index
int64
0
1,000k
blob_id
stringlengths
40
40
code
stringlengths
7
10.4M
5,900
33b6a4c76079ed698809b29772abb59a34831472
from django.db import models from django.utils import timezone from django.contrib.auth.models import User, Group # Create your models here. def default_expiration(): return timezone.now() + timezone.timedelta(days=10) class Category(models.Model): name = models.CharField(max_length=200) description = models.TextField() def __str__(self): return self.name class Survey(models.Model): name = models.CharField(max_length=200) description = models.TextField() category = models.ForeignKey(Category, blank=True, null=True, on_delete=models.CASCADE) users = models.ManyToManyField(User, through='SurveyToUser') groups = models.ManyToManyField(Group, through='SurveyToGroup') pub_date = models.DateTimeField(default=timezone.now) exp_date = models.DateTimeField(default=default_expiration) period = models.DurationField(default=None, null=True, blank=True) @property def get_questions(self): return self.question_set.all() def __str__(self): return f'{self.name}: {self.description}' class Question(models.Model): TEXT = 'text' NUMBER = 'number' SELECT = 'select' SELECT_MULTIPLE = 'select-multiple' RADIO = 'radio' CHECKBOX = 'checkbox' SURVEY_QUESTION_TYPES_CHOICES = [ (TEXT, 'text'), (NUMBER, 'number'), (SELECT, 'select'), (SELECT_MULTIPLE, 'select-multiple'), (RADIO, 'radio'), (CHECKBOX, 'checkbox'), ] text = models.TextField() required = models.BooleanField(default=True) survey = models.ForeignKey(Survey, blank=False, null=False, on_delete=models.CASCADE) question_type = models.CharField( max_length=50, choices=SURVEY_QUESTION_TYPES_CHOICES, default=TEXT, ) choices = models.TextField(blank=True, null=True) other = models.TextField(blank=True, null=True) def __str__(self): return f'Question: {self.text} of survey {self.survey.name}' class Answer(models.Model): text = models.TextField(blank=True) question = models.ForeignKey(Question, blank=False, null=False, on_delete=models.CASCADE) user = models.ForeignKey(User, blank=False, null=False, on_delete=models.CASCADE) def __str__(self): return f'Answer: {self.text} to the Question {self.question.text} ' \ f'given by User: {self.user.username} for survey {self.question.survey.name}' class SurveyToUser(models.Model): user = models.ForeignKey(User, blank=True, null=True, on_delete=models.CASCADE) survey = models.ForeignKey(Survey, blank=False, null=False, on_delete=models.CASCADE, related_name='user_survey') completed = models.BooleanField(default=False, null=False) completion_date = models.DateTimeField(default=None, null=True, blank=True) class SurveyToGroup(models.Model): group = models.ForeignKey(Group, blank=True, null=True, on_delete=models.CASCADE) survey = models.ForeignKey(Survey, blank=False, null=False, on_delete=models.CASCADE) completed = models.BooleanField(default=False, null=False) completion_date = models.DateTimeField(default=None, null=True, blank=True) class StarRating(models.Model): text = models.TextField(blank=True, null=False, default=None) user = models.ForeignKey(User, blank=False, null=False, on_delete=models.CASCADE) completed = models.DateTimeField(blank=True, null=True, default=None)
5,901
3fdb29797894737edae37ad7890e14cb9ce705e8
import pygame naytto = pygame.display.set_mode((740, 500)) pygame.display.set_caption("Piirtรคminen") x = 100 y = 300 def main(): while True: tapahtuma = pygame.event.poll() if tapahtuma.type == pygame.QUIT: break naytto.fill((0, 0, 0)) pygame.draw.line(naytto, (0, 0, 255), (0, 0), (640, 400)) pygame.draw.line(naytto, (0, 255, 0), (640, 0), (0, 400)) pygame.draw.rect(naytto, (255, 0, 0), (100, 50, 150, 200)) pygame.draw.circle(naytto, (255, 255, 0), (350, 150), 40) kuva = pygame.image.load("mycat.png").convert() naytto.blit(kuva, (x, y)) pygame.display.flip() main()
5,902
42021b762737a2eb21866ba029ece4ac120152cd
class Solution(object): def countSmaller(self, nums): """ :type nums: List[int] :rtype: List[int] naive -- o(n^2) """ ## StefanPochmann solution #2 def countSmaller(self, nums): def sort(enum): half = len(enum) / 2 if half: left = sort(enum[:half]) right = sort(enum[half:]) for i in range(len(enum))[::-1]: if not right or left and left[-1][1] > right[-1][1]: smaller[left[-1][0]] += len(right) enum[i] = left.pop() else: enum[i] = right.pop() return enum smaller = [0] * len(nums) sort(list(enumerate(nums))) return smaller ## StefanPochmann solution #1 def countSmaller(self, nums): def sort(enum): half = len(enum) / 2 if half: left, right = sort(enum[:half]), sort(enum[half:]) m, n = len(left), len(right) i = j = 0 while i < m or j < n: if j == n or i < m and left[i][1] <= right[j][1]: enum[i+j] = left[i] smaller[left[i][0]] += j i += 1 else: enum[i+j] = right[j] j += 1 return enum smaller = [0] * len(nums) sort(list(enumerate(nums))) return smaller """ a = [2,4,6] b = [1,3,5] """ def mergesort(x): if len(x)==0: return x, [] if len(x)==1: return x, [0] mid = len(x)/2 a, A = mergesort(x[:mid]) b, B = mergesort(x[mid:]) y, Y = merge(a, b, A, B) return y,Y def merge(a, b): res = [] i,j = 0,0 while i < len(a) and j < len(b): if a[i] <= b[j]: res.append(a[i]) i += 1 else: res.append(b[j]) ### j += 1 if i < len(a): res += a[i:] elif j < len(b): res += b[j:] return res merge([2,4,6], [1,3,5], [0,0,0], [0,0,0]) mergesort([5, 2, 6, 1]) """ base merge sort: """ def mergesort(x): if len(x)==0 or len(x)==1: return x else: mid = len(x)/2 a = mergesort(x[:mid]) b = mergesort(x[mid:]) return merge(a,b) def merge(a,b, left, right): # left, right will keep track of inversions so far res = [] while len(a)>0 and len(b)>0: if a[0] < b[0]: res += [a[0]] a = a[1:] else: res += [b[0]] b = b[1:] if len(a) > 0: res += a if len(b) > 0: res += b return res
5,903
ff924b803a875d3f6201baa2c1251a6c5b8cde61
from django.http import request from restapp.ExcelSheet import * '''ApiHomeDict={} class LoadDict(): e = ExcelSheetAll() ApiHomeDict = e.apiHomeDict() print ApiHomeDict class ReturnApi: def returnDict(self): return ApiHomeDict''' '''if "ApiDictionary" in request.session: print 'Dictioanry is already stored in session' else: e=ExcelSheetAll() ApiHomeDict=e.apiHomeDict() request.session['ApiDictionary'] = ApiHomeDict #print ApiHomeDict print request.session['ApiDictionary']'''
5,904
9247896850e5282265cd08240f6f505e675ce5f0
n = int(input()) num = list(map(int, input().split())) plus_cnt = 0 div_max = 0 for i in num: div = 0 while i > 0: if i % 2 == 0: i //= 2 div += 1 else: i -= 1 plus_cnt += 1 div_max = max(div_max, div) print(plus_cnt + div_max)
5,905
aff439361716c35e5f492680a55e7470b4ee0c42
from numpy import empty import pickle from dataset import Dataset from image import Image f = open("./digitdata/trainingimages", "r") reader = f.readlines() labels = open("./digitdata/traininglabels", "r") lreader = labels.readlines() trainImageList = [] j = 0 i = 0 while(j < len(reader)): image_array = empty([28, 28]) for r in range(0, 28): row = reader[j] j += 1 for c in range(0, 28): if row[c] == '#' or row[c] == '+': image_array[r][c] = 1 else: image_array[r][c] = 0 label = lreader[i] i += 1 image = Image(image_array, label) trainImageList.append(image) f = open("./digitdata/testimages", "r") reader = f.readlines() labels = open("./digitdata/testlabels", "r") lreader = labels.readlines() testImageList = [] j = 0 i = 0 while(j < len(reader)): image_array = empty([28, 28]) for r in range(0, 28): row = reader[j] j += 1 for c in range(0, 28): if row[c] == '#' or row[c] == '+': image_array[r][c] = 1 else: image_array[r][c] = 0 label = lreader[i] i += 1 image = Image(image_array, label) testImageList.append(image) f = open("./digitdata/validationimages", "r") reader = f.readlines() labels = open("./digitdata/validationlabels", "r") lreader = labels.readlines() valImageList = [] j = 0 i = 0 while(j < len(reader)): image_array = empty([28, 28]) for r in range(0, 28): row = reader[j] j += 1 for c in range(0, 28): if row[c] == '#' or row[c] == '+': image_array[r][c] = 1 else: image_array[r][c] = 0 label = lreader[i] i += 1 image = Image(image_array, label) valImageList.append(image) dataset = Dataset(trainImageList, testImageList, valImageList) output_file = open('digits_dataset', 'wb') pickle.dump(dataset, output_file)
5,906
b4b80e40d12486881e37dd7ddeeef9c76417ebd9
def add(a, b): print "ADDING %d + %d" % (a, b) return a + b def subtract(a, b): print "SUBTRACTING %d - %d" %(a, b) return a - b def multipy(a, b): print "MULTIPLYING %d * %d" % (a, b) return a * b def divide(a, b): print "DIVIDING %d / %d" % (a, b) return a / b print "Let's do some math with just functions!" age = add(30, 5) height = subtract(78, 4) weight = multipy(90, 2) iq = divide(100, 2) print "Age: %d, Height: %d, Weight: %d, IQ: %d" %(age, height, weight, iq) # A puzzle for the extra credit, type in anyway. print "Here is a puzzle." what = add(age, subtract(height, multipy(weight, divide(iq, 2)))) print "That becomes: ", what, "Can you do it by hand?" print "Sure, let me show you!" solution = ((30 + 5)+((78 - 4)-((90 * 2) * ((100 / 2) / 2)))) print "See how smart I am, look at this", solution, "!" print "Now I break the formula by deleteing all ():" solution2 = 30 + 5 + 78 - 4 - 90 * 2 * 100 / 2 / 2 print solution, "is the same as", solution2, ". Because python knows math rules." solution3 = 30 * 2 + 5 * 100 + 78 / 2 - 4 / 2 - 90 print solution3, "is different, because I changed the order of the terms." print "Now I will make my own formula into a function." solution4 = 24.0 + 34.0 / 100.0 - 1023.0 term1 = divide(34.0, 100.0) term2 = add(24.0, term1) term3 = subtract(term2, 1023.0) print term3, "and", solution4 # Mistakes I make: # Typos # forgot quotes # forgot formatter % # forgot \n # things to remember: # go back to study drills of ex 10
5,907
7f9046582ff03d1c72d191a8f78c911cbc8a0650
#!/usr/bin/env python """ Power calculation based for admixture mapping. @ref: Design and Analysis of admixture mapping studies, (2004). @Author: wavefancy@gmail.com Usage: PowerCalculation.py -r aratio -n nhap PowerCalculation.py -h | --help | -v | --version | -f | --format Notes: 1. Read parameters from stdin, and output to stdout. Options: -r aratio Ancestry risk ratio. aratio = f2/f0 for multiplicative model. -n nhap Number of haplotypes, n = 2*N, N for sample size. -h --help Show this screen. -v --version Show version. -f --format Show input/output file format example. """ import sys from docopt import docopt from signal import signal, SIGPIPE, SIG_DFL def ShowFormat(): '''File format example''' print(''' #rfmix output, 3 person, 2 snps ------------------------ 1 1 2 1 2 2 1 2 2 1 2 2 #id average: ------------------------ 0.8 0.5 0.1 #output: ------------------------ 0.40 0.00 -0.20 -0.60 0.00 -0.20 '''); if __name__ == '__main__': args = docopt(__doc__, version='1.0') # print(args) # sys.exit(0) if(args['--format']): ShowFormat() sys.exit(-1) idav = [] # 2*ID_average with open(args['-a'],'r') as ifile: for line in ifile: line = line.strip() if line: idav.append(2 * float(line)) checkLen = True for line in sys.stdin: line = line.strip() if line: ss = line.split() ss = [2-int(x) for x in ss] #number of pop1 copy for each haplotype. obs = [] for i in range(0, len(ss), 2): obs.append(ss[i] + ss[i+1]) if checkLen: if len(obs) != len(idav): sys.stderr.write('Error: numbr of individuals in ID_average file is not the same as that in sys.stdin.\n') sys.exit(-1) else: checkLen = False out = [ '%.2f'%(y-x) for x,y in zip(idav, obs)] sys.stdout.write('%s\n'%('\t'.join(out))) sys.stdout.flush() sys.stdout.close() sys.stderr.flush() sys.stderr.close()
5,908
a6c45ab3df0a692cd625d8203e1152e942a4cd6c
# DISCLAIMER # The "Math" code was taken from http://depado.markdownblog.com/2015-09-29-mistune-parser-syntax-highlighter-mathjax-support-and-centered-images # The HighlightRenderer code was taken from https://github.com/rupeshk/MarkdownHighlighter # MarkdownHighlighter is a simple syntax highlighter for Markdown syntax. # The initial code for MarkdownHighlighter was taken from niwmarkdowneditor by John Schember # Copyright 2009 John Schember, Copyright 2012 Rupesh Kumar # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, # MA 02110-1301, USA. import re import mistune import pygments from pygments.lexers import get_lexer_by_name from pygments.formatters import html class HighlightRenderer(mistune.Renderer): def block_code(self, code, lang): if not lang: return '\n<pre><code>%s</code></pre>\n' % \ mistune.escape(code) try: lexer = get_lexer_by_name(lang, stripall=True) except pygments.util.ClassNotFound: return '\n<pre><code>%s</code></pre>\n' % \ mistune.escape(code) formatter = html.HtmlFormatter() return pygments.highlight(code, lexer, formatter) # Pass math through unaltered - mathjax does the rendering in the browser def block_math(self, text): return '$$%s$$' % text def latex_environment(self, name, text): return r'\begin{%s}%s\end{%s}' % (name, text, name) def inline_math(self, text): return '$%s$' % text class MathBlockGrammar(mistune.BlockGrammar): block_math = re.compile(r"^\$\$(.*?)\$\$", re.DOTALL) latex_environment = re.compile( r"^\\begin\{([a-z]*\*?)\}(.*?)\\end\{\1\}", re.DOTALL) class MathBlockLexer(mistune.BlockLexer): default_rules = [ 'block_math', 'latex_environment'] + mistune.BlockLexer.default_rules def __init__(self, rules=None, **kwargs): if rules is None: rules = MathBlockGrammar() super(MathBlockLexer, self).__init__(rules, **kwargs) def parse_block_math(self, m): """Parse a $$math$$ block""" self.tokens.append({ 'type': 'block_math', 'text': m.group(1) }) def parse_latex_environment(self, m): self.tokens.append({ 'type': 'latex_environment', 'name': m.group(1), 'text': m.group(2) }) class MathInlineGrammar(mistune.InlineGrammar): math = re.compile(r"^\$(.+?)\$", re.DOTALL) block_math = re.compile(r"^\$\$(.+?)\$\$", re.DOTALL) text = re.compile(r'^[\s\S]+?(?=[\\<!\[_*`~$]|https?://| {2,}\n|$)') class MathInlineLexer(mistune.InlineLexer): default_rules = ['block_math', 'math'] + mistune.InlineLexer.default_rules def __init__(self, renderer, rules=None, **kwargs): if rules is None: rules = MathInlineGrammar() super(MathInlineLexer, self).__init__(renderer, rules, **kwargs) def output_math(self, m): return self.renderer.inline_math(m.group(1)) def output_block_math(self, m): return self.renderer.block_math(m.group(1)) class MarkdownWithMath(mistune.Markdown): def __init__(self, renderer, **kwargs): if 'inline' not in kwargs: kwargs['inline'] = MathInlineLexer if 'block' not in kwargs: kwargs['block'] = MathBlockLexer super(MarkdownWithMath, self).__init__(renderer, **kwargs) def output_block_math(self): return self.renderer.block_math(self.token['text']) def output_latex_environment(self): return self.renderer.latex_environment(self.token['name'], self.token['text'])
5,909
603a73a7cc0487fcabb527ebc21d44cb95817ecb
def checkRaiz(): a = int(input("Informe o primeiro coeficiente: ")) b = int(input("Informe o segundo coeficiente: ")) c = int(input("Informe o terceiro coeficiente: ")) delta = (b*b) - (4*a*c) if (delta < 0): print("Nรฃo tem raiz real") elif (delta == 0): print("Existe uma raiz real") else: print("Existem duas raizes reais") checkRaiz()
5,910
0dc556336cee9e5f41c036c6fcf6da950216693c
from twindb_backup.copy.binlog_copy import BinlogCopy from twindb_backup.status.binlog_status import BinlogStatus def test_get_latest_backup(raw_binlog_status): instance = BinlogStatus(raw_binlog_status) assert instance.get_latest_backup() == BinlogCopy( host='master1', name='mysqlbin005.bin', created_at=100504 )
5,911
9dd5db441044c808274493f16a912d1b65a6c28b
print("Leer 10 nรบmeros enteros, almacenarlos en un vector y determinar en quรฉ posiciones se encuentran los nรบmeros con mas de 3 dรญgitos") count=1 lista=[] while count<11: numero=int(input('Introduzca su %d numero:' %(count))) lista.append(numero) count=count+1 listanueva=[] s= ',' for element in lista: if element > 999 or element<-999: listanueva.append(lista.index(element)) posiciones= ','.join(str (x) for x in listanueva) print("Los numeros con mas de tres digitos se encuentran en las posiciones",posiciones) input()
5,912
1cba7889370cc7de47bb5cd1eaeadfece056e68a
#Problem available at: https://www.hackerrank.com/challenges/weather-observation-station-6/problem SELECT DISTINCT CITY from STATION where substr(CITY,1,1) in ('a','e','i','o','u');
5,913
731110b02c8a09dc84042a99c14eef990ae33cd2
""" Have the function CharlietheDog(strArr) read the array of strings stored in strArr which will be a 4x4 matrix of the characters 'C', 'H', 'F', 'O', where C represents Charlie the dog, H represents its home, F represents dog food, and O represents and empty space in the grid. Your goal is to figure out the least amount of moves required to get Charlie to grab each piece of food in the grid by moving up, down, left, or right, and then make it home right after. Charlie cannot move onto the home before all pieces of food have been collected. For example: if strArr is ["FOOF", "OCOO", "OOOH", "FOOO"], then this looks like the following grid: F O O F O C O O O O O H F O O O For the input above, the least amount of steps where the dog can reach each piece of food, and then return home is 11 steps, so your program should return the number 11. The grid will always contain between 1 and 8 pieces of food. Use the Parameter Testing feature in the box below to test your code with different arguments. """ from itertools import permutations def CharlietheDog(strArr): def walk(food_home, dog, matriz, steps=0): food_home_dx = food_home[0][0] - dog[0] food_home_dy = food_home[0][1] - dog[1] walk_x = food_home_dx/(abs(food_home_dx) if food_home_dx != 0 else 1) walk_y = food_home_dy/(abs(food_home_dy) if food_home_dy != 0 else 1) steps += abs(walk_x) + abs(walk_y) dog = (dog[0] + walk_x, dog[1] + walk_y) if food_home[0] == dog: food_home = food_home[1:] food_home_size = len(food_home) if food_home_size <= 0: return steps return walk(food_home, dog, matriz, steps) food = [] home = None dog = None for i in range(len(strArr)): for j in range(len(strArr[i])): if strArr[i][j] == 'F': food.append((i, j)) if strArr[i][j] == 'H': home = (i, j) if strArr[i][j] == 'C': dog = (i, j) foods = permutations(food) min_steps = None for food in foods: food_home = food + (home, ) steps = walk(food_home, dog, strArr) if min_steps == None or steps < min_steps: min_steps = steps return int(min_steps) # keep this function call here print (CharlietheDog(raw_input()))
5,914
9feb24da78113310509664fa9efcf5f399be5335
# Import smtplib for the actual sending function import smtplib # Import the email modules we'll need from email.message import EmailMessage # Open the plain text file whose name is in textfile for reading. with open("testfile.txt") as fp: # Create a text/plain message msg = EmailMessage() msg.set_content("test") me = "njordan@kohanakai.com" you = ['john.pelletier@ymail.com', 'jdp2766@gmail.com'] msg['Subject'] = 'The tester email' msg['From'] = me msg['To'] = you # Send the message via our own SMTP server. s = smtplib.SMTP('smtp-relay.gmail.com', 25) s.send_message(msg) s.quit()
5,915
dcb57ecf2c72b8ac816bb06986d80544ff97c669
from http import HTTPStatus from ninja import Router mock_post_router = Router() @mock_post_router.get( "/mock_posts", url_name="mock_post_list", summary="์ „์ฒด mock post์˜ list๋ฅผ ๋ฐ˜ํ™˜ํ•œ๋‹ค", response={200: None}, ) def retrieve_all_mock_posts(request): return HTTPStatus.OK
5,916
d30e5e24dd06a4846fdde3c9fcac0a5dac55ad0d
import sys import os from django.conf import settings BASE_DIR=os.path.dirname(__file__) settings.configure( DEBUG=True, SECRET_KEY='ki==706e99f0ps9w5s*!kx%1^=5jq_k1c&4r@#e&ng9=xlm5_', ROOT_URLCONF='sitebuilder.urls', MIDDLEWARE_CLASSES=(), INSTALLED_APPS=( 'django.contrib.staticfiles', 'django.contrib.webdesign', 'sitebuilder', 'compressor', ), STATIC_URL='/static/', SITE_PAGES_DIRECTORY=os.path.join(BASE_DIR,'pages'), SITE_OUTPUT_DIRECTORY=os.path.join(BASE_DIR,'_build'), STATIC_ROOT=os.path.join(BASE_DIR,'_build','static'), #STATICFILES_STORAGE='django.contrib.staticfiles.storage.CachedStaticFilesStorage', STATICFILES_FINDERS=( 'django.contrib.staticfiles.finders.FileSystemFinder', 'django.contrib.staticfiles.finders.AppDirectoriesFinder', 'compressor.finders.CompressorFinder', ) ) if __name__ =="__main__": from django.core.management import execute_from_command_line execute_from_command_line(sys.argv)
5,917
b318f5d443dbf8e4442707839649149e75653295
#!/usr/bin/python import socket import sys host = '10.211.55.5' port = 69 try: s = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) except: print "socket() failed" sys.exit(1) filename = "Aa0Aa1Aa2Aa3Aa4Aa5Aa6Aa7Aa8Aa9Ab0Ab1Ab2Ab3Ab4Ab5Ab6Ab7Ab8Ab9Ac0Ac1Ac2Ac3Ac4Ac5Ac6Ac7Ac8Ac9Ad0Ad1Ad2Ad3Ad4Ad5Ad6Ad7Ad8Ad9Ae0Ae1Ae2Ae3Ae4Ae5Ae6Ae7Ae8Ae9Af0Af1Af2Af3Af4Af5Af6Af7Af8Af9Ag0Ag1Ag2Ag3Ag4Ag5Ag6Ag7Ag8Ag9Ah0Ah1Ah2Ah3Ah4Ah5Ah6Ah7Ah8Ah9Ai0Ai1Ai2Ai3Ai4Ai5Ai6Ai7Ai8Ai9Aj0Aj1Aj2Aj3Aj4Aj5Aj6Aj7Aj8Aj9Ak0Ak1Ak2Ak3Ak4Ak5Ak6Ak7Ak8Ak9Al0Al1Al2Al3Al4Al5Al6Al7Al8Al9Am0Am1Am2Am3Am4Am5Am6Am7Am8Am9An0An1An2An3An4An5An6An7An8An9Ao0Ao1Ao2Ao3Ao4Ao5Ao6Ao7Ao8Ao9Ap0Ap1Ap2Ap3Ap4Ap5Ap6Ap7Ap8Ap9Aq0Aq1Aq2Aq3Aq4Aq5Aq6Aq7Aq8Aq9Ar0Ar1Ar2Ar3Ar4Ar5Ar6Ar7Ar8Ar9As0As1As2As3As4As5As6As7As8As9At0At1At2At3At4At5At6At7At8At9Au0Au1Au2Au3Au4Au5Au6Au7Au8Au9Av0Av1Av2Av3Av4Av5Av6Av7Av8Av9Aw0Aw1Aw2Aw3Aw4Aw5Aw6Aw7Aw8Aw9Ax0Ax1Ax2Ax3Ax4Ax5Ax6Ax7Ax8Ax9Ay0Ay1Ay2Ay3Ay4Ay5Ay6Ay7Ay8Ay9Az0Az1Az2Az3Az4Az5Az6Az7Az8Az9Ba0Ba1Ba2Ba3Ba4Ba5Ba6Ba7Ba8Ba9Bb0Bb1Bb2Bb3Bb4Bb5Bb6Bb7Bb8Bb9Bc0Bc1Bc2Bc3Bc4Bc5Bc6Bc7Bc8Bc9Bd0Bd1Bd2Bd3Bd4Bd5Bd6Bd7Bd8Bd9Be0Be1Be2Be3Be4Be5Be6Be7Be8Be9Bf0Bf1Bf2Bf3Bf4Bf5Bf6Bf7Bf8Bf9Bg0Bg1Bg2Bg3Bg4Bg5Bg6Bg7Bg8Bg9Bh0Bh1Bh2Bh3Bh4Bh5Bh6Bh7Bh8Bh9Bi0Bi1Bi2Bi3Bi4Bi5Bi6Bi7Bi8Bi9Bj0Bj1Bj2Bj3Bj4Bj5Bj6Bj7Bj8Bj9Bk0Bk1Bk2Bk3Bk4Bk5Bk6Bk7Bk8Bk9Bl0Bl1Bl2Bl3Bl4Bl5Bl6Bl7Bl8Bl9Bm0Bm1Bm2Bm3Bm4Bm5Bm6Bm7Bm8Bm9Bn0Bn1Bn2Bn3Bn4Bn5Bn6Bn7Bn8Bn9Bo0Bo1Bo2Bo3Bo4Bo5Bo6Bo7Bo8Bo9Bp0Bp1Bp2Bp3Bp4Bp5Bp6Bp7Bp8Bp9Bq0Bq1Bq2Bq3Bq4Bq5Bq6Bq7Bq8Bq9Br0Br1Br2Br3Br4Br5Br6Br7Br8Br9Bs0Bs1Bs2Bs3Bs4Bs5Bs6Bs7Bs8Bs9Bt0Bt1Bt2Bt3Bt4Bt5Bt6Bt7Bt8Bt9Bu0Bu1Bu2Bu3Bu4Bu5Bu6Bu7Bu8Bu9Bv0Bv1Bv2Bv3Bv4Bv5Bv6Bv7Bv8Bv9Bw0Bw1Bw2Bw3Bw4Bw5Bw6Bw7Bw8Bw9Bx0Bx1Bx2Bx3Bx4Bx5Bx6Bx7Bx8Bx9By0By1By2By3By4By5By6By7By8By9Bz0Bz1Bz2Bz3Bz4Bz5Bz6Bz7Bz8Bz9Ca0Ca1Ca2Ca3Ca4Ca5Ca6Ca7Ca8Ca9Cb0Cb1Cb2Cb3Cb4Cb5Cb6Cb7Cb8Cb9Cc0Cc1Cc2Cc3Cc4Cc5Cc6Cc7Cc8Cc9Cd0Cd1Cd2Cd3Cd4Cd5Cd6Cd7Cd8Cd9Ce0Ce1Ce2Ce3Ce4Ce5Ce6Ce7Ce8Ce9Cf0Cf1Cf2Cf3Cf4Cf5Cf6Cf7Cf8Cf9Cg0Cg1Cg2Cg3Cg4Cg5Cg6Cg7Cg8Cg9Ch0Ch1Ch2Ch3Ch4Ch5Ch6Ch7Ch8Ch9Ci0Ci1Ci2Ci3Ci4Ci5Ci6Ci7Ci8Ci9Cj0Cj1Cj2Cj3Cj4Cj5Cj6Cj7Cj8Cj9Ck0Ck1Ck2Ck3Ck4Ck5Ck6Ck7Ck8Ck9Cl0Cl1Cl2Cl3Cl4Cl5Cl6Cl7Cl8Cl9Cm0Cm1Cm2Cm3Cm4Cm5Cm6Cm7Cm8Cm9Cn0Cn1Cn2Cn3Cn4Cn5Cn6Cn7Cn8Cn9Co0Co1Co2Co3Co4Co5Co6Co7Co8Co9Cp0Cp1Cp2Cp3Cp4Cp5Cp6Cp7Cp8Cp9Cq0Cq1Cq2Cq3Cq4Cq5Cq6Cq7Cq8Cq9Cr0Cr1Cr2Cr3Cr4Cr5Cr6Cr7Cr8Cr9Cs0Cs1Cs2Cs3Cs4Cs5Cs6Cs7Cs8Cs9Ct0Ct1Ct2Ct3Ct4Ct5Ct6Ct7Ct8Ct9Cu0Cu1Cu2Cu3Cu4Cu5Cu6Cu7Cu8Cu9Cv0Cv1Cv2Cv3Cv4Cv5Cv6Cv7Cv8Cv9Cw0Cw1Cw2Cw3Cw4Cw5Cw6Cw7Cw8Cw9Cx0Cx1Cx2Cx3Cx4Cx5Cx6Cx7Cx8Cx9Cy0Cy1Cy2Cy3Cy4Cy5Cy6Cy7Cy8Cy9Cz0Cz1Cz2Cz3Cz4Cz5Cz6Cz7Cz8Cz9Da0Da1Da2Da3Da4Da5Da6Da7Da8Da9Db0Db1Db2Db3Db4Db5Db6Db7Db8Db9Dc0Dc1Dc2Dc3Dc4Dc5Dc6Dc7Dc8Dc9Dd0Dd1Dd2Dd3Dd4Dd5Dd6Dd7Dd8Dd9De0De1De2De3De4De5De6De7De8De9Df0Df1Df2Df3Df4Df5Df6Df7Df8Df9Dg0Dg1Dg2Dg3Dg4Dg5Dg6Dg7Dg8Dg9Dh0Dh1Dh2Dh3Dh4Dh5Dh6Dh7Dh8Dh9Di0Di1Di2Di3Di4Di5Di6Di7Di8Di9Dj0Dj1Dj2Dj3Dj4Dj5Dj6Dj7Dj8Dj9Dk0Dk1Dk2Dk3Dk4Dk5Dk6Dk7Dk8Dk9Dl0Dl1Dl2Dl3Dl4Dl5Dl6Dl7Dl8Dl9Dm0Dm1Dm2Dm3Dm4Dm5Dm6Dm7Dm8Dm9Dn0Dn1Dn2Dn3Dn4Dn5Dn6Dn7Dn8Dn9Do0Do1Do2Do3Do4Do5Do6Do7Do8Do9Dp0Dp1Dp2Dp3Dp4Dp5Dp6Dp7Dp8Dp9Dq0Dq1Dq2Dq3Dq4Dq5Dq6Dq7Dq8Dq9Dr0Dr1Dr2Dr3Dr4Dr5Dr6Dr7Dr8Dr9Ds0Ds1Ds2Ds3Ds4Ds5Ds6Ds7Ds8Ds9Dt0Dt1Dt2Dt3Dt4Dt5Dt6Dt7Dt8Dt9Du0Du1Du2Du3Du4Du5Du6Du7Du8Du9Dv0Dv1Dv2Dv3Dv4Dv5Dv6Dv7Dv8Dv9Dw0Dw1Dw2Dw3Dw4Dw5Dw6Dw7Dw8Dw9Dx0Dx1Dx2Dx3Dx4Dx5Dx6Dx7Dx8Dx9Dy0Dy1Dy2Dy3Dy4Dy5Dy6Dy7Dy8Dy9Dz0Dz1Dz2Dz3Dz4Dz5Dz6Dz7Dz8Dz9Ea0Ea1Ea2Ea3Ea4Ea5Ea6Ea7Ea8Ea9Eb0Eb1Eb2Eb3Eb4Eb5Eb6Eb7Eb8Eb9Ec0Ec1Ec2Ec3Ec4Ec5Ec6Ec7Ec8Ec9Ed0Ed1Ed2Ed3Ed4Ed5Ed6Ed7Ed8Ed9Ee0Ee1Ee2Ee3Ee4Ee5Ee6Ee7Ee8Ee9Ef0Ef1Ef2Ef3Ef4Ef5Ef6Ef7Ef8Ef9Eg0Eg1Eg2Eg3Eg4Eg5Eg6Eg7Eg8Eg9Eh0Eh1Eh2Eh3Eh4Eh5Eh6Eh7Eh8Eh9Ei0Ei1Ei2Ei3Ei4Ei5Ei6Ei7Ei8Ei9Ej0Ej1Ej2Ej3Ej4Ej5Ej6Ej7Ej8Ej9Ek0Ek1Ek2Ek3Ek4Ek5Ek6Ek7Ek8Ek9El0El1El2El3El4El5El6El7El8El9Em0Em1Em2Em3Em4Em5Em6Em7Em8Em9En0En1En2En3En4En5En6En7En8En9Eo0Eo1Eo2Eo3Eo4Eo5Eo6Eo7Eo8Eo9Ep0Ep1Ep2Ep3Ep4Ep5Ep6Ep7Ep8Ep9Eq0Eq1Eq2Eq3Eq4Eq5Eq6Eq7Eq8Eq9Er0Er1Er2Er3Er4Er5Er6Er7Er8Er9Es0Es1Es2Es3Es4Es5Es6Es7Es8Es9Et0Et1Et2Et3Et4Et5Et6Et7Et8Et9Eu0Eu1Eu2Eu3Eu4Eu5Eu6Eu7Eu8Eu9Ev0Ev1Ev2Ev3Ev4Ev5Ev6Ev7Ev8Ev9Ew0Ew1Ew2Ew3Ew4Ew5Ew6Ew7Ew8Ew9Ex0Ex1Ex2Ex3Ex4Ex5Ex6Ex7Ex8Ex9Ey0Ey1Ey2Ey3Ey4Ey5Ey6Ey7Ey8Ey9Ez0Ez1Ez2Ez3Ez4Ez5Ez6Ez7Ez8Ez9Fa0Fa1Fa2Fa3Fa4Fa5Fa6Fa7Fa8Fa9Fb0Fb1Fb2Fb3Fb4Fb5Fb6Fb7Fb8Fb9Fc0Fc1Fc2Fc3Fc4Fc5Fc6Fc7Fc8Fc9Fd0Fd1Fd2Fd3Fd4Fd5Fd6Fd7Fd8Fd9Fe0Fe1Fe2Fe3Fe4Fe5Fe6Fe7Fe8Fe9Ff0Ff1Ff2Ff3Ff4Ff5Ff6Ff7Ff8Ff9Fg0Fg1Fg2Fg3Fg4Fg5Fg6Fg7Fg8Fg9Fh0Fh1Fh2Fh3Fh4Fh5Fh6Fh7Fh8Fh9Fi0Fi1Fi2Fi3Fi4Fi5Fi6Fi7Fi8Fi9Fj0Fj1Fj2Fj3Fj4Fj5Fj6Fj7Fj8Fj9Fk0Fk1Fk2Fk3Fk4Fk5Fk6Fk7Fk8Fk9Fl0Fl1Fl2Fl3Fl4Fl5Fl6Fl7Fl8Fl9Fm0Fm1Fm2Fm3Fm4Fm5Fm6Fm7Fm8Fm9Fn0Fn1Fn2Fn3Fn4Fn5Fn6Fn7Fn8Fn9Fo0Fo1Fo2Fo3Fo4Fo5Fo6Fo7Fo8Fo9Fp0Fp1Fp2Fp3Fp4Fp5Fp6Fp7Fp8Fp9Fq0Fq1Fq2Fq3Fq4Fq5Fq6Fq7Fq8Fq9Fr0Fr1Fr2Fr3Fr4Fr5Fr6Fr7Fr8Fr9Fs0Fs1Fs2Fs3Fs4Fs5Fs6Fs7Fs8Fs9Ft0Ft1Ft2Ft3Ft4Ft5Ft6Ft7Ft8Ft9Fu0Fu1Fu2Fu3Fu4Fu5Fu6Fu7Fu8Fu9Fv0Fv1Fv2Fv3Fv4Fv5Fv6Fv7Fv8Fv9Fw0Fw1Fw2Fw3Fw4Fw5Fw6Fw7Fw8Fw9Fx0Fx1Fx2Fx3Fx4Fx5Fx6Fx7Fx8Fx9Fy0Fy1Fy2Fy3Fy4Fy5Fy6Fy7Fy8Fy9Fz0Fz1Fz2Fz3Fz4Fz5Fz6Fz7Fz8Fz9Ga0Ga1Ga2Ga3Ga4Ga5Ga6Ga7Ga8Ga9Gb0Gb1Gb2Gb3Gb4Gb5Gb6Gb7Gb8Gb9Gc0Gc1Gc2Gc3Gc4Gc5Gc6Gc7Gc8Gc9Gd0Gd1Gd2Gd3Gd4Gd5Gd6Gd7Gd8Gd9Ge0Ge1Ge2Ge3Ge4Ge5Ge6Ge7Ge8Ge9Gf0Gf1Gf2Gf3Gf4Gf5Gf6Gf7Gf8Gf9Gg0Gg1Gg2Gg3Gg4Gg5Gg6Gg7Gg8Gg9Gh0Gh1Gh2Gh3Gh4Gh5Gh6Gh7Gh8Gh9Gi0Gi1Gi2Gi3Gi4Gi5Gi6Gi7Gi8Gi9Gj0Gj1Gj2Gj3Gj4Gj5Gj6Gj7Gj8Gj9Gk0Gk1Gk2Gk3Gk4Gk5Gk" mode = "netascii" buf = "\x00\x02" + filename+ "\0" + mode+ "\0" s.sendto(buf, (host, port))
5,918
7cc9d445d712d485eaebd090d2485dac0c38b3fb
# file /home/hep/ss4314/cmtuser/Gauss_v45r10p1/Gen/DecFiles/options/16303437.py generated: Wed, 25 Jan 2017 15:25:22 # # Event Type: 16303437 # # ASCII decay Descriptor: [Xi_b- -> (rho- -> pi- pi0) K- p+]cc # from Configurables import Generation Generation().EventType = 16303437 Generation().SampleGenerationTool = "SignalRepeatedHadronization" from Configurables import SignalRepeatedHadronization Generation().addTool( SignalRepeatedHadronization ) Generation().SignalRepeatedHadronization.ProductionTool = "PythiaProduction" from Configurables import ToolSvc from Configurables import EvtGenDecay ToolSvc().addTool( EvtGenDecay ) ToolSvc().EvtGenDecay.UserDecayFile = "$DECFILESROOT/dkfiles/Omegab_rho-h-p+,pi-pi0_PPChange=phsp,DecProdCut.dec" Generation().SignalRepeatedHadronization.CutTool = "DaughtersInLHCb" Generation().SignalRepeatedHadronization.SignalPIDList = [ 5132,-5132 ] from Configurables import LHCb__ParticlePropertySvc LHCb__ParticlePropertySvc().Particles = [ "Xi_b- 122 5132 -1.0 6.048 1.13e-012 Xi_b- 5132 0.000000e+000", "Xi_b~+ 123 -5132 1.0 6.071 1.1e-012 anti-Xi_b+ -5132 0.000000e+000" ]
5,919
8e26a6b50539fa5f498aa2079a2625214e5b4d03
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import threading import time from datetime import timedelta from typing import List, Optional, Set import airflow.utils.dag_processing as dag_processing from airflow.configuration import conf from airflow.contrib.jobs.background_service import BackgroundService from airflow.events.scheduler_events import DagExecutableEvent from airflow.jobs import scheduler_job from airflow.models import DagModel from airflow.utils.log.logging_mixin import LoggingMixin from airflow.utils.mailbox import Mailbox from airflow.utils.mixins import MultiprocessingStartMethodMixin from airflow.utils.session import create_session class DagTriggerDagFileProcessorAgent(dag_processing.DagFileProcessorAgent): def wait_on_manager_message(self, timeout=None): self._parent_signal_conn.poll(timeout) class StoppableThread(threading.Thread, LoggingMixin): """Thread class with a stop() method. The thread itself has to check regularly for the stopped() condition.""" def __init__(self, *args, **kwargs): super(StoppableThread, self).__init__(*args, **kwargs) self._ended = threading.Event() def stop(self): self.log.debug("stopping thread") self._ended.set() def stopped(self): return self._ended.is_set() class DagRunnableReportingThread(StoppableThread, LoggingMixin): def __init__(self, async_mode: bool, dag_file_processor_agent, mailbox: Mailbox, *args, **kwargs): super(DagRunnableReportingThread, self).__init__(*args, **kwargs) self.setName("DagTrigger-DagRunnableReporter") self._async_mode = async_mode self._dag_file_processor_agent: DagTriggerDagFileProcessorAgent = dag_file_processor_agent self._mailbox = mailbox def run(self) -> None: while not self.stopped(): # send AGENT_RUN_ONCE to DagFileProcessorManager to trigger dag parsing if not async mode if not self._async_mode: self._dag_file_processor_agent.run_single_parsing_loop() with create_session() as session: dag_models = DagModel.dags_needing_dagruns(session).all() self.log.debug("dags needs dagruns: {}".format(dag_models)) self._send_dag_executable(dag_models) time.sleep(5) self.log.info("DagRunnableReporter exiting") def _send_dag_executable(self, dag_models: Set[DagModel]): for dag_model in dag_models: self._mailbox.send_message(DagExecutableEvent(dag_model.dag_id).to_event()) class ParsingStatRetrieveThread(StoppableThread): def __init__(self, dag_file_processor_agent, *args, **kwargs): super(ParsingStatRetrieveThread, self).__init__(*args, **kwargs) self.setName("DagTrigger-ParsingStatRetriever") self._dag_file_processor_agent: DagTriggerDagFileProcessorAgent = dag_file_processor_agent def run(self) -> None: while not self.stopped(): self._dag_file_processor_agent.wait_on_manager_message() self._dag_file_processor_agent.heartbeat() time.sleep(10) self.log.info("ParsingStatRetriever exiting") class DagTrigger(BackgroundService, MultiprocessingStartMethodMixin): def __init__(self, dag_directory: str, max_runs: int, dag_ids: Optional[List[str]], pickle_dags: bool, mailbox: Mailbox, refresh_dag_dir_interval=1, notification_service_uri=None): """ :param dag_directory: Directory where DAG definitions are kept. All files in file_paths should be under this directory :type dag_directory: unicode :param max_runs: The number of times to parse and schedule each file. -1 for unlimited. :type max_runs: int :param dag_ids: if specified, only schedule tasks with these DAG IDs :type dag_ids: list[str] :param pickle_dags: whether to pickle DAGs. :type pickle_dags: bool :param mailbox: the mailbox to send the DagExecutableEvent :type mailbox: Mailbox """ super().__init__() self._dag_directory = dag_directory self._max_runs = max_runs self._dag_ids = dag_ids self._pickle_dags = pickle_dags self._mailbox = mailbox # use synchronize mode when using sqlite self._async_mode = not conf.get('core', 'sql_alchemy_conn').lower().startswith('sqlite') self._dag_runnable_reporting_thread: Optional[StoppableThread] = None self._parsing_stat_process_thread: Optional[StoppableThread] = None self._dag_file_processor_agent: Optional[DagTriggerDagFileProcessorAgent] = None self._refresh_dag_dir_interval = refresh_dag_dir_interval self._notification_service_uri = notification_service_uri def start(self): self._start_dag_file_processor_manager() self._dag_runnable_reporting_thread = DagRunnableReportingThread(self._async_mode, self._dag_file_processor_agent, self._mailbox) self._dag_runnable_reporting_thread.start() self._parsing_stat_process_thread = ParsingStatRetrieveThread(self._dag_file_processor_agent) self._parsing_stat_process_thread.start() def end(self) -> None: if self._dag_file_processor_agent is not None: self._dag_file_processor_agent.terminate() if self._dag_runnable_reporting_thread is not None: self._dag_runnable_reporting_thread.stop() if self._parsing_stat_process_thread is not None: self._parsing_stat_process_thread.stop() self._dag_runnable_reporting_thread.join() self._parsing_stat_process_thread.join() self._dag_file_processor_agent.end() def terminate(self): if self._dag_file_processor_agent is not None: self._dag_file_processor_agent.end() if self._dag_runnable_reporting_thread is not None: self._dag_runnable_reporting_thread.stop() if self._parsing_stat_process_thread is not None: self._parsing_stat_process_thread.stop() def _start_dag_file_processor_manager(self): processor_factory = scheduler_job.SchedulerJob._create_dag_file_processor self._dag_file_processor_agent = DagTriggerDagFileProcessorAgent(self._dag_directory, self._max_runs, processor_factory, self._get_processor_timeout(), [], self._pickle_dags, self._async_mode, self._refresh_dag_dir_interval, self._notification_service_uri) self._dag_file_processor_agent.start() @staticmethod def _get_processor_timeout(): processor_timeout_seconds: int = conf.getint('core', 'dag_file_processor_timeout') return timedelta(seconds=processor_timeout_seconds) def is_alive(self) -> bool: return self._dag_file_processor_agent is not None \ and self._dag_runnable_reporting_thread is not None and self._dag_runnable_reporting_thread.is_alive() \ and self._parsing_stat_process_thread is not None and self._parsing_stat_process_thread.is_alive()
5,920
ffb6379f2f2611fd8aa73f3a3c15fed4550d348f
############################################################################## # # Copyright (c) 2005 Nexedi SARL and Contributors. All Rights Reserved. # Yoshinori Okuji <yo@nexedi.com> # Christophe Dumez <christophe@nexedi.com> # # WARNING: This program as such is intended to be used by professional # programmers who take the whole responsability of assessing all potential # consequences resulting from its eventual inadequacies and bugs # End users who are looking for a ready-to-use solution with commercial # garantees and support are strongly adviced to contract a Free Software # Service Company # # This program is Free Software; you can redistribute it and/or # modify it under the terms of the GNU General Public License # as published by the Free Software Foundation; either version 2 # of the License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. # ############################################################################## """ Provide a feature not present into difflib, which is generate a colored diff from a diff file/string. This code is original form ERP5VCS and was moved to here for be used in general ERP5. XXX The organisation of DiffUtils should be reviewed and reorganised in a tool if a general tool want to be provided. """ import os, re from xml.sax.saxutils import escape NBSP = '&nbsp;' NBSP_TAB = NBSP*8 NO_DIFF_COLOR = 'white' MODIFIED_DIFF_COLOR = 'rgb(253, 228, 6);'#light orange DELETED_DIFF_COLOR = 'rgb(253, 117, 74);'#light red ADDITION_DIFF_COLOR = 'rgb(83, 253, 74);'#light green class DiffFile(object): """ # Members : - path : path of the modified file - children : sub codes modified - old_revision - new_revision """ def __init__(self, raw_diff): self.children = [] self.binary = raw_diff and '@@' not in raw_diff if self.binary or not raw_diff: return self.header = raw_diff.split('@@')[0][:-1] # Getting file path in header self.path = self.header.split('====')[0][:-1].strip() # Getting revisions in header for line in self.header.splitlines(): if line.startswith('--- '): tmp = re.search('\\([^)]+\\)$', line) if tmp is not None: self.old_revision = tmp.string[tmp.start():tmp.end()][1:-1].strip() else: self.old_revision = line.replace("--- ", "") if line.startswith('+++ '): tmp = re.search('\\([^)]+\\)$', line) if tmp is not None: self.new_revision = tmp.string[tmp.start():tmp.end()][1:-1].strip() else: self.new_revision = line.replace("+++ ", "") # Splitting the body from the header self.body = os.linesep.join(raw_diff.strip().splitlines()[3:]) if not self.body.startswith('@@'): self.body = os.linesep.join(raw_diff.strip().splitlines()[4:]) # Now splitting modifications first = True tmp = [] for line in self.body.splitlines(): if line: if line.startswith('@@') and not first: self.children.append(CodeBlock(os.linesep.join(tmp))) tmp = [line, ] else: first = False tmp.append(line) self.children.append(CodeBlock(os.linesep.join(tmp))) def __nonzero__(self): return self.binary or bool(self.children) def __len__(self): return len(self.children) toHTML__roles__ = None # public def toHTML(self): """ return HTML diff """ # Adding header of the table if self.binary: return '<b>Folder or binary file or just no changes!</b><br/><br/><br/>' if not self: return '' html_list = [] html_list.append(''' <table style="text-align: left; width: 100%%; border: 0;" cellpadding="0" cellspacing="0"> <tbody> <tr> <td style="background-color: grey; text-align: center; font-weight: bold;">%s</td> <td style="background-color: black; width: 2px;"></td> <td style="background-color: grey; text-align: center; font-weight: bold;">%s</td> </tr>''' % (self.old_revision, self.new_revision)) header_color = 'grey' child_html_text = '''<tr><td style="background-color: %(headcolor)s"> &nbsp;</td><td style="background-color: black; width: 2px;"></td> <td style="background-color: %(headcolor)s">&nbsp;</td></tr><tr> <td style="background-color: rgb(68, 132, 255);font-weight: bold;">Line %(oldline)s</td> <td style="background-color: black; width: 2px;"></td> <td style="background-color: rgb(68, 132, 255);font-weight: bold;">Line %(newline)s</td> </tr>''' for child in self.children: # Adding line number of the modification html_list.append( child_html_text % {'headcolor':header_color, 'oldline':child.old_line, 'newline':child.new_line} ) header_color = 'white' # Adding diff of the modification old_code_list = child.getOldCodeList() new_code_list = child.getNewCodeList() i = 0 for old_line_tuple in old_code_list: new_line_tuple = new_code_list[i] new_line = new_line_tuple[0] or ' ' old_line = old_line_tuple[0] or ' ' i += 1 html_list.append( '''<tr style="font-family: monospace"> <td style="background-color: %s">%s</td> <td style="background-color: black; width: 2px;"></td> <td style="background-color: %s">%s</td> </tr>'''%(old_line_tuple[1], escape(old_line).replace(' ', NBSP).replace('\t', NBSP_TAB), new_line_tuple[1], escape(new_line).replace(' ', NBSP).replace('\t', NBSP_TAB)) ) html_list.append('''</tbody></table><br/>''') return '\n'.join(html_list) def getModifiedBlockList(self): """ Return a list of modified blocks List contains tuples (block object : (old_modified_code, new_modified_code)) """ if self.binary: return [] block_list = [] for child in self.children: old_line_list = [line.strip() for line, color in child.getOldCodeList() if line is not None and color in (MODIFIED_DIFF_COLOR, DELETED_DIFF_COLOR)] new_line_list = [line.strip() for line, color in child.getNewCodeList() if line is not None and color in (MODIFIED_DIFF_COLOR, ADDITION_DIFF_COLOR)] if old_line_list or new_line_list: block_list.append((child,(old_line_list, new_line_list))) return block_list class CodeBlock: """ A code block contains several SubCodeBlocks Members : - old_line : line in old code (before modif) - new line : line in new code (after modif) Methods : - getOldCodeList() : return code before modif - getNewCodeList() : return code after modif Note: the code returned is a list of tuples (code line, background color) """ def __init__(self, raw_diff): # Splitting body and header self.body = os.linesep.join(raw_diff.splitlines()[1:]) self.header = raw_diff.splitlines()[0] # Getting modifications lines tmp = re.search('^@@ -\d+', self.header) self.old_line = tmp.string[tmp.start():tmp.end()][4:] tmp = re.search('\+\d+', self.header) self.new_line = tmp.string[tmp.start():tmp.end()][1:] # Splitting modifications in SubCodeBlocks in_modif = False self.children = [] tmp = [] for line in self.body.splitlines(): if line: if (line.startswith('+') or line.startswith('-')): if in_modif: tmp.append(line) else: self.children.append(SubCodeBlock(os.linesep.join(tmp))) tmp = [line, ] in_modif = True else: if in_modif: self.children.append(SubCodeBlock(os.linesep.join(tmp))) tmp = [line, ] in_modif = False else: tmp.append(line) self.children.append(SubCodeBlock(os.linesep.join(tmp))) def getOldCodeList(self): """ Return code before modification """ tmp = [] for child in self.children: tmp.extend(child.getOldCodeList()) return tmp def getNewCodeList(self): """ Return code after modification """ tmp = [] for child in self.children: tmp.extend(child.getNewCodeList()) return tmp class SubCodeBlock: """ a SubCodeBlock contain 0 or 1 modification (not more) """ def __init__(self, code): self.body = code self.modification = self._getModif() self.old_code_length = self._getOldCodeLength() self.new_code_length = self._getNewCodeLength() # Choosing background color if self.modification == 'none': self.color = NO_DIFF_COLOR elif self.modification == 'change': self.color = MODIFIED_DIFF_COLOR elif self.modification == 'deletion': self.color = DELETED_DIFF_COLOR else: # addition self.color = ADDITION_DIFF_COLOR def _getModif(self): """ Return type of modification : addition, deletion, none """ nb_plus = 0 nb_minus = 0 for line in self.body.splitlines(): if line.startswith("-"): nb_minus -= 1 elif line.startswith("+"): nb_plus += 1 if (nb_plus == 0 and nb_minus == 0): return 'none' if (nb_minus == 0): return 'addition' if (nb_plus == 0): return 'deletion' return 'change' def _getOldCodeLength(self): """ Private function to return old code length """ nb_lines = 0 for line in self.body.splitlines(): if not line.startswith("+"): nb_lines += 1 return nb_lines def _getNewCodeLength(self): """ Private function to return new code length """ nb_lines = 0 for line in self.body.splitlines(): if not line.startswith("-"): nb_lines += 1 return nb_lines def getOldCodeList(self): """ Return code before modification """ if self.modification == 'none': old_code = [(x, 'white') for x in self.body.splitlines()] elif self.modification == 'change': old_code = [self._getOldCodeList(x) for x in self.body.splitlines() \ if self._getOldCodeList(x)[0]] # we want old_code_list and new_code_list to have the same length if(self.old_code_length < self.new_code_length): filling = [(None, self.color)] * (self.new_code_length - \ self.old_code_length) old_code.extend(filling) else: # deletion or addition old_code = [self._getOldCodeList(x) for x in self.body.splitlines()] return old_code def _getOldCodeList(self, line): """ Private function to return code before modification """ if line.startswith('+'): return (None, self.color) if line.startswith('-'): return (' ' + line[1:], self.color) return (line, self.color) def getNewCodeList(self): """ Return code after modification """ if self.modification == 'none': new_code = [(x, 'white') for x in self.body.splitlines()] elif self.modification == 'change': new_code = [self._getNewCodeList(x) for x in self.body.splitlines() \ if self._getNewCodeList(x)[0]] # we want old_code_list and new_code_list to have the same length if(self.new_code_length < self.old_code_length): filling = [(None, self.color)] * (self.old_code_length - \ self.new_code_length) new_code.extend(filling) else: # deletion or addition new_code = [self._getNewCodeList(x) for x in self.body.splitlines()] return new_code def _getNewCodeList(self, line): """ Private function to return code after modification """ if line.startswith('-'): return (None, self.color) if line.startswith('+'): return (' ' + line[1:], self.color) return (line, self.color)
5,921
08e5e8515528eae400a59bfc0c58b8d7b4affd7e
# coding: utf-8 ## ROC for CLEF-IP2010 patents ####### ROC for clef-ip2010 patents # In[ ]: def vectorize_corpus(corpus,tokenizer,vocabulary,max_ngram_size): # tokenize text from sklearn.feature_extraction.text import CountVectorizer from sklearn.feature_extraction.text import TfidfTransformer from clef_globals import * # generate corpus vectors vectorizer = CountVectorizer(min_df=min_df,tokenizer=tokenizer,ngram_range=(1,max_ngram_size),vocabulary=vocabulary,stop_words={}) corpus_vectors = vectorizer.fit_transform(corpus) # generate tfidf vectors transformer = TfidfTransformer() corpus_tfidf_vectors = transformer.fit_transform(corpus_vectors) return corpus_tfidf_vectors # In[ ]: # given classifier predictions probabilities, return predictions with top n probabilities > 0.5 for each instance or greatest one if all are <=0.5 def get_max_n_pred(pred_proba, n_pred, threshold): import heapq import numpy max_n_pred = numpy.ndarray(shape=pred_proba.shape) for i in range(len(pred_proba)): largest_n_proba = heapq.nlargest(n_pred,pred_proba[i]) max_n_pred[i] = numpy.array(((pred_proba[i]>threshold) & (pred_proba[i]>=largest_n_proba[len(largest_n_proba)-1]) & 1)) if max_n_pred[i].sum(axis=0)==0: # at least one label should be returned max_n_pred[i] = numpy.array(((pred_proba[i]>=max(pred_proba[i])) & 1)) return max_n_pred # In[ ]: # reference: http://scikit-learn.org/stable/modules/model_evaluation.html#multiclass-and-multilabel-classification def classify(labels,corpus_tfidf_vectors,test_size,max_labels,threshold): from sklearn.preprocessing import MultiLabelBinarizer from sklearn.multiclass import OneVsRestClassifier from sklearn.svm import SVC from sklearn.svm import LinearSVC from sklearn.linear_model import SGDClassifier from sklearn.linear_model import LogisticRegression from sklearn.naive_bayes import MultinomialNB from sklearn.cross_validation import train_test_split from sklearn import metrics import numpy # binarize the labels mlb = MultiLabelBinarizer() labels_binarized = mlb.fit_transform(labels) # train/test split #corpus_tfidf_vectors, labels_binarized = shuffle(corpus_tfidf_vectors, labels_binarized) print 'test size=0.2' x_train, x_test, y_train, y_test = train_test_split(corpus_tfidf_vectors, labels_binarized, test_size=0.2, random_state=1) # classify #cls = OneVsRestClassifier(LogisticRegression(class_weight='auto')) #cls = OneVsRestClassifier(LogisticRegression()) #cls = OneVsRestClassifier(MultinomialNB(alpha=0.01)) #cls = OneVsRestClassifier(SVC(kernel='linear',probability=True,n_iter=1000)) cls = OneVsRestClassifier(SGDClassifier(loss='hinge',penalty='l2',max_iter=1000,n_jobs=5)) #cls = OneVsRestClassifier(LinearSVC()) cls.fit(x_train, y_train) pred_proba = 1/(1+numpy.exp(-1*cls.decision_function(x_test))) # evaluate #pred_proba = cls.predict_proba(x_test) #print len(pred_proba[0]) # make sure it is 121 pred_labels = mlb.inverse_transform(get_max_n_pred(pred_proba, max_labels,threshold)) actual_labels = mlb.inverse_transform(y_test) result = 'threshold: {0}, precision: {1}, recall: {2}, f1: {3}'.format(threshold,metrics.precision_score(actual_labels, pred_labels, average='micro'),metrics.recall_score(actual_labels, pred_labels, average='micro'),metrics.f1_score(actual_labels, pred_labels, average='micro')) print result # In[ ]: def test_lemmatized_unigrams(corpus,labels,vocabulary_src,with_stopwords_removal,use_chi_features): import thread from lemmatizing_tokenizer import LemmaTokenizer from clef_globals import * from clef_vocabulary_loader import load_vocabulary max_ngram_size = 1 tokenizer = LemmaTokenizer() if with_stopwords_removal==False: stopwords_pattern = '' else: stopwords_pattern = '_stopwords' if use_chi_features==False: chi_features_pattern = '' else: chi_features_pattern = '_chi' # load vocabulary vocabulary_tbl_name = 'clef_2010_{0}_lemmas{1}_unigrams{2}_df{3}_tf{4}'.format(vocabulary_src,chi_features_pattern,stopwords_pattern,min_df,min_tf) vocabulary = load_vocabulary(vocabulary_tbl_name) # generate tfidf vectors corpus_tfidf_vectors = vectorize_corpus(corpus,tokenizer,vocabulary,max_ngram_size) # classify & evaluate classify(labels,corpus_tfidf_vectors,test_set_size,max_labels,0.5) for i in range(0,101): #thread.start_new_thread(classify, (labels,corpus_tfidf_vectors,test_set_size,max_labels,i/100.0)) classify(labels,corpus_tfidf_vectors,test_set_size,max_labels,i/100.0) # In[ ]: def test(vocabulary_src): from clef_corpus_loader import load_corpus_with_labels # load clef patents with class lables from DB using only vocabulary_src as main field for vocabulary (e.g., abstract, description, claims...) corpus_data = load_corpus_with_labels(vocabulary_src) corpus = corpus_data['corpus'] labels = corpus_data['labels'] labels_dic = corpus_data['labels_dic'] labels_arr = corpus_data['labels_arr'] print 'done loading {0} records and {1} labels.'.format(len(corpus),len(labels_dic)) test_lemmatized_unigrams(corpus,labels,vocabulary_src,True,True) # In[ ]: # test using abstracts vocabulary test('abstract')
5,922
fcc12b26308e3031de7e8fcf4ad43ec92279d400
__author__ = 'jamjiang' class Person: def __init__(self, name): self.name = name def sayHi(self): print 'hi!, I am', self.name david = Person('David') david.sayHi() Person('leo').sayHi()
5,923
1298c2abae519a5365cc0d9d406196db987eb219
from collections import defaultdict def k_most_frequent(arr:list, k:int): ''' ''' counts = defaultdict(int) for n in nums: counts[n] += 1 counts = [(k,v) for k,v in counts.items()] ordered = list(reversed(sorted(counts, key=lambda d: d[1]))) return [o[0] for o in ordered[:k]] nums = [1,6,2,1,6,1,4,2,6,1] k_most_frequent(nums, 3)
5,924
0eaba8f570772de864f52168a597b47a4150d015
# -*- coding:utf-8 -*- from common import * import itertools def iteration_spider(): max_errors = 5 num_errors = 0 for page in itertools.count(1): url = 'http://example.webscraping.com/view/-{}'.format(page) html = download(url) if html is None: num_errors += 1 if num_errors == max_errors: break else: num_errors = 0 if __name__ == '__main__': iteration_spider()
5,925
649c0c0f170b50fe51f5eaf11908e968f66625c9
import os import shutil def flatCopyWithExt(srcDir, dstDir, ext): if not os.path.exists(dstDir): os.makedirs(dstDir) for basename in os.listdir(srcDir): if basename.endswith(ext): pathname = os.path.join(srcDir, basename) if os.path.isfile(pathname): shutil.copy2(pathname, dstDir) def moveSDLIncludes(): flatCopyWithExt("./ext/SDL2/core/code/include/", "./ext/SDL2/core/include/", ".h") flatCopyWithExt("./ext/SDL2/SDL2-image/code/", "./ext/SDL2/SDL2-image/include/", ".h") flatCopyWithExt("./ext/SDL2/SDL2-mixer/code/", "./ext/SDL2/SDL2-mixer/include/", ".h") flatCopyWithExt("./ext/SDL2/SDL2-ttf/code/", "./ext/SDL2/SDL2-ttf/include/", ".h")
5,926
9d0727970c760a9a8123c5c07359ba5c538cea3c
# CS 5010 Project # Team Metro # Test the data cleaning import unittest from cleaning_data import dfClean # import the dataframe we created after cleaning the data class DataTypesTestCase(unittest.TestCase): # we will test that each column has the correct data type # note that there is a strange occurence seen below when converting to a pandas dataframe def test_is_holiday_a_string(self): holiday = dfClean.iloc[4908,0] self.assertTrue(isinstance(holiday, str)) def test_is_temperature_a_float(self): temp = dfClean.iloc[4908,1] self.assertTrue(isinstance(temp, float)) def test_is_rain_a_float(self): rain = dfClean.iloc[4908,2] self.assertTrue(isinstance(rain, float)) def test_is_snow_a_float(self): snow = dfClean.iloc[4908,3] self.assertTrue(isinstance(snow, float)) def test_is_clouds_an_int(self): clouds = dfClean.iloc[4908,4] self.assertEqual(str(type(clouds)), "<class 'numpy.int64'>") # pandas converts all of the ints in the list to numpy.int64 # could not figure out how to avoid this def test_is_weather_main_a_string(self): weather = dfClean.iloc[4908,5] self.assertTrue(isinstance(weather, str)) def test_is_weather_descrip_a_string(self): weather = dfClean.iloc[4908,6] self.assertTrue(isinstance(weather, str)) def test_is_date_time_a_string(self): dateTime = dfClean.iloc[4908,7] self.assertTrue(isinstance(dateTime, str)) def test_is_traffic_an_int(self): traffic = dfClean.iloc[4908,8] self.assertEqual(str(type(traffic)), "<class 'numpy.int64'>") def test_is_month_an_int(self): month = dfClean.iloc[4908,9] self.assertEqual(str(type(month)), "<class 'numpy.int64'>") def test_is_day_an_int(self): day = dfClean.iloc[4908,10] self.assertEqual(str(type(day)), "<class 'numpy.int64'>") def test_is_year_an_int(self): year = dfClean.iloc[4908,11] self.assertEqual(str(type(year)), "<class 'numpy.int64'>") def test_is_hour_an_int(self): hour = dfClean.iloc[4908,12] self.assertEqual(str(type(hour)), "<class 'numpy.int64'>") class DateTimeFormatTestCase(unittest.TestCase): def test_does_month_have_two_digits(self): i = 0 booln = True while i < len(dfClean): if dfClean.iloc[i,7][2] != "/": booln = False i += 1 self.assertTrue(booln) # make sure that every data point has a two digit month # in cleaning, 0 should have been added to make it two digits def test_does_day_have_two_digits(self): i = 0 booln = True while i < len(dfClean): if dfClean.iloc[i,7][5] != "/": booln = False i += 1 self.assertTrue(booln) # all months in the date/time string should have two digits after cleaning def test_does_year_have_four_digits(self): i = 0 booln = True while i < len(dfClean): if dfClean.iloc[i,7][6:8] != "20": booln = False i += 1 self.assertTrue(booln) # all years should be in the form 20xx in the date/time string def test_does_hour_have_two_digits(self): i = 0 booln = True # since we already tested all of the other cleaning items on the date/time string while i < len(dfClean): # we can check the hour by checking the length of the whole string if len(dfClean.iloc[i,7]) != 16: # all in column should have the form "mm/dd/yyyy hh:00" booln = False i += 1 self.assertTrue(booln) # in cleaning, 0 should have been added to make a one digit hour (0-9) two digits (00-09) # without the other tests this would be a way to check all in one test but would not # tell us what part of the cleaning on the date/time string did not work correctly class AppendColumnsTestCase(unittest.TestCase): # we will check that each of the four new columns (month, day, year, and hour) # appended correctly to the dataset def test_is_month_column_appending_correctly(self): i = 0 booln = True while i < len(dfClean): if int(dfClean.iloc[i,9]) != int(dfClean.iloc[i,7][:2]): booln = False i += 1 self.assertTrue(booln) # we check that the month in the month column matches that in the original date/time column def test_is_day_column_apending_correctly(self): i = 0 booln = True while i < len(dfClean): if int(dfClean.iloc[i,10]) != int(dfClean.iloc[i,7][3:5]): booln = False i += 1 self.assertTrue(booln) # we check that the day in the day column matches that in the original date/time column def test_is_year_column_apending_correctly(self): i = 0 booln = True while i < len(dfClean): if int(dfClean.iloc[i,11]) != int(dfClean.iloc[i,7][6:10]): booln = False i += 1 self.assertTrue(booln) # we check that the year in the year column matches that in the original date/time column def test_is_hour_column_apending_correctly(self): i = 0 booln = True while i < len(dfClean): if int(dfClean.iloc[i,12]) != int(dfClean.iloc[i,7][11:13]): booln = False i += 1 self.assertTrue(booln) # we check that the hour in the hour column matches that in the original date/time column class HolidayTestCase(unittest.TestCase): # we test that every hour of the same day has a consistent holiday def test_are_all_hours_correct_holiday(self): i = 0 booln = True hol = "None" while i < len(dfClean): if dfClean.iloc[i,12] == 0: hol = dfClean.iloc[i,0] else: if dfClean.iloc[i,0] != hol: booln = False i += 1 self.assertTrue(booln) class UniqueDataPointsTestCase(unittest.TestCase): # this test ensures that no two data points have the exact same date and hour def test_are_all_datetimes_unique(self): i = 1 booln = True while i < len(dfClean): if dfClean.iloc[i,7] == dfClean.iloc[i-1,7]: booln = False i += 1 self.assertTrue(booln) class TemperatureConversionTestCase(unittest.TestCase): # we test that the temperature was converted to Fahrenheit # note that since we overrode the original temperature, we simply check for # outlier that would make sense as Kelvin values but not Fahrenheit values # This how we discovered there were some missing temperatures input as 0 Kelvin # because they converted to -450 Fahrenheit def test_is_temp_converting_from_kelvin_to_F(self): i = 1 booln = True while i < len(dfClean): if (dfClean.iloc[i,1] > 120) | (dfClean.iloc[i,1] < -50): booln = False i += 1 self.assertTrue(booln) if __name__ == '__main__': unittest.main()
5,927
7636925982434b12307383ba7b01f931f7ea6e24
from mininet.cli import CLI from mininet.term import makeTerms from mininet.util import irange from log import log from utils import (UITextStyle, display) from dijkstra import (get_routing_decision, get_route_cost) # Check if route directly connects two switches def isDirect(route): return (len(route) == 2) # Add purple background for indirect routes def brightLabel(text): return (UITextStyle.BackgroundColor.purple + str(text) + UITextStyle.Format.reset) # Execute commands one by one def __wait__(*commandList): steps = len(commandList) for i in range(steps): commandList[i]('') display.prompt('\n\nPress <Return> to continue (%s/%s)' % (i + 1, steps)) try: x = input('') except: x = '' # Mininet Command Line Interface extension class DongPhamTestCli(CLI): prompt = 'dongpham> ' def __init__(self, _mininet, _env): self.env = _env self.net = _mininet self._testCLI = {} CLI.__init__(self, _mininet) # Tell the controller to do a command def do(self, shell, quiet=False): if (quiet): return self.mn.controller.cmd(shell) return self.mn.controller.cmdPrint(shell) def doPrint(self, shell): display.cmdHighlight(True) self.mn.controller.cmdPrint(shell) display.cmdHighlight(False) # Run all commands in the wait list def do_all(self, _): __wait__( # Show ip self.do_ips, # Routing commands self.do_weights, self.do_costs, self.do_routes, self.do_paths, # Flow commands self.do_flows, self.do_stats ) # Show object info # info [node1, node2, ...] def do_info(self, line): locals = self.getLocals() _nodes = line.split() display.section("All functions") if not (_nodes): _nodes = self.mn.keys() for n in _nodes: if not (locals.__contains__(n)): break obj = locals[n] display.subsection('%s (%s)' % (n, obj.IP())) print(dir(obj)) # Show IP addresses # ips def do_ips(self, _): display.section("IP Addresses") locals = self.getLocals() def showIP(*keys): for key in keys: display.message('%s\t%s' % (key.name, key.IP())) def showAll(*keys): for key in keys: display.message('%s\t%s\t%s' % (key.name, key.IP(), key.MAC())) # For each node display.subsection('Controllers') for c in self.mn.controllers: showIP(locals[c.name]) display.subsection('Switches') for s in self.mn.switches: showIP(locals[s.name]) display.subsection('Hosts') for h in self.mn.hosts: showAll(locals[h.name]) #MARK: - Routing # Show link weights # weights def do_weights(self, _): display.section("Weights") log.infoln('Link\t\tWeight') log.infoln('--------------------') for (i, j, w) in self.mn.topo._slinks: log.infoln('{s%s, s%s}\t%s' % (i, j, w)) # Show costs of reaching every other switch # costs def do_costs(self, _): # Algorithm input switches = self.mn.topo.switches() weights = [('s'+str(i[0]), 's'+str(i[1]), i[2]) for i in self.mn.topo._slinks] # Print cost of reaching 'end' switch from 'start' switch display.section("Total path costs") print('From\\To'), ('\t'.join(switches)) for start in switches: print(start + '\t'), for end in switches: if (start == end): print('--\t'), continue route = get_routing_decision(start, weights, end) cost = get_route_cost([route]) if (isDirect(route)): # Print result for directly connected switches print(cost), else: # Print and highlight routes with intermediate switches print(brightLabel(cost)), print('\t'), print('') # Show least-cost paths from every switch to every other switch # routes def do_routes(self, _): # Algorithm input switches = self.mn.topo.switches() weights = [('s'+str(i[0]), 's'+str(i[1]), i[2]) for i in self.mn.topo._slinks] # Print next hop switch display.section("First-Hop with lowest cost") print('From\\To\t'), ('\t'.join(switches)) for start in switches: print(start + '\t'), for end in switches: if (start == end): print('--\t'), continue route = get_routing_decision(start, weights, end) if (isDirect(route)): # Print result for directly connected switches print(end), else: # Print and highlight routes with intermediate switches print(brightLabel(route[1])), print('\t'), print('') # Show the complete shortest path from one switch to every other switch # paths def do_paths(self, line): # Algorithm input switches = self.mn.topo.switches() weights = [('s'+str(i[0]), 's'+str(i[1]), i[2]) for i in self.mn.topo._slinks] # Least cost paths to every node display.section("Least-cost paths to other nodes") display.message('From -> To\tCost\t\tFull Shortest Path') for start in switches: display.subsection('%s' % start) for end in switches: if (start == end): continue route = get_routing_decision(start, weights, end) cost = get_route_cost([route]) display.message('%s -> %s\t%s\t\t%s' % (start, end, cost, route)) #MARK: - OpenFlow # Display flows # flows def do_flows(self, _line): display.section("Showing all flows of all OVSSwitches") for s in self.mn.switches: self.doPrint('sudo ovs-ofctl dump-flows %s' % s) # Delete flows # deleteFlows def do_deleteFlows(self, _line): display.section("Deleting all flows of all OVSSwitches") for s in self.mn.switches: self.doPrint('sudo ovs-ofctl del-flows %s' % s) # Display flow statistics # stats def do_stats(self, _): display.section("OpenFlow: Sent/Received Packets") display.message( 'Packets passing through a switch on the way host with IP address = "nw_dst"') for s in self.mn.switches: display.subsection('%s - Traffic' % s.name) self.doPrint( 'sudo ovs-ofctl dump-flows %s | grep -e "n_packets=[1-9]*.*n_bytes=[1-9]*.*nw_dst=10.10.[1-9].[1-9]" -To' % (s.name)) # MARK: - Run on every node # arps def do_arps(self, _line): display.section("ARP caches of all hosts") sh = 'arp -a' for h in self.mn.hosts: h.cmdPrint(sh) # netstats def do_netstats(self, _line): display.section("Routing Tables") sh = 'netstat -rn' display.subsection('Hosts') for h in self.mn.hosts: h.cmdPrint(sh) display.subsection('Controller') self.doPrint(sh) # ifconfigs def do_ifconfigs(self, _line): display.section("Showing Interface Configuration") sh = 'ifconfig -a' display.subsection('Hosts') for h in self.mn.hosts: h.cmdPrint(sh) display.subsection('Controller') self.doPrint(sh) #MARK: - Other def do_xxx_testFlows1(self, _line): display.section("Adding test flows to Tiny Network") self.do('sudo ovs-ofctl add-flow s1 ip,ip_dst=10.0.0.2,actions=output:1') self.do('sudo ovs-ofctl add-flow s1 ip,ip_dst=10.0.0.1,actions=output:4') self.do('sudo ovs-ofctl add-flow s2 ip,ip_dst=10.0.0.1,actions=output:1') self.do('sudo ovs-ofctl add-flow s2 ip,ip_dst=10.0.0.2,actions=output:3') self.do('sudo ovs-ofctl add-flow s1 arp,arp_tpa=10.0.0.2,actions=output:1') self.do('sudo ovs-ofctl add-flow s1 arp,arp_tpa=10.0.0.1,actions=output:4') self.do('sudo ovs-ofctl add-flow s2 arp,arp_tpa=10.0.0.1,actions=output:1') self.do('sudo ovs-ofctl add-flow s2 arp,arp_tpa=10.0.0.2,actions=output:3') def do_xxx_traffic(self, _line): # display.section("Monitoring sent and received packets of all hosts") for h in self.mn.hosts: h.cmdPrint('tcpdump -i %s' % h.defaultIntf().name) def do_xxx_xterms(self, _line): locals = self.getLocals() terms = makeTerms([locals[name] for name in ['h1', 'h2', 's1', 's2']]) self.mn.terms += terms def do_xxx_sharks(self, line): display.section("Launching Wireshark") sh = 'sudo wireshark &' locals = self.getLocals() _nodes = line.split() if not (_nodes): _nodes = self.mn.keys() for n in _nodes: if not (locals.__contains__(n)): break obj = locals[n] obj.cmdPrint(sh)
5,928
cfea7848dfb41c913e5d8fec2f0f4f8afaaa09f3
import sys reload(sys) sys.setdefaultencoding('utf-8') import xml.etree.ElementTree as ET tree = ET.parse('iliad1.xml') root = tree.getroot() file = open('iliad1_clean.txt','w') for l in root.iter('l'): file.write(''.join(l.itertext()) + "\n") file.close()
5,929
08c3155a5fbf6c94f5885c12cfc7c917313ae9c7
from abc import ABCMeta, abstractmethod, ABC from domain.models.network_information import NetworkInformation class AbstractTensorboardExportService(ABC): __metaclass__ = ABCMeta @abstractmethod def save_tensorboard(self, network_info: NetworkInformation) -> None: raise NotImplementedError
5,930
2678aac08104a580e866984bc4cf4adf8cb8ac5c
from __future__ import division, print_function, unicode_literals import sys import os sys.path.insert(0, os.path.join(os.path.dirname(__file__), '..')) from pyglet.gl import * from pyglet.window import key from cocos.actions import * from cocos.director import director from cocos.layer import Layer from cocos.scene import Scene from cocos.sprite import Sprite from haiku import generate_haiku from time import time def get_steps(index): return Scene(FontLayer(title="", subtitle='\n'.join(generate_haiku())), SpriteMoveTo(index)) class SpriteLayer(Layer): is_event_handler = True #: enable pyglet's events def __init__(self, index=1): super(SpriteLayer, self).__init__() self.index = index self.image = pyglet.resource.image('flat-black-l.png') self.image.anchor_x = self.image.width self.image.anchor_y = self.image.height def on_key_release(self, keys, mod): # LEFT: go to previous scene # RIGTH: go to next scene # ENTER: restart scene max_steps = 8 if keys == key.LEFT: self.index -= 1 if self.index < 0: self.index = max_steps - 1 elif keys == key.RIGHT: self.index += 1 if self.index >= 8: self.index = 0 if keys in (key.LEFT, key.RIGHT, key.ENTER): director.replace(get_steps(self.index)) return True # def on_exit( self ): # for o in self.objects: # o.stop() class SpriteMoveTo(SpriteLayer): def on_enter(self): super(SpriteMoveTo, self).on_enter() sprite3 = Sprite(self.image) self.add(sprite3) x, y = divmod(self.index, 3) sprite3.position = x * 100 +100 , y * 100 + 100 # sprite3.do(MoveTo((620, 300), 1)) class FontLayer(Layer): def __init__(self, title="Sprite Exmaple #", subtitle="Goto()"): super(FontLayer, self).__init__() self.title = title self.subtitle = subtitle self.batch = pyglet.graphics.Batch() self.text_title = pyglet.text.Label(self.title, font_size=32, x=5, y=director.get_window_size()[1], anchor_x='left', anchor_y='top', batch=self.batch) self.text_subtitle = pyglet.text.Label(self.subtitle, multiline=True, width=600, font_size=16, x=5, y=director.get_window_size()[1] - 80, anchor_x='left', anchor_y='top', batch=self.batch) self.text_help = pyglet.text.Label("Press LEFT / RIGHT for prev/next test, " "ENTER to restart test", font_size=16, x=director.get_window_size()[0] // 2, y=20, anchor_x='center', anchor_y='center', batch=self.batch) def draw(self): super(FontLayer, self).draw() self.batch.draw() if __name__ == "__main__": director.init(resizable=True, caption='SuperStepper') director.run(get_steps(1))
5,931
f19056222be713c1556817d852af14d04483c9a3
i = 0 num = '' while len(num) < 1e6: i += 1 num += str(i) prod = 1 for i in xrange(0, 7): prod *= int(num[10 ** i - 1]) print prod
5,932
b3c22b4a453aa55da980b090df2749ff9f1066e6
#game that has a timer and you need to stop the timer #with 0 at the end. import simplegui #necessary global variables #time for the timer time = 0 #the display for the timer(string form) watch = '' #tries and correct presses tries = 0 correct = 0 #changes time to watch(number to string of form A:BC.D) def format(): global time, watch t = time deciseconds = t % 10 remains = t - deciseconds seconds = (remains % 600) / 10 minutes = remains / 600 if seconds<10: zero = '0' else: zero = '' watch = str(minutes) + ":" + zero + str(seconds) + "." + str(deciseconds) #increase the time def increment(): global time time = time + 1 #start the timer def start(): timer.start() #stop the timer + claculate the tries and correct stops def stop(): global correct, tries timer.stop() if time != 0: tries = tries + 1 if time % 10 == 0: correct = correct + 1 #reset all values def reset(): global time, correct, tries time, correct, tries = 0,0,0 stop() #necessary drawings def draw(canvas): format() canvas.draw_text(str(correct), (253, 30), 30, 'white') canvas.draw_text('/', (270, 30), 30, 'white') canvas.draw_text(str(tries), (280, 30), 30, 'white') canvas.draw_text(watch, (70, 130), 60,'white') #frame and event handlers frame = simplegui.create_frame("StOpWaTcH: gAmE", 320, 200) button1 = frame.add_button("Start timer", start, 100) button2 = frame.add_button("Stop timer", stop, 100) button3 = frame.add_button("Resrt timer", reset, 100) frame.set_draw_handler(draw) timer = simplegui.create_timer(100, increment) #start of the game frame.start()
5,933
f4519fa82ffc6bf945c7bb36d3761a708a06f641
import os from flask import Flask, jsonify, request, abort, make_response from flask_sqlalchemy import SQLAlchemy from .models import User from .config import app_config app = Flask(__name__) app.config.from_object(app_config[os.getenv('FLASK_ENV', 'production')]) db = SQLAlchemy(app) @app.route('/api/v1/users/<int:user_id>', methods=['GET']) def get_user(user_id): try: user = User.query.filter_by(id=user_id).first() return jsonify({'user': user.serialize}) except: abort(404) @app.route('/api/v1/users', methods=['POST']) def create_user(): if not request.json or not 'firstName' or not 'lastName' in request.json: abort(400) user = User(request.get_json()['firstName'], request.get_json()['lastName']) db.session.add(user) db.session.commit() return jsonify({'user': user.serialize}), 201 @app.errorhandler(404) def not_found(error): return make_response(jsonify({'error': 'Not found'}), 404) @app.errorhandler(400) def not_found(error): return make_response(jsonify({'error': 'Bad Request'}), 400) @app.errorhandler(405) def not_found(error): return make_response(jsonify({'error': 'Method Not Allowed'}), 405)
5,934
f3aaa6ae7a9a57946bdb035a4d52e84541c1a292
import turtle from turtle import color import random screen = turtle.Screen() screen.setup(width=500, height=400) colours = ["red", "pink", "blue", "purple", "black", "green"] y_pos = [100, 60, 20, -20, -60, -100] user_bet = screen.textinput(title="Make your bet", prompt="Which turtle will win? Choose a colour: ") is_race_on = False all_racers = [] class Racer(turtle.Turtle): # def __init__(self, color, x, y): def __init__(self, color, x, y): super().__init__(shape="turtle") self.color(color) self.penup() self.goto(x=x, y=y) def race(self): self.forward(random.randint(0, 10)) for i in range(0, 6): racer = Racer(colours[i], -230, y_pos[i]) all_racers.append(racer) if user_bet: is_race_on = True while is_race_on: for racer in all_racers: if racer.xcor() > 230: is_race_on = False winning_colour = racer.pencolor() if winning_colour == user_bet: print( f"You won! The winning turtle colour was {winning_colour}.") else: print( f"You lost! The winning turtle colour was {winning_colour}.") racer.race() screen.exitonclick()
5,935
cc81e13bba0ea0186966bce7f5aac05bb106e971
import sys import os def my_add(a, b): return a + b
5,936
d0991d8ea47379a0c1de836b5d215c99166ad049
import sys sys.path.append('../') import constants as cnst import os os.environ['PYTHONHASHSEED'] = '2' import tqdm from model.stg2_generator import StyledGenerator import numpy as np from my_utils.visualize_flame_overlay import OverLayViz from my_utils.flm_dynamic_fit_overlay import camera_ringnetpp from my_utils.generic_utils import save_set_of_images import constants from dataset_loaders import fast_image_reshape import torch from my_utils import generic_utils from my_utils.eye_centering import position_to_given_location from copy import deepcopy from my_utils.photometric_optimization.models import FLAME from my_utils.photometric_optimization import util def ge_gen_in(flm_params, textured_rndr, norm_map, normal_map_cond, texture_cond): if normal_map_cond and texture_cond: return torch.cat((textured_rndr, norm_map), dim=1) elif normal_map_cond: return norm_map elif texture_cond: return textured_rndr else: return flm_params def corrupt_flame_given_sigma(flm_params, corruption_type, sigma, jaw_sigma, pose_sigma): # import ipdb; ipdb.set_trace() # np.random.seed(2) corrupted_flame = deepcopy(flm_params) if corruption_type == 'shape' or corruption_type == 'all': corrupted_flame[:, :10] = flm_params[:, :10] + \ np.clip(np.random.normal(0, sigma, flm_params[:, :10].shape), -3 * sigma, 3 * sigma).astype('float32') if corruption_type == 'exp_jaw'or corruption_type == 'all': # Expression corrupted_flame[:, 100:110] = flm_params[:, 100:110] + \ np.clip(np.random.normal(0, sigma, flm_params[:, 100:110].shape), -3 * sigma, 3 * sigma).astype('float32') # Jaw pose corrupted_flame[:, 153] = flm_params[:, 153] + \ np.random.normal(0, jaw_sigma, corrupted_flame.shape[0]) if corruption_type == 'pose' or corruption_type == 'all': # pose_perturbation = np.random.normal(0, pose_sigma[i], (corrupted_flame.shape[0], 3)) # corrupted_flame[:, 150:153] += np.clip(pose_perturbation, -3 * pose_sigma[i], 3 * pose_sigma[i]) pose_perturbation = np.random.normal(0, pose_sigma, (corrupted_flame.shape[0],)) corrupted_flame[:, 151] = flm_params[:, 151] + \ np.clip(pose_perturbation, -3 * pose_sigma, 3 * pose_sigma) return corrupted_flame # General settings save_images = True code_size = 236 use_inst_norm = True core_tensor_res = 4 resolution = 256 alpha = 1 step_max = int(np.log2(resolution) - 2) num_smpl_to_eval_on = 128 use_styled_conv_stylegan2 = True flength = 5000 cam_t = np.array([0., 0., 0]) camera_params = camera_ringnetpp((512, 512), trans=cam_t, focal=flength) # Uncomment the appropriate run_id run_ids_1 = [29, ] # with sqrt(2) # run_ids_1 = [7, 24, 8, 3] # run_ids_1 = [7, 8, 3] # run_ids_1 = [7] settings_for_runs = \ {24: {'name': 'vector_cond', 'model_idx': '216000_1', 'normal_maps_as_cond': False, 'rendered_flame_as_condition': False, 'apply_sqrt2_fac_in_eq_lin': False}, 29: {'name': 'full_model', 'model_idx': '294000_1', 'normal_maps_as_cond': True, 'rendered_flame_as_condition': True, 'apply_sqrt2_fac_in_eq_lin': True}, 7: {'name': 'flm_rndr_tex_interp', 'model_idx': '051000_1', 'normal_maps_as_cond': False, 'rendered_flame_as_condition': True, 'apply_sqrt2_fac_in_eq_lin': False}, 3: {'name': 'norm_mp_tex_interp', 'model_idx': '203000_1', 'normal_maps_as_cond': True, 'rendered_flame_as_condition': False, 'apply_sqrt2_fac_in_eq_lin': False}, 8: {'name': 'norm_map_rend_flm_no_tex_interp', 'model_idx': '009000_1', 'normal_maps_as_cond': True, 'rendered_flame_as_condition': True, 'apply_sqrt2_fac_in_eq_lin': False},} overlay_visualizer = OverLayViz() # overlay_visualizer.setup_renderer(mesh_file=None) flm_params = np.zeros((num_smpl_to_eval_on, code_size)).astype('float32') fl_param_dict = np.load(cnst.all_flame_params_file, allow_pickle=True).item() np.random.seed(2) for i, key in enumerate(fl_param_dict): flame_param = fl_param_dict[key] shape_params = np.concatenate((np.random.normal(0, 1, [3,]), np.zeros(97))).astype('float32') exp_params = np.concatenate((np.random.normal(0, 1, [3,]), np.zeros(47))).astype('float32') # +- pi/4 for bad samples +- pi/8 for good samples # pose = np.array([0, np.random.uniform(-np.pi/4, np.pi/4, 1), 0, # np.random.uniform(0, np.pi/12, 1), 0, 0]).astype('float32') pose = np.array([0, np.random.uniform(-np.pi / 8, np.pi / 8, 1), 0, np.random.uniform(0, np.pi / 12, 1), 0, 0]).astype('float32') texture = np.random.normal(0, 1, [50]).astype('float32') # texture = flame_param['tex'] flame_param = np.hstack((shape_params, exp_params, pose, flame_param['cam'], texture, flame_param['lit'].flatten())) # tz = camera_params['f'][0] / (camera_params['c'][0] * flame_param[:, 156:157]) # flame_param[:, 156:159] = np.concatenate((flame_param[:, 157:], tz), axis=1) # import ipdb; ipdb.set_trace() flm_params[i, :] = flame_param.astype('float32') if i == num_smpl_to_eval_on - 1: break batch_size = 32 num_sigmas = 1 corruption_sigma = np.linspace(0, 1.5, num_sigmas) jaw_rot_range = (0, np.pi/8) jaw_rot_sigmas = np.linspace(0, (jaw_rot_range[1] - jaw_rot_range[0])/6, num_sigmas) pose_range = (-np.pi/3, np.pi/3) pose_sigmas = np.linspace(0, (pose_range[1] - pose_range[0])/6, num_sigmas) config_obj = util.dict2obj(cnst.flame_config) flame_decoder = FLAME.FLAME(config_obj).cuda().eval() for run_idx in run_ids_1: # import ipdb; ipdb.set_trace() generator_1 = torch.nn.DataParallel( StyledGenerator(embedding_vocab_size=69158, rendered_flame_ascondition=settings_for_runs[run_idx]['rendered_flame_as_condition'], normal_maps_as_cond=settings_for_runs[run_idx]['normal_maps_as_cond'], apply_sqrt2_fac_in_eq_lin=settings_for_runs[run_idx]['apply_sqrt2_fac_in_eq_lin'], core_tensor_res=core_tensor_res, w_truncation_factor=1.0, n_mlp=8)).cuda() model_idx = settings_for_runs[run_idx]['model_idx'] ckpt1 = torch.load(f'{cnst.output_root}checkpoint/{run_idx}/{model_idx}.model') generator_1.load_state_dict(ckpt1['generator_running']) generator_1 = generator_1.eval() params_to_save = {'cam': [], 'shape': [], 'exp': [], 'pose': [], 'light_code': [], 'texture_code': [], 'identity_indices': []} for i, sigma in enumerate(corruption_sigma): images = np.zeros((num_smpl_to_eval_on, 3, resolution, resolution)).astype('float32') flame_mesh_imgs = np.zeros((num_smpl_to_eval_on, 3, resolution, resolution)).astype('float32') pbar = tqdm.tqdm(range(0, num_smpl_to_eval_on, batch_size)) pbar.set_description('Generating_images') # print(flm_params[1, :]) for batch_idx in pbar: flm_batch = flm_params[batch_idx:batch_idx+batch_size, :] flm_batch = torch.from_numpy(flm_batch).cuda() # flm_batch = eye_cntr_reg.substitute_flame_batch_with_regressed_camera(flm_batch) flm_batch = position_to_given_location(flame_decoder, flm_batch) if settings_for_runs[run_idx]['normal_maps_as_cond'] or \ settings_for_runs[run_idx]['rendered_flame_as_condition']: batch_size_true = flm_batch.shape[0] cam = flm_batch[:, constants.DECA_IDX['cam'][0]:constants.DECA_IDX['cam'][1]:] shape = flm_batch[:, constants.INDICES['SHAPE'][0]:constants.INDICES['SHAPE'][1]] exp = flm_batch[:, constants.INDICES['EXP'][0]:constants.INDICES['EXP'][1]] pose = flm_batch[:, constants.INDICES['POSE'][0]:constants.INDICES['POSE'][1]] # import ipdb; ipdb.set_trace() light_code = \ flm_batch[:, constants.DECA_IDX['lit'][0]:constants.DECA_IDX['lit'][1]:].view((batch_size_true, 9, 3)) texture_code = flm_batch[:, constants.DECA_IDX['tex'][0]:constants.DECA_IDX['tex'][1]:] params_to_save['cam'].append(cam.cpu().detach().numpy()) params_to_save['shape'].append(shape.cpu().detach().numpy()) params_to_save['shape'].append(shape.cpu().detach().numpy()) params_to_save['exp'].append(exp.cpu().detach().numpy()) params_to_save['pose'].append(pose.cpu().detach().numpy()) params_to_save['light_code'].append(light_code.cpu().detach().numpy()) params_to_save['texture_code'].append(texture_code.cpu().detach().numpy()) norma_map_img, _, _, _, rend_flm = \ overlay_visualizer.get_rendered_mesh(flame_params=(shape, exp, pose, light_code, texture_code), camera_params=cam) # import ipdb; ipdb.set_trace() rend_flm = torch.clamp(rend_flm, 0, 1) * 2 - 1 norma_map_img = torch.clamp(norma_map_img, 0, 1) * 2 - 1 rend_flm = fast_image_reshape(rend_flm, height_out=256, width_out=256, mode='bilinear') norma_map_img = fast_image_reshape(norma_map_img, height_out=256, width_out=256, mode='bilinear') # Render the 2nd time to get backface culling and white texture # norma_map_img_to_save, _, _, _, rend_flm_to_save = \ # overlay_visualizer.get_rendered_mesh(flame_params=(shape, exp, pose, light_code, texture_code), # camera_params=cam, cull_backfaces=True, constant_albedo=0.6) # Back face culling temporarily un-availabe norma_map_img_to_save, _, _, _, rend_flm_to_save = \ overlay_visualizer.get_rendered_mesh(flame_params=(shape, exp, pose, light_code, texture_code), camera_params=cam, cull_backfaces=False, constant_albedo=0.6) rend_flm_to_save = torch.clamp(rend_flm_to_save, 0, 1) * 2 - 1 # rend_flm_to_save = rend_flm # norma_map_img_to_save = torch.clamp(norma_map_img, 0, 1) * 2 - 1 rend_flm_to_save = fast_image_reshape(rend_flm_to_save, height_out=256, width_out=256, mode='bilinear') # norma_map_img_to_save = fast_image_reshape(norma_map_img, height_out=256, width_out=256, mode='bilinear') else: rend_flm = None norma_map_img = None gen_1_in = ge_gen_in(flm_batch, rend_flm, norma_map_img, settings_for_runs[run_idx]['normal_maps_as_cond'], settings_for_runs[run_idx]['rendered_flame_as_condition']) # torch.manual_seed(2) identity_embeddings = torch.randint(low=0, high=69158, size=(gen_1_in.shape[0], ), dtype=torch.long, device='cuda') mdl_1_gen_images = generic_utils.get_images_from_flame_params( flame_params=gen_1_in.cpu().numpy(), pose=None, model=generator_1, step=step_max, alpha=alpha, input_indices=identity_embeddings.cpu().numpy()) params_to_save['identity_indices'].append(identity_embeddings.cpu().detach().numpy()) # import ipdb; ipdb.set_trace() images[batch_idx:batch_idx+batch_size_true] = torch.clamp(mdl_1_gen_images, -1, 1).cpu().numpy() # if flame_mesh_imgs is None: flame_mesh_imgs[batch_idx:batch_idx+batch_size_true] = torch.clamp(rend_flm_to_save, -1, 1).cpu().numpy() if save_images: mdl_name = settings_for_runs[run_idx]['name'] for key in params_to_save.keys(): params_to_save[key] = np.concatenate(params_to_save[key], axis=0) save_dir = os.path.join(cnst.output_root, 'sample', str(run_idx), f'random_samples_q_eval_{mdl_name}') os.makedirs(save_dir, exist_ok=True) np.save(os.path.join(save_dir, 'params.npy'), params_to_save) save_path_current_id = os.path.join(save_dir, 'images') save_set_of_images(path=save_path_current_id, prefix='', images=(images + 1) / 2, show_prog_bar=True) #save flam rndr save_path_current_id_flm_rndr = os.path.join(save_dir, 'conditions') save_set_of_images(path=save_path_current_id_flm_rndr, prefix='mesh', images=(flame_mesh_imgs + 1) / 2, show_prog_bar=True)
5,937
337309da79ce9d90010fef5c171b6b344e6dc63f
"""Test Spotify module""" from spoetify.spotify import Spotify from nose.tools import assert_equal def test_search_track(): sp = Spotify() t = sp.search_track("avocado") assert_equal(t.id, "1UyzA43l3OIcJ6jd3hh3ac")
5,938
006e1088e72201fab7eebd1409c025b5dba69403
# Definition for a binary tree node. # class TreeNode(object): # def __init__(self, x): # self.val = x # self.left = None # self.right = None class Codec: def serialize(self, root): """Encodes a tree to a single string. :type root: TreeNode :rtype: str """ if(not root) : return "X" else : return ",".join([str(root.val), self.serialize(root.left), self.serialize(root.right)]) # Q = [root] # res = [] # while(Q) : # newQ = [] # noChange = True # while(Q) : # v = Q.pop(0) # if(v == None) : # res.append(' ') # newQ.append(None) # newQ.append(None) # else : # res.append(str(v.val)) # if(v.left == None) : # newQ.append(None) # else : # noChange = False # newQ.append(v.left) # if(v.right == None) : # newQ.append(None) # else : # noChange = False # newQ.append(v.right) # if(noChange) : # break # Q = newQ # return ','.join(res) def deserialize(self, data): """Decodes your encoded data to tree. :type data: str :rtype: TreeNode """ self.data = data if(data[0] == "X") : return None else : t = TreeNode(int(self.data[: self.data.find(",")])) t.left = self.deserialize(self.data[self.data.find(",") + 1 :]) t.right = self.deserialize(self.data[self.data.find(",") + 1 :]) return t # arr = data.split(",") # l = len(arr) # if(l == 0 or arr[0] == " ") : # return None # t = TreeNode(int(arr[0])) # Q = [t] # half = (l + 1) / 2 - 1 # i = 0 # while(i < half) : # v = Q.pop(0) # if(v == None) : # i += 1 # Q.append(None) # Q.append(None) # continue # if(arr[2 * i + 1] == ' ') : # v.left = None # Q.append(None) # else : # l = TreeNode(int(arr[2 * i + 1])) # v.left = l # Q.append(l) # if(arr[2 * i + 2] == ' ') : # v.right = None # Q.append(None) # else : # r = TreeNode(int(arr[2 * i + 2])) # v.right = r # Q.append(r) # i += 1 # return t # Your Codec object will be instantiated and called as such: # ser = Codec() # deser = Codec() # ans = deser.deserialize(ser.serialize(root))
5,939
7d1ca15129b1bf6b713e1d5eda4436d4a8539ad1
import numpy as np class nearest(svm): name="MLLKM2" def __init__(self): svm.__init__(self) def fit(self,x,y): self.x=x self.y=y def predict(self,x): diff=np.subtract(x,self.x) distance=np.linalg.norm(diff,axis=1) dmin= np.argmin( distance ) return self.y[dmin]
5,940
4dac8e7e695c473cb73ceaf3887373bcc0a08aff
# from datetime import datetime from datetime import datetime, time, timedelta # today = datetime.now() # previous_day = today - timedelta(days=1) # previous_day = previous_day.strftime("%Y%m%d") # print(today) # print(previous_day) print(datetime.strptime("2013-1-25", '%Y-%m-%d').strftime('%Y-%m-%d 00:00:00')) # def is_midnight(): # current_time = datetime.now().time # match_date = datetime.now() # # current_time = datetime.now() # if current_time >= time(0,0) and current_time <= time(4, 30): # print(match_date) # return match_date.strftime("%Y%m%d") # else: # match_date = current_time - timedelta(days=1) # return match_date # print(is_midnight()) # def is_midnight(): # current_time = datetime.now().time() # # today = datetime.now() # previous_day = current_time - timedelta(days=1) # previous_day = previous_day.strftime("%Y%m%d") # if current_time >= time(0,0) and current_time <= time(4, 30): # print('yesy') # if time(0,0) < time(4, 30): # return current_time >= time(0,0) and current_time <= time(4, 30) # else: # crosses midnight # return current_time >= time(0,0) or current_time <= time(4, 30) # print(is_midnight()) # match_date = datetime.now() # current_time = datetime.now().time() # if current_time >= time(0,0) and current_time <= time(4, 30): # previous_day = match_date - timedelta(days=1) # match_date = previous_day.strftime("%Y%m%d") # print(match_date) # match_date = datetime.now().strftime("%Y-%m-%d") # # datetime.timedelta(days=1) # hour = datetime.now().strftime("%H") # if int(hour) < 4: # print('Previous day: %s' % (datetime.timedelta(days=1))) # else: # print(match_date) # print(datetime.now().strftime("%Y-%m-%d %H:%M:%S")) # import cx_Oracle # connection = None # try: # connection = cx_Oracle.connect( # 'JW', # '901203', # 'HOME-PC/XE', # encoding='UTF-8') # # show the version of the Oracle Database # print(connection.version) # c = connection.cursor() # c.execute('SELECT MATCH_ID,MATCH_DATETIME,LEAGUE,HOME_TEAM,AWAY_TEAM,HOME_FT_GOAL,AWAY_FT_GOAL,CASE WHEN HOME_FT_GOAL > AWAY_FT_GOAL THEN \'H\' WHEN HOME_FT_GOAL = AWAY_FT_GOAL THEN \'D\' ELSE \'A\' END HDA_RESULT,DRAW_MEAN,DRAW_MEDIAN,O_MACAU_D,O_BET365_D,O_HKJC_D,AWAY_MEAN,AWAY_MEDIAN,O_MACAU_A,O_BET365_A,O_HKJC_A,HKJC_ASIAN_HANDICAP,HKJC_ASIAN_AWAY FROM HDA_MEAN_VIEW WHERE MATCH_HANDICAP=\'ไธŠ็›ค\' AND HOME_IND=0 AND DRAW_IND=1 AND AWAY_IND=1 ORDER BY MATCH_DATETIME DESC') # for row in c: # print(row[0],',',row[1]) # except cx_Oracle.Error as error: # print(error) # finally: # # release the connection # if connection: # connection.close()
5,941
2a500968cf6786440c0d4240430433db90d1fc2f
n = int(input()) p = [220000] + list(map(int, input().split())) cnt = 0 m = 220000 for i in range(1, n+1): now = p[i] m = min(m, now) if now == m: cnt += 1 print(cnt)
5,942
29c1a989365408bf5c3d6196f7afc969be63df85
def patternCount(dnaText, pattern): count = 0 for i in range(0, len(dnaText) - len(pattern)): word = dnaText[i:i+len(pattern)] if (word == pattern): count = count + 1 return count def freqWordProblem(text, k): countWords = [] for i in range(0, len(text) - k): pattern = text[i:i+k] countWords.append(patternCount(text, pattern)) maxCount = 0 indexes = [] for j in range(0, len(countWords)): count = countWords[j] if (count == maxCount): indexes.append(j) elif (count > maxCount): indexes = [j] maxCount = count result = set() for index in indexes: result.add(text[index:index+k]) return list(result) mapDNA = { "A": "T", "G": "C", "T": "A", "C": "G" } def complimentDNA(text): result = "" for letter in text: result = result + mapDNA[letter] return result[::-1] def patternFind(text, pattern): index = [] for i in range(0,len(text)-len(pattern)): word = text[i:i+len(pattern)] if word == pattern: index.append(i) return index for word in patternFind("AATGGTCGAAGCGCCACTGCGCCACGACTAAACGCGCCACTAAATCTCCATCAGAGCGCCACTGCGCCACGTGGCGCCACTAGCGCCACCCGTTGGCGCCACTGGGCGCCACGCGCCACGCGCGCCACGCGCCACTGCGCCACCTGAGTAGCGCCACATAGACCGGCGCCACTAAGCGCCACTGCGCCACAGAGGGCGCCACTAACTGCGCCACGCGCCACGTGCGCGCCACGGGCGAACGTTGCGCCACCTTGCCCCGCGCCACGCGCCACGCGCCACGCGCCACCGGGGGCATTGCGCCACGCGCCACGCGCCACCCCGCGCCACGTGTGCCGCGCCACAGCGCCACTTGGCGCGCCACACGCGCCACGCGCCACCTAGCGCCACATAGCGCCACGCGCCACGCGCCACGGCGCCACGCGCCACGCGCCACATCTGCGCCACCAGCGCCACGAGCGCCACCATACTGGCGCCACAGCGCGCCACGGCGCCACGCGCCACCCATGCGCCACATAGCCTGTGCGCCACGCGCCACGCGCCACGCGCCACGGCGCCACCGCGCCACTGAGCGCCACCCCTAGGCGCCACGCGCCACGCGCCACTGCGCCACGCGCCACGAGGGGGTGCGCCACACGGCCCCAGCGCGAGAGTGCGCCACGCGCCACGCGCCACGCGCCACCGCGCCACGCGGCGCCACGCGCCACATCGGGCGCCACTTAAGCCTTGGATTTGCGCCACGGCGGGCGCCACGCCAGCGCCACGTCACAGCGGGCGCCACACGCGCCACTGCGCCACGCGCCACAGCGCGCCACGGCGCCACGAAACGCGCCACCCGGCGCCACGCGCCACTACAAGCGCCACAAGGCGCGCCACTGGCGCCACTGCGCCACACAGGCGCCACGCGCCACGCGCCACATGCGCCACAGGCGCCACGGGGCGCGCCACTTCGCGCCACGCGCCACGGCGCCACGCGCCACAGCGCCACCCTCGCGCCACCGCGCCACGCGCCACGCGCCACGCGCCACGGGCGCCACTCGCGCCACTTCGCGCCACGCGCCACTTCGGGCGCCACGCGCCACGAAATGCGCCACCTGAGGCGCCACTGCGCCACGCGCCACCAGCGCCACAGCGCCACGGGCGCGCCACGCGCCACTCCGCGCCACCGCGCGCCACGCGCCACGAAGCGCCACGCGCCACTGCGCCACACCTGGATAAGCGCCACTGCGCCACACGCTGCGCCACGGCGCCACTGGGGCGCCACGCGCCACAGCGCCACGCGCCACGCTCGCGCCACGCGCCACGTGCGCCACTCCGCGCCACATTTGCGCCACGCGCCACAAGCGCCACGGTGCGCCACTACATGTGTGGTGCGCCACACGAGCGCCACGTCTGTTCACGCGCCACCCTATAGGCGCCACTCAGCGCCACAGCGCCACCTGTAGTGCGCCACGCGCCACCAGGCGCCACCCAGGCGTGCCGTGAGATAGCGCCACGGCGCCACAGCGCCACGCGCCACTCGCGCCACGTGCGCCACCGCGCCACTTTCGCGCCACCCAGCGCCACGCGCCACTAGCGCCACGCGCCACGCGCCACATGCGCCACCCGCGCCACGTGCGCCACTAGATCGCGCCACTCCGGCGCCACGCGCCACTACGCGCCACACGCGCCACAGCGCCACTCTGAAATTCGCGCCACGCGCCACGCGCCACGAGCGCCACTCGCGCCACAAGCGCCACGCGCCACACCCGCGCCACGCGCCACGCGCCACGCTCTGTTGCGCCACGCGCCACGGCGCCACGCGCCACGCGCCACGGCTTGGTTGCGCCACAGCGCCACGGCGCCACGCGCCACTCACCGAAGTGATGGCGCCACACGAGGAGGCGCCACAGCGCCACTGCGCCACTGCGCCACTGCGCCACGCGCCACTTGGCGCGCCACTGGCGCCACGCGCCACAGCGCCACTACGCGCCACCGCGCCACGCGCCACTGCGCCACCGCGCCACGCGCCACGGCGCCACTGATGCGCCACCGCGCCACTGTCGTGCGCCACGTCTGGGCTACGGCGCCACCGCGCCACATGGGGCGCCACGACGCGCCACCGGCGCCACACGCGCCACGTGCGCCACCGGCGCCACCGCGCCACTGAGCGCCACACTGCTTGCGCCACATAGAGGCGCCACGCGCCACGCGCCACGCGCCACGGCGCCACGCGCCACAATTCTGCCATCTGCGGTCGCGCCACGGTATTTTGCGCCACGCGCCACCCTAGGCGCCACTAGCGCCACAAGCGCCACTCGGCGCCACCCTCAGGCGCCACAGCGCCACTACAGCGCCACTGCGCGCCACGCGCCACGCGCCACATTGCCTCAGCGCCACGGCGCCACGCGCTGTAGCGCCACGCGCCACGTTGCGCCACATGCGCCACACATGCGCCACCCTTGCGCCACGCGCCACCAAAGCGCCACGGCGCCACGCGCCACCTGACGGTGGCGCCACCCCTGCTCTTTGCGCCACGGCGCCACGCGCCACTAGCGCCACGCGCCACGCGCCACTGCGCCACAATGTGCGCCACCCCTCTAGGCGCCACTGCGCCACGGCGCCACGGCGCCACGTAGCGCCACGCGCCACGCGCCACCAGTCAATCGGCGCCACCATTCGGCCCGACGCGCCACGCGCCACTGCGCCACGGGCGCCACCATAACGGCGCCACGCGCCACGCGCCACTTGGTTTGATAGCCTGCGCCACAGCGCCACGGCGGCGCCACGTGTAGCGCCACGCGCCACCTTATGCGCCACGCGCCACGCGCCACGAGCGCCACGCGCCACCTTAATTAGCGCCACATAGCGCCACTGCGCCACGCGCCACCAAGATACAAGCGCCACTGGGCGCCACGCGCCACGCGCCACGCGCCACTGCTGCAGGCAGCGCCACCACAGGCGCCACTAGCGCCACTTGAGGCGCCACCGCGCCACTAGAGCGCCACGCGCCACTGGCGCCACTCCCGTCGGCGCCACCGCGCCACAGAGCGCCACCTGCGCCACGCGCCACTCGCGCCACCGTCACGCGCCACAGGCGCGCCACCCCGGCGCCACTGCGCCACTCTAGCGCCACTGCGCGCCACATATGGCGCCACCTACAACAGCGCCACACGCGCCACGCTATTCGCGCCACGCGCCACCGAGCGCCACGCGCCACATATACTCCTATTTGCGCCACGCGCCACCGTGGCGCCACGCGCCACCAGCGCCACTTGGTGCGCCACCCAAGCGCCACCTGCGCCACAGCGCCACTCGCGCCACGATAGATTTGCAAGCGCCACGTCCCGCGCCACAAGCGCCACTCTGCGCCACCGCGCCACGCGCCACTCTATGGCGCCACCGGCGCCACGCGCCACCCAGGCGCCACTCGCGCCACAGCGCCACGCGCGCCACTTCTTAGGCGCCACGCGCCACCAGGCGCCACTCTGCGCGCCACGTAGCGCCACTCGTGCGCCACTTTCGGCATGCGCGCCACATAGGCGCCACGGCGCCACCCCTGGCGCCACAGCGCCACGCGCCACTAGGGCGCCACTCGGCTCGAGCGCCACGCGCCACCGCGCCACTCGCGCCACGCGCCACGCGCCACATCTGCGCCACGCGCCACGCGCCACAGCGCCACCGCGCCACTTGGGCTATGGCGCCACGAAGCGCCACGGCGCCACGTGCGCCACCTAACGCGCCACAGCGCCACGCGCCACATGTCGCCCAGCGCCACCGCGCCACGGCGCCACCGCGCCACCCACGCCGCGCCACTGCGCCACAGCGCCACGGCGCCACGCGCCACATGCGCCACGCAGCGCCACCCCTCCGCCGCGCCACCGGTGCGCCACGCGCCACGCGCCACTTGGCGCCACGCTTCTGCGCCACGGCGCCACCAGCGCCACTAAGCGCCACAGCGCCACCAGCGCCACAAGGGCGCCACTAATGCGCCACAAGCGCCACGCGCCACGCGCCACGCGCCACCGCGCCACGCGCCACACCGTCCGCGCCACCTGCGCCACAGGCGCCACGTTTTCTTACTGTATAATAGCGCCACTTCGCGCCACGCGCCACGGGCGCCACGAATGTGTGCGCCACGTCGTGCGCCACGCGCCACGCGCCACTGGGCGCCACGCGCCACCCCCCCGCGCCACTAGCGCCACGCGCCACGCGCCACTGAATTGTAGCGCCACGCGCCACGCGCGCCACTCTATAGGCAAATTGGGCGCCACGCGCCACTATGGTAGTCGTGCGCCACTGCGCCACGCGCCACGCTGCGCCACGCGCCACTGCGCCACGCGCCACGCGCCACGGCGCCACGCGCCACGCGCCACCACGCGCCACCTCGCGCGCCACGCGCCACCTAGTAGCGCCACAGCGCCACGAGCGCCACCAGCGCCACGGAAGGCGCGCCACAGGCGCCACTTAGCGCCACCGGCGCCACGCGCCACAGCGCCACTGTGCGCCACGCGCCACGCGCCACTGCGCCACGCCAAATGCGCGCCACCCGCGCCACAAGCGCCACATTGGGGGTCTTAGCGCCACATCGCGCCACGCGCCACCAAATTGCGCGCCACACAGGTCGCGCCACTTCGTCCAGGCGCCACTTCAGCGCCACGGCGCCACGCGCCACGCGCCACTCCGAGCGCCACTGTGCGCCACAGACAGCTCCGCGCCACGGGAGGGGCGCCACATTTTAGCGCCACGCGCCACGCGTTTTGAGCGCCACTGCGCCACCGGAAAGCGCCACTGCTGAGGCGCCACCACAGCGCCACCGCGCCACGCACTGGCGCCACGATATGCGCCACCGCGCCACCGCGCCACAAGGGCGCCACGCGCCACCTAGACGCGCCACGAAAGCGCCACCACTATGCGCCACTCGGCGCCACGCGCCACCACAGGAAAGTATGCGCCACAAAACTGCGCCACGCGCCACGCGCCACGCGCCACGGATTGCGCCACGCGCCACGCGCCACCACGCGCCACGTCCCTGGCGCGCCACGCGCCACGCGCCACGGCGCCACAATGCGCCACATGCGCCACAGGCGCCACCGCGCCACTGCGCCACGCGCCACTGCGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACTAGGCGCCACACTGCGCGCCACGCTACGGAGGACCGATAGCGCCACAGCGCCACGATAGCGCCACGCGCCACGAGTTCTGCGCCACAATGGCCTAGTCGCGCCACCGCGCCACTTACGCGCCACTGCGCCACGCGCCACTTGCGCCACGGCGCCACGCGCCACTGGCGCCACGCGCCACCTCCCGCTGCGCCACGCGCCACTATCCGTGCGCCACGCGCCACTGGCGCCACGCGGCGCCACTGCGAAGTAATCGCGCCACAGCGCCACGCTAAGCGCCACATGCGCGGTGTGCGCCACGCGCCACGCGCCACTCAAGCGCCACAAGCGCCACGAGCGCCACGCGCCACGCGCCACTAAGCGCCACGGCGCCACTTTAATATGCGCCACAAAGCGCCACTGCGCCACCTGCTGCGCCACATCACGCGCCACGAGCGCCACAGTTGCGCGCCACATAATGGGCGCCACGGCCCGTTGAGCGCCACGCGCCACGCGCCACAGTGCCACCCGCGCCACACGCGCCACAGTCGCGCCACGGCGCCACCGGGTTATTATGCGCCACGTGCGGTCGCGCCACTGCGCCACGCGCGCCACAAGCGCCACTCGGATGGCGCCACTTCTGTGGCGCCACGCGCCACACTGCGCCACAGCGCCACGCGCCACACGCGCCACCGCGCCACCGAGTATTAGCGCCACTGCGCCACAAGATGGCGCCACGCGCCACCAGGCGCCACTCGCGCCACGGCGCCACGCGCCACGCGCCACGCGCCACCGCGCCACCTGCGCCACAAGGGGCGCGCCACGCGCCACGCGCCACAGGACCATCGGCGCCACGTCATGGCGCCACCTGGGTCCATGCGCGCCACCTCCTGCGCCACAGCGCCACCGTCTAAAGCGCCACGAGCGCCACGGCGCCACGCGCCACAGCGCCACGCGCCACCTTCACCGAGTCCGCAGGCGCCACCGTCATAATTGAGTGCGCCACCCCATGCCGCGCCACATAGCGCCACGCTGGCGCCACGGCGCCACGCGCCACGCGCGCCACAGCGCCACGCGCCACACGCGCGCCACAGCGCCACGCGCCACTGTATCGCGCCACGAGCGCCACGTGTGCCACCTACGCTATGCGCCACAAGCGCCACGAGCGCCACAAAGCGCCACTGCGCCACTGGCGCCACTGTGGCAGCGCCACTCGCGCCACTGAAGCGCCACAGCGCCACGGCGCCACGCGCCACCCGGATGCGCCACAGCGCCACATGCGCCACTGCGCCACCATGCTGCGCCACAGCGCCACAGTCGCGCCACTGCGCCACGCGCCACCTCGCGCCACTTGCGCCACGCGCCACGCTGGCAGCGCCACTGCGCCACACAAGATTTCTGAGCGCCACCGACCCCTATAAGCGCCACTGAAGGTGCGCCACGCGCCACTCGCGCCACCTAAGGCGCCACTCTGCGCCACGTGCGCCACCCCTGCGCCACTGCGCCACCTGCGCCACTGAGCGCGCCACGGGCGCCACGCGCCACCCTGCGCCACTGCGCCACTGCGCCACGCTGCGCCACCTGAACTTGGCGCCACGTAGCGCCACGCGCCACGCGCCACCGCGCCACGCGCCACTCGCGCCACTCGTGCGCCACAAGAGCGCCACTGGTTAAGCGATTTGCGCCACGCGCCACACTTGCGCCACGCGCCACAAGTCGGGGCGCCACCTCGCCCCTCGCGCCACTAGCGCCACGCGCCACCACCTGAAAGCGCCACACTACTAGGCGCCACAGGCGCCACGCGCCACGCGCCACCGTCTGCGCCACGCGCGCCACCAGCGCCACAGGGTGCGCCACCGCGCCACGCGCCACCGCGCCACGCGCCACTCCCGGTCAGGGGCGCCACAAAAGGCGCCACAGGGAGGTTCTATCCGCGCCACACACGCGCCACGACGAACATGCGCGCCACTGCGCCACCGCGCCACTAAGCGCCACGGGCGCCACGCGCCACCTAGTCGCGCCACAAAGTGATCGCGGCGCCACCTGCGCCACCGGCGCCACCCAAGCGCCACTTAGGCGCCACGTGCGCCACCCTTGCGCCACCTTGCGCCACCGCGCCACGGCGCCACTCGTGGTGCGCCACTGCCCGCGCCACATAGCGCCACCCGAGCGCCACAGCGTGTTATTTGCGCCACAGCGCCACGCGCCACTGCGCCACGCATGCCGCGCCACAGTGCGCCACGACGCGCCACTGCGCCACGTCGTCTTCGCGCCACTTGACCGACATTTGCCTAGCGCCACCGCGCCACGGCGCCACGGCGCCACCAGCCGATTGCTTTCTTGTTCCACAGGTGCGCCACTGGCGCCACAGAGCGCCACCGGCGCCACGGCGCCACTGCGCCACGCGCCACGCGCCACATGCGCCACTAGCGCCACGCGCCACCCCGCGCCACTGCGCCACATGGCGCCACCAAAGGGTTGCGCCACTTGCGCCACTGCGCCACTCGCGCCACGTTTGCCGCGCCACAAGGCGCCACTTGCGCCACGCGCCACTGCGCCACGTTACCGCCGCGCCACTTAAACCCTGCTTGCGCCACCTGCGCCACGCGCCACGCGCCACAAAACTAGCGCCACTTCAGTACGCGCCACAGCGCCACCTCTCAGCGCGCCACCATCTGGCGCCACACGTGGCGCCACTGCGCCACAGCGCCACTGTGCGCCACCGCGCCACATTTAGCGCCACCAGCGCCACGGCTGCGCCACCCCCCCTTTGCGCCACAAAGCGCCACGCCAGCGCCACTTGGCGCCACAGCGCCACGGGCGGCGCCACGCGCCACGCGCCACGGCGCCACGCGCCACAGAAAAGCGCCACAGAGCGCCACAAATCTGGCAGCAGCGCCACAAGTGCGCCACCGCGCCACGAAAGAGGACCCAGCGCCACAGCGCCACATGCGCCACGTGCGCCACGCGCCACTGTGATCGCGCCACGCGCCACGCGCCACCAGAATAGCGCCACAGCGCCACCGCGCCACAGCGCCACAAGGTTCACTGGCGCCACGCGCCACCGCGCCACTCGCGCCACCGGCGCCACCGACCGCGCCACTATGCGCCACCATGCGCCACGCGCCACCTGCGCCACGAGCGCCACAGCGCCACCTTTATGCGCCACGCACCGCGCCACGAGCTTGCGCCACTTTCGCGCCACGCGCCACCTTTATAAAGCGCCACTCGCTGCGCCACGCGCCACCTAATCGCGCCACTGGCGCCACGCGCCACCTGCGCCACGCAAGGCGCCACGGCGCCACAGCGCCACGCGCCACTCGGCGCCACGGAGGCGCCACAGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACGTGATAAGCGCCACAGACTCGCGGCGCCACTTCTGCGCCACGCGCCACTCGGGCGCCACAATGCGCCACGGCGCCACACGCGCCACAGGCGCCACCTGTTGCGCCACCGCGCCACGGCTCAATGCGCCACTAGGCGCCACTGCGCCACGCGCCACTTGCGCCACGCGCCACCCATGTATGCGCCACGCGCCACGTGGTGGGCGCCACTTCTCGTGCGCCACAACTCCATAAAACGGCGCCACCGCGCCACACAGCGCCACAGCGCCACGTTCAGCGCCACTTGGCGCCACTGCGCCACCGCGCCACTGTGCGCCACCGCGCCACGCGCCACGTGGCGCCACGCGCCACTGCGCCACTTGCGCCACAGCGCCACGCTACTTAGTCGTGGCGCCACTTGTGTGGCACCATTAGCGAGGGCGCCACGGCGCCACCAAGCGCCACTAAATGGTGGGCGGCGCCACTGCGCCACTTGCGCCACTTAGCGCCACCTAGCGCCACCACCGCGAAAGCGCCACTTCAGCGCCACGAATGCGCCACGCGCCACTTCCTAACTTGCGCCACGGCACGGCGCCACGCTGCGCCACGGCACGAAAGCGCCACTGCGCCACGGCGCCACACCAAGCGCCACGCGCCACGGCGCCACAGCGCCACAGCGCCACACAGCCGGCGCCACAGCGCCACGGCGCCACTCCAGCGCCACCCTAGCGCCACGGCGCCACCTCGTGCGCCACTGCGCCACTAGCGCCACTGCGCCACGTTGCGCCACGCGCCACTGGGCGCCACATAAACAATAGCGCCACGGGCGCCACGCGCCACGGCGAGCGCCACTCGCGCCACGCGCCACGCGCCACTGCGCCACATGCCCCAGCGCCACGCGCCACTGCGCCACGCGCCACAGCGCCAC","GCGCCACGC"): print(word)
5,943
88343b9c5cac3510e8cea75ac5b11f517ddc164b
from __future__ import absolute_import from __future__ import division from __future__ import print_function from keras.layers import Dense, Input from keras.layers import Conv2D, Flatten, Lambda from keras.layers import Reshape, Conv2DTranspose from keras.models import Model from keras.losses import mse, binary_crossentropy from keras.utils import plot_model from keras import backend as K from sklearn.model_selection import train_test_split import pandas as pd import numpy as np import matplotlib.pyplot as plt K.clear_session() np.random.seed(237) # reparameterization trick # instead of sampling from Q(z|X), sample eps = N(0,I) # then z = z_mean + sqrt(var)*eps def sampling(args): """Reparameterization trick by sampling fr an isotropic unit Gaussian. # Arguments args (tensor): mean and log of variance of Q(z|X) # Returns z (tensor): sampled latent vector """ z_mean, z_log_var = args batch = K.shape(z_mean)[0] dim = K.int_shape(z_mean)[1] # by default, random_normal has mean=0 and std=1.0 epsilon = K.random_normal(shape=(batch, dim)) return z_mean + K.exp(0.5 * z_log_var) * epsilon def process_data(data_path): data = np.load(data_path) X_train, X_test = train_test_split(data, test_size=0.05, random_state=42) print('Shape train/test:', X_train.shape, X_test.shape) image_size = X_train.shape[1], X_train.shape[2] data = np.reshape(data, [-1, image_size[0], image_size[1], 1]) X_train = np.reshape(X_train, [-1, image_size[0], image_size[1], 1]) X_test = np.reshape(X_test, [-1, image_size[0], image_size[1], 1]) data = data.astype('float32') / 255 X_train = X_train.astype('float32') / 255 X_test = X_test.astype('float32') / 255 return data, X_train, X_test, image_size def construct_vae(image_size, kernel_size, latent_dim): # network parameters input_shape = (image_size[0], image_size[1], 1) # VAE model = encoder + decoder # build encoder model inputs = Input(shape=input_shape, name='encoder_input') x = inputs x = Conv2D(filters=16, kernel_size=kernel_size, activation='relu', strides=1, padding='same')(x) x = Conv2D(filters=32, kernel_size=kernel_size, activation='relu', strides=2, padding='same')(x) x = Conv2D(filters=64, kernel_size=kernel_size, activation='relu', strides=1, padding='same')(x) # shape info needed to build decoder model shape = K.int_shape(x) # generate latent vector Q(z|X) x = Flatten()(x) x = Dense(16, activation='relu')(x) z_mean = Dense(latent_dim, name='z_mean')(x) z_log_var = Dense(latent_dim, name='z_log_var')(x) # use reparameterization trick to push the sampling out as input # note that "output_shape" isn't necessary with the TensorFlow backend z = Lambda(sampling, output_shape=(latent_dim,), name='z')([z_mean, z_log_var]) # instantiate encoder model encoder = Model(inputs, [z_mean, z_log_var, z], name='encoder') encoder.summary() plot_model(encoder, to_file='vae_cnn_encoder.png', show_shapes=True) # build decoder model latent_inputs = Input(shape=(latent_dim,), name='z_sampling') x = Dense(shape[1] * shape[2] * shape[3], activation='relu')(latent_inputs) x = Reshape((shape[1], shape[2], shape[3]))(x) x = Conv2DTranspose(filters=64, kernel_size=kernel_size, activation='relu', strides=1, padding='same')(x) x = Conv2DTranspose(filters=32, kernel_size=kernel_size, activation='relu', strides=2, padding='same')(x) x = Conv2DTranspose(filters=16, kernel_size=kernel_size, activation='relu', strides=1, padding='same')(x) outputs = Conv2DTranspose(filters=1, kernel_size=kernel_size, activation='sigmoid', padding='same', name='decoder_output')(x) # instantiate decoder model decoder = Model(latent_inputs, outputs, name='decoder') decoder.summary() plot_model(decoder, to_file='vae_cnn_decoder.png', show_shapes=True) # instantiate VAE model outputs = decoder(encoder(inputs)[2]) vae = Model(inputs, outputs, name='vae') # VAE loss = mse_loss or xent_loss + kl_loss reconstruction_loss = binary_crossentropy(K.flatten(inputs), K.flatten(outputs)) reconstruction_loss *= image_size[0] * image_size[1] kl_loss = 1 + z_log_var - K.square(z_mean) - K.exp(z_log_var) kl_loss = K.sum(kl_loss, axis=-1) kl_loss *= -0.5 vae_loss = K.mean(reconstruction_loss + kl_loss) vae.add_loss(vae_loss) vae.compile(optimizer='rmsprop') vae.summary() plot_model(vae, to_file='vae_cnn.png', show_shapes=True) return vae, encoder, decoder if __name__ == '__main__': is_train = False data_file = '../data/out/moment_frames_5.npy' data, X_train, X_test, im_size = process_data(data_file) kernel_size = (3, 3) latent_dim = 128 batch_size = 128 epochs = 10 vae, encoder, decoder = construct_vae(im_size, kernel_size, latent_dim) if is_train: history = vae.fit(X_train, epochs=epochs, batch_size=batch_size, validation_data=(X_test, None), verbose=2) vae.save_weights('vae_cnn.h5') # summarize history for loss plt.plot(history.history['loss']) plt.plot(history.history['val_loss']) plt.title('model loss') plt.ylabel('loss') plt.xlabel('epoch') plt.legend(['train', 'test'], loc='upper left') plt.savefig('vae_train.jpeg') plt.show() else: vae.load_weights('vae_cnn.h5') # Transform to latent representation encoded_data = encoder.predict(data, batch_size=batch_size) pd.DataFrame(encoded_data[0]).to_csv('latest_rep_cnn.csv', index=None) print('Completed.')
5,944
87e17eb6fa91be09ac9afa43c4e58054faa77477
# Generated by Django 3.1.2 on 2020-10-29 06:04 from django.conf import settings from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ] operations = [ migrations.CreateModel( name='userProfile', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('kassa', models.FloatField(null=True)), ('sirket', models.CharField(max_length=50, null=True)), ('telefon', models.CharField(max_length=50, null=True)), ('adress', models.CharField(max_length=200, null=True)), ('profilsekli', models.ImageField(null=True, upload_to='')), ('dogumtarixi', models.DateField(null=True)), ('user', models.OneToOneField(null=True, on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL)), ], ), ]
5,945
90ae6fe37cea2c07d8308498c62460c10ca46846
# -*- coding: utf-8 -*- """ Created on Wed Oct 4 20:55:22 2017 @author: Ivan """ # ----------- # User Instructions # # Modify the test() function to include two new test cases: # 1) four of a kind (fk) vs. full house (fh) returns fk. # 2) full house (fh) vs. full house (fh) returns fh. # # Since the program is still incomplete, clicking RUN won't do # anything, but clicking SUBMIT will let you know if you # have gotten the problem right. #HAND EXAMPLES # straight flush 8, 11 for Jack #FOUR ACES IS MAJOR RANK NUMBER 7 #ACE IS CARD RANK NUMBER 14 #QUEEN RANK 12 def poker(hands): "Return the best hand: poker([hand, ...]) => hand" return max(hands, key = hand_rank) def hand_rank(hand): "return a value indicationg the ranking of a hand." ranks = card_ranks(hand) if straight (ranks) and flush(hand): return (8, max(ranks))# 2 3 4 5 6 (8,6) 6 7 8 9 T (8, 10) elif kind (4 , ranks): return (7, kind(4,ranks), kind(1,ranks))#9 9 9 9 3 9(7,9,3) elif : def test(): "Test cases for the functions in poker program" sf = "6C 7C 8C 9C TC".split() # Straight Flush fk = "9D 9H 9S 9C 7D".split() # Four of a Kind fh = "TD TC TH 7C 7D".split() # Full House assert poker([sf, fk, fh]) == sf assert poker([fk, fh]) == fk assert poker([fh, fh]) == fh assert poker([sf]) == sf assert poker([sf] + 99*[fh]) == sf # For example, calling hand_rank on sf should output (8, 10) assert hand_rank([sf]) == (8,10) assert hand_rank([sf]) == (7,9,7) assert hand_rank([sf]) == (6,10,7) return "test pass" print (test()) print (max([3,4,5,0]), max([3,2,-5,4],key = abs))
5,946
4318c99b3de9bb9c44eed57525c9ccbe82a17276
#!/usr/bin/python # # Script written by Legoktm, 2011 # Released into the Public Domain on November, 16, 2011 # This product comes with no warranty of any sort. # Enjoy! # from commands import getoutput def notify(string, program=False): if not program: command = 'growlnotify Python -m "%s"' %string else: command = 'growlnotify "%s" -m "%s"' %(program, string) getoutput(command) def notifyold(string): #THIS IS THE OLD METHOD. YOU SHOULD ONLY USE THIS IF YOU DO NOT HAVE growlnotify INSTALLED. print"""]9;%s """ %string
5,947
9e02b1a90d61de6d794dd350b50417a2f7260df6
from django import forms from django.contrib.auth.models import User from .models import TblPublish , TblSnippetTopics, TblSnippetData, TblLearnTopics, TblLearnData, TblBlog, TblBlogComments,TblLearnDataComments, TblBlogGvp, TblLearnDataGvp,TblSnippetDataGvp, TblHome, TblAbout, TblQueries from django.contrib.auth.forms import UserCreationForm class UsersigninForm(forms.Form): username = forms.CharField(required = True, label = 'Username', max_length = 100, widget=forms.TextInput(attrs={'placeholder': 'Username'})) password = forms.CharField(required = True, label = 'Password', max_length = 32, widget = forms.PasswordInput(attrs={'placeholder': 'Password'})) class SignupForm(UserCreationForm): email = forms.EmailField(max_length=200, help_text='Required') class Meta: model = User fields = ('username', 'email', 'password1', 'password2') def __init__(self, *args, **kwargs): super(SignupForm, self).__init__(*args, **kwargs) self.fields['username'].widget.attrs['placeholder'] = "Username" self.fields['email'].widget.attrs['placeholder'] = "email" self.fields['password1'].widget.attrs['placeholder'] ="password" self.fields['password2'].widget.attrs['placeholder'] = "password Again" class UserRegistrationForm(forms.Form): username = forms.CharField(required = True, min_length=6,label = 'Username', max_length = 100, widget=forms.TextInput(attrs={'placeholder': 'Username'}) ) email = forms.EmailField(required = True, label = 'Email', max_length = 100, widget=forms.EmailInput(attrs={'placeholder': 'e.g. : email@gmail.com'})) firstname = forms.CharField(required = True, label = 'First Name', max_length = 100, widget=forms.TextInput(attrs={'placeholder': 'First Name'})) lastname = forms.CharField(required = True, label = 'Last Name', max_length = 100, widget=forms.TextInput(attrs={'placeholder': 'Last Name'})) password = forms.CharField(required = True, label = 'Password', max_length = 100, widget = forms.PasswordInput(attrs={'placeholder': 'Password'})) passwordagain = forms.CharField(required = True, label = 'Password (Again)', max_length = 100, widget = forms.PasswordInput(attrs={'placeholder': 'Password (Again)'})) class TblPublishForm(forms.ModelForm): class Meta(): model = TblPublish fields = '__all__' class TblSnippetDataForm(forms.ModelForm): class Meta(): model = TblSnippetData fields = ['snippet_topics','snippet_data_subject','snippet_data_description','snippet_data_keyword','snippet_data_code','snippet_data_datetime','snippet_data_added_by','snippet_topics','snippet_data_publish'] def clean_snippet_topics_added_by(self): if not self.cleaned_data['snippet_topics_added_by']: return User() return self.cleaned_data['snippet_topics_added_by'] def __init__(self, *args, **kwargs): super(TblSnippetDataForm, self).__init__(*args, **kwargs) self.fields['snippet_data_datetime'].widget = forms.HiddenInput() self.fields['snippet_data_added_by'].widget = forms.HiddenInput() self.fields['snippet_topics'].widget = forms.HiddenInput() self.fields['snippet_data_subject'].widget.attrs['placeholder'] = "Title/Topics" self.fields['snippet_data_description'].widget.attrs['placeholder'] = "Brief Description" self.fields['snippet_data_keyword'].widget.attrs['placeholder'] ="Keyword For Search" self.fields['snippet_data_code'].widget.attrs['placeholder'] = "Snippet (Code)" self.fields['snippet_data_publish'].widget.attrs['placeholder'] = "Ready-To-Publish" self.fields['snippet_data_publish'].label = "Publish" class TblBlogForm(forms.ModelForm): class Meta(): model = TblBlog fields = ['blog_title','blog_description','blog_keyword','blog_content','blog_pics','blog_publish','blog_datetime','blog_summary','blog_like','blog_added_by'] def __init__(self, *args, **kwargs): super(TblBlogForm, self).__init__(*args, **kwargs) self.fields['blog_datetime'].widget = forms.HiddenInput() self.fields['blog_summary'].widget = forms.HiddenInput() self.fields['blog_like'].widget = forms.HiddenInput() self.fields['blog_added_by'].widget = forms.HiddenInput() self.fields['blog_title'].widget.attrs['placeholder'] = "Title/Topics" self.fields['blog_description'].widget.attrs['placeholder'] = "Brief Description" self.fields['blog_content'].widget.attrs['placeholder'] = "Blog Content" self.fields['blog_keyword'].widget.attrs['placeholder'] = "Keyword For Search" self.fields['blog_pics'].widget.attrs['placeholder'] = "Upload Pics" self.fields['blog_publish'].label = "Publish" class TblBlogCommentsForm(forms.ModelForm): class Meta(): model = TblBlogComments fields = '__all__' class TblLearnDataForm(forms.ModelForm): class Meta(): model = TblLearnData fields = ['learn_data','learn_data_keyword','learn_data_description','learn_data_publish','learn_data_datetime','learn_data_added_by','learn_topics','learn_data_like','learn_data_icon'] def __init__(self, *args, **kwargs): super(TblLearnDataForm, self).__init__(*args, **kwargs) self.fields['learn_data_datetime'].widget = forms.HiddenInput() self.fields['learn_data_added_by'].widget = forms.HiddenInput() self.fields['learn_topics'].widget = forms.HiddenInput() self.fields['learn_data_like'].widget = forms.HiddenInput() self.fields['learn_data_icon'].widget = forms.HiddenInput() self.fields['learn_data'].widget.attrs['placeholder'] = "Title/Topics" self.fields['learn_data_description'].widget.attrs['placeholder'] = "Brief Description" self.fields['learn_data_keyword'].widget.attrs['placeholder'] = "Keyword For Search" self.fields['learn_data_publish'].label = "Publish" class TblLearnDataCommentsForm(forms.ModelForm): class Meta(): model = TblLearnDataComments fields = '__all__' class TblBlogGvpForm(forms.ModelForm): class Meta(): model = TblBlogGvp fields = '__all__' class TblLearnDataGvpForm(forms.ModelForm): class Meta(): model = TblLearnDataGvp fields = '__all__' class TblHomeForm(forms.ModelForm): class Meta(): model = TblHome fields = '__all__' def __init__(self, *args, **kwargs): super(TblHomeForm, self).__init__(*args, **kwargs) self.fields['home_datetime'].widget = forms.HiddenInput() self.fields['home_added_by'].widget = forms.HiddenInput() self.fields['home_pics'].widget.attrs['placeholder'] = "Upload Image" self.fields['home_content'].widget.attrs['placeholder'] = "Content" self.fields['home_content_description'].widget.attrs['placeholder'] = "Description" self.fields['home_publish'].label = "Publish" class TblAboutForm(forms.ModelForm): class Meta(): model = TblAbout fields = '__all__' def __init__(self, *args, **kwargs): super(TblAboutForm, self).__init__(*args, **kwargs) self.fields['about_datetime'].widget = forms.HiddenInput() self.fields['about_added_by'].widget = forms.HiddenInput() self.fields['about_pics'].widget.attrs['placeholder'] = "Upload Image" self.fields['about_content'].widget.attrs['placeholder'] = "Content" self.fields['about_content_description'].widget.attrs['placeholder'] = "Description" self.fields['about_publish'].label = "Publish" class TblLearnTopicsForm(forms.ModelForm): class Meta(): model = TblLearnTopics fields = '__all__' def __init__(self, *args, **kwargs): super(TblLearnTopicsForm, self).__init__(*args, **kwargs) self.fields['learn_topics_datetime'].widget = forms.HiddenInput() # self.fields['learn_topics_added_by'].widget = forms.HiddenInput() self.fields['learn_topics_icon'].widget.attrs['placeholder'] = 'Icon' self.fields['learn_topics_coverpage_img'].widget = forms.HiddenInput() self.fields['learn_topics'].widget.attrs['placeholder'] = "Topics" self.fields['learn_topics_description'].widget.attrs['placeholder'] = "Description" self.fields['learn_topics_publish'].label = "Publish" def clean_learn_topics_added_by(self): if not self.cleaned_data['learn_topics_added_by']: return User() return self.cleaned_data['learn_topics_added_by'] class TblSnippetTopicsForm(forms.ModelForm): class Meta(): model = TblSnippetTopics fields = '__all__' def __init__(self, *args, **kwargs): super(TblSnippetTopicsForm, self).__init__(*args, **kwargs) self.fields['snippet_topics_datetime'].widget = forms.HiddenInput() self.fields['snippet_topics_added_by'].widget = forms.HiddenInput() self.fields['snippet_topics_icon'].widget = forms.HiddenInput() self.fields['snippet_topics_coverpage_img'].widget = forms.HiddenInput() self.fields['snippet_topics_expire'].widget = forms.HiddenInput() self.fields['snippet_topics'].widget.attrs['placeholder'] = "Topics" self.fields['snippet_topics_description'].widget.attrs['placeholder'] = "Description" self.fields['snippet_topics_publish'].label = "Publish" def clean_snippet_topics_added_by(self): if not self.cleaned_data['snippet_topics_added_by']: return User() return self.cleaned_data['snippet_topics_added_by'] class TblQueriesForm(forms.ModelForm): class Meta(): model = TblQueries fields = '__all__' def __init__(self, *args, **kwargs): super(TblQueriesForm, self).__init__(*args, **kwargs) self.fields['datetime'].widget = forms.HiddenInput() self.fields['name'].widget.attrs['placeholder'] = "Name" self.fields['email'].widget.attrs['placeholder'] = "Email" self.fields['subject'].widget.attrs['placeholder'] = "Subject" self.fields['message'].widget.attrs['placeholder'] = "Message"
5,948
fa880adcb9f009ffc206de59e8284ac6350fef4c
from django.db import models #from ingredients.models import * class Unit(models.Model): short_name = models.CharField(max_length=20) full_name = models.CharField(max_length=255, null=True) weight_in_grams = models.FloatField(default=1.0) def __str__(self): return f"{self.short_name}"
5,949
9527743802a0bb680ab3dcf325c0f7749a51afc6
i = 100 while i >= 100: print(i) i -= 1 print(i)
5,950
6111c9730c556ab3ab95f7685ffa135a2bbeb2ca
from __future__ import with_statement from fabric.api import * from fabric.colors import * from fabric.utils import puts from fabric.context_managers import shell_env env.hosts = ['git@tweetset.com'] def deploy(): "deploys the project to the server" with prefix('source /srv/django-envs/tweetset/bin/activate'): with shell_env(DJANGO_SETTINGS_MODULE='tweetset.settings.production'): with cd('/srv/django-projects/tweetset'): puts(magenta("[Pulling changes]")) run('git pull origin master') puts(magenta("[Installing packages]")) run('pip install -r requirements.txt') with cd('/srv/django-projects/tweetset/tweetset'): puts(magenta("[Migrating apps]")) run('python manage.py migrate --no-initial-data') puts(magenta("[Collecting static files]")) run('python manage.py collectstatic --noinput') puts(magenta("[Touching wsgi.py]")) run('touch /srv/django-projects/tweetset/tweetset/tweetset/wsgi.py')
5,951
2075e7e05882524c295c8542ca7aefae2cf3e0fc
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """Tests for the storage format CLI arguments helper.""" import argparse import unittest from plaso.cli import tools from plaso.cli.helpers import storage_format from plaso.lib import errors from tests.cli import test_lib as cli_test_lib class StorageFormatArgumentsHelperTest(cli_test_lib.CLIToolTestCase): """Tests for the storage format CLI arguments helper.""" # pylint: disable=no-member,protected-access _EXPECTED_OUTPUT = """\ usage: cli_helper.py [--storage_format FORMAT] [--task_storage_format FORMAT] Test argument parser. {0:s}: --storage_format FORMAT, --storage-format FORMAT Format of the storage file, the default is: sqlite. Supported options: sqlite --task_storage_format FORMAT, --task-storage-format FORMAT Format for task storage, the default is: sqlite. Supported options: redis, sqlite """.format(cli_test_lib.ARGPARSE_OPTIONS) def testAddArguments(self): """Tests the AddArguments function.""" argument_parser = argparse.ArgumentParser( prog='cli_helper.py', description='Test argument parser.', add_help=False, formatter_class=cli_test_lib.SortedArgumentsHelpFormatter) storage_format.StorageFormatArgumentsHelper.AddArguments(argument_parser) output = self._RunArgparseFormatHelp(argument_parser) self.assertEqual(output, self._EXPECTED_OUTPUT) def testParseOptions(self): """Tests the ParseOptions function.""" options = cli_test_lib.TestOptions() options.storage_format = 'sqlite' options.task_storage_format = 'sqlite' test_tool = tools.CLITool() storage_format.StorageFormatArgumentsHelper.ParseOptions(options, test_tool) self.assertEqual(test_tool._storage_format, options.storage_format) self.assertEqual( test_tool._task_storage_format, options.task_storage_format) with self.assertRaises(errors.BadConfigObject): storage_format.StorageFormatArgumentsHelper.ParseOptions(options, None) with self.assertRaises(errors.BadConfigOption): options.storage_format = 'bogus' storage_format.StorageFormatArgumentsHelper.ParseOptions( options, test_tool) if __name__ == '__main__': unittest.main()
5,952
83bac8176caafc5551089c4bef5c1f38e1e8d4da
# block-comments.py ''' Block comments generally apply to some (or all) code that follows them, and are indented to the same level as that code. Each line of a block comment starts with a # and a single space (unless it is indented text inside the comment). Paragraphs inside a block comment are separated by a line containing a single #. '''
5,953
679ca76212b90261683d59899c1189280b6b6e8c
#!/user/bin/env python3 -tt """ https://adventofcode.com/2017/day/7 """ import sys import re # Global variables task="d-7" infile=task + ".input" with open('input/' + infile) as file: input = file.read() file.close() class Node: parent = None children = None weight_sum = 0 def __init__(self, name, weight, linked): self.name = name self.weight = int(weight) self.weight_sum += self.weight self.linked = linked self.children = [] def __str__(self): children_str = " ".join(self.linked) parent_name = self.parent.name if self.parent else "KING" return "" + self.name + " : " + parent_name + ":" + str(self.weight) + " : " + children_str #+ ":||||:" + " ".join([n.name for n in self.children]) nodeTree = [] def traverseTree(node, deep): if len(nodeTree) <= deep: nodeTree.append([]) nodeTree[deep].append(node) if not node.children: return for child in node.children: traverseTree(child, deep+1) def detectUnstable(node, deep): weights = [] for n in node.children: if n.weight_sum not in weights: weights.append(n.weight_sum) for n in node.children: if len(weights) > 1 and max(weights) == n.weight_sum: print("found unstable for: ", n.name, " in: ", weights) diff = max(weights) - min(weights) new_weight = n.weight - diff print("[", deep, "]New weight:", new_weight, " for: ", n, " diff: ", diff) for n in node.children: if len(nodeTree) > deep + 1: detectUnstable(n, deep +1) def buildTree(parent, nodes): if not parent.linked: return parent for link_str in parent.linked: for node in nodes: #Find matching node if link_str == node.name: node.parent = parent parent.children.append(node) child = buildTree(node, nodes) parent.weight_sum += child.weight_sum return parent def printNodes(nodes): print("Print all nodes") for node in nodes: print(node) def solve(): raw_node_list = [s.rstrip() for s in input.split("\n")] regex = re.compile(r'(\w+) \((\d+)\)') master_node = None nodes = [] all_linked_node_names = [] for n in raw_node_list: pmn = regex.match(n) np = Node(pmn.group(1).rstrip(), pmn.group(2).rstrip(), []) links = n.split("->") if len(links) > 1: np.linked = [s.strip() for s in links[1].split(",")] if np: nodes.append(np) for link in np.linked: all_linked_node_names.append(link) for node in nodes: if len(node.linked) > 1 and not node.name in ":".join(all_linked_node_names): master_node = node buildTree(master_node, nodes) traverseTree(master_node, 0) # for row in nodeTree: # nodes = "" # for node in row: # parent = node.parent.name if node.parent else "KING" # nodes += "[" + parent + "]" + node.name + ":" + str(node.weight_sum) # print(nodes) # for weights in weightTree: # if len(weights) > 1: # print(":".join([str(s) for s in weights])) print("Detect unstable:") detectUnstable(master_node, 0) if __name__ == '__main__': solve() print("Finished executing: " + task) sys.exit(1)
5,954
7747cbb1a1ed191b616b0d1bcfd51cdea05067f5
from bs4 import BeautifulSoup import re class Rules: def __init__(self): self.ruleCollection = { "1" : self.rule1, "2" : self.rule2, "3" : self.rule3, "4" : self.rule4, "5" : self.rule5, "6" : self.rule6, "7" : self.rule7, "8" : self.rule8, "9" : self.rule9, "10" : self.rule10, } def getRule(self, id): return self.ruleCollection[id] # Image without text alternatives def rule1(self,dom): return dom.find_all(self._img_without_alt) # Embeded multimedia without noembed (text or audio) def rule2(self,dom): video_arr = [] for embed in dom.find_all("embed"): if not embed.noembed: video_arr.append(embed) return video_arr #color cues #without the definitions in css #This rule needs to be improved def rule3(self,dom): clrcue_arr = [] for fnt in dom.find_all('font'): if fnt.has_attr('color'): clrcue_arr.append(fnt) for spn in dom.find_all('span'): if spn.has_attr('style'): clrcue_arr.append(spn) return clrcue_arr #Table without summary def rule4(self,dom): return dom.find_all(self._tbl_without_summ) #Table without caption def rule5(self,dom): twcap_arr = []; for tb in dom.find_all("table"): if not tb.caption: twcap_arr.append(tb) return twcap_arr def rule6(self,dom): lbl_arr = []; inputElems =[] inputElems.extend(dom.find_all(["textarea", "select"])) inputElems.extend(dom.find_all(type=["text","password", "checkbox", "radio", "file"])) labels = dom.find_all('label') for input in inputElems: hasLabel = False if input.has_attr('id'): id = input['id'] for lbl in labels: if lbl.has_attr("for") and lbl['for'] == id: hasLabel = True break if not hasLabel: lbl_arr.append(input) return lbl_arr def rule7(self,dom): dblclk_arr = [] dblclk_arr = dom.find_all(ondblclick = True, onkeypress = False) return dblclk_arr def rule8(self,dom): title_arr = [] isTitle = dom.find('title') if isTitle is None: title_arr.append(dom.find('head')) return title_arr def rule9(self,dom): link_arr = [] url_tags = ['http', 'https', '://www.' , 'www' ] for link in dom.find_all('a'): if not ('http' in link or 'https' in link or '://www.' in link or 'www' in link): link_arr.append(link) return link_arr def rule10(self,dom): tab_arr = [] for tab in dom.find_all('a', 'input', ondblclick = True, onkeydown = True, onkeypress = True): if not tab.has_attr('tabindex'): tab_arr.append(tab) return tab_arr def _img_without_alt(self,tag): return tag.name == "img" and not tag.has_attr("alt") def _tbl_without_summ(self,tag): return tag.name == "table" and not tag.has_attr("summary") #for testing
5,955
e26fa69ea1f0bee82b4108ac5a541a6175645728
import numpy as np import cPickle from features import create_features, PROJECT from parse import load_data from dict_vectorizer import DictVectorizer videos, users, reviews = load_data() orig_X = np.array([(x['date'], x['text'], x['user']) for x in reviews]) feats = create_features(orig_X, None) v = DictVectorizer(sparse=False) feats = v.fit_transform(feats) # feats is now in vectorized format # v.transform() is the transformation that needs to be used on test data cPickle.dump(v, open(PROJECT + "db/dictvectorizer.pickle", "wb"))
5,956
459dd9302f7100ad02119cc94b735b19287f21e5
import tensorflow as tf import numpy as np import time import os from sklearn.metrics import roc_curve import matplotlib.pyplot as plt from src.model import get_args from src.funcs import linear from src.youtubeface import load_ytf_data from src.lfw import load_lfw_data from src.facescrub import load_fs_data from src.wrapper_basicImg import wrapper_basicImg if __name__ == '__main__': os.environ["CUDA_VISIBLE_DEVICES"] = '0' total_iteration = 300000 m = 512 q = 32 lam = 0.01 beta = 1. margin = 0.5 s = 32 batch_size = 256 class_num = 1595 train_dataset = 'FS' eval_dataset = "LFW" args = get_args() ### Get image and label from tfrecord image, label, iterator = {}, {}, {} if train_dataset == 'YTF': image['train'], label['train'], iterator['train'] = load_ytf_data(batch_size, 'train') elif train_dataset == 'FS': image['train'], label['train'], iterator['train'] = load_fs_data(batch_size, 'train') else: print("Select proper dataset") ### Get evaluation dataset. Wrapper wrapper = wrapper_basicImg(dataset=eval_dataset) if eval_dataset == 'YTF': image['gallery'], label['gallery'], iterator['gallery'] = load_ytf_data(batch_size, 'train', eval=True) image['test'], label['test'], iterator['test'] = load_ytf_data(batch_size, 'test') elif eval_dataset == 'LFW': image['gallery'], label['gallery'], iterator['gallery'] = load_lfw_data(batch_size, 'gallery') image['test'], label['test'], iterator['test'] = load_lfw_data(batch_size, 'probe') ### Backbone network (Arcface) embedding_tensor = tf.placeholder(name='img_inputs', shape=[None, 512], dtype=tf.float32) labels = tf.placeholder(name='label', shape=[None, ], dtype=tf.int32) ### Global step & learning rate global_step = tf.Variable(0, trainable=False) starter_learning_rate = 0.003 learning_rate = tf.train.exponential_decay(starter_learning_rate, global_step, total_iteration, 0.96) ### My implementation (DIom algorithm) with tf.variable_scope('DIom'): fc1 = linear(tf.nn.relu(embedding_tensor), 1024, 'fc1') fc2 = linear(tf.nn.relu(fc1), 1024, 'fc2') fc3 = linear(tf.nn.relu(fc2), m * q, 'fc3') h_k = tf.reshape(fc3, [-1, m, q]) h_k = tf.nn.softmax(beta * h_k, axis=2) index_matrix = tf.range(1, q + 1, dtype=tf.float32) h = tf.reduce_sum(h_k * index_matrix, axis=2) h = tf.reshape(h, [-1, m]) h_norm = tf.math.l2_normalize(h, axis=1) ### Loss function l = tf.one_hot(labels, class_num) l = tf.matmul(l, tf.transpose(l)) l_float = tf.cast(l, tf.float32) l = tf.reshape(tf.clip_by_value(l_float, 0., 1.), (-1, 1)) label_int = tf.cast(tf.squeeze(l, 1), tf.int32) inner_prod = tf.reshape(tf.matmul(h_norm, tf.transpose(h_norm)), (-1, 1)) cos_t = tf.clip_by_value(inner_prod, -1., 1. - 1e-6) theta = tf.math.acos(cos_t) sin_t = tf.math.sin(theta) cos_mt = tf.math.cos(theta + margin) sin_mt = tf.math.sin(theta + margin) logit = l * s * (tf.concat([sin_t, cos_mt], 1)) + (1 - l) * s * (tf.concat([sin_mt, cos_t], 1)) l_ij_logit = tf.nn.sparse_softmax_cross_entropy_with_logits(logits=logit, labels=label_int) c_ij = tf.abs(tf.reduce_mean(h, axis=0) - (q + 1) / 2) # Baseline pairwise-CE # label_ce = tf.cast(labels, tf.float32) # l_ij = l * tf.log(tf.square(inner_prod)) + (1 - l) * tf.log(tf.maximum(1e-6, 1 - tf.square(inner_prod))) # l_ij = -tf.reduce_mean(l_ij) # My novel cosine loss l_ij = tf.reduce_mean(l_ij_logit) c_ij = tf.reduce_mean(c_ij) loss = l_ij + lam * c_ij gradient = tf.gradients(loss, sin_t) ### Optimizer t_vars = tf.global_variables() train_vars = [var for var in t_vars if 'DIom' in var.name] opt_t = tf.train.MomentumOptimizer(learning_rate, momentum=0.9).minimize(loss, var_list=train_vars, global_step=global_step) with tf.Session() as sess: tf.global_variables_initializer().run() sess.run(iterator['train'].initializer) ### Training iteration = sess.run(global_step) t_opt = [opt_t, loss, l_ij, c_ij] start_time = time.time() while iteration != total_iteration: img, lbl = sess.run([image['train'], label['train']]) train_dict = { embedding_tensor: img, labels: lbl } _, train_loss, loss_l, loss_c = sess.run(t_opt, feed_dict=train_dict) iteration += 1 if iteration % 10000 == 0: ### Evaluation after training ### Get gallery hash code # gallery = [] # gallery_label = [] # sess.run(iterator['gallery'].initializer) # try: # while True: # img, lbl = sess.run([image['gallery'], label['gallery']]) # # gallery_dict = { # embedding_tensor: img # } # # hash_code = sess.run(h_norm, feed_dict=gallery_dict) # # if gallery == []: # gallery = hash_code # gallery_label = lbl # else: # gallery = np.concatenate((gallery, hash_code), axis=0) # gallery_label = np.concatenate((gallery_label, lbl), axis=0) # # except tf.errors.OutOfRangeError: # pass # # ### Get probe hash code # probe = [] # probe_label = [] # code_arr = [] # sess.run(iterator['test'].initializer) # try: # while True: # img, lbl = sess.run([image['test'], label['test']]) # # gallery_dict = { # embedding_tensor: img # } # # code, hash_code = sess.run([h, h_norm], feed_dict=gallery_dict) # # if probe == []: # probe = hash_code # probe_label = lbl # code_arr = code # else: # probe = np.concatenate((probe, hash_code), axis=0) # probe_label = np.concatenate((probe_label, lbl), axis=0) # code_arr = np.concatenate((code_arr, code), axis=0) # # except tf.errors.OutOfRangeError: # pass # # ### Code frequency # code_arr = np.around(code_arr) # count_arr = [] # for i in range(q): # count_arr.append(np.count_nonzero(code_arr == i + 1)) # # plt.clf() # plt.bar(range(1, q+1), count_arr) # plt.savefig('./plt/code_' + str(iteration) + '.png') # ### Calculate MAP # gtp = 40 # k = 50 # # distance = np.matmul(probe, gallery.T) # arg_idx = np.argsort(-distance, axis=1) # # max_label = gallery_label[arg_idx[:, :k]] # match_matrix = np.equal(max_label, probe_label[:,np.newaxis]) # # tp_seen = match_matrix * np.cumsum(match_matrix, axis=1) # ap = np.sum(tp_seen / np.arange(1, k + 1)[np.newaxis, :], axis=1) / gtp # MAP = np.mean(ap) ### Calculate EER dist_list = [] label_list = [] code_list = [] while wrapper.samples_left > 0: imgs, lbls = wrapper.get_next_batch(100) imgs = np.reshape(imgs, [-1, 512]) eer_dict = { embedding_tensor: imgs } code, int_code = sess.run([h_norm, h], feed_dict=eer_dict) code = np.reshape(code, [-1, 2, m]) distance = np.sum(np.prod(code, axis=1), axis=1) if dist_list == []: dist_list = distance label_list = lbls code_list = int_code else: dist_list = np.concatenate((dist_list, distance), axis=0) label_list = np.concatenate((label_list, lbls), axis=0) code_list = np.concatenate((code_list, int_code), axis=0) wrapper.samples_left= np.size(wrapper.labels, axis=0) wrapper.next_batch_pointer = 0 fpr, tpr, threshold = roc_curve(label_list, dist_list, pos_label=1) fnr = 1 - tpr # eer_threshold = threshold(np.nanargmin(np.absolute((fnr - fpr)))) eer = fpr[np.nanargmin(np.absolute((fnr - fpr)))] ### Code frequency code_arr = np.around(code_list) count_arr = [] for i in range(q): count_arr.append(np.count_nonzero(code_arr == i + 1)) plt.clf() plt.bar(range(1, q + 1), count_arr) plt.savefig('./plt/code_' + str(iteration) + '.png') time_taken = time.time() - start_time MAP = 0 # print("good") print("[Iteration %d] Train Loss: %.4f, Loss_l: %.4f, Loss_c: %.4f, MAP: %.4f, EER: %.4f, Taken time: %.4f" % (iteration, train_loss, loss_l, loss_c, MAP, eer, time_taken)) start_time = time.time() # np.save('CP.npy', np.concatenate((fpr[np.newaxis, :], tpr[np.newaxis, :]), axis=0)) ### Save model. # save_vars = [var for var in t_vars if 'DIom' in var.name] # saver = tf.train.Saver(var_list=save_vars) # saver.save(sess, './model/DIom_layer')
5,957
3770e59c5bd6837a0fb812f80c6549024e06a9e4
''' Functional tests for the Write Stream ''' from behave import given, when, then from OSC import OSCClient, OSCMessage, OSCServer @given('I want to send an integer') def step_impl (context): pass @given('I want to send a float') def step_impl (context): pass @given('I want to send two integers with one channel') def step_impl (context): pass @given('I want to send two floats with one channel') def step_impl (context): pass rep=0 @given('I want to send {reps} floats with 1 channel') def step_impl (context, reps): rep = reps @when('I define "{host}" and the port {port} and the number is {flt_one}, and the second is {flt_two}') def step_impl(context, host, port, flt_one,flt_two): client = OSCClient() client.connect((host, int(port))) if rep > 2: for i in range(rep): if flt_two > 0.0: client.send(OSCMessage(['/test', flt_one, flt_two])) else: client.send(OSCMessage('/test', flt_one)) else: if flt_two > 0.0: client.send(OSCMessage(['/test', flt_one,flt_two])) else: client.send(OSCMessage(['/test', flt_one])) @when('I define "{host}" and the port "{port}" and the integer is {int_one}, and the second is {int_sec}') def step_impl(context, host, port, int_one, int_sec): client = OSCClient() client.connect((host, port)) if int_sec > 0: client.send(OSCMessage('/test', int_one, int_sec)) else: client.send(OSCMessage('/test', int_one)) @then('I hear a sound') def step_impl(context): pass @then('I hear two sounds') def step_impl(context): pass @then('I hear a sound that lasts for {son_length} seconds') def step_impl(context,son_length): pass def listen_handler(path, tags, args, source): ''' Handler for the listener ''' response = args[0] assert(response, "Negative numbers not processed") @then('I want to receive "{message}"') def step_impl(context, message): listen = OSCServer(("127.0.0.1", 4589)) listen.timeout = 0 #infinite timeout listen.addMsgHandler("/err", listen_handler) listen.close()
5,958
2343a9d3e253b5a0347b5890a5d7b9c3be777669
import tkinter import csv import datetime import time root = tkinter.Tk() root.title("Attendance") root.geometry("+450+250") ts = time.time() date = datetime.datetime.fromtimestamp(ts).strftime('%Y-%m-%d') fileName = "Attendance/Attendance_"+date+".csv" # open file with open(fileName, newline="") as file: reader = csv.reader(file) # r and c tell us where to grid the labels r = 0 for col in reader: c = 0 for row in col: row = row.strip("['']") if r == 0: label = tkinter.Label(root, width=20, height=4, text=row, bg="#7d807e", relief=tkinter.RIDGE) label.grid(row=r, column=c) else: label = tkinter.Label(root, width=20, height=4, text=row, relief=tkinter.RIDGE) label.grid(row=r, column=c) c += 1 r += 1 fileName2 = "StudentDetails/StudentDetails.csv" with open(fileName, newline="") as file: reader = csv.reader(file) # r and c tell us where to grid the labels r2 = 0 for col in reader: r2 += 1 total = r2-1 print(total) present = r - 1 absent = total - present label = tkinter.Label(root, width=20, height=4, text="Present", fg="green", relief=tkinter.RIDGE) label.grid(row=r+1, column=0) label = tkinter.Label(root, width=20, height=4, text=present, relief=tkinter.RIDGE) label.grid(row=r+1, column=1) label = tkinter.Label(root, width=20, height=4, text="Absent", fg="red", relief=tkinter.RIDGE) label.grid(row=r+1, column=2) label = tkinter.Label(root, width=20, height=4, text=absent, relief=tkinter.RIDGE) label.grid(row=r+1, column=3) root.mainloop()
5,959
ae998fb17b8d6f4f5c8871a0ebe86a039501ec99
# -*- coding: utf-8 -*- __all__ = "corner" import logging import numpy as np from corner.core import corner_impl try: from corner.arviz_corner import arviz_corner except ImportError: arviz_corner = None def corner( data, bins=20, *, # Original corner parameters range=None, axes_scale="linear", weights=None, color=None, hist_bin_factor=1, smooth=None, smooth1d=None, labels=None, label_kwargs=None, titles=None, show_titles=False, title_quantiles=None, title_fmt=".2f", title_kwargs=None, truths=None, truth_color="#4682b4", scale_hist=False, quantiles=None, verbose=False, fig=None, max_n_ticks=5, top_ticks=False, use_math_text=False, reverse=False, labelpad=0.0, hist_kwargs=None, # Arviz parameters group="posterior", var_names=None, filter_vars=None, coords=None, divergences=False, divergences_kwargs=None, labeller=None, **hist2d_kwargs, ): """ Make a *sick* corner plot showing the projections of a data set in a multi-dimensional space. kwargs are passed to hist2d() or used for `matplotlib` styling. Parameters ---------- data : obj Any object that can be converted to an ``arviz.InferenceData`` object. Refer to documentation of ``arviz.convert_to_dataset`` for details. bins : int or array_like[ndim,] The number of bins to use in histograms, either as a fixed value for all dimensions, or as a list of integers for each dimension. group : str Specifies which InferenceData group should be plotted. Defaults to ``'posterior'``. var_names : list Variables to be plotted, if ``None`` all variable are plotted. Prefix the variables by `~` when you want to exclude them from the plot. filter_vars : {``None``, ``"like"``, ``"regex"``} If ``None`` (default), interpret ``var_names`` as the real variables names. If ``"like"``, interpret ``var_names`` as substrings of the real variables names. If ``"regex"``, interpret ``var_names`` as regular expressions on the real variables names. A la ``pandas.filter``. coords : mapping Coordinates of ``var_names`` to be plotted. Passed to ``arviz.Dataset.sel``. divergences : bool If ``True`` divergences will be plotted in a different color, only if ``group`` is either ``'prior'`` or ``'posterior'``. divergences_kwargs : dict Any extra keyword arguments to send to the ``overplot_points`` when plotting the divergences. labeller : arviz.Labeller Class providing the method ``make_label_vert`` to generate the labels in the plot. Read the ArviZ label guide for more details and usage examples. weights : array_like[nsamples,] The weight of each sample. If `None` (default), samples are given equal weight. color : str A ``matplotlib`` style color for all histograms. hist_bin_factor : float or array_like[ndim,] This is a factor (or list of factors, one for each dimension) that will multiply the bin specifications when making the 1-D histograms. This is generally used to increase the number of bins in the 1-D plots to provide more resolution. smooth, smooth1d : float The standard deviation for Gaussian kernel passed to `scipy.ndimage.gaussian_filter` to smooth the 2-D and 1-D histograms respectively. If `None` (default), no smoothing is applied. labels : iterable (ndim,) A list of names for the dimensions. .. deprecated:: 2.2.1 If a ``xs`` is a ``pandas.DataFrame`` *and* ArviZ is installed, labels will default to column names. This behavior will be removed in version 3; either use ArviZ data structures instead or pass ``labels=dataframe.columns`` manually. label_kwargs : dict Any extra keyword arguments to send to the `set_xlabel` and `set_ylabel` methods. Note that passing the `labelpad` keyword in this dictionary will not have the desired effect. Use the `labelpad` keyword in this function instead. titles : iterable (ndim,) A list of titles for the dimensions. If `None` (default), uses labels as titles. show_titles : bool Displays a title above each 1-D histogram showing the 0.5 quantile with the upper and lower errors supplied by the quantiles argument. title_quantiles : iterable A list of 3 fractional quantiles to show as the the upper and lower errors. If `None` (default), inherit the values from quantiles, unless quantiles is `None`, in which case it defaults to [0.16,0.5,0.84] title_fmt : string The format string for the quantiles given in titles. If you explicitly set ``show_titles=True`` and ``title_fmt=None``, the labels will be shown as the titles. (default: ``.2f``) title_kwargs : dict Any extra keyword arguments to send to the `set_title` command. range : iterable (ndim,) A list where each element is either a length 2 tuple containing lower and upper bounds or a float in range (0., 1.) giving the fraction of samples to include in bounds, e.g., [(0.,10.), (1.,5), 0.999, etc.]. If a fraction, the bounds are chosen to be equal-tailed. axes_scale : str or iterable (ndim,) Scale (``"linear"``, ``"log"``) to use for each data dimension. If only one scale is specified, use that for all dimensions. truths : iterable (ndim,) A list of reference values to indicate on the plots. Individual values can be omitted by using ``None``. truth_color : str A ``matplotlib`` style color for the ``truths`` makers. scale_hist : bool Should the 1-D histograms be scaled in such a way that the zero line is visible? quantiles : iterable A list of fractional quantiles to show on the 1-D histograms as vertical dashed lines. verbose : bool If true, print the values of the computed quantiles. plot_contours : bool Draw contours for dense regions of the plot. use_math_text : bool If true, then axis tick labels for very large or small exponents will be displayed as powers of 10 rather than using `e`. reverse : bool If true, plot the corner plot starting in the upper-right corner instead of the usual bottom-left corner labelpad : float Padding between the axis and the x- and y-labels in units of the fraction of the axis from the lower left max_n_ticks: int Maximum number of ticks to try to use top_ticks : bool If true, label the top ticks of each axis fig : `~matplotlib.figure.Figure` Overplot onto the provided figure object, which must either have no axes yet, or ``ndim * ndim`` axes already present. If not set, the plot will be drawn on a newly created figure. hist_kwargs : dict Any extra keyword arguments to send to the 1-D histogram plots. **hist2d_kwargs Any remaining keyword arguments are sent to :func:`corner.hist2d` to generate the 2-D histogram plots. Returns ------- fig : `~matplotlib.figure.Figure` The ``matplotlib`` figure instance for the corner plot. """ if arviz_corner is None: if not ( isinstance(data, np.ndarray) or data.__class__.__name__ == "DataFrame" ): raise ImportError( "Please install arviz or use a numpy array as input" ) if ( var_names is not None or filter_vars is not None or coords is not None or divergences or divergences_kwargs is not None or labeller is not None ): logging.warning( "Please install arviz to use the advanced features of corner" ) return corner_impl( data, bins=bins, range=range, axes_scale=axes_scale, weights=weights, color=color, hist_bin_factor=hist_bin_factor, smooth=smooth, smooth1d=smooth1d, labels=labels, label_kwargs=label_kwargs, titles=titles, show_titles=show_titles, title_quantiles=title_quantiles, title_fmt=title_fmt, title_kwargs=title_kwargs, truths=truths, truth_color=truth_color, scale_hist=scale_hist, quantiles=quantiles, verbose=verbose, fig=fig, max_n_ticks=max_n_ticks, top_ticks=top_ticks, use_math_text=use_math_text, reverse=reverse, labelpad=labelpad, hist_kwargs=hist_kwargs, **hist2d_kwargs, ) return arviz_corner( data, bins=bins, range=range, axes_scale=axes_scale, weights=weights, color=color, hist_bin_factor=hist_bin_factor, smooth=smooth, smooth1d=smooth1d, labels=labels, label_kwargs=label_kwargs, titles=titles, show_titles=show_titles, title_quantiles=title_quantiles, title_fmt=title_fmt, title_kwargs=title_kwargs, truths=truths, truth_color=truth_color, scale_hist=scale_hist, quantiles=quantiles, verbose=verbose, fig=fig, max_n_ticks=max_n_ticks, top_ticks=top_ticks, use_math_text=use_math_text, reverse=reverse, labelpad=labelpad, hist_kwargs=hist_kwargs, group=group, var_names=var_names, filter_vars=filter_vars, coords=coords, divergences=divergences, divergences_kwargs=divergences_kwargs, labeller=labeller, **hist2d_kwargs, )
5,960
9586dc118be4388491770d823a38e8068e3b91cb
from django.contrib import admin from .models import Contactus,ContactusAdmin,Company,CompanyAdmin,Products,ProductsAdmin,Brands,BrandsAdmin # Register your models here. admin.site.register(Contactus,ContactusAdmin), admin.site.register(Company,CompanyAdmin), admin.site.register(Products,ProductsAdmin), admin.site.register(Brands,BrandsAdmin),
5,961
6623ac194e380c9554d72a1b20bf860b958dda97
from django.http import HttpResponse from django.shortcuts import render from .models import game def index(request): all_games = game.objects.all() context = { 'all_games' : all_games } return render(request,'game/index.html',context) def gameview(response): return HttpResponse("<h1>Ludo King</h1>")
5,962
ce263424b856c07e04bd66cda7ebda646583b1fe
S=input() T=int(input()) B=abs(S.count('L')-S.count('R'))+abs(S.count('U')-S.count('D')) print(B+S.count('?') if T==1 else max(B-S.count('?'),(B-S.count('?'))%2))
5,963
719f7b7b2d8df037583263588e93d884ab3820fe
#!/usr/bin/env python # coding: utf-8 # In[1]: import pandas as pd gp = pd.read_csv('graph6.csv') N=gp['Starting-node'].max() M=gp['Ending-node'].max() N=max(N,M) gp=gp.sort_values(by='Cost') gp=gp.reset_index() gp=gp.reset_index() gp['tree label']=gp['level_0'] index=gp['index'].max() gp.drop('index',axis=1,inplace=True) gp.drop('level_0',axis=1,inplace=True) for n in range(index+1): Count=[] Visit=[] Visit2=[] for i in range(11): Count.append(0) for m in range(n): if gp.iloc[n]['Starting-node']==gp.iloc[m]['Starting-node']: if gp.iloc[n]['Starting-node'] not in Visit2: Count[gp.iloc[m,3]]+=1 Visit2.append(gp.iloc[n]['Starting-node']) Visit.append(gp.iloc[m,3]) if gp.iloc[n]['Starting-node']==gp.iloc[m]['Ending-node']: if gp.iloc[n]['Starting-node'] not in Visit2: Count[gp.iloc[m,3]]+=1 Visit2.append(gp.iloc[n]['Starting-node']) Visit.append(gp.iloc[m,3]) if gp.iloc[n]['Ending-node']==gp.iloc[m]['Starting-node']: if gp.iloc[n]['Ending-node'] not in Visit2: Count[gp.iloc[m,3]]+=1 Visit2.append(gp.iloc[n]['Ending-node']) Visit.append(gp.iloc[m,3]) if gp.iloc[n]['Ending-node']==gp.iloc[m]['Ending-node']: if gp.iloc[n]['Ending-node'] not in Visit2: Count[gp.iloc[m,3]]+=1 Visit2.append(gp.iloc[n]['Ending-node']) Visit.append(gp.iloc[m,3]) if max(Count)==2: gp.iloc[n,0]=0 gp.iloc[n,1]=0 gp.iloc[n,2]=0 gp.iloc[n,3]=0 # gp.drop(n,axis=0,inplace=True) if max(Count)!=2: for k in range(n): if gp.iloc[k,3] in Visit: gp.iloc[k,3]=n gp.head(11) # In[ ]:
5,964
596f7dfacc931f5e756c71b8622f4001df19934b
from rest_framework import serializers from plan.models import RoughRequirement, DetailedRequirement from plan.models import OfferingCourse, FieldOfStudy, IndicatorFactor from plan.models import BasisTemplate class SimpleOfferingCourseSerializer(serializers.ModelSerializer): class Meta: model = OfferingCourse fields = ['id', 'name'] extra_kwargs = {'name': {'required': False}} class RoughRequirementSerializer(serializers.ModelSerializer): class Meta: model = RoughRequirement fields = ['id', 'index', 'title', 'description'] class DetailedRequirementSerializer(serializers.ModelSerializer): class Meta: model = DetailedRequirement fields = ['id', 'index', 'description', 'indicator_warning_line', 'rough_requirement'] class RequirementSerializer(serializers.ModelSerializer): detailed_requirements = DetailedRequirementSerializer(many=True) class Meta: model = RoughRequirement fields = ['id', 'index', 'title', 'description', 'detailed_requirements'] class OfferingCourseSerializer(serializers.ModelSerializer): class Meta: model = OfferingCourse fields = '__all__' class SimpleOfferingCourseSerializer(serializers.ModelSerializer): class Meta: model = OfferingCourse fields = ["id", "name"] class FieldOfStudySerializer(serializers.ModelSerializer): class Meta: model = FieldOfStudy fields = '__all__' class IndicatorFactorSerializer(serializers.ModelSerializer): class Meta: model = IndicatorFactor fields = '__all__' class BasisTemplateSerializer(serializers.ModelSerializer): class Meta: model = BasisTemplate fields = '__all__' class ReadIndicatorFactorSerializer(serializers.ModelSerializer): offering_course = SimpleOfferingCourseSerializer() field_of_study = FieldOfStudySerializer() basis_templates = BasisTemplateSerializer(many=True) rough_requirement = serializers.IntegerField(source='detailed_requirement.rough_requirement.id') detailed_index = serializers.IntegerField(source='detailed_requirement.index') rough_index = serializers.IntegerField(source='detailed_requirement.rough_requirement.index') detailed_description = serializers.CharField(source='detailed_requirement.description') rough_description = serializers.CharField(source='detailed_requirement.rough_requirement.description') rough_title = serializers.CharField(source='detailed_requirement.rough_requirement.title') class Meta: model = IndicatorFactor fields = '__all__'
5,965
cc1a1491ffbcf470705aeea079faac290dbaa25e
# this is the example code from the t0p-level README..d from spatialmath import SE3 import roboticstoolbox as rtb import swift robot = rtb.models.DH.Panda() print(robot) T = robot.fkine(robot.qz) print(T) # IK T = SE3(0.7, 0.2, 0.1) * SE3.OA([0, 1, 0], [0, 0, -1]) sol = robot.ikine_LMS(T) # solve IK, ignore additional outputs print(sol.q) # display joint angles # FK shows that desired end-effector pose was achieved print(robot.fkine(sol.q)) qtraj = rtb.jtraj(robot.qz, sol.q, 50) robot.plot(qtraj.q, movie="panda1.gif") # URDF + Swift version dt = 0.050 # simulation timestep in seconds robot = rtb.models.URDF.Panda() print(robot) env = swift.Swift() # instantiate 3D browser-based visualizer env.launch("chrome") # activate it env.add(robot) # add robot to the 3D scene env.start_recording("panda2", 1 / dt) for qk in qtraj.q: # for each joint configuration on trajectory robot.q = qk # update the robot state env.step() # update visualization env.stop_recording() # ffmpeg -i panda2.webm -vf "scale=iw*.5:ih*.5" panda2.gif
5,966
7aa426723f5311b5abec4a7ace9d3ec1e5e31d9a
''' ่ฟ™้ƒจๅˆ†็†่งฃๅ‚่€ƒ๏ผš https://www.bilibili.com/video/BV1QA411H7tK?from=search&seid=17305042509580602672 ๅ›พๆ–‡ไปฃ็ ๅœฐๅ€๏ผš https://blog.csdn.net/qq_30758629/article/details/112527763 ''' import threading import time data=0 lock=threading.Lock() #ๅˆ›ๅปบไธ€ไธช้”ๅฏน่ฑก def func(): global data print("%s is acquire lock..\n" %threading.current_thread().getName()) if lock.acquire(): print("%s get lock "%threading.current_thread().getName()) data+=1 time.sleep(2) print("%s release lock "%threading.current_thread().getName()) print(data) lock.release() t1=threading.Thread(target=func) t2=threading.Thread(target=func) t3=threading.Thread(target=func) t1.start() t2.start() t3.start()
5,967
8cf6a9243182a4f6b68199a8967e06790396dc10
#THIS IS PYTHON3 import tkinter as tk from tkinter import * from PIL import ImageTk from PIL import Image #to handle non-gif image formats import cv2 import numpy as np from statistics import mode import time import random import predict as ml def calcSuccess(predictedCounter, randAssault): vidLabel.pack_forget() if predictedCounter == "parry_R": instructionLabel.config(text="RIGHT PARRY") if randAssault == 4 or randAssault == 2: descriptionLabel.config(text="You've successfully parried!") elif randAssault == 3: descriptionLabel.config(text="You've been cut!") elif randAssault == 5: descriptionLabel.config(text="You've been hit!") else: descriptionLabel.config(text="You've been grabbed!") if predictedCounter == "parry_L": instructionLabel.config(text="LEFT PARRY") if randAssault == 5 or randAssault == 3: descriptionLabel.config(text="You've successfully parried!") elif randAssault == 2: descriptionLabel.config(text="You've been cut!") elif randAssault == 4: descriptionLabel.config(text="You've been hit!") else: descriptionLabel.config(text="You've been grabbed!") if predictedCounter == "punch_R": instructionLabel.config(text="RIGHT PUNCH") if randAssault == 0 or randAssault == 1 or randAssault == 4: descriptionLabel.config(text="You've successfully counter attacked!") elif randAssault == 2 or randAssault == 3: descriptionLabel.config(text="You've been cut!") elif randAssault == 5: descriptionLabel.config(text="You've been hit!") if predictedCounter == "punch_L": instructionLabel.config(text="LEFT PUNCH") if randAssault == 0 or randAssault == 1 or randAssault == 5: descriptionLabel.config(text="You've successfully counter attacked!") elif randAssault == 2 or randAssault == 3: descriptionLabel.config(text="You've been cut!") elif randAssault == 4: descriptionLabel.config(text="You've been hit!") if predictedCounter == "weave_R": instructionLabel.config(text="RIGHT WEAVE") if randAssault == 1 or randAssault == 3 or randAssault == 5: descriptionLabel.config(text="You've successfully evaded!") elif randAssault == 4: descriptionLabel.config(text="You've been hit!") elif randAssault == 2: descriptionLabel.config(text="You've been cut!") else: descriptionLabel.config(text="You've been grabbed!") if predictedCounter == "weave_L": instructionLabel.config(text="LEFT WEAVE") if randAssault == 0 or randAssault == 2 or randAssault == 4: descriptionLabel.config(text="You've successfully evaded!") elif randAssault == 5: descriptionLabel.config(text="You've been hit!") elif randAssault == 3: descriptionLabel.config(text="You've been cut!") else: descriptionLabel.config(text="You've been grabbed!") if predictedCounter == "block": instructionLabel.config(text="BLOCK") if randAssault == 5 or randAssault == 4: descriptionLabel.config(text="You've successfully blocked!") elif randAssault == 2 or randAssault == 3: descriptionLabel.config(text="You've been cut!") elif randAssault == 0 or randAssault == 1: descriptionLabel.config(text="You've been grabbed!") descriptionLabel.pack() cap = cv2.VideoCapture(0) root = tk.Tk() #initialize tkinter by making tk rook widget--consists of window with tile bar and decoration provided by window manager. Root widget must be made first and can only be one. root.geometry("2000x1100") ldFrame = Frame(root).pack(side="top") #frame to hold logo and description canvas = Canvas(ldFrame, width=700, height=200) canvas.pack(side="top") #open image with pil image because PhotoImage only takes gif pilLogo = Image.open("Logo.png") logo = ImageTk.PhotoImage(pilLogo) #makes PhotoImage from pil image canvas.create_image(350, 100, image=logo) #adds PhotoImage to Canvas #make basic description label from text string on the logo description frame descriptionText = """This program trains the user to respond in self defense to common physical threats.""" descriptionLabel = tk.Label(ldFrame, justify="center", padx=10, font=("Courier", 18), wraplength=1900, text=descriptionText) descriptionLabel.pack(side="top") #make center frame that will show instructions initially and then have "assaulter" prompts and live video centerFrame = Frame(root).pack() countdownLabel = tk.Label(centerFrame, justify="center", font=("Courier", 20), text="") #invisible for now because not packed instructionText = """In this training system, you will be prompted with how an aggressor is approaching you. You may select a difficulty for this system by choosing how much time you would like to be allowed to react. Based on your counter attack, the system will tell you if the attacker has been [Narrowly Avoided], [Stunned], or [Subdued] based on the quality of your reaction. Your success rate will be tracked at the bottom of the screen. Press the [Start] button to begin and the [Stop] button to end the session.""" instructionLabel = tk.Label(centerFrame, justify="center", padx=50, pady=50, font=("Courier", 16), wraplength=1800, text=instructionText) instructionLabel.pack(side="top") #setup to capture video frames vidLabel = Label(root) def show_frame(milliseconds): if milliseconds > 0: #global predictionArr _, frame = cap.read() #predictionArr.append(predict.get_prediction(frame, "ace-connection-236822", "ICN2459521650166688930")) frame = cv2.flip(frame, 1) #horizontally flips images so is like reflection cv2image = cv2.cvtColor(frame, cv2.COLOR_BGR2RGBA) #makes normal color img = Image.fromarray(cv2image) imgtk = ImageTk.PhotoImage(img) vidLabel.imgtk = imgtk vidLabel.config(image=imgtk) root.update() root.after(30, show_frame, (milliseconds-30)) _, frame = cap.read() cv2image = cv2.cvtColor(frame, cv2.COLOR_BGR2RGBA) img = Image.fromarray(cv2image) img = img.convert("RGB") img.save("imgFile.jpeg") if milliseconds == secondsChosen*3000: return ml.predict("imgFile.jpeg") #make bottom frame that hold buttons buttonFrame = Frame(root) buttonFrame.pack(side="bottom") difficultyList = Listbox(buttonFrame, selectmode=SINGLE, height=3, font=("Courier", 16)) difficultyList.insert(1, "Easy: 6 seconds") difficultyList.insert(2, "Medium: 3 seconds") difficultyList.insert(3, "Hard: 1 seconds") difficultyList.pack(side="top") cycling = True def runPrompt(): startButton.config(text="Next") startButton.pack(side=LEFT) resetButton.pack(side=RIGHT) descriptionLabel.pack_forget() assaultList = ["Grab from your right", "Grab from your left", "Blade attack from the right", "Blade attack from the left", "Hit from the right", "Hit from the left"] counterList = ["parry_R", "parry_L", "weave_R", "weave_L", "punch_R", "punch_L", "block"] difficultyChoice = (difficultyList.get(ACTIVE)) global secondsChosen secondsChosen = 0 if difficultyChoice[0] == "E": secondsChosen = 6 elif difficultyChoice[0] == "M": secondsChosen = 3 else: secondsChosen = 1 print(secondsChosen) difficultyList.pack_forget() randAssault = random.randint(0, 5) instructionLabel.config(text=assaultList[randAssault], font=("Courier", 25)) vidLabel.pack() predictedCounter = show_frame(secondsChosen*1000) if predictedCounter not in counterList: predictedCounter = counterList[random.randint(0, 6)] root.after(secondsChosen*1200, calcSuccess, predictedCounter, randAssault) return 0 def reset(): resetButton.pack_forget() startButton.config(text="Start") startButton.pack(side=BOTTOM) instructionLabel.config(text=instructionText, font=("Courier", 16)) descriptionLabel.config(text=descriptionText, font=("Courier", 18)) descriptionLabel.pack(side=TOP) difficultyList.pack(side=TOP) startButton = Button(buttonFrame, bd=6, padx=20, pady=20,font=("Courier", 16), text="Start", fg="green", command=runPrompt) startButton.pack(side=BOTTOM) resetButton = Button(buttonFrame, bd=6, padx=20, pady=20, font=("Courier", 16), text="Reset", fg="red", command=reset) root.mainloop() cap.release()
5,968
48e3259698788904e000eb15b5443067b0c3e791
#alds13c from collections import deque d_stack=deque() res_stack=deque() s = input() for i in range(len(s)): #print(d_stack,res_stack) if s[i]=="\\": d_stack.append(i) elif s[i]=="/": if len(d_stack)==0: continue left = d_stack.pop() area = i-left #res_stack.append((left,area)) if len(res_stack)>0: flag=True #merge_candidate = [] mergeareasum=0 while flag: if len(res_stack)>0 and left<res_stack[-1][0]: mc = res_stack.pop() mergeareasum += mc[1] #res_stack.append((left,under[1]+area)) else: flag = False res_stack.append((left,area+mergeareasum)) else: res_stack.append((left,area)) ans=0 v_devided=[] for pair in res_stack: ans += pair[1] v_devided.append(str(pair[1])) print(ans) if len(v_devided)>0: print(len(v_devided)," ".join(v_devided)) else: print(0)
5,969
436cc06778bf9ac9e04a897f4a4db90c595d943c
# load the dependencies from airflow import DAG from datetime import date, timedelta, datetime # default_args are the default arguments applied to the DAG and all inherited tasks DAG_DEFAULT_ARGS = { 'owner': 'airflow', 'depends_on_past': False, 'retries': 1, 'retry_delay': timedelta(minutes=1) } with DAG('twitter_dag_v1', start_date=datetime(2018, 10, 1), schedule_interval="@daily", default_args=DAG_DEFAULT_ARGS, catchup=False) as dag: None
5,970
cfa0937f1c49b52283c562d9ab1cb0542e71b990
import matplotlib.pyplot as plt from partisan_symmetry_noplot import partisan_symmetry for k in range(1,100): a=[] for i in range(1,100): a.append([]) for j in range(1,100): a[i-1].append(partisan_symmetry([5*i/100,.20,5*j/100],1000,False)) plt.imshow(a) plt.colorbar() plt.xticks(range(99),[x/20 for x in range(1,100)]) plt.yticks(range(99),[x/20 for x in range(1,100)]) plt.title("Partisan Symmetry Difference for (x,"+str(k)+",y)") plt.savefig("./ps"+str(k)+".png") plt.close() print("figure",k,"done")
5,971
aa47b7c74b9b6b8a7f014de4bd58236edeba485d
import os class User(object): def __init__(self, meta): meta.update({ 'groups': meta.get('groups', []) + [meta['username']] }) self.meta = meta @property def username(self): return self.meta['username'] @property def groups(self): return self.meta['groups'] @property def home_path(self): return os.path.join('/home', self.username) @property def is_root(self): return self.username == 'root' def own(self, node): if self.is_root: return True return node.owner == self.username def can_read(self, node): if self.is_root: return True if self.own(node) and node.owner_readable: return True if node.group in self.groups and node.group_readable: return True if node.other_readable: return True return False def can_write(self, node): if self.is_root: return True if self.own(node) and node.owner_writable: return True if node.group in self.groups and node.group_writable: return True if node.other_writable: return True return False def can_create(self, node): return self.can_write(node.parent) def can_remove(self, node): return self.can_write(node.parent) def __getitem__(self, key): return self.meta.__getitem__(key) def __repr__(self): return repr(self.meta) root_user = User({'username': 'root'})
5,972
cdd929ee041c485d2a6c1149ea1b1ced92d7b7ab
# -*- coding: utf-8 -*- # Generated by Django 1.9.2 on 2016-08-03 02:31 from __future__ import unicode_literals from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='Kategori', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('nama_kategori', models.CharField(max_length=30)), ('deskripsi', models.CharField(max_length=100)), ], ), migrations.CreateModel( name='Stone', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('kode', models.CharField(max_length=30)), ('deskripsi', models.CharField(max_length=200)), ('cover_stone', models.ImageField(upload_to='\\images')), ('kategori', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='stones.Kategori')), ], ), ]
5,973
41294c803cf42611fa003f21b74a49dd5576a8e8
# Copyright (c) 2020, Galois, Inc. # # All Rights Reserved # # This material is based upon work supported by the Defense Advanced Research # Projects Agency (DARPA) under Contract No. FA8750-20-C-0203. # # Any opinions, findings and conclusions or recommendations expressed in this # material are those of the author(s) and do not necessarily reflect the views # of the Defense Advanced Research Projects Agency (DARPA). from dataclasses import dataclass import semtk from migration_helpers.name_space import NameSpace, get_uri from ontology_changes.ontology_change import stylize_property, OntologyChange @dataclass class RemoveIsATypeOf(OntologyChange): """ Represents an ontology change where: property_id is a type of from_property_id. has been removed. """ name_space: NameSpace class_id: str property_id: str range_id: str def text_description(self) -> str: prop = stylize_property(self.property_id) range_str = stylize_property(self.range_id) return f"Property {prop} used to be a type of {range_str}, no longer." def migrate_json(self, json: semtk.SemTKJSON) -> None: json.accept(MigrationVisitor(self)) class MigrationVisitor(semtk.DefaultSemTKVisitor): def __init__(self, data: RemoveIsATypeOf): self.data = data # TODO?
5,974
661d82adc7d0746635fb57abf6d0e70ee615ada4
# -*- coding: utf-8 -*- file1 = raw_input("Enter the path of your first file: ") file2 = raw_input("Enter the path of your second file: ") Basex = open(file1).read().split() Basey = open(file2).read().split() if Basex != Basey: print("The files are different!") else: print("The files are the same!")
5,975
efe5921afb160b7b5a953cdd0c2f90f64b5f34c9
""" Make sure overwriting read-only files works as expected (via win-tool). """ import TestGyp import filecmp import os import stat import sys if sys.platform == 'win32': test = TestGyp.TestGyp(formats=['ninja']) os.makedirs('subdir') read_only_files = ['read-only-file', 'subdir/A', 'subdir/B', 'subdir/C'] for f in read_only_files: test.write(f, 'source_contents') test.chmod(f, stat.S_IREAD) if os.access(f, os.W_OK): test.fail_test() os.makedirs(test.built_file_path('dest/subdir')) for f in read_only_files: f = os.path.join('dest', f) test.write(test.built_file_path(f), 'SHOULD BE OVERWRITTEN') test.chmod(test.built_file_path(f), stat.S_IREAD) if os.access(test.built_file_path(f), os.W_OK): test.fail_test() test.run_gyp('copies_readonly_files.gyp') test.build('copies_readonly_files.gyp') for f in read_only_files: f = os.path.join('dest', f) test.must_contain(test.built_file_path(f), 'source_contents') for f in read_only_files: if not filecmp.cmp(f, test.built_file_path(os.path.join('dest', f))): test.fail_test() test.pass_test()
5,976
e1ecc08f66e094841647f72b78bcd29ed8d32668
import requests import json l = list() with open ( "token.txt", "r") as f: token = f.read() # ัะพะทะดะฐะตะผ ะทะฐะณะพะปะพะฒะพะบ, ัะพะดะตั€ะถะฐั‰ะธะน ะฝะฐัˆ ั‚ะพะบะตะฝ headers = {"X-Xapp-Token" : token} with open('dataset_24476_4.txt', 'r') as id: for line in id: address = "https://api.artsy.net/api/artists/" + line.strip() # ะธะฝะธั†ะธะธั€ัƒะตะผ ะทะฐะฟั€ะพั ั ะทะฐะณะพะปะพะฒะบะพะผ r = requests.get(address, headers=headers) # ั€ะฐะทะฑะธั€ะฐะตะผ ะพั‚ะฒะตั‚ ัะตั€ะฒะตั€ะฐ j = json.loads(r.text) l.append((j['sortable_name'], j['birthday'])) #l.append((('Warhol Bandy', '1928'))) #l.append((('Warhol Aandy', '1928'))) l = sorted(l, key=lambda tup: (tup[1], tup[0])) for i in l: print(i[0]) # year = '0000' # new_l = [] # # k = [] # # for i in l: # if i[1] != year: # k = [] # k.append(i[0]) # year = i[1] # else: # k.append(i[0]) # k.sort() # print(next(name for name in k))
5,977
cc6f02f9e1633fa15b97af5f926e083a65a8336e
# Problem 20: Factorial digit sum def factorial(num): sum = 1 while num != 0: sum *= num num -= 1 return sum def sum_digits(num): sum = 0 while num != 0: sum += num % 10 num //= 10 return sum print(sum_digits(factorial(100)))
5,978
30a57197e3156023ac9a7c4a5218bfe825e143d9
# Fix a method's vtable calls + reference making #@author simo #@category iOS.kernel #@keybinding R #@toolbar logos/refs.png #@description Resolve references for better CFG # -*- coding: utf-8 -*- """ script which does the following: - adds references to virtual method calls - Identifies methods belong to a specific namespace - Handles multi value vtable reference (multi-nodes) """ from utils.references import * if __name__ == "__main__": fix_extra_refs(currentAddress)
5,979
021cbd1bd22f9ec48db2e52b2a98be169bbfdbbd
# -*- coding: utf-8 -*- # @Author: huerke # @Date: 2016-09-03 10:55:54 # @Last Modified by: huerke # @Last Modified time: 2016-09-03 15:54:50 from flask import render_template from . import main @main.app_errorhandler(404) def page_not_found(e): return render_template('404.html'), 404 @main.app_errorhandler(500) def internal_server_error(e): return render_template('500.html'), 500
5,980
603d7df0639def2b620cca2299077674e35a74b2
from wrapper import SeleniumWrapper from selenium.webdriver.common.by import By class PageDetector: def __init__(self, driver): self.selenium = SeleniumWrapper(driver) def detect(self): if self.selenium.wait_for_presence(locator=(By.ID, "teams-app-bar"), timeout=30): if self.selenium.wait_for_presence(locator=(By.ID, "download-desktop-page"), timeout=3): return "promo-page" return "main-app-page" elif self.selenium.wait_for_title_contains(title_substring="Sign in", timeout=30): return "sign-in-page" else: return "unknown"
5,981
3b5141a86948df6632612f6c9d7fc0089acc60aa
#!/usr/bin/env python # -*- coding: utf-8 -*- import random class Role: """ ่ง’่‰ฒ็ฑป ๅงๅบ• ๅนณๆฐ‘ """ def __init__(self,key_word="",role_id = 0): self.key_word = key_word self.role_id = role_id #ๅนณๆฐ‘-0๏ผ›ๅงๅบ•-1๏ผ› class User(Role): """ ็”จๆˆท็ฑป ็Žฉๅฎถ """ def __init__(self,id,role_id): self.id = id #็Žฉๅฎถid self.role_id = role_id
5,982
c414e5d3934f741540fb5721a529b48f95e17016
# -*- coding: utf-8 -*- import sqlalchemy as sa import ujson from aiohttp import web, WSMsgType from .db import TLE from .log import logger from .utils import parse_sa_filter, parse_sa_order, check_sa_column, get_sa_column async def query(request): filters = [] if 'filters' not in request.query: raise web.HTTPBadRequest(reason='Query parameter `filters` is required') try: _filters = ujson.loads(request.query.get('filters', '{}')) for k, v in _filters.items(): filters.extend(parse_sa_filter(TLE, k, v)) except ValueError: raise web.HTTPBadRequest(reason='Query parameter `filters` must contains valid JSON') _order = request.query.get('order', '{}') if _order.startswith('{'): try: order = ujson.loads(_order) except ValueError: raise web.HTTPBadRequest(reason='Query parameter `order` must contains valid JSON') else: order = _order order = parse_sa_order(TLE, order) only = [get_sa_column(TLE, key) for key in request.query.get('only', '').split(',') if check_sa_column(TLE, key)] async with request.app['pg'].acquire() as conn: rp = await conn.execute(sa.select(only or [TLE]).where(sa.and_(*filters)).order_by(*order)) return [dict(r) async for r in rp] async def index(request): html = ''' <html> <head> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.9.1/jquery.min.js"></script> <script> var source = new WebSocket('ws://' + window.location.host + '/subscribe'); function eventListener(event) { var message = JSON.parse(event.data); $('.messages').append([ $('<dt>').text(message.channel), $('<dd>').text(event.data), ]); } source.onmessage = eventListener; </script> </head> <body> <dl class="messages"></dl> </body> </html> ''' return web.Response(text=html, content_type='text/html') async def subscribe(request): ws = web.WebSocketResponse() await ws.prepare(request) request.app['channels'].add(ws) logger.debug('Someone joined.') try: while True: msg = await ws.receive_json() if msg.get('command') == 'close': await ws.close() except Exception as exc: logger.exception(exc) finally: request.app['channels'].remove(ws) if ws.closed: request.app['channels'].remove(ws) logger.debug('websocket connection closed') return ws
5,983
705bc651e7d12769bcf5994168fe6685a6bae05d
#!/usr/bin/env python import sys import requests import numpy as np import astropy.table as at if __name__=='__main__': targets = at.Table.read('targets_LCO2018A_002.txt', format='ascii') headers={'Authorization': 'Token {}'.format(sys.argv[1])} for x in targets['targetname']: obs = requests.get('https://observe.lco.global/api/userrequests/?proposal=LCO2018A-002&title={}'.format(x.split('.')[0]),headers=headers).json() for y in obs['results']: print(y['group_id'])
5,984
86c053b7d4c752182965755ad5b6ba6937ce6f86
import unittest from dispatcher.task import * from mock import * class TestTask(unittest.TestCase): def test_init(self): task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=1D', 'time=09:45', 'description=invalid time'] task = Task(task_attr) self.assertEqual(task.basename(), 'dummy_task2.py') self.assertEqual(task.frequency, str('1D').lower()) self.assertEqual(task.filename, 'C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py') self.assertEqual(task.time, '09:45') self.assertTrue(task.is_good()) def test_init_bad_invalid_filename(self): task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\sadfsda.py', 'frequency=1D', 'time=09:45', 'description=invalid filename'] task = Task(task_attr) self.assertFalse(task.is_good()) task_attr = ['filename=', 'frequency=1D', 'time=09:45', 'description=invalid filename'] task = Task(task_attr) self.assertFalse(task.is_good()) def test_init_bad_invalid_time(self): task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=1D', 'time=0ssss9:45', 'description=invalid time'] task = Task(task_attr) self.assertFalse(task.is_good()) task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=1D', 'time=09:45:924355435', 'description=invalid time'] task = Task(task_attr) self.assertFalse(task.is_good()) task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=1D', 'time=09924355435', 'description=invalid time'] task = Task(task_attr) self.assertFalse(task.is_good()) def test_init_good_empty_time(self): task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=1D', 'time=', 'description='] task = Task(task_attr) self.assertTrue(task.is_good()) def test_init_bad_invalid_frequency(self): task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=1Dhhhh', 'time=', 'description=invalid frequency'] task = Task(task_attr) self.assertFalse(task.is_good()) task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=D', 'time=', 'description=invalid frequency'] task = Task(task_attr) self.assertFalse(task.is_good()) task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=2S', 'time=', 'description=invalid frequency'] task = Task(task_attr) self.assertFalse(task.is_good()) task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=', 'time=', 'description=invalid frequency'] task = Task(task_attr) self.assertFalse(task.is_good()) def test_init_good_zero_frequency(self): task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py', 'frequency=0minute', 'time=', 'description=invalid frequency'] task = Task(task_attr) self.assertTrue(task.is_good()) if __name__ == '__main__': unittest.main()
5,985
963e736fd4a942fb1c51e1e0a357ad6be48aed9a
#Una empresa les paga a sus empleados con base en las horas trabajadas en la semana. #Realice un algoritmo para determinar el sueldo semanal de N trabajadores #y, ademรกs, calcule cuรกnto pagรณ la empresa por los N empleados. base = int(input("Dinero por hora trabajada: ")) emp = int(input("Dime el nยบ de empleados: ")) for i in range(0,8):
5,986
ca25739583d3b7ff449fbd2f56a96631981c815d
# -*- coding: utf-8 -*- import sys from os import path try: import DMP except ImportError: sys.path.append(path.dirname(path.dirname(path.abspath(__file__)))) from DMP.modeling.vectorMaker import VectorMaker from DMP.modeling.variables import KEY_TOTAL, KEY_TRAIN, KEY_VALID, KEY_TEST from DMP.dataset.dataHandler import DataHandler from DMP.utils.arg_encoding import * if __name__ == '__main__': file_dict = { KEY_TOTAL: SAVE_FILE_TOTAL, KEY_TRAIN: SAVE_FILE_TRAIN, KEY_VALID: SAVE_FILE_VALID, KEY_TEST: SAVE_FILE_TEST } dataHandler_dict = dict() # loading data for key, read_csv in file_dict.items(): dataHandler = DataHandler(read_csv, column_target=COLUMN_TARGET, eliminate_target=True) dataHandler.load() dataHandler_dict[key] = dataHandler # encoding data using dataHandler vectorMaker = VectorMaker(dataHandler_dict) vectorMaker.encoding() vectorMaker.show_vector_info() vectorMaker.build_tf_records() vectorMaker.build_pillow_img() vectorMaker.dump()
5,987
635b02e03578d44f13530bd57ab1a99987d4909d
# -*- coding: utf-8 -*- """ Created on Wed May 16 10:17:32 2018 @author: pearseb """ #%% imporst import os import numpy as np import netCDF4 as nc import matplotlib.pyplot as plt import matplotlib.cm as cm import cmocean.cm as cmo import seaborn as sb sb.set(style='ticks') import mpl_toolkits.basemap as bm import pandas as pd # move to working directory os.chdir("C://Users/pearseb/Dropbox/PhD/My articles/nitrogen-carbon cycles/data_for_publication") #%% get data data = nc.Dataset('BGC_Mk3Lpi_Fe-mod_default_N15active.nc', 'r') mk3lpi_no3 = data.variables['no3'][...] mk3lpi_n15 = data.variables['no3_15'][...] mk3lpi_no3 = np.ma.masked_where(mk3lpi_no3<0.1, mk3lpi_no3) mk3lpi_n15 = np.ma.masked_where(mk3lpi_no3<0.1, mk3lpi_n15) mk3lpi_d15n = (mk3lpi_n15/(mk3lpi_no3-mk3lpi_n15)-1)*1000 mk3lpi_d15org = data.variables['sed_d15n'][...] data = nc.Dataset('BGC_Mk3Lpi_Fe-2500per_default_N15active.nc', 'r') mk3lpidust_no3 = data.variables['no3'][...] mk3lpidust_n15 = data.variables['no3_15'][...] mk3lpidust_no3 = np.ma.masked_where(mk3lpidust_no3<0.1, mk3lpidust_no3) mk3lpidust_n15 = np.ma.masked_where(mk3lpidust_no3<0.1, mk3lpidust_n15) mk3lpidust_d15n = (mk3lpidust_n15/(mk3lpidust_no3-mk3lpidust_n15)-1)*1000 mk3lpidust_d15org = data.variables['sed_d15n'][...] data = nc.Dataset('BGC_Mk3Llgm_Fe-mod_default_N15active.nc', 'r') mk3llgm_no3 = data.variables['no3'][...] mk3llgm_n15 = data.variables['no3_15'][...] mk3llgm_no3 = np.ma.masked_where(mk3llgm_no3<0.1, mk3llgm_no3) mk3llgm_n15 = np.ma.masked_where(mk3llgm_no3<0.1, mk3llgm_n15) mk3llgm_d15n = (mk3llgm_n15/(mk3llgm_no3-mk3llgm_n15)-1)*1000 mk3llgm_d15org = data.variables['sed_d15n'][...] data = nc.Dataset('BGC_Mk3Llgm_Fe-2500per_default_N15active.nc', 'r') mk3llgmdust_no3 = data.variables['no3'][...] mk3llgmdust_n15 = data.variables['no3_15'][...] mk3llgmdust_no3 = np.ma.masked_where(mk3llgmdust_no3<0.1, mk3llgmdust_no3) mk3llgmdust_n15 = np.ma.masked_where(mk3llgmdust_no3<0.1, mk3llgmdust_n15) mk3llgmdust_d15n = (mk3llgmdust_n15/(mk3llgmdust_no3-mk3llgmdust_n15)-1)*1000 mk3llgmdust_d15org = data.variables['sed_d15n'][...] grid = nc.Dataset('grid_spec_mk3l_128_112_21_v2.nc', 'r') dvts = grid.variables['dvts'][...] dats = grid.variables['dats'][...] lats = grid.variables['latts'][...] lat_bnds = grid.variables['latts_bnds'][...] lons = grid.variables['lonts'][...] lon_bnds = grid.variables['lonts_bnds'][...] lon_bnds[:,0] += 360.0 deps = grid.variables['zts'][...] dep_bnds = grid.variables['zts_bnds'][...] zts = dvts/dats #%% apply depth correction to d15N of organic matter (see Robinson et al., 2012, Paleoceanography) deps3d = np.cumsum(zts,axis=0) # correction mk3lpi_d15org_cor = mk3lpi_d15org + 0.9*(deps3d*1e-3) mk3lpidust_d15org_cor = mk3lpidust_d15org + 0.9*(deps3d*1e-3) mk3llgm_d15org_cor = mk3llgm_d15org + 0.9*(deps3d*1e-3) mk3llgmdust_d15org_cor = mk3llgmdust_d15org + 0.9*(deps3d*1e-3) # average over all depths mk3lpi_d15org_corz = np.ma.average(mk3lpi_d15org_cor, axis=0, weights=zts) mk3lpidust_d15org_corz = np.ma.average(mk3lpidust_d15org_cor, axis=0, weights=zts) mk3llgm_d15org_corz = np.ma.average(mk3llgm_d15org_cor, axis=0, weights=zts) mk3llgmdust_d15org_corz = np.ma.average(mk3llgmdust_d15org_cor, axis=0, weights=zts) #%% collect prepared compilation of sedimentary d15N records df = pd.read_csv('Supplementary Data 1.csv') print(df) records = df[~np.isnan(df['d15n_LateH'])] bulk_records = records[records['type']=='bulk'] bound_records = records[records['type']!='bulk'] #%% lat_labs = ['80$^{\circ}$S', '60$^{\circ}$S', '40$^{\circ}$S', '20$^{\circ}$S', '0$^{\circ}$', \ '20$^{\circ}$N', '40$^{\circ}$N', '60$^{\circ}$N', '80$^{\circ}$N'] lon_labs = ['0$^{\circ}$E', '50$^{\circ}$E', '100$^{\circ}$E', '150$^{\circ}$E', '200$^{\circ}$E', \ '250$^{\circ}$E', '300$^{\circ}$E', '350$^{\circ}$E'] domain = [-45,0,45,355] domain_draw = [-40,0,40,360] dlat=20 dlon=60 xx,yy = np.meshgrid(lons, lats) #%% levs = np.arange(-5,5.1,0.5) conts = [-1,1] fig = plt.figure(facecolor='w', figsize=(10,4)) plt.title('Glacial minus Late Holocene change in $\delta^{15}$N$_{org}$', family='sans-serif', fontsize=12) proj = bm.Basemap(projection='merc', llcrnrlat=domain[0], llcrnrlon=domain[1], urcrnrlat=domain[2], urcrnrlon=domain[3], resolution='c') lonproj, latproj = proj(xx, yy) bulk_x, bulk_y = proj(np.array(bulk_records['lon']),np.array(bulk_records['lat'])) bound_x, bound_y = proj(np.array(bound_records['lon']),np.array(bound_records['lat'])) proj.drawcoastlines(linewidth=0.5, color='k') proj.fillcontinents(color='grey') p3 = plt.contourf(lonproj, latproj, mk3lpidust_d15org_corz-mk3lpi_d15org_corz, cmap=cmo.balance, corner_mask=False, \ levels=levs, vmin=np.ma.min(levs), vmax=np.ma.max(levs), extend='both') c3 = plt.contour(lonproj, latproj, mk3lpidust_d15org_corz-mk3lpi_d15org_corz, colors='black', levels=conts, alpha=0.8, linewidths=0.5, linestyle='-') s31 = plt.scatter(bound_x, bound_y, s=150, c=bound_records['d15n_LGM']-bound_records['d15n_LateH'], \ marker='*', vmin=np.ma.min(levs), vmax=np.ma.max(levs), cmap=cmo.balance, \ alpha=0.75, edgecolor='k', linewidths=1.0, zorder=3) s32 = plt.scatter(bulk_x, bulk_y, s=40, c=bulk_records['d15n_LGM']-bulk_records['d15n_LateH'], \ marker='o', vmin=np.ma.min(levs), vmax=np.ma.max(levs), cmap=cmo.balance, \ alpha=0.75, edgecolor='k', linewidths=1.0, zorder=2) proj.drawparallels(range(domain_draw[0],domain_draw[2]+1,dlat), labels=[True,False,False,False], color=(.3,.3,.3), linewidth=0, fontsize=12, family='sans-serif') proj.drawmeridians(range(domain_draw[1],domain_draw[3]+1,dlon), labels=[True,False,False,True], color=(.3,.3,.3), linewidth=0, fontsize=12) from matplotlib.lines import Line2D elements = [Line2D([0], [0], marker='o', markerfacecolor='w', markeredgecolor='k', color='w', linewidth=1.0, markersize=15, label='Bulk organic N'),\ Line2D([0], [0], marker='*', markerfacecolor='w', markeredgecolor='k', color='w', linewidth=1.0, markersize=20, label='Bound organic N')] plt.legend(handles=elements, loc='center', bbox_to_anchor=(0.5,-0.25), ncol=2, frameon=False, scatterpoints=1) plt.subplots_adjust(bottom=0.1, top=0.95, left=0.075, right=0.85) cbax = fig.add_axes([0.88, 0.25, 0.03, 0.55]) cbar = plt.colorbar(p3, cax=cbax, orientation='vertical') cbar.ax.set_ylabel(u'$\delta^{15}$N โ€ฐ vs air', fontsize=12, family='sans-serif') plt.clabel(c3, manual=True, fmt='%i', fontsize=10, colors='k', inline=True) fig.savefig('figures_for_publication/fig4.pdf',dpi=300,bbox_inches='tight') fig.savefig('figures_for_publication/fig4.png',dpi=300,bbox_inches='tight')
5,988
40ee790f4272c05c1619eb7b2cc66a8b57bbe8a8
# -*- coding: utf-8 -*- from cms.app_base import CMSApp from cms.apphook_pool import apphook_pool from django.utils.translation import ugettext_lazy as _ class StaffApp(CMSApp): name = _('Staff') urls = ['blog.urls', ] app_name = 'staff' apphook_pool.register(StaffApp)
5,989
4abcca52095a169b71d2527ce52b8367534c42a4
# -*- python -*- # ex: set syntax=python: # vim: set syntax=python: import os import re from collections import defaultdict, namedtuple from enum import Enum from pathlib import Path import buildbot.www.authz.endpointmatchers as ems from buildbot.changes.filter import ChangeFilter from buildbot.changes.gitpoller import GitPoller from buildbot.config import BuilderConfig from buildbot.locks import WorkerLock from buildbot.process.factory import BuildFactory from buildbot.process.properties import Interpolate, Property, renderer, Transform from buildbot.reporters.generators.build import BuildStartEndStatusGenerator from buildbot.reporters.github import GitHubStatusPush from buildbot.reporters.message import MessageFormatterRenderable from buildbot.schedulers.basic import AnyBranchScheduler from buildbot.schedulers.forcesched import ForceScheduler from buildbot.schedulers.timed import Nightly from buildbot.steps.cmake import CMake from buildbot.steps.master import SetProperties from buildbot.steps.shell import SetPropertyFromCommand, ShellCommand from buildbot.steps.source.git import Git from buildbot.steps.source.github import GitHub from buildbot.steps.transfer import FileUpload, FileDownload from buildbot.steps.worker import MakeDirectory, SetPropertiesFromEnv, RemoveDirectory from buildbot.worker import Worker from buildbot.www.auth import UserPasswordAuth from buildbot.www.authz import Authz from buildbot.www.authz.roles import RolesFromUsername from buildbot.www.hooks.github import GitHubEventHandler from twisted.internet import defer from custom_steps import CTest, CleanOldFiles, SetPropertiesFromCMakeCache # This is the dictionary that the buildmaster pays attention to. We also use # a shorter alias to save typing. c = BuildmasterConfig = {} # SECRETS GITHUB_TOKEN = Path('github_token.txt').read_text().strip() WORKER_SECRET = Path('halide_bb_pass.txt').read_text().strip() WEBHOOK_SECRET = Path('webhook_token.txt').read_text().strip() WWW_PASSWORD = Path('buildbot_www_pass.txt').read_text().strip() # SERVER SETTINGS ARTIFACTS_DIR = os.environ.get('HALIDE_BB_MASTER_ARTIFACTS_DIR', '/home/halidenightly/artifacts') REPO_DIR = Path(__file__, '..', '..').resolve() # LLVM # At any given time, we test (at least) 3 LLVM versions: # - the current main (changes daily) # - the most recent release (expected to be stable) # - an older release (expected to be stable) # # The branches that correspond to these will rotate as new versions # are released, but the underlying test logic should not need changing. Version = namedtuple('Version', ['major', 'minor', 'patch']) VersionedBranch = namedtuple('VersionedBranch', ['ref', 'version']) LLVM_MAIN = 'main' LLVM_RELEASE_17 = 'release_17' LLVM_RELEASE_16 = 'release_16' LLVM_RELEASE_15 = 'release_15' LLVM_BRANCHES = {LLVM_MAIN: VersionedBranch(ref='main', version=Version(18, 0, 0)), LLVM_RELEASE_17: VersionedBranch(ref='release/17.x', version=Version(17, 0, 0)), LLVM_RELEASE_16: VersionedBranch(ref='llvmorg-16.0.6', version=Version(16, 0, 6)), LLVM_RELEASE_15: VersionedBranch(ref='llvmorg-15.0.7', version=Version(15, 0, 7))} # At any given time, Halide has a main branch, which supports (at least) # the LLVM main branch and the most recent release branch (and maybe one older). # # We also support previous release branches; a release branch tracks *only* the # corresponding version of LLVM (i.e., Halide 13 is 'release/13.x' and is only # built/tested against LLVM13, even though it might still work with other LLVM versions). # # Note that we deliberately chose branch names that match LLVM's conventions. # # (Note that there are older releases of Halide that we no longer bother to build/test regularly.) HALIDE_MAIN = 'main' HALIDE_RELEASE_16 = 'release_16' HALIDE_RELEASE_15 = 'release_15' _HALIDE_RELEASES = [ HALIDE_RELEASE_16, HALIDE_RELEASE_15, ] HALIDE_BRANCHES = {HALIDE_MAIN: VersionedBranch(ref='main', version=Version(17, 0, 0)), HALIDE_RELEASE_16: VersionedBranch(ref='release/16.x', version=Version(16, 0, 6)), HALIDE_RELEASE_15: VersionedBranch(ref='release/15.x', version=Version(15, 0, 1))} # This lists the Halide branch(es) for which we want to build nightlies; # it's usually desirable to constrain these to save buildbot time (esp on the slower bots) # and avoid branches that aren't changing much (i.e. -- recent releases that aren't # likely to need new updates soon). HALIDE_NIGHTLIES = [HALIDE_MAIN] # Given a halide branch, return the 'native' llvm version we expect to use with it. # For halide release branches, this is the corresponding llvm release branch; for # halide main, it's llvm main. LLVM_FOR_HALIDE = { HALIDE_MAIN: [LLVM_MAIN, LLVM_RELEASE_17, LLVM_RELEASE_16], HALIDE_RELEASE_16: [LLVM_RELEASE_16], HALIDE_RELEASE_15: [LLVM_RELEASE_15], } # WORKERS # Can use Python 3.7 dataclasses instead, if we choose to upgrade to that. WorkerConfig = namedtuple('WorkerConfig', ['max_builds', 'j', 'arch', 'bits', 'os']) # Using nproc+2 on the arm32 builds causes internal errors in gcc-armeabihf. Let's just use nproc. _NPROC = Interpolate("%(worker:numcpus)s") # For machines with max_builds=1, using nproc+2 cores for building is the conventional choice # (and what ninja defaults to). Oddly, "ninja -j 0" means "use as many threads as you like" which # is definitely not what we want. _NPROC_PLUS_2 = Transform(lambda x: f'{int(x) + 2}', _NPROC) _WORKERS = [ ('linux-worker-1', WorkerConfig(max_builds=4, j=8, arch='x86', bits=[32, 64], os='linux')), ('linux-worker-4', WorkerConfig(max_builds=4, j=8, arch='x86', bits=[32, 64], os='linux')), # 2013 Mac Pro running a 6-core Xeon. ('mac-x86-worker-1', WorkerConfig(max_builds=2, j=8, arch='x86', bits=[64], os='osx')), # Mac Mini 2018, 3.2 GHz 6-Core Intel Core i7, 16GB memory ('mac-x86-worker-2', WorkerConfig(max_builds=2, j=8, arch='x86', bits=[64], os='osx')), # Mac Mini 2018, ??? details TBD ('mac-x86-worker-3', WorkerConfig(max_builds=2, j=8, arch='x86', bits=[64], os='osx')), ('mac-arm-worker-1', WorkerConfig(max_builds=2, j=8, arch='arm', bits=[64], os='osx')), # The arm-linux bots here have 4 cores but apparently don't have enough RAM to do more # than -j=2 without crashing during LLVM builds. ('arm32-linux-worker-1', WorkerConfig(max_builds=1, j=2, arch='arm', bits=[32], os='linux')), ('arm32-linux-worker-2', WorkerConfig(max_builds=1, j=2, arch='arm', bits=[32], os='linux')), ('arm64-linux-worker-1', WorkerConfig(max_builds=1, j=2, arch='arm', bits=[64], os='linux')), ('arm64-linux-worker-2', WorkerConfig(max_builds=1, j=2, arch='arm', bits=[64], os='linux')), # The rpi4 has 8GB ram, so apparently it's OK with -j=nproc for now. ('rpi4-linux-worker-1', WorkerConfig(max_builds=1, j=_NPROC, arch='arm', bits=[32], os='linux')), # TODO: should normally be offline because every D3D12 test fails ('win-worker-2', WorkerConfig(max_builds=1, j=_NPROC_PLUS_2, arch='x86', bits=[32, 64], os='windows')), # TODO: broken, pending repair till Monday # ('win-worker-3', WorkerConfig(max_builds=2, j=_NPROC_PLUS_2, arch='x86', bits=[32, 64], os='windows')), ] # The 'workers' list defines the set of recognized buildworkers. Each element is # a Worker object, specifying a unique worker name and password. The same # worker name and password must be configured on the worker. c['workers'] = [Worker(n, WORKER_SECRET, keepalive_interval=300, # default is 3600 (1 hour). We'll do 5 mins. max_builds=cfg.max_builds, properties={'WORKER_BUILD_PARALLELISM': cfg.j}) for n, cfg in _WORKERS] _SANITIZERS = [ 'asan', 'fuzzer', # this isn't *technically* a sanitizer, but is close enough that it's a good fit ] # LOCKS # Performance testing requires exclusive use of a worker # Compute-intensive build steps will grab this lock in reader # mode. The performance test will grab it in exclusive mode. performance_lock = WorkerLock("performance_lock", maxCount=9999) # When building the LLVM nightlies, we can sync & build LLVM independently # from other work, but when we update the install directory, we need to ensure # we have an exclusive lock across the entire worker. (Since we have a small # number of LLVM versions, and since 'make install' doesn't take very long, # we could probably just get by with a single lock for *any* llvm install, # but this isn't much harder to do.) llvm_build_locks = {} for llvm_branch, info in LLVM_BRANCHES.items(): for bits in [32, 64]: llvm_build_locks[llvm_branch + str(bits)] = WorkerLock( f'llvm_install_lock_{info.version.major}_{bits}', maxCount=9999) # CHANGESOURCES # Here we point the buildbot at third-party codebases, ie. dependencies. # Currently, we only have LLVM's `main` branch configured. c['change_source'] = [ GitPoller( repourl='https://github.com/llvm/llvm-project.git', workdir='gitpoller-llvm-workdir', branch=LLVM_BRANCHES[LLVM_MAIN].ref, pollInterval=60 * 60 * 24, # Only check llvm once every 24 hours pollAtLaunch=True) ] # CODEBASES all_repositories = { 'https://github.com/halide/Halide.git': 'halide', 'https://github.com/llvm/llvm-project.git': 'llvm', } def codebase_generator(chdict): repo = chdict['repository'] assert repo in all_repositories, "Codebase not found for chdict: " + str(chdict) return all_repositories[repo] c['codebaseGenerator'] = codebase_generator # BUILDERS # The 'builders' list defines the Builders, which tell Buildbot how to perform a build: # what steps, and which workers can execute them. Note that any particular build will # only take place on one worker. class Purpose(Enum): halide_nightly = 1 halide_testbranch = 2 llvm_nightly = 3 class BuildSystem(Enum): make = 0 cmake = 1 class BuilderType: """A class to encapsulate the settings for a specific Builder. (Do not confuse with CMake's 'BUILD_TYPE', which is something else.) It includes: - Halide 'target' in the form of arch-bits-os - LLVM branch to be used - CMake vs Make - halide-nightly vs halide-testbranch vs llvm-nightly - sanitizers vs none It doesn't currently include any 'features' because we don't currently bake any in at build time. It doesn't currently include the C++ compiler used (eg gcc7 vs gcc8 vs clang), mainly because we currently never test with multiple compilers for a given setup. (If we ever need to do so, compiler should be added to this.) """ def __init__(self, arch, bits, os, halide_branch, llvm_branch, purpose, sanitizer=None, buildsystem=BuildSystem.cmake): assert arch in ['arm', 'x86'] assert bits in [32, 64] assert os in ['linux', 'windows', 'osx'] assert llvm_branch in LLVM_BRANCHES, f'{llvm_branch} not recognized' self.arch = arch self.bits = bits self.os = os self.halide_branch = halide_branch self.llvm_branch = llvm_branch self.buildsystem = buildsystem self.purpose = purpose self.sanitizer = sanitizer if self.halide_branch: assert self.purpose != Purpose.llvm_nightly assert self.halide_branch in HALIDE_BRANCHES, f'unknown branch {self.halide_branch}' assert (self.purpose == Purpose.halide_testbranch or # if not testbranch... self.llvm_branch in LLVM_FOR_HALIDE[self.halide_branch]) else: assert self.purpose == Purpose.llvm_nightly if self.sanitizer: assert self.sanitizer in _SANITIZERS # The armbots aren't configured with Python at all. # We don't support the Python bindings on 32-bit at all. def handles_python(self): if self.bits == 32: return False if self.arch == 'arm' and self.os == 'linux': return False if self.sanitizer_preset() is not None: return False return True def handles_sanitizers(self): if self.buildsystem != BuildSystem.cmake: return False return (self.arch == 'x86' and self.bits == 64 and self.os == 'linux' and self.llvm_branch == LLVM_MAIN) def sanitizer_preset(self): if self.handles_sanitizers(): if self.sanitizer == 'asan': return 'linux-x64-asan' if self.sanitizer == 'fuzzer': return 'linux-x64-fuzzer' return None def handles_riscv(self): # Only support RISCV on LLVM16 or later. return self.llvm_branch not in [LLVM_RELEASE_15] def handles_hexagon(self): return (self.arch == 'x86' and self.bits == 64 and self.os == 'linux' and self.llvm_branch == LLVM_MAIN) def handles_wasm(self): is_linux_x64 = (self.arch == 'x86' and self.bits == 64 and self.os == 'linux') return (self.llvm_branch == LLVM_MAIN and (is_linux_x64 or self.os == 'osx')) def handles_wasm_wabt(self): return self.handles_wasm() def handles_wasm_v8(self): # OSX machines don't have V8 installed return self.handles_wasm() and self.os == 'linux' def has_nvidia(self): return (self.arch == 'x86' and self.bits == 64 and self.os in ['windows', 'linux']) def handles_vulkan(self): # TODO: disabled temporarily pending fixes to the Vulkan runtime return False # Stick with Linux on x86-64 for now. Others TBD. # return (self.arch == 'x86' # and self.bits == 64 # and self.os == 'linux' # and self.halide_branch in [HALIDE_MAIN, HALIDE_RELEASE_16]) def handles_webgpu(self): # At the moment, the WebGPU team recommends the OSX versions of Dawn/Node # as the most robust for testing, so that's all we're set up to test with. # (Note that 'Dawn' must be built/installed on the test machines manually; # there are no binaries/prebuilts available at this time.) return self.os == 'osx' and self.halide_branch not in [HALIDE_RELEASE_15] def has_tflite(self): if self.arch == 'x86' and self.bits == 64 and self.os == 'linux': return True if self.arch == 'arm' and self.bits == 64 and self.os == 'osx': return True return False def has_ccache(self): return self.os in ['osx', 'linux'] def halide_target(self): return '%s-%d-%s' % (self.arch, self.bits, self.os) def llvm_builder_label(self): return 'llvm-%s-%s' % (LLVM_BRANCHES[self.llvm_branch].version.major, self.halide_target()) def halide_builder_label(self): # This currently tries to (somewhat) mimic the existing label pattern, # but is arbitrary. (If changed, manual purging of buildbot temporaries # is appropriate) a = ['halide'] if self.sanitizer: a.append(self.sanitizer) if self.purpose == Purpose.halide_testbranch: a.append('testbranch') elif self.purpose == Purpose.halide_nightly: a.append('nightly') a.append(self.halide_branch) if self.halide_branch == HALIDE_MAIN: # Halide master is built against multiple LLVM versions, # so append that here for clarity a.append(f'llvm{LLVM_BRANCHES[self.llvm_branch].version.major}') a.append(self.halide_target()) a.append(self.buildsystem.name) return '-'.join(a) def builder_label(self): if self.purpose == Purpose.llvm_nightly: return self.llvm_builder_label() else: return self.halide_builder_label() def builder_tags(self): return self.builder_label().split('-') def get_worker_names(self): return [n for n, cfg in _WORKERS if self.arch == cfg.arch and self.bits in cfg.bits and self.os == cfg.os] def __str__(self): return self.halide_target() def get_builddir_subpath(subpath): # Normalize paths to use forward slashes. return Transform(lambda x: x.replace('\\', '/'), Interpolate(f'%(prop:builddir)s/{subpath}')) def get_llvm_toolchains_path(*subpaths): return get_builddir_subpath(os.path.join('llvm-toolchains', *subpaths)) # TODO: make private to the LLVM code def get_llvm_source_path(*subpaths): return get_builddir_subpath(os.path.join('llvm-project', *subpaths)) # TODO: make private to the LLVM code def get_llvm_build_path(*subpaths): return get_builddir_subpath(os.path.join('llvm-build', *subpaths)) def get_llvm_install_path(builder_type, *subpaths): # Note that `builder_type.purpose` can be a Halide builder or an LLVM builder; # we want to ignore that aspect and produce the same effective path # regardless (ie, based only on the other aspects of the builder_type). llvm_workdir = builder_type.llvm_builder_label() return get_builddir_subpath(os.path.join('..', llvm_workdir, 'llvm-install', *subpaths)) def get_halide_source_path(*subpaths): return get_builddir_subpath(os.path.join('halide-source', *subpaths)) def get_halide_build_path(*subpaths): return get_builddir_subpath(os.path.join('halide-build', *subpaths)) def get_halide_install_path(builder_type, *subpaths): s = 'halide-install' if builder_type.sanitizer: s += '-' + builder_type.sanitizer return get_builddir_subpath(os.path.join(s, *subpaths)) def add_get_halide_source_steps(factory, builder_type): factory.addStep(GitHub(name='Get Halide source', locks=[performance_lock.access('counting')], codebase='halide', workdir=get_halide_source_path(), repourl='https://github.com/halide/Halide.git', branch=HALIDE_BRANCHES[builder_type.halide_branch].ref, mode='incremental')) def add_get_llvm_source_steps(factory, builder_type): factory.addStep(Git(name=f'Get LLVM {LLVM_BRANCHES[builder_type.llvm_branch].version.major}', locks=[performance_lock.access('counting')], codebase='llvm', workdir=get_llvm_source_path(), repourl='https://github.com/llvm/llvm-project.git', branch=LLVM_BRANCHES[builder_type.llvm_branch].ref, mode='incremental')) # Always download the toolchains, even on platforms we don't need 'em toolchains_dir = get_llvm_toolchains_path() factory.addStep(MakeDirectory(name="Make CMake toolchain directory", locks=[performance_lock.access('counting')], dir=toolchains_dir, haltOnFailure=False)) factory.addStep(FileDownload(name='Download CMake toolchains', mastersrc='toolchain.linux-arm32.cmake', # relative to base dir workerdest='toolchain.linux-arm32.cmake', # relative to workdir workdir=toolchains_dir, locks=[performance_lock.access('counting')], haltOnFailure=True, mode=0o644)) # Determined by running `set` in cmd.exe before and after vcvarsall.bat # and diffing the output. It's likely that we don't need all of these # to make things work, but I haven't bothered to figure out what is irrelevant, # so I'm erring on the side of maybe too much. # noinspection SpellCheckingInspection VCVARSALL_ENV_VARS = [ "COMMANDPROMPTTYPE", "DEVENVDIR", "EXTENSIONSDKDIR", "FRAMEWORK40VERSION", "FRAMEWORKDIR", "FRAMEWORKDIR64", "FRAMEWORKVERSION", "FRAMEWORKVERSION64", "INCLUDE", "LIB", "LIBPATH", "NETFXSDKDIR", "PATH", "PLATFORM", "UCRTVERSION", "UNIVERSALCRTSDKDIR", "VCIDEINSTALLDIR", "VCINSTALLDIR", "VCTOOLSINSTALLDIR", "VCTOOLSREDISTDIR", "VCTOOLSVERSION", "VISUALSTUDIOVERSION", "VS110COMNTOOLS", "VS120COMNTOOLS", "VS140COMNTOOLS", "VS160COMNTOOLS", "VSCMD_ARG_APP_PLAT", "VSCMD_ARG_HOST_ARCH", "VSCMD_ARG_TGT_ARCH", "VSCMD_VER", "VSINSTALLDIR", "WINDOWSLIBPATH", "WINDOWSSDKBINPATH", "WINDOWSSDKDIR", "WINDOWSSDKLIBVERSION", "WINDOWSSDKVERBINPATH", "WINDOWSSDKVERSION", "WINDOWSSDK_EXECUTABLEPATH_X64", "WINDOWSSDK_EXECUTABLEPATH_X86", "__DOTNET_ADD_64BIT", "__DOTNET_PREFERRED_BITNESS", "__VSCMD_PREINIT_PATH", "__VSCMD_SCRIPT_ERR_COUNT", ] def get_msvc_config_steps(factory, builder_type): # ensure that we use the x64 host compiler, not the x86 host compiler arch_for_bits = {32: 'x64_x86', 64: 'x64'} vcvarsall = 'vcvarsall.bat %s && set' % arch_for_bits[builder_type.bits] # TODO: surely there is a better way of locating vcvarsall # vcvarsdir = "c:/Program Files (x86)/Microsoft Visual Studio/2019/Community/VC/Auxiliary/Build" vcvarsdir = "C:/Program Files/Microsoft Visual Studio/2022/Community/VC/Auxiliary/Build" # `vsvarsall && set` dumps all the settings to stdout; # we'll extract & save just the subset we think are likely to be relevant. def save_interesting_env_vars(rc, stdout, stderr): d = {} for line in stdout.split('\n'): match = re.match("^([a-zA-Z0-9_-]+)=(.*)$", line.strip()) if match: key = match.group(1).upper() value = match.group(2) if key in VCVARSALL_ENV_VARS: d[key] = value return {'env': d} factory.addStep( SetPropertyFromCommand(name='Run VcVarsAll', description='Run VcVarsAll', workdir=vcvarsdir, locks=[performance_lock.access('counting')], haltOnFailure=True, command=vcvarsall, extract_fn=save_interesting_env_vars)) def merge_renderable(_base, _extn): @renderer @defer.inlineCallbacks def render(props): base = yield props.render(_base) extn = yield props.render(_extn) base.update(extn) return base return render def get_distrib_name(_version, target, ext): @renderer @defer.inlineCallbacks def render(props): rev = props.getProperty('got_revision')['halide'] version = yield props.render(_version) return os.path.join(ARTIFACTS_DIR, f'Halide-{version}-{target}-{rev}.{ext}') return render def get_cmake_generator(builder_type): return 'Ninja' def get_llvm_cmake_options(builder_type): options = [] return options def get_halide_cmake_options(builder_type, build_dir): options = [] if builder_type.sanitizer and builder_type.purpose != Purpose.llvm_nightly: assert builder_type.handles_sanitizers() options.append("--preset=%s" % builder_type.sanitizer_preset()) # append *after* preset so we override the build dir options += ['-B', build_dir] return options def get_ctest_options(builder_type, build_dir): assert builder_type.purpose != Purpose.llvm_nightly if builder_type.sanitizer: assert builder_type.handles_sanitizers() # No, this won't work, see https://gitlab.kitware.com/cmake/cmake/-/issues/23982 -- # fortunately, we don't need to specify the current sanitizer toolchains # at test time (just at configure time). # return {'preset': builder_type.sanitizer_preset(), 'test_dir': build_dir} return {'build_config': builder_type.sanitizer_preset()} else: return {'build_config': 'Release'} def get_halide_cmake_definitions(builder_type, halide_target='host', wasm_jit='wabt'): cmake_definitions = { 'Clang_DIR': get_llvm_install_path(builder_type, 'lib/cmake/clang'), 'CMAKE_INSTALL_PREFIX': get_halide_install_path(builder_type), 'Halide_TARGET': halide_target, 'LLD_DIR': get_llvm_install_path(builder_type, 'lib/cmake/lld'), 'LLVM_DIR': get_llvm_install_path(builder_type, 'lib/cmake/llvm'), 'LLVM_ROOT': get_llvm_install_path(builder_type), 'WITH_PYTHON_BINDINGS': 'ON' if builder_type.handles_python() else 'OFF', 'WITH_TEST_FUZZ': 'ON' if builder_type.sanitizer == 'fuzzer' else 'OFF' } if builder_type.sanitizer and builder_type.handles_sanitizers(): pass else: cmake_definitions['CMAKE_BUILD_TYPE'] = 'Release' # Sanitizer builds intermittently fail when using CCache for reasons that aren't # clear ("precompiled header modified") -- for now, just ignore CCache for them if builder_type.has_ccache() and not builder_type.sanitizer_preset(): cmake_definitions['Halide_CCACHE_BUILD'] = 'ON' if builder_type.arch == 'arm' and builder_type.bits == 32 and builder_type.os == 'linux': # Halide always uses its own toolchain files, from the cmake/ subdir. cmake_definitions['CMAKE_TOOLCHAIN_FILE'] = get_halide_source_path('cmake', 'toolchain.linux-arm32.cmake') if builder_type.os == 'windows': cmake_definitions['CMAKE_TOOLCHAIN_FILE'] = Interpolate('%(prop:VCPKG_ROOT)s/scripts/buildsystems/vcpkg.cmake') # CMake on Windows can't reliably find our pip-installed PyBind11 unless we set CMAKE_PREFIX_PATH to point to is cmake_definitions['pybind11_DIR'] = Interpolate('%(prop:VIRTUAL_ENV)s/share/cmake/pybind11') # Don't bother with anything Python-related if we are targeting WebAssembly. if "wasm" in halide_target: cmake_definitions['WITH_PYTHON_BINDINGS'] = 'OFF' # TODO: HALIDE_NODE_JS_PATH is only necessary until EMSDK updates their built-in version of Node # to v16.13+; when that is done, remove this definition. if builder_type.handles_wasm() and halide_target.startswith("wasm-"): cmake_definitions['CMAKE_TOOLCHAIN_FILE'] = Interpolate( '%(prop:EMSDK)s/upstream/emscripten/cmake/Modules/Platform/Emscripten.cmake') cmake_definitions['NODE_JS_EXECUTABLE'] = Property('HALIDE_NODE_JS_PATH') if wasm_jit == 'v8': cmake_definitions['WITH_WABT'] = 'OFF' cmake_definitions['WITH_V8'] = 'ON' cmake_definitions['V8_INCLUDE_PATH'] = '/home/halidenightly/v8/v8/include' cmake_definitions['V8_LIB_PATH'] = \ '/home/halidenightly/v8/v8/out/x64.release.static/obj/libv8_monolith.a' elif wasm_jit == 'wabt': cmake_definitions['WITH_WABT'] = 'ON' cmake_definitions['WITH_V8'] = 'OFF' cmake_definitions['V8_INCLUDE_PATH'] = '' cmake_definitions['V8_LIB_PATH'] = '' else: assert False, "Unknown wasm jit " + str(wasm_jit) if builder_type.handles_webgpu() and "webgpu" in halide_target: # TODO(srj): remove these after https://github.com/halide/Halide/pull/7422 lands cmake_definitions['WEBGPU_NODE_BINDINGS'] = Property('HL_WEBGPU_NODE_BINDINGS') cmake_definitions['WEBGPU_NATIVE_LIB'] = Property('HL_WEBGPU_NATIVE_LIB') if builder_type.handles_hexagon() and 'hvx' in halide_target: cmake_definitions['Halide_BUILD_HEXAGON_REMOTE_RUNTIME'] = 'ON' return cmake_definitions def get_cmake_build_command(builder_type, build_dir, targets=None): cmd = ['ninja', '-C', build_dir, '-j', Property('WORKER_BUILD_PARALLELISM')] # TODO(srj): for debugging apps/c_backend if builder_type.os == "windows": cmd.append('-v') if targets: cmd.extend(targets) return cmd def get_llvm_cmake_definitions(builder_type): # Keep sorted! definitions = { 'CMAKE_BUILD_TYPE': 'Release', 'CMAKE_INSTALL_PREFIX': get_llvm_install_path(builder_type), 'LLVM_BUILD_32_BITS': ('ON' if builder_type.bits == 32 else 'OFF'), 'LLVM_ENABLE_ASSERTIONS': 'ON', 'LLVM_ENABLE_BINDINGS': 'OFF', 'LLVM_ENABLE_CURL': 'OFF', 'LLVM_ENABLE_DIA_SDK': 'OFF', 'LLVM_ENABLE_HTTPLIB': 'OFF', 'LLVM_ENABLE_IDE': 'OFF', 'LLVM_ENABLE_LIBXML2': 'OFF', 'LLVM_ENABLE_OCAMLDOC': 'OFF', 'LLVM_ENABLE_RTTI': 'ON', 'LLVM_ENABLE_TERMINFO': 'OFF', 'LLVM_ENABLE_WARNINGS': 'OFF', # silence them, it's not like we're gonna fix them 'LLVM_ENABLE_ZLIB': 'ON', 'LLVM_ENABLE_ZSTD': 'OFF', 'LLVM_INCLUDE_BENCHMARKS': 'OFF', 'LLVM_INCLUDE_EXAMPLES': 'OFF', 'LLVM_INCLUDE_TESTS': 'OFF', 'LLVM_TARGETS_TO_BUILD': 'X86;ARM;NVPTX;AArch64;Hexagon;PowerPC;WebAssembly', } if builder_type.bits == 32: definitions['CMAKE_FIND_ROOT_PATH_MODE_INCLUDE'] = "ONLY" definitions['CMAKE_FIND_ROOT_PATH_MODE_LIBRARY'] = "ONLY" definitions['CMAKE_FIND_ROOT_PATH_MODE_PACKAGE'] = "ONLY" definitions['CMAKE_FIND_ROOT_PATH_MODE_PROGRAM'] = "NEVER" if builder_type.handles_riscv(): definitions['LLVM_TARGETS_TO_BUILD'] += ";RISCV" if builder_type.handles_sanitizers(): definitions['LLVM_ENABLE_RUNTIMES'] = "compiler-rt;libcxx;libcxxabi;libunwind" # We only need clang-tools-extra if building for sanitizers -- skip them # if the builder will never do this, to save time & space. definitions['LLVM_ENABLE_PROJECTS'] = "clang;lld;clang-tools-extra" else: definitions['LLVM_ENABLE_PROJECTS'] = "clang;lld" # Some versions of GCC will flood the output with useless warnings about # "parameter passing for argument of type foo changed in GCC 7.1" unless # we disable this warning. This isn't *essential*, but it makes looking at the # LLVM build logs much less noisy. if builder_type.os != 'windows': definitions['CMAKE_CXX_FLAGS'] = '-Wno-psabi' if builder_type.arch == 'arm' and builder_type.bits == 32 and builder_type.os == 'linux': # LLVM doesn't provide a toolchain file, and we can't/don't-want-to rely on the # one from Halide, so we'll rely on one that the buildbot downloads to each worker. # (Note that this assumes the file has been properly downloaded.) definitions['CMAKE_TOOLCHAIN_FILE'] = get_llvm_toolchains_path('toolchain.linux-arm32.cmake') definitions['LLVM_TARGET_ARCH'] = 'ARM' definitions['LLVM_DEFAULT_TARGET_TRIPLE'] = 'arm-linux-gnueabihf' if builder_type.arch == 'x86' and builder_type.bits == 32 and builder_type.os == 'linux': definitions['CMAKE_FIND_ROOT_PATH'] = '/usr/lib/i386-linux-gnu' definitions['CMAKE_FIND_ROOT_PATH_MODE_LIBRARY'] = 'ONLY' # This disables an XCode setting that can get enabled by default # when assertions are enabled, but only if your XCode install has # certain frameworks installed; we want it disabled, as it prevents # prebuilt libraries from working properly with XCode 9.x. if builder_type.os == 'osx': definitions['LLVM_ENABLE_SUPPORT_XCODE_SIGNPOSTS'] = 'FORCE_OFF' # We never build LLVM with sanitizers enabled if builder_type.has_ccache(): definitions['LLVM_CCACHE_BUILD'] = 'ON' return definitions def extend_property(dict_name, **kwargs): @renderer def render(props): table = props.getProperty(dict_name, default={}) table.update(kwargs) return table return render def add_env_setup_step(factory, builder_type, enable_ccache=False): if builder_type.os == 'windows': # do this first because the SetPropertyFromCommand step isn't smart enough to merge get_msvc_config_steps(factory, builder_type) cxx = 'c++' cc = 'cc' ld = 'ld' if builder_type.os == 'linux': cc = 'gcc-9' cxx = 'g++-9' ld = 'ld' if builder_type.arch == 'x86' and builder_type.bits == 32: cxx += ' -m32' cc += ' -m32' ld += ' -melf_i386' elif builder_type.os == 'windows': cxx = 'cl.exe' cc = 'cl.exe' # This is only necessary (or desirable) for make-based builds of Halide; # CMake-based builds handle it via Halide_CCACHE_BUILD and/or LLVM_CCACHE_BUILD if enable_ccache and builder_type.has_ccache(): cxx = 'ccache ' + cxx cc = 'ccache ' + cc env = { 'CC': cc, 'CXX': cxx, 'LD': ld, } # TODO: HALIDE_NODE_JS_PATH is only necessary until EMSDK updates their built-in version of Node # to v16.13+; when that is done, remove HALIDE_NODE_JS_PATH here and on the workers. factory.addStep(SetPropertiesFromEnv(name='Read worker environment', variables=['EMSDK', 'HALIDE_NODE_JS_PATH', 'HL_HEXAGON_TOOLS', 'HL_WEBGPU_NATIVE_LIB', 'HL_WEBGPU_NODE_BINDINGS', 'LD_LIBRARY_PATH', 'VIRTUAL_ENV', 'VCPKG_ROOT'])) vcpkg_root = Property('VCPKG_ROOT', default=None) if builder_type.handles_hexagon(): # Environment variables for testing Hexagon DSP hexagon_remote_bin = get_halide_build_path('src', 'runtime', 'hexagon_remote') # Assume that HL_HEXAGON_TOOLS points to the correct directory (it might not be /usr/local/hexagon) env['HL_HEXAGON_SIM_REMOTE'] = Transform(os.path.join, hexagon_remote_bin, 'hexagon', 'bin', 'hexagon_sim_remote') env['HL_HEXAGON_SIM_CYCLES'] = '1' env['LD_LIBRARY_PATH'] = [ # no, this will cause a failure at runtime if LD_LIBRARY_PATH is unset (or empty!) # Property('LD_LIBRARY_PATH'), hexagon_remote_bin, Interpolate('%(prop:HL_HEXAGON_TOOLS)s/lib/iss'), ] env['HEXAGON_SDK_ROOT'] = Interpolate('%(prop:HL_HEXAGON_TOOLS)s/../../../..') # Force Vulkan validation layer on to catch any driver related errors # ... this enables a suite of diagnostic checks implemented in the Vulkan SDK # that verifies the driver and application conform to the Vulkan runtime # specification. This should not be enabled in production due to the overhead, # but we want to catch any changes in driver behaviour and/or spurious errors that # may be hard to find (but easy to fix if the right error messages are present) if builder_type.has_nvidia() and builder_type.handles_vulkan(): env['VK_INSTANCE_LAYERS'] = "VK_LAYER_KHRONOS_validation" if builder_type.os == 'osx': # Environment variable for turning on Metal API validation # This will have no effect on CPU testing, just Metal testing env['METAL_DEVICE_WRAPPER_TYPE'] = '1' if builder_type.os == 'windows': vcpkg_root = Property('VCPKG_ROOT', default='C:/vcpkg') env['VCPKG_ROOT'] = vcpkg_root # Current NVidia drivers on our Windows buildbots can corrupt their own # cache, leading to many spurious failures. Disable the cache # for now, pending NVidia investigation. env['CUDA_CACHE_DISABLE'] = '1' # We don't ever want an Abort, Retry, Ignore dialog in our tests env['HL_DISABLE_WINDOWS_ABORT_DIALOG'] = '1' # Leaving this here (but commented out) in case we need to temporarily # disable leak-checking in the future. # # if builder_type.handles_sanitizers(): # # Disable leak-checking (for now) for ASAN builds # env['ASAN_OPTIONS'] = 'detect_leaks=0' factory.addStep(SetProperties( name='Initialize environment', properties=dict( env=extend_property('env', **env), VCPKG_ROOT=vcpkg_root))) @renderer def get_llvm_latest_commit(props): # Note that this property is a dict for multi-codebase builds, # but just a string for single-codebase builds. build_dir = props.getProperty('builddir') assert not isinstance(build_dir, dict) build_dir = build_dir.replace('\\', '/') # Can't use got_revision here since we may be using git directly. return "cd %s/llvm-project && git log -1 > %s/llvm-install/llvm_latest_commit.txt" % (build_dir, build_dir) def add_llvm_steps(factory, builder_type, clean_rebuild): build_dir = get_llvm_build_path() install_dir = get_llvm_install_path(builder_type) llvm_name = str(LLVM_BRANCHES[builder_type.llvm_branch].version.major) if clean_rebuild: factory.addStep(RemoveDirectory(name="Remove LLVM %s Build Dir" % llvm_name, locks=[performance_lock.access('counting')], dir=build_dir, haltOnFailure=False)) factory.addStep(RemoveDirectory(name="Remove LLVM %s Install Dir" % llvm_name, locks=[performance_lock.access('counting')], dir=install_dir, haltOnFailure=False)) factory.addStep(MakeDirectory(name="Make LLVM %s Build Dir" % llvm_name, locks=[performance_lock.access('counting')], dir=build_dir, haltOnFailure=False)) factory.addStep(MakeDirectory(name="Make LLVM %s Install Dir" % llvm_name, locks=[performance_lock.access('counting')], dir=install_dir, haltOnFailure=False)) factory.addStep( CMake(name='Configure LLVM %s' % llvm_name, locks=[performance_lock.access('counting')], haltOnFailure=True, env=Property('env'), workdir=build_dir, path=get_llvm_source_path('llvm'), generator=get_cmake_generator(builder_type), definitions=get_llvm_cmake_definitions(builder_type), options=get_llvm_cmake_options(builder_type))) factory.addStep( ShellCommand(name='Build LLVM %s' % llvm_name, locks=[performance_lock.access('counting')], haltOnFailure=True, workdir=build_dir, env=Property('env'), command=get_cmake_build_command(builder_type, build_dir, targets=['install']))) # Save the SHA of LLVM's head rev into ${INSTALL}/llvm_version.txt, # just to make debugging simpler # factory.addStep( ShellCommand(name='Stamp Install Directory for LLVM %s' % llvm_name, locks=[performance_lock.access('counting')], haltOnFailure=True, workdir=get_llvm_source_path(), env=Property('env'), command=get_llvm_latest_commit)) def add_halide_cmake_build_steps(factory, builder_type): # Always do a clean build for Halide source_dir = get_halide_source_path() build_dir = get_halide_build_path() install_dir = get_halide_install_path(builder_type) factory.addStep(RemoveDirectory(name="Remove Halide Build Dir", locks=[performance_lock.access('counting')], dir=build_dir, haltOnFailure=False)) factory.addStep(MakeDirectory(name="Make Halide Build Dir", locks=[performance_lock.access('counting')], dir=build_dir, haltOnFailure=False)) factory.addStep(RemoveDirectory(name="Remove Halide Install Dir", locks=[performance_lock.access('counting')], dir=install_dir, haltOnFailure=False)) factory.addStep(MakeDirectory(name="Make Halide Install Dir", locks=[performance_lock.access('counting')], dir=install_dir, haltOnFailure=False)) factory.addStep(CMake(name='Configure Halide', description='Configure Halide', locks=[performance_lock.access('counting')], haltOnFailure=True, workdir=build_dir, env=Property('env'), path=source_dir, generator=get_cmake_generator(builder_type), definitions=get_halide_cmake_definitions(builder_type), options=get_halide_cmake_options(builder_type, build_dir))) factory.addStep( ShellCommand(name='Build Halide', description='Build Halide', locks=[performance_lock.access('counting')], haltOnFailure=True, workdir=build_dir, env=Property('env'), command=get_cmake_build_command(builder_type, build_dir, targets=['all', 'install']))) def add_halide_cmake_package_steps(factory, builder_type): source_dir = get_halide_source_path() target = builder_type.halide_target() ext = 'zip' if builder_type.os == 'windows' else 'tar.gz' factory.addStep( SetPropertiesFromCMakeCache( name='Get Halide package version', workdir=get_halide_build_path(), props=['CMAKE_PROJECT_VERSION'])) extra_env = dict( Clang_DIR=get_llvm_install_path(builder_type, 'lib/cmake/clang'), LLD_DIR=get_llvm_install_path(builder_type, 'lib/cmake/lld'), LLVM_DIR=get_llvm_install_path(builder_type, 'lib/cmake/llvm'), Halide_VERSION=Property('CMAKE_PROJECT_VERSION') ) if builder_type.os == 'windows': # TODO: on Windows, we can't use Ninja for packaging (as we do everywhere # else in this cfg) due to a bug in CMake 3.18, so we must use MSBuild; # that means we must use a different build directory entirely. To simplify the # world, we make this a subdir of the real build dir (so it gets cleaned properly). # https://github.com/halide/Halide/issues/5264 build_dir = get_halide_build_path("packaging_dir") if builder_type.arch == 'arm': arch = 'ARM' if builder_type.bits == 32 else 'ARM64' else: arch = 'Win32' if builder_type.bits == 32 else 'x64' cmd = [get_halide_source_path('packaging/zip/package.bat'), source_dir, build_dir, arch] else: build_dir = get_halide_build_path() cmd = [get_halide_source_path('packaging/tgz/package.sh'), source_dir, build_dir] if builder_type.arch == 'arm' and builder_type.bits == 32 and builder_type.os == 'linux': extra_env['CMAKE_TOOLCHAIN_FILE'] = get_halide_source_path('cmake', 'toolchain.linux-arm32.cmake') factory.addStep( ShellCommand(name='Package Halide', description='Package Halide', workdir=build_dir, env=extend_property('env', **extra_env), locks=[performance_lock.access('counting')], haltOnFailure=True, command=cmd)) factory.addStep( FileUpload(name='Upload Halide package', workersrc=Interpolate(f'Halide-%(prop:CMAKE_PROJECT_VERSION)s-{target}.{ext}'), locks=[performance_lock.access('counting')], haltOnFailure=True, workdir=build_dir, mode=0o644, masterdest=get_distrib_name(Property('CMAKE_PROJECT_VERSION'), target, ext))) def pkg_version_and_target(path: Path): # Archives names are formatted like: Halide-[version]-[arch]-[commit].[ext] # This grabs "Halide-[version]-[arch]". match = re.match(r'^(.*)-[a-f0-9]+\.(tar\.gz|tgz|zip)', path.name) return match.group(1) if match else None factory.addStep(CleanOldFiles( name='Clean old releases', workdir=ARTIFACTS_DIR, locks=[performance_lock.access('counting')], groupfn=pkg_version_and_target)) # Figure out which "non-cpu" (GPU, DSP, etc) targets this builder can handle. # Return (target, is_simulator) def get_gpu_dsp_targets(builder_type): if builder_type.sanitizer_preset() is not None: return if builder_type.has_nvidia(): yield 'host-cuda', False yield 'host-opencl', False # TODO: temporarily disabled because our only windows bot doesn't support it... # if builder_type.os == 'windows': # yield 'host-d3d12compute', False # If we're running on a capable GPU, add all optional feature flags to the vulkan target # which are required to get all the correctness tests to pass if builder_type.handles_vulkan(): yield 'host-vulkan-vk_int8-vk_int16-vk_int64-vk_float16-vk_float64-vk_v13', False if builder_type.handles_webgpu(): yield 'host-webgpu', False if builder_type.os == 'osx': yield 'host-metal', False if builder_type.handles_hexagon(): # All the buildbots use a simulator for HVX, so performance tests # won't be useful yield 'host-hvx', True # Return a dict with halide-targets as the keys, and a list of test-labels for each value. def get_test_labels(builder_type): targets = defaultdict(list) preset = builder_type.sanitizer_preset() # For the fuzz sanitizer, run only the fuzz tests if preset and 'fuzz' in preset: targets['host'].extend(['fuzz']) return targets targets['host'].extend(['internal', 'correctness', 'generator', 'autoschedulers_cpu', 'error', 'warning', 'apps', 'performance', 'tutorial']) # For all other sanitizers (eg asan), don't bother with the gpu/etc tests. if preset: return targets # TODO: some JIT+generator tests are failing on arm32; disable for now # pending fixes (see https://github.com/halide/Halide/issues/4940) if builder_type.arch == 'arm' and builder_type.bits == 32 and builder_type.os == 'linux': targets['host'].remove('internal') targets['host'].remove('generator') if builder_type.handles_python(): targets['host'].extend(['python']) # Test without SSE4.1 on all x86 systems if builder_type.arch == 'x86': t = 'x86-%d-%s' % (builder_type.bits, builder_type.os) targets[t].extend(['correctness']) # on x86-64, also test with SSE4.1 (but nothing else that 'host' might sniff) if builder_type.bits == 64: targets['%s-sse41' % t].extend(['correctness']) # Test a subset of things on GPU/DSP targets, as appropriate for t, is_simulator in get_gpu_dsp_targets(builder_type): # TODO(https://github.com/halide/Halide/issues/7420): disable apps for host-gpu until the errors are resolved if t == 'host-webgpu': targets[t].extend(['correctness', 'generator']) else: targets[t].extend(['correctness', 'generator', 'apps']) if 'cuda' in t: targets[t].extend(['autoschedulers_cuda']) if 'hvx' not in t: targets[t].extend(['autoschedulers_gpu']) # Don't do performance testing on simulators. if not is_simulator: targets[t].extend(['performance']) # Handle this special case separately if builder_type.has_nvidia(): targets['host-cuda-opencl'].extend(['correctness_multi_gpu']) # If we're running on a capable GPU, add all optional feature flags to the vulkan target # which are required to get all the correctness tests to pass if builder_type.handles_vulkan(): targets['host-vulkan-vk_int8-vk_int16-vk_int64-vk_float16-vk_float64-vk_v13'].extend( ['internal', 'correctness', 'generator', 'error', 'warning']) if builder_type.handles_wasm(): if builder_type.handles_wasm_wabt(): # TODO: this is a horrid hack. For now, we want to test JIT with both WABT and V8. # Add as a horrible wart on the target string. targets['wasm-32-wasmrt-wasm_simd128-wasm_signext-wasm_sat_float_to_int/wabt'].extend( ['internal', 'correctness', 'generator', 'error', 'warning']) if builder_type.handles_wasm_v8(): # TODO: this is a horrid hack. For now, we want to test JIT with both WABT and V8. # Add as a horrible wart on the target string. targets['wasm-32-wasmrt-wasm_simd128-wasm_signext-wasm_sat_float_to_int/v8'].extend( ['internal', 'correctness', 'generator', 'error', 'warning']) # WABT (and thus WASM JIT) can't handle code build with wasm_threads yet, # so only test Generator here targets['wasm-32-wasmrt-wasm_simd128-wasm_signext-wasm_sat_float_to_int-wasm_threads'].extend( ['generator', 'apps']) if builder_type.handles_webgpu(): # Most apps can't handle wasm builds yet. targets['wasm-32-wasmrt-webgpu'].extend(['generator']) return targets def is_time_critical_test(test): # Return true if the test label (or single-test name) is 'time critical' and must # be run with an exclusive lock on the buildbot (typically, performance tests) return test in ['performance', 'autoschedulers_cpu', 'autoschedulers_gpu', 'autoschedulers_cuda'] def short_target(halide_target): s = halide_target.split('-') if len(s) == 1: return s[0] elif len(s) == 2: return '%s-%s' % (s[0], s[1]) elif len(s) == 3: return '%s-%s-%s' % (s[0], s[1], s[2]) elif len(s) > 3: return '%s-%s-%sโ€ฆ' % (s[0], s[1], s[2]) else: return '<unknown>' def add_halide_cmake_test_steps(factory, builder_type): parallelism = Property('WORKER_BUILD_PARALLELISM') labels = get_test_labels(builder_type) source_dir = get_halide_source_path() build_dir = get_halide_build_path() install_dir = get_halide_install_path(builder_type) # NOQA # Since we need to do at least a partial rebuild for each different target, # we want to group things by target. Do host first, followed by a key-sorted # order, to ensure predictability. keys = list(labels.keys()) keys.remove('host') keys.sort() keys.insert(0, 'host') for halide_target in keys: # HL_TARGET is now ignored by CMake builds, no need to set # (must specify -DHalide_TARGET to CMake instead) # env['HL_TARGET'] = halide_target env = extend_property('env', HL_JIT_TARGET=halide_target) desc = 'T=%s' % short_target(halide_target) # Do this *before* splitting the horrid wasm-specific target string test_labels = labels[halide_target] # wasm targets must ensure that the EMSDK (emcc, etc) are added to the # active env. wasm_jit = None if halide_target.startswith("wasm-"): halide_target, sep, wasm_jit = halide_target.partition('/') # Re-set HL_JIT_TARGET with the de-warted target string env = extend_property('env', HL_JIT_TARGET=halide_target) if wasm_jit: desc = '%s + T=%s' % (wasm_jit, short_target(halide_target)) if not wasm_jit: wasm_jit = 'wabt' factory.addStep( CMake(name='Reconfigure for %s' % short_target(halide_target), description='Reconfigure for %s' % desc, locks=[performance_lock.access('counting')], haltOnFailure=True, env=env, workdir=build_dir, path=source_dir, generator=get_cmake_generator(builder_type), definitions=get_halide_cmake_definitions( builder_type, halide_target=halide_target, wasm_jit=wasm_jit), options=get_halide_cmake_options(builder_type, build_dir))) factory.addStep( ShellCommand(name='Rebuild for %s' % (short_target(halide_target)), description='Rebuild Halide for %s' % desc, locks=[performance_lock.access('counting')], haltOnFailure=True, workdir=build_dir, env=env, command=get_cmake_build_command(builder_type, build_dir, targets=['all', 'install']))) do_apps = 'apps' in test_labels if do_apps: test_labels.remove('apps') if not builder_type.handles_python(): if 'python' in test_labels: test_labels.remove('python') # TODO : some of the apps require python, so we must skip them for now also do_apps = False parallel_test_labels = [ test for test in test_labels if not is_time_critical_test(test)] exclusive_test_labels = [test for test in test_labels if is_time_critical_test(test)] if parallel_test_labels: if len(parallel_test_labels) > 2: test_set = ','.join([s[0] for s in parallel_test_labels]) else: test_set = ', '.join(parallel_test_labels) # Build up some special cases to exclude exclude_tests = [] if builder_type.os == 'windows' or builder_type.os == 'linux': # TODO: disable lens_blur on windows for now due to # https://bugs.llvm.org/show_bug.cgi?id=46176 # and also due to Windows testbots having inadequate GPU RAM # and also due to Linux testbots having inadequate GPU RAM exclude_tests.append('interpolate') exclude_tests.append('lens_blur') exclude_tests.append('unsharp') if builder_type.os == 'linux' or builder_type.bits == 32: # TODO: disable tutorial_lesson_12_using_the_gpu (both C++ and python) on linux and 32-bit exclude_tests.append('tutorial_lesson_12') if builder_type.sanitizer == 'asan': # lesson 19 can trigger memory leaks in some of the GPU device drivers, # so just exclude it when doing ASAN exclude_tests.append('tutorial_lesson_19') if builder_type.arch == 'arm' or builder_type.bits == 32: # TODO: disable lesson_19 on arm32 # https://github.com/halide/Halide/issues/5224 exclude_tests.append('tutorial_lesson_19') factory.addStep( CTest(name='Test %s %s' % (test_set, desc), description='Test %s %s' % (test_set, desc), locks=[performance_lock.access('counting')], workdir=build_dir, env=env, timeout=3600, labels=parallel_test_labels, exclude_tests=exclude_tests, jobs=parallelism, **get_ctest_options(builder_type, build_dir))) if exclusive_test_labels: test_set = ','.join([s.replace('autoschedulers_', 'a_') for s in exclusive_test_labels]) factory.addStep( CTest(name='Test %s %s' % (test_set, desc), description='Test %s %s' % (test_set, desc), locks=[performance_lock.access('exclusive')], workdir=build_dir, env=env, timeout=3600, labels=exclusive_test_labels, **get_ctest_options(builder_type, build_dir))) if do_apps: apps_build_dir = get_halide_build_path("apps") apps_source_dir = get_halide_source_path("apps") # We currently don't attempt to build any of the apps with wasm apps_cmake_defs = get_halide_cmake_definitions(builder_type, halide_target=halide_target) apps_cmake_defs['CMAKE_PREFIX_PATH'] = get_halide_install_path(builder_type) # apps/hannk is expensive to build, and doesn't (yet) build on all systems, so special-case it here want_hannk = (builder_type.has_tflite() and not halide_target.startswith("wasm-")) apps_cmake_defs['ENABLE_APPS_HANNK'] = 'ON' if want_hannk else 'OFF' factory.addStep( CMake(name='Configure apps for %s' % desc, description='Configure apps for %s' % desc, locks=[performance_lock.access('counting')], haltOnFailure=True, env=env, workdir=apps_build_dir, path=apps_source_dir, generator=get_cmake_generator(builder_type), definitions=apps_cmake_defs, options=get_halide_cmake_options(builder_type, build_dir))) factory.addStep( ShellCommand(name='Build apps for %s' % desc, description='Build apps for %s' % desc, locks=[performance_lock.access('counting')], haltOnFailure=True, workdir=apps_build_dir, env=env, command=get_cmake_build_command(builder_type, apps_build_dir))) # Note: do *not* run the apps/ tests in parallel; many of them expect # to make full use of all cores, and running in parallel will just slow # things down. exclude_tests = [] if builder_type.os == 'windows': # TODO: disable lens_blur_filter on windows for now due to # https://github.com/halide/Halide/issues/5552 exclude_tests.append('lens_blur_filter') factory.addStep( CTest(name='Test apps for %s' % desc, description='Test apps for %s' % desc, locks=[performance_lock.access('exclusive')], workdir=apps_build_dir, env=env, timeout=3600, exclude_tests=exclude_tests, exclude_labels=['slow_tests'], **get_ctest_options(builder_type, apps_build_dir))) def create_halide_make_factory(builder_type): assert builder_type.os != 'windows' make_threads = Property('WORKER_BUILD_PARALLELISM') build_dir = get_halide_build_path() factory = BuildFactory() # We never enable sanitizers for Make builds here (only for CMake) add_env_setup_step(factory, builder_type, enable_ccache=True) # It's never necessary to use get_msvc_config_steps() for Make, # since we never use Make with MSVC add_get_halide_source_steps(factory, builder_type) # Force a full rebuild of Halide every time factory.addStep(RemoveDirectory(name="Remove Halide Build Dir", locks=[performance_lock.access('counting')], dir=build_dir)) target_label_pairs = [('host', 'build_tests')] for halide_target, labels_for_target in get_test_labels(builder_type).items(): # For Make we skip every target that isn't plain 'host' if halide_target != 'host': continue _labels_to_skip = [ # auto_schedule and performance requires exclusive machine access and isn't worth it for Make "autoschedulers_cpu", "autoschedulers_gpu", "autoschedulers_cuda", "performance", # Make no longer provides support for building the Python bindings, # regardless of builder_type.handles_python() "python", ] if builder_type.bits == 32: # Don't test autoschedulers on 32-bit systems via Make; # it's not set up 100% correctly for crosscompilation there # and the CMake-based coverage is fine. _labels_to_skip.extend(['autoschedulers_cpu', 'autoschedulers_gpu', 'autoschedulers_cuda']) for label in labels_for_target: if label in _labels_to_skip: continue target_label_pairs.append((halide_target, label)) for halide_target, label in target_label_pairs: env = extend_property('env', LLVM_CONFIG=get_llvm_install_path(builder_type, 'bin/llvm-config'), HL_TARGET=halide_target, HL_JIT_TARGET=halide_target) if is_time_critical_test(label): p = 1 lock_mode = 'exclusive' else: p = make_threads lock_mode = 'counting' if label != 'build_tests': label = 'test_%s' % label factory.addStep(ShellCommand(name='make ' + label, description=label + ' ' + halide_target, locks=[performance_lock.access(lock_mode)], workdir=build_dir, env=env, haltOnFailure=False, command=['make', '-f', get_halide_source_path('Makefile'), '-j', p, label], timeout=3600)) return factory def create_halide_cmake_factory(builder_type): factory = BuildFactory() add_env_setup_step(factory, builder_type) add_get_halide_source_steps(factory, builder_type) add_halide_cmake_build_steps(factory, builder_type) add_halide_cmake_test_steps(factory, builder_type) # If everything else looks ok, build a distrib. if builder_type.purpose == Purpose.halide_nightly: add_halide_cmake_package_steps(factory, builder_type) return factory def create_halide_factory(builder_type): if builder_type.buildsystem == BuildSystem.cmake: return create_halide_cmake_factory(builder_type) else: return create_halide_make_factory(builder_type) def get_interesting_halide_targets(): for arch in ['arm', 'x86']: for bits in [32, 64]: for os in ['linux', 'osx', 'windows']: if arch == 'arm' and os == 'windows': # No buildbots for windows-on-arm (yet) continue if os == 'osx' and bits != 64: # osx is 64-bit only, period continue yield arch, bits, os def create_halide_builder(arch, bits, os, halide_branch, llvm_branch, purpose, buildsystem=BuildSystem.cmake): # Always do a build with no sanitizers sanitizers = [None] # Also build with sanitizers (but not if we are doing nightlies) if purpose != Purpose.halide_nightly: sanitizers.extend(_SANITIZERS) for san in sanitizers: builder_type = BuilderType(arch, bits, os, halide_branch, llvm_branch, purpose, san, buildsystem) if san and purpose == Purpose.llvm_nightly: continue if san and not builder_type.handles_sanitizers(): continue workers = builder_type.get_worker_names() builder = BuilderConfig(name=builder_type.builder_label(), workernames=workers, factory=create_halide_factory(builder_type), collapseRequests=True, # We need counting access to our llvm branch during Halide builds. # (We could probably get by with access during only a subset of # our steps, but there doesn't appear to be a way to group # lock requests across multiple-but-not-all-steps in a Build.) locks=[llvm_build_locks[llvm_branch + str(bits)].access('counting')], tags=builder_type.builder_tags()) builder.builder_type = builder_type yield builder def create_halide_builders(): for arch, bits, os in get_interesting_halide_targets(): # Create builders for build + package of Halide master + release branches # (but only against their 'native' LLVM versions) for halide_branch in HALIDE_NIGHTLIES: for llvm_branch in LLVM_FOR_HALIDE[halide_branch]: yield from create_halide_builder(arch, bits, os, halide_branch, llvm_branch, Purpose.halide_nightly) # Create the builders for testing pull requests to releases. for halide_branch in _HALIDE_RELEASES: for llvm_branch in LLVM_FOR_HALIDE[halide_branch]: yield from create_halide_builder(arch, bits, os, halide_branch, llvm_branch, Purpose.halide_testbranch) # Create the builders for testing pull requests to main. yield from create_halide_builder(arch, bits, os, HALIDE_MAIN, LLVM_MAIN, Purpose.halide_testbranch) # Also test Makefiles on x86-linux & osx (but only on Halide main) to ensure they # stay healthy. (Note: deliberately skip arm-linux, since they are the slowest bots.) yield from create_halide_builder('x86', 64, 'linux', HALIDE_MAIN, LLVM_MAIN, Purpose.halide_testbranch, BuildSystem.make) yield from create_halide_builder('x86', 32, 'linux', HALIDE_MAIN, LLVM_MAIN, Purpose.halide_testbranch, BuildSystem.make) yield from create_halide_builder('x86', 64, 'osx', HALIDE_MAIN, LLVM_MAIN, Purpose.halide_testbranch, BuildSystem.make) yield from create_halide_builder('arm', 64, 'osx', HALIDE_MAIN, LLVM_MAIN, Purpose.halide_testbranch, BuildSystem.make) # Test pull requests for Halide master against the current and previous LLVM, for at least one target. for llvm_branch in LLVM_BRANCHES: if abs(LLVM_BRANCHES[llvm_branch].version.major - LLVM_BRANCHES[LLVM_MAIN].version.major) in [1, 2]: yield from create_halide_builder('x86', 64, 'linux', HALIDE_MAIN, llvm_branch, Purpose.halide_testbranch) def create_halide_scheduler(halide_branch): def is_halide_base_branch(br): return any(br == hl.ref for hl in HALIDE_BRANCHES.values()) def is_halide_pr_branch(br): # If it's not one of the well-known branches, assume it's a pull request return not is_halide_base_branch(br) def github_base_branch_matches(change): ref = change.properties.getProperty('basename') return ref == HALIDE_BRANCHES[halide_branch].ref # ----- nightlies builders = [b for b in c['builders'] if b.builder_type.halide_branch == halide_branch and b.builder_type.purpose == Purpose.halide_nightly] if builders: builder_names = [str(b.name) for b in builders] # Start the Halide nightlies at 9PM Pacific; our buildbot master uses UTC for # cron, so that's 0400. Note that this is (deliberately) well before # the LLVM nightlies get built (currently 11pm start); the idea is # that Halide nightlies get built using the previous day's LLVM # nightlies, on the assumption that those are more likely to get at # least some test coverage (via testbranch) to minimize breakage. yield Nightly( name='halide-package-' + halide_branch, codebases=['halide'], builderNames=builder_names, change_filter=ChangeFilter(codebase='halide'), hour=4, minute=0) yield ForceScheduler( name='force-halide-nightly-' + halide_branch, builderNames=builder_names, codebases=['halide']) # ----- testbranch builders = [b for b in c['builders'] if b.builder_type.halide_branch == halide_branch and b.builder_type.purpose == Purpose.halide_testbranch] if builders: # NOT SingleBranchScheduler, because this can process changes from many branches (all PRs) builder_names = [str(b.name) for b in builders] yield AnyBranchScheduler( name='halide-testbranch-' + halide_branch, codebases=['halide'], change_filter=ChangeFilter(category='pull', codebase='halide', branch_fn=is_halide_pr_branch, filter_fn=github_base_branch_matches), treeStableTimer=60 * 5, # seconds builderNames=builder_names) yield ForceScheduler( name='force-halide-testbranch-' + halide_branch, builderNames=builder_names, codebases=['halide']) def create_llvm_cmake_factory(builder_type): factory = BuildFactory() add_env_setup_step(factory, builder_type) add_get_llvm_source_steps(factory, builder_type) clean_llvm_rebuild = (builder_type.llvm_branch == LLVM_MAIN) add_llvm_steps(factory, builder_type, clean_llvm_rebuild) return factory def create_llvm_builders(): for arch, bits, os in get_interesting_halide_targets(): # Note that we want these Builders to run on *every* eligible worker; # the goal is to ensure that all LLVM builds are updated locally # on all of the workers. for llvm_branch in LLVM_BRANCHES: builder_type = BuilderType(arch, bits, os, None, llvm_branch, Purpose.llvm_nightly) for w in builder_type.get_worker_names(): # Note that we need the builder name to be unique across workers, # but we want the builddir on the *worker* side to be the same for all workers # (to simplify things). label = builder_type.llvm_builder_label() builder = BuilderConfig(name="%s/%s" % (label, w), workerbuilddir=label, workernames=[w], factory=create_llvm_cmake_factory(builder_type), collapseRequests=True, # We want exclusive access to this workerlock # thru all this Builder's steps. (We could probably # get by with holding it just during the install phase, # but we'd have to finesse some details like removing # the old install directory within the lock, and this # is much simpler.) locks=[llvm_build_locks[llvm_branch + str(bits)].access('exclusive')], tags=builder_type.builder_tags()) builder.builder_type = builder_type yield builder def create_llvm_scheduler(llvm_branch): builders = [str(b.name) for b in c['builders'] if b.builder_type.llvm_branch == llvm_branch and b.builder_type.purpose == Purpose.llvm_nightly] # Start every day at 11PM Pacific; our buildbot use UTC for cron, so that's 0600 yield Nightly( name=f'llvm-nightly-{LLVM_BRANCHES[llvm_branch].version.major}', codebases=['llvm'], builderNames=builders, change_filter=ChangeFilter(codebase='llvm'), hour=6, minute=0) for b in builders: yield ForceScheduler( name='force-llvm-nightly-' + b.replace('/', '_'), codebases=['llvm'], builderNames=[b]) def create_builders(): yield from create_llvm_builders() yield from create_halide_builders() def create_schedulers(): for llvm_branch in LLVM_BRANCHES: yield from create_llvm_scheduler(llvm_branch) for halide_branch in HALIDE_BRANCHES: yield from create_halide_scheduler(halide_branch) c['builders'] = list(create_builders()) c['schedulers'] = list(create_schedulers()) # Set the builder priorities def prioritize_builders(buildmaster, builders): def importance(builder): builder_type = builder.config.builder_type assert builder_type # LLVM nightlies run only once a day (late at night) and should always # get priority over everything else. if builder_type.purpose == Purpose.llvm_nightly: return 0 # Branch testers all need to come back before we can merge a PR, # so they all have equal next-highest priority. if builder_type.purpose == Purpose.halide_testbranch: return 1 # non-branch testers are mostly used for bisecting failures that # didn't show up in the branch testers and doing binary # releases. We care most about the most recently-released llvm so # that we have a full set of builds for releases, then llvm main # for bisection, then older llvm versions. if builder_type.llvm_branch in LLVM_FOR_HALIDE[HALIDE_RELEASE_15]: return 2 if builder_type.llvm_branch in LLVM_FOR_HALIDE[HALIDE_RELEASE_16]: return 2 if builder_type.llvm_branch in LLVM_FOR_HALIDE[HALIDE_MAIN]: return 3 return 4 return list(sorted(builders, key=importance)) c['prioritizeBuilders'] = prioritize_builders # GitHub pull request filter class SafeGitHubEventHandler(GitHubEventHandler): def handle_push(self, payload, event): ref = payload['ref'] if re.match(r"^refs/(heads|tags)/(master|main|release/\d+\.x)$", ref): return super().handle_push(payload, event) else: print(f'SafeGitHubEventHandler: ignoring push event for ref: {ref}') return self.skip() def handle_pull_request(self, payload, event): pr = payload['pull_request'] try: # Skip anything with the 'skip_buildbots' label if any(label['name'] == 'skip_buildbots' for label in pr['labels']): # print("PR %s was skipped due to skip_buildbots" % str(pr['html_url'])) return self.skip() # Test anything (even external) that has 'halidebuildbots' as a reviewer. if any(r['login'] == 'halidebuildbots' for r in pr['requested_reviewers']): # print("PR %s was handled due halidebuildbots" % str(pr['html_url'])) if payload['action'] == 'review_requested': # Pretend it's a synchronize event instead since private buildbot code # rejects review_requested for no apparent reason. payload['action'] = 'synchronize' return super().handle_pull_request(payload, event) # Skip external pull requests that originate from untrusted forks trusted_repos = ( 'halide/Halide', # the primary repository is obviously trusted 'CodeLinaro/Halide', # the Qualcomm open-source staging fork is trustworthy ) if pr['head']['repo']['full_name'] not in trusted_repos: # print("PR %s was skipped due to being external:" % str(pr['head']['repo']['full_name'])) return self.skip() # print("PR %s is being handled normally" % str(pr['html_url'])) return super().handle_pull_request(payload, event) except KeyError as e: print(f'SafeGitHubEventHandler: malformed payload: {payload}') print(f'SafeGitHubEventHandler: missing key "{e}"') return self.skip() @staticmethod def skip(): return [], 'git' # WEB SERVER # 'protocols' contains information about protocols which master will use for communicating with workers. # You must define at least 'port' option that workers could connect to your master with this protocol. # 'port' must match the value configured into the buildworkers (with their --master option) c['protocols'] = {'pb': {'port': 9990}} authz = Authz( allowRules=[ems.ForceBuildEndpointMatcher(role="admins"), ems.StopBuildEndpointMatcher(role="admins"), ems.RebuildBuildEndpointMatcher(role="admins"), ems.EnableSchedulerEndpointMatcher(role="admins")], roleMatchers=[RolesFromUsername(roles=["admins"], usernames=["halidenightly"])]) c['www'] = dict( auth=UserPasswordAuth({'halidenightly': WWW_PASSWORD}), authz=authz, port=8012, change_hook_dialects={ 'github': { 'secret': WEBHOOK_SECRET, 'codebase': 'halide', 'skips': [], 'class': SafeGitHubEventHandler, # 'github_property_whitelist': ['github.base.ref'], }, }, ) # PROJECT IDENTITY # the 'title' string will appear at the top of this buildbot # installation's html.WebStatus home page (linked to the # 'titleURL') and is embedded in the title of the waterfall HTML page. c['title'] = 'Halide' c['titleURL'] = 'http://halide-lang.org' # the 'buildbotURL' string should point to the location where the buildbot's # internal web server (usually the html.WebStatus page) is visible. This # typically uses the port number set in the Waterfall 'status' entry, but # with an externally-visible host name which the buildbot cannot figure out # without some help. c['buildbotURL'] = 'https://buildbot.halide-lang.org/master/' # DB URL c['db'] = { # This specifies what database buildbot uses to store its state. You can leave # this at its default for all but the largest installations. 'db_url': 'sqlite:///state.sqlite', } # GitHub Integration # Only testbranch builders need to be considered here builders = [str(b.name) for b in c['builders'] if b.builder_type.purpose != Purpose.llvm_nightly] generator = BuildStartEndStatusGenerator(builders=builders, start_formatter=MessageFormatterRenderable('Build started.'), end_formatter=MessageFormatterRenderable('Build done.')) gs = GitHubStatusPush(token=GITHUB_TOKEN, context=Interpolate("buildbot/%(prop:buildername)s"), generators=[generator], verbose=True) c['services'] = [gs] # Disable sending usage data c['buildbotNetUsageData'] = None
5,990
1ad40ef3aa7c81b6eee4fe0b98bcdd2f1110ef8d
#!/usr/bin/env python # On CI, you can pass the logging and the password of dockerhub through # the environment variables DOCKER_USERNAME and DOCKER_PASSWORD import getpass import os import subprocess import sys from builtins import input SCRIPT_DIR = os.path.realpath(os.path.join(__file__, '..')) ROOT_DIR = os.path.realpath(os.path.join(SCRIPT_DIR, '..')) def main(arguments): docker = [ ('Dockerfile.ubuntu1804', 'ubuntu1804_ansible_testinfra'), ('Dockerfile.ubuntu1604', 'ubuntu1604_ansible_testinfra'), ] docker_username = os.environ.get('DOCKER_USERNAME', None) if docker_username is None: docker_username = input('docker hub user (DOCKER_USERNAME) ? ') docker_password = os.environ.get('DOCKER_PASSWORD', None) if docker_password is None: docker_password = getpass.getpass('docker hub password (DOCKER_PASSWORD) ? ') _system('docker login -u {0} -p {1}'.format(docker_username, docker_password), logged=False) for docker_file, docker_image in docker: _system('docker build -f {0} -t {1} {2}'.format(docker_file, docker_image, ROOT_DIR)) for _, docker_image in docker: _system('docker tag {0} {1}/{0}'.format(docker_image, docker_username)) _system('docker push {1}/{0}'.format(docker_image, docker_username)) def _system(cmd, logged = True): if logged: print('$ {0}'.format(cmd)) if os.system(cmd) > 0: raise OSError() if __name__ == '__main__': sys.exit(main(sys.argv[1:]))
5,991
2c2ad4b6e8c5055afa3dfb3b540a44bda65fa004
""" A web-page. """ import re import pkg_resources from .components import Link, Javascript, inject class Page: """A web-page presenting container. Args: favicon (str): The file name for the favorite icon displayed in a browser tab(default=None) title (str): The page title, displayed in a browser tab (default=None). resources (list): The list of `Link` and `Javascript` components which representing the page resources (default=None). menu (Menu): The page top level menu (default=None). container (WebComponent): The page container (default=None). """ def __init__( self, favicon=None, resources=None, title=None, menu=None, container=None ): super().__init__() self.__favicon = favicon self.__resources = resources self.__title = title self.__menu = menu self.__container = container self.__vars = {} def __html__(self): """Renders an HTML page.""" return str(self) def background(self, color=None, image=None, position=None, size=None, repeat=None, origin=None, clip=None, attachment=None): """Configures the page background. See <a href="https://www.w3schools.com/cssref/css3_pr_background.asp"> form more information. Args: color (str): The background color to used. image(str): The background images to used. position(str): The position of the background images. size(str): The size of the background images. repeat(str): The parameter to define of how to repeat the background images. origin(str): The positioning area of the background images. clip(str): The painting area of the background images. attachment (str): The parameter to define whether the background images are fixed or scrolls with the rest of the page. Returns: obj (self): The instance of this class. """ if color: self.__vars['--body-background-color'] = color if image: self.__vars['--body-background-image'] = image if position: self.__vars['--body-background-position'] = position if size: self.__vars['background-size'] = size if repeat: self.__vars['--body-background-repeat'] = repeat if origin: self.__vars['--body-background-origin'] = origin if clip: self.__vars['--body-background-clip'] = clip if attachment: self.__vars['--body-background-attachment'] = attachment return self def __str__(self): """Renders an HTML page.""" # Collects CSS supporting Bootstrap stypes. links = [ Link('https://maxcdn.bootstrapcdn.com/bootstrap/4.0.0/css/bootstrap.min.css'), # NOQA Link('https://cdnjs.cloudflare.com/ajax/libs/font-awesome/5.8.2/css/all.min.css'), # NOQA Link('https://cdnjs.cloudflare.com/ajax/libs/highlight.js/10.5.0/styles/default.min.css') # NOQA ] # Collects FABICON showing in tab. if self.__favicon: links.append(Link(self.__favicon, 'icon', 'image/x-icon')) # Collects JS scriptis supporting JQuery and code highlights. scripts = [ Javascript('https://ajax.googleapis.com/ajax/libs/jquery/3.1.0/jquery.min.js'), # NOQA Javascript('https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.16.0/umd/popper.min.js'), # NOQA Javascript('https://maxcdn.bootstrapcdn.com/bootstrap/4.0.0/js/bootstrap.min.js'), # NOQA Javascript('https://cdnjs.cloudflare.com/ajax/libs/highlight.js/10.5.0/highlight.min.js'), # NOQA Javascript('https://cdnjs.cloudflare.com/ajax/libs/highlight.js/10.5.0/languages/python.min.js') # NOQA ] # Adds customer defined resources which could be CSS or JS files. if self.__resources: for resource in self.__resources: if isinstance(resource, Link): links.append(resource) elif isinstance(resource, Javascript): scripts.append(resource) else: raise TypeError( 'Page resource must be either <class "Link"> or ' f'<class "Javascript">, but got: {type(resource)};', ) # Sets the page title. title = None if self.__title: if isinstance(self.__title, str): title = f'''<title>{self.__title}</title>''' else: raise TypeError( f'Page title must be <str>, but got: {type(title)};', ) # Creates inner style which will be embedded in the page. root_vars = '' if len(self.__vars) > 0: for name, value in self.__vars.items(): root_vars += '%s: %s;' % (name, value) root_vars += '--container-margin-top: %s' % ( '90px' if self.__menu else '10px' ) root_vars = ':root{' + root_vars + '}' inner_style = pkg_resources.resource_string(__name__, 'generic.css').\ decode('utf-8') inner_style = root_vars + inner_style inner_style = re.sub('\\n|\\s\\s+', ' ', inner_style) # Creates inner script which will be embedded in the page. inner_script = pkg_resources.resource_string(__name__, 'generic.js').\ decode('utf-8') inner_script = re.sub('\\n|\\s\\s+', ' ', inner_script) return f''' <!DOCTYPE html> <html lang="en"> <head> <meta charset="utf-8"/> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"/> {inject(*links)} {inject(*scripts)} {inject(title)} </head> <body> {inject(self.__menu)} <div class="container-fluid"> {inject(self.__container)} </div> </body> <script>{inner_script}</script> <style>{inner_style}</style> </html> '''
5,992
652918e09a3506869c939be39b71a06467459f8a
import configparser # CONFIG config = configparser.ConfigParser() config.read('dwh.cfg') # DROP TABLES drop_schema="DROP SCHEMA IF EXISTS sparkifydb;" set_search_path="SET SEARCH_PATH to sparkifydb;" staging_events_table_drop = "DROP TABLE IF EXISTS staging_events;" staging_songs_table_drop = "DROP TABLE IF EXISTS staging_songs;" songplay_table_drop = "DROP TABLE IF EXISTS songplay;" user_table_drop = "DROP TABLE IF EXISTS sparkifydb.users;" song_table_drop ="DROP TABLE IF EXISTS sparkifydb.songs;" artist_table_drop = "DROP TABLE IF EXISTS sparkifydb.artists;" time_table_drop = "DROP TABLE IF EXISTS sparkifydb.time;" #CREATE SCHEMA create_sparkify_schema="CREATE SCHEMA IF NOT EXISTS sparkifydb;" # CREATE TABLES staging_events_table_create= (""" CREATE TABLE staging_events ( event_id int identity(0,1) SORTKEY, artist_name text NULL DISTKEY, auth text NULL, firstName text NULL, gender varchar(5) NULL, itemInSession bigint NULL, lastName text NULL, length double precision NULL, level text NULL, location text NULL, method text NULL, page text NULL, registration text NULL, sessionId bigint NULL, song text NULL, status int NULL, ts text NULL, userAgent text NULL, userId bigint ); """) staging_songs_table_create = (""" CREATE TABLE staging_songs ( num_songs int, artist_id varchar(255) DISTKEY, artist_latitude varchar(255) NULL, artist_longitude varchar(255) NULL, artist_location varchar(255) NULL, artist_name text NOT NULL, song_id varchar(255) SORTKEY NOT NULL, title text NOT NULL, duration double precision NOT NULL, year int NULL ); """) songplay_table_create = (""" CREATE TABLE songplay ( songplay_id int identity(0,1) PRIMARY KEY SORTKEY NOT NULL, start_time timestamp NOT NULL, user_id text NOT NULL, level text, song_id text NOT NULL, artist_id text NOT NULL DISTKEY, session_id text, location text, user_agent text); """) user_table_create = (""" CREATE TABLE users( user_id bigint PRIMARY KEY SORTKEY NOT NULL , first_name text, last_name text, gender varchar(10), level text )diststyle all; """) song_table_create = (""" CREATE TABLE songs( song_id varchar(255) SORTKEY PRIMARY KEY NOT NULL, artist_id text NOT NULL, year int, duration double precision, level text )diststyle all; """) artist_table_create = (""" CREATE TABLE artists( artist_id text PRIMARY KEY SORTKEY, artist_name text, location text, lattitude text, longitude text ) diststyle all; """) time_table_create = (""" CREATE TABLE time( start_time timestamp PRIMARY KEY SORTKEY, hour int, day int, week int, month int, year int, weekday int ) diststyle all; """) # STAGING TABLES staging_events_copy = ("""copy staging_events from '{}' credentials 'aws_iam_role={}' compupdate off region 'us-west-2' JSON '{}' """).format(config['S3']['LOG_DATA'],config['IAM_ROLE']['ARN'],config['S3']['LOG_JSONPATH']) staging_songs_copy = ("""copy staging_songs from '{}' credentials 'aws_iam_role={}' compupdate off region 'us-west-2' JSON 'auto' """).format(config['S3']['SONG_DATA'],config['IAM_ROLE']['ARN']) # FINAL TABLES songplay_table_insert = (""" INSERT INTO songplay(start_time,user_id,level,song_id,artist_id,session_id,location,user_agent) SELECT TIMESTAMP 'epoch' + se.ts/1000 * INTERVAL '1 Second ' AS start_time, se.userId AS user_id, se.level AS level, ss.song_id AS song_id, ss.artist_id AS artist_id, se.sessionId AS session_id, ss.artist_location AS location, se.userAgent AS user_agent FROM staging_songs AS ss JOIN staging_events AS se ON (ss.title=se.song AND ss.artist_name=se.artist_name) AND se.page = 'NextSong'; """) user_table_insert = (""" INSERT INTO users(user_id,first_name,last_name,gender,level) SELECT DISTINCT(s.userId) AS user_id, s.firstName AS first_name, s.lastName AS last_name, s.gender AS gender, s.level AS level FROM staging_events as s WHERE s.page = 'NextSong' """) song_table_insert = (""" INSERT INTO songs (song_id,artist_id,year, duration) SELECT DISTINCT(ss.song_id) AS song_id, ss.artist_id AS artist_id, ss.year AS year, ss.duration AS duration FROM staging_songs AS ss """) artist_table_insert = (""" INSERT INTO artists (artist_id,artist_name,location,lattitude,longitude) SELECT DISTINCT(s.artist_id) AS artist_id, s.artist_name AS artist_name, s.artist_location AS location, s.artist_latitude AS lattitude, s.artist_longitude AS longitude FROM staging_songs AS s; """) time_table_insert = (""" INSERT INTO time (start_time,hour,day,week,month,year,weekday) SELECT DISTINCT(TIMESTAMP 'epoch' + s.ts/1000 * INTERVAL '1 Second ') AS start_time, EXTRACT(HOUR from start_time) AS hour, EXTRACT(DAY from start_time) AS day, EXTRACT(WEEK from start_time) AS week, EXTRACT(MONTH from start_time) AS month, EXTRACT(YEAR from start_time) AS year, EXTRACT(DOW from start_time) AS weekday FROM staging_events AS s WHERE s.page = 'NextSong'; """) # QUERY LISTS create_table_queries =[set_search_path,songplay_table_create, user_table_create, song_table_create, artist_table_create, time_table_create,staging_events_table_create,staging_songs_table_create] drop_table_queries = [create_sparkify_schema,set_search_path,staging_events_table_drop, staging_songs_table_drop, songplay_table_drop, user_table_drop, song_table_drop, artist_table_drop, time_table_drop] copy_table_queries = [set_search_path,staging_events_copy, staging_songs_copy] insert_table_queries = [set_search_path,user_table_insert, song_table_insert, artist_table_insert, time_table_insert,songplay_table_insert]
5,993
c0e1c0c4545777a669fac19900239ab9baade242
""" Physical units and dimensions """ from sympy import * from sympy.core.basic import Atom from sympy.core.methods import ArithMeths, RelMeths class Unit(Atom, RelMeths, ArithMeths): is_positive = True # make (m**2)**Rational(1,2) --> m is_commutative = True def __init__(self, name, abbrev): self.name = name self.abbrev = abbrev def tostr(self, level=0): return self.abbrev def __eq__(self, other): return isinstance(other, Unit) and self.name == other.name def defunit(value, *names): u = value g = globals() for name in names: g[name] = u # Dimensionless percent = percents = Rational(1,100) permille = permille = Rational(1,1000) ten = Rational(10) yotta = ten**24 zetta = ten**21 exa = ten**18 peta = ten**15 tera = ten**12 giga = ten**9 mega = ten**6 kilo = ten**3 deca = ten**1 deci = ten**-1 centi = ten**-2 milli = ten**-3 micro = ten**-6 nano = ten**-9 pico = ten**-12 femto = ten**-15 atto = ten**-18 zepto = ten**-21 yocto = ten**-24 rad = radian = radians = 1 deg = degree = degrees = pi/180 # Base units defunit(Unit('meter', 'm'), 'm', 'meter', 'meters') defunit(Unit('kilogram', 'kg'), 'kg', 'kilogram', 'kilograms') defunit(Unit('second', 's'), 's', 'second', 'seconds') defunit(Unit('ampere', 'A'), 'A', 'ampere', 'amperes') defunit(Unit('kelvin', 'K'), 'K', 'kelvin', 'kelvins') defunit(Unit('mole', 'mol'), 'mol', 'mole', 'moles') defunit(Unit('candela', 'cd'), 'cd', 'candela', 'candelas') # Derived units defunit(1/s, 'Hz', 'hz', 'hertz') defunit(m*kg/s**2, 'N', 'newton', 'newtons') defunit(N*m, 'J', 'joule', 'joules') defunit(J/s, 'W', 'watt', 'watts') defunit(N/m**2, 'Pa', 'pa', 'pascal', 'pascals') defunit(s*A, 'C', 'coulomb', 'coulombs') defunit(W/A, 'v', 'V', 'volt', 'volts') defunit(V/A, 'ohm', 'ohms') defunit(A/V, 'S', 'siemens', 'mho', 'mhos') defunit(C/V, 'F', 'farad', 'farads') defunit(J/A, 'Wb', 'wb', 'weber', 'webers') defunit(V*s/m**2, 'T', 'tesla', 'teslas') defunit(V*s/A, 'H', 'henry', 'henrys') # Common length units defunit(kilo*m, 'km', 'kilometer', 'kilometers') defunit(deci*m, 'dm', 'decimeter', 'decimeters') defunit(centi*m, 'cm', 'centimeter', 'centimeters') defunit(milli*m, 'mm', 'millimeter', 'millimeters') defunit(micro*m, 'um', 'micrometer', 'micrometers', 'micron', 'microns') defunit(nano*m, 'nm', 'nanometer', 'nanometers') defunit(pico*m, 'pm', 'picometer', 'picometers') defunit(Rational('0.3048')*m, 'ft', 'foot', 'feet') defunit(Rational('25.4')*mm, 'inch', 'inches') defunit(3*ft, 'yd', 'yard', 'yards') defunit(5280*ft, 'mi', 'mile', 'miles') # Common volume and area units defunit(m**3 / 1000, 'l', 'liter', 'liters') defunit(deci*l, 'dl', 'deciliter', 'deciliters') defunit(centi*l, 'cl', 'centiliter', 'centiliters') defunit(milli*l, 'ml', 'milliliter', 'milliliters') # Common time units defunit(milli*s, 'ms', 'millisecond', 'milliseconds') defunit(micro*s, 'us', 'microsecond', 'microseconds') defunit(nano*s, 'ns', 'nanosecond', 'nanoseconds') defunit(pico*s, 'ps', 'picosecond', 'picoseconds') defunit(60*s, 'minute', 'minutes') defunit(60*minute, 'h', 'hour', 'hours') defunit(24*hour, 'day', 'days') defunit(Rational('31558149.540')*s, 'sidereal_year', 'sidereal_years') defunit(Rational('365.24219')*day, 'tropical_year', 'tropical_years') defunit(Rational('365')*day, 'common_year', 'common_years') defunit(Rational('365.25')*day, 'julian_year', 'julian_years') year = years = tropical_year # Common mass units defunit(kilogram / kilo, 'g', 'gram', 'grams') defunit(milli * g, 'mg', 'milligram', 'milligrams') defunit(micro * g, 'ug', 'microgram', 'micrograms') #---------------------------------------------------------------------------- # Physical constants # c = speed_of_light = 299792458 * m/s G = gravitational_constant = Rational('6.67428') * ten**-11 * m**3 / kg / s**2 u0 = magnetic_constant = 4*pi * ten**-7 * N/A**2 e0 = electric_constant = 1/(u0 * c**2) Z0 = vacuum_impedance = u0 * c planck = Rational('6.2606896') * ten**-34 * J*s hbar = planck / (2*pi) avogadro = (Rational('6.02214179') * 10**23) / mol boltzmann = Rational('1.3806505') * ten**-23 * J / K gee = gees = Rational('9.80665') * m/s**2 atmosphere = atmospheres = atm = 101325 * pascal # Other convenient units and magnitudes defunit(c*julian_year, 'ly', 'lightyear', 'lightyears') defunit(149597870691*m, 'au', 'astronomical_unit', 'astronomical_units')
5,994
414fa4021b21cea0dc49380aebfe67f0204f0574
def multiplica(): one = int(input('1ยบ: ')) two = int(input('2ยบ: ')) print('a multiplicaรงรฃo รฉ: ', one*two) def soma(): one = int(input('1ยบ: ')) two = int(input('2ยบ: ')) print('a soma รฉ: ', one+two) def subtra(): one = int(input('1ยบ: ')) two = int(input('2ยบ: ')) print('a subtraรงรฃo รฉ: ', one-two) ans=True while ans: print (""" 1.Multiplicaรงรฃo 2.Soma 3.Subtraรงรฃo 4.Exit/Quit """) ans= int(input("What would you like to do? ")) if ans== 1: multiplica() elif ans== 2: print("\n Student Deleted") elif ans== 3: print("\n Student Record Found") elif ans== 4: print("\n Goodbye") exit() else: print("\n Not Valid Choice Try again")
5,995
54a6405e3447d488aa4fca88159ccaac2506df2c
#!/usr/bin/env python import serial from action import Action import math comm = serial.Serial("/dev/ttyACM3", 115200, timeout=1) #comm = None robot = Action(comm) from flask import Flask from flask import send_from_directory import os static_dir = os.path.join(os.getcwd(), "ControlApp") print "serving from " + static_dir app = Flask(__name__) app.debug = False @app.route('/') def root(): return send_from_directory(static_dir, "control.html") @app.route("/stop") def do_stop(): robot.stop() return "ok" @app.route("/forward") def do_forward(): robot.move(0, 1) return "ok" @app.route("/backward") def do_backward(): robot.move(0, -1) return "ok" @app.route("/left") def do_left(): robot.move(math.pi/2.0, 1) return "ok" @app.route("/right") def do_right(): robot.move(math.pi*3.0/2.0, 1) return "ok" @app.route("/turncw") def do_turncw(): robot.turn(0.5) return "ok" @app.route("/turnacw") def do_turnacw(): robot.turn(-0.5) return "ok" @app.route("/kick") def do_kick(): robot.kick() return "ok" @app.route("/catch") def do_catch(): robot.catch() return "ok" if __name__ == "__main__": app.debug = True app.run(port=5001)
5,996
0bc53130a4248178f4c3fabbae7d2546f0d5b8fd
from __future__ import unicode_literals from django.db import models from django.utils import timezone # Create your models here. class Article(models.Model): title = models.CharField(max_length=200) author = models.CharField(max_length=100, default='admin') content = models.TextField(max_length=5000) hide_content = models.TextField(max_length=1000, default='', blank=True) create_time = models.DateTimeField(auto_now_add=True) visible = models.BooleanField(default=True) description = models.CharField(max_length=200, default='', blank=True) # comment = models.ForeignKey(Comment, related_name='article_comment') cover = models.CharField(max_length=100, default='/') def __unicode__(self): return self.title class Comment(models.Model): article = models.ForeignKey(Article, related_name='article_comment') content = models.TextField(max_length=1000, default='') create_time = models.DateTimeField(auto_now_add=True) user_id = models.CharField(max_length=100, blank=False) def __unicode__(self): return self.content class ZoneSubject(models.Model): title = models.CharField(max_length=20, default='', blank=True) image_url = models.CharField(max_length=500) create_time = models.DateTimeField(default=timezone.now) def __unicode__(self): return self.image_url class Search_record(models.Model): title = models.CharField(max_length=100) url = models.CharField(max_length=100) searchCount = models.IntegerField(blank=True) zhihu_type = models.IntegerField(blank=True, null=True) def __unicode__(self): return self.title class DoubanTopic(models.Model): group_id = models.CharField(max_length=10) url = models.CharField(max_length=100) title = models.CharField(max_length=100) create_time = models.CharField(max_length=20) author_name = models.CharField(max_length=50) author_url = models.CharField(max_length=200) user_img_small = models.CharField(max_length=200) visible = models.BooleanField(default=True) def __unicode__(self): return self.title class ZhihuSubject(models.Model): title = models.CharField(max_length=200) url = models.CharField(max_length=100) zhihu_type = models.IntegerField() def __unicode__(self): return self.title class ZhihuQuestion(models.Model): subject = models.ForeignKey(ZhihuSubject, related_name='subject_question') answer_url = models.CharField(max_length=200) author = models.CharField(max_length=100) author_url = models.CharField(max_length=200,null=True) title = models.CharField(max_length=100, default='') def __unicode__(self): return self.title class ZhihuImage(models.Model): question = models.ForeignKey(ZhihuQuestion, related_name='question_image') origin_url = models.CharField(max_length=200) def __unicode__(self): return self.origin_url class DoubanImage(models.Model): topic = models.ForeignKey(DoubanTopic, related_name='topic_image') origin_url = models.CharField(max_length=200) cos_url = models.CharField(max_length=200, default='',blank=True) type = models.IntegerField(default=0) def __unicode__(self): return self.origin_url
5,997
327e9dcba49419b8a8c320940e333765c1d9b980
# Standard Library Imports # Third Party Imports from kivy.clock import Clock from kivy.properties import StringProperty from kivy.uix.screenmanager import Screen, ScreenManager from kivy.uix.widget import Widget # Local Imports from client.source.ui.kv_widgets import ModalPopupButton, SubmissionPopup, FailedSubmissionPopup, ServerShutdownPopup # ==================================== # CONSTANTS # ==================================== PORT = 1776 # ==================================== # PARAMETERS # ==================================== TIME_UNIT = 'MINUTES' class RootScreen(ScreenManager): def __init__(self, client_protocol, **kwargs): super().__init__(**kwargs) self.client_protocol = client_protocol class StartScreen(Screen): def attempt_to_connect(self, server_ip, username, password): self.parent.client_protocol.start_connection(server_ip, username, password) self.open_connecting_popup() self.timeout = 0 self.wait_For_server_response_event = Clock.schedule_interval(self.wait_for_server_response, 1) def wait_for_server_response(self, *args): print(self.timeout) # Login success if self.parent.client_protocol.login_success: self.popup.dismiss() self.wait_For_server_response_event.cancel() self.parent.current = 'ChatRoomScreen' # Timeout elif self.timeout == 5: self.failed_to_connect(message='Failed to connect to server. Please try again or check your network connection.') # Invalid credentials elif self.parent.client_protocol.invalid_credentials: self.parent.client_protocol.invalid_credentials = False self.failed_to_connect(message='Invalid username/password combination. Please try again.') else: self.timeout += 1 def failed_to_connect(self, message): print("FAILED TO CONNECT") self.popup.dismiss() self.open_failed_popup(message=message) self.wait_For_server_response_event.cancel() def open_connecting_popup(self): self.popup = SubmissionPopup() self.popup.open() def open_failed_popup(self, message): self.popup = FailedSubmissionPopup(message=message) self.popup.open() class ChatRoomScreen(Screen): chat_history = StringProperty('') user_list = StringProperty('') def on_enter(self): Clock.schedule_once(self.schedule_update_display_info) def schedule_update_display_info(self, *args): Clock.schedule_interval(self.update_display_info, 1) def update_user_list_buttons(self): self.clear_user_list_display() for user in self.user_list.split("\n"): button = ModalPopupButton(text=user) self.ids.user_list.add_widget(button) self.ids.user_list.add_widget(Widget()) def clear_user_list_display(self): self.ids.user_list.clear_widgets() def update_display_info(self, *args): if self.chat_history != self.parent.client_protocol.chat_history.history_string: self.chat_history = self.parent.client_protocol.chat_history.history_string if self.user_list != self.parent.client_protocol.user_list: print("User List mismatch") self.user_list = self.parent.client_protocol.user_list self.update_user_list_buttons() if self.parent.client_protocol.server_shutdown: self.server_shutdown() def next_message_private(self, user): current_text = self.ids.message.text self.ids.message.text = '' current_text = "@{}, ".format(user) + current_text self.ids.message.text = current_text def server_shutdown(self): print("SERVER SHUTDOWN") self.popup = ServerShutdownPopup() self.popup.open() def schedule_clear_input_box(self): Clock.schedule_once(self.clear_input_box, 0.25) def clear_input_box(self, *args): self.ids.message.text = ''
5,998
dc6cbf43424a31f1aefde8bd71b6f1b7ecf8166b
vect = [0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 8.320673301762177, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.287897844304593, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 4.394449154672439, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 1.3862943611198906, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 1.7412592803704001, 2.9957322735539913, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.198469360840316, 0.0, 2.550898738446989, 0, 0, 0.0, 0, 0.0, 3.4011973816621555, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 3.58351893845611, 0, 0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 3.2188758248682006, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6888794541139363, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.649511027115099, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6109179126442243, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.5834963087817, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0, 0.0, 0.0, 2.9957322735539913, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 3.6888794541139363, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.295836866004329, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 4.605170185988092, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0, 0, 12.266590935297321, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0, 0.0, 5.924066185063897, 0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 7.200951859620047, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0, 0, 4.0943445622221, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 4.962844630259907, 0.0, 0.0, 0, 0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0, 0, 0.0, 0.0, 0, 0.0, 3.8501476017100584, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 1.0986122886681098, 2.1972245773362196, 0, 0.0, 0.0, 4.581130849408909, 0.0, 0, 2.5649493574615367, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.6375861597263857, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 8.921925063191328, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9957322735539913, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.367295829986474, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0.0, 10.39720770839918, 2.302585092994046, 2.5649493574615367, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 2.9957322735539913, 0, 0, 4.06534854782536, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.295836866004329, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0, 2.6390573296152584, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.490536906871891, 0.0, 0.0, 0.0, 3.5263605246161616, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 2.550898738446989, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.02535169073515, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 3.258096538021482, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.290459441148391, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.31748811353631, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4339872044851467, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 2.1972245773362196, 3.4825185607408002, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2237778411112, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.9512437185814275, 7.983380992735443, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 7.917171988845775, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.969640753475787, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 5.723585101952381, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.76977456331519, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 7.000208219919599, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 4.143134726391533, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 4.795790545596741, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.044522437723423, 0.0, 0, 0.0, 0.0, 0.0, 4.74493212836325, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 6.516193076042964, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 3.2958368660043296, 0.0, 3.58351893845611, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.51085950651685, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.952096120109145, 0.0, 5.58914919554, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0, 0, 0.0, 1.3862943611198906, 3.258096538021482, 0, 0.0, 0.0, 0.0, 4.394449154672439, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 5.101797476893978, 0.0, 2.302585092994046, 0, 0, 0.0, 4.292158018817389, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 4.06534854782536, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0, 3.5553480614894135, 0.0, 0, 2.5649493574615367, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 5.46286043483228, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 18.767037148656488, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.584967478670572, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 4.0943445622221, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.711235389328078, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.367295829986474, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.9512437185814275, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0, 0, 0, 3.1354942159291497, 3.800574088041945, 0, 0.0, 0.0, 0.0, 0, 4.969640753475787, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 4.631631038266565, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.833213344056216, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.3322045101752034, 0.0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.367295829986474, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.41610040220442, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.833213344056216, 0, 0.0, 0, 3.58351893845611, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.553876891600541, 0, 0.0, 3.367295829986474, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9120230054281455, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.800574088041945, 0, 0.0, 0, 0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.6635616461296467, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0, 0, 0.0, 5.204006687076795, 0.0, 0.0, 8.61362370353681, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0, 0.0, 0, 2.550898738446989, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.44274094706523, 5.679743138077019, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 11.069054569245793, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 5.03709614637473, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.961361141082371, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6109179126442243, 0, 0.0, 0.0, 0.0, 3.931825632724326, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.189654742026425, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.718498871295094, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 4.007333185232471, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 16.237278281910243, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 4.330733340286331, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 1.3862943611198906, 0, 3.8005740880419454, 0.0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 7.454719949364001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.70805020110221, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 11.484086901809196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 4.518263445217987, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 17.287514144901962, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.1972245773362196, 1.7412592803704001, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 13.660472509367466, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 3.7369991058576035, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 7.973471367577775, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.2188758248682006, 0, 3.8005740880419454, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.8005740880419454, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.437751649736401, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.101797476893978, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 11.76620976334845, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 10.559023657635953, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.008260801089284, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.877735781779639, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 3.4339872044851467, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 2.833213344056216, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 3.649511027115099, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 4.06534854782536, 0.0, 5.545177444479562, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 5.16396083649347, 0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.367295829986474, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.111987788356544, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.101797476893978, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 7.917171988845775, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 5.346437018291705, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.215149976722676, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 11.08366673682469, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.4849066497880004, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 5.780743515792329, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 5.41610040220442, 0, 0.0, 0.0, 4.581130849408909, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.991464547107983, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.869976334119211, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 4.330733340286331, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.995732273553991, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.897839799950911, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 4.748123315783208, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693497, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 4.454347296253507, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.6635616461296467, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.871201010907891, 3.2188758248682006, 0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 5.0301047650807, 4.605170185988092, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 3.2188758248682006, 0.0, 3.6375861597263857, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.77912349311153, 1.3862943611198906, 0.0, 0, 1.791759469228055, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 4.394449154672439, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 12.332621592519935, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.7376696182833684, 0.0, 0.0, 0.0, 5.390770307485499, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.804021044733257, 0.0, 0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.800574088041945, 0.0, 4.06534854782536, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.6635616461296467, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 7.217724106087479, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.6635616461296467, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.0301047650807, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.1683892320507745, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 2.833213344056216, 3.4011973816621555, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 3.178053830347946, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.49053690687189, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.6931471805599453, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 4.8991863767100545, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.812184355372417, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 2.1972245773362196, 1.6094379124341003, 0, 0.0, 4.574710978503383, 0, 6.462743943876961, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.262134127775067, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0, 0.0, 0.0, 11.284134957569469, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 6.821864234308754, 0, 0.0, 0.0, 0.0, 3.4965075614664802, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.471502607305074, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 4.976733742420574, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.828641396489095, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 3.8918202981106265, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 2.8398715690385097, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 3.044522437723423, 0.0, 0.0, 5.846735604451319, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 3.367295829986474, 0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 4.969813299576001, 5.346437018291705, 0.0, 1.7412592803704001, 0.0, 1.7412592803704001, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.000208219919599, 2.6390573296152584, 0, 0.0, 0, 0.6931471805599453, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 3.6109179126442243, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 6.287897844304593, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.795790545596741, 0.0, 0, 8.365613809386995, 0.0, 0.0, 0.0, 0.0, 0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.007333185232471, 0, 0, 0.0, 0.0, 3.9512437185814275, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.499809670330265, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.2188758248682006, 0.0, 4.48863636973214, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.952096120109145, 4.828313737302301, 3.4339872044851467, 0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 4.969813299576001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.127134385045092, 0.0, 0, 6.821864234308754, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0, 8.802445120171846, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 12.404515991916155, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0.0, 16.168878379615265, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0, 0.0, 3.8005740880419454, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 1.6094379124341003, 0.0, 0, 16.168230769388487, 0, 0.0, 0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0, 0, 0.0, 4.518263445217987, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.941642422609304, 4.700480365792417, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0, 3.2188758248682006, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 4.828313737302301, 0.0, 0, 0, 5.605802066295998, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 5.101797476893978, 3.0910424533583156, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.101797476893978, 4.969640753475787, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.3694478524670215, 0, 0, 0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 1.6094379124341003, 0, 0.0, 3.2188758248682006, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0, 3.58351893845611, 0.0, 0.0, 0, 3.7369991058576035, 0.0, 4.02535169073515, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.0841946160253877, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.182806904693497, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 2.70805020110221, 0, 0, 0, 0.0, 10.484135188312967, 7.275172319452771, 0.0, 0, 3.0841946160253872, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 7.953835426675504, 0.0, 2.70805020110221, 0.0, 0, 0, 0, 0.0, 0.0, 9.830786204133961, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0, 0, 0, 0, 0.0, 0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.07753744390572, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.356107660695892, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0, 0.0, 0, 0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.127134385045092, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.214935757608986, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.053835369501174, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 2.1972245773362196, 0, 0.0, 2.0794415416798357, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.969640753475787, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.739792912179235, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 5.075173815233827, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.784189633918261, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.847027830639663, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 7.471502607305073, 0.0, 0.0, 1.3862943611198906, 0.0, 3.4339872044851467, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 4.795790545596741, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 3.0841946160253877, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.278114659230517, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.58351893845611, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.833213344056216, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 6.591673732008658, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.465908118654584, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 5.95562797505323, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 4.762173934797756, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.736198448394496, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 4.330733340286331, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.101797476893978, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0.0, 0.0, 6.102339570951937, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.459585514144159, 0, 0.0, 0.0, 0.0, 2.995732273553991, 3.2958368660043296, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 8.73217391546585, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0.0, 0, 0, 1.9459101490553132, 0, 0.0, 0, 4.795790545596741, 0, 0.0, 4.518263445217986, 3.5553480614894135, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0.6931471805599453, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.6931471805599453, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 1.7412592803704001, 0, 0, 3.93848385770662, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 4.160336650881089, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 2.9444389791664403, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 4.204692619390966, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.6888794541139363, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 9.174503799921432, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.8858724694518925, 0.0, 0, 0.0, 0, 1.0986122886681098, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 1.3862943611198906, 0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 4.2626798770413155, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0, 0, 0.0, 0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6888794541139363, 0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.46286043483228, 6.127701357652087, 0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.666426688112432, 2.4849066497880004, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 0.0, 0, 0, 3.6635616461296467, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0, 0.0, 0, 0, 1.0986122886681098, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 2.772588722239781, 0.0, 0, 0.0, 3.5553480614894135, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 4.748123315783209, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 4.66682536764049, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0, 1.0986122886681098, 0, 0, 0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.6375861597263857, 0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 6.54135323573334, 0, 0.0, 2.0794415416798357, 0, 0, 1.9459101490553132, 0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.8066624897703196, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 5.666426688112432, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2237778411112, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.276666119016055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 3.784189633918261, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.0841946160253877, 0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.0841946160253872, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 5.769774563315189, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.127134385045092, 0, 0.0, 0, 0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 5.46286043483228, 0, 0.0, 3.295836866004329, 1.0986122886681098, 0, 0, 0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 2.4849066497880004, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0, 4.828313737302301, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0, 6.198469360840316, 9.129638369467537, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4825185607408002, 5.723585101952381, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 5.346437018291705, 4.490536906871891, 0.0, 5.375278407684165, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 6.711235389328078, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0, 0.0, 1.6094379124341003, 0, 1.6094379124341003, 0, 0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 3.0841946160253872, 0.0, 0.0, 4.06534854782536, 5.1298987149230735, 0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.007333185232471, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.631631038266565, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.346437018291705, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 2.550898738446989, 0.0, 0.0, 1.791759469228055, 0, 0.6931471805599453, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 3.6888794541139363, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0, 0.0, 2.302585092994046, 0.0, 2.772588722239781, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 2.4849066497880004, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 3.58351893845611, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0, 0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.884768704067333, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 3.9318256327243257, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.02535169073515, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 7.9730554676126895, 0.0, 0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 11.613215656391521, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 5.8066078281957605, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.182806904693496, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.970291913552122, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.77912349311153, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 10.73885431325499, 0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.9459101490553132, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.19044141596179, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.804021044733257, 0.0, 0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 3.8918202981106265, 3.649511027115099, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 10.532317184711113, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.924066185063897, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 3.7369991058576035, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.518263445217987, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.969640753475787, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.9384838577066197, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.292763799896557, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9120230054281455, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 5.8377304471659395, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2958368660043296, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.833213344056216, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 6.9558749307258045, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.295836866004329, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 1.3862943611198906, 0, 0, 0, 0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.770684624465665, 0, 0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.3322045101752034, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.454347296253507, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6888794541139363, 0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.795790545596741, 2.833213344056216, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 8.73323621912248, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 8.105134969404936, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 3.2188758248682006, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.07753744390572, 0.0, 0, 0.0, 0, 4.605170185988092, 3.295836866004329, 0, 0, 0.0, 3.7376696182833684, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0.0, 0.0, 3.3322045101752034, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.87326690740586, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.23410650459726, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 2.550898738446989, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0, 0, 0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.257339727119625, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 4.356708826689592, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 2.8398715690385097, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.23410650459726, 0.0, 0.0, 0.0, 0.0, 0, 4.394449154672439, 0.0, 0.0, 0.0, 4.290459441148391, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.941642422609304, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 4.060443010546419, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 3.3322045101752034, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 4.795790545596741, 0, 0.0, 0, 0.0, 0, 0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0, 0.0, 0.0, 0.0, 3.93848385770662, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.7612001156935624, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.99022883006837, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 4.48863636973214, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.219507705176107, 0, 0, 0.0, 3.7376696182833684, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 1.0986122886681098, 4.1588830833596715, 0.0, 3.4011973816621555, 0.0, 0, 0, 0, 3.1354942159291497, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0.0, 3.044522437723423, 3.6888794541139363, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 6.42339050749462, 5.567740402508132, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 3.828641396489095, 0.0, 0.0, 0, 4.160336650881089, 0.0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 4.127134385045092, 0.0, 0, 0, 0, 4.394449154672439, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.3322045101752034, 0, 0, 3.367295829986474, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 3.828641396489095, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 2.550898738446989, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 3.2188758248682006, 0.0, 3.5553480614894135, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.7612001156935624, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.394449154672439, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.564348191467836, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 4.204692619390966, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.9384838577066197, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 3.295836866004329, 0, 3.9889840465642745, 0, 0.0, 0, 0.0, 0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.390770307485499, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 10.55570332597337, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.356708826689592, 0.0, 0, 0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.4849066497880004, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9318256327243257, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.258096538021482, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 3.7369991058576035, 0.0, 2.302585092994046, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0, 0.0, 4.631631038266565, 0, 0, 0.0, 0.0, 0.0, 6.198469360840315, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.6888794541139363, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.787491742782046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.182084906716631, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 5.365976015021851, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 1.9459101490553132, 3.0841946160253877, 0, 0.0, 0, 0.0, 0.0, 0.0, 5.3230099791384085, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 3.4825185607408002, 0, 0.0, 0.0, 5.2237778411112, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.553876891600541, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.368314490550079, 5.2237778411112, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 2.772588722239781, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 4.160336650881089, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 4.859812404361672, 0.0, 0.0, 0.0, 5.493061443340549, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.4339872044851467, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 1.0986122886681098, 0, 0.0, 2.8398715690385097, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.93848385770662, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.6109179126442243, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 1.6094379124341003, 0.0, 1.791759469228055, 4.06534854782536, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 4.06534854782536, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 5.480638923341991, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.9318256327243257, 0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.2574953720277815, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 2.9957322735539913, 0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 9.656627474604601, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 7.3792124757492905, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0, 3.4825185607408002, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.6109179126442243, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.6375861597263857, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 2.4849066497880004, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.666426688112432, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 2.5649493574615367, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.662960480135945, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 9.887510598012987, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.437751649736401, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.553876891600541, 0.0, 0.0, 0, 4.3694478524670215, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.9459101490553132, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 16.025617661073383, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.390770307485499, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.665683717782408, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 7.299022054230198, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.631631038266565, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 4.182806904693497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.20455776256869, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.518263445217987, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 3.8005740880419454, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 4.553876891600541, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.215149976722676, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.649511027115099, 0, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 3.044522437723423, 1.0986122886681098, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.160336650881089, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.2237778411112, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 3.6375861597263857, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 7.16703787691222, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 25.273805172346215, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.899745575730817, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 10.781540614970998, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.969640753475787, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 1.6094379124341003, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.6635616461296467, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0, 1.3862943611198906, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.4339872044851467, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 9.406482647787449, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 2.995732273553991, 6.127701357652087, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 3.4965075614664802, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 1.3862943611198906, 5.442417710521793, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.4965075614664802, 5.723585101952381, 0, 0, 3.800574088041945, 0.0, 4.518263445217986, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.295836866004329, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.969813299576001, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 5.545177444479562, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 4.7535901911063645, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6635616461296467, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.0794415416798357, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.174387269895637, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.430816798843313, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.532599493153256, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 7.193685818395112, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 2.550898738446989, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 2.4849066497880004, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.952096120109145, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0, 4.406719247264253, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.2188758248682006, 1.6094379124341003, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.46286043483228, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 2.8398715690385097, 0.0, 0.0, 0.6931471805599453, 0.0, 1.3862943611198906, 5.101797476893978, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 3.58351893845611, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.912654885736052, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 3.6888794541139363, 0, 4.160336650881089, 3.044522437723423, 0.0, 0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 3.0841946160253877, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.718498871295094, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 2.1972245773362196, 0.0, 0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 4.969813299576001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 6.9558749307258045, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.93848385770662, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0, 0, 0.0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 2.550898738446989, 0, 0, 3.0841946160253877, 0.0, 0.0, 3.295836866004329, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 2.5649493574615367, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.367295829986474, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.160336650881089, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 5.780743515792329, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 6.907755278982138, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 4.2626798770413155, 0, 0, 0, 0, 0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 1.7412592803704001, 4.969640753475787, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 5.567740402508132, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 4.160336650881089, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 8.995948045406804, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.6390573296152584, 0.0, 0.0, 3.7369991058576035, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.970291913552122, 0, 3.7369991058576035, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.7535901911063645, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.423390507494619, 0.0, 0, 0, 0.0, 0, 4.160336650881089, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0, 3.6375861597263857, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 2.1972245773362196, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0, 3.044522437723423, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 2.772588722239781, 0.0, 3.713572066704308, 0.0, 0, 0, 5.03709614637473, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 3.7612001156935624, 0.0, 0.0, 2.772588722239781, 0, 3.2188758248682006, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030104765080701, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.238324625039507, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 2.5649493574615367, 3.8918202981106265, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 6.731743096669168, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.6635616461296467, 0, 0.0, 0, 2.9444389791664403, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.8903717578961645, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 4.890349128221754, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 2.1972245773362196, 0.0, 0, 0, 2.0794415416798357, 5.8888779583328805, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.8066078281957605, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 4.0943445622221, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4339872044851467, 0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.784189633918261, 0, 0.0, 7.454719949364001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.897839799950911, 0.0, 0, 0, 0.0, 0.0, 0, 0, 2.1972245773362196, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0, 0.0, 0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.550898738446989, 0, 0, 4.160336650881089, 1.3862943611198906, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 4.1588830833596715, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.9444389791664403, 0, 0, 0.0, 0.0, 0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.825453896395788, 0, 1.3862943611198906, 1.6094379124341003, 0, 1.6094379124341003, 6.778355426745129, 0, 0, 0.0, 0.0, 2.4849066497880004, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0, 3.2958368660043296, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.110873864173311, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.969813299576001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.105134969404935, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.917171988845775, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.281419193361606, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 6.168389232050775, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.254681213103192, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 16.400167309572016, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4825185607408002, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.178053830347946, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.9459101490553132, 0, 0.0, 11.29853313840085, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 6.200409765562088, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 8.873266907405862, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.1972245773362196, 6.351472826488934, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 4.828313737302301, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.46286043483228, 3.6375861597263857, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.367295829986474, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.044522437723423, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4965075614664802, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.007333185232471, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 6.4641735942733005, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.70805020110221, 0.0, 4.110873864173311, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.07753744390572, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.465908118654584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.6888794541139363, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.342334251964811, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.49053690687189, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.828641396489095, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.23410650459726, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.825453896395788, 0.0, 0, 0, 0.0, 0.0, 0, 0, 5.101797476893978, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2237778411112, 0, 0.0, 0.0, 0, 0.0, 0, 10.849972553336867, 0, 0.0, 0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 2.8903717578961645, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.520577332514767, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 3.6109179126442243, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 5.723585101952381, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.7430031878094825, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.276666119016055, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.280392111322715, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 6.9558749307258045, 0, 0.0, 0.0, 0.0, 8.791967689147654, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.367295829986474, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.115509720156162, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.367295829986474, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 7.652696215340966, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.2626798770413155, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.258096538021482, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.567740402508133, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.969813299576001, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.961361141082371, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.561728078908178, 0.0, 4.825453896395787, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.68697535633982, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 17.680622364027936, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.825453896395788, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.631631038266565, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.5553480614894135, 0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.736198448394496, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0.0, 0.0, 8.266085260861173, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 4.890349128221754, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4825185607408002, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.6888794541139363, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.060443010546419, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4965075614664802, 0.0, 0.0, 7.965635675306504, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0, 0.0, 0, 4.634728988229636, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 5.101797476893978, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 4.0943445622221, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 6.578517662373903, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4011973816621555, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 3.7369991058576035, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.769774563315189, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 12.912195279612511, 0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.942799375126702, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.709530201312334, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 2.8398715690385097, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 5.4680601411351315, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.160336650881089, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 4.406719247264253, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 4.477336814478207, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.927253685157205, 0.0, 3.58351893845611, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0, 0.0, 0, 0.0, 9.252583848076162, 0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 2.8398715690385097, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.462743943876961, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.069162183664976, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 3.8501476017100584, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 5.0689042022202315, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 10.92572086966456, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.2626798770413155, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 13.17304868542365, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.871201010907891, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.736198448394496, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 2.1972245773362196, 4.795790545596741, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 9.545153519762186, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 1.791759469228055, 0.0, 3.044522437723423, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 2.833213344056216, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.16396083649347, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 5.567740402508132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 1.6094379124341003, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.624972813284271, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0, 3.0841946160253872, 4.969640753475787, 3.0841946160253872, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.713572066704308, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.8918202981106265, 4.06534854782536, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 4.518263445217987, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 18.468344649580203, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 3.4011973816621555, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.871201010907891, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 4.356708826689592, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 6.2166061010848646, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.238324625039507, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.081404364984463, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.6931471805599453, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.70805020110221, 0.6931471805599453, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 6.437751649736401, 0.0, 0.0, 0.0, 2.0794415416798357, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 7.471502607305074, 0.0, 1.3862943611198906, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.330733340286331, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 1.791759469228055, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.545177444479562, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.6931471805599453, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 1.6094379124341003, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.518263445217986, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.0301047650807, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.9459101490553132, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 6.731743096669168, 0.0, 0.0, 0, 0.0, 0, 5.375278407684165, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.578517662373903, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 2.302585092994046, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 5.0301047650807, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 10.112432770990234, 0, 0.0, 0.0, 0.0, 9.840079788958109, 0.0, 0.0, 0.0, 0.0, 0.0, 7.408770583887592, 0.0, 0.0, 0.0, 10.137128175207733, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 9.840079788958109, 0.0, 0.0, 0.0, 0.0, 9.453194522336574, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 11.228574125921016, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.952096120109145, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 9.897636166013237, 0.0, 0.0, 0, 5.952096120109145, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.41610040220442, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.635093354472376, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.1298987149230735, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 6.127701357652087, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 7.917171988845775, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 7.408770583887592, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.6931471805599453, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0, 0, 0, 0, 0, 0, 1.6094379124341003, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.518263445217987, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 1.3862943611198906, 1.0986122886681098, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.567740402508133, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 1.3862943611198906, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 5.991464547107983, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 5.030437921392435, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 1.7412592803704001, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 5.346437018291705, 0.0, 0.0, 0.0, 1.6094379124341003, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0, 0, 0, 0, 0.0, 1.0986122886681098, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.6931471805599453, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.6931471805599453, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.6931471805599453, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.6931471805599453, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.6931471805599453, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 5.278114659230517, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.0986122886681098, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 6.182084906716631, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.969813299576001, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.825453896395787, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.028278520230698, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 8.266085260861173, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.8971538676367405, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.3978952727983707, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.465908118654584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.475339236566737, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 7.052721049232323, 0.0, 0.0, 0, 0, 3.93848385770662, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.3862943611198906, 0.0, 3.5553480614894135, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.828641396489095, 0.0, 4.74493212836325, 0.0, 0.0, 3.4011973816621555, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0.0, 0, 0.0, 11.851968999389458, 0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 1.9459101490553132, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.356708826689592, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 3.4011973816621555, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.908694592507015, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.828641396489095, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 18.568604526672758, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 13.031161839818749, 0.0, 0.0, 12.949565591960841, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.626454784082686, 0.0, 0.0, 0.0, 5.346437018291705, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.278114659230517, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 7.052721049232323, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 6.028278520230698, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 6.5998704992128365, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 2.1972245773362196, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 2.8398715690385097, 0.0, 3.649511027115099, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.969640753475787, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 6.925410995016817, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 6.984716320118266, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 7.694848072384611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 3.044522437723423, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2832037287379885, 0.0, 0.0, 4.518263445217986, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7376696182833684, 0, 0, 5.780743515792329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.2626798770413155, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 2.833213344056216, 3.8005740880419454, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.02535169073515, 0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.4849066497880004, 0, 0.0, 0.0, 3.784189633918261, 0.0, 2.772588722239781, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.613324979540639, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 6.102339570951937, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.6931471805599453, 0, 0.0, 4.182806904693496, 0.0, 0.0, 0, 3.5553480614894135, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.365976015021851, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.147494476813453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2237778411112, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.219507705176107, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.219507705176107, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 3.4011973816621555, 0, 3.3322045101752034, 0, 2.8903717578961645, 0, 0, 0.0, 0, 0.0, 3.2188758248682006, 0, 1.791759469228055, 0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.655991810819852, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.03709614637473, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.484135188312965, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.833213344056216, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 3.649511027115099, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 3.0841946160253872, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 4.518263445217986, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.795790545596741, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 3.0841946160253872, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.007333185232471, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.7369991058576035, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.365976015021851, 0.0, 1.0986122886681098, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 4.418840607796598, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.7412592803704001, 0, 3.5263605246161616, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0, 0.0, 0.0, 8.317766166719343, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 4.48863636973214, 0.0, 0.0, 3.6109179126442243, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 4.1588830833596715, 12.46359237448458, 0.0, 0.0, 0.0, 0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.846735604451319, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.06534854782536, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 4.672828834461906, 0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.649511027115099, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.518263445217986, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.6913478822291435, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.178053830347946, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.969640753475787, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.970291913552122, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.9459101490553132, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.8903717578961645, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 3.649511027115099, 0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 4.553876891600541, 0.0, 1.0986122886681098, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 3.8918202981106265, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 3.9384838577066197, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.330408475910399, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.679743138077019, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.3862943611198906, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.442417710521793, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.713572066704308, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4825185607408002, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 9.129638369467537, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.1588830833596715, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 4.04305126783455, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.0841946160253872, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 6.5667131767661875, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0, 0, 4.31748811353631, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 6.578517662373903, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.221747728346623, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 3.367295829986474, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.574710978503383, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.1588830833596715, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.7612001156935624, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4965075614664802, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.952096120109145, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.384291749700655, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.2237778411112, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.575949103146317, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.290459441148391, 0, 0.0, 0, 0.0, 0, 0.0, 2.0794415416798357, 0, 3.800574088041945, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.800574088041945, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 3.649511027115099, 2.995732273553991, 3.367295829986474, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 1.6094379124341003, 2.8903717578961645, 0, 0.0, 0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.800574088041945, 3.8005740880419454, 0, 0.0, 0.0, 3.2188758248682006, 0.0, 3.044522437723423, 4.605170185988092, 1.7412592803704001, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0, 0, 0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.1298987149230735, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 17.402456000857075, 4.8991863767100545, 3.0841946160253872, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 4.77912349311153, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.828641396489095, 0, 0.0, 0, 0.0, 0.0, 5.43372200355424, 0.0, 0, 0, 0, 5.390770307485499, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4965075614664802, 0.0, 2.1972245773362196, 0.0, 0.0, 4.06534854782536, 0.0, 0, 0, 2.1972245773362196, 0.0, 2.5649493574615367, 0, 4.969640753475787, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 7.177178314942233, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 3.258096538021482, 0, 0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 3.4011973816621555, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.0841946160253877, 2.70805020110221, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.123963979403259, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.5263605246161616, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 2.833213344056216, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0.0, 0.0, 0, 0.0, 4.1588830833596715, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 3.649511027115099, 4.762173934797756, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 9.620060922111964, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.248495242049359, 0, 0, 0, 2.1972245773362196, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6109179126442243, 7.69484807238461, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 3.0841946160253872, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 4.825453896395788, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 2.5649493574615367, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 3.4825185607408002, 5.0301047650807, 0.0, 5.346437018291705, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 4.343805421853684, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 4.248495242049359, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 2.1972245773362196, 0.0, 4.143134726391533, 0, 0, 0.0, 5.679743138077019, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.03709614637473, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 3.258096538021482, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.23410650459726, 0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 3.8066624897703196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.418840607796598, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0, 0.0, 0.0, 0, 0.0, 0, 4.343805421853684, 4.605170185988092, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.220355825078324, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.970291913552122, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.518263445217987, 4.941642422609304, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 3.931825632724326, 8.921925063191328, 12.820490352323048, 0, 0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.518263445217986, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 3.1354942159291497, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.976014914136014, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 4.584967478670572, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 11.292366238736987, 5.723585101952381, 0.0, 5.346437018291705, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.310508262345584, 7.602458061243374, 1.6094379124341003, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 3.4965075614664802, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0, 3.4825185607408002, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 4.59511985013459, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 5.375278407684164, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 4.795790545596741, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.58351893845611, 0, 0, 4.394449154672439, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 1.791759469228055, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.290459441148391, 0.0, 0, 0, 0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.772588722239781, 0.0, 0.0, 6.955874930725805, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.2188758248682006, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 5.76977456331519, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.769774563315189, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.160336650881089, 0, 0.0, 0, 0, 0, 0.0, 4.825453896395787, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.174387269895637, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0, 1.3862943611198906, 0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 4.189654742026425, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.631631038266565, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.258096538021482, 0.0, 0.0, 4.189654742026425, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.545177444479562, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0, 0.0, 2.0794415416798357, 4.852030263919617, 0, 0, 0, 0.0, 0.0, 3.0841946160253872, 0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.991464547107983, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.6109179126442243, 1.6094379124341003, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.248495242049359, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0, 0.0, 1.791759469228055, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 3.4657359027997265, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9120230054281455, 5.46286043483228, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.969813299576001, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.198469360840315, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 9.036526890435972, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 10.645964802870076, 0, 3.0910424533583156, 0, 4.394449154672439, 0, 0.0, 5.16396083649347, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.983606621708336, 5.723585101952381, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 6.731743096669168, 0.0, 0.0, 0.0, 4.248495242049359, 2.302585092994046, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.484135188312967, 0.0, 0.0, 4.581130849408909, 0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0.0, 7.3777589082278725, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 4.828313737302301, 0.0, 0, 3.8918202981106265, 0, 0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.6913478822291435, 0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.70805020110221, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0, 0.0, 0, 0.0, 4.748123315783209, 0.0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 5.375278407684164, 0.0, 0, 0.0, 0.0, 0.0, 3.649511027115099, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.9512437185814275, 0.0, 0, 3.178053830347946, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0, 5.262690188904886, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.8903717578961645, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 4.182806904693496, 0.0, 0.0, 5.541833368412345, 0, 0.0, 0.0, 0.0, 4.0943445622221, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 7.652696215340967, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0, 0, 2.302585092994046, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 1.9459101490553132, 0, 0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 4.394449154672439, 0.0, 0.0, 0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0, 4.160336650881089, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 18.10738653744207, 0.0, 0.0, 0.0, 0.0, 15.33168766477724, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 7.783640596221253, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.49964003216865, 5.723585101952381, 16.710753060660316, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.429345628954441, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.1298987149230735, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.515580919909374, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 5.95562797505323, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.631631038266565, 0, 3.1354942159291497, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.390770307485499, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 3.0910424533583156, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 6.976014914136014, 0.0, 0, 0.0, 0.0, 0.0, 4.394449154672439, 3.7369991058576035, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 10.06087584278487, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.812184355372417, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.2237778411112, 0.0, 5.76977456331519, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.8991863767100545, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0, 3.3322045101752034, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 2.6390573296152584, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.770684624465665, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 10.163621819966615, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.203592144986466, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.26326207653313, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.160336650881089, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.833213344056216, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.828313737302301, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 7.97305546761269, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0, 4.748123315783209, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.532599493153256, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.825453896395787, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 3.800574088041945, 0.0, 0.0, 0.0, 1.3862943611198906, 1.791759469228055, 0.0, 0, 0.0, 3.044522437723423, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 6.976014914136014, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.238324625039507, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.346437018291705, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.8858724694518925, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 0, 0.0, 2.6390573296152584, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 4.8991863767100545, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 4.292158018817389, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.2958368660043296, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.017279836814924, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 9.129416400820892, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 3.0841946160253877, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.9318256327243257, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.634728988229636, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.332718793265369, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 13.426106100346976, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.04305126783455, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9318256327243257, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 5.58914919554, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.0986122886681098, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 5.723585101952381, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9889840465642745, 0, 2.833213344056216, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 4.518263445217986, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 4.1588830833596715, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.4011973816621555, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.7369991058576035, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.351472826488934, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 4.624972813284271, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4965075614664802, 0, 0.0, 0.0, 0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.178053830347946, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 2.1972245773362196, 0.0, 5.030437921392435, 0.0, 6.836775589408022, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 3.8918202981106265, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.0794415416798357, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.581130849408909, 4.969640753475787, 0.0, 5.723585101952381, 1.3862943611198906, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 4.06534854782536, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 1.0986122886681098, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.83331693749932, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.7376696182833684, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 2.772588722239781, 0.0, 0.0, 7.358193752733032, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.567740402508133, 0.0, 0.0, 5.030104765080701, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.631631038266565, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 2.550898738446989, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.160336650881089, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 5.545177444479562, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.356107660695892, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.3862943611198906, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 3.7369991058576035, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.645446897643238, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 5.0301047650807, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.4825185607408002, 0, 3.970291913552122, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 4.182806904693497, 3.58351893845611, 0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.833213344056216, 0, 0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.101797476893978, 0, 5.375278407684164, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.871201010907891, 0, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 3.713572066704308, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.4011973816621555, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.0841946160253877, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 2.9444389791664403, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 2.302585092994046, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0, 3.6375861597263857, 0, 0, 0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 4.8991863767100545, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.93848385770662, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0.0, 2.8903717578961645, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.9318256327243257, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.3694478524670215, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.61512051684126, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 3.828641396489095, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.423390507494619, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.281419193361606, 0.0, 6.802394763324311, 0.0, 0.0, 5.375278407684165, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.9459101490553132, 1.791759469228055, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 2.833213344056216, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0, 0.0, 5.8066078281957605, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.545177444479562, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 3.4825185607408002, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 5.101797476893978, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 3.800574088041945, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 4.442651256490317, 0, 0.0, 2.302585092994046, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 7.275172319452771, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.952096120109145, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.343805421853684, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.828641396489095, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4339872044851467, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 3.178053830347946, 0, 0, 0.0, 0, 0.0, 4.0943445622221, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.1354942159291497, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.330733340286331, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.375278407684165, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.605802066295998, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 8.114299381106088, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.581130849408909, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2958368660043296, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.292158018817389, 3.9318256327243257, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.204692619390966, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.044522437723423, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.178053830347946, 0, 0.0, 0.0, 0.0, 5.375278407684165, 0.0, 0.0, 0.0, 0.0, 0, 2.4849066497880004, 0.0, 0.0, 4.110873864173311, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 1.0986122886681098, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.969813299576001, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 5.278114659230517, 0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 9.825309771472105, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0, 0, 0, 0.0, 0, 3.0841946160253877, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.9120230054281455, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.6109179126442243, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 8.791967689147654, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.833213344056216, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.941642422609304, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.7412592803704001, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 7.052721049232323, 0.0, 2.302585092994046, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 5.58914919554, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0, 0.0, 0.0, 3.4825185607408002, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9318256327243257, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.995948045406804, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.6888794541139363, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 1.791759469228055, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 2.550898738446989, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 3.7369991058576035, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 5.679743138077019, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 5.952096120109145, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.783640596221253, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.499809670330265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 6.6052979209482015, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 5.952096120109145, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.367295829986474, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 5.375278407684164, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 0, 3.295836866004329, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.581130849408909, 0.0, 0, 0.0, 2.995732273553991, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.0841946160253872, 0.0, 2.4849066497880004, 0.0, 0.0, 5.375278407684164, 0.0, 0.0, 0.0, 5.8377304471659395, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.518263445217986, 0.0, 3.295836866004329, 2.9444389791664403, 0.0, 0.0, 0.0, 5.030104765080701, 0, 0, 0.0, 0.0, 2.5649493574615367, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 4.330733340286331, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0, 2.4849066497880004, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 4.330733340286331, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 5.952096120109145, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8903717578961645, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.8289456176102075, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 0.0, 2.302585092994046, 2.772588722239781, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.672828834461906, 0, 0.0, 0.0, 3.649511027115099, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.110873864173311, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0.0, 0, 2.70805020110221, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.302585092994046, 1.9459101490553132, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.044522437723423, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030104765080701, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.6443908991413725, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 12.444372333547394, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 2.6390573296152584, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.812184355372417, 0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 1.6094379124341003, 2.70805020110221, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.90527477843843, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 1.7412592803704001, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.969640753475787, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.8888779583328805, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.9444389791664403, 0.0, 0.0, 0, 0, 0.0, 0.0, 6.864049944976711, 0, 0.0, 2.3978952727983707, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.631631038266565, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8903717578961645, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.6931471805599453, 3.7369991058576035, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.9930151229329605, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0, 2.8398715690385097, 0, 0.0, 4.518263445217987, 0.0, 0, 4.748123315783209, 4.292158018817389, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 7.149543163850748, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 4.66682536764049, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 7.27447955877387, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.4825185607408002, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 9.722561256775933, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 0, 0.0, 0, 0, 1.0986122886681098, 4.795790545596741, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.175867270105761, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.772588722239781, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.112432770990234, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 1.7412592803704001, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 2.1972245773362196, 0.0, 2.833213344056216, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 2.772588722239781, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.718498871295094, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.98107381374378, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.784189633918261, 0, 0.0, 0.0, 0.0, 0, 0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.382026634673881, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 4.418840607796598, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.784189633918261, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 5.723585101952381, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.784189633918261, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 3.044522437723423, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 4.394449154672439, 0.0, 4.518263445217987, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.10594547390058, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.059123195581797, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.178053830347946, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.5263605246161616, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.976733742420574, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.93848385770662, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9120230054281455, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.044522437723423, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0]
5,999
5b8322761975ebec76d1dccd0290c0fb1da404e5
# ๋ฌธ์ œ ์„ค๋ช… # ๊ธธ์ด๊ฐ€ ๊ฐ™์€ ๋‘ 1์ฐจ์› ์ •์ˆ˜ ๋ฐฐ์—ด a, b๊ฐ€ ๋งค๊ฐœ๋ณ€์ˆ˜๋กœ ์ฃผ์–ด์ง‘๋‹ˆ๋‹ค. a์™€ b์˜ ๋‚ด์ ์„ return ํ•˜๋„๋ก solution ํ•จ์ˆ˜๋ฅผ ์™„์„ฑํ•ด์ฃผ์„ธ์š”. # ์ด๋•Œ, a์™€ b์˜ ๋‚ด์ ์€ a[0]*b[0] + a[1]*b[1] + ... + a[n-1]*b[n-1] ์ž…๋‹ˆ๋‹ค. (n์€ a, b์˜ ๊ธธ์ด) # ์ œํ•œ์‚ฌํ•ญ # a, b์˜ ๊ธธ์ด๋Š” 1 ์ด์ƒ 1,000 ์ดํ•˜์ž…๋‹ˆ๋‹ค. # a, b์˜ ๋ชจ๋“  ์ˆ˜๋Š” -1,000 ์ด์ƒ 1,000 ์ดํ•˜์ž…๋‹ˆ๋‹ค. # ์ž…์ถœ๋ ฅ ์˜ˆ # a b result # [1,2,3,4] [-3,-1,0,2] 3 # [-1,0,1] [1,0,-1] -2 # ์ž…์ถœ๋ ฅ ์˜ˆ ์„ค๋ช… # ์ž…์ถœ๋ ฅ ์˜ˆ #1 # a์™€ b์˜ ๋‚ด์ ์€ 1*(-3) + 2*(-1) + 3*0 + 4*2 = 3 ์ž…๋‹ˆ๋‹ค. # ์ž…์ถœ๋ ฅ ์˜ˆ #2 # a์™€ b์˜ ๋‚ด์ ์€ (-1)*1 + 0*0 + 1*(-1) = -2 ์ž…๋‹ˆ๋‹ค. def solution(a, b): answer = 0 for i in range(len(a)): answer += a[i] * b[i] return answer # ๋ฆฌ์ŠคํŠธ ์ปจํ”„๋ฆฌํ—จ์…˜ ์‚ฌ์šฉ def solution2(a, b): answer = [a[i] * b[i] for i in range(len(a))] return sum(answer) # ๋žŒ๋‹ค ์‚ฌ์šฉ def solution3(a, b): return sum(map(lambda x,y: x * y , a, b)) # zip ์‚ฌ์šฉ def solution4(a, b): answer = 0 for i,j in zip(a,b): answer += i * j return answer # zip + ๋ฆฌ์ŠคํŠธ ์ปจํ”„๋ฆฌํ—จ์…˜ ์‚ฌ์šฉ def solution5(a, b): answer = sum([i * j for i,j in zip(a,b)]) return answer