from_dict(connexion.request.get_json()) # noqa: E501 return 'do some magic!' def get_sensors_temperature(access_token, sensor_param): # noqa: E501 """/sensors/temperature Get temperature for requested sensors. This method returns the current ambient temperature (and probe temperature if applicable) for the requested sensors. # noqa: E501 :param access_token: Samsara API access token. :type access_token: str :param sensor_param: :type sensor_param: dict | bytes :rtype: TemperatureResponse """ if connexion.request.is_json: sensor_param = InlineObject24.from_dict(connexion.request.get_json()) # noqa: E501 return 'do some magic!'
21,797
2b613df5caed52b08c2cffb6f6675fefe407bcec
from flask import Flask app = Flask(__name__) @app.route("/") def hello(): return "Hello World" @app.route("/Lwin") def Lwin(): return "Hello LwinMeMeKhaing"
21,798
160772027862595cc905f032732cd5835ae232e0
import os from pathlib import Path import pandas as pd import time import experiment_config_gpflow as config import experiment_funcs_gpflow as ef import warnings warnings.filterwarnings(action='ignore', module='GPy') records = pd.DataFrame() # Data for acquiring MP experiments = [] triggerAt = 1 tstart = time.time() count_experiments = 0.0 for folder in config.DATA_FOLDERS: location = Path(config.DATA_ROOT).joinpath(folder) trainFiles = list(filter(lambda name: 'train' in name, os.listdir(location))) ## for file in trainFiles: data = ef.read_experiment_data(folder, location, file) idx = ef.get_idx(file) print(folder, file) # Now the experiment (different kernels) start for kName in list(config.EXPERIMENTS.keys()): print(kName) inputs = ef.ExperimentInput(kName, data, config.EXPERIMENTS[kName], config.LIKELIHOOD_EXPERIMENT.get(kName, config.LIKELIHOOD_DEFAULT), config.MODEL_EXPERIMENT.get(kName, config.MODEL_DEFAULT), config.PRIORS_EXPERIMENT.get(kName, config.PRIOR_DEFAULT), config.SCORE.get(kName, config.SCORE_DEFAULT), config.INDUCING_EXPERIMENT.get(kName, config.INDUCING_DEFAULT), config.N_RESTARTS.get(kName, config.N_RESTARTS_DEF)) if config.FORCE_RERUN_IF_EXISTS: ef.train_and_save(inputs) else: result_path = Path(config.RESULT_ROOT).joinpath(folder).joinpath(str(idx)) model_file = result_path.joinpath('{0} {1}.predictions.pbz2'.format(kName, config.CHECKPOINTS[-1])) # Check so we dont rerun the same model if it is already saved from a previous run if model_file.exists() is False: ef.train_and_save(inputs) else: print("{0} already exists for {1}-{2}".format(kName, folder, idx))
21,799
7e0f83a84c6c963899ef2092339e299c20c6fd0a
from django import forms from .models import Wishlist from products.models import Product from django.forms import TextInput, Textarea class WishlistForm(forms.ModelForm): class Meta: model = Wishlist fields = ( "products", "name", ) def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) placeholders = { 'product': 'Product...', 'name': 'name', } for field in self.fields: if self.fields[field].required: placeholder = f'{placeholders[field]}' else: placeholder = placeholders[field] self.fields[field].widget.attrs['placeholder'] = placeholder self.fields[field].widget.attrs['class'] = 'border-black rounded-0'