index int64 0 1,000k | blob_id stringlengths 40 40 | code stringlengths 7 10.4M |
|---|---|---|
5,900 | 33b6a4c76079ed698809b29772abb59a34831472 | from django.db import models
from django.utils import timezone
from django.contrib.auth.models import User, Group
# Create your models here.
def default_expiration():
return timezone.now() + timezone.timedelta(days=10)
class Category(models.Model):
name = models.CharField(max_length=200)
description = models.TextField()
def __str__(self):
return self.name
class Survey(models.Model):
name = models.CharField(max_length=200)
description = models.TextField()
category = models.ForeignKey(Category, blank=True, null=True, on_delete=models.CASCADE)
users = models.ManyToManyField(User, through='SurveyToUser')
groups = models.ManyToManyField(Group, through='SurveyToGroup')
pub_date = models.DateTimeField(default=timezone.now)
exp_date = models.DateTimeField(default=default_expiration)
period = models.DurationField(default=None, null=True, blank=True)
@property
def get_questions(self):
return self.question_set.all()
def __str__(self):
return f'{self.name}: {self.description}'
class Question(models.Model):
TEXT = 'text'
NUMBER = 'number'
SELECT = 'select'
SELECT_MULTIPLE = 'select-multiple'
RADIO = 'radio'
CHECKBOX = 'checkbox'
SURVEY_QUESTION_TYPES_CHOICES = [
(TEXT, 'text'),
(NUMBER, 'number'),
(SELECT, 'select'),
(SELECT_MULTIPLE, 'select-multiple'),
(RADIO, 'radio'),
(CHECKBOX, 'checkbox'),
]
text = models.TextField()
required = models.BooleanField(default=True)
survey = models.ForeignKey(Survey, blank=False, null=False, on_delete=models.CASCADE)
question_type = models.CharField(
max_length=50,
choices=SURVEY_QUESTION_TYPES_CHOICES,
default=TEXT,
)
choices = models.TextField(blank=True, null=True)
other = models.TextField(blank=True, null=True)
def __str__(self):
return f'Question: {self.text} of survey {self.survey.name}'
class Answer(models.Model):
text = models.TextField(blank=True)
question = models.ForeignKey(Question, blank=False, null=False, on_delete=models.CASCADE)
user = models.ForeignKey(User, blank=False, null=False, on_delete=models.CASCADE)
def __str__(self):
return f'Answer: {self.text} to the Question {self.question.text} ' \
f'given by User: {self.user.username} for survey {self.question.survey.name}'
class SurveyToUser(models.Model):
user = models.ForeignKey(User, blank=True, null=True, on_delete=models.CASCADE)
survey = models.ForeignKey(Survey, blank=False, null=False, on_delete=models.CASCADE, related_name='user_survey')
completed = models.BooleanField(default=False, null=False)
completion_date = models.DateTimeField(default=None, null=True, blank=True)
class SurveyToGroup(models.Model):
group = models.ForeignKey(Group, blank=True, null=True, on_delete=models.CASCADE)
survey = models.ForeignKey(Survey, blank=False, null=False, on_delete=models.CASCADE)
completed = models.BooleanField(default=False, null=False)
completion_date = models.DateTimeField(default=None, null=True, blank=True)
class StarRating(models.Model):
text = models.TextField(blank=True, null=False, default=None)
user = models.ForeignKey(User, blank=False, null=False, on_delete=models.CASCADE)
completed = models.DateTimeField(blank=True, null=True, default=None)
|
5,901 | 3fdb29797894737edae37ad7890e14cb9ce705e8 | import pygame
naytto = pygame.display.set_mode((740, 500))
pygame.display.set_caption("Piirtรคminen")
x = 100
y = 300
def main():
while True:
tapahtuma = pygame.event.poll()
if tapahtuma.type == pygame.QUIT:
break
naytto.fill((0, 0, 0))
pygame.draw.line(naytto, (0, 0, 255), (0, 0), (640, 400))
pygame.draw.line(naytto, (0, 255, 0), (640, 0), (0, 400))
pygame.draw.rect(naytto, (255, 0, 0), (100, 50, 150, 200))
pygame.draw.circle(naytto, (255, 255, 0), (350, 150), 40)
kuva = pygame.image.load("mycat.png").convert()
naytto.blit(kuva, (x, y))
pygame.display.flip()
main() |
5,902 | 42021b762737a2eb21866ba029ece4ac120152cd | class Solution(object):
def countSmaller(self, nums):
"""
:type nums: List[int]
:rtype: List[int]
naive -- o(n^2)
"""
## StefanPochmann solution #2
def countSmaller(self, nums):
def sort(enum):
half = len(enum) / 2
if half:
left = sort(enum[:half])
right = sort(enum[half:])
for i in range(len(enum))[::-1]:
if not right or left and left[-1][1] > right[-1][1]:
smaller[left[-1][0]] += len(right)
enum[i] = left.pop()
else:
enum[i] = right.pop()
return enum
smaller = [0] * len(nums)
sort(list(enumerate(nums)))
return smaller
## StefanPochmann solution #1
def countSmaller(self, nums):
def sort(enum):
half = len(enum) / 2
if half:
left, right = sort(enum[:half]), sort(enum[half:])
m, n = len(left), len(right)
i = j = 0
while i < m or j < n:
if j == n or i < m and left[i][1] <= right[j][1]:
enum[i+j] = left[i]
smaller[left[i][0]] += j
i += 1
else:
enum[i+j] = right[j]
j += 1
return enum
smaller = [0] * len(nums)
sort(list(enumerate(nums)))
return smaller
"""
a = [2,4,6]
b = [1,3,5]
"""
def mergesort(x):
if len(x)==0:
return x, []
if len(x)==1:
return x, [0]
mid = len(x)/2
a, A = mergesort(x[:mid])
b, B = mergesort(x[mid:])
y, Y = merge(a, b, A, B)
return y,Y
def merge(a, b):
res = []
i,j = 0,0
while i < len(a) and j < len(b):
if a[i] <= b[j]:
res.append(a[i])
i += 1
else:
res.append(b[j])
###
j += 1
if i < len(a):
res += a[i:]
elif j < len(b):
res += b[j:]
return res
merge([2,4,6], [1,3,5], [0,0,0], [0,0,0])
mergesort([5, 2, 6, 1])
"""
base merge sort:
"""
def mergesort(x):
if len(x)==0 or len(x)==1:
return x
else:
mid = len(x)/2
a = mergesort(x[:mid])
b = mergesort(x[mid:])
return merge(a,b)
def merge(a,b, left, right): # left, right will keep track of inversions so far
res = []
while len(a)>0 and len(b)>0:
if a[0] < b[0]:
res += [a[0]]
a = a[1:]
else:
res += [b[0]]
b = b[1:]
if len(a) > 0:
res += a
if len(b) > 0:
res += b
return res
|
5,903 | ff924b803a875d3f6201baa2c1251a6c5b8cde61 | from django.http import request
from restapp.ExcelSheet import *
'''ApiHomeDict={}
class LoadDict():
e = ExcelSheetAll()
ApiHomeDict = e.apiHomeDict()
print ApiHomeDict
class ReturnApi:
def returnDict(self):
return ApiHomeDict'''
'''if "ApiDictionary" in request.session:
print 'Dictioanry is already stored in session'
else:
e=ExcelSheetAll()
ApiHomeDict=e.apiHomeDict()
request.session['ApiDictionary'] = ApiHomeDict
#print ApiHomeDict
print request.session['ApiDictionary']'''
|
5,904 | 9247896850e5282265cd08240f6f505e675ce5f0 | n = int(input())
num = list(map(int, input().split()))
plus_cnt = 0
div_max = 0
for i in num:
div = 0
while i > 0:
if i % 2 == 0:
i //= 2
div += 1
else:
i -= 1
plus_cnt += 1
div_max = max(div_max, div)
print(plus_cnt + div_max) |
5,905 | aff439361716c35e5f492680a55e7470b4ee0c42 | from numpy import empty
import pickle
from dataset import Dataset
from image import Image
f = open("./digitdata/trainingimages", "r")
reader = f.readlines()
labels = open("./digitdata/traininglabels", "r")
lreader = labels.readlines()
trainImageList = []
j = 0
i = 0
while(j < len(reader)):
image_array = empty([28, 28])
for r in range(0, 28):
row = reader[j]
j += 1
for c in range(0, 28):
if row[c] == '#' or row[c] == '+':
image_array[r][c] = 1
else:
image_array[r][c] = 0
label = lreader[i]
i += 1
image = Image(image_array, label)
trainImageList.append(image)
f = open("./digitdata/testimages", "r")
reader = f.readlines()
labels = open("./digitdata/testlabels", "r")
lreader = labels.readlines()
testImageList = []
j = 0
i = 0
while(j < len(reader)):
image_array = empty([28, 28])
for r in range(0, 28):
row = reader[j]
j += 1
for c in range(0, 28):
if row[c] == '#' or row[c] == '+':
image_array[r][c] = 1
else:
image_array[r][c] = 0
label = lreader[i]
i += 1
image = Image(image_array, label)
testImageList.append(image)
f = open("./digitdata/validationimages", "r")
reader = f.readlines()
labels = open("./digitdata/validationlabels", "r")
lreader = labels.readlines()
valImageList = []
j = 0
i = 0
while(j < len(reader)):
image_array = empty([28, 28])
for r in range(0, 28):
row = reader[j]
j += 1
for c in range(0, 28):
if row[c] == '#' or row[c] == '+':
image_array[r][c] = 1
else:
image_array[r][c] = 0
label = lreader[i]
i += 1
image = Image(image_array, label)
valImageList.append(image)
dataset = Dataset(trainImageList, testImageList, valImageList)
output_file = open('digits_dataset', 'wb')
pickle.dump(dataset, output_file)
|
5,906 | b4b80e40d12486881e37dd7ddeeef9c76417ebd9 | def add(a, b):
print "ADDING %d + %d" % (a, b)
return a + b
def subtract(a, b):
print "SUBTRACTING %d - %d" %(a, b)
return a - b
def multipy(a, b):
print "MULTIPLYING %d * %d" % (a, b)
return a * b
def divide(a, b):
print "DIVIDING %d / %d" % (a, b)
return a / b
print "Let's do some math with just functions!"
age = add(30, 5)
height = subtract(78, 4)
weight = multipy(90, 2)
iq = divide(100, 2)
print "Age: %d, Height: %d, Weight: %d, IQ: %d" %(age, height, weight, iq)
# A puzzle for the extra credit, type in anyway.
print "Here is a puzzle."
what = add(age, subtract(height, multipy(weight, divide(iq, 2))))
print "That becomes: ", what, "Can you do it by hand?"
print "Sure, let me show you!"
solution = ((30 + 5)+((78 - 4)-((90 * 2) * ((100 / 2) / 2))))
print "See how smart I am, look at this", solution, "!"
print "Now I break the formula by deleteing all ():"
solution2 = 30 + 5 + 78 - 4 - 90 * 2 * 100 / 2 / 2
print solution, "is the same as", solution2, ". Because python knows math rules."
solution3 = 30 * 2 + 5 * 100 + 78 / 2 - 4 / 2 - 90
print solution3, "is different, because I changed the order of the terms."
print "Now I will make my own formula into a function."
solution4 = 24.0 + 34.0 / 100.0 - 1023.0
term1 = divide(34.0, 100.0)
term2 = add(24.0, term1)
term3 = subtract(term2, 1023.0)
print term3, "and", solution4
# Mistakes I make:
# Typos
# forgot quotes
# forgot formatter %
# forgot \n
# things to remember:
# go back to study drills of ex 10
|
5,907 | 7f9046582ff03d1c72d191a8f78c911cbc8a0650 | #!/usr/bin/env python
"""
Power calculation based for admixture mapping.
@ref: Design and Analysis of admixture mapping studies, (2004).
@Author: wavefancy@gmail.com
Usage:
PowerCalculation.py -r aratio -n nhap
PowerCalculation.py -h | --help | -v | --version | -f | --format
Notes:
1. Read parameters from stdin, and output to stdout.
Options:
-r aratio Ancestry risk ratio. aratio = f2/f0 for multiplicative model.
-n nhap Number of haplotypes, n = 2*N, N for sample size.
-h --help Show this screen.
-v --version Show version.
-f --format Show input/output file format example.
"""
import sys
from docopt import docopt
from signal import signal, SIGPIPE, SIG_DFL
def ShowFormat():
'''File format example'''
print('''
#rfmix output, 3 person, 2 snps
------------------------
1 1 2 1 2 2
1 2 2 1 2 2
#id average:
------------------------
0.8
0.5
0.1
#output:
------------------------
0.40 0.00 -0.20
-0.60 0.00 -0.20
''');
if __name__ == '__main__':
args = docopt(__doc__, version='1.0')
# print(args)
# sys.exit(0)
if(args['--format']):
ShowFormat()
sys.exit(-1)
idav = [] # 2*ID_average
with open(args['-a'],'r') as ifile:
for line in ifile:
line = line.strip()
if line:
idav.append(2 * float(line))
checkLen = True
for line in sys.stdin:
line = line.strip()
if line:
ss = line.split()
ss = [2-int(x) for x in ss] #number of pop1 copy for each haplotype.
obs = []
for i in range(0, len(ss), 2):
obs.append(ss[i] + ss[i+1])
if checkLen:
if len(obs) != len(idav):
sys.stderr.write('Error: numbr of individuals in ID_average file is not the same as that in sys.stdin.\n')
sys.exit(-1)
else:
checkLen = False
out = [ '%.2f'%(y-x) for x,y in zip(idav, obs)]
sys.stdout.write('%s\n'%('\t'.join(out)))
sys.stdout.flush()
sys.stdout.close()
sys.stderr.flush()
sys.stderr.close()
|
5,908 | a6c45ab3df0a692cd625d8203e1152e942a4cd6c | # DISCLAIMER
# The "Math" code was taken from http://depado.markdownblog.com/2015-09-29-mistune-parser-syntax-highlighter-mathjax-support-and-centered-images
# The HighlightRenderer code was taken from https://github.com/rupeshk/MarkdownHighlighter
# MarkdownHighlighter is a simple syntax highlighter for Markdown syntax.
# The initial code for MarkdownHighlighter was taken from niwmarkdowneditor by John Schember
# Copyright 2009 John Schember, Copyright 2012 Rupesh Kumar
# This program is free software; you can redistribute it and/or modify
# it under the terms of the GNU General Public License as published by
# the Free Software Foundation; either version 2 of the License, or
# (at your option) any later version.
# This program is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU General Public License for more details.
# You should have received a copy of the GNU General Public License
# along with this program; if not, write to the Free Software
# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston,
# MA 02110-1301, USA.
import re
import mistune
import pygments
from pygments.lexers import get_lexer_by_name
from pygments.formatters import html
class HighlightRenderer(mistune.Renderer):
def block_code(self, code, lang):
if not lang:
return '\n<pre><code>%s</code></pre>\n' % \
mistune.escape(code)
try:
lexer = get_lexer_by_name(lang, stripall=True)
except pygments.util.ClassNotFound:
return '\n<pre><code>%s</code></pre>\n' % \
mistune.escape(code)
formatter = html.HtmlFormatter()
return pygments.highlight(code, lexer, formatter)
# Pass math through unaltered - mathjax does the rendering in the browser
def block_math(self, text):
return '$$%s$$' % text
def latex_environment(self, name, text):
return r'\begin{%s}%s\end{%s}' % (name, text, name)
def inline_math(self, text):
return '$%s$' % text
class MathBlockGrammar(mistune.BlockGrammar):
block_math = re.compile(r"^\$\$(.*?)\$\$", re.DOTALL)
latex_environment = re.compile(
r"^\\begin\{([a-z]*\*?)\}(.*?)\\end\{\1\}", re.DOTALL)
class MathBlockLexer(mistune.BlockLexer):
default_rules = [
'block_math', 'latex_environment'] + mistune.BlockLexer.default_rules
def __init__(self, rules=None, **kwargs):
if rules is None:
rules = MathBlockGrammar()
super(MathBlockLexer, self).__init__(rules, **kwargs)
def parse_block_math(self, m):
"""Parse a $$math$$ block"""
self.tokens.append({
'type': 'block_math',
'text': m.group(1)
})
def parse_latex_environment(self, m):
self.tokens.append({
'type': 'latex_environment',
'name': m.group(1),
'text': m.group(2)
})
class MathInlineGrammar(mistune.InlineGrammar):
math = re.compile(r"^\$(.+?)\$", re.DOTALL)
block_math = re.compile(r"^\$\$(.+?)\$\$", re.DOTALL)
text = re.compile(r'^[\s\S]+?(?=[\\<!\[_*`~$]|https?://| {2,}\n|$)')
class MathInlineLexer(mistune.InlineLexer):
default_rules = ['block_math', 'math'] + mistune.InlineLexer.default_rules
def __init__(self, renderer, rules=None, **kwargs):
if rules is None:
rules = MathInlineGrammar()
super(MathInlineLexer, self).__init__(renderer, rules, **kwargs)
def output_math(self, m):
return self.renderer.inline_math(m.group(1))
def output_block_math(self, m):
return self.renderer.block_math(m.group(1))
class MarkdownWithMath(mistune.Markdown):
def __init__(self, renderer, **kwargs):
if 'inline' not in kwargs:
kwargs['inline'] = MathInlineLexer
if 'block' not in kwargs:
kwargs['block'] = MathBlockLexer
super(MarkdownWithMath, self).__init__(renderer, **kwargs)
def output_block_math(self):
return self.renderer.block_math(self.token['text'])
def output_latex_environment(self):
return self.renderer.latex_environment(self.token['name'],
self.token['text'])
|
5,909 | 603a73a7cc0487fcabb527ebc21d44cb95817ecb |
def checkRaiz():
a = int(input("Informe o primeiro coeficiente: "))
b = int(input("Informe o segundo coeficiente: "))
c = int(input("Informe o terceiro coeficiente: "))
delta = (b*b) - (4*a*c)
if (delta < 0):
print("Nรฃo tem raiz real")
elif (delta == 0):
print("Existe uma raiz real")
else:
print("Existem duas raizes reais")
checkRaiz() |
5,910 | 0dc556336cee9e5f41c036c6fcf6da950216693c | from twindb_backup.copy.binlog_copy import BinlogCopy
from twindb_backup.status.binlog_status import BinlogStatus
def test_get_latest_backup(raw_binlog_status):
instance = BinlogStatus(raw_binlog_status)
assert instance.get_latest_backup() == BinlogCopy(
host='master1',
name='mysqlbin005.bin',
created_at=100504
)
|
5,911 | 9dd5db441044c808274493f16a912d1b65a6c28b | print("Leer 10 nรบmeros enteros, almacenarlos en un vector y determinar en quรฉ posiciones se encuentran los nรบmeros con mas de 3 dรญgitos")
count=1
lista=[]
while count<11:
numero=int(input('Introduzca su %d numero:' %(count)))
lista.append(numero)
count=count+1
listanueva=[]
s= ','
for element in lista:
if element > 999 or element<-999:
listanueva.append(lista.index(element))
posiciones= ','.join(str (x) for x in listanueva)
print("Los numeros con mas de tres digitos se encuentran en las posiciones",posiciones)
input() |
5,912 | 1cba7889370cc7de47bb5cd1eaeadfece056e68a | #Problem available at: https://www.hackerrank.com/challenges/weather-observation-station-6/problem
SELECT DISTINCT CITY from STATION where substr(CITY,1,1) in ('a','e','i','o','u'); |
5,913 | 731110b02c8a09dc84042a99c14eef990ae33cd2 | """
Have the function CharlietheDog(strArr) read the array of strings stored in strArr which
will be a 4x4 matrix of the characters 'C', 'H', 'F', 'O', where C represents Charlie the dog,
H represents its home, F represents dog food, and O represents and empty space in the grid.
Your goal is to figure out the least amount of moves required to get Charlie to grab each piece of food in the grid by moving
up, down, left, or right, and then make it home right after.
Charlie cannot move onto the home before all pieces of food have been collected.
For example: if strArr is ["FOOF", "OCOO", "OOOH", "FOOO"], then this looks like the following grid:
F O O F
O C O O
O O O H
F O O O
For the input above, the least amount of steps where the dog can reach each piece of food,
and then return home is 11 steps, so your program should return the number 11.
The grid will always contain between 1 and 8 pieces of food.
Use the Parameter Testing feature in the box below to test your code with different arguments.
"""
from itertools import permutations
def CharlietheDog(strArr):
def walk(food_home, dog, matriz, steps=0):
food_home_dx = food_home[0][0] - dog[0]
food_home_dy = food_home[0][1] - dog[1]
walk_x = food_home_dx/(abs(food_home_dx) if food_home_dx != 0 else 1)
walk_y = food_home_dy/(abs(food_home_dy) if food_home_dy != 0 else 1)
steps += abs(walk_x) + abs(walk_y)
dog = (dog[0] + walk_x, dog[1] + walk_y)
if food_home[0] == dog:
food_home = food_home[1:]
food_home_size = len(food_home)
if food_home_size <= 0:
return steps
return walk(food_home, dog, matriz, steps)
food = []
home = None
dog = None
for i in range(len(strArr)):
for j in range(len(strArr[i])):
if strArr[i][j] == 'F':
food.append((i, j))
if strArr[i][j] == 'H':
home = (i, j)
if strArr[i][j] == 'C':
dog = (i, j)
foods = permutations(food)
min_steps = None
for food in foods:
food_home = food + (home, )
steps = walk(food_home, dog, strArr)
if min_steps == None or steps < min_steps:
min_steps = steps
return int(min_steps)
# keep this function call here
print (CharlietheDog(raw_input()))
|
5,914 | 9feb24da78113310509664fa9efcf5f399be5335 | # Import smtplib for the actual sending function
import smtplib
# Import the email modules we'll need
from email.message import EmailMessage
# Open the plain text file whose name is in textfile for reading.
with open("testfile.txt") as fp:
# Create a text/plain message
msg = EmailMessage()
msg.set_content("test")
me = "njordan@kohanakai.com"
you = ['john.pelletier@ymail.com', 'jdp2766@gmail.com']
msg['Subject'] = 'The tester email'
msg['From'] = me
msg['To'] = you
# Send the message via our own SMTP server.
s = smtplib.SMTP('smtp-relay.gmail.com', 25)
s.send_message(msg)
s.quit()
|
5,915 | dcb57ecf2c72b8ac816bb06986d80544ff97c669 | from http import HTTPStatus
from ninja import Router
mock_post_router = Router()
@mock_post_router.get(
"/mock_posts",
url_name="mock_post_list",
summary="์ ์ฒด mock post์ list๋ฅผ ๋ฐํํ๋ค",
response={200: None},
)
def retrieve_all_mock_posts(request):
return HTTPStatus.OK
|
5,916 | d30e5e24dd06a4846fdde3c9fcac0a5dac55ad0d | import sys
import os
from django.conf import settings
BASE_DIR=os.path.dirname(__file__)
settings.configure(
DEBUG=True,
SECRET_KEY='ki==706e99f0ps9w5s*!kx%1^=5jq_k1c&4r@#e&ng9=xlm5_',
ROOT_URLCONF='sitebuilder.urls',
MIDDLEWARE_CLASSES=(),
INSTALLED_APPS=(
'django.contrib.staticfiles',
'django.contrib.webdesign',
'sitebuilder',
'compressor',
),
STATIC_URL='/static/',
SITE_PAGES_DIRECTORY=os.path.join(BASE_DIR,'pages'),
SITE_OUTPUT_DIRECTORY=os.path.join(BASE_DIR,'_build'),
STATIC_ROOT=os.path.join(BASE_DIR,'_build','static'),
#STATICFILES_STORAGE='django.contrib.staticfiles.storage.CachedStaticFilesStorage',
STATICFILES_FINDERS=(
'django.contrib.staticfiles.finders.FileSystemFinder',
'django.contrib.staticfiles.finders.AppDirectoriesFinder',
'compressor.finders.CompressorFinder',
)
)
if __name__ =="__main__":
from django.core.management import execute_from_command_line
execute_from_command_line(sys.argv) |
5,917 | b318f5d443dbf8e4442707839649149e75653295 | #!/usr/bin/python
import socket
import sys
host = '10.211.55.5'
port = 69
try:
s = socket.socket(socket.AF_INET, socket.SOCK_DGRAM)
except:
print "socket() failed"
sys.exit(1)
filename = "Aa0Aa1Aa2Aa3Aa4Aa5Aa6Aa7Aa8Aa9Ab0Ab1Ab2Ab3Ab4Ab5Ab6Ab7Ab8Ab9Ac0Ac1Ac2Ac3Ac4Ac5Ac6Ac7Ac8Ac9Ad0Ad1Ad2Ad3Ad4Ad5Ad6Ad7Ad8Ad9Ae0Ae1Ae2Ae3Ae4Ae5Ae6Ae7Ae8Ae9Af0Af1Af2Af3Af4Af5Af6Af7Af8Af9Ag0Ag1Ag2Ag3Ag4Ag5Ag6Ag7Ag8Ag9Ah0Ah1Ah2Ah3Ah4Ah5Ah6Ah7Ah8Ah9Ai0Ai1Ai2Ai3Ai4Ai5Ai6Ai7Ai8Ai9Aj0Aj1Aj2Aj3Aj4Aj5Aj6Aj7Aj8Aj9Ak0Ak1Ak2Ak3Ak4Ak5Ak6Ak7Ak8Ak9Al0Al1Al2Al3Al4Al5Al6Al7Al8Al9Am0Am1Am2Am3Am4Am5Am6Am7Am8Am9An0An1An2An3An4An5An6An7An8An9Ao0Ao1Ao2Ao3Ao4Ao5Ao6Ao7Ao8Ao9Ap0Ap1Ap2Ap3Ap4Ap5Ap6Ap7Ap8Ap9Aq0Aq1Aq2Aq3Aq4Aq5Aq6Aq7Aq8Aq9Ar0Ar1Ar2Ar3Ar4Ar5Ar6Ar7Ar8Ar9As0As1As2As3As4As5As6As7As8As9At0At1At2At3At4At5At6At7At8At9Au0Au1Au2Au3Au4Au5Au6Au7Au8Au9Av0Av1Av2Av3Av4Av5Av6Av7Av8Av9Aw0Aw1Aw2Aw3Aw4Aw5Aw6Aw7Aw8Aw9Ax0Ax1Ax2Ax3Ax4Ax5Ax6Ax7Ax8Ax9Ay0Ay1Ay2Ay3Ay4Ay5Ay6Ay7Ay8Ay9Az0Az1Az2Az3Az4Az5Az6Az7Az8Az9Ba0Ba1Ba2Ba3Ba4Ba5Ba6Ba7Ba8Ba9Bb0Bb1Bb2Bb3Bb4Bb5Bb6Bb7Bb8Bb9Bc0Bc1Bc2Bc3Bc4Bc5Bc6Bc7Bc8Bc9Bd0Bd1Bd2Bd3Bd4Bd5Bd6Bd7Bd8Bd9Be0Be1Be2Be3Be4Be5Be6Be7Be8Be9Bf0Bf1Bf2Bf3Bf4Bf5Bf6Bf7Bf8Bf9Bg0Bg1Bg2Bg3Bg4Bg5Bg6Bg7Bg8Bg9Bh0Bh1Bh2Bh3Bh4Bh5Bh6Bh7Bh8Bh9Bi0Bi1Bi2Bi3Bi4Bi5Bi6Bi7Bi8Bi9Bj0Bj1Bj2Bj3Bj4Bj5Bj6Bj7Bj8Bj9Bk0Bk1Bk2Bk3Bk4Bk5Bk6Bk7Bk8Bk9Bl0Bl1Bl2Bl3Bl4Bl5Bl6Bl7Bl8Bl9Bm0Bm1Bm2Bm3Bm4Bm5Bm6Bm7Bm8Bm9Bn0Bn1Bn2Bn3Bn4Bn5Bn6Bn7Bn8Bn9Bo0Bo1Bo2Bo3Bo4Bo5Bo6Bo7Bo8Bo9Bp0Bp1Bp2Bp3Bp4Bp5Bp6Bp7Bp8Bp9Bq0Bq1Bq2Bq3Bq4Bq5Bq6Bq7Bq8Bq9Br0Br1Br2Br3Br4Br5Br6Br7Br8Br9Bs0Bs1Bs2Bs3Bs4Bs5Bs6Bs7Bs8Bs9Bt0Bt1Bt2Bt3Bt4Bt5Bt6Bt7Bt8Bt9Bu0Bu1Bu2Bu3Bu4Bu5Bu6Bu7Bu8Bu9Bv0Bv1Bv2Bv3Bv4Bv5Bv6Bv7Bv8Bv9Bw0Bw1Bw2Bw3Bw4Bw5Bw6Bw7Bw8Bw9Bx0Bx1Bx2Bx3Bx4Bx5Bx6Bx7Bx8Bx9By0By1By2By3By4By5By6By7By8By9Bz0Bz1Bz2Bz3Bz4Bz5Bz6Bz7Bz8Bz9Ca0Ca1Ca2Ca3Ca4Ca5Ca6Ca7Ca8Ca9Cb0Cb1Cb2Cb3Cb4Cb5Cb6Cb7Cb8Cb9Cc0Cc1Cc2Cc3Cc4Cc5Cc6Cc7Cc8Cc9Cd0Cd1Cd2Cd3Cd4Cd5Cd6Cd7Cd8Cd9Ce0Ce1Ce2Ce3Ce4Ce5Ce6Ce7Ce8Ce9Cf0Cf1Cf2Cf3Cf4Cf5Cf6Cf7Cf8Cf9Cg0Cg1Cg2Cg3Cg4Cg5Cg6Cg7Cg8Cg9Ch0Ch1Ch2Ch3Ch4Ch5Ch6Ch7Ch8Ch9Ci0Ci1Ci2Ci3Ci4Ci5Ci6Ci7Ci8Ci9Cj0Cj1Cj2Cj3Cj4Cj5Cj6Cj7Cj8Cj9Ck0Ck1Ck2Ck3Ck4Ck5Ck6Ck7Ck8Ck9Cl0Cl1Cl2Cl3Cl4Cl5Cl6Cl7Cl8Cl9Cm0Cm1Cm2Cm3Cm4Cm5Cm6Cm7Cm8Cm9Cn0Cn1Cn2Cn3Cn4Cn5Cn6Cn7Cn8Cn9Co0Co1Co2Co3Co4Co5Co6Co7Co8Co9Cp0Cp1Cp2Cp3Cp4Cp5Cp6Cp7Cp8Cp9Cq0Cq1Cq2Cq3Cq4Cq5Cq6Cq7Cq8Cq9Cr0Cr1Cr2Cr3Cr4Cr5Cr6Cr7Cr8Cr9Cs0Cs1Cs2Cs3Cs4Cs5Cs6Cs7Cs8Cs9Ct0Ct1Ct2Ct3Ct4Ct5Ct6Ct7Ct8Ct9Cu0Cu1Cu2Cu3Cu4Cu5Cu6Cu7Cu8Cu9Cv0Cv1Cv2Cv3Cv4Cv5Cv6Cv7Cv8Cv9Cw0Cw1Cw2Cw3Cw4Cw5Cw6Cw7Cw8Cw9Cx0Cx1Cx2Cx3Cx4Cx5Cx6Cx7Cx8Cx9Cy0Cy1Cy2Cy3Cy4Cy5Cy6Cy7Cy8Cy9Cz0Cz1Cz2Cz3Cz4Cz5Cz6Cz7Cz8Cz9Da0Da1Da2Da3Da4Da5Da6Da7Da8Da9Db0Db1Db2Db3Db4Db5Db6Db7Db8Db9Dc0Dc1Dc2Dc3Dc4Dc5Dc6Dc7Dc8Dc9Dd0Dd1Dd2Dd3Dd4Dd5Dd6Dd7Dd8Dd9De0De1De2De3De4De5De6De7De8De9Df0Df1Df2Df3Df4Df5Df6Df7Df8Df9Dg0Dg1Dg2Dg3Dg4Dg5Dg6Dg7Dg8Dg9Dh0Dh1Dh2Dh3Dh4Dh5Dh6Dh7Dh8Dh9Di0Di1Di2Di3Di4Di5Di6Di7Di8Di9Dj0Dj1Dj2Dj3Dj4Dj5Dj6Dj7Dj8Dj9Dk0Dk1Dk2Dk3Dk4Dk5Dk6Dk7Dk8Dk9Dl0Dl1Dl2Dl3Dl4Dl5Dl6Dl7Dl8Dl9Dm0Dm1Dm2Dm3Dm4Dm5Dm6Dm7Dm8Dm9Dn0Dn1Dn2Dn3Dn4Dn5Dn6Dn7Dn8Dn9Do0Do1Do2Do3Do4Do5Do6Do7Do8Do9Dp0Dp1Dp2Dp3Dp4Dp5Dp6Dp7Dp8Dp9Dq0Dq1Dq2Dq3Dq4Dq5Dq6Dq7Dq8Dq9Dr0Dr1Dr2Dr3Dr4Dr5Dr6Dr7Dr8Dr9Ds0Ds1Ds2Ds3Ds4Ds5Ds6Ds7Ds8Ds9Dt0Dt1Dt2Dt3Dt4Dt5Dt6Dt7Dt8Dt9Du0Du1Du2Du3Du4Du5Du6Du7Du8Du9Dv0Dv1Dv2Dv3Dv4Dv5Dv6Dv7Dv8Dv9Dw0Dw1Dw2Dw3Dw4Dw5Dw6Dw7Dw8Dw9Dx0Dx1Dx2Dx3Dx4Dx5Dx6Dx7Dx8Dx9Dy0Dy1Dy2Dy3Dy4Dy5Dy6Dy7Dy8Dy9Dz0Dz1Dz2Dz3Dz4Dz5Dz6Dz7Dz8Dz9Ea0Ea1Ea2Ea3Ea4Ea5Ea6Ea7Ea8Ea9Eb0Eb1Eb2Eb3Eb4Eb5Eb6Eb7Eb8Eb9Ec0Ec1Ec2Ec3Ec4Ec5Ec6Ec7Ec8Ec9Ed0Ed1Ed2Ed3Ed4Ed5Ed6Ed7Ed8Ed9Ee0Ee1Ee2Ee3Ee4Ee5Ee6Ee7Ee8Ee9Ef0Ef1Ef2Ef3Ef4Ef5Ef6Ef7Ef8Ef9Eg0Eg1Eg2Eg3Eg4Eg5Eg6Eg7Eg8Eg9Eh0Eh1Eh2Eh3Eh4Eh5Eh6Eh7Eh8Eh9Ei0Ei1Ei2Ei3Ei4Ei5Ei6Ei7Ei8Ei9Ej0Ej1Ej2Ej3Ej4Ej5Ej6Ej7Ej8Ej9Ek0Ek1Ek2Ek3Ek4Ek5Ek6Ek7Ek8Ek9El0El1El2El3El4El5El6El7El8El9Em0Em1Em2Em3Em4Em5Em6Em7Em8Em9En0En1En2En3En4En5En6En7En8En9Eo0Eo1Eo2Eo3Eo4Eo5Eo6Eo7Eo8Eo9Ep0Ep1Ep2Ep3Ep4Ep5Ep6Ep7Ep8Ep9Eq0Eq1Eq2Eq3Eq4Eq5Eq6Eq7Eq8Eq9Er0Er1Er2Er3Er4Er5Er6Er7Er8Er9Es0Es1Es2Es3Es4Es5Es6Es7Es8Es9Et0Et1Et2Et3Et4Et5Et6Et7Et8Et9Eu0Eu1Eu2Eu3Eu4Eu5Eu6Eu7Eu8Eu9Ev0Ev1Ev2Ev3Ev4Ev5Ev6Ev7Ev8Ev9Ew0Ew1Ew2Ew3Ew4Ew5Ew6Ew7Ew8Ew9Ex0Ex1Ex2Ex3Ex4Ex5Ex6Ex7Ex8Ex9Ey0Ey1Ey2Ey3Ey4Ey5Ey6Ey7Ey8Ey9Ez0Ez1Ez2Ez3Ez4Ez5Ez6Ez7Ez8Ez9Fa0Fa1Fa2Fa3Fa4Fa5Fa6Fa7Fa8Fa9Fb0Fb1Fb2Fb3Fb4Fb5Fb6Fb7Fb8Fb9Fc0Fc1Fc2Fc3Fc4Fc5Fc6Fc7Fc8Fc9Fd0Fd1Fd2Fd3Fd4Fd5Fd6Fd7Fd8Fd9Fe0Fe1Fe2Fe3Fe4Fe5Fe6Fe7Fe8Fe9Ff0Ff1Ff2Ff3Ff4Ff5Ff6Ff7Ff8Ff9Fg0Fg1Fg2Fg3Fg4Fg5Fg6Fg7Fg8Fg9Fh0Fh1Fh2Fh3Fh4Fh5Fh6Fh7Fh8Fh9Fi0Fi1Fi2Fi3Fi4Fi5Fi6Fi7Fi8Fi9Fj0Fj1Fj2Fj3Fj4Fj5Fj6Fj7Fj8Fj9Fk0Fk1Fk2Fk3Fk4Fk5Fk6Fk7Fk8Fk9Fl0Fl1Fl2Fl3Fl4Fl5Fl6Fl7Fl8Fl9Fm0Fm1Fm2Fm3Fm4Fm5Fm6Fm7Fm8Fm9Fn0Fn1Fn2Fn3Fn4Fn5Fn6Fn7Fn8Fn9Fo0Fo1Fo2Fo3Fo4Fo5Fo6Fo7Fo8Fo9Fp0Fp1Fp2Fp3Fp4Fp5Fp6Fp7Fp8Fp9Fq0Fq1Fq2Fq3Fq4Fq5Fq6Fq7Fq8Fq9Fr0Fr1Fr2Fr3Fr4Fr5Fr6Fr7Fr8Fr9Fs0Fs1Fs2Fs3Fs4Fs5Fs6Fs7Fs8Fs9Ft0Ft1Ft2Ft3Ft4Ft5Ft6Ft7Ft8Ft9Fu0Fu1Fu2Fu3Fu4Fu5Fu6Fu7Fu8Fu9Fv0Fv1Fv2Fv3Fv4Fv5Fv6Fv7Fv8Fv9Fw0Fw1Fw2Fw3Fw4Fw5Fw6Fw7Fw8Fw9Fx0Fx1Fx2Fx3Fx4Fx5Fx6Fx7Fx8Fx9Fy0Fy1Fy2Fy3Fy4Fy5Fy6Fy7Fy8Fy9Fz0Fz1Fz2Fz3Fz4Fz5Fz6Fz7Fz8Fz9Ga0Ga1Ga2Ga3Ga4Ga5Ga6Ga7Ga8Ga9Gb0Gb1Gb2Gb3Gb4Gb5Gb6Gb7Gb8Gb9Gc0Gc1Gc2Gc3Gc4Gc5Gc6Gc7Gc8Gc9Gd0Gd1Gd2Gd3Gd4Gd5Gd6Gd7Gd8Gd9Ge0Ge1Ge2Ge3Ge4Ge5Ge6Ge7Ge8Ge9Gf0Gf1Gf2Gf3Gf4Gf5Gf6Gf7Gf8Gf9Gg0Gg1Gg2Gg3Gg4Gg5Gg6Gg7Gg8Gg9Gh0Gh1Gh2Gh3Gh4Gh5Gh6Gh7Gh8Gh9Gi0Gi1Gi2Gi3Gi4Gi5Gi6Gi7Gi8Gi9Gj0Gj1Gj2Gj3Gj4Gj5Gj6Gj7Gj8Gj9Gk0Gk1Gk2Gk3Gk4Gk5Gk"
mode = "netascii"
buf = "\x00\x02" + filename+ "\0" + mode+ "\0"
s.sendto(buf, (host, port)) |
5,918 | 7cc9d445d712d485eaebd090d2485dac0c38b3fb | # file /home/hep/ss4314/cmtuser/Gauss_v45r10p1/Gen/DecFiles/options/16303437.py generated: Wed, 25 Jan 2017 15:25:22
#
# Event Type: 16303437
#
# ASCII decay Descriptor: [Xi_b- -> (rho- -> pi- pi0) K- p+]cc
#
from Configurables import Generation
Generation().EventType = 16303437
Generation().SampleGenerationTool = "SignalRepeatedHadronization"
from Configurables import SignalRepeatedHadronization
Generation().addTool( SignalRepeatedHadronization )
Generation().SignalRepeatedHadronization.ProductionTool = "PythiaProduction"
from Configurables import ToolSvc
from Configurables import EvtGenDecay
ToolSvc().addTool( EvtGenDecay )
ToolSvc().EvtGenDecay.UserDecayFile = "$DECFILESROOT/dkfiles/Omegab_rho-h-p+,pi-pi0_PPChange=phsp,DecProdCut.dec"
Generation().SignalRepeatedHadronization.CutTool = "DaughtersInLHCb"
Generation().SignalRepeatedHadronization.SignalPIDList = [ 5132,-5132 ]
from Configurables import LHCb__ParticlePropertySvc
LHCb__ParticlePropertySvc().Particles = [ "Xi_b- 122 5132 -1.0 6.048 1.13e-012 Xi_b- 5132 0.000000e+000", "Xi_b~+ 123 -5132 1.0 6.071 1.1e-012 anti-Xi_b+ -5132 0.000000e+000" ]
|
5,919 | 8e26a6b50539fa5f498aa2079a2625214e5b4d03 | # Licensed to the Apache Software Foundation (ASF) under one
# or more contributor license agreements. See the NOTICE file
# distributed with this work for additional information
# regarding copyright ownership. The ASF licenses this file
# to you under the Apache License, Version 2.0 (the
# "License"); you may not use this file except in compliance
# with the License. You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing,
# software distributed under the License is distributed on an
# "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
# KIND, either express or implied. See the License for the
# specific language governing permissions and limitations
# under the License.
import threading
import time
from datetime import timedelta
from typing import List, Optional, Set
import airflow.utils.dag_processing as dag_processing
from airflow.configuration import conf
from airflow.contrib.jobs.background_service import BackgroundService
from airflow.events.scheduler_events import DagExecutableEvent
from airflow.jobs import scheduler_job
from airflow.models import DagModel
from airflow.utils.log.logging_mixin import LoggingMixin
from airflow.utils.mailbox import Mailbox
from airflow.utils.mixins import MultiprocessingStartMethodMixin
from airflow.utils.session import create_session
class DagTriggerDagFileProcessorAgent(dag_processing.DagFileProcessorAgent):
def wait_on_manager_message(self, timeout=None):
self._parent_signal_conn.poll(timeout)
class StoppableThread(threading.Thread, LoggingMixin):
"""Thread class with a stop() method. The thread itself has to check
regularly for the stopped() condition."""
def __init__(self, *args, **kwargs):
super(StoppableThread, self).__init__(*args, **kwargs)
self._ended = threading.Event()
def stop(self):
self.log.debug("stopping thread")
self._ended.set()
def stopped(self):
return self._ended.is_set()
class DagRunnableReportingThread(StoppableThread, LoggingMixin):
def __init__(self, async_mode: bool, dag_file_processor_agent, mailbox: Mailbox, *args, **kwargs):
super(DagRunnableReportingThread, self).__init__(*args, **kwargs)
self.setName("DagTrigger-DagRunnableReporter")
self._async_mode = async_mode
self._dag_file_processor_agent: DagTriggerDagFileProcessorAgent = dag_file_processor_agent
self._mailbox = mailbox
def run(self) -> None:
while not self.stopped():
# send AGENT_RUN_ONCE to DagFileProcessorManager to trigger dag parsing if not async mode
if not self._async_mode:
self._dag_file_processor_agent.run_single_parsing_loop()
with create_session() as session:
dag_models = DagModel.dags_needing_dagruns(session).all()
self.log.debug("dags needs dagruns: {}".format(dag_models))
self._send_dag_executable(dag_models)
time.sleep(5)
self.log.info("DagRunnableReporter exiting")
def _send_dag_executable(self, dag_models: Set[DagModel]):
for dag_model in dag_models:
self._mailbox.send_message(DagExecutableEvent(dag_model.dag_id).to_event())
class ParsingStatRetrieveThread(StoppableThread):
def __init__(self, dag_file_processor_agent, *args, **kwargs):
super(ParsingStatRetrieveThread, self).__init__(*args, **kwargs)
self.setName("DagTrigger-ParsingStatRetriever")
self._dag_file_processor_agent: DagTriggerDagFileProcessorAgent = dag_file_processor_agent
def run(self) -> None:
while not self.stopped():
self._dag_file_processor_agent.wait_on_manager_message()
self._dag_file_processor_agent.heartbeat()
time.sleep(10)
self.log.info("ParsingStatRetriever exiting")
class DagTrigger(BackgroundService, MultiprocessingStartMethodMixin):
def __init__(self,
dag_directory: str,
max_runs: int,
dag_ids: Optional[List[str]],
pickle_dags: bool,
mailbox: Mailbox,
refresh_dag_dir_interval=1,
notification_service_uri=None):
"""
:param dag_directory: Directory where DAG definitions are kept. All
files in file_paths should be under this directory
:type dag_directory: unicode
:param max_runs: The number of times to parse and schedule each file. -1
for unlimited.
:type max_runs: int
:param dag_ids: if specified, only schedule tasks with these DAG IDs
:type dag_ids: list[str]
:param pickle_dags: whether to pickle DAGs.
:type pickle_dags: bool
:param mailbox: the mailbox to send the DagExecutableEvent
:type mailbox: Mailbox
"""
super().__init__()
self._dag_directory = dag_directory
self._max_runs = max_runs
self._dag_ids = dag_ids
self._pickle_dags = pickle_dags
self._mailbox = mailbox
# use synchronize mode when using sqlite
self._async_mode = not conf.get('core', 'sql_alchemy_conn').lower().startswith('sqlite')
self._dag_runnable_reporting_thread: Optional[StoppableThread] = None
self._parsing_stat_process_thread: Optional[StoppableThread] = None
self._dag_file_processor_agent: Optional[DagTriggerDagFileProcessorAgent] = None
self._refresh_dag_dir_interval = refresh_dag_dir_interval
self._notification_service_uri = notification_service_uri
def start(self):
self._start_dag_file_processor_manager()
self._dag_runnable_reporting_thread = DagRunnableReportingThread(self._async_mode,
self._dag_file_processor_agent,
self._mailbox)
self._dag_runnable_reporting_thread.start()
self._parsing_stat_process_thread = ParsingStatRetrieveThread(self._dag_file_processor_agent)
self._parsing_stat_process_thread.start()
def end(self) -> None:
if self._dag_file_processor_agent is not None:
self._dag_file_processor_agent.terminate()
if self._dag_runnable_reporting_thread is not None:
self._dag_runnable_reporting_thread.stop()
if self._parsing_stat_process_thread is not None:
self._parsing_stat_process_thread.stop()
self._dag_runnable_reporting_thread.join()
self._parsing_stat_process_thread.join()
self._dag_file_processor_agent.end()
def terminate(self):
if self._dag_file_processor_agent is not None:
self._dag_file_processor_agent.end()
if self._dag_runnable_reporting_thread is not None:
self._dag_runnable_reporting_thread.stop()
if self._parsing_stat_process_thread is not None:
self._parsing_stat_process_thread.stop()
def _start_dag_file_processor_manager(self):
processor_factory = scheduler_job.SchedulerJob._create_dag_file_processor
self._dag_file_processor_agent = DagTriggerDagFileProcessorAgent(self._dag_directory,
self._max_runs,
processor_factory,
self._get_processor_timeout(),
[],
self._pickle_dags,
self._async_mode,
self._refresh_dag_dir_interval,
self._notification_service_uri)
self._dag_file_processor_agent.start()
@staticmethod
def _get_processor_timeout():
processor_timeout_seconds: int = conf.getint('core', 'dag_file_processor_timeout')
return timedelta(seconds=processor_timeout_seconds)
def is_alive(self) -> bool:
return self._dag_file_processor_agent is not None \
and self._dag_runnable_reporting_thread is not None and self._dag_runnable_reporting_thread.is_alive() \
and self._parsing_stat_process_thread is not None and self._parsing_stat_process_thread.is_alive()
|
5,920 | ffb6379f2f2611fd8aa73f3a3c15fed4550d348f | ##############################################################################
#
# Copyright (c) 2005 Nexedi SARL and Contributors. All Rights Reserved.
# Yoshinori Okuji <yo@nexedi.com>
# Christophe Dumez <christophe@nexedi.com>
#
# WARNING: This program as such is intended to be used by professional
# programmers who take the whole responsability of assessing all potential
# consequences resulting from its eventual inadequacies and bugs
# End users who are looking for a ready-to-use solution with commercial
# garantees and support are strongly adviced to contract a Free Software
# Service Company
#
# This program is Free Software; you can redistribute it and/or
# modify it under the terms of the GNU General Public License
# as published by the Free Software Foundation; either version 2
# of the License, or (at your option) any later version.
#
# This program is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU General Public License for more details.
#
# You should have received a copy of the GNU General Public License
# along with this program; if not, write to the Free Software
# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
#
##############################################################################
"""
Provide a feature not present into difflib, which is generate a colored diff
from a diff file/string.
This code is original form ERP5VCS and was moved to here for be used in
general ERP5.
XXX The organisation of DiffUtils should be reviewed and reorganised in a tool
if a general tool want to be provided.
"""
import os, re
from xml.sax.saxutils import escape
NBSP = ' '
NBSP_TAB = NBSP*8
NO_DIFF_COLOR = 'white'
MODIFIED_DIFF_COLOR = 'rgb(253, 228, 6);'#light orange
DELETED_DIFF_COLOR = 'rgb(253, 117, 74);'#light red
ADDITION_DIFF_COLOR = 'rgb(83, 253, 74);'#light green
class DiffFile(object):
"""
# Members :
- path : path of the modified file
- children : sub codes modified
- old_revision
- new_revision
"""
def __init__(self, raw_diff):
self.children = []
self.binary = raw_diff and '@@' not in raw_diff
if self.binary or not raw_diff:
return
self.header = raw_diff.split('@@')[0][:-1]
# Getting file path in header
self.path = self.header.split('====')[0][:-1].strip()
# Getting revisions in header
for line in self.header.splitlines():
if line.startswith('--- '):
tmp = re.search('\\([^)]+\\)$', line)
if tmp is not None:
self.old_revision = tmp.string[tmp.start():tmp.end()][1:-1].strip()
else:
self.old_revision = line.replace("--- ", "")
if line.startswith('+++ '):
tmp = re.search('\\([^)]+\\)$', line)
if tmp is not None:
self.new_revision = tmp.string[tmp.start():tmp.end()][1:-1].strip()
else:
self.new_revision = line.replace("+++ ", "")
# Splitting the body from the header
self.body = os.linesep.join(raw_diff.strip().splitlines()[3:])
if not self.body.startswith('@@'):
self.body = os.linesep.join(raw_diff.strip().splitlines()[4:])
# Now splitting modifications
first = True
tmp = []
for line in self.body.splitlines():
if line:
if line.startswith('@@') and not first:
self.children.append(CodeBlock(os.linesep.join(tmp)))
tmp = [line, ]
else:
first = False
tmp.append(line)
self.children.append(CodeBlock(os.linesep.join(tmp)))
def __nonzero__(self):
return self.binary or bool(self.children)
def __len__(self):
return len(self.children)
toHTML__roles__ = None # public
def toHTML(self):
""" return HTML diff
"""
# Adding header of the table
if self.binary:
return '<b>Folder or binary file or just no changes!</b><br/><br/><br/>'
if not self:
return ''
html_list = []
html_list.append('''
<table style="text-align: left; width: 100%%; border: 0;" cellpadding="0" cellspacing="0">
<tbody>
<tr>
<td style="background-color: grey; text-align: center; font-weight: bold;">%s</td>
<td style="background-color: black; width: 2px;"></td>
<td style="background-color: grey; text-align: center; font-weight: bold;">%s</td>
</tr>''' % (self.old_revision, self.new_revision))
header_color = 'grey'
child_html_text = '''<tr><td style="background-color: %(headcolor)s">
</td><td style="background-color: black; width: 2px;"></td>
<td style="background-color: %(headcolor)s"> </td></tr><tr>
<td style="background-color: rgb(68, 132, 255);font-weight: bold;">Line %(oldline)s</td>
<td style="background-color: black; width: 2px;"></td>
<td style="background-color: rgb(68, 132, 255);font-weight: bold;">Line %(newline)s</td>
</tr>'''
for child in self.children:
# Adding line number of the modification
html_list.append( child_html_text % {'headcolor':header_color, 'oldline':child.old_line, 'newline':child.new_line} )
header_color = 'white'
# Adding diff of the modification
old_code_list = child.getOldCodeList()
new_code_list = child.getNewCodeList()
i = 0
for old_line_tuple in old_code_list:
new_line_tuple = new_code_list[i]
new_line = new_line_tuple[0] or ' '
old_line = old_line_tuple[0] or ' '
i += 1
html_list.append( '''<tr style="font-family: monospace">
<td style="background-color: %s">%s</td>
<td style="background-color: black; width: 2px;"></td>
<td style="background-color: %s">%s</td>
</tr>'''%(old_line_tuple[1],
escape(old_line).replace(' ', NBSP).replace('\t', NBSP_TAB),
new_line_tuple[1],
escape(new_line).replace(' ', NBSP).replace('\t', NBSP_TAB))
)
html_list.append('''</tbody></table><br/>''')
return '\n'.join(html_list)
def getModifiedBlockList(self):
"""
Return a list of modified blocks
List contains tuples (block object : (old_modified_code, new_modified_code))
"""
if self.binary:
return []
block_list = []
for child in self.children:
old_line_list = [line.strip() for line, color in child.getOldCodeList()
if line is not None and color in (MODIFIED_DIFF_COLOR,
DELETED_DIFF_COLOR)]
new_line_list = [line.strip() for line, color in child.getNewCodeList()
if line is not None and color in (MODIFIED_DIFF_COLOR,
ADDITION_DIFF_COLOR)]
if old_line_list or new_line_list:
block_list.append((child,(old_line_list, new_line_list)))
return block_list
class CodeBlock:
"""
A code block contains several SubCodeBlocks
Members :
- old_line : line in old code (before modif)
- new line : line in new code (after modif)
Methods :
- getOldCodeList() : return code before modif
- getNewCodeList() : return code after modif
Note: the code returned is a list of tuples (code line, background color)
"""
def __init__(self, raw_diff):
# Splitting body and header
self.body = os.linesep.join(raw_diff.splitlines()[1:])
self.header = raw_diff.splitlines()[0]
# Getting modifications lines
tmp = re.search('^@@ -\d+', self.header)
self.old_line = tmp.string[tmp.start():tmp.end()][4:]
tmp = re.search('\+\d+', self.header)
self.new_line = tmp.string[tmp.start():tmp.end()][1:]
# Splitting modifications in SubCodeBlocks
in_modif = False
self.children = []
tmp = []
for line in self.body.splitlines():
if line:
if (line.startswith('+') or line.startswith('-')):
if in_modif:
tmp.append(line)
else:
self.children.append(SubCodeBlock(os.linesep.join(tmp)))
tmp = [line, ]
in_modif = True
else:
if in_modif:
self.children.append(SubCodeBlock(os.linesep.join(tmp)))
tmp = [line, ]
in_modif = False
else:
tmp.append(line)
self.children.append(SubCodeBlock(os.linesep.join(tmp)))
def getOldCodeList(self):
""" Return code before modification
"""
tmp = []
for child in self.children:
tmp.extend(child.getOldCodeList())
return tmp
def getNewCodeList(self):
""" Return code after modification
"""
tmp = []
for child in self.children:
tmp.extend(child.getNewCodeList())
return tmp
class SubCodeBlock:
""" a SubCodeBlock contain 0 or 1 modification (not more)
"""
def __init__(self, code):
self.body = code
self.modification = self._getModif()
self.old_code_length = self._getOldCodeLength()
self.new_code_length = self._getNewCodeLength()
# Choosing background color
if self.modification == 'none':
self.color = NO_DIFF_COLOR
elif self.modification == 'change':
self.color = MODIFIED_DIFF_COLOR
elif self.modification == 'deletion':
self.color = DELETED_DIFF_COLOR
else: # addition
self.color = ADDITION_DIFF_COLOR
def _getModif(self):
""" Return type of modification :
addition, deletion, none
"""
nb_plus = 0
nb_minus = 0
for line in self.body.splitlines():
if line.startswith("-"):
nb_minus -= 1
elif line.startswith("+"):
nb_plus += 1
if (nb_plus == 0 and nb_minus == 0):
return 'none'
if (nb_minus == 0):
return 'addition'
if (nb_plus == 0):
return 'deletion'
return 'change'
def _getOldCodeLength(self):
""" Private function to return old code length
"""
nb_lines = 0
for line in self.body.splitlines():
if not line.startswith("+"):
nb_lines += 1
return nb_lines
def _getNewCodeLength(self):
""" Private function to return new code length
"""
nb_lines = 0
for line in self.body.splitlines():
if not line.startswith("-"):
nb_lines += 1
return nb_lines
def getOldCodeList(self):
""" Return code before modification
"""
if self.modification == 'none':
old_code = [(x, 'white') for x in self.body.splitlines()]
elif self.modification == 'change':
old_code = [self._getOldCodeList(x) for x in self.body.splitlines() \
if self._getOldCodeList(x)[0]]
# we want old_code_list and new_code_list to have the same length
if(self.old_code_length < self.new_code_length):
filling = [(None, self.color)] * (self.new_code_length - \
self.old_code_length)
old_code.extend(filling)
else: # deletion or addition
old_code = [self._getOldCodeList(x) for x in self.body.splitlines()]
return old_code
def _getOldCodeList(self, line):
""" Private function to return code before modification
"""
if line.startswith('+'):
return (None, self.color)
if line.startswith('-'):
return (' ' + line[1:], self.color)
return (line, self.color)
def getNewCodeList(self):
""" Return code after modification
"""
if self.modification == 'none':
new_code = [(x, 'white') for x in self.body.splitlines()]
elif self.modification == 'change':
new_code = [self._getNewCodeList(x) for x in self.body.splitlines() \
if self._getNewCodeList(x)[0]]
# we want old_code_list and new_code_list to have the same length
if(self.new_code_length < self.old_code_length):
filling = [(None, self.color)] * (self.old_code_length - \
self.new_code_length)
new_code.extend(filling)
else: # deletion or addition
new_code = [self._getNewCodeList(x) for x in self.body.splitlines()]
return new_code
def _getNewCodeList(self, line):
""" Private function to return code after modification
"""
if line.startswith('-'):
return (None, self.color)
if line.startswith('+'):
return (' ' + line[1:], self.color)
return (line, self.color)
|
5,921 | 08e5e8515528eae400a59bfc0c58b8d7b4affd7e |
# coding: utf-8
## ROC for CLEF-IP2010 patents
####### ROC for clef-ip2010 patents
# In[ ]:
def vectorize_corpus(corpus,tokenizer,vocabulary,max_ngram_size):
# tokenize text
from sklearn.feature_extraction.text import CountVectorizer
from sklearn.feature_extraction.text import TfidfTransformer
from clef_globals import *
# generate corpus vectors
vectorizer = CountVectorizer(min_df=min_df,tokenizer=tokenizer,ngram_range=(1,max_ngram_size),vocabulary=vocabulary,stop_words={})
corpus_vectors = vectorizer.fit_transform(corpus)
# generate tfidf vectors
transformer = TfidfTransformer()
corpus_tfidf_vectors = transformer.fit_transform(corpus_vectors)
return corpus_tfidf_vectors
# In[ ]:
# given classifier predictions probabilities, return predictions with top n probabilities > 0.5 for each instance or greatest one if all are <=0.5
def get_max_n_pred(pred_proba, n_pred, threshold):
import heapq
import numpy
max_n_pred = numpy.ndarray(shape=pred_proba.shape)
for i in range(len(pred_proba)):
largest_n_proba = heapq.nlargest(n_pred,pred_proba[i])
max_n_pred[i] = numpy.array(((pred_proba[i]>threshold) & (pred_proba[i]>=largest_n_proba[len(largest_n_proba)-1]) & 1))
if max_n_pred[i].sum(axis=0)==0: # at least one label should be returned
max_n_pred[i] = numpy.array(((pred_proba[i]>=max(pred_proba[i])) & 1))
return max_n_pred
# In[ ]:
# reference: http://scikit-learn.org/stable/modules/model_evaluation.html#multiclass-and-multilabel-classification
def classify(labels,corpus_tfidf_vectors,test_size,max_labels,threshold):
from sklearn.preprocessing import MultiLabelBinarizer
from sklearn.multiclass import OneVsRestClassifier
from sklearn.svm import SVC
from sklearn.svm import LinearSVC
from sklearn.linear_model import SGDClassifier
from sklearn.linear_model import LogisticRegression
from sklearn.naive_bayes import MultinomialNB
from sklearn.cross_validation import train_test_split
from sklearn import metrics
import numpy
# binarize the labels
mlb = MultiLabelBinarizer()
labels_binarized = mlb.fit_transform(labels)
# train/test split
#corpus_tfidf_vectors, labels_binarized = shuffle(corpus_tfidf_vectors, labels_binarized)
print 'test size=0.2'
x_train, x_test, y_train, y_test = train_test_split(corpus_tfidf_vectors, labels_binarized, test_size=0.2, random_state=1)
# classify
#cls = OneVsRestClassifier(LogisticRegression(class_weight='auto'))
#cls = OneVsRestClassifier(LogisticRegression())
#cls = OneVsRestClassifier(MultinomialNB(alpha=0.01))
#cls = OneVsRestClassifier(SVC(kernel='linear',probability=True,n_iter=1000))
cls = OneVsRestClassifier(SGDClassifier(loss='hinge',penalty='l2',max_iter=1000,n_jobs=5))
#cls = OneVsRestClassifier(LinearSVC())
cls.fit(x_train, y_train)
pred_proba = 1/(1+numpy.exp(-1*cls.decision_function(x_test)))
# evaluate
#pred_proba = cls.predict_proba(x_test)
#print len(pred_proba[0]) # make sure it is 121
pred_labels = mlb.inverse_transform(get_max_n_pred(pred_proba, max_labels,threshold))
actual_labels = mlb.inverse_transform(y_test)
result = 'threshold: {0}, precision: {1}, recall: {2}, f1: {3}'.format(threshold,metrics.precision_score(actual_labels, pred_labels, average='micro'),metrics.recall_score(actual_labels, pred_labels, average='micro'),metrics.f1_score(actual_labels, pred_labels, average='micro'))
print result
# In[ ]:
def test_lemmatized_unigrams(corpus,labels,vocabulary_src,with_stopwords_removal,use_chi_features):
import thread
from lemmatizing_tokenizer import LemmaTokenizer
from clef_globals import *
from clef_vocabulary_loader import load_vocabulary
max_ngram_size = 1
tokenizer = LemmaTokenizer()
if with_stopwords_removal==False:
stopwords_pattern = ''
else:
stopwords_pattern = '_stopwords'
if use_chi_features==False:
chi_features_pattern = ''
else:
chi_features_pattern = '_chi'
# load vocabulary
vocabulary_tbl_name = 'clef_2010_{0}_lemmas{1}_unigrams{2}_df{3}_tf{4}'.format(vocabulary_src,chi_features_pattern,stopwords_pattern,min_df,min_tf)
vocabulary = load_vocabulary(vocabulary_tbl_name)
# generate tfidf vectors
corpus_tfidf_vectors = vectorize_corpus(corpus,tokenizer,vocabulary,max_ngram_size)
# classify & evaluate
classify(labels,corpus_tfidf_vectors,test_set_size,max_labels,0.5)
for i in range(0,101):
#thread.start_new_thread(classify, (labels,corpus_tfidf_vectors,test_set_size,max_labels,i/100.0))
classify(labels,corpus_tfidf_vectors,test_set_size,max_labels,i/100.0)
# In[ ]:
def test(vocabulary_src):
from clef_corpus_loader import load_corpus_with_labels
# load clef patents with class lables from DB using only vocabulary_src as main field for vocabulary (e.g., abstract, description, claims...)
corpus_data = load_corpus_with_labels(vocabulary_src)
corpus = corpus_data['corpus']
labels = corpus_data['labels']
labels_dic = corpus_data['labels_dic']
labels_arr = corpus_data['labels_arr']
print 'done loading {0} records and {1} labels.'.format(len(corpus),len(labels_dic))
test_lemmatized_unigrams(corpus,labels,vocabulary_src,True,True)
# In[ ]:
# test using abstracts vocabulary
test('abstract')
|
5,922 | fcc12b26308e3031de7e8fcf4ad43ec92279d400 | __author__ = 'jamjiang'
class Person:
def __init__(self, name):
self.name = name
def sayHi(self):
print 'hi!, I am', self.name
david = Person('David')
david.sayHi()
Person('leo').sayHi()
|
5,923 | 1298c2abae519a5365cc0d9d406196db987eb219 |
from collections import defaultdict
def k_most_frequent(arr:list, k:int):
''' '''
counts = defaultdict(int)
for n in nums:
counts[n] += 1
counts = [(k,v) for k,v in counts.items()]
ordered = list(reversed(sorted(counts, key=lambda d: d[1])))
return [o[0] for o in ordered[:k]]
nums = [1,6,2,1,6,1,4,2,6,1]
k_most_frequent(nums, 3)
|
5,924 | 0eaba8f570772de864f52168a597b47a4150d015 | # -*- coding:utf-8 -*-
from common import *
import itertools
def iteration_spider():
max_errors = 5
num_errors = 0
for page in itertools.count(1):
url = 'http://example.webscraping.com/view/-{}'.format(page)
html = download(url)
if html is None:
num_errors += 1
if num_errors == max_errors:
break
else:
num_errors = 0
if __name__ == '__main__':
iteration_spider() |
5,925 | 649c0c0f170b50fe51f5eaf11908e968f66625c9 | import os
import shutil
def flatCopyWithExt(srcDir, dstDir, ext):
if not os.path.exists(dstDir):
os.makedirs(dstDir)
for basename in os.listdir(srcDir):
if basename.endswith(ext):
pathname = os.path.join(srcDir, basename)
if os.path.isfile(pathname):
shutil.copy2(pathname, dstDir)
def moveSDLIncludes():
flatCopyWithExt("./ext/SDL2/core/code/include/", "./ext/SDL2/core/include/", ".h")
flatCopyWithExt("./ext/SDL2/SDL2-image/code/", "./ext/SDL2/SDL2-image/include/", ".h")
flatCopyWithExt("./ext/SDL2/SDL2-mixer/code/", "./ext/SDL2/SDL2-mixer/include/", ".h")
flatCopyWithExt("./ext/SDL2/SDL2-ttf/code/", "./ext/SDL2/SDL2-ttf/include/", ".h")
|
5,926 | 9d0727970c760a9a8123c5c07359ba5c538cea3c | # CS 5010 Project
# Team Metro
# Test the data cleaning
import unittest
from cleaning_data import dfClean # import the dataframe we created after cleaning the data
class DataTypesTestCase(unittest.TestCase):
# we will test that each column has the correct data type
# note that there is a strange occurence seen below when converting to a pandas dataframe
def test_is_holiday_a_string(self):
holiday = dfClean.iloc[4908,0]
self.assertTrue(isinstance(holiday, str))
def test_is_temperature_a_float(self):
temp = dfClean.iloc[4908,1]
self.assertTrue(isinstance(temp, float))
def test_is_rain_a_float(self):
rain = dfClean.iloc[4908,2]
self.assertTrue(isinstance(rain, float))
def test_is_snow_a_float(self):
snow = dfClean.iloc[4908,3]
self.assertTrue(isinstance(snow, float))
def test_is_clouds_an_int(self):
clouds = dfClean.iloc[4908,4]
self.assertEqual(str(type(clouds)), "<class 'numpy.int64'>")
# pandas converts all of the ints in the list to numpy.int64
# could not figure out how to avoid this
def test_is_weather_main_a_string(self):
weather = dfClean.iloc[4908,5]
self.assertTrue(isinstance(weather, str))
def test_is_weather_descrip_a_string(self):
weather = dfClean.iloc[4908,6]
self.assertTrue(isinstance(weather, str))
def test_is_date_time_a_string(self):
dateTime = dfClean.iloc[4908,7]
self.assertTrue(isinstance(dateTime, str))
def test_is_traffic_an_int(self):
traffic = dfClean.iloc[4908,8]
self.assertEqual(str(type(traffic)), "<class 'numpy.int64'>")
def test_is_month_an_int(self):
month = dfClean.iloc[4908,9]
self.assertEqual(str(type(month)), "<class 'numpy.int64'>")
def test_is_day_an_int(self):
day = dfClean.iloc[4908,10]
self.assertEqual(str(type(day)), "<class 'numpy.int64'>")
def test_is_year_an_int(self):
year = dfClean.iloc[4908,11]
self.assertEqual(str(type(year)), "<class 'numpy.int64'>")
def test_is_hour_an_int(self):
hour = dfClean.iloc[4908,12]
self.assertEqual(str(type(hour)), "<class 'numpy.int64'>")
class DateTimeFormatTestCase(unittest.TestCase):
def test_does_month_have_two_digits(self):
i = 0
booln = True
while i < len(dfClean):
if dfClean.iloc[i,7][2] != "/":
booln = False
i += 1
self.assertTrue(booln)
# make sure that every data point has a two digit month
# in cleaning, 0 should have been added to make it two digits
def test_does_day_have_two_digits(self):
i = 0
booln = True
while i < len(dfClean):
if dfClean.iloc[i,7][5] != "/":
booln = False
i += 1
self.assertTrue(booln)
# all months in the date/time string should have two digits after cleaning
def test_does_year_have_four_digits(self):
i = 0
booln = True
while i < len(dfClean):
if dfClean.iloc[i,7][6:8] != "20":
booln = False
i += 1
self.assertTrue(booln)
# all years should be in the form 20xx in the date/time string
def test_does_hour_have_two_digits(self):
i = 0
booln = True # since we already tested all of the other cleaning items on the date/time string
while i < len(dfClean): # we can check the hour by checking the length of the whole string
if len(dfClean.iloc[i,7]) != 16: # all in column should have the form "mm/dd/yyyy hh:00"
booln = False
i += 1
self.assertTrue(booln)
# in cleaning, 0 should have been added to make a one digit hour (0-9) two digits (00-09)
# without the other tests this would be a way to check all in one test but would not
# tell us what part of the cleaning on the date/time string did not work correctly
class AppendColumnsTestCase(unittest.TestCase):
# we will check that each of the four new columns (month, day, year, and hour)
# appended correctly to the dataset
def test_is_month_column_appending_correctly(self):
i = 0
booln = True
while i < len(dfClean):
if int(dfClean.iloc[i,9]) != int(dfClean.iloc[i,7][:2]):
booln = False
i += 1
self.assertTrue(booln)
# we check that the month in the month column matches that in the original date/time column
def test_is_day_column_apending_correctly(self):
i = 0
booln = True
while i < len(dfClean):
if int(dfClean.iloc[i,10]) != int(dfClean.iloc[i,7][3:5]):
booln = False
i += 1
self.assertTrue(booln)
# we check that the day in the day column matches that in the original date/time column
def test_is_year_column_apending_correctly(self):
i = 0
booln = True
while i < len(dfClean):
if int(dfClean.iloc[i,11]) != int(dfClean.iloc[i,7][6:10]):
booln = False
i += 1
self.assertTrue(booln)
# we check that the year in the year column matches that in the original date/time column
def test_is_hour_column_apending_correctly(self):
i = 0
booln = True
while i < len(dfClean):
if int(dfClean.iloc[i,12]) != int(dfClean.iloc[i,7][11:13]):
booln = False
i += 1
self.assertTrue(booln)
# we check that the hour in the hour column matches that in the original date/time column
class HolidayTestCase(unittest.TestCase):
# we test that every hour of the same day has a consistent holiday
def test_are_all_hours_correct_holiday(self):
i = 0
booln = True
hol = "None"
while i < len(dfClean):
if dfClean.iloc[i,12] == 0:
hol = dfClean.iloc[i,0]
else:
if dfClean.iloc[i,0] != hol:
booln = False
i += 1
self.assertTrue(booln)
class UniqueDataPointsTestCase(unittest.TestCase):
# this test ensures that no two data points have the exact same date and hour
def test_are_all_datetimes_unique(self):
i = 1
booln = True
while i < len(dfClean):
if dfClean.iloc[i,7] == dfClean.iloc[i-1,7]:
booln = False
i += 1
self.assertTrue(booln)
class TemperatureConversionTestCase(unittest.TestCase):
# we test that the temperature was converted to Fahrenheit
# note that since we overrode the original temperature, we simply check for
# outlier that would make sense as Kelvin values but not Fahrenheit values
# This how we discovered there were some missing temperatures input as 0 Kelvin
# because they converted to -450 Fahrenheit
def test_is_temp_converting_from_kelvin_to_F(self):
i = 1
booln = True
while i < len(dfClean):
if (dfClean.iloc[i,1] > 120) | (dfClean.iloc[i,1] < -50):
booln = False
i += 1
self.assertTrue(booln)
if __name__ == '__main__':
unittest.main() |
5,927 | 7636925982434b12307383ba7b01f931f7ea6e24 |
from mininet.cli import CLI
from mininet.term import makeTerms
from mininet.util import irange
from log import log
from utils import (UITextStyle, display)
from dijkstra import (get_routing_decision, get_route_cost)
# Check if route directly connects two switches
def isDirect(route):
return (len(route) == 2)
# Add purple background for indirect routes
def brightLabel(text):
return (UITextStyle.BackgroundColor.purple + str(text) + UITextStyle.Format.reset)
# Execute commands one by one
def __wait__(*commandList):
steps = len(commandList)
for i in range(steps):
commandList[i]('')
display.prompt('\n\nPress <Return> to continue (%s/%s)' %
(i + 1, steps))
try:
x = input('')
except:
x = ''
# Mininet Command Line Interface extension
class DongPhamTestCli(CLI):
prompt = 'dongpham> '
def __init__(self, _mininet, _env):
self.env = _env
self.net = _mininet
self._testCLI = {}
CLI.__init__(self, _mininet)
# Tell the controller to do a command
def do(self, shell, quiet=False):
if (quiet):
return self.mn.controller.cmd(shell)
return self.mn.controller.cmdPrint(shell)
def doPrint(self, shell):
display.cmdHighlight(True)
self.mn.controller.cmdPrint(shell)
display.cmdHighlight(False)
# Run all commands in the wait list
def do_all(self, _):
__wait__(
# Show ip
self.do_ips,
# Routing commands
self.do_weights, self.do_costs, self.do_routes, self.do_paths,
# Flow commands
self.do_flows, self.do_stats
)
# Show object info
# info [node1, node2, ...]
def do_info(self, line):
locals = self.getLocals()
_nodes = line.split()
display.section("All functions")
if not (_nodes):
_nodes = self.mn.keys()
for n in _nodes:
if not (locals.__contains__(n)):
break
obj = locals[n]
display.subsection('%s (%s)' % (n, obj.IP()))
print(dir(obj))
# Show IP addresses
# ips
def do_ips(self, _):
display.section("IP Addresses")
locals = self.getLocals()
def showIP(*keys):
for key in keys:
display.message('%s\t%s' % (key.name, key.IP()))
def showAll(*keys):
for key in keys:
display.message('%s\t%s\t%s' % (key.name, key.IP(), key.MAC()))
# For each node
display.subsection('Controllers')
for c in self.mn.controllers:
showIP(locals[c.name])
display.subsection('Switches')
for s in self.mn.switches:
showIP(locals[s.name])
display.subsection('Hosts')
for h in self.mn.hosts:
showAll(locals[h.name])
#MARK: - Routing
# Show link weights
# weights
def do_weights(self, _):
display.section("Weights")
log.infoln('Link\t\tWeight')
log.infoln('--------------------')
for (i, j, w) in self.mn.topo._slinks:
log.infoln('{s%s, s%s}\t%s' % (i, j, w))
# Show costs of reaching every other switch
# costs
def do_costs(self, _):
# Algorithm input
switches = self.mn.topo.switches()
weights = [('s'+str(i[0]), 's'+str(i[1]), i[2])
for i in self.mn.topo._slinks]
# Print cost of reaching 'end' switch from 'start' switch
display.section("Total path costs")
print('From\\To'), ('\t'.join(switches))
for start in switches:
print(start + '\t'),
for end in switches:
if (start == end):
print('--\t'),
continue
route = get_routing_decision(start, weights, end)
cost = get_route_cost([route])
if (isDirect(route)):
# Print result for directly connected switches
print(cost),
else:
# Print and highlight routes with intermediate switches
print(brightLabel(cost)),
print('\t'),
print('')
# Show least-cost paths from every switch to every other switch
# routes
def do_routes(self, _):
# Algorithm input
switches = self.mn.topo.switches()
weights = [('s'+str(i[0]), 's'+str(i[1]), i[2])
for i in self.mn.topo._slinks]
# Print next hop switch
display.section("First-Hop with lowest cost")
print('From\\To\t'), ('\t'.join(switches))
for start in switches:
print(start + '\t'),
for end in switches:
if (start == end):
print('--\t'),
continue
route = get_routing_decision(start, weights, end)
if (isDirect(route)):
# Print result for directly connected switches
print(end),
else:
# Print and highlight routes with intermediate switches
print(brightLabel(route[1])),
print('\t'),
print('')
# Show the complete shortest path from one switch to every other switch
# paths
def do_paths(self, line):
# Algorithm input
switches = self.mn.topo.switches()
weights = [('s'+str(i[0]), 's'+str(i[1]), i[2])
for i in self.mn.topo._slinks]
# Least cost paths to every node
display.section("Least-cost paths to other nodes")
display.message('From -> To\tCost\t\tFull Shortest Path')
for start in switches:
display.subsection('%s' % start)
for end in switches:
if (start == end):
continue
route = get_routing_decision(start, weights, end)
cost = get_route_cost([route])
display.message('%s -> %s\t%s\t\t%s' %
(start, end, cost, route))
#MARK: - OpenFlow
# Display flows
# flows
def do_flows(self, _line):
display.section("Showing all flows of all OVSSwitches")
for s in self.mn.switches:
self.doPrint('sudo ovs-ofctl dump-flows %s' % s)
# Delete flows
# deleteFlows
def do_deleteFlows(self, _line):
display.section("Deleting all flows of all OVSSwitches")
for s in self.mn.switches:
self.doPrint('sudo ovs-ofctl del-flows %s' % s)
# Display flow statistics
# stats
def do_stats(self, _):
display.section("OpenFlow: Sent/Received Packets")
display.message(
'Packets passing through a switch on the way host with IP address = "nw_dst"')
for s in self.mn.switches:
display.subsection('%s - Traffic' % s.name)
self.doPrint(
'sudo ovs-ofctl dump-flows %s | grep -e "n_packets=[1-9]*.*n_bytes=[1-9]*.*nw_dst=10.10.[1-9].[1-9]" -To' % (s.name))
# MARK: - Run on every node
# arps
def do_arps(self, _line):
display.section("ARP caches of all hosts")
sh = 'arp -a'
for h in self.mn.hosts:
h.cmdPrint(sh)
# netstats
def do_netstats(self, _line):
display.section("Routing Tables")
sh = 'netstat -rn'
display.subsection('Hosts')
for h in self.mn.hosts:
h.cmdPrint(sh)
display.subsection('Controller')
self.doPrint(sh)
# ifconfigs
def do_ifconfigs(self, _line):
display.section("Showing Interface Configuration")
sh = 'ifconfig -a'
display.subsection('Hosts')
for h in self.mn.hosts:
h.cmdPrint(sh)
display.subsection('Controller')
self.doPrint(sh)
#MARK: - Other
def do_xxx_testFlows1(self, _line):
display.section("Adding test flows to Tiny Network")
self.do('sudo ovs-ofctl add-flow s1 ip,ip_dst=10.0.0.2,actions=output:1')
self.do('sudo ovs-ofctl add-flow s1 ip,ip_dst=10.0.0.1,actions=output:4')
self.do('sudo ovs-ofctl add-flow s2 ip,ip_dst=10.0.0.1,actions=output:1')
self.do('sudo ovs-ofctl add-flow s2 ip,ip_dst=10.0.0.2,actions=output:3')
self.do('sudo ovs-ofctl add-flow s1 arp,arp_tpa=10.0.0.2,actions=output:1')
self.do('sudo ovs-ofctl add-flow s1 arp,arp_tpa=10.0.0.1,actions=output:4')
self.do('sudo ovs-ofctl add-flow s2 arp,arp_tpa=10.0.0.1,actions=output:1')
self.do('sudo ovs-ofctl add-flow s2 arp,arp_tpa=10.0.0.2,actions=output:3')
def do_xxx_traffic(self, _line):
# display.section("Monitoring sent and received packets of all hosts")
for h in self.mn.hosts:
h.cmdPrint('tcpdump -i %s' % h.defaultIntf().name)
def do_xxx_xterms(self, _line):
locals = self.getLocals()
terms = makeTerms([locals[name]
for name in ['h1', 'h2', 's1', 's2']])
self.mn.terms += terms
def do_xxx_sharks(self, line):
display.section("Launching Wireshark")
sh = 'sudo wireshark &'
locals = self.getLocals()
_nodes = line.split()
if not (_nodes):
_nodes = self.mn.keys()
for n in _nodes:
if not (locals.__contains__(n)):
break
obj = locals[n]
obj.cmdPrint(sh)
|
5,928 | cfea7848dfb41c913e5d8fec2f0f4f8afaaa09f3 | import sys
reload(sys)
sys.setdefaultencoding('utf-8')
import xml.etree.ElementTree as ET
tree = ET.parse('iliad1.xml')
root = tree.getroot()
file = open('iliad1_clean.txt','w')
for l in root.iter('l'):
file.write(''.join(l.itertext()) + "\n")
file.close() |
5,929 | 08c3155a5fbf6c94f5885c12cfc7c917313ae9c7 | from abc import ABCMeta, abstractmethod, ABC
from domain.models.network_information import NetworkInformation
class AbstractTensorboardExportService(ABC):
__metaclass__ = ABCMeta
@abstractmethod
def save_tensorboard(self, network_info: NetworkInformation) -> None: raise NotImplementedError
|
5,930 | 2678aac08104a580e866984bc4cf4adf8cb8ac5c | from __future__ import division, print_function, unicode_literals
import sys
import os
sys.path.insert(0, os.path.join(os.path.dirname(__file__), '..'))
from pyglet.gl import *
from pyglet.window import key
from cocos.actions import *
from cocos.director import director
from cocos.layer import Layer
from cocos.scene import Scene
from cocos.sprite import Sprite
from haiku import generate_haiku
from time import time
def get_steps(index):
return Scene(FontLayer(title="", subtitle='\n'.join(generate_haiku())), SpriteMoveTo(index))
class SpriteLayer(Layer):
is_event_handler = True #: enable pyglet's events
def __init__(self, index=1):
super(SpriteLayer, self).__init__()
self.index = index
self.image = pyglet.resource.image('flat-black-l.png')
self.image.anchor_x = self.image.width
self.image.anchor_y = self.image.height
def on_key_release(self, keys, mod):
# LEFT: go to previous scene
# RIGTH: go to next scene
# ENTER: restart scene
max_steps = 8
if keys == key.LEFT:
self.index -= 1
if self.index < 0:
self.index = max_steps - 1
elif keys == key.RIGHT:
self.index += 1
if self.index >= 8:
self.index = 0
if keys in (key.LEFT, key.RIGHT, key.ENTER):
director.replace(get_steps(self.index))
return True
# def on_exit( self ):
# for o in self.objects:
# o.stop()
class SpriteMoveTo(SpriteLayer):
def on_enter(self):
super(SpriteMoveTo, self).on_enter()
sprite3 = Sprite(self.image)
self.add(sprite3)
x, y = divmod(self.index, 3)
sprite3.position = x * 100 +100 , y * 100 + 100
# sprite3.do(MoveTo((620, 300), 1))
class FontLayer(Layer):
def __init__(self, title="Sprite Exmaple #", subtitle="Goto()"):
super(FontLayer, self).__init__()
self.title = title
self.subtitle = subtitle
self.batch = pyglet.graphics.Batch()
self.text_title = pyglet.text.Label(self.title,
font_size=32,
x=5,
y=director.get_window_size()[1],
anchor_x='left',
anchor_y='top',
batch=self.batch)
self.text_subtitle = pyglet.text.Label(self.subtitle,
multiline=True,
width=600,
font_size=16,
x=5,
y=director.get_window_size()[1] - 80,
anchor_x='left',
anchor_y='top',
batch=self.batch)
self.text_help = pyglet.text.Label("Press LEFT / RIGHT for prev/next test, "
"ENTER to restart test",
font_size=16,
x=director.get_window_size()[0] // 2,
y=20,
anchor_x='center',
anchor_y='center',
batch=self.batch)
def draw(self):
super(FontLayer, self).draw()
self.batch.draw()
if __name__ == "__main__":
director.init(resizable=True, caption='SuperStepper')
director.run(get_steps(1)) |
5,931 | f19056222be713c1556817d852af14d04483c9a3 | i = 0
num = ''
while len(num) < 1e6:
i += 1
num += str(i)
prod = 1
for i in xrange(0, 7):
prod *= int(num[10 ** i - 1])
print prod
|
5,932 | b3c22b4a453aa55da980b090df2749ff9f1066e6 | #game that has a timer and you need to stop the timer
#with 0 at the end.
import simplegui
#necessary global variables
#time for the timer
time = 0
#the display for the timer(string form)
watch = ''
#tries and correct presses
tries = 0
correct = 0
#changes time to watch(number to string of form A:BC.D)
def format():
global time, watch
t = time
deciseconds = t % 10
remains = t - deciseconds
seconds = (remains % 600) / 10
minutes = remains / 600
if seconds<10:
zero = '0'
else:
zero = ''
watch = str(minutes) + ":" + zero + str(seconds) + "." + str(deciseconds)
#increase the time
def increment():
global time
time = time + 1
#start the timer
def start():
timer.start()
#stop the timer + claculate the tries and correct stops
def stop():
global correct, tries
timer.stop()
if time != 0:
tries = tries + 1
if time % 10 == 0:
correct = correct + 1
#reset all values
def reset():
global time, correct, tries
time, correct, tries = 0,0,0
stop()
#necessary drawings
def draw(canvas):
format()
canvas.draw_text(str(correct), (253, 30), 30, 'white')
canvas.draw_text('/', (270, 30), 30, 'white')
canvas.draw_text(str(tries), (280, 30), 30, 'white')
canvas.draw_text(watch, (70, 130), 60,'white')
#frame and event handlers
frame = simplegui.create_frame("StOpWaTcH: gAmE", 320, 200)
button1 = frame.add_button("Start timer", start, 100)
button2 = frame.add_button("Stop timer", stop, 100)
button3 = frame.add_button("Resrt timer", reset, 100)
frame.set_draw_handler(draw)
timer = simplegui.create_timer(100, increment)
#start of the game
frame.start()
|
5,933 | f4519fa82ffc6bf945c7bb36d3761a708a06f641 | import os
from flask import Flask, jsonify, request, abort, make_response
from flask_sqlalchemy import SQLAlchemy
from .models import User
from .config import app_config
app = Flask(__name__)
app.config.from_object(app_config[os.getenv('FLASK_ENV', 'production')])
db = SQLAlchemy(app)
@app.route('/api/v1/users/<int:user_id>', methods=['GET'])
def get_user(user_id):
try:
user = User.query.filter_by(id=user_id).first()
return jsonify({'user': user.serialize})
except:
abort(404)
@app.route('/api/v1/users', methods=['POST'])
def create_user():
if not request.json or not 'firstName' or not 'lastName' in request.json:
abort(400)
user = User(request.get_json()['firstName'], request.get_json()['lastName'])
db.session.add(user)
db.session.commit()
return jsonify({'user': user.serialize}), 201
@app.errorhandler(404)
def not_found(error):
return make_response(jsonify({'error': 'Not found'}), 404)
@app.errorhandler(400)
def not_found(error):
return make_response(jsonify({'error': 'Bad Request'}), 400)
@app.errorhandler(405)
def not_found(error):
return make_response(jsonify({'error': 'Method Not Allowed'}), 405)
|
5,934 | f3aaa6ae7a9a57946bdb035a4d52e84541c1a292 | import turtle
from turtle import color
import random
screen = turtle.Screen()
screen.setup(width=500, height=400)
colours = ["red", "pink", "blue", "purple", "black", "green"]
y_pos = [100, 60, 20, -20, -60, -100]
user_bet = screen.textinput(title="Make your bet",
prompt="Which turtle will win? Choose a colour: ")
is_race_on = False
all_racers = []
class Racer(turtle.Turtle):
# def __init__(self, color, x, y):
def __init__(self, color, x, y):
super().__init__(shape="turtle")
self.color(color)
self.penup()
self.goto(x=x, y=y)
def race(self):
self.forward(random.randint(0, 10))
for i in range(0, 6):
racer = Racer(colours[i], -230, y_pos[i])
all_racers.append(racer)
if user_bet:
is_race_on = True
while is_race_on:
for racer in all_racers:
if racer.xcor() > 230:
is_race_on = False
winning_colour = racer.pencolor()
if winning_colour == user_bet:
print(
f"You won! The winning turtle colour was {winning_colour}.")
else:
print(
f"You lost! The winning turtle colour was {winning_colour}.")
racer.race()
screen.exitonclick()
|
5,935 | cc81e13bba0ea0186966bce7f5aac05bb106e971 | import sys
import os
def my_add(a, b):
return a + b
|
5,936 | d0991d8ea47379a0c1de836b5d215c99166ad049 | import sys
sys.path.append('../')
import constants as cnst
import os
os.environ['PYTHONHASHSEED'] = '2'
import tqdm
from model.stg2_generator import StyledGenerator
import numpy as np
from my_utils.visualize_flame_overlay import OverLayViz
from my_utils.flm_dynamic_fit_overlay import camera_ringnetpp
from my_utils.generic_utils import save_set_of_images
import constants
from dataset_loaders import fast_image_reshape
import torch
from my_utils import generic_utils
from my_utils.eye_centering import position_to_given_location
from copy import deepcopy
from my_utils.photometric_optimization.models import FLAME
from my_utils.photometric_optimization import util
def ge_gen_in(flm_params, textured_rndr, norm_map, normal_map_cond, texture_cond):
if normal_map_cond and texture_cond:
return torch.cat((textured_rndr, norm_map), dim=1)
elif normal_map_cond:
return norm_map
elif texture_cond:
return textured_rndr
else:
return flm_params
def corrupt_flame_given_sigma(flm_params, corruption_type, sigma, jaw_sigma, pose_sigma):
# import ipdb; ipdb.set_trace()
# np.random.seed(2)
corrupted_flame = deepcopy(flm_params)
if corruption_type == 'shape' or corruption_type == 'all':
corrupted_flame[:, :10] = flm_params[:, :10] + \
np.clip(np.random.normal(0, sigma, flm_params[:, :10].shape),
-3 * sigma, 3 * sigma).astype('float32')
if corruption_type == 'exp_jaw'or corruption_type == 'all':
# Expression
corrupted_flame[:, 100:110] = flm_params[:, 100:110] + \
np.clip(np.random.normal(0, sigma, flm_params[:, 100:110].shape),
-3 * sigma, 3 * sigma).astype('float32')
# Jaw pose
corrupted_flame[:, 153] = flm_params[:, 153] + \
np.random.normal(0, jaw_sigma, corrupted_flame.shape[0])
if corruption_type == 'pose' or corruption_type == 'all':
# pose_perturbation = np.random.normal(0, pose_sigma[i], (corrupted_flame.shape[0], 3))
# corrupted_flame[:, 150:153] += np.clip(pose_perturbation, -3 * pose_sigma[i], 3 * pose_sigma[i])
pose_perturbation = np.random.normal(0, pose_sigma, (corrupted_flame.shape[0],))
corrupted_flame[:, 151] = flm_params[:, 151] + \
np.clip(pose_perturbation, -3 * pose_sigma, 3 * pose_sigma)
return corrupted_flame
# General settings
save_images = True
code_size = 236
use_inst_norm = True
core_tensor_res = 4
resolution = 256
alpha = 1
step_max = int(np.log2(resolution) - 2)
num_smpl_to_eval_on = 128
use_styled_conv_stylegan2 = True
flength = 5000
cam_t = np.array([0., 0., 0])
camera_params = camera_ringnetpp((512, 512), trans=cam_t, focal=flength)
# Uncomment the appropriate run_id
run_ids_1 = [29, ] # with sqrt(2)
# run_ids_1 = [7, 24, 8, 3]
# run_ids_1 = [7, 8, 3]
# run_ids_1 = [7]
settings_for_runs = \
{24: {'name': 'vector_cond', 'model_idx': '216000_1', 'normal_maps_as_cond': False,
'rendered_flame_as_condition': False, 'apply_sqrt2_fac_in_eq_lin': False},
29: {'name': 'full_model', 'model_idx': '294000_1', 'normal_maps_as_cond': True,
'rendered_flame_as_condition': True, 'apply_sqrt2_fac_in_eq_lin': True},
7: {'name': 'flm_rndr_tex_interp', 'model_idx': '051000_1', 'normal_maps_as_cond': False,
'rendered_flame_as_condition': True, 'apply_sqrt2_fac_in_eq_lin': False},
3: {'name': 'norm_mp_tex_interp', 'model_idx': '203000_1', 'normal_maps_as_cond': True,
'rendered_flame_as_condition': False, 'apply_sqrt2_fac_in_eq_lin': False},
8: {'name': 'norm_map_rend_flm_no_tex_interp', 'model_idx': '009000_1', 'normal_maps_as_cond': True,
'rendered_flame_as_condition': True, 'apply_sqrt2_fac_in_eq_lin': False},}
overlay_visualizer = OverLayViz()
# overlay_visualizer.setup_renderer(mesh_file=None)
flm_params = np.zeros((num_smpl_to_eval_on, code_size)).astype('float32')
fl_param_dict = np.load(cnst.all_flame_params_file, allow_pickle=True).item()
np.random.seed(2)
for i, key in enumerate(fl_param_dict):
flame_param = fl_param_dict[key]
shape_params = np.concatenate((np.random.normal(0, 1, [3,]), np.zeros(97))).astype('float32')
exp_params = np.concatenate((np.random.normal(0, 1, [3,]), np.zeros(47))).astype('float32')
# +- pi/4 for bad samples +- pi/8 for good samples
# pose = np.array([0, np.random.uniform(-np.pi/4, np.pi/4, 1), 0,
# np.random.uniform(0, np.pi/12, 1), 0, 0]).astype('float32')
pose = np.array([0, np.random.uniform(-np.pi / 8, np.pi / 8, 1), 0,
np.random.uniform(0, np.pi / 12, 1), 0, 0]).astype('float32')
texture = np.random.normal(0, 1, [50]).astype('float32')
# texture = flame_param['tex']
flame_param = np.hstack((shape_params, exp_params, pose, flame_param['cam'],
texture, flame_param['lit'].flatten()))
# tz = camera_params['f'][0] / (camera_params['c'][0] * flame_param[:, 156:157])
# flame_param[:, 156:159] = np.concatenate((flame_param[:, 157:], tz), axis=1)
# import ipdb; ipdb.set_trace()
flm_params[i, :] = flame_param.astype('float32')
if i == num_smpl_to_eval_on - 1:
break
batch_size = 32
num_sigmas = 1
corruption_sigma = np.linspace(0, 1.5, num_sigmas)
jaw_rot_range = (0, np.pi/8)
jaw_rot_sigmas = np.linspace(0, (jaw_rot_range[1] - jaw_rot_range[0])/6, num_sigmas)
pose_range = (-np.pi/3, np.pi/3)
pose_sigmas = np.linspace(0, (pose_range[1] - pose_range[0])/6, num_sigmas)
config_obj = util.dict2obj(cnst.flame_config)
flame_decoder = FLAME.FLAME(config_obj).cuda().eval()
for run_idx in run_ids_1:
# import ipdb; ipdb.set_trace()
generator_1 = torch.nn.DataParallel(
StyledGenerator(embedding_vocab_size=69158,
rendered_flame_ascondition=settings_for_runs[run_idx]['rendered_flame_as_condition'],
normal_maps_as_cond=settings_for_runs[run_idx]['normal_maps_as_cond'],
apply_sqrt2_fac_in_eq_lin=settings_for_runs[run_idx]['apply_sqrt2_fac_in_eq_lin'],
core_tensor_res=core_tensor_res,
w_truncation_factor=1.0,
n_mlp=8)).cuda()
model_idx = settings_for_runs[run_idx]['model_idx']
ckpt1 = torch.load(f'{cnst.output_root}checkpoint/{run_idx}/{model_idx}.model')
generator_1.load_state_dict(ckpt1['generator_running'])
generator_1 = generator_1.eval()
params_to_save = {'cam': [], 'shape': [], 'exp': [], 'pose': [], 'light_code': [], 'texture_code': [],
'identity_indices': []}
for i, sigma in enumerate(corruption_sigma):
images = np.zeros((num_smpl_to_eval_on, 3, resolution, resolution)).astype('float32')
flame_mesh_imgs = np.zeros((num_smpl_to_eval_on, 3, resolution, resolution)).astype('float32')
pbar = tqdm.tqdm(range(0, num_smpl_to_eval_on, batch_size))
pbar.set_description('Generating_images')
# print(flm_params[1, :])
for batch_idx in pbar:
flm_batch = flm_params[batch_idx:batch_idx+batch_size, :]
flm_batch = torch.from_numpy(flm_batch).cuda()
# flm_batch = eye_cntr_reg.substitute_flame_batch_with_regressed_camera(flm_batch)
flm_batch = position_to_given_location(flame_decoder, flm_batch)
if settings_for_runs[run_idx]['normal_maps_as_cond'] or \
settings_for_runs[run_idx]['rendered_flame_as_condition']:
batch_size_true = flm_batch.shape[0]
cam = flm_batch[:, constants.DECA_IDX['cam'][0]:constants.DECA_IDX['cam'][1]:]
shape = flm_batch[:, constants.INDICES['SHAPE'][0]:constants.INDICES['SHAPE'][1]]
exp = flm_batch[:, constants.INDICES['EXP'][0]:constants.INDICES['EXP'][1]]
pose = flm_batch[:, constants.INDICES['POSE'][0]:constants.INDICES['POSE'][1]]
# import ipdb; ipdb.set_trace()
light_code = \
flm_batch[:, constants.DECA_IDX['lit'][0]:constants.DECA_IDX['lit'][1]:].view((batch_size_true, 9, 3))
texture_code = flm_batch[:, constants.DECA_IDX['tex'][0]:constants.DECA_IDX['tex'][1]:]
params_to_save['cam'].append(cam.cpu().detach().numpy())
params_to_save['shape'].append(shape.cpu().detach().numpy())
params_to_save['shape'].append(shape.cpu().detach().numpy())
params_to_save['exp'].append(exp.cpu().detach().numpy())
params_to_save['pose'].append(pose.cpu().detach().numpy())
params_to_save['light_code'].append(light_code.cpu().detach().numpy())
params_to_save['texture_code'].append(texture_code.cpu().detach().numpy())
norma_map_img, _, _, _, rend_flm = \
overlay_visualizer.get_rendered_mesh(flame_params=(shape, exp, pose, light_code, texture_code),
camera_params=cam)
# import ipdb; ipdb.set_trace()
rend_flm = torch.clamp(rend_flm, 0, 1) * 2 - 1
norma_map_img = torch.clamp(norma_map_img, 0, 1) * 2 - 1
rend_flm = fast_image_reshape(rend_flm, height_out=256, width_out=256, mode='bilinear')
norma_map_img = fast_image_reshape(norma_map_img, height_out=256, width_out=256, mode='bilinear')
# Render the 2nd time to get backface culling and white texture
# norma_map_img_to_save, _, _, _, rend_flm_to_save = \
# overlay_visualizer.get_rendered_mesh(flame_params=(shape, exp, pose, light_code, texture_code),
# camera_params=cam, cull_backfaces=True, constant_albedo=0.6)
# Back face culling temporarily un-availabe
norma_map_img_to_save, _, _, _, rend_flm_to_save = \
overlay_visualizer.get_rendered_mesh(flame_params=(shape, exp, pose, light_code, texture_code),
camera_params=cam, cull_backfaces=False, constant_albedo=0.6)
rend_flm_to_save = torch.clamp(rend_flm_to_save, 0, 1) * 2 - 1
# rend_flm_to_save = rend_flm
# norma_map_img_to_save = torch.clamp(norma_map_img, 0, 1) * 2 - 1
rend_flm_to_save = fast_image_reshape(rend_flm_to_save, height_out=256, width_out=256, mode='bilinear')
# norma_map_img_to_save = fast_image_reshape(norma_map_img, height_out=256, width_out=256, mode='bilinear')
else:
rend_flm = None
norma_map_img = None
gen_1_in = ge_gen_in(flm_batch, rend_flm, norma_map_img, settings_for_runs[run_idx]['normal_maps_as_cond'],
settings_for_runs[run_idx]['rendered_flame_as_condition'])
# torch.manual_seed(2)
identity_embeddings = torch.randint(low=0, high=69158, size=(gen_1_in.shape[0], ), dtype=torch.long,
device='cuda')
mdl_1_gen_images = generic_utils.get_images_from_flame_params(
flame_params=gen_1_in.cpu().numpy(), pose=None,
model=generator_1,
step=step_max, alpha=alpha,
input_indices=identity_embeddings.cpu().numpy())
params_to_save['identity_indices'].append(identity_embeddings.cpu().detach().numpy())
# import ipdb; ipdb.set_trace()
images[batch_idx:batch_idx+batch_size_true] = torch.clamp(mdl_1_gen_images, -1, 1).cpu().numpy()
# if flame_mesh_imgs is None:
flame_mesh_imgs[batch_idx:batch_idx+batch_size_true] = torch.clamp(rend_flm_to_save, -1, 1).cpu().numpy()
if save_images:
mdl_name = settings_for_runs[run_idx]['name']
for key in params_to_save.keys():
params_to_save[key] = np.concatenate(params_to_save[key], axis=0)
save_dir = os.path.join(cnst.output_root, 'sample', str(run_idx), f'random_samples_q_eval_{mdl_name}')
os.makedirs(save_dir, exist_ok=True)
np.save(os.path.join(save_dir, 'params.npy'), params_to_save)
save_path_current_id = os.path.join(save_dir, 'images')
save_set_of_images(path=save_path_current_id, prefix='', images=(images + 1) / 2, show_prog_bar=True)
#save flam rndr
save_path_current_id_flm_rndr = os.path.join(save_dir, 'conditions')
save_set_of_images(path=save_path_current_id_flm_rndr, prefix='mesh', images=(flame_mesh_imgs + 1) / 2,
show_prog_bar=True)
|
5,937 | 337309da79ce9d90010fef5c171b6b344e6dc63f | """Test Spotify module"""
from spoetify.spotify import Spotify
from nose.tools import assert_equal
def test_search_track():
sp = Spotify()
t = sp.search_track("avocado")
assert_equal(t.id, "1UyzA43l3OIcJ6jd3hh3ac")
|
5,938 | 006e1088e72201fab7eebd1409c025b5dba69403 | # Definition for a binary tree node.
# class TreeNode(object):
# def __init__(self, x):
# self.val = x
# self.left = None
# self.right = None
class Codec:
def serialize(self, root):
"""Encodes a tree to a single string.
:type root: TreeNode
:rtype: str
"""
if(not root) :
return "X"
else :
return ",".join([str(root.val), self.serialize(root.left), self.serialize(root.right)])
# Q = [root]
# res = []
# while(Q) :
# newQ = []
# noChange = True
# while(Q) :
# v = Q.pop(0)
# if(v == None) :
# res.append(' ')
# newQ.append(None)
# newQ.append(None)
# else :
# res.append(str(v.val))
# if(v.left == None) :
# newQ.append(None)
# else :
# noChange = False
# newQ.append(v.left)
# if(v.right == None) :
# newQ.append(None)
# else :
# noChange = False
# newQ.append(v.right)
# if(noChange) :
# break
# Q = newQ
# return ','.join(res)
def deserialize(self, data):
"""Decodes your encoded data to tree.
:type data: str
:rtype: TreeNode
"""
self.data = data
if(data[0] == "X") :
return None
else :
t = TreeNode(int(self.data[: self.data.find(",")]))
t.left = self.deserialize(self.data[self.data.find(",") + 1 :])
t.right = self.deserialize(self.data[self.data.find(",") + 1 :])
return t
# arr = data.split(",")
# l = len(arr)
# if(l == 0 or arr[0] == " ") :
# return None
# t = TreeNode(int(arr[0]))
# Q = [t]
# half = (l + 1) / 2 - 1
# i = 0
# while(i < half) :
# v = Q.pop(0)
# if(v == None) :
# i += 1
# Q.append(None)
# Q.append(None)
# continue
# if(arr[2 * i + 1] == ' ') :
# v.left = None
# Q.append(None)
# else :
# l = TreeNode(int(arr[2 * i + 1]))
# v.left = l
# Q.append(l)
# if(arr[2 * i + 2] == ' ') :
# v.right = None
# Q.append(None)
# else :
# r = TreeNode(int(arr[2 * i + 2]))
# v.right = r
# Q.append(r)
# i += 1
# return t
# Your Codec object will be instantiated and called as such:
# ser = Codec()
# deser = Codec()
# ans = deser.deserialize(ser.serialize(root)) |
5,939 | 7d1ca15129b1bf6b713e1d5eda4436d4a8539ad1 | import numpy as np
class nearest(svm):
name="MLLKM2"
def __init__(self):
svm.__init__(self)
def fit(self,x,y):
self.x=x
self.y=y
def predict(self,x):
diff=np.subtract(x,self.x)
distance=np.linalg.norm(diff,axis=1)
dmin= np.argmin( distance )
return self.y[dmin] |
5,940 | 4dac8e7e695c473cb73ceaf3887373bcc0a08aff | # from datetime import datetime
from datetime import datetime, time, timedelta
# today = datetime.now()
# previous_day = today - timedelta(days=1)
# previous_day = previous_day.strftime("%Y%m%d")
# print(today)
# print(previous_day)
print(datetime.strptime("2013-1-25", '%Y-%m-%d').strftime('%Y-%m-%d 00:00:00'))
# def is_midnight():
# current_time = datetime.now().time
# match_date = datetime.now()
# # current_time = datetime.now()
# if current_time >= time(0,0) and current_time <= time(4, 30):
# print(match_date)
# return match_date.strftime("%Y%m%d")
# else:
# match_date = current_time - timedelta(days=1)
# return match_date
# print(is_midnight())
# def is_midnight():
# current_time = datetime.now().time()
# # today = datetime.now()
# previous_day = current_time - timedelta(days=1)
# previous_day = previous_day.strftime("%Y%m%d")
# if current_time >= time(0,0) and current_time <= time(4, 30):
# print('yesy')
# if time(0,0) < time(4, 30):
# return current_time >= time(0,0) and current_time <= time(4, 30)
# else: # crosses midnight
# return current_time >= time(0,0) or current_time <= time(4, 30)
# print(is_midnight())
# match_date = datetime.now()
# current_time = datetime.now().time()
# if current_time >= time(0,0) and current_time <= time(4, 30):
# previous_day = match_date - timedelta(days=1)
# match_date = previous_day.strftime("%Y%m%d")
# print(match_date)
# match_date = datetime.now().strftime("%Y-%m-%d")
# # datetime.timedelta(days=1)
# hour = datetime.now().strftime("%H")
# if int(hour) < 4:
# print('Previous day: %s' % (datetime.timedelta(days=1)))
# else:
# print(match_date)
# print(datetime.now().strftime("%Y-%m-%d %H:%M:%S"))
# import cx_Oracle
# connection = None
# try:
# connection = cx_Oracle.connect(
# 'JW',
# '901203',
# 'HOME-PC/XE',
# encoding='UTF-8')
# # show the version of the Oracle Database
# print(connection.version)
# c = connection.cursor()
# c.execute('SELECT MATCH_ID,MATCH_DATETIME,LEAGUE,HOME_TEAM,AWAY_TEAM,HOME_FT_GOAL,AWAY_FT_GOAL,CASE WHEN HOME_FT_GOAL > AWAY_FT_GOAL THEN \'H\' WHEN HOME_FT_GOAL = AWAY_FT_GOAL THEN \'D\' ELSE \'A\' END HDA_RESULT,DRAW_MEAN,DRAW_MEDIAN,O_MACAU_D,O_BET365_D,O_HKJC_D,AWAY_MEAN,AWAY_MEDIAN,O_MACAU_A,O_BET365_A,O_HKJC_A,HKJC_ASIAN_HANDICAP,HKJC_ASIAN_AWAY FROM HDA_MEAN_VIEW WHERE MATCH_HANDICAP=\'ไธ็ค\' AND HOME_IND=0 AND DRAW_IND=1 AND AWAY_IND=1 ORDER BY MATCH_DATETIME DESC')
# for row in c:
# print(row[0],',',row[1])
# except cx_Oracle.Error as error:
# print(error)
# finally:
# # release the connection
# if connection:
# connection.close()
|
5,941 | 2a500968cf6786440c0d4240430433db90d1fc2f | n = int(input())
p = [220000] + list(map(int, input().split()))
cnt = 0
m = 220000
for i in range(1, n+1):
now = p[i]
m = min(m, now)
if now == m:
cnt += 1
print(cnt) |
5,942 | 29c1a989365408bf5c3d6196f7afc969be63df85 |
def patternCount(dnaText, pattern):
count = 0
for i in range(0, len(dnaText) - len(pattern)):
word = dnaText[i:i+len(pattern)]
if (word == pattern):
count = count + 1
return count
def freqWordProblem(text, k):
countWords = []
for i in range(0, len(text) - k):
pattern = text[i:i+k]
countWords.append(patternCount(text, pattern))
maxCount = 0
indexes = []
for j in range(0, len(countWords)):
count = countWords[j]
if (count == maxCount):
indexes.append(j)
elif (count > maxCount):
indexes = [j]
maxCount = count
result = set()
for index in indexes:
result.add(text[index:index+k])
return list(result)
mapDNA = {
"A": "T",
"G": "C",
"T": "A",
"C": "G"
}
def complimentDNA(text):
result = ""
for letter in text:
result = result + mapDNA[letter]
return result[::-1]
def patternFind(text, pattern):
index = []
for i in range(0,len(text)-len(pattern)):
word = text[i:i+len(pattern)]
if word == pattern:
index.append(i)
return index
for word in patternFind("AATGGTCGAAGCGCCACTGCGCCACGACTAAACGCGCCACTAAATCTCCATCAGAGCGCCACTGCGCCACGTGGCGCCACTAGCGCCACCCGTTGGCGCCACTGGGCGCCACGCGCCACGCGCGCCACGCGCCACTGCGCCACCTGAGTAGCGCCACATAGACCGGCGCCACTAAGCGCCACTGCGCCACAGAGGGCGCCACTAACTGCGCCACGCGCCACGTGCGCGCCACGGGCGAACGTTGCGCCACCTTGCCCCGCGCCACGCGCCACGCGCCACGCGCCACCGGGGGCATTGCGCCACGCGCCACGCGCCACCCCGCGCCACGTGTGCCGCGCCACAGCGCCACTTGGCGCGCCACACGCGCCACGCGCCACCTAGCGCCACATAGCGCCACGCGCCACGCGCCACGGCGCCACGCGCCACGCGCCACATCTGCGCCACCAGCGCCACGAGCGCCACCATACTGGCGCCACAGCGCGCCACGGCGCCACGCGCCACCCATGCGCCACATAGCCTGTGCGCCACGCGCCACGCGCCACGCGCCACGGCGCCACCGCGCCACTGAGCGCCACCCCTAGGCGCCACGCGCCACGCGCCACTGCGCCACGCGCCACGAGGGGGTGCGCCACACGGCCCCAGCGCGAGAGTGCGCCACGCGCCACGCGCCACGCGCCACCGCGCCACGCGGCGCCACGCGCCACATCGGGCGCCACTTAAGCCTTGGATTTGCGCCACGGCGGGCGCCACGCCAGCGCCACGTCACAGCGGGCGCCACACGCGCCACTGCGCCACGCGCCACAGCGCGCCACGGCGCCACGAAACGCGCCACCCGGCGCCACGCGCCACTACAAGCGCCACAAGGCGCGCCACTGGCGCCACTGCGCCACACAGGCGCCACGCGCCACGCGCCACATGCGCCACAGGCGCCACGGGGCGCGCCACTTCGCGCCACGCGCCACGGCGCCACGCGCCACAGCGCCACCCTCGCGCCACCGCGCCACGCGCCACGCGCCACGCGCCACGGGCGCCACTCGCGCCACTTCGCGCCACGCGCCACTTCGGGCGCCACGCGCCACGAAATGCGCCACCTGAGGCGCCACTGCGCCACGCGCCACCAGCGCCACAGCGCCACGGGCGCGCCACGCGCCACTCCGCGCCACCGCGCGCCACGCGCCACGAAGCGCCACGCGCCACTGCGCCACACCTGGATAAGCGCCACTGCGCCACACGCTGCGCCACGGCGCCACTGGGGCGCCACGCGCCACAGCGCCACGCGCCACGCTCGCGCCACGCGCCACGTGCGCCACTCCGCGCCACATTTGCGCCACGCGCCACAAGCGCCACGGTGCGCCACTACATGTGTGGTGCGCCACACGAGCGCCACGTCTGTTCACGCGCCACCCTATAGGCGCCACTCAGCGCCACAGCGCCACCTGTAGTGCGCCACGCGCCACCAGGCGCCACCCAGGCGTGCCGTGAGATAGCGCCACGGCGCCACAGCGCCACGCGCCACTCGCGCCACGTGCGCCACCGCGCCACTTTCGCGCCACCCAGCGCCACGCGCCACTAGCGCCACGCGCCACGCGCCACATGCGCCACCCGCGCCACGTGCGCCACTAGATCGCGCCACTCCGGCGCCACGCGCCACTACGCGCCACACGCGCCACAGCGCCACTCTGAAATTCGCGCCACGCGCCACGCGCCACGAGCGCCACTCGCGCCACAAGCGCCACGCGCCACACCCGCGCCACGCGCCACGCGCCACGCTCTGTTGCGCCACGCGCCACGGCGCCACGCGCCACGCGCCACGGCTTGGTTGCGCCACAGCGCCACGGCGCCACGCGCCACTCACCGAAGTGATGGCGCCACACGAGGAGGCGCCACAGCGCCACTGCGCCACTGCGCCACTGCGCCACGCGCCACTTGGCGCGCCACTGGCGCCACGCGCCACAGCGCCACTACGCGCCACCGCGCCACGCGCCACTGCGCCACCGCGCCACGCGCCACGGCGCCACTGATGCGCCACCGCGCCACTGTCGTGCGCCACGTCTGGGCTACGGCGCCACCGCGCCACATGGGGCGCCACGACGCGCCACCGGCGCCACACGCGCCACGTGCGCCACCGGCGCCACCGCGCCACTGAGCGCCACACTGCTTGCGCCACATAGAGGCGCCACGCGCCACGCGCCACGCGCCACGGCGCCACGCGCCACAATTCTGCCATCTGCGGTCGCGCCACGGTATTTTGCGCCACGCGCCACCCTAGGCGCCACTAGCGCCACAAGCGCCACTCGGCGCCACCCTCAGGCGCCACAGCGCCACTACAGCGCCACTGCGCGCCACGCGCCACGCGCCACATTGCCTCAGCGCCACGGCGCCACGCGCTGTAGCGCCACGCGCCACGTTGCGCCACATGCGCCACACATGCGCCACCCTTGCGCCACGCGCCACCAAAGCGCCACGGCGCCACGCGCCACCTGACGGTGGCGCCACCCCTGCTCTTTGCGCCACGGCGCCACGCGCCACTAGCGCCACGCGCCACGCGCCACTGCGCCACAATGTGCGCCACCCCTCTAGGCGCCACTGCGCCACGGCGCCACGGCGCCACGTAGCGCCACGCGCCACGCGCCACCAGTCAATCGGCGCCACCATTCGGCCCGACGCGCCACGCGCCACTGCGCCACGGGCGCCACCATAACGGCGCCACGCGCCACGCGCCACTTGGTTTGATAGCCTGCGCCACAGCGCCACGGCGGCGCCACGTGTAGCGCCACGCGCCACCTTATGCGCCACGCGCCACGCGCCACGAGCGCCACGCGCCACCTTAATTAGCGCCACATAGCGCCACTGCGCCACGCGCCACCAAGATACAAGCGCCACTGGGCGCCACGCGCCACGCGCCACGCGCCACTGCTGCAGGCAGCGCCACCACAGGCGCCACTAGCGCCACTTGAGGCGCCACCGCGCCACTAGAGCGCCACGCGCCACTGGCGCCACTCCCGTCGGCGCCACCGCGCCACAGAGCGCCACCTGCGCCACGCGCCACTCGCGCCACCGTCACGCGCCACAGGCGCGCCACCCCGGCGCCACTGCGCCACTCTAGCGCCACTGCGCGCCACATATGGCGCCACCTACAACAGCGCCACACGCGCCACGCTATTCGCGCCACGCGCCACCGAGCGCCACGCGCCACATATACTCCTATTTGCGCCACGCGCCACCGTGGCGCCACGCGCCACCAGCGCCACTTGGTGCGCCACCCAAGCGCCACCTGCGCCACAGCGCCACTCGCGCCACGATAGATTTGCAAGCGCCACGTCCCGCGCCACAAGCGCCACTCTGCGCCACCGCGCCACGCGCCACTCTATGGCGCCACCGGCGCCACGCGCCACCCAGGCGCCACTCGCGCCACAGCGCCACGCGCGCCACTTCTTAGGCGCCACGCGCCACCAGGCGCCACTCTGCGCGCCACGTAGCGCCACTCGTGCGCCACTTTCGGCATGCGCGCCACATAGGCGCCACGGCGCCACCCCTGGCGCCACAGCGCCACGCGCCACTAGGGCGCCACTCGGCTCGAGCGCCACGCGCCACCGCGCCACTCGCGCCACGCGCCACGCGCCACATCTGCGCCACGCGCCACGCGCCACAGCGCCACCGCGCCACTTGGGCTATGGCGCCACGAAGCGCCACGGCGCCACGTGCGCCACCTAACGCGCCACAGCGCCACGCGCCACATGTCGCCCAGCGCCACCGCGCCACGGCGCCACCGCGCCACCCACGCCGCGCCACTGCGCCACAGCGCCACGGCGCCACGCGCCACATGCGCCACGCAGCGCCACCCCTCCGCCGCGCCACCGGTGCGCCACGCGCCACGCGCCACTTGGCGCCACGCTTCTGCGCCACGGCGCCACCAGCGCCACTAAGCGCCACAGCGCCACCAGCGCCACAAGGGCGCCACTAATGCGCCACAAGCGCCACGCGCCACGCGCCACGCGCCACCGCGCCACGCGCCACACCGTCCGCGCCACCTGCGCCACAGGCGCCACGTTTTCTTACTGTATAATAGCGCCACTTCGCGCCACGCGCCACGGGCGCCACGAATGTGTGCGCCACGTCGTGCGCCACGCGCCACGCGCCACTGGGCGCCACGCGCCACCCCCCCGCGCCACTAGCGCCACGCGCCACGCGCCACTGAATTGTAGCGCCACGCGCCACGCGCGCCACTCTATAGGCAAATTGGGCGCCACGCGCCACTATGGTAGTCGTGCGCCACTGCGCCACGCGCCACGCTGCGCCACGCGCCACTGCGCCACGCGCCACGCGCCACGGCGCCACGCGCCACGCGCCACCACGCGCCACCTCGCGCGCCACGCGCCACCTAGTAGCGCCACAGCGCCACGAGCGCCACCAGCGCCACGGAAGGCGCGCCACAGGCGCCACTTAGCGCCACCGGCGCCACGCGCCACAGCGCCACTGTGCGCCACGCGCCACGCGCCACTGCGCCACGCCAAATGCGCGCCACCCGCGCCACAAGCGCCACATTGGGGGTCTTAGCGCCACATCGCGCCACGCGCCACCAAATTGCGCGCCACACAGGTCGCGCCACTTCGTCCAGGCGCCACTTCAGCGCCACGGCGCCACGCGCCACGCGCCACTCCGAGCGCCACTGTGCGCCACAGACAGCTCCGCGCCACGGGAGGGGCGCCACATTTTAGCGCCACGCGCCACGCGTTTTGAGCGCCACTGCGCCACCGGAAAGCGCCACTGCTGAGGCGCCACCACAGCGCCACCGCGCCACGCACTGGCGCCACGATATGCGCCACCGCGCCACCGCGCCACAAGGGCGCCACGCGCCACCTAGACGCGCCACGAAAGCGCCACCACTATGCGCCACTCGGCGCCACGCGCCACCACAGGAAAGTATGCGCCACAAAACTGCGCCACGCGCCACGCGCCACGCGCCACGGATTGCGCCACGCGCCACGCGCCACCACGCGCCACGTCCCTGGCGCGCCACGCGCCACGCGCCACGGCGCCACAATGCGCCACATGCGCCACAGGCGCCACCGCGCCACTGCGCCACGCGCCACTGCGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACTAGGCGCCACACTGCGCGCCACGCTACGGAGGACCGATAGCGCCACAGCGCCACGATAGCGCCACGCGCCACGAGTTCTGCGCCACAATGGCCTAGTCGCGCCACCGCGCCACTTACGCGCCACTGCGCCACGCGCCACTTGCGCCACGGCGCCACGCGCCACTGGCGCCACGCGCCACCTCCCGCTGCGCCACGCGCCACTATCCGTGCGCCACGCGCCACTGGCGCCACGCGGCGCCACTGCGAAGTAATCGCGCCACAGCGCCACGCTAAGCGCCACATGCGCGGTGTGCGCCACGCGCCACGCGCCACTCAAGCGCCACAAGCGCCACGAGCGCCACGCGCCACGCGCCACTAAGCGCCACGGCGCCACTTTAATATGCGCCACAAAGCGCCACTGCGCCACCTGCTGCGCCACATCACGCGCCACGAGCGCCACAGTTGCGCGCCACATAATGGGCGCCACGGCCCGTTGAGCGCCACGCGCCACGCGCCACAGTGCCACCCGCGCCACACGCGCCACAGTCGCGCCACGGCGCCACCGGGTTATTATGCGCCACGTGCGGTCGCGCCACTGCGCCACGCGCGCCACAAGCGCCACTCGGATGGCGCCACTTCTGTGGCGCCACGCGCCACACTGCGCCACAGCGCCACGCGCCACACGCGCCACCGCGCCACCGAGTATTAGCGCCACTGCGCCACAAGATGGCGCCACGCGCCACCAGGCGCCACTCGCGCCACGGCGCCACGCGCCACGCGCCACGCGCCACCGCGCCACCTGCGCCACAAGGGGCGCGCCACGCGCCACGCGCCACAGGACCATCGGCGCCACGTCATGGCGCCACCTGGGTCCATGCGCGCCACCTCCTGCGCCACAGCGCCACCGTCTAAAGCGCCACGAGCGCCACGGCGCCACGCGCCACAGCGCCACGCGCCACCTTCACCGAGTCCGCAGGCGCCACCGTCATAATTGAGTGCGCCACCCCATGCCGCGCCACATAGCGCCACGCTGGCGCCACGGCGCCACGCGCCACGCGCGCCACAGCGCCACGCGCCACACGCGCGCCACAGCGCCACGCGCCACTGTATCGCGCCACGAGCGCCACGTGTGCCACCTACGCTATGCGCCACAAGCGCCACGAGCGCCACAAAGCGCCACTGCGCCACTGGCGCCACTGTGGCAGCGCCACTCGCGCCACTGAAGCGCCACAGCGCCACGGCGCCACGCGCCACCCGGATGCGCCACAGCGCCACATGCGCCACTGCGCCACCATGCTGCGCCACAGCGCCACAGTCGCGCCACTGCGCCACGCGCCACCTCGCGCCACTTGCGCCACGCGCCACGCTGGCAGCGCCACTGCGCCACACAAGATTTCTGAGCGCCACCGACCCCTATAAGCGCCACTGAAGGTGCGCCACGCGCCACTCGCGCCACCTAAGGCGCCACTCTGCGCCACGTGCGCCACCCCTGCGCCACTGCGCCACCTGCGCCACTGAGCGCGCCACGGGCGCCACGCGCCACCCTGCGCCACTGCGCCACTGCGCCACGCTGCGCCACCTGAACTTGGCGCCACGTAGCGCCACGCGCCACGCGCCACCGCGCCACGCGCCACTCGCGCCACTCGTGCGCCACAAGAGCGCCACTGGTTAAGCGATTTGCGCCACGCGCCACACTTGCGCCACGCGCCACAAGTCGGGGCGCCACCTCGCCCCTCGCGCCACTAGCGCCACGCGCCACCACCTGAAAGCGCCACACTACTAGGCGCCACAGGCGCCACGCGCCACGCGCCACCGTCTGCGCCACGCGCGCCACCAGCGCCACAGGGTGCGCCACCGCGCCACGCGCCACCGCGCCACGCGCCACTCCCGGTCAGGGGCGCCACAAAAGGCGCCACAGGGAGGTTCTATCCGCGCCACACACGCGCCACGACGAACATGCGCGCCACTGCGCCACCGCGCCACTAAGCGCCACGGGCGCCACGCGCCACCTAGTCGCGCCACAAAGTGATCGCGGCGCCACCTGCGCCACCGGCGCCACCCAAGCGCCACTTAGGCGCCACGTGCGCCACCCTTGCGCCACCTTGCGCCACCGCGCCACGGCGCCACTCGTGGTGCGCCACTGCCCGCGCCACATAGCGCCACCCGAGCGCCACAGCGTGTTATTTGCGCCACAGCGCCACGCGCCACTGCGCCACGCATGCCGCGCCACAGTGCGCCACGACGCGCCACTGCGCCACGTCGTCTTCGCGCCACTTGACCGACATTTGCCTAGCGCCACCGCGCCACGGCGCCACGGCGCCACCAGCCGATTGCTTTCTTGTTCCACAGGTGCGCCACTGGCGCCACAGAGCGCCACCGGCGCCACGGCGCCACTGCGCCACGCGCCACGCGCCACATGCGCCACTAGCGCCACGCGCCACCCCGCGCCACTGCGCCACATGGCGCCACCAAAGGGTTGCGCCACTTGCGCCACTGCGCCACTCGCGCCACGTTTGCCGCGCCACAAGGCGCCACTTGCGCCACGCGCCACTGCGCCACGTTACCGCCGCGCCACTTAAACCCTGCTTGCGCCACCTGCGCCACGCGCCACGCGCCACAAAACTAGCGCCACTTCAGTACGCGCCACAGCGCCACCTCTCAGCGCGCCACCATCTGGCGCCACACGTGGCGCCACTGCGCCACAGCGCCACTGTGCGCCACCGCGCCACATTTAGCGCCACCAGCGCCACGGCTGCGCCACCCCCCCTTTGCGCCACAAAGCGCCACGCCAGCGCCACTTGGCGCCACAGCGCCACGGGCGGCGCCACGCGCCACGCGCCACGGCGCCACGCGCCACAGAAAAGCGCCACAGAGCGCCACAAATCTGGCAGCAGCGCCACAAGTGCGCCACCGCGCCACGAAAGAGGACCCAGCGCCACAGCGCCACATGCGCCACGTGCGCCACGCGCCACTGTGATCGCGCCACGCGCCACGCGCCACCAGAATAGCGCCACAGCGCCACCGCGCCACAGCGCCACAAGGTTCACTGGCGCCACGCGCCACCGCGCCACTCGCGCCACCGGCGCCACCGACCGCGCCACTATGCGCCACCATGCGCCACGCGCCACCTGCGCCACGAGCGCCACAGCGCCACCTTTATGCGCCACGCACCGCGCCACGAGCTTGCGCCACTTTCGCGCCACGCGCCACCTTTATAAAGCGCCACTCGCTGCGCCACGCGCCACCTAATCGCGCCACTGGCGCCACGCGCCACCTGCGCCACGCAAGGCGCCACGGCGCCACAGCGCCACGCGCCACTCGGCGCCACGGAGGCGCCACAGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACGCGCCACGTGATAAGCGCCACAGACTCGCGGCGCCACTTCTGCGCCACGCGCCACTCGGGCGCCACAATGCGCCACGGCGCCACACGCGCCACAGGCGCCACCTGTTGCGCCACCGCGCCACGGCTCAATGCGCCACTAGGCGCCACTGCGCCACGCGCCACTTGCGCCACGCGCCACCCATGTATGCGCCACGCGCCACGTGGTGGGCGCCACTTCTCGTGCGCCACAACTCCATAAAACGGCGCCACCGCGCCACACAGCGCCACAGCGCCACGTTCAGCGCCACTTGGCGCCACTGCGCCACCGCGCCACTGTGCGCCACCGCGCCACGCGCCACGTGGCGCCACGCGCCACTGCGCCACTTGCGCCACAGCGCCACGCTACTTAGTCGTGGCGCCACTTGTGTGGCACCATTAGCGAGGGCGCCACGGCGCCACCAAGCGCCACTAAATGGTGGGCGGCGCCACTGCGCCACTTGCGCCACTTAGCGCCACCTAGCGCCACCACCGCGAAAGCGCCACTTCAGCGCCACGAATGCGCCACGCGCCACTTCCTAACTTGCGCCACGGCACGGCGCCACGCTGCGCCACGGCACGAAAGCGCCACTGCGCCACGGCGCCACACCAAGCGCCACGCGCCACGGCGCCACAGCGCCACAGCGCCACACAGCCGGCGCCACAGCGCCACGGCGCCACTCCAGCGCCACCCTAGCGCCACGGCGCCACCTCGTGCGCCACTGCGCCACTAGCGCCACTGCGCCACGTTGCGCCACGCGCCACTGGGCGCCACATAAACAATAGCGCCACGGGCGCCACGCGCCACGGCGAGCGCCACTCGCGCCACGCGCCACGCGCCACTGCGCCACATGCCCCAGCGCCACGCGCCACTGCGCCACGCGCCACAGCGCCAC","GCGCCACGC"):
print(word)
|
5,943 | 88343b9c5cac3510e8cea75ac5b11f517ddc164b | from __future__ import absolute_import
from __future__ import division
from __future__ import print_function
from keras.layers import Dense, Input
from keras.layers import Conv2D, Flatten, Lambda
from keras.layers import Reshape, Conv2DTranspose
from keras.models import Model
from keras.losses import mse, binary_crossentropy
from keras.utils import plot_model
from keras import backend as K
from sklearn.model_selection import train_test_split
import pandas as pd
import numpy as np
import matplotlib.pyplot as plt
K.clear_session()
np.random.seed(237)
# reparameterization trick
# instead of sampling from Q(z|X), sample eps = N(0,I)
# then z = z_mean + sqrt(var)*eps
def sampling(args):
"""Reparameterization trick by sampling fr an isotropic unit Gaussian.
# Arguments
args (tensor): mean and log of variance of Q(z|X)
# Returns
z (tensor): sampled latent vector
"""
z_mean, z_log_var = args
batch = K.shape(z_mean)[0]
dim = K.int_shape(z_mean)[1]
# by default, random_normal has mean=0 and std=1.0
epsilon = K.random_normal(shape=(batch, dim))
return z_mean + K.exp(0.5 * z_log_var) * epsilon
def process_data(data_path):
data = np.load(data_path)
X_train, X_test = train_test_split(data, test_size=0.05, random_state=42)
print('Shape train/test:', X_train.shape, X_test.shape)
image_size = X_train.shape[1], X_train.shape[2]
data = np.reshape(data, [-1, image_size[0], image_size[1], 1])
X_train = np.reshape(X_train, [-1, image_size[0], image_size[1], 1])
X_test = np.reshape(X_test, [-1, image_size[0], image_size[1], 1])
data = data.astype('float32') / 255
X_train = X_train.astype('float32') / 255
X_test = X_test.astype('float32') / 255
return data, X_train, X_test, image_size
def construct_vae(image_size, kernel_size, latent_dim):
# network parameters
input_shape = (image_size[0], image_size[1], 1)
# VAE model = encoder + decoder
# build encoder model
inputs = Input(shape=input_shape, name='encoder_input')
x = inputs
x = Conv2D(filters=16, kernel_size=kernel_size, activation='relu', strides=1, padding='same')(x)
x = Conv2D(filters=32, kernel_size=kernel_size, activation='relu', strides=2, padding='same')(x)
x = Conv2D(filters=64, kernel_size=kernel_size, activation='relu', strides=1, padding='same')(x)
# shape info needed to build decoder model
shape = K.int_shape(x)
# generate latent vector Q(z|X)
x = Flatten()(x)
x = Dense(16, activation='relu')(x)
z_mean = Dense(latent_dim, name='z_mean')(x)
z_log_var = Dense(latent_dim, name='z_log_var')(x)
# use reparameterization trick to push the sampling out as input
# note that "output_shape" isn't necessary with the TensorFlow backend
z = Lambda(sampling, output_shape=(latent_dim,), name='z')([z_mean, z_log_var])
# instantiate encoder model
encoder = Model(inputs, [z_mean, z_log_var, z], name='encoder')
encoder.summary()
plot_model(encoder, to_file='vae_cnn_encoder.png', show_shapes=True)
# build decoder model
latent_inputs = Input(shape=(latent_dim,), name='z_sampling')
x = Dense(shape[1] * shape[2] * shape[3], activation='relu')(latent_inputs)
x = Reshape((shape[1], shape[2], shape[3]))(x)
x = Conv2DTranspose(filters=64, kernel_size=kernel_size, activation='relu', strides=1, padding='same')(x)
x = Conv2DTranspose(filters=32, kernel_size=kernel_size, activation='relu', strides=2, padding='same')(x)
x = Conv2DTranspose(filters=16, kernel_size=kernel_size, activation='relu', strides=1, padding='same')(x)
outputs = Conv2DTranspose(filters=1,
kernel_size=kernel_size,
activation='sigmoid',
padding='same',
name='decoder_output')(x)
# instantiate decoder model
decoder = Model(latent_inputs, outputs, name='decoder')
decoder.summary()
plot_model(decoder, to_file='vae_cnn_decoder.png', show_shapes=True)
# instantiate VAE model
outputs = decoder(encoder(inputs)[2])
vae = Model(inputs, outputs, name='vae')
# VAE loss = mse_loss or xent_loss + kl_loss
reconstruction_loss = binary_crossentropy(K.flatten(inputs), K.flatten(outputs))
reconstruction_loss *= image_size[0] * image_size[1]
kl_loss = 1 + z_log_var - K.square(z_mean) - K.exp(z_log_var)
kl_loss = K.sum(kl_loss, axis=-1)
kl_loss *= -0.5
vae_loss = K.mean(reconstruction_loss + kl_loss)
vae.add_loss(vae_loss)
vae.compile(optimizer='rmsprop')
vae.summary()
plot_model(vae, to_file='vae_cnn.png', show_shapes=True)
return vae, encoder, decoder
if __name__ == '__main__':
is_train = False
data_file = '../data/out/moment_frames_5.npy'
data, X_train, X_test, im_size = process_data(data_file)
kernel_size = (3, 3)
latent_dim = 128
batch_size = 128
epochs = 10
vae, encoder, decoder = construct_vae(im_size, kernel_size, latent_dim)
if is_train:
history = vae.fit(X_train,
epochs=epochs,
batch_size=batch_size,
validation_data=(X_test, None),
verbose=2)
vae.save_weights('vae_cnn.h5')
# summarize history for loss
plt.plot(history.history['loss'])
plt.plot(history.history['val_loss'])
plt.title('model loss')
plt.ylabel('loss')
plt.xlabel('epoch')
plt.legend(['train', 'test'], loc='upper left')
plt.savefig('vae_train.jpeg')
plt.show()
else:
vae.load_weights('vae_cnn.h5')
# Transform to latent representation
encoded_data = encoder.predict(data, batch_size=batch_size)
pd.DataFrame(encoded_data[0]).to_csv('latest_rep_cnn.csv', index=None)
print('Completed.')
|
5,944 | 87e17eb6fa91be09ac9afa43c4e58054faa77477 | # Generated by Django 3.1.2 on 2020-10-29 06:04
from django.conf import settings
from django.db import migrations, models
import django.db.models.deletion
class Migration(migrations.Migration):
initial = True
dependencies = [
migrations.swappable_dependency(settings.AUTH_USER_MODEL),
]
operations = [
migrations.CreateModel(
name='userProfile',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('kassa', models.FloatField(null=True)),
('sirket', models.CharField(max_length=50, null=True)),
('telefon', models.CharField(max_length=50, null=True)),
('adress', models.CharField(max_length=200, null=True)),
('profilsekli', models.ImageField(null=True, upload_to='')),
('dogumtarixi', models.DateField(null=True)),
('user', models.OneToOneField(null=True, on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL)),
],
),
]
|
5,945 | 90ae6fe37cea2c07d8308498c62460c10ca46846 | # -*- coding: utf-8 -*-
"""
Created on Wed Oct 4 20:55:22 2017
@author: Ivan
"""
# -----------
# User Instructions
#
# Modify the test() function to include two new test cases:
# 1) four of a kind (fk) vs. full house (fh) returns fk.
# 2) full house (fh) vs. full house (fh) returns fh.
#
# Since the program is still incomplete, clicking RUN won't do
# anything, but clicking SUBMIT will let you know if you
# have gotten the problem right.
#HAND EXAMPLES
# straight flush 8, 11 for Jack
#FOUR ACES IS MAJOR RANK NUMBER 7
#ACE IS CARD RANK NUMBER 14
#QUEEN RANK 12
def poker(hands):
"Return the best hand: poker([hand, ...]) => hand"
return max(hands, key = hand_rank)
def hand_rank(hand):
"return a value indicationg the ranking of a hand."
ranks = card_ranks(hand)
if straight (ranks) and flush(hand):
return (8, max(ranks))# 2 3 4 5 6 (8,6) 6 7 8 9 T (8, 10)
elif kind (4 , ranks):
return (7, kind(4,ranks), kind(1,ranks))#9 9 9 9 3 9(7,9,3)
elif :
def test():
"Test cases for the functions in poker program"
sf = "6C 7C 8C 9C TC".split() # Straight Flush
fk = "9D 9H 9S 9C 7D".split() # Four of a Kind
fh = "TD TC TH 7C 7D".split() # Full House
assert poker([sf, fk, fh]) == sf
assert poker([fk, fh]) == fk
assert poker([fh, fh]) == fh
assert poker([sf]) == sf
assert poker([sf] + 99*[fh]) == sf
# For example, calling hand_rank on sf should output (8, 10)
assert hand_rank([sf]) == (8,10)
assert hand_rank([sf]) == (7,9,7)
assert hand_rank([sf]) == (6,10,7)
return "test pass"
print (test())
print (max([3,4,5,0]), max([3,2,-5,4],key = abs))
|
5,946 | 4318c99b3de9bb9c44eed57525c9ccbe82a17276 | #!/usr/bin/python
#
# Script written by Legoktm, 2011
# Released into the Public Domain on November, 16, 2011
# This product comes with no warranty of any sort.
# Enjoy!
#
from commands import getoutput
def notify(string, program=False):
if not program:
command = 'growlnotify Python -m "%s"' %string
else:
command = 'growlnotify "%s" -m "%s"' %(program, string)
getoutput(command)
def notifyold(string):
#THIS IS THE OLD METHOD. YOU SHOULD ONLY USE THIS IF YOU DO NOT HAVE growlnotify INSTALLED.
print"""]9;%s
""" %string
|
5,947 | 9e02b1a90d61de6d794dd350b50417a2f7260df6 | from django import forms
from django.contrib.auth.models import User
from .models import TblPublish , TblSnippetTopics, TblSnippetData, TblLearnTopics, TblLearnData, TblBlog, TblBlogComments,TblLearnDataComments, TblBlogGvp, TblLearnDataGvp,TblSnippetDataGvp, TblHome, TblAbout, TblQueries
from django.contrib.auth.forms import UserCreationForm
class UsersigninForm(forms.Form):
username = forms.CharField(required = True, label = 'Username', max_length = 100, widget=forms.TextInput(attrs={'placeholder': 'Username'}))
password = forms.CharField(required = True, label = 'Password', max_length = 32, widget = forms.PasswordInput(attrs={'placeholder': 'Password'}))
class SignupForm(UserCreationForm):
email = forms.EmailField(max_length=200, help_text='Required')
class Meta:
model = User
fields = ('username', 'email', 'password1', 'password2')
def __init__(self, *args, **kwargs):
super(SignupForm, self).__init__(*args, **kwargs)
self.fields['username'].widget.attrs['placeholder'] = "Username"
self.fields['email'].widget.attrs['placeholder'] = "email"
self.fields['password1'].widget.attrs['placeholder'] ="password"
self.fields['password2'].widget.attrs['placeholder'] = "password Again"
class UserRegistrationForm(forms.Form):
username = forms.CharField(required = True, min_length=6,label = 'Username', max_length = 100, widget=forms.TextInput(attrs={'placeholder': 'Username'}) )
email = forms.EmailField(required = True, label = 'Email', max_length = 100, widget=forms.EmailInput(attrs={'placeholder': 'e.g. : email@gmail.com'}))
firstname = forms.CharField(required = True, label = 'First Name', max_length = 100, widget=forms.TextInput(attrs={'placeholder': 'First Name'}))
lastname = forms.CharField(required = True, label = 'Last Name', max_length = 100, widget=forms.TextInput(attrs={'placeholder': 'Last Name'}))
password = forms.CharField(required = True, label = 'Password', max_length = 100, widget = forms.PasswordInput(attrs={'placeholder': 'Password'}))
passwordagain = forms.CharField(required = True, label = 'Password (Again)', max_length = 100, widget = forms.PasswordInput(attrs={'placeholder': 'Password (Again)'}))
class TblPublishForm(forms.ModelForm):
class Meta():
model = TblPublish
fields = '__all__'
class TblSnippetDataForm(forms.ModelForm):
class Meta():
model = TblSnippetData
fields = ['snippet_topics','snippet_data_subject','snippet_data_description','snippet_data_keyword','snippet_data_code','snippet_data_datetime','snippet_data_added_by','snippet_topics','snippet_data_publish']
def clean_snippet_topics_added_by(self):
if not self.cleaned_data['snippet_topics_added_by']:
return User()
return self.cleaned_data['snippet_topics_added_by']
def __init__(self, *args, **kwargs):
super(TblSnippetDataForm, self).__init__(*args, **kwargs)
self.fields['snippet_data_datetime'].widget = forms.HiddenInput()
self.fields['snippet_data_added_by'].widget = forms.HiddenInput()
self.fields['snippet_topics'].widget = forms.HiddenInput()
self.fields['snippet_data_subject'].widget.attrs['placeholder'] = "Title/Topics"
self.fields['snippet_data_description'].widget.attrs['placeholder'] = "Brief Description"
self.fields['snippet_data_keyword'].widget.attrs['placeholder'] ="Keyword For Search"
self.fields['snippet_data_code'].widget.attrs['placeholder'] = "Snippet (Code)"
self.fields['snippet_data_publish'].widget.attrs['placeholder'] = "Ready-To-Publish"
self.fields['snippet_data_publish'].label = "Publish"
class TblBlogForm(forms.ModelForm):
class Meta():
model = TblBlog
fields = ['blog_title','blog_description','blog_keyword','blog_content','blog_pics','blog_publish','blog_datetime','blog_summary','blog_like','blog_added_by']
def __init__(self, *args, **kwargs):
super(TblBlogForm, self).__init__(*args, **kwargs)
self.fields['blog_datetime'].widget = forms.HiddenInput()
self.fields['blog_summary'].widget = forms.HiddenInput()
self.fields['blog_like'].widget = forms.HiddenInput()
self.fields['blog_added_by'].widget = forms.HiddenInput()
self.fields['blog_title'].widget.attrs['placeholder'] = "Title/Topics"
self.fields['blog_description'].widget.attrs['placeholder'] = "Brief Description"
self.fields['blog_content'].widget.attrs['placeholder'] = "Blog Content"
self.fields['blog_keyword'].widget.attrs['placeholder'] = "Keyword For Search"
self.fields['blog_pics'].widget.attrs['placeholder'] = "Upload Pics"
self.fields['blog_publish'].label = "Publish"
class TblBlogCommentsForm(forms.ModelForm):
class Meta():
model = TblBlogComments
fields = '__all__'
class TblLearnDataForm(forms.ModelForm):
class Meta():
model = TblLearnData
fields = ['learn_data','learn_data_keyword','learn_data_description','learn_data_publish','learn_data_datetime','learn_data_added_by','learn_topics','learn_data_like','learn_data_icon']
def __init__(self, *args, **kwargs):
super(TblLearnDataForm, self).__init__(*args, **kwargs)
self.fields['learn_data_datetime'].widget = forms.HiddenInput()
self.fields['learn_data_added_by'].widget = forms.HiddenInput()
self.fields['learn_topics'].widget = forms.HiddenInput()
self.fields['learn_data_like'].widget = forms.HiddenInput()
self.fields['learn_data_icon'].widget = forms.HiddenInput()
self.fields['learn_data'].widget.attrs['placeholder'] = "Title/Topics"
self.fields['learn_data_description'].widget.attrs['placeholder'] = "Brief Description"
self.fields['learn_data_keyword'].widget.attrs['placeholder'] = "Keyword For Search"
self.fields['learn_data_publish'].label = "Publish"
class TblLearnDataCommentsForm(forms.ModelForm):
class Meta():
model = TblLearnDataComments
fields = '__all__'
class TblBlogGvpForm(forms.ModelForm):
class Meta():
model = TblBlogGvp
fields = '__all__'
class TblLearnDataGvpForm(forms.ModelForm):
class Meta():
model = TblLearnDataGvp
fields = '__all__'
class TblHomeForm(forms.ModelForm):
class Meta():
model = TblHome
fields = '__all__'
def __init__(self, *args, **kwargs):
super(TblHomeForm, self).__init__(*args, **kwargs)
self.fields['home_datetime'].widget = forms.HiddenInput()
self.fields['home_added_by'].widget = forms.HiddenInput()
self.fields['home_pics'].widget.attrs['placeholder'] = "Upload Image"
self.fields['home_content'].widget.attrs['placeholder'] = "Content"
self.fields['home_content_description'].widget.attrs['placeholder'] = "Description"
self.fields['home_publish'].label = "Publish"
class TblAboutForm(forms.ModelForm):
class Meta():
model = TblAbout
fields = '__all__'
def __init__(self, *args, **kwargs):
super(TblAboutForm, self).__init__(*args, **kwargs)
self.fields['about_datetime'].widget = forms.HiddenInput()
self.fields['about_added_by'].widget = forms.HiddenInput()
self.fields['about_pics'].widget.attrs['placeholder'] = "Upload Image"
self.fields['about_content'].widget.attrs['placeholder'] = "Content"
self.fields['about_content_description'].widget.attrs['placeholder'] = "Description"
self.fields['about_publish'].label = "Publish"
class TblLearnTopicsForm(forms.ModelForm):
class Meta():
model = TblLearnTopics
fields = '__all__'
def __init__(self, *args, **kwargs):
super(TblLearnTopicsForm, self).__init__(*args, **kwargs)
self.fields['learn_topics_datetime'].widget = forms.HiddenInput()
# self.fields['learn_topics_added_by'].widget = forms.HiddenInput()
self.fields['learn_topics_icon'].widget.attrs['placeholder'] = 'Icon'
self.fields['learn_topics_coverpage_img'].widget = forms.HiddenInput()
self.fields['learn_topics'].widget.attrs['placeholder'] = "Topics"
self.fields['learn_topics_description'].widget.attrs['placeholder'] = "Description"
self.fields['learn_topics_publish'].label = "Publish"
def clean_learn_topics_added_by(self):
if not self.cleaned_data['learn_topics_added_by']:
return User()
return self.cleaned_data['learn_topics_added_by']
class TblSnippetTopicsForm(forms.ModelForm):
class Meta():
model = TblSnippetTopics
fields = '__all__'
def __init__(self, *args, **kwargs):
super(TblSnippetTopicsForm, self).__init__(*args, **kwargs)
self.fields['snippet_topics_datetime'].widget = forms.HiddenInput()
self.fields['snippet_topics_added_by'].widget = forms.HiddenInput()
self.fields['snippet_topics_icon'].widget = forms.HiddenInput()
self.fields['snippet_topics_coverpage_img'].widget = forms.HiddenInput()
self.fields['snippet_topics_expire'].widget = forms.HiddenInput()
self.fields['snippet_topics'].widget.attrs['placeholder'] = "Topics"
self.fields['snippet_topics_description'].widget.attrs['placeholder'] = "Description"
self.fields['snippet_topics_publish'].label = "Publish"
def clean_snippet_topics_added_by(self):
if not self.cleaned_data['snippet_topics_added_by']:
return User()
return self.cleaned_data['snippet_topics_added_by']
class TblQueriesForm(forms.ModelForm):
class Meta():
model = TblQueries
fields = '__all__'
def __init__(self, *args, **kwargs):
super(TblQueriesForm, self).__init__(*args, **kwargs)
self.fields['datetime'].widget = forms.HiddenInput()
self.fields['name'].widget.attrs['placeholder'] = "Name"
self.fields['email'].widget.attrs['placeholder'] = "Email"
self.fields['subject'].widget.attrs['placeholder'] = "Subject"
self.fields['message'].widget.attrs['placeholder'] = "Message"
|
5,948 | fa880adcb9f009ffc206de59e8284ac6350fef4c | from django.db import models
#from ingredients.models import *
class Unit(models.Model):
short_name = models.CharField(max_length=20)
full_name = models.CharField(max_length=255, null=True)
weight_in_grams = models.FloatField(default=1.0)
def __str__(self):
return f"{self.short_name}" |
5,949 | 9527743802a0bb680ab3dcf325c0f7749a51afc6 | i = 100
while i >= 100:
print(i)
i -= 1
print(i)
|
5,950 | 6111c9730c556ab3ab95f7685ffa135a2bbeb2ca | from __future__ import with_statement
from fabric.api import *
from fabric.colors import *
from fabric.utils import puts
from fabric.context_managers import shell_env
env.hosts = ['git@tweetset.com']
def deploy():
"deploys the project to the server"
with prefix('source /srv/django-envs/tweetset/bin/activate'):
with shell_env(DJANGO_SETTINGS_MODULE='tweetset.settings.production'):
with cd('/srv/django-projects/tweetset'):
puts(magenta("[Pulling changes]"))
run('git pull origin master')
puts(magenta("[Installing packages]"))
run('pip install -r requirements.txt')
with cd('/srv/django-projects/tweetset/tweetset'):
puts(magenta("[Migrating apps]"))
run('python manage.py migrate --no-initial-data')
puts(magenta("[Collecting static files]"))
run('python manage.py collectstatic --noinput')
puts(magenta("[Touching wsgi.py]"))
run('touch /srv/django-projects/tweetset/tweetset/tweetset/wsgi.py')
|
5,951 | 2075e7e05882524c295c8542ca7aefae2cf3e0fc | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""Tests for the storage format CLI arguments helper."""
import argparse
import unittest
from plaso.cli import tools
from plaso.cli.helpers import storage_format
from plaso.lib import errors
from tests.cli import test_lib as cli_test_lib
class StorageFormatArgumentsHelperTest(cli_test_lib.CLIToolTestCase):
"""Tests for the storage format CLI arguments helper."""
# pylint: disable=no-member,protected-access
_EXPECTED_OUTPUT = """\
usage: cli_helper.py [--storage_format FORMAT] [--task_storage_format FORMAT]
Test argument parser.
{0:s}:
--storage_format FORMAT, --storage-format FORMAT
Format of the storage file, the default is: sqlite.
Supported options: sqlite
--task_storage_format FORMAT, --task-storage-format FORMAT
Format for task storage, the default is: sqlite.
Supported options: redis, sqlite
""".format(cli_test_lib.ARGPARSE_OPTIONS)
def testAddArguments(self):
"""Tests the AddArguments function."""
argument_parser = argparse.ArgumentParser(
prog='cli_helper.py', description='Test argument parser.',
add_help=False,
formatter_class=cli_test_lib.SortedArgumentsHelpFormatter)
storage_format.StorageFormatArgumentsHelper.AddArguments(argument_parser)
output = self._RunArgparseFormatHelp(argument_parser)
self.assertEqual(output, self._EXPECTED_OUTPUT)
def testParseOptions(self):
"""Tests the ParseOptions function."""
options = cli_test_lib.TestOptions()
options.storage_format = 'sqlite'
options.task_storage_format = 'sqlite'
test_tool = tools.CLITool()
storage_format.StorageFormatArgumentsHelper.ParseOptions(options, test_tool)
self.assertEqual(test_tool._storage_format, options.storage_format)
self.assertEqual(
test_tool._task_storage_format, options.task_storage_format)
with self.assertRaises(errors.BadConfigObject):
storage_format.StorageFormatArgumentsHelper.ParseOptions(options, None)
with self.assertRaises(errors.BadConfigOption):
options.storage_format = 'bogus'
storage_format.StorageFormatArgumentsHelper.ParseOptions(
options, test_tool)
if __name__ == '__main__':
unittest.main()
|
5,952 | 83bac8176caafc5551089c4bef5c1f38e1e8d4da | # block-comments.py
'''
Block comments generally apply to some (or all) code that follows them, and are
indented to the same level as that code. Each line of a block comment starts
with a # and a single space (unless it is indented text inside the comment).
Paragraphs inside a block comment are separated by a line containing a single #.
'''
|
5,953 | 679ca76212b90261683d59899c1189280b6b6e8c | #!/user/bin/env python3 -tt
"""
https://adventofcode.com/2017/day/7
"""
import sys
import re
# Global variables
task="d-7"
infile=task + ".input"
with open('input/' + infile) as file:
input = file.read()
file.close()
class Node:
parent = None
children = None
weight_sum = 0
def __init__(self, name, weight, linked):
self.name = name
self.weight = int(weight)
self.weight_sum += self.weight
self.linked = linked
self.children = []
def __str__(self):
children_str = " ".join(self.linked)
parent_name = self.parent.name if self.parent else "KING"
return "" + self.name + " : " + parent_name + ":" + str(self.weight) + " : " + children_str #+ ":||||:" + " ".join([n.name for n in self.children])
nodeTree = []
def traverseTree(node, deep):
if len(nodeTree) <= deep:
nodeTree.append([])
nodeTree[deep].append(node)
if not node.children:
return
for child in node.children:
traverseTree(child, deep+1)
def detectUnstable(node, deep):
weights = []
for n in node.children:
if n.weight_sum not in weights:
weights.append(n.weight_sum)
for n in node.children:
if len(weights) > 1 and max(weights) == n.weight_sum:
print("found unstable for: ", n.name, " in: ", weights)
diff = max(weights) - min(weights)
new_weight = n.weight - diff
print("[", deep, "]New weight:", new_weight, " for: ", n, " diff: ", diff)
for n in node.children:
if len(nodeTree) > deep + 1:
detectUnstable(n, deep +1)
def buildTree(parent, nodes):
if not parent.linked:
return parent
for link_str in parent.linked:
for node in nodes:
#Find matching node
if link_str == node.name:
node.parent = parent
parent.children.append(node)
child = buildTree(node, nodes)
parent.weight_sum += child.weight_sum
return parent
def printNodes(nodes):
print("Print all nodes")
for node in nodes:
print(node)
def solve():
raw_node_list = [s.rstrip() for s in input.split("\n")]
regex = re.compile(r'(\w+) \((\d+)\)')
master_node = None
nodes = []
all_linked_node_names = []
for n in raw_node_list:
pmn = regex.match(n)
np = Node(pmn.group(1).rstrip(), pmn.group(2).rstrip(), [])
links = n.split("->")
if len(links) > 1:
np.linked = [s.strip() for s in links[1].split(",")]
if np:
nodes.append(np)
for link in np.linked:
all_linked_node_names.append(link)
for node in nodes:
if len(node.linked) > 1 and not node.name in ":".join(all_linked_node_names):
master_node = node
buildTree(master_node, nodes)
traverseTree(master_node, 0)
# for row in nodeTree:
# nodes = ""
# for node in row:
# parent = node.parent.name if node.parent else "KING"
# nodes += "[" + parent + "]" + node.name + ":" + str(node.weight_sum)
# print(nodes)
# for weights in weightTree:
# if len(weights) > 1:
# print(":".join([str(s) for s in weights]))
print("Detect unstable:")
detectUnstable(master_node, 0)
if __name__ == '__main__':
solve()
print("Finished executing: " + task)
sys.exit(1)
|
5,954 | 7747cbb1a1ed191b616b0d1bcfd51cdea05067f5 | from bs4 import BeautifulSoup
import re
class Rules:
def __init__(self):
self.ruleCollection = {
"1" : self.rule1,
"2" : self.rule2,
"3" : self.rule3,
"4" : self.rule4,
"5" : self.rule5,
"6" : self.rule6,
"7" : self.rule7,
"8" : self.rule8,
"9" : self.rule9,
"10" : self.rule10,
}
def getRule(self, id):
return self.ruleCollection[id]
# Image without text alternatives
def rule1(self,dom):
return dom.find_all(self._img_without_alt)
# Embeded multimedia without noembed (text or audio)
def rule2(self,dom):
video_arr = []
for embed in dom.find_all("embed"):
if not embed.noembed:
video_arr.append(embed)
return video_arr
#color cues
#without the definitions in css
#This rule needs to be improved
def rule3(self,dom):
clrcue_arr = []
for fnt in dom.find_all('font'):
if fnt.has_attr('color'):
clrcue_arr.append(fnt)
for spn in dom.find_all('span'):
if spn.has_attr('style'):
clrcue_arr.append(spn)
return clrcue_arr
#Table without summary
def rule4(self,dom):
return dom.find_all(self._tbl_without_summ)
#Table without caption
def rule5(self,dom):
twcap_arr = [];
for tb in dom.find_all("table"):
if not tb.caption:
twcap_arr.append(tb)
return twcap_arr
def rule6(self,dom):
lbl_arr = [];
inputElems =[]
inputElems.extend(dom.find_all(["textarea", "select"]))
inputElems.extend(dom.find_all(type=["text","password", "checkbox", "radio", "file"]))
labels = dom.find_all('label')
for input in inputElems:
hasLabel = False
if input.has_attr('id'):
id = input['id']
for lbl in labels:
if lbl.has_attr("for") and lbl['for'] == id:
hasLabel = True
break
if not hasLabel:
lbl_arr.append(input)
return lbl_arr
def rule7(self,dom):
dblclk_arr = []
dblclk_arr = dom.find_all(ondblclick = True, onkeypress = False)
return dblclk_arr
def rule8(self,dom):
title_arr = []
isTitle = dom.find('title')
if isTitle is None:
title_arr.append(dom.find('head'))
return title_arr
def rule9(self,dom):
link_arr = []
url_tags = ['http', 'https', '://www.' , 'www' ]
for link in dom.find_all('a'):
if not ('http' in link or 'https' in link or '://www.' in link or 'www' in link):
link_arr.append(link)
return link_arr
def rule10(self,dom):
tab_arr = []
for tab in dom.find_all('a', 'input', ondblclick = True, onkeydown = True, onkeypress = True):
if not tab.has_attr('tabindex'):
tab_arr.append(tab)
return tab_arr
def _img_without_alt(self,tag):
return tag.name == "img" and not tag.has_attr("alt")
def _tbl_without_summ(self,tag):
return tag.name == "table" and not tag.has_attr("summary")
#for testing
|
5,955 | e26fa69ea1f0bee82b4108ac5a541a6175645728 | import numpy as np
import cPickle
from features import create_features, PROJECT
from parse import load_data
from dict_vectorizer import DictVectorizer
videos, users, reviews = load_data()
orig_X = np.array([(x['date'], x['text'], x['user']) for x in reviews])
feats = create_features(orig_X, None)
v = DictVectorizer(sparse=False)
feats = v.fit_transform(feats)
# feats is now in vectorized format
# v.transform() is the transformation that needs to be used on test data
cPickle.dump(v, open(PROJECT + "db/dictvectorizer.pickle", "wb"))
|
5,956 | 459dd9302f7100ad02119cc94b735b19287f21e5 | import tensorflow as tf
import numpy as np
import time
import os
from sklearn.metrics import roc_curve
import matplotlib.pyplot as plt
from src.model import get_args
from src.funcs import linear
from src.youtubeface import load_ytf_data
from src.lfw import load_lfw_data
from src.facescrub import load_fs_data
from src.wrapper_basicImg import wrapper_basicImg
if __name__ == '__main__':
os.environ["CUDA_VISIBLE_DEVICES"] = '0'
total_iteration = 300000
m = 512
q = 32
lam = 0.01
beta = 1.
margin = 0.5
s = 32
batch_size = 256
class_num = 1595
train_dataset = 'FS'
eval_dataset = "LFW"
args = get_args()
### Get image and label from tfrecord
image, label, iterator = {}, {}, {}
if train_dataset == 'YTF':
image['train'], label['train'], iterator['train'] = load_ytf_data(batch_size, 'train')
elif train_dataset == 'FS':
image['train'], label['train'], iterator['train'] = load_fs_data(batch_size, 'train')
else:
print("Select proper dataset")
### Get evaluation dataset. Wrapper
wrapper = wrapper_basicImg(dataset=eval_dataset)
if eval_dataset == 'YTF':
image['gallery'], label['gallery'], iterator['gallery'] = load_ytf_data(batch_size, 'train', eval=True)
image['test'], label['test'], iterator['test'] = load_ytf_data(batch_size, 'test')
elif eval_dataset == 'LFW':
image['gallery'], label['gallery'], iterator['gallery'] = load_lfw_data(batch_size, 'gallery')
image['test'], label['test'], iterator['test'] = load_lfw_data(batch_size, 'probe')
### Backbone network (Arcface)
embedding_tensor = tf.placeholder(name='img_inputs', shape=[None, 512], dtype=tf.float32)
labels = tf.placeholder(name='label', shape=[None, ], dtype=tf.int32)
### Global step & learning rate
global_step = tf.Variable(0, trainable=False)
starter_learning_rate = 0.003
learning_rate = tf.train.exponential_decay(starter_learning_rate, global_step, total_iteration, 0.96)
### My implementation (DIom algorithm)
with tf.variable_scope('DIom'):
fc1 = linear(tf.nn.relu(embedding_tensor), 1024, 'fc1')
fc2 = linear(tf.nn.relu(fc1), 1024, 'fc2')
fc3 = linear(tf.nn.relu(fc2), m * q, 'fc3')
h_k = tf.reshape(fc3, [-1, m, q])
h_k = tf.nn.softmax(beta * h_k, axis=2)
index_matrix = tf.range(1, q + 1, dtype=tf.float32)
h = tf.reduce_sum(h_k * index_matrix, axis=2)
h = tf.reshape(h, [-1, m])
h_norm = tf.math.l2_normalize(h, axis=1)
### Loss function
l = tf.one_hot(labels, class_num)
l = tf.matmul(l, tf.transpose(l))
l_float = tf.cast(l, tf.float32)
l = tf.reshape(tf.clip_by_value(l_float, 0., 1.), (-1, 1))
label_int = tf.cast(tf.squeeze(l, 1), tf.int32)
inner_prod = tf.reshape(tf.matmul(h_norm, tf.transpose(h_norm)), (-1, 1))
cos_t = tf.clip_by_value(inner_prod, -1., 1. - 1e-6)
theta = tf.math.acos(cos_t)
sin_t = tf.math.sin(theta)
cos_mt = tf.math.cos(theta + margin)
sin_mt = tf.math.sin(theta + margin)
logit = l * s * (tf.concat([sin_t, cos_mt], 1)) + (1 - l) * s * (tf.concat([sin_mt, cos_t], 1))
l_ij_logit = tf.nn.sparse_softmax_cross_entropy_with_logits(logits=logit, labels=label_int)
c_ij = tf.abs(tf.reduce_mean(h, axis=0) - (q + 1) / 2)
# Baseline pairwise-CE
# label_ce = tf.cast(labels, tf.float32)
# l_ij = l * tf.log(tf.square(inner_prod)) + (1 - l) * tf.log(tf.maximum(1e-6, 1 - tf.square(inner_prod)))
# l_ij = -tf.reduce_mean(l_ij)
# My novel cosine loss
l_ij = tf.reduce_mean(l_ij_logit)
c_ij = tf.reduce_mean(c_ij)
loss = l_ij + lam * c_ij
gradient = tf.gradients(loss, sin_t)
### Optimizer
t_vars = tf.global_variables()
train_vars = [var for var in t_vars if 'DIom' in var.name]
opt_t = tf.train.MomentumOptimizer(learning_rate, momentum=0.9).minimize(loss, var_list=train_vars, global_step=global_step)
with tf.Session() as sess:
tf.global_variables_initializer().run()
sess.run(iterator['train'].initializer)
### Training
iteration = sess.run(global_step)
t_opt = [opt_t, loss, l_ij, c_ij]
start_time = time.time()
while iteration != total_iteration:
img, lbl = sess.run([image['train'], label['train']])
train_dict = {
embedding_tensor: img,
labels: lbl
}
_, train_loss, loss_l, loss_c = sess.run(t_opt, feed_dict=train_dict)
iteration += 1
if iteration % 10000 == 0:
### Evaluation after training
### Get gallery hash code
# gallery = []
# gallery_label = []
# sess.run(iterator['gallery'].initializer)
# try:
# while True:
# img, lbl = sess.run([image['gallery'], label['gallery']])
#
# gallery_dict = {
# embedding_tensor: img
# }
#
# hash_code = sess.run(h_norm, feed_dict=gallery_dict)
#
# if gallery == []:
# gallery = hash_code
# gallery_label = lbl
# else:
# gallery = np.concatenate((gallery, hash_code), axis=0)
# gallery_label = np.concatenate((gallery_label, lbl), axis=0)
#
# except tf.errors.OutOfRangeError:
# pass
#
# ### Get probe hash code
# probe = []
# probe_label = []
# code_arr = []
# sess.run(iterator['test'].initializer)
# try:
# while True:
# img, lbl = sess.run([image['test'], label['test']])
#
# gallery_dict = {
# embedding_tensor: img
# }
#
# code, hash_code = sess.run([h, h_norm], feed_dict=gallery_dict)
#
# if probe == []:
# probe = hash_code
# probe_label = lbl
# code_arr = code
# else:
# probe = np.concatenate((probe, hash_code), axis=0)
# probe_label = np.concatenate((probe_label, lbl), axis=0)
# code_arr = np.concatenate((code_arr, code), axis=0)
#
# except tf.errors.OutOfRangeError:
# pass
#
# ### Code frequency
# code_arr = np.around(code_arr)
# count_arr = []
# for i in range(q):
# count_arr.append(np.count_nonzero(code_arr == i + 1))
#
# plt.clf()
# plt.bar(range(1, q+1), count_arr)
# plt.savefig('./plt/code_' + str(iteration) + '.png')
# ### Calculate MAP
# gtp = 40
# k = 50
#
# distance = np.matmul(probe, gallery.T)
# arg_idx = np.argsort(-distance, axis=1)
#
# max_label = gallery_label[arg_idx[:, :k]]
# match_matrix = np.equal(max_label, probe_label[:,np.newaxis])
#
# tp_seen = match_matrix * np.cumsum(match_matrix, axis=1)
# ap = np.sum(tp_seen / np.arange(1, k + 1)[np.newaxis, :], axis=1) / gtp
# MAP = np.mean(ap)
### Calculate EER
dist_list = []
label_list = []
code_list = []
while wrapper.samples_left > 0:
imgs, lbls = wrapper.get_next_batch(100)
imgs = np.reshape(imgs, [-1, 512])
eer_dict = {
embedding_tensor: imgs
}
code, int_code = sess.run([h_norm, h], feed_dict=eer_dict)
code = np.reshape(code, [-1, 2, m])
distance = np.sum(np.prod(code, axis=1), axis=1)
if dist_list == []:
dist_list = distance
label_list = lbls
code_list = int_code
else:
dist_list = np.concatenate((dist_list, distance), axis=0)
label_list = np.concatenate((label_list, lbls), axis=0)
code_list = np.concatenate((code_list, int_code), axis=0)
wrapper.samples_left= np.size(wrapper.labels, axis=0)
wrapper.next_batch_pointer = 0
fpr, tpr, threshold = roc_curve(label_list, dist_list, pos_label=1)
fnr = 1 - tpr
# eer_threshold = threshold(np.nanargmin(np.absolute((fnr - fpr))))
eer = fpr[np.nanargmin(np.absolute((fnr - fpr)))]
### Code frequency
code_arr = np.around(code_list)
count_arr = []
for i in range(q):
count_arr.append(np.count_nonzero(code_arr == i + 1))
plt.clf()
plt.bar(range(1, q + 1), count_arr)
plt.savefig('./plt/code_' + str(iteration) + '.png')
time_taken = time.time() - start_time
MAP = 0
# print("good")
print("[Iteration %d] Train Loss: %.4f, Loss_l: %.4f, Loss_c: %.4f, MAP: %.4f, EER: %.4f, Taken time: %.4f"
% (iteration, train_loss, loss_l, loss_c, MAP, eer, time_taken))
start_time = time.time()
# np.save('CP.npy', np.concatenate((fpr[np.newaxis, :], tpr[np.newaxis, :]), axis=0))
### Save model.
# save_vars = [var for var in t_vars if 'DIom' in var.name]
# saver = tf.train.Saver(var_list=save_vars)
# saver.save(sess, './model/DIom_layer') |
5,957 | 3770e59c5bd6837a0fb812f80c6549024e06a9e4 | '''
Functional tests for the Write Stream
'''
from behave import given, when, then
from OSC import OSCClient, OSCMessage, OSCServer
@given('I want to send an integer')
def step_impl (context):
pass
@given('I want to send a float')
def step_impl (context):
pass
@given('I want to send two integers with one channel')
def step_impl (context):
pass
@given('I want to send two floats with one channel')
def step_impl (context):
pass
rep=0
@given('I want to send {reps} floats with 1 channel')
def step_impl (context, reps):
rep = reps
@when('I define "{host}" and the port {port} and the number is {flt_one}, and the second is {flt_two}')
def step_impl(context, host, port, flt_one,flt_two):
client = OSCClient()
client.connect((host, int(port)))
if rep > 2:
for i in range(rep):
if flt_two > 0.0:
client.send(OSCMessage(['/test', flt_one, flt_two]))
else:
client.send(OSCMessage('/test', flt_one))
else:
if flt_two > 0.0:
client.send(OSCMessage(['/test', flt_one,flt_two]))
else:
client.send(OSCMessage(['/test', flt_one]))
@when('I define "{host}" and the port "{port}" and the integer is {int_one}, and the second is {int_sec}')
def step_impl(context, host, port, int_one, int_sec):
client = OSCClient()
client.connect((host, port))
if int_sec > 0:
client.send(OSCMessage('/test', int_one, int_sec))
else:
client.send(OSCMessage('/test', int_one))
@then('I hear a sound')
def step_impl(context):
pass
@then('I hear two sounds')
def step_impl(context):
pass
@then('I hear a sound that lasts for {son_length} seconds')
def step_impl(context,son_length):
pass
def listen_handler(path, tags, args, source):
'''
Handler for the listener
'''
response = args[0]
assert(response, "Negative numbers not processed")
@then('I want to receive "{message}"')
def step_impl(context, message):
listen = OSCServer(("127.0.0.1", 4589))
listen.timeout = 0 #infinite timeout
listen.addMsgHandler("/err", listen_handler)
listen.close()
|
5,958 | 2343a9d3e253b5a0347b5890a5d7b9c3be777669 | import tkinter
import csv
import datetime
import time
root = tkinter.Tk()
root.title("Attendance")
root.geometry("+450+250")
ts = time.time()
date = datetime.datetime.fromtimestamp(ts).strftime('%Y-%m-%d')
fileName = "Attendance/Attendance_"+date+".csv"
# open file
with open(fileName, newline="") as file:
reader = csv.reader(file)
# r and c tell us where to grid the labels
r = 0
for col in reader:
c = 0
for row in col:
row = row.strip("['']")
if r == 0:
label = tkinter.Label(root, width=20, height=4,
text=row, bg="#7d807e", relief=tkinter.RIDGE)
label.grid(row=r, column=c)
else:
label = tkinter.Label(root, width=20, height=4,
text=row, relief=tkinter.RIDGE)
label.grid(row=r, column=c)
c += 1
r += 1
fileName2 = "StudentDetails/StudentDetails.csv"
with open(fileName, newline="") as file:
reader = csv.reader(file)
# r and c tell us where to grid the labels
r2 = 0
for col in reader:
r2 += 1
total = r2-1
print(total)
present = r - 1
absent = total - present
label = tkinter.Label(root, width=20, height=4,
text="Present", fg="green", relief=tkinter.RIDGE)
label.grid(row=r+1, column=0)
label = tkinter.Label(root, width=20, height=4,
text=present, relief=tkinter.RIDGE)
label.grid(row=r+1, column=1)
label = tkinter.Label(root, width=20, height=4,
text="Absent", fg="red", relief=tkinter.RIDGE)
label.grid(row=r+1, column=2)
label = tkinter.Label(root, width=20, height=4,
text=absent, relief=tkinter.RIDGE)
label.grid(row=r+1, column=3)
root.mainloop()
|
5,959 | ae998fb17b8d6f4f5c8871a0ebe86a039501ec99 | # -*- coding: utf-8 -*-
__all__ = "corner"
import logging
import numpy as np
from corner.core import corner_impl
try:
from corner.arviz_corner import arviz_corner
except ImportError:
arviz_corner = None
def corner(
data,
bins=20,
*,
# Original corner parameters
range=None,
axes_scale="linear",
weights=None,
color=None,
hist_bin_factor=1,
smooth=None,
smooth1d=None,
labels=None,
label_kwargs=None,
titles=None,
show_titles=False,
title_quantiles=None,
title_fmt=".2f",
title_kwargs=None,
truths=None,
truth_color="#4682b4",
scale_hist=False,
quantiles=None,
verbose=False,
fig=None,
max_n_ticks=5,
top_ticks=False,
use_math_text=False,
reverse=False,
labelpad=0.0,
hist_kwargs=None,
# Arviz parameters
group="posterior",
var_names=None,
filter_vars=None,
coords=None,
divergences=False,
divergences_kwargs=None,
labeller=None,
**hist2d_kwargs,
):
"""
Make a *sick* corner plot showing the projections of a data set in a
multi-dimensional space. kwargs are passed to hist2d() or used for
`matplotlib` styling.
Parameters
----------
data : obj
Any object that can be converted to an ``arviz.InferenceData`` object.
Refer to documentation of ``arviz.convert_to_dataset`` for details.
bins : int or array_like[ndim,]
The number of bins to use in histograms, either as a fixed value for
all dimensions, or as a list of integers for each dimension.
group : str
Specifies which InferenceData group should be plotted. Defaults to
``'posterior'``.
var_names : list
Variables to be plotted, if ``None`` all variable are plotted. Prefix
the variables by `~` when you want to exclude them from the plot.
filter_vars : {``None``, ``"like"``, ``"regex"``}
If ``None`` (default), interpret ``var_names`` as the real variables
names. If ``"like"``, interpret ``var_names`` as substrings of the real
variables names. If ``"regex"``, interpret ``var_names`` as regular
expressions on the real variables names. A la ``pandas.filter``.
coords : mapping
Coordinates of ``var_names`` to be plotted. Passed to
``arviz.Dataset.sel``.
divergences : bool
If ``True`` divergences will be plotted in a different color, only if
``group`` is either ``'prior'`` or ``'posterior'``.
divergences_kwargs : dict
Any extra keyword arguments to send to the ``overplot_points`` when
plotting the divergences.
labeller : arviz.Labeller
Class providing the method ``make_label_vert`` to generate the labels
in the plot. Read the ArviZ label guide for more details and usage
examples.
weights : array_like[nsamples,]
The weight of each sample. If `None` (default), samples are given
equal weight.
color : str
A ``matplotlib`` style color for all histograms.
hist_bin_factor : float or array_like[ndim,]
This is a factor (or list of factors, one for each dimension) that
will multiply the bin specifications when making the 1-D histograms.
This is generally used to increase the number of bins in the 1-D plots
to provide more resolution.
smooth, smooth1d : float
The standard deviation for Gaussian kernel passed to
`scipy.ndimage.gaussian_filter` to smooth the 2-D and 1-D histograms
respectively. If `None` (default), no smoothing is applied.
labels : iterable (ndim,)
A list of names for the dimensions.
.. deprecated:: 2.2.1
If a ``xs`` is a ``pandas.DataFrame`` *and* ArviZ is installed,
labels will default to column names.
This behavior will be removed in version 3;
either use ArviZ data structures instead or pass
``labels=dataframe.columns`` manually.
label_kwargs : dict
Any extra keyword arguments to send to the `set_xlabel` and
`set_ylabel` methods. Note that passing the `labelpad` keyword
in this dictionary will not have the desired effect. Use the
`labelpad` keyword in this function instead.
titles : iterable (ndim,)
A list of titles for the dimensions. If `None` (default),
uses labels as titles.
show_titles : bool
Displays a title above each 1-D histogram showing the 0.5 quantile
with the upper and lower errors supplied by the quantiles argument.
title_quantiles : iterable
A list of 3 fractional quantiles to show as the the upper and lower
errors. If `None` (default), inherit the values from quantiles, unless
quantiles is `None`, in which case it defaults to [0.16,0.5,0.84]
title_fmt : string
The format string for the quantiles given in titles. If you explicitly
set ``show_titles=True`` and ``title_fmt=None``, the labels will be
shown as the titles. (default: ``.2f``)
title_kwargs : dict
Any extra keyword arguments to send to the `set_title` command.
range : iterable (ndim,)
A list where each element is either a length 2 tuple containing
lower and upper bounds or a float in range (0., 1.)
giving the fraction of samples to include in bounds, e.g.,
[(0.,10.), (1.,5), 0.999, etc.].
If a fraction, the bounds are chosen to be equal-tailed.
axes_scale : str or iterable (ndim,)
Scale (``"linear"``, ``"log"``) to use for each data dimension. If only
one scale is specified, use that for all dimensions.
truths : iterable (ndim,)
A list of reference values to indicate on the plots. Individual
values can be omitted by using ``None``.
truth_color : str
A ``matplotlib`` style color for the ``truths`` makers.
scale_hist : bool
Should the 1-D histograms be scaled in such a way that the zero line
is visible?
quantiles : iterable
A list of fractional quantiles to show on the 1-D histograms as
vertical dashed lines.
verbose : bool
If true, print the values of the computed quantiles.
plot_contours : bool
Draw contours for dense regions of the plot.
use_math_text : bool
If true, then axis tick labels for very large or small exponents will
be displayed as powers of 10 rather than using `e`.
reverse : bool
If true, plot the corner plot starting in the upper-right corner
instead of the usual bottom-left corner
labelpad : float
Padding between the axis and the x- and y-labels in units of the
fraction of the axis from the lower left
max_n_ticks: int
Maximum number of ticks to try to use
top_ticks : bool
If true, label the top ticks of each axis
fig : `~matplotlib.figure.Figure`
Overplot onto the provided figure object, which must either have no
axes yet, or ``ndim * ndim`` axes already present. If not set, the
plot will be drawn on a newly created figure.
hist_kwargs : dict
Any extra keyword arguments to send to the 1-D histogram plots.
**hist2d_kwargs
Any remaining keyword arguments are sent to :func:`corner.hist2d` to
generate the 2-D histogram plots.
Returns
-------
fig : `~matplotlib.figure.Figure`
The ``matplotlib`` figure instance for the corner plot.
"""
if arviz_corner is None:
if not (
isinstance(data, np.ndarray)
or data.__class__.__name__ == "DataFrame"
):
raise ImportError(
"Please install arviz or use a numpy array as input"
)
if (
var_names is not None
or filter_vars is not None
or coords is not None
or divergences
or divergences_kwargs is not None
or labeller is not None
):
logging.warning(
"Please install arviz to use the advanced features of corner"
)
return corner_impl(
data,
bins=bins,
range=range,
axes_scale=axes_scale,
weights=weights,
color=color,
hist_bin_factor=hist_bin_factor,
smooth=smooth,
smooth1d=smooth1d,
labels=labels,
label_kwargs=label_kwargs,
titles=titles,
show_titles=show_titles,
title_quantiles=title_quantiles,
title_fmt=title_fmt,
title_kwargs=title_kwargs,
truths=truths,
truth_color=truth_color,
scale_hist=scale_hist,
quantiles=quantiles,
verbose=verbose,
fig=fig,
max_n_ticks=max_n_ticks,
top_ticks=top_ticks,
use_math_text=use_math_text,
reverse=reverse,
labelpad=labelpad,
hist_kwargs=hist_kwargs,
**hist2d_kwargs,
)
return arviz_corner(
data,
bins=bins,
range=range,
axes_scale=axes_scale,
weights=weights,
color=color,
hist_bin_factor=hist_bin_factor,
smooth=smooth,
smooth1d=smooth1d,
labels=labels,
label_kwargs=label_kwargs,
titles=titles,
show_titles=show_titles,
title_quantiles=title_quantiles,
title_fmt=title_fmt,
title_kwargs=title_kwargs,
truths=truths,
truth_color=truth_color,
scale_hist=scale_hist,
quantiles=quantiles,
verbose=verbose,
fig=fig,
max_n_ticks=max_n_ticks,
top_ticks=top_ticks,
use_math_text=use_math_text,
reverse=reverse,
labelpad=labelpad,
hist_kwargs=hist_kwargs,
group=group,
var_names=var_names,
filter_vars=filter_vars,
coords=coords,
divergences=divergences,
divergences_kwargs=divergences_kwargs,
labeller=labeller,
**hist2d_kwargs,
)
|
5,960 | 9586dc118be4388491770d823a38e8068e3b91cb | from django.contrib import admin
from .models import Contactus,ContactusAdmin,Company,CompanyAdmin,Products,ProductsAdmin,Brands,BrandsAdmin
# Register your models here.
admin.site.register(Contactus,ContactusAdmin),
admin.site.register(Company,CompanyAdmin),
admin.site.register(Products,ProductsAdmin),
admin.site.register(Brands,BrandsAdmin), |
5,961 | 6623ac194e380c9554d72a1b20bf860b958dda97 | from django.http import HttpResponse
from django.shortcuts import render
from .models import game
def index(request):
all_games = game.objects.all()
context = {
'all_games' : all_games
}
return render(request,'game/index.html',context)
def gameview(response):
return HttpResponse("<h1>Ludo King</h1>")
|
5,962 | ce263424b856c07e04bd66cda7ebda646583b1fe | S=input()
T=int(input())
B=abs(S.count('L')-S.count('R'))+abs(S.count('U')-S.count('D'))
print(B+S.count('?') if T==1 else max(B-S.count('?'),(B-S.count('?'))%2)) |
5,963 | 719f7b7b2d8df037583263588e93d884ab3820fe | #!/usr/bin/env python
# coding: utf-8
# In[1]:
import pandas as pd
gp = pd.read_csv('graph6.csv')
N=gp['Starting-node'].max()
M=gp['Ending-node'].max()
N=max(N,M)
gp=gp.sort_values(by='Cost')
gp=gp.reset_index()
gp=gp.reset_index()
gp['tree label']=gp['level_0']
index=gp['index'].max()
gp.drop('index',axis=1,inplace=True)
gp.drop('level_0',axis=1,inplace=True)
for n in range(index+1):
Count=[]
Visit=[]
Visit2=[]
for i in range(11):
Count.append(0)
for m in range(n):
if gp.iloc[n]['Starting-node']==gp.iloc[m]['Starting-node']:
if gp.iloc[n]['Starting-node'] not in Visit2:
Count[gp.iloc[m,3]]+=1
Visit2.append(gp.iloc[n]['Starting-node'])
Visit.append(gp.iloc[m,3])
if gp.iloc[n]['Starting-node']==gp.iloc[m]['Ending-node']:
if gp.iloc[n]['Starting-node'] not in Visit2:
Count[gp.iloc[m,3]]+=1
Visit2.append(gp.iloc[n]['Starting-node'])
Visit.append(gp.iloc[m,3])
if gp.iloc[n]['Ending-node']==gp.iloc[m]['Starting-node']:
if gp.iloc[n]['Ending-node'] not in Visit2:
Count[gp.iloc[m,3]]+=1
Visit2.append(gp.iloc[n]['Ending-node'])
Visit.append(gp.iloc[m,3])
if gp.iloc[n]['Ending-node']==gp.iloc[m]['Ending-node']:
if gp.iloc[n]['Ending-node'] not in Visit2:
Count[gp.iloc[m,3]]+=1
Visit2.append(gp.iloc[n]['Ending-node'])
Visit.append(gp.iloc[m,3])
if max(Count)==2:
gp.iloc[n,0]=0
gp.iloc[n,1]=0
gp.iloc[n,2]=0
gp.iloc[n,3]=0
# gp.drop(n,axis=0,inplace=True)
if max(Count)!=2:
for k in range(n):
if gp.iloc[k,3] in Visit:
gp.iloc[k,3]=n
gp.head(11)
# In[ ]:
|
5,964 | 596f7dfacc931f5e756c71b8622f4001df19934b | from rest_framework import serializers
from plan.models import RoughRequirement, DetailedRequirement
from plan.models import OfferingCourse, FieldOfStudy, IndicatorFactor
from plan.models import BasisTemplate
class SimpleOfferingCourseSerializer(serializers.ModelSerializer):
class Meta:
model = OfferingCourse
fields = ['id', 'name']
extra_kwargs = {'name': {'required': False}}
class RoughRequirementSerializer(serializers.ModelSerializer):
class Meta:
model = RoughRequirement
fields = ['id', 'index', 'title', 'description']
class DetailedRequirementSerializer(serializers.ModelSerializer):
class Meta:
model = DetailedRequirement
fields = ['id', 'index', 'description', 'indicator_warning_line', 'rough_requirement']
class RequirementSerializer(serializers.ModelSerializer):
detailed_requirements = DetailedRequirementSerializer(many=True)
class Meta:
model = RoughRequirement
fields = ['id', 'index', 'title', 'description', 'detailed_requirements']
class OfferingCourseSerializer(serializers.ModelSerializer):
class Meta:
model = OfferingCourse
fields = '__all__'
class SimpleOfferingCourseSerializer(serializers.ModelSerializer):
class Meta:
model = OfferingCourse
fields = ["id", "name"]
class FieldOfStudySerializer(serializers.ModelSerializer):
class Meta:
model = FieldOfStudy
fields = '__all__'
class IndicatorFactorSerializer(serializers.ModelSerializer):
class Meta:
model = IndicatorFactor
fields = '__all__'
class BasisTemplateSerializer(serializers.ModelSerializer):
class Meta:
model = BasisTemplate
fields = '__all__'
class ReadIndicatorFactorSerializer(serializers.ModelSerializer):
offering_course = SimpleOfferingCourseSerializer()
field_of_study = FieldOfStudySerializer()
basis_templates = BasisTemplateSerializer(many=True)
rough_requirement = serializers.IntegerField(source='detailed_requirement.rough_requirement.id')
detailed_index = serializers.IntegerField(source='detailed_requirement.index')
rough_index = serializers.IntegerField(source='detailed_requirement.rough_requirement.index')
detailed_description = serializers.CharField(source='detailed_requirement.description')
rough_description = serializers.CharField(source='detailed_requirement.rough_requirement.description')
rough_title = serializers.CharField(source='detailed_requirement.rough_requirement.title')
class Meta:
model = IndicatorFactor
fields = '__all__' |
5,965 | cc1a1491ffbcf470705aeea079faac290dbaa25e | # this is the example code from the t0p-level README..d
from spatialmath import SE3
import roboticstoolbox as rtb
import swift
robot = rtb.models.DH.Panda()
print(robot)
T = robot.fkine(robot.qz)
print(T)
# IK
T = SE3(0.7, 0.2, 0.1) * SE3.OA([0, 1, 0], [0, 0, -1])
sol = robot.ikine_LMS(T) # solve IK, ignore additional outputs
print(sol.q) # display joint angles
# FK shows that desired end-effector pose was achieved
print(robot.fkine(sol.q))
qtraj = rtb.jtraj(robot.qz, sol.q, 50)
robot.plot(qtraj.q, movie="panda1.gif")
# URDF + Swift version
dt = 0.050 # simulation timestep in seconds
robot = rtb.models.URDF.Panda()
print(robot)
env = swift.Swift() # instantiate 3D browser-based visualizer
env.launch("chrome") # activate it
env.add(robot) # add robot to the 3D scene
env.start_recording("panda2", 1 / dt)
for qk in qtraj.q: # for each joint configuration on trajectory
robot.q = qk # update the robot state
env.step() # update visualization
env.stop_recording()
# ffmpeg -i panda2.webm -vf "scale=iw*.5:ih*.5" panda2.gif
|
5,966 | 7aa426723f5311b5abec4a7ace9d3ec1e5e31d9a | '''
่ฟ้จๅ็่งฃๅ่๏ผ
https://www.bilibili.com/video/BV1QA411H7tK?from=search&seid=17305042509580602672
ๅพๆไปฃ็ ๅฐๅ๏ผ https://blog.csdn.net/qq_30758629/article/details/112527763
'''
import threading
import time
data=0
lock=threading.Lock() #ๅๅปบไธไธช้ๅฏน่ฑก
def func():
global data
print("%s is acquire lock..\n" %threading.current_thread().getName())
if lock.acquire():
print("%s get lock "%threading.current_thread().getName())
data+=1
time.sleep(2)
print("%s release lock "%threading.current_thread().getName())
print(data)
lock.release()
t1=threading.Thread(target=func)
t2=threading.Thread(target=func)
t3=threading.Thread(target=func)
t1.start()
t2.start()
t3.start() |
5,967 | 8cf6a9243182a4f6b68199a8967e06790396dc10 | #THIS IS PYTHON3
import tkinter as tk
from tkinter import *
from PIL import ImageTk
from PIL import Image #to handle non-gif image formats
import cv2
import numpy as np
from statistics import mode
import time
import random
import predict as ml
def calcSuccess(predictedCounter, randAssault):
vidLabel.pack_forget()
if predictedCounter == "parry_R":
instructionLabel.config(text="RIGHT PARRY")
if randAssault == 4 or randAssault == 2:
descriptionLabel.config(text="You've successfully parried!")
elif randAssault == 3:
descriptionLabel.config(text="You've been cut!")
elif randAssault == 5:
descriptionLabel.config(text="You've been hit!")
else:
descriptionLabel.config(text="You've been grabbed!")
if predictedCounter == "parry_L":
instructionLabel.config(text="LEFT PARRY")
if randAssault == 5 or randAssault == 3:
descriptionLabel.config(text="You've successfully parried!")
elif randAssault == 2:
descriptionLabel.config(text="You've been cut!")
elif randAssault == 4:
descriptionLabel.config(text="You've been hit!")
else:
descriptionLabel.config(text="You've been grabbed!")
if predictedCounter == "punch_R":
instructionLabel.config(text="RIGHT PUNCH")
if randAssault == 0 or randAssault == 1 or randAssault == 4:
descriptionLabel.config(text="You've successfully counter attacked!")
elif randAssault == 2 or randAssault == 3:
descriptionLabel.config(text="You've been cut!")
elif randAssault == 5:
descriptionLabel.config(text="You've been hit!")
if predictedCounter == "punch_L":
instructionLabel.config(text="LEFT PUNCH")
if randAssault == 0 or randAssault == 1 or randAssault == 5:
descriptionLabel.config(text="You've successfully counter attacked!")
elif randAssault == 2 or randAssault == 3:
descriptionLabel.config(text="You've been cut!")
elif randAssault == 4:
descriptionLabel.config(text="You've been hit!")
if predictedCounter == "weave_R":
instructionLabel.config(text="RIGHT WEAVE")
if randAssault == 1 or randAssault == 3 or randAssault == 5:
descriptionLabel.config(text="You've successfully evaded!")
elif randAssault == 4:
descriptionLabel.config(text="You've been hit!")
elif randAssault == 2:
descriptionLabel.config(text="You've been cut!")
else:
descriptionLabel.config(text="You've been grabbed!")
if predictedCounter == "weave_L":
instructionLabel.config(text="LEFT WEAVE")
if randAssault == 0 or randAssault == 2 or randAssault == 4:
descriptionLabel.config(text="You've successfully evaded!")
elif randAssault == 5:
descriptionLabel.config(text="You've been hit!")
elif randAssault == 3:
descriptionLabel.config(text="You've been cut!")
else:
descriptionLabel.config(text="You've been grabbed!")
if predictedCounter == "block":
instructionLabel.config(text="BLOCK")
if randAssault == 5 or randAssault == 4:
descriptionLabel.config(text="You've successfully blocked!")
elif randAssault == 2 or randAssault == 3:
descriptionLabel.config(text="You've been cut!")
elif randAssault == 0 or randAssault == 1:
descriptionLabel.config(text="You've been grabbed!")
descriptionLabel.pack()
cap = cv2.VideoCapture(0)
root = tk.Tk() #initialize tkinter by making tk rook widget--consists of window with tile bar and decoration provided by window manager. Root widget must be made first and can only be one.
root.geometry("2000x1100")
ldFrame = Frame(root).pack(side="top") #frame to hold logo and description
canvas = Canvas(ldFrame, width=700, height=200)
canvas.pack(side="top")
#open image with pil image because PhotoImage only takes gif
pilLogo = Image.open("Logo.png")
logo = ImageTk.PhotoImage(pilLogo) #makes PhotoImage from pil image
canvas.create_image(350, 100, image=logo) #adds PhotoImage to Canvas
#make basic description label from text string on the logo description frame
descriptionText = """This program trains the user to respond in self defense to common physical threats."""
descriptionLabel = tk.Label(ldFrame, justify="center", padx=10, font=("Courier", 18), wraplength=1900, text=descriptionText)
descriptionLabel.pack(side="top")
#make center frame that will show instructions initially and then have "assaulter" prompts and live video
centerFrame = Frame(root).pack()
countdownLabel = tk.Label(centerFrame, justify="center", font=("Courier", 20), text="") #invisible for now because not packed
instructionText = """In this training system, you will be prompted with how an aggressor is approaching you. You may select a difficulty for this system by choosing how much time you would like to be allowed to react. Based on your counter attack, the system will tell you if the attacker has been [Narrowly Avoided], [Stunned], or [Subdued] based on the quality of your reaction. Your success rate will be tracked at the bottom of the screen. Press the [Start] button to begin and the [Stop] button to end the session."""
instructionLabel = tk.Label(centerFrame, justify="center", padx=50, pady=50, font=("Courier", 16), wraplength=1800, text=instructionText)
instructionLabel.pack(side="top")
#setup to capture video frames
vidLabel = Label(root)
def show_frame(milliseconds):
if milliseconds > 0:
#global predictionArr
_, frame = cap.read()
#predictionArr.append(predict.get_prediction(frame, "ace-connection-236822", "ICN2459521650166688930"))
frame = cv2.flip(frame, 1) #horizontally flips images so is like reflection
cv2image = cv2.cvtColor(frame, cv2.COLOR_BGR2RGBA) #makes normal color
img = Image.fromarray(cv2image)
imgtk = ImageTk.PhotoImage(img)
vidLabel.imgtk = imgtk
vidLabel.config(image=imgtk)
root.update()
root.after(30, show_frame, (milliseconds-30))
_, frame = cap.read()
cv2image = cv2.cvtColor(frame, cv2.COLOR_BGR2RGBA)
img = Image.fromarray(cv2image)
img = img.convert("RGB")
img.save("imgFile.jpeg")
if milliseconds == secondsChosen*3000:
return ml.predict("imgFile.jpeg")
#make bottom frame that hold buttons
buttonFrame = Frame(root)
buttonFrame.pack(side="bottom")
difficultyList = Listbox(buttonFrame, selectmode=SINGLE, height=3, font=("Courier", 16))
difficultyList.insert(1, "Easy: 6 seconds")
difficultyList.insert(2, "Medium: 3 seconds")
difficultyList.insert(3, "Hard: 1 seconds")
difficultyList.pack(side="top")
cycling = True
def runPrompt():
startButton.config(text="Next")
startButton.pack(side=LEFT)
resetButton.pack(side=RIGHT)
descriptionLabel.pack_forget()
assaultList = ["Grab from your right", "Grab from your left", "Blade attack from the right", "Blade attack from the left", "Hit from the right", "Hit from the left"]
counterList = ["parry_R", "parry_L", "weave_R", "weave_L", "punch_R", "punch_L", "block"]
difficultyChoice = (difficultyList.get(ACTIVE))
global secondsChosen
secondsChosen = 0
if difficultyChoice[0] == "E":
secondsChosen = 6
elif difficultyChoice[0] == "M":
secondsChosen = 3
else:
secondsChosen = 1
print(secondsChosen)
difficultyList.pack_forget()
randAssault = random.randint(0, 5)
instructionLabel.config(text=assaultList[randAssault], font=("Courier", 25))
vidLabel.pack()
predictedCounter = show_frame(secondsChosen*1000)
if predictedCounter not in counterList:
predictedCounter = counterList[random.randint(0, 6)]
root.after(secondsChosen*1200, calcSuccess, predictedCounter, randAssault)
return 0
def reset():
resetButton.pack_forget()
startButton.config(text="Start")
startButton.pack(side=BOTTOM)
instructionLabel.config(text=instructionText, font=("Courier", 16))
descriptionLabel.config(text=descriptionText, font=("Courier", 18))
descriptionLabel.pack(side=TOP)
difficultyList.pack(side=TOP)
startButton = Button(buttonFrame, bd=6, padx=20, pady=20,font=("Courier", 16), text="Start", fg="green", command=runPrompt)
startButton.pack(side=BOTTOM)
resetButton = Button(buttonFrame, bd=6, padx=20, pady=20, font=("Courier", 16), text="Reset", fg="red", command=reset)
root.mainloop()
cap.release()
|
5,968 | 48e3259698788904e000eb15b5443067b0c3e791 | #alds13c
from collections import deque
d_stack=deque()
res_stack=deque()
s = input()
for i in range(len(s)):
#print(d_stack,res_stack)
if s[i]=="\\":
d_stack.append(i)
elif s[i]=="/":
if len(d_stack)==0:
continue
left = d_stack.pop()
area = i-left
#res_stack.append((left,area))
if len(res_stack)>0:
flag=True
#merge_candidate = []
mergeareasum=0
while flag:
if len(res_stack)>0 and left<res_stack[-1][0]:
mc = res_stack.pop()
mergeareasum += mc[1]
#res_stack.append((left,under[1]+area))
else:
flag = False
res_stack.append((left,area+mergeareasum))
else:
res_stack.append((left,area))
ans=0
v_devided=[]
for pair in res_stack:
ans += pair[1]
v_devided.append(str(pair[1]))
print(ans)
if len(v_devided)>0:
print(len(v_devided)," ".join(v_devided))
else:
print(0)
|
5,969 | 436cc06778bf9ac9e04a897f4a4db90c595d943c | # load the dependencies
from airflow import DAG
from datetime import date, timedelta, datetime
# default_args are the default arguments applied to the DAG and all inherited tasks
DAG_DEFAULT_ARGS = {
'owner': 'airflow',
'depends_on_past': False,
'retries': 1,
'retry_delay': timedelta(minutes=1)
}
with DAG('twitter_dag_v1', start_date=datetime(2018, 10, 1), schedule_interval="@daily", default_args=DAG_DEFAULT_ARGS, catchup=False) as dag:
None
|
5,970 | cfa0937f1c49b52283c562d9ab1cb0542e71b990 | import matplotlib.pyplot as plt
from partisan_symmetry_noplot import partisan_symmetry
for k in range(1,100):
a=[]
for i in range(1,100):
a.append([])
for j in range(1,100):
a[i-1].append(partisan_symmetry([5*i/100,.20,5*j/100],1000,False))
plt.imshow(a)
plt.colorbar()
plt.xticks(range(99),[x/20 for x in range(1,100)])
plt.yticks(range(99),[x/20 for x in range(1,100)])
plt.title("Partisan Symmetry Difference for (x,"+str(k)+",y)")
plt.savefig("./ps"+str(k)+".png")
plt.close()
print("figure",k,"done")
|
5,971 | aa47b7c74b9b6b8a7f014de4bd58236edeba485d | import os
class User(object):
def __init__(self, meta):
meta.update({
'groups': meta.get('groups', []) + [meta['username']]
})
self.meta = meta
@property
def username(self):
return self.meta['username']
@property
def groups(self):
return self.meta['groups']
@property
def home_path(self):
return os.path.join('/home', self.username)
@property
def is_root(self):
return self.username == 'root'
def own(self, node):
if self.is_root:
return True
return node.owner == self.username
def can_read(self, node):
if self.is_root:
return True
if self.own(node) and node.owner_readable:
return True
if node.group in self.groups and node.group_readable:
return True
if node.other_readable:
return True
return False
def can_write(self, node):
if self.is_root:
return True
if self.own(node) and node.owner_writable:
return True
if node.group in self.groups and node.group_writable:
return True
if node.other_writable:
return True
return False
def can_create(self, node):
return self.can_write(node.parent)
def can_remove(self, node):
return self.can_write(node.parent)
def __getitem__(self, key):
return self.meta.__getitem__(key)
def __repr__(self):
return repr(self.meta)
root_user = User({'username': 'root'})
|
5,972 | cdd929ee041c485d2a6c1149ea1b1ced92d7b7ab | # -*- coding: utf-8 -*-
# Generated by Django 1.9.2 on 2016-08-03 02:31
from __future__ import unicode_literals
from django.db import migrations, models
import django.db.models.deletion
class Migration(migrations.Migration):
initial = True
dependencies = [
]
operations = [
migrations.CreateModel(
name='Kategori',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('nama_kategori', models.CharField(max_length=30)),
('deskripsi', models.CharField(max_length=100)),
],
),
migrations.CreateModel(
name='Stone',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('kode', models.CharField(max_length=30)),
('deskripsi', models.CharField(max_length=200)),
('cover_stone', models.ImageField(upload_to='\\images')),
('kategori', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='stones.Kategori')),
],
),
]
|
5,973 | 41294c803cf42611fa003f21b74a49dd5576a8e8 | # Copyright (c) 2020, Galois, Inc.
#
# All Rights Reserved
#
# This material is based upon work supported by the Defense Advanced Research
# Projects Agency (DARPA) under Contract No. FA8750-20-C-0203.
#
# Any opinions, findings and conclusions or recommendations expressed in this
# material are those of the author(s) and do not necessarily reflect the views
# of the Defense Advanced Research Projects Agency (DARPA).
from dataclasses import dataclass
import semtk
from migration_helpers.name_space import NameSpace, get_uri
from ontology_changes.ontology_change import stylize_property, OntologyChange
@dataclass
class RemoveIsATypeOf(OntologyChange):
"""
Represents an ontology change where:
property_id is a type of from_property_id.
has been removed.
"""
name_space: NameSpace
class_id: str
property_id: str
range_id: str
def text_description(self) -> str:
prop = stylize_property(self.property_id)
range_str = stylize_property(self.range_id)
return f"Property {prop} used to be a type of {range_str}, no longer."
def migrate_json(self, json: semtk.SemTKJSON) -> None:
json.accept(MigrationVisitor(self))
class MigrationVisitor(semtk.DefaultSemTKVisitor):
def __init__(self, data: RemoveIsATypeOf):
self.data = data
# TODO?
|
5,974 | 661d82adc7d0746635fb57abf6d0e70ee615ada4 | # -*- coding: utf-8 -*-
file1 = raw_input("Enter the path of your first file: ")
file2 = raw_input("Enter the path of your second file: ")
Basex = open(file1).read().split()
Basey = open(file2).read().split()
if Basex != Basey:
print("The files are different!")
else:
print("The files are the same!")
|
5,975 | efe5921afb160b7b5a953cdd0c2f90f64b5f34c9 |
"""
Make sure overwriting read-only files works as expected (via win-tool).
"""
import TestGyp
import filecmp
import os
import stat
import sys
if sys.platform == 'win32':
test = TestGyp.TestGyp(formats=['ninja'])
os.makedirs('subdir')
read_only_files = ['read-only-file', 'subdir/A', 'subdir/B', 'subdir/C']
for f in read_only_files:
test.write(f, 'source_contents')
test.chmod(f, stat.S_IREAD)
if os.access(f, os.W_OK):
test.fail_test()
os.makedirs(test.built_file_path('dest/subdir'))
for f in read_only_files:
f = os.path.join('dest', f)
test.write(test.built_file_path(f), 'SHOULD BE OVERWRITTEN')
test.chmod(test.built_file_path(f), stat.S_IREAD)
if os.access(test.built_file_path(f), os.W_OK):
test.fail_test()
test.run_gyp('copies_readonly_files.gyp')
test.build('copies_readonly_files.gyp')
for f in read_only_files:
f = os.path.join('dest', f)
test.must_contain(test.built_file_path(f), 'source_contents')
for f in read_only_files:
if not filecmp.cmp(f, test.built_file_path(os.path.join('dest', f))):
test.fail_test()
test.pass_test()
|
5,976 | e1ecc08f66e094841647f72b78bcd29ed8d32668 | import requests
import json
l = list()
with open ( "token.txt", "r") as f:
token = f.read()
# ัะพะทะดะฐะตะผ ะทะฐะณะพะปะพะฒะพะบ, ัะพะดะตัะถะฐัะธะน ะฝะฐั ัะพะบะตะฝ
headers = {"X-Xapp-Token" : token}
with open('dataset_24476_4.txt', 'r') as id:
for line in id:
address = "https://api.artsy.net/api/artists/" + line.strip()
# ะธะฝะธัะธะธััะตะผ ะทะฐะฟัะพั ั ะทะฐะณะพะปะพะฒะบะพะผ
r = requests.get(address, headers=headers)
# ัะฐะทะฑะธัะฐะตะผ ะพัะฒะตั ัะตัะฒะตัะฐ
j = json.loads(r.text)
l.append((j['sortable_name'], j['birthday']))
#l.append((('Warhol Bandy', '1928')))
#l.append((('Warhol Aandy', '1928')))
l = sorted(l, key=lambda tup: (tup[1], tup[0]))
for i in l:
print(i[0])
# year = '0000'
# new_l = []
#
# k = []
#
# for i in l:
# if i[1] != year:
# k = []
# k.append(i[0])
# year = i[1]
# else:
# k.append(i[0])
# k.sort()
# print(next(name for name in k))
|
5,977 | cc6f02f9e1633fa15b97af5f926e083a65a8336e | # Problem 20: Factorial digit sum
def factorial(num):
sum = 1
while num != 0:
sum *= num
num -= 1
return sum
def sum_digits(num):
sum = 0
while num != 0:
sum += num % 10
num //= 10
return sum
print(sum_digits(factorial(100))) |
5,978 | 30a57197e3156023ac9a7c4a5218bfe825e143d9 | # Fix a method's vtable calls + reference making
#@author simo
#@category iOS.kernel
#@keybinding R
#@toolbar logos/refs.png
#@description Resolve references for better CFG
# -*- coding: utf-8 -*-
"""
script which does the following:
- adds references to virtual method calls
- Identifies methods belong to a specific namespace
- Handles multi value vtable reference (multi-nodes)
"""
from utils.references import *
if __name__ == "__main__":
fix_extra_refs(currentAddress)
|
5,979 | 021cbd1bd22f9ec48db2e52b2a98be169bbfdbbd | # -*- coding: utf-8 -*-
# @Author: huerke
# @Date: 2016-09-03 10:55:54
# @Last Modified by: huerke
# @Last Modified time: 2016-09-03 15:54:50
from flask import render_template
from . import main
@main.app_errorhandler(404)
def page_not_found(e):
return render_template('404.html'), 404
@main.app_errorhandler(500)
def internal_server_error(e):
return render_template('500.html'), 500
|
5,980 | 603d7df0639def2b620cca2299077674e35a74b2 | from wrapper import SeleniumWrapper
from selenium.webdriver.common.by import By
class PageDetector:
def __init__(self, driver):
self.selenium = SeleniumWrapper(driver)
def detect(self):
if self.selenium.wait_for_presence(locator=(By.ID, "teams-app-bar"), timeout=30):
if self.selenium.wait_for_presence(locator=(By.ID, "download-desktop-page"), timeout=3):
return "promo-page"
return "main-app-page"
elif self.selenium.wait_for_title_contains(title_substring="Sign in", timeout=30):
return "sign-in-page"
else:
return "unknown" |
5,981 | 3b5141a86948df6632612f6c9d7fc0089acc60aa | #!/usr/bin/env python
# -*- coding: utf-8 -*-
import random
class Role:
"""
่ง่ฒ็ฑป
ๅงๅบ
ๅนณๆฐ
"""
def __init__(self,key_word="",role_id = 0):
self.key_word = key_word
self.role_id = role_id #ๅนณๆฐ-0๏ผๅงๅบ-1๏ผ
class User(Role):
"""
็จๆท็ฑป
็ฉๅฎถ
"""
def __init__(self,id,role_id):
self.id = id #็ฉๅฎถid
self.role_id = role_id
|
5,982 | c414e5d3934f741540fb5721a529b48f95e17016 | # -*- coding: utf-8 -*-
import sqlalchemy as sa
import ujson
from aiohttp import web, WSMsgType
from .db import TLE
from .log import logger
from .utils import parse_sa_filter, parse_sa_order, check_sa_column, get_sa_column
async def query(request):
filters = []
if 'filters' not in request.query:
raise web.HTTPBadRequest(reason='Query parameter `filters` is required')
try:
_filters = ujson.loads(request.query.get('filters', '{}'))
for k, v in _filters.items():
filters.extend(parse_sa_filter(TLE, k, v))
except ValueError:
raise web.HTTPBadRequest(reason='Query parameter `filters` must contains valid JSON')
_order = request.query.get('order', '{}')
if _order.startswith('{'):
try:
order = ujson.loads(_order)
except ValueError:
raise web.HTTPBadRequest(reason='Query parameter `order` must contains valid JSON')
else:
order = _order
order = parse_sa_order(TLE, order)
only = [get_sa_column(TLE, key) for key in request.query.get('only', '').split(',') if check_sa_column(TLE, key)]
async with request.app['pg'].acquire() as conn:
rp = await conn.execute(sa.select(only or [TLE]).where(sa.and_(*filters)).order_by(*order))
return [dict(r) async for r in rp]
async def index(request):
html = '''
<html>
<head>
<script src="//ajax.googleapis.com/ajax/libs/jquery/1.9.1/jquery.min.js"></script>
<script>
var source = new WebSocket('ws://' + window.location.host + '/subscribe');
function eventListener(event) {
var message = JSON.parse(event.data);
$('.messages').append([
$('<dt>').text(message.channel),
$('<dd>').text(event.data),
]);
}
source.onmessage = eventListener;
</script>
</head>
<body>
<dl class="messages"></dl>
</body>
</html>
'''
return web.Response(text=html, content_type='text/html')
async def subscribe(request):
ws = web.WebSocketResponse()
await ws.prepare(request)
request.app['channels'].add(ws)
logger.debug('Someone joined.')
try:
while True:
msg = await ws.receive_json()
if msg.get('command') == 'close':
await ws.close()
except Exception as exc:
logger.exception(exc)
finally:
request.app['channels'].remove(ws)
if ws.closed:
request.app['channels'].remove(ws)
logger.debug('websocket connection closed')
return ws
|
5,983 | 705bc651e7d12769bcf5994168fe6685a6bae05d | #!/usr/bin/env python
import sys
import requests
import numpy as np
import astropy.table as at
if __name__=='__main__':
targets = at.Table.read('targets_LCO2018A_002.txt', format='ascii')
headers={'Authorization': 'Token {}'.format(sys.argv[1])}
for x in targets['targetname']:
obs = requests.get('https://observe.lco.global/api/userrequests/?proposal=LCO2018A-002&title={}'.format(x.split('.')[0]),headers=headers).json()
for y in obs['results']:
print(y['group_id'])
|
5,984 | 86c053b7d4c752182965755ad5b6ba6937ce6f86 | import unittest
from dispatcher.task import *
from mock import *
class TestTask(unittest.TestCase):
def test_init(self):
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=1D', 'time=09:45', 'description=invalid time']
task = Task(task_attr)
self.assertEqual(task.basename(), 'dummy_task2.py')
self.assertEqual(task.frequency, str('1D').lower())
self.assertEqual(task.filename, 'C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py')
self.assertEqual(task.time, '09:45')
self.assertTrue(task.is_good())
def test_init_bad_invalid_filename(self):
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\sadfsda.py',
'frequency=1D', 'time=09:45', 'description=invalid filename']
task = Task(task_attr)
self.assertFalse(task.is_good())
task_attr = ['filename=',
'frequency=1D', 'time=09:45', 'description=invalid filename']
task = Task(task_attr)
self.assertFalse(task.is_good())
def test_init_bad_invalid_time(self):
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=1D', 'time=0ssss9:45', 'description=invalid time']
task = Task(task_attr)
self.assertFalse(task.is_good())
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=1D', 'time=09:45:924355435', 'description=invalid time']
task = Task(task_attr)
self.assertFalse(task.is_good())
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=1D', 'time=09924355435', 'description=invalid time']
task = Task(task_attr)
self.assertFalse(task.is_good())
def test_init_good_empty_time(self):
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=1D', 'time=', 'description=']
task = Task(task_attr)
self.assertTrue(task.is_good())
def test_init_bad_invalid_frequency(self):
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=1Dhhhh', 'time=', 'description=invalid frequency']
task = Task(task_attr)
self.assertFalse(task.is_good())
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=D', 'time=', 'description=invalid frequency']
task = Task(task_attr)
self.assertFalse(task.is_good())
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=2S', 'time=', 'description=invalid frequency']
task = Task(task_attr)
self.assertFalse(task.is_good())
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=', 'time=', 'description=invalid frequency']
task = Task(task_attr)
self.assertFalse(task.is_good())
def test_init_good_zero_frequency(self):
task_attr = ['filename=C:\\Users\\kcheng\\PycharmProjects\\first_project\\dummy_task2.py',
'frequency=0minute', 'time=', 'description=invalid frequency']
task = Task(task_attr)
self.assertTrue(task.is_good())
if __name__ == '__main__':
unittest.main() |
5,985 | 963e736fd4a942fb1c51e1e0a357ad6be48aed9a |
#Una empresa les paga a sus empleados con base en las horas trabajadas en la semana.
#Realice un algoritmo para determinar el sueldo semanal de N trabajadores
#y, ademรกs, calcule cuรกnto pagรณ la empresa por los N empleados.
base = int(input("Dinero por hora trabajada: "))
emp = int(input("Dime el nยบ de empleados: "))
for i in range(0,8):
|
5,986 | ca25739583d3b7ff449fbd2f56a96631981c815d | # -*- coding: utf-8 -*-
import sys
from os import path
try:
import DMP
except ImportError:
sys.path.append(path.dirname(path.dirname(path.abspath(__file__))))
from DMP.modeling.vectorMaker import VectorMaker
from DMP.modeling.variables import KEY_TOTAL, KEY_TRAIN, KEY_VALID, KEY_TEST
from DMP.dataset.dataHandler import DataHandler
from DMP.utils.arg_encoding import *
if __name__ == '__main__':
file_dict = {
KEY_TOTAL: SAVE_FILE_TOTAL,
KEY_TRAIN: SAVE_FILE_TRAIN,
KEY_VALID: SAVE_FILE_VALID,
KEY_TEST: SAVE_FILE_TEST
}
dataHandler_dict = dict()
# loading data
for key, read_csv in file_dict.items():
dataHandler = DataHandler(read_csv, column_target=COLUMN_TARGET, eliminate_target=True)
dataHandler.load()
dataHandler_dict[key] = dataHandler
# encoding data using dataHandler
vectorMaker = VectorMaker(dataHandler_dict)
vectorMaker.encoding()
vectorMaker.show_vector_info()
vectorMaker.build_tf_records()
vectorMaker.build_pillow_img()
vectorMaker.dump()
|
5,987 | 635b02e03578d44f13530bd57ab1a99987d4909d | # -*- coding: utf-8 -*-
"""
Created on Wed May 16 10:17:32 2018
@author: pearseb
"""
#%% imporst
import os
import numpy as np
import netCDF4 as nc
import matplotlib.pyplot as plt
import matplotlib.cm as cm
import cmocean.cm as cmo
import seaborn as sb
sb.set(style='ticks')
import mpl_toolkits.basemap as bm
import pandas as pd
# move to working directory
os.chdir("C://Users/pearseb/Dropbox/PhD/My articles/nitrogen-carbon cycles/data_for_publication")
#%% get data
data = nc.Dataset('BGC_Mk3Lpi_Fe-mod_default_N15active.nc', 'r')
mk3lpi_no3 = data.variables['no3'][...]
mk3lpi_n15 = data.variables['no3_15'][...]
mk3lpi_no3 = np.ma.masked_where(mk3lpi_no3<0.1, mk3lpi_no3)
mk3lpi_n15 = np.ma.masked_where(mk3lpi_no3<0.1, mk3lpi_n15)
mk3lpi_d15n = (mk3lpi_n15/(mk3lpi_no3-mk3lpi_n15)-1)*1000
mk3lpi_d15org = data.variables['sed_d15n'][...]
data = nc.Dataset('BGC_Mk3Lpi_Fe-2500per_default_N15active.nc', 'r')
mk3lpidust_no3 = data.variables['no3'][...]
mk3lpidust_n15 = data.variables['no3_15'][...]
mk3lpidust_no3 = np.ma.masked_where(mk3lpidust_no3<0.1, mk3lpidust_no3)
mk3lpidust_n15 = np.ma.masked_where(mk3lpidust_no3<0.1, mk3lpidust_n15)
mk3lpidust_d15n = (mk3lpidust_n15/(mk3lpidust_no3-mk3lpidust_n15)-1)*1000
mk3lpidust_d15org = data.variables['sed_d15n'][...]
data = nc.Dataset('BGC_Mk3Llgm_Fe-mod_default_N15active.nc', 'r')
mk3llgm_no3 = data.variables['no3'][...]
mk3llgm_n15 = data.variables['no3_15'][...]
mk3llgm_no3 = np.ma.masked_where(mk3llgm_no3<0.1, mk3llgm_no3)
mk3llgm_n15 = np.ma.masked_where(mk3llgm_no3<0.1, mk3llgm_n15)
mk3llgm_d15n = (mk3llgm_n15/(mk3llgm_no3-mk3llgm_n15)-1)*1000
mk3llgm_d15org = data.variables['sed_d15n'][...]
data = nc.Dataset('BGC_Mk3Llgm_Fe-2500per_default_N15active.nc', 'r')
mk3llgmdust_no3 = data.variables['no3'][...]
mk3llgmdust_n15 = data.variables['no3_15'][...]
mk3llgmdust_no3 = np.ma.masked_where(mk3llgmdust_no3<0.1, mk3llgmdust_no3)
mk3llgmdust_n15 = np.ma.masked_where(mk3llgmdust_no3<0.1, mk3llgmdust_n15)
mk3llgmdust_d15n = (mk3llgmdust_n15/(mk3llgmdust_no3-mk3llgmdust_n15)-1)*1000
mk3llgmdust_d15org = data.variables['sed_d15n'][...]
grid = nc.Dataset('grid_spec_mk3l_128_112_21_v2.nc', 'r')
dvts = grid.variables['dvts'][...]
dats = grid.variables['dats'][...]
lats = grid.variables['latts'][...]
lat_bnds = grid.variables['latts_bnds'][...]
lons = grid.variables['lonts'][...]
lon_bnds = grid.variables['lonts_bnds'][...]
lon_bnds[:,0] += 360.0
deps = grid.variables['zts'][...]
dep_bnds = grid.variables['zts_bnds'][...]
zts = dvts/dats
#%% apply depth correction to d15N of organic matter (see Robinson et al., 2012, Paleoceanography)
deps3d = np.cumsum(zts,axis=0)
# correction
mk3lpi_d15org_cor = mk3lpi_d15org + 0.9*(deps3d*1e-3)
mk3lpidust_d15org_cor = mk3lpidust_d15org + 0.9*(deps3d*1e-3)
mk3llgm_d15org_cor = mk3llgm_d15org + 0.9*(deps3d*1e-3)
mk3llgmdust_d15org_cor = mk3llgmdust_d15org + 0.9*(deps3d*1e-3)
# average over all depths
mk3lpi_d15org_corz = np.ma.average(mk3lpi_d15org_cor, axis=0, weights=zts)
mk3lpidust_d15org_corz = np.ma.average(mk3lpidust_d15org_cor, axis=0, weights=zts)
mk3llgm_d15org_corz = np.ma.average(mk3llgm_d15org_cor, axis=0, weights=zts)
mk3llgmdust_d15org_corz = np.ma.average(mk3llgmdust_d15org_cor, axis=0, weights=zts)
#%% collect prepared compilation of sedimentary d15N records
df = pd.read_csv('Supplementary Data 1.csv')
print(df)
records = df[~np.isnan(df['d15n_LateH'])]
bulk_records = records[records['type']=='bulk']
bound_records = records[records['type']!='bulk']
#%%
lat_labs = ['80$^{\circ}$S', '60$^{\circ}$S', '40$^{\circ}$S', '20$^{\circ}$S', '0$^{\circ}$', \
'20$^{\circ}$N', '40$^{\circ}$N', '60$^{\circ}$N', '80$^{\circ}$N']
lon_labs = ['0$^{\circ}$E', '50$^{\circ}$E', '100$^{\circ}$E', '150$^{\circ}$E', '200$^{\circ}$E', \
'250$^{\circ}$E', '300$^{\circ}$E', '350$^{\circ}$E']
domain = [-45,0,45,355]
domain_draw = [-40,0,40,360]
dlat=20
dlon=60
xx,yy = np.meshgrid(lons, lats)
#%%
levs = np.arange(-5,5.1,0.5)
conts = [-1,1]
fig = plt.figure(facecolor='w', figsize=(10,4))
plt.title('Glacial minus Late Holocene change in $\delta^{15}$N$_{org}$', family='sans-serif', fontsize=12)
proj = bm.Basemap(projection='merc', llcrnrlat=domain[0], llcrnrlon=domain[1], urcrnrlat=domain[2], urcrnrlon=domain[3], resolution='c')
lonproj, latproj = proj(xx, yy)
bulk_x, bulk_y = proj(np.array(bulk_records['lon']),np.array(bulk_records['lat']))
bound_x, bound_y = proj(np.array(bound_records['lon']),np.array(bound_records['lat']))
proj.drawcoastlines(linewidth=0.5, color='k')
proj.fillcontinents(color='grey')
p3 = plt.contourf(lonproj, latproj, mk3lpidust_d15org_corz-mk3lpi_d15org_corz, cmap=cmo.balance, corner_mask=False, \
levels=levs, vmin=np.ma.min(levs), vmax=np.ma.max(levs), extend='both')
c3 = plt.contour(lonproj, latproj, mk3lpidust_d15org_corz-mk3lpi_d15org_corz, colors='black', levels=conts, alpha=0.8, linewidths=0.5, linestyle='-')
s31 = plt.scatter(bound_x, bound_y, s=150, c=bound_records['d15n_LGM']-bound_records['d15n_LateH'], \
marker='*', vmin=np.ma.min(levs), vmax=np.ma.max(levs), cmap=cmo.balance, \
alpha=0.75, edgecolor='k', linewidths=1.0, zorder=3)
s32 = plt.scatter(bulk_x, bulk_y, s=40, c=bulk_records['d15n_LGM']-bulk_records['d15n_LateH'], \
marker='o', vmin=np.ma.min(levs), vmax=np.ma.max(levs), cmap=cmo.balance, \
alpha=0.75, edgecolor='k', linewidths=1.0, zorder=2)
proj.drawparallels(range(domain_draw[0],domain_draw[2]+1,dlat), labels=[True,False,False,False], color=(.3,.3,.3), linewidth=0, fontsize=12, family='sans-serif')
proj.drawmeridians(range(domain_draw[1],domain_draw[3]+1,dlon), labels=[True,False,False,True], color=(.3,.3,.3), linewidth=0, fontsize=12)
from matplotlib.lines import Line2D
elements = [Line2D([0], [0], marker='o', markerfacecolor='w', markeredgecolor='k', color='w', linewidth=1.0, markersize=15, label='Bulk organic N'),\
Line2D([0], [0], marker='*', markerfacecolor='w', markeredgecolor='k', color='w', linewidth=1.0, markersize=20, label='Bound organic N')]
plt.legend(handles=elements, loc='center', bbox_to_anchor=(0.5,-0.25), ncol=2, frameon=False, scatterpoints=1)
plt.subplots_adjust(bottom=0.1, top=0.95, left=0.075, right=0.85)
cbax = fig.add_axes([0.88, 0.25, 0.03, 0.55])
cbar = plt.colorbar(p3, cax=cbax, orientation='vertical')
cbar.ax.set_ylabel(u'$\delta^{15}$N โฐ vs air', fontsize=12, family='sans-serif')
plt.clabel(c3, manual=True, fmt='%i', fontsize=10, colors='k', inline=True)
fig.savefig('figures_for_publication/fig4.pdf',dpi=300,bbox_inches='tight')
fig.savefig('figures_for_publication/fig4.png',dpi=300,bbox_inches='tight')
|
5,988 | 40ee790f4272c05c1619eb7b2cc66a8b57bbe8a8 | # -*- coding: utf-8 -*-
from cms.app_base import CMSApp
from cms.apphook_pool import apphook_pool
from django.utils.translation import ugettext_lazy as _
class StaffApp(CMSApp):
name = _('Staff')
urls = ['blog.urls', ]
app_name = 'staff'
apphook_pool.register(StaffApp)
|
5,989 | 4abcca52095a169b71d2527ce52b8367534c42a4 | # -*- python -*-
# ex: set syntax=python:
# vim: set syntax=python:
import os
import re
from collections import defaultdict, namedtuple
from enum import Enum
from pathlib import Path
import buildbot.www.authz.endpointmatchers as ems
from buildbot.changes.filter import ChangeFilter
from buildbot.changes.gitpoller import GitPoller
from buildbot.config import BuilderConfig
from buildbot.locks import WorkerLock
from buildbot.process.factory import BuildFactory
from buildbot.process.properties import Interpolate, Property, renderer, Transform
from buildbot.reporters.generators.build import BuildStartEndStatusGenerator
from buildbot.reporters.github import GitHubStatusPush
from buildbot.reporters.message import MessageFormatterRenderable
from buildbot.schedulers.basic import AnyBranchScheduler
from buildbot.schedulers.forcesched import ForceScheduler
from buildbot.schedulers.timed import Nightly
from buildbot.steps.cmake import CMake
from buildbot.steps.master import SetProperties
from buildbot.steps.shell import SetPropertyFromCommand, ShellCommand
from buildbot.steps.source.git import Git
from buildbot.steps.source.github import GitHub
from buildbot.steps.transfer import FileUpload, FileDownload
from buildbot.steps.worker import MakeDirectory, SetPropertiesFromEnv, RemoveDirectory
from buildbot.worker import Worker
from buildbot.www.auth import UserPasswordAuth
from buildbot.www.authz import Authz
from buildbot.www.authz.roles import RolesFromUsername
from buildbot.www.hooks.github import GitHubEventHandler
from twisted.internet import defer
from custom_steps import CTest, CleanOldFiles, SetPropertiesFromCMakeCache
# This is the dictionary that the buildmaster pays attention to. We also use
# a shorter alias to save typing.
c = BuildmasterConfig = {}
# SECRETS
GITHUB_TOKEN = Path('github_token.txt').read_text().strip()
WORKER_SECRET = Path('halide_bb_pass.txt').read_text().strip()
WEBHOOK_SECRET = Path('webhook_token.txt').read_text().strip()
WWW_PASSWORD = Path('buildbot_www_pass.txt').read_text().strip()
# SERVER SETTINGS
ARTIFACTS_DIR = os.environ.get('HALIDE_BB_MASTER_ARTIFACTS_DIR', '/home/halidenightly/artifacts')
REPO_DIR = Path(__file__, '..', '..').resolve()
# LLVM
# At any given time, we test (at least) 3 LLVM versions:
# - the current main (changes daily)
# - the most recent release (expected to be stable)
# - an older release (expected to be stable)
#
# The branches that correspond to these will rotate as new versions
# are released, but the underlying test logic should not need changing.
Version = namedtuple('Version', ['major', 'minor', 'patch'])
VersionedBranch = namedtuple('VersionedBranch', ['ref', 'version'])
LLVM_MAIN = 'main'
LLVM_RELEASE_17 = 'release_17'
LLVM_RELEASE_16 = 'release_16'
LLVM_RELEASE_15 = 'release_15'
LLVM_BRANCHES = {LLVM_MAIN: VersionedBranch(ref='main', version=Version(18, 0, 0)),
LLVM_RELEASE_17: VersionedBranch(ref='release/17.x', version=Version(17, 0, 0)),
LLVM_RELEASE_16: VersionedBranch(ref='llvmorg-16.0.6', version=Version(16, 0, 6)),
LLVM_RELEASE_15: VersionedBranch(ref='llvmorg-15.0.7', version=Version(15, 0, 7))}
# At any given time, Halide has a main branch, which supports (at least)
# the LLVM main branch and the most recent release branch (and maybe one older).
#
# We also support previous release branches; a release branch tracks *only* the
# corresponding version of LLVM (i.e., Halide 13 is 'release/13.x' and is only
# built/tested against LLVM13, even though it might still work with other LLVM versions).
#
# Note that we deliberately chose branch names that match LLVM's conventions.
#
# (Note that there are older releases of Halide that we no longer bother to build/test regularly.)
HALIDE_MAIN = 'main'
HALIDE_RELEASE_16 = 'release_16'
HALIDE_RELEASE_15 = 'release_15'
_HALIDE_RELEASES = [
HALIDE_RELEASE_16,
HALIDE_RELEASE_15,
]
HALIDE_BRANCHES = {HALIDE_MAIN: VersionedBranch(ref='main', version=Version(17, 0, 0)),
HALIDE_RELEASE_16: VersionedBranch(ref='release/16.x', version=Version(16, 0, 6)),
HALIDE_RELEASE_15: VersionedBranch(ref='release/15.x', version=Version(15, 0, 1))}
# This lists the Halide branch(es) for which we want to build nightlies;
# it's usually desirable to constrain these to save buildbot time (esp on the slower bots)
# and avoid branches that aren't changing much (i.e. -- recent releases that aren't
# likely to need new updates soon).
HALIDE_NIGHTLIES = [HALIDE_MAIN]
# Given a halide branch, return the 'native' llvm version we expect to use with it.
# For halide release branches, this is the corresponding llvm release branch; for
# halide main, it's llvm main.
LLVM_FOR_HALIDE = {
HALIDE_MAIN: [LLVM_MAIN, LLVM_RELEASE_17, LLVM_RELEASE_16],
HALIDE_RELEASE_16: [LLVM_RELEASE_16],
HALIDE_RELEASE_15: [LLVM_RELEASE_15],
}
# WORKERS
# Can use Python 3.7 dataclasses instead, if we choose to upgrade to that.
WorkerConfig = namedtuple('WorkerConfig', ['max_builds', 'j', 'arch', 'bits', 'os'])
# Using nproc+2 on the arm32 builds causes internal errors in gcc-armeabihf. Let's just use nproc.
_NPROC = Interpolate("%(worker:numcpus)s")
# For machines with max_builds=1, using nproc+2 cores for building is the conventional choice
# (and what ninja defaults to). Oddly, "ninja -j 0" means "use as many threads as you like" which
# is definitely not what we want.
_NPROC_PLUS_2 = Transform(lambda x: f'{int(x) + 2}', _NPROC)
_WORKERS = [
('linux-worker-1', WorkerConfig(max_builds=4, j=8, arch='x86', bits=[32, 64], os='linux')),
('linux-worker-4', WorkerConfig(max_builds=4, j=8, arch='x86', bits=[32, 64], os='linux')),
# 2013 Mac Pro running a 6-core Xeon.
('mac-x86-worker-1', WorkerConfig(max_builds=2, j=8, arch='x86', bits=[64], os='osx')),
# Mac Mini 2018, 3.2 GHz 6-Core Intel Core i7, 16GB memory
('mac-x86-worker-2', WorkerConfig(max_builds=2, j=8, arch='x86', bits=[64], os='osx')),
# Mac Mini 2018, ??? details TBD
('mac-x86-worker-3', WorkerConfig(max_builds=2, j=8, arch='x86', bits=[64], os='osx')),
('mac-arm-worker-1', WorkerConfig(max_builds=2, j=8, arch='arm', bits=[64], os='osx')),
# The arm-linux bots here have 4 cores but apparently don't have enough RAM to do more
# than -j=2 without crashing during LLVM builds.
('arm32-linux-worker-1', WorkerConfig(max_builds=1, j=2, arch='arm', bits=[32], os='linux')),
('arm32-linux-worker-2', WorkerConfig(max_builds=1, j=2, arch='arm', bits=[32], os='linux')),
('arm64-linux-worker-1', WorkerConfig(max_builds=1, j=2, arch='arm', bits=[64], os='linux')),
('arm64-linux-worker-2', WorkerConfig(max_builds=1, j=2, arch='arm', bits=[64], os='linux')),
# The rpi4 has 8GB ram, so apparently it's OK with -j=nproc for now.
('rpi4-linux-worker-1', WorkerConfig(max_builds=1, j=_NPROC, arch='arm', bits=[32], os='linux')),
# TODO: should normally be offline because every D3D12 test fails
('win-worker-2', WorkerConfig(max_builds=1, j=_NPROC_PLUS_2, arch='x86', bits=[32, 64], os='windows')),
# TODO: broken, pending repair till Monday
# ('win-worker-3', WorkerConfig(max_builds=2, j=_NPROC_PLUS_2, arch='x86', bits=[32, 64], os='windows')),
]
# The 'workers' list defines the set of recognized buildworkers. Each element is
# a Worker object, specifying a unique worker name and password. The same
# worker name and password must be configured on the worker.
c['workers'] = [Worker(n,
WORKER_SECRET,
keepalive_interval=300, # default is 3600 (1 hour). We'll do 5 mins.
max_builds=cfg.max_builds,
properties={'WORKER_BUILD_PARALLELISM': cfg.j}) for n, cfg in _WORKERS]
_SANITIZERS = [
'asan',
'fuzzer', # this isn't *technically* a sanitizer, but is close enough that it's a good fit
]
# LOCKS
# Performance testing requires exclusive use of a worker
# Compute-intensive build steps will grab this lock in reader
# mode. The performance test will grab it in exclusive mode.
performance_lock = WorkerLock("performance_lock", maxCount=9999)
# When building the LLVM nightlies, we can sync & build LLVM independently
# from other work, but when we update the install directory, we need to ensure
# we have an exclusive lock across the entire worker. (Since we have a small
# number of LLVM versions, and since 'make install' doesn't take very long,
# we could probably just get by with a single lock for *any* llvm install,
# but this isn't much harder to do.)
llvm_build_locks = {}
for llvm_branch, info in LLVM_BRANCHES.items():
for bits in [32, 64]:
llvm_build_locks[llvm_branch + str(bits)] = WorkerLock(
f'llvm_install_lock_{info.version.major}_{bits}', maxCount=9999)
# CHANGESOURCES
# Here we point the buildbot at third-party codebases, ie. dependencies.
# Currently, we only have LLVM's `main` branch configured.
c['change_source'] = [
GitPoller(
repourl='https://github.com/llvm/llvm-project.git',
workdir='gitpoller-llvm-workdir',
branch=LLVM_BRANCHES[LLVM_MAIN].ref,
pollInterval=60 * 60 * 24, # Only check llvm once every 24 hours
pollAtLaunch=True)
]
# CODEBASES
all_repositories = {
'https://github.com/halide/Halide.git': 'halide',
'https://github.com/llvm/llvm-project.git': 'llvm',
}
def codebase_generator(chdict):
repo = chdict['repository']
assert repo in all_repositories, "Codebase not found for chdict: " + str(chdict)
return all_repositories[repo]
c['codebaseGenerator'] = codebase_generator
# BUILDERS
# The 'builders' list defines the Builders, which tell Buildbot how to perform a build:
# what steps, and which workers can execute them. Note that any particular build will
# only take place on one worker.
class Purpose(Enum):
halide_nightly = 1
halide_testbranch = 2
llvm_nightly = 3
class BuildSystem(Enum):
make = 0
cmake = 1
class BuilderType:
"""A class to encapsulate the settings for a specific Builder.
(Do not confuse with CMake's 'BUILD_TYPE', which is something else.)
It includes:
- Halide 'target' in the form of arch-bits-os
- LLVM branch to be used
- CMake vs Make
- halide-nightly vs halide-testbranch vs llvm-nightly
- sanitizers vs none
It doesn't currently include any 'features' because we don't currently
bake any in at build time.
It doesn't currently include the C++ compiler used (eg gcc7 vs gcc8 vs clang),
mainly because we currently never test with multiple compilers for a given
setup. (If we ever need to do so, compiler should be added to this.)
"""
def __init__(self, arch, bits, os, halide_branch, llvm_branch, purpose, sanitizer=None,
buildsystem=BuildSystem.cmake):
assert arch in ['arm', 'x86']
assert bits in [32, 64]
assert os in ['linux', 'windows', 'osx']
assert llvm_branch in LLVM_BRANCHES, f'{llvm_branch} not recognized'
self.arch = arch
self.bits = bits
self.os = os
self.halide_branch = halide_branch
self.llvm_branch = llvm_branch
self.buildsystem = buildsystem
self.purpose = purpose
self.sanitizer = sanitizer
if self.halide_branch:
assert self.purpose != Purpose.llvm_nightly
assert self.halide_branch in HALIDE_BRANCHES, f'unknown branch {self.halide_branch}'
assert (self.purpose == Purpose.halide_testbranch or # if not testbranch...
self.llvm_branch in LLVM_FOR_HALIDE[self.halide_branch])
else:
assert self.purpose == Purpose.llvm_nightly
if self.sanitizer:
assert self.sanitizer in _SANITIZERS
# The armbots aren't configured with Python at all.
# We don't support the Python bindings on 32-bit at all.
def handles_python(self):
if self.bits == 32:
return False
if self.arch == 'arm' and self.os == 'linux':
return False
if self.sanitizer_preset() is not None:
return False
return True
def handles_sanitizers(self):
if self.buildsystem != BuildSystem.cmake:
return False
return (self.arch == 'x86'
and self.bits == 64
and self.os == 'linux'
and self.llvm_branch == LLVM_MAIN)
def sanitizer_preset(self):
if self.handles_sanitizers():
if self.sanitizer == 'asan':
return 'linux-x64-asan'
if self.sanitizer == 'fuzzer':
return 'linux-x64-fuzzer'
return None
def handles_riscv(self):
# Only support RISCV on LLVM16 or later.
return self.llvm_branch not in [LLVM_RELEASE_15]
def handles_hexagon(self):
return (self.arch == 'x86'
and self.bits == 64
and self.os == 'linux'
and self.llvm_branch == LLVM_MAIN)
def handles_wasm(self):
is_linux_x64 = (self.arch == 'x86'
and self.bits == 64
and self.os == 'linux')
return (self.llvm_branch == LLVM_MAIN
and (is_linux_x64 or self.os == 'osx'))
def handles_wasm_wabt(self):
return self.handles_wasm()
def handles_wasm_v8(self):
# OSX machines don't have V8 installed
return self.handles_wasm() and self.os == 'linux'
def has_nvidia(self):
return (self.arch == 'x86'
and self.bits == 64
and self.os in ['windows', 'linux'])
def handles_vulkan(self):
# TODO: disabled temporarily pending fixes to the Vulkan runtime
return False
# Stick with Linux on x86-64 for now. Others TBD.
# return (self.arch == 'x86'
# and self.bits == 64
# and self.os == 'linux'
# and self.halide_branch in [HALIDE_MAIN, HALIDE_RELEASE_16])
def handles_webgpu(self):
# At the moment, the WebGPU team recommends the OSX versions of Dawn/Node
# as the most robust for testing, so that's all we're set up to test with.
# (Note that 'Dawn' must be built/installed on the test machines manually;
# there are no binaries/prebuilts available at this time.)
return self.os == 'osx' and self.halide_branch not in [HALIDE_RELEASE_15]
def has_tflite(self):
if self.arch == 'x86' and self.bits == 64 and self.os == 'linux':
return True
if self.arch == 'arm' and self.bits == 64 and self.os == 'osx':
return True
return False
def has_ccache(self):
return self.os in ['osx', 'linux']
def halide_target(self):
return '%s-%d-%s' % (self.arch, self.bits, self.os)
def llvm_builder_label(self):
return 'llvm-%s-%s' % (LLVM_BRANCHES[self.llvm_branch].version.major, self.halide_target())
def halide_builder_label(self):
# This currently tries to (somewhat) mimic the existing label pattern,
# but is arbitrary. (If changed, manual purging of buildbot temporaries
# is appropriate)
a = ['halide']
if self.sanitizer:
a.append(self.sanitizer)
if self.purpose == Purpose.halide_testbranch:
a.append('testbranch')
elif self.purpose == Purpose.halide_nightly:
a.append('nightly')
a.append(self.halide_branch)
if self.halide_branch == HALIDE_MAIN:
# Halide master is built against multiple LLVM versions,
# so append that here for clarity
a.append(f'llvm{LLVM_BRANCHES[self.llvm_branch].version.major}')
a.append(self.halide_target())
a.append(self.buildsystem.name)
return '-'.join(a)
def builder_label(self):
if self.purpose == Purpose.llvm_nightly:
return self.llvm_builder_label()
else:
return self.halide_builder_label()
def builder_tags(self):
return self.builder_label().split('-')
def get_worker_names(self):
return [n for n, cfg in _WORKERS
if self.arch == cfg.arch and self.bits in cfg.bits and self.os == cfg.os]
def __str__(self):
return self.halide_target()
def get_builddir_subpath(subpath):
# Normalize paths to use forward slashes.
return Transform(lambda x: x.replace('\\', '/'), Interpolate(f'%(prop:builddir)s/{subpath}'))
def get_llvm_toolchains_path(*subpaths):
return get_builddir_subpath(os.path.join('llvm-toolchains', *subpaths))
# TODO: make private to the LLVM code
def get_llvm_source_path(*subpaths):
return get_builddir_subpath(os.path.join('llvm-project', *subpaths))
# TODO: make private to the LLVM code
def get_llvm_build_path(*subpaths):
return get_builddir_subpath(os.path.join('llvm-build', *subpaths))
def get_llvm_install_path(builder_type, *subpaths):
# Note that `builder_type.purpose` can be a Halide builder or an LLVM builder;
# we want to ignore that aspect and produce the same effective path
# regardless (ie, based only on the other aspects of the builder_type).
llvm_workdir = builder_type.llvm_builder_label()
return get_builddir_subpath(os.path.join('..', llvm_workdir, 'llvm-install', *subpaths))
def get_halide_source_path(*subpaths):
return get_builddir_subpath(os.path.join('halide-source', *subpaths))
def get_halide_build_path(*subpaths):
return get_builddir_subpath(os.path.join('halide-build', *subpaths))
def get_halide_install_path(builder_type, *subpaths):
s = 'halide-install'
if builder_type.sanitizer:
s += '-' + builder_type.sanitizer
return get_builddir_subpath(os.path.join(s, *subpaths))
def add_get_halide_source_steps(factory, builder_type):
factory.addStep(GitHub(name='Get Halide source',
locks=[performance_lock.access('counting')],
codebase='halide',
workdir=get_halide_source_path(),
repourl='https://github.com/halide/Halide.git',
branch=HALIDE_BRANCHES[builder_type.halide_branch].ref,
mode='incremental'))
def add_get_llvm_source_steps(factory, builder_type):
factory.addStep(Git(name=f'Get LLVM {LLVM_BRANCHES[builder_type.llvm_branch].version.major}',
locks=[performance_lock.access('counting')],
codebase='llvm',
workdir=get_llvm_source_path(),
repourl='https://github.com/llvm/llvm-project.git',
branch=LLVM_BRANCHES[builder_type.llvm_branch].ref,
mode='incremental'))
# Always download the toolchains, even on platforms we don't need 'em
toolchains_dir = get_llvm_toolchains_path()
factory.addStep(MakeDirectory(name="Make CMake toolchain directory",
locks=[performance_lock.access('counting')],
dir=toolchains_dir,
haltOnFailure=False))
factory.addStep(FileDownload(name='Download CMake toolchains',
mastersrc='toolchain.linux-arm32.cmake', # relative to base dir
workerdest='toolchain.linux-arm32.cmake', # relative to workdir
workdir=toolchains_dir,
locks=[performance_lock.access('counting')],
haltOnFailure=True,
mode=0o644))
# Determined by running `set` in cmd.exe before and after vcvarsall.bat
# and diffing the output. It's likely that we don't need all of these
# to make things work, but I haven't bothered to figure out what is irrelevant,
# so I'm erring on the side of maybe too much.
# noinspection SpellCheckingInspection
VCVARSALL_ENV_VARS = [
"COMMANDPROMPTTYPE",
"DEVENVDIR",
"EXTENSIONSDKDIR",
"FRAMEWORK40VERSION",
"FRAMEWORKDIR",
"FRAMEWORKDIR64",
"FRAMEWORKVERSION",
"FRAMEWORKVERSION64",
"INCLUDE",
"LIB",
"LIBPATH",
"NETFXSDKDIR",
"PATH",
"PLATFORM",
"UCRTVERSION",
"UNIVERSALCRTSDKDIR",
"VCIDEINSTALLDIR",
"VCINSTALLDIR",
"VCTOOLSINSTALLDIR",
"VCTOOLSREDISTDIR",
"VCTOOLSVERSION",
"VISUALSTUDIOVERSION",
"VS110COMNTOOLS",
"VS120COMNTOOLS",
"VS140COMNTOOLS",
"VS160COMNTOOLS",
"VSCMD_ARG_APP_PLAT",
"VSCMD_ARG_HOST_ARCH",
"VSCMD_ARG_TGT_ARCH",
"VSCMD_VER",
"VSINSTALLDIR",
"WINDOWSLIBPATH",
"WINDOWSSDKBINPATH",
"WINDOWSSDKDIR",
"WINDOWSSDKLIBVERSION",
"WINDOWSSDKVERBINPATH",
"WINDOWSSDKVERSION",
"WINDOWSSDK_EXECUTABLEPATH_X64",
"WINDOWSSDK_EXECUTABLEPATH_X86",
"__DOTNET_ADD_64BIT",
"__DOTNET_PREFERRED_BITNESS",
"__VSCMD_PREINIT_PATH",
"__VSCMD_SCRIPT_ERR_COUNT",
]
def get_msvc_config_steps(factory, builder_type):
# ensure that we use the x64 host compiler, not the x86 host compiler
arch_for_bits = {32: 'x64_x86', 64: 'x64'}
vcvarsall = 'vcvarsall.bat %s && set' % arch_for_bits[builder_type.bits]
# TODO: surely there is a better way of locating vcvarsall
# vcvarsdir = "c:/Program Files (x86)/Microsoft Visual Studio/2019/Community/VC/Auxiliary/Build"
vcvarsdir = "C:/Program Files/Microsoft Visual Studio/2022/Community/VC/Auxiliary/Build"
# `vsvarsall && set` dumps all the settings to stdout;
# we'll extract & save just the subset we think are likely to be relevant.
def save_interesting_env_vars(rc, stdout, stderr):
d = {}
for line in stdout.split('\n'):
match = re.match("^([a-zA-Z0-9_-]+)=(.*)$", line.strip())
if match:
key = match.group(1).upper()
value = match.group(2)
if key in VCVARSALL_ENV_VARS:
d[key] = value
return {'env': d}
factory.addStep(
SetPropertyFromCommand(name='Run VcVarsAll',
description='Run VcVarsAll',
workdir=vcvarsdir,
locks=[performance_lock.access('counting')],
haltOnFailure=True,
command=vcvarsall,
extract_fn=save_interesting_env_vars))
def merge_renderable(_base, _extn):
@renderer
@defer.inlineCallbacks
def render(props):
base = yield props.render(_base)
extn = yield props.render(_extn)
base.update(extn)
return base
return render
def get_distrib_name(_version, target, ext):
@renderer
@defer.inlineCallbacks
def render(props):
rev = props.getProperty('got_revision')['halide']
version = yield props.render(_version)
return os.path.join(ARTIFACTS_DIR, f'Halide-{version}-{target}-{rev}.{ext}')
return render
def get_cmake_generator(builder_type):
return 'Ninja'
def get_llvm_cmake_options(builder_type):
options = []
return options
def get_halide_cmake_options(builder_type, build_dir):
options = []
if builder_type.sanitizer and builder_type.purpose != Purpose.llvm_nightly:
assert builder_type.handles_sanitizers()
options.append("--preset=%s" % builder_type.sanitizer_preset())
# append *after* preset so we override the build dir
options += ['-B', build_dir]
return options
def get_ctest_options(builder_type, build_dir):
assert builder_type.purpose != Purpose.llvm_nightly
if builder_type.sanitizer:
assert builder_type.handles_sanitizers()
# No, this won't work, see https://gitlab.kitware.com/cmake/cmake/-/issues/23982 --
# fortunately, we don't need to specify the current sanitizer toolchains
# at test time (just at configure time).
# return {'preset': builder_type.sanitizer_preset(), 'test_dir': build_dir}
return {'build_config': builder_type.sanitizer_preset()}
else:
return {'build_config': 'Release'}
def get_halide_cmake_definitions(builder_type, halide_target='host', wasm_jit='wabt'):
cmake_definitions = {
'Clang_DIR': get_llvm_install_path(builder_type, 'lib/cmake/clang'),
'CMAKE_INSTALL_PREFIX': get_halide_install_path(builder_type),
'Halide_TARGET': halide_target,
'LLD_DIR': get_llvm_install_path(builder_type, 'lib/cmake/lld'),
'LLVM_DIR': get_llvm_install_path(builder_type, 'lib/cmake/llvm'),
'LLVM_ROOT': get_llvm_install_path(builder_type),
'WITH_PYTHON_BINDINGS': 'ON' if builder_type.handles_python() else 'OFF',
'WITH_TEST_FUZZ': 'ON' if builder_type.sanitizer == 'fuzzer' else 'OFF'
}
if builder_type.sanitizer and builder_type.handles_sanitizers():
pass
else:
cmake_definitions['CMAKE_BUILD_TYPE'] = 'Release'
# Sanitizer builds intermittently fail when using CCache for reasons that aren't
# clear ("precompiled header modified") -- for now, just ignore CCache for them
if builder_type.has_ccache() and not builder_type.sanitizer_preset():
cmake_definitions['Halide_CCACHE_BUILD'] = 'ON'
if builder_type.arch == 'arm' and builder_type.bits == 32 and builder_type.os == 'linux':
# Halide always uses its own toolchain files, from the cmake/ subdir.
cmake_definitions['CMAKE_TOOLCHAIN_FILE'] = get_halide_source_path('cmake', 'toolchain.linux-arm32.cmake')
if builder_type.os == 'windows':
cmake_definitions['CMAKE_TOOLCHAIN_FILE'] = Interpolate('%(prop:VCPKG_ROOT)s/scripts/buildsystems/vcpkg.cmake')
# CMake on Windows can't reliably find our pip-installed PyBind11 unless we set CMAKE_PREFIX_PATH to point to is
cmake_definitions['pybind11_DIR'] = Interpolate('%(prop:VIRTUAL_ENV)s/share/cmake/pybind11')
# Don't bother with anything Python-related if we are targeting WebAssembly.
if "wasm" in halide_target:
cmake_definitions['WITH_PYTHON_BINDINGS'] = 'OFF'
# TODO: HALIDE_NODE_JS_PATH is only necessary until EMSDK updates their built-in version of Node
# to v16.13+; when that is done, remove this definition.
if builder_type.handles_wasm() and halide_target.startswith("wasm-"):
cmake_definitions['CMAKE_TOOLCHAIN_FILE'] = Interpolate(
'%(prop:EMSDK)s/upstream/emscripten/cmake/Modules/Platform/Emscripten.cmake')
cmake_definitions['NODE_JS_EXECUTABLE'] = Property('HALIDE_NODE_JS_PATH')
if wasm_jit == 'v8':
cmake_definitions['WITH_WABT'] = 'OFF'
cmake_definitions['WITH_V8'] = 'ON'
cmake_definitions['V8_INCLUDE_PATH'] = '/home/halidenightly/v8/v8/include'
cmake_definitions['V8_LIB_PATH'] = \
'/home/halidenightly/v8/v8/out/x64.release.static/obj/libv8_monolith.a'
elif wasm_jit == 'wabt':
cmake_definitions['WITH_WABT'] = 'ON'
cmake_definitions['WITH_V8'] = 'OFF'
cmake_definitions['V8_INCLUDE_PATH'] = ''
cmake_definitions['V8_LIB_PATH'] = ''
else:
assert False, "Unknown wasm jit " + str(wasm_jit)
if builder_type.handles_webgpu() and "webgpu" in halide_target:
# TODO(srj): remove these after https://github.com/halide/Halide/pull/7422 lands
cmake_definitions['WEBGPU_NODE_BINDINGS'] = Property('HL_WEBGPU_NODE_BINDINGS')
cmake_definitions['WEBGPU_NATIVE_LIB'] = Property('HL_WEBGPU_NATIVE_LIB')
if builder_type.handles_hexagon() and 'hvx' in halide_target:
cmake_definitions['Halide_BUILD_HEXAGON_REMOTE_RUNTIME'] = 'ON'
return cmake_definitions
def get_cmake_build_command(builder_type, build_dir, targets=None):
cmd = ['ninja',
'-C', build_dir,
'-j', Property('WORKER_BUILD_PARALLELISM')]
# TODO(srj): for debugging apps/c_backend
if builder_type.os == "windows":
cmd.append('-v')
if targets:
cmd.extend(targets)
return cmd
def get_llvm_cmake_definitions(builder_type):
# Keep sorted!
definitions = {
'CMAKE_BUILD_TYPE': 'Release',
'CMAKE_INSTALL_PREFIX': get_llvm_install_path(builder_type),
'LLVM_BUILD_32_BITS': ('ON' if builder_type.bits == 32 else 'OFF'),
'LLVM_ENABLE_ASSERTIONS': 'ON',
'LLVM_ENABLE_BINDINGS': 'OFF',
'LLVM_ENABLE_CURL': 'OFF',
'LLVM_ENABLE_DIA_SDK': 'OFF',
'LLVM_ENABLE_HTTPLIB': 'OFF',
'LLVM_ENABLE_IDE': 'OFF',
'LLVM_ENABLE_LIBXML2': 'OFF',
'LLVM_ENABLE_OCAMLDOC': 'OFF',
'LLVM_ENABLE_RTTI': 'ON',
'LLVM_ENABLE_TERMINFO': 'OFF',
'LLVM_ENABLE_WARNINGS': 'OFF', # silence them, it's not like we're gonna fix them
'LLVM_ENABLE_ZLIB': 'ON',
'LLVM_ENABLE_ZSTD': 'OFF',
'LLVM_INCLUDE_BENCHMARKS': 'OFF',
'LLVM_INCLUDE_EXAMPLES': 'OFF',
'LLVM_INCLUDE_TESTS': 'OFF',
'LLVM_TARGETS_TO_BUILD': 'X86;ARM;NVPTX;AArch64;Hexagon;PowerPC;WebAssembly',
}
if builder_type.bits == 32:
definitions['CMAKE_FIND_ROOT_PATH_MODE_INCLUDE'] = "ONLY"
definitions['CMAKE_FIND_ROOT_PATH_MODE_LIBRARY'] = "ONLY"
definitions['CMAKE_FIND_ROOT_PATH_MODE_PACKAGE'] = "ONLY"
definitions['CMAKE_FIND_ROOT_PATH_MODE_PROGRAM'] = "NEVER"
if builder_type.handles_riscv():
definitions['LLVM_TARGETS_TO_BUILD'] += ";RISCV"
if builder_type.handles_sanitizers():
definitions['LLVM_ENABLE_RUNTIMES'] = "compiler-rt;libcxx;libcxxabi;libunwind"
# We only need clang-tools-extra if building for sanitizers -- skip them
# if the builder will never do this, to save time & space.
definitions['LLVM_ENABLE_PROJECTS'] = "clang;lld;clang-tools-extra"
else:
definitions['LLVM_ENABLE_PROJECTS'] = "clang;lld"
# Some versions of GCC will flood the output with useless warnings about
# "parameter passing for argument of type foo changed in GCC 7.1" unless
# we disable this warning. This isn't *essential*, but it makes looking at the
# LLVM build logs much less noisy.
if builder_type.os != 'windows':
definitions['CMAKE_CXX_FLAGS'] = '-Wno-psabi'
if builder_type.arch == 'arm' and builder_type.bits == 32 and builder_type.os == 'linux':
# LLVM doesn't provide a toolchain file, and we can't/don't-want-to rely on the
# one from Halide, so we'll rely on one that the buildbot downloads to each worker.
# (Note that this assumes the file has been properly downloaded.)
definitions['CMAKE_TOOLCHAIN_FILE'] = get_llvm_toolchains_path('toolchain.linux-arm32.cmake')
definitions['LLVM_TARGET_ARCH'] = 'ARM'
definitions['LLVM_DEFAULT_TARGET_TRIPLE'] = 'arm-linux-gnueabihf'
if builder_type.arch == 'x86' and builder_type.bits == 32 and builder_type.os == 'linux':
definitions['CMAKE_FIND_ROOT_PATH'] = '/usr/lib/i386-linux-gnu'
definitions['CMAKE_FIND_ROOT_PATH_MODE_LIBRARY'] = 'ONLY'
# This disables an XCode setting that can get enabled by default
# when assertions are enabled, but only if your XCode install has
# certain frameworks installed; we want it disabled, as it prevents
# prebuilt libraries from working properly with XCode 9.x.
if builder_type.os == 'osx':
definitions['LLVM_ENABLE_SUPPORT_XCODE_SIGNPOSTS'] = 'FORCE_OFF'
# We never build LLVM with sanitizers enabled
if builder_type.has_ccache():
definitions['LLVM_CCACHE_BUILD'] = 'ON'
return definitions
def extend_property(dict_name, **kwargs):
@renderer
def render(props):
table = props.getProperty(dict_name, default={})
table.update(kwargs)
return table
return render
def add_env_setup_step(factory, builder_type, enable_ccache=False):
if builder_type.os == 'windows':
# do this first because the SetPropertyFromCommand step isn't smart enough to merge
get_msvc_config_steps(factory, builder_type)
cxx = 'c++'
cc = 'cc'
ld = 'ld'
if builder_type.os == 'linux':
cc = 'gcc-9'
cxx = 'g++-9'
ld = 'ld'
if builder_type.arch == 'x86' and builder_type.bits == 32:
cxx += ' -m32'
cc += ' -m32'
ld += ' -melf_i386'
elif builder_type.os == 'windows':
cxx = 'cl.exe'
cc = 'cl.exe'
# This is only necessary (or desirable) for make-based builds of Halide;
# CMake-based builds handle it via Halide_CCACHE_BUILD and/or LLVM_CCACHE_BUILD
if enable_ccache and builder_type.has_ccache():
cxx = 'ccache ' + cxx
cc = 'ccache ' + cc
env = {
'CC': cc,
'CXX': cxx,
'LD': ld,
}
# TODO: HALIDE_NODE_JS_PATH is only necessary until EMSDK updates their built-in version of Node
# to v16.13+; when that is done, remove HALIDE_NODE_JS_PATH here and on the workers.
factory.addStep(SetPropertiesFromEnv(name='Read worker environment',
variables=['EMSDK',
'HALIDE_NODE_JS_PATH',
'HL_HEXAGON_TOOLS',
'HL_WEBGPU_NATIVE_LIB',
'HL_WEBGPU_NODE_BINDINGS',
'LD_LIBRARY_PATH',
'VIRTUAL_ENV',
'VCPKG_ROOT']))
vcpkg_root = Property('VCPKG_ROOT', default=None)
if builder_type.handles_hexagon():
# Environment variables for testing Hexagon DSP
hexagon_remote_bin = get_halide_build_path('src', 'runtime', 'hexagon_remote')
# Assume that HL_HEXAGON_TOOLS points to the correct directory (it might not be /usr/local/hexagon)
env['HL_HEXAGON_SIM_REMOTE'] = Transform(os.path.join,
hexagon_remote_bin,
'hexagon',
'bin',
'hexagon_sim_remote')
env['HL_HEXAGON_SIM_CYCLES'] = '1'
env['LD_LIBRARY_PATH'] = [
# no, this will cause a failure at runtime if LD_LIBRARY_PATH is unset (or empty!)
# Property('LD_LIBRARY_PATH'),
hexagon_remote_bin,
Interpolate('%(prop:HL_HEXAGON_TOOLS)s/lib/iss'),
]
env['HEXAGON_SDK_ROOT'] = Interpolate('%(prop:HL_HEXAGON_TOOLS)s/../../../..')
# Force Vulkan validation layer on to catch any driver related errors
# ... this enables a suite of diagnostic checks implemented in the Vulkan SDK
# that verifies the driver and application conform to the Vulkan runtime
# specification. This should not be enabled in production due to the overhead,
# but we want to catch any changes in driver behaviour and/or spurious errors that
# may be hard to find (but easy to fix if the right error messages are present)
if builder_type.has_nvidia() and builder_type.handles_vulkan():
env['VK_INSTANCE_LAYERS'] = "VK_LAYER_KHRONOS_validation"
if builder_type.os == 'osx':
# Environment variable for turning on Metal API validation
# This will have no effect on CPU testing, just Metal testing
env['METAL_DEVICE_WRAPPER_TYPE'] = '1'
if builder_type.os == 'windows':
vcpkg_root = Property('VCPKG_ROOT', default='C:/vcpkg')
env['VCPKG_ROOT'] = vcpkg_root
# Current NVidia drivers on our Windows buildbots can corrupt their own
# cache, leading to many spurious failures. Disable the cache
# for now, pending NVidia investigation.
env['CUDA_CACHE_DISABLE'] = '1'
# We don't ever want an Abort, Retry, Ignore dialog in our tests
env['HL_DISABLE_WINDOWS_ABORT_DIALOG'] = '1'
# Leaving this here (but commented out) in case we need to temporarily
# disable leak-checking in the future.
#
# if builder_type.handles_sanitizers():
# # Disable leak-checking (for now) for ASAN builds
# env['ASAN_OPTIONS'] = 'detect_leaks=0'
factory.addStep(SetProperties(
name='Initialize environment',
properties=dict(
env=extend_property('env', **env),
VCPKG_ROOT=vcpkg_root)))
@renderer
def get_llvm_latest_commit(props):
# Note that this property is a dict for multi-codebase builds,
# but just a string for single-codebase builds.
build_dir = props.getProperty('builddir')
assert not isinstance(build_dir, dict)
build_dir = build_dir.replace('\\', '/')
# Can't use got_revision here since we may be using git directly.
return "cd %s/llvm-project && git log -1 > %s/llvm-install/llvm_latest_commit.txt" % (build_dir, build_dir)
def add_llvm_steps(factory, builder_type, clean_rebuild):
build_dir = get_llvm_build_path()
install_dir = get_llvm_install_path(builder_type)
llvm_name = str(LLVM_BRANCHES[builder_type.llvm_branch].version.major)
if clean_rebuild:
factory.addStep(RemoveDirectory(name="Remove LLVM %s Build Dir" % llvm_name,
locks=[performance_lock.access('counting')],
dir=build_dir,
haltOnFailure=False))
factory.addStep(RemoveDirectory(name="Remove LLVM %s Install Dir" % llvm_name,
locks=[performance_lock.access('counting')],
dir=install_dir,
haltOnFailure=False))
factory.addStep(MakeDirectory(name="Make LLVM %s Build Dir" % llvm_name,
locks=[performance_lock.access('counting')],
dir=build_dir,
haltOnFailure=False))
factory.addStep(MakeDirectory(name="Make LLVM %s Install Dir" % llvm_name,
locks=[performance_lock.access('counting')],
dir=install_dir,
haltOnFailure=False))
factory.addStep(
CMake(name='Configure LLVM %s' % llvm_name,
locks=[performance_lock.access('counting')],
haltOnFailure=True,
env=Property('env'),
workdir=build_dir,
path=get_llvm_source_path('llvm'),
generator=get_cmake_generator(builder_type),
definitions=get_llvm_cmake_definitions(builder_type),
options=get_llvm_cmake_options(builder_type)))
factory.addStep(
ShellCommand(name='Build LLVM %s' % llvm_name,
locks=[performance_lock.access('counting')],
haltOnFailure=True,
workdir=build_dir,
env=Property('env'),
command=get_cmake_build_command(builder_type, build_dir, targets=['install'])))
# Save the SHA of LLVM's head rev into ${INSTALL}/llvm_version.txt,
# just to make debugging simpler
#
factory.addStep(
ShellCommand(name='Stamp Install Directory for LLVM %s' % llvm_name,
locks=[performance_lock.access('counting')],
haltOnFailure=True,
workdir=get_llvm_source_path(),
env=Property('env'),
command=get_llvm_latest_commit))
def add_halide_cmake_build_steps(factory, builder_type):
# Always do a clean build for Halide
source_dir = get_halide_source_path()
build_dir = get_halide_build_path()
install_dir = get_halide_install_path(builder_type)
factory.addStep(RemoveDirectory(name="Remove Halide Build Dir",
locks=[performance_lock.access('counting')],
dir=build_dir,
haltOnFailure=False))
factory.addStep(MakeDirectory(name="Make Halide Build Dir",
locks=[performance_lock.access('counting')],
dir=build_dir,
haltOnFailure=False))
factory.addStep(RemoveDirectory(name="Remove Halide Install Dir",
locks=[performance_lock.access('counting')],
dir=install_dir,
haltOnFailure=False))
factory.addStep(MakeDirectory(name="Make Halide Install Dir",
locks=[performance_lock.access('counting')],
dir=install_dir,
haltOnFailure=False))
factory.addStep(CMake(name='Configure Halide',
description='Configure Halide',
locks=[performance_lock.access('counting')],
haltOnFailure=True,
workdir=build_dir,
env=Property('env'),
path=source_dir,
generator=get_cmake_generator(builder_type),
definitions=get_halide_cmake_definitions(builder_type),
options=get_halide_cmake_options(builder_type, build_dir)))
factory.addStep(
ShellCommand(name='Build Halide',
description='Build Halide',
locks=[performance_lock.access('counting')],
haltOnFailure=True,
workdir=build_dir,
env=Property('env'),
command=get_cmake_build_command(builder_type, build_dir, targets=['all', 'install'])))
def add_halide_cmake_package_steps(factory, builder_type):
source_dir = get_halide_source_path()
target = builder_type.halide_target()
ext = 'zip' if builder_type.os == 'windows' else 'tar.gz'
factory.addStep(
SetPropertiesFromCMakeCache(
name='Get Halide package version',
workdir=get_halide_build_path(),
props=['CMAKE_PROJECT_VERSION']))
extra_env = dict(
Clang_DIR=get_llvm_install_path(builder_type, 'lib/cmake/clang'),
LLD_DIR=get_llvm_install_path(builder_type, 'lib/cmake/lld'),
LLVM_DIR=get_llvm_install_path(builder_type, 'lib/cmake/llvm'),
Halide_VERSION=Property('CMAKE_PROJECT_VERSION')
)
if builder_type.os == 'windows':
# TODO: on Windows, we can't use Ninja for packaging (as we do everywhere
# else in this cfg) due to a bug in CMake 3.18, so we must use MSBuild;
# that means we must use a different build directory entirely. To simplify the
# world, we make this a subdir of the real build dir (so it gets cleaned properly).
# https://github.com/halide/Halide/issues/5264
build_dir = get_halide_build_path("packaging_dir")
if builder_type.arch == 'arm':
arch = 'ARM' if builder_type.bits == 32 else 'ARM64'
else:
arch = 'Win32' if builder_type.bits == 32 else 'x64'
cmd = [get_halide_source_path('packaging/zip/package.bat'), source_dir, build_dir, arch]
else:
build_dir = get_halide_build_path()
cmd = [get_halide_source_path('packaging/tgz/package.sh'), source_dir, build_dir]
if builder_type.arch == 'arm' and builder_type.bits == 32 and builder_type.os == 'linux':
extra_env['CMAKE_TOOLCHAIN_FILE'] = get_halide_source_path('cmake', 'toolchain.linux-arm32.cmake')
factory.addStep(
ShellCommand(name='Package Halide',
description='Package Halide',
workdir=build_dir,
env=extend_property('env', **extra_env),
locks=[performance_lock.access('counting')],
haltOnFailure=True,
command=cmd))
factory.addStep(
FileUpload(name='Upload Halide package',
workersrc=Interpolate(f'Halide-%(prop:CMAKE_PROJECT_VERSION)s-{target}.{ext}'),
locks=[performance_lock.access('counting')],
haltOnFailure=True,
workdir=build_dir,
mode=0o644,
masterdest=get_distrib_name(Property('CMAKE_PROJECT_VERSION'), target, ext)))
def pkg_version_and_target(path: Path):
# Archives names are formatted like: Halide-[version]-[arch]-[commit].[ext]
# This grabs "Halide-[version]-[arch]".
match = re.match(r'^(.*)-[a-f0-9]+\.(tar\.gz|tgz|zip)', path.name)
return match.group(1) if match else None
factory.addStep(CleanOldFiles(
name='Clean old releases',
workdir=ARTIFACTS_DIR,
locks=[performance_lock.access('counting')],
groupfn=pkg_version_and_target))
# Figure out which "non-cpu" (GPU, DSP, etc) targets this builder can handle.
# Return (target, is_simulator)
def get_gpu_dsp_targets(builder_type):
if builder_type.sanitizer_preset() is not None:
return
if builder_type.has_nvidia():
yield 'host-cuda', False
yield 'host-opencl', False
# TODO: temporarily disabled because our only windows bot doesn't support it...
# if builder_type.os == 'windows':
# yield 'host-d3d12compute', False
# If we're running on a capable GPU, add all optional feature flags to the vulkan target
# which are required to get all the correctness tests to pass
if builder_type.handles_vulkan():
yield 'host-vulkan-vk_int8-vk_int16-vk_int64-vk_float16-vk_float64-vk_v13', False
if builder_type.handles_webgpu():
yield 'host-webgpu', False
if builder_type.os == 'osx':
yield 'host-metal', False
if builder_type.handles_hexagon():
# All the buildbots use a simulator for HVX, so performance tests
# won't be useful
yield 'host-hvx', True
# Return a dict with halide-targets as the keys, and a list of test-labels for each value.
def get_test_labels(builder_type):
targets = defaultdict(list)
preset = builder_type.sanitizer_preset()
# For the fuzz sanitizer, run only the fuzz tests
if preset and 'fuzz' in preset:
targets['host'].extend(['fuzz'])
return targets
targets['host'].extend(['internal', 'correctness', 'generator',
'autoschedulers_cpu', 'error', 'warning', 'apps', 'performance', 'tutorial'])
# For all other sanitizers (eg asan), don't bother with the gpu/etc tests.
if preset:
return targets
# TODO: some JIT+generator tests are failing on arm32; disable for now
# pending fixes (see https://github.com/halide/Halide/issues/4940)
if builder_type.arch == 'arm' and builder_type.bits == 32 and builder_type.os == 'linux':
targets['host'].remove('internal')
targets['host'].remove('generator')
if builder_type.handles_python():
targets['host'].extend(['python'])
# Test without SSE4.1 on all x86 systems
if builder_type.arch == 'x86':
t = 'x86-%d-%s' % (builder_type.bits, builder_type.os)
targets[t].extend(['correctness'])
# on x86-64, also test with SSE4.1 (but nothing else that 'host' might sniff)
if builder_type.bits == 64:
targets['%s-sse41' % t].extend(['correctness'])
# Test a subset of things on GPU/DSP targets, as appropriate
for t, is_simulator in get_gpu_dsp_targets(builder_type):
# TODO(https://github.com/halide/Halide/issues/7420): disable apps for host-gpu until the errors are resolved
if t == 'host-webgpu':
targets[t].extend(['correctness', 'generator'])
else:
targets[t].extend(['correctness', 'generator', 'apps'])
if 'cuda' in t:
targets[t].extend(['autoschedulers_cuda'])
if 'hvx' not in t:
targets[t].extend(['autoschedulers_gpu'])
# Don't do performance testing on simulators.
if not is_simulator:
targets[t].extend(['performance'])
# Handle this special case separately
if builder_type.has_nvidia():
targets['host-cuda-opencl'].extend(['correctness_multi_gpu'])
# If we're running on a capable GPU, add all optional feature flags to the vulkan target
# which are required to get all the correctness tests to pass
if builder_type.handles_vulkan():
targets['host-vulkan-vk_int8-vk_int16-vk_int64-vk_float16-vk_float64-vk_v13'].extend(
['internal', 'correctness', 'generator', 'error', 'warning'])
if builder_type.handles_wasm():
if builder_type.handles_wasm_wabt():
# TODO: this is a horrid hack. For now, we want to test JIT with both WABT and V8.
# Add as a horrible wart on the target string.
targets['wasm-32-wasmrt-wasm_simd128-wasm_signext-wasm_sat_float_to_int/wabt'].extend(
['internal', 'correctness', 'generator', 'error', 'warning'])
if builder_type.handles_wasm_v8():
# TODO: this is a horrid hack. For now, we want to test JIT with both WABT and V8.
# Add as a horrible wart on the target string.
targets['wasm-32-wasmrt-wasm_simd128-wasm_signext-wasm_sat_float_to_int/v8'].extend(
['internal', 'correctness', 'generator', 'error', 'warning'])
# WABT (and thus WASM JIT) can't handle code build with wasm_threads yet,
# so only test Generator here
targets['wasm-32-wasmrt-wasm_simd128-wasm_signext-wasm_sat_float_to_int-wasm_threads'].extend(
['generator', 'apps'])
if builder_type.handles_webgpu():
# Most apps can't handle wasm builds yet.
targets['wasm-32-wasmrt-webgpu'].extend(['generator'])
return targets
def is_time_critical_test(test):
# Return true if the test label (or single-test name) is 'time critical' and must
# be run with an exclusive lock on the buildbot (typically, performance tests)
return test in ['performance', 'autoschedulers_cpu', 'autoschedulers_gpu', 'autoschedulers_cuda']
def short_target(halide_target):
s = halide_target.split('-')
if len(s) == 1:
return s[0]
elif len(s) == 2:
return '%s-%s' % (s[0], s[1])
elif len(s) == 3:
return '%s-%s-%s' % (s[0], s[1], s[2])
elif len(s) > 3:
return '%s-%s-%sโฆ' % (s[0], s[1], s[2])
else:
return '<unknown>'
def add_halide_cmake_test_steps(factory, builder_type):
parallelism = Property('WORKER_BUILD_PARALLELISM')
labels = get_test_labels(builder_type)
source_dir = get_halide_source_path()
build_dir = get_halide_build_path()
install_dir = get_halide_install_path(builder_type) # NOQA
# Since we need to do at least a partial rebuild for each different target,
# we want to group things by target. Do host first, followed by a key-sorted
# order, to ensure predictability.
keys = list(labels.keys())
keys.remove('host')
keys.sort()
keys.insert(0, 'host')
for halide_target in keys:
# HL_TARGET is now ignored by CMake builds, no need to set
# (must specify -DHalide_TARGET to CMake instead)
# env['HL_TARGET'] = halide_target
env = extend_property('env', HL_JIT_TARGET=halide_target)
desc = 'T=%s' % short_target(halide_target)
# Do this *before* splitting the horrid wasm-specific target string
test_labels = labels[halide_target]
# wasm targets must ensure that the EMSDK (emcc, etc) are added to the
# active env.
wasm_jit = None
if halide_target.startswith("wasm-"):
halide_target, sep, wasm_jit = halide_target.partition('/')
# Re-set HL_JIT_TARGET with the de-warted target string
env = extend_property('env', HL_JIT_TARGET=halide_target)
if wasm_jit:
desc = '%s + T=%s' % (wasm_jit, short_target(halide_target))
if not wasm_jit:
wasm_jit = 'wabt'
factory.addStep(
CMake(name='Reconfigure for %s' % short_target(halide_target),
description='Reconfigure for %s' % desc,
locks=[performance_lock.access('counting')],
haltOnFailure=True,
env=env,
workdir=build_dir,
path=source_dir,
generator=get_cmake_generator(builder_type),
definitions=get_halide_cmake_definitions(
builder_type, halide_target=halide_target, wasm_jit=wasm_jit),
options=get_halide_cmake_options(builder_type, build_dir)))
factory.addStep(
ShellCommand(name='Rebuild for %s' % (short_target(halide_target)),
description='Rebuild Halide for %s' % desc,
locks=[performance_lock.access('counting')],
haltOnFailure=True,
workdir=build_dir,
env=env,
command=get_cmake_build_command(builder_type, build_dir, targets=['all', 'install'])))
do_apps = 'apps' in test_labels
if do_apps:
test_labels.remove('apps')
if not builder_type.handles_python():
if 'python' in test_labels:
test_labels.remove('python')
# TODO : some of the apps require python, so we must skip them for now also
do_apps = False
parallel_test_labels = [
test for test in test_labels if not is_time_critical_test(test)]
exclusive_test_labels = [test for test in test_labels if is_time_critical_test(test)]
if parallel_test_labels:
if len(parallel_test_labels) > 2:
test_set = ','.join([s[0] for s in parallel_test_labels])
else:
test_set = ', '.join(parallel_test_labels)
# Build up some special cases to exclude
exclude_tests = []
if builder_type.os == 'windows' or builder_type.os == 'linux':
# TODO: disable lens_blur on windows for now due to
# https://bugs.llvm.org/show_bug.cgi?id=46176
# and also due to Windows testbots having inadequate GPU RAM
# and also due to Linux testbots having inadequate GPU RAM
exclude_tests.append('interpolate')
exclude_tests.append('lens_blur')
exclude_tests.append('unsharp')
if builder_type.os == 'linux' or builder_type.bits == 32:
# TODO: disable tutorial_lesson_12_using_the_gpu (both C++ and python) on linux and 32-bit
exclude_tests.append('tutorial_lesson_12')
if builder_type.sanitizer == 'asan':
# lesson 19 can trigger memory leaks in some of the GPU device drivers,
# so just exclude it when doing ASAN
exclude_tests.append('tutorial_lesson_19')
if builder_type.arch == 'arm' or builder_type.bits == 32:
# TODO: disable lesson_19 on arm32
# https://github.com/halide/Halide/issues/5224
exclude_tests.append('tutorial_lesson_19')
factory.addStep(
CTest(name='Test %s %s' % (test_set, desc),
description='Test %s %s' % (test_set, desc),
locks=[performance_lock.access('counting')],
workdir=build_dir,
env=env,
timeout=3600,
labels=parallel_test_labels,
exclude_tests=exclude_tests,
jobs=parallelism,
**get_ctest_options(builder_type, build_dir)))
if exclusive_test_labels:
test_set = ','.join([s.replace('autoschedulers_', 'a_') for s in exclusive_test_labels])
factory.addStep(
CTest(name='Test %s %s' % (test_set, desc),
description='Test %s %s' % (test_set, desc),
locks=[performance_lock.access('exclusive')],
workdir=build_dir,
env=env,
timeout=3600,
labels=exclusive_test_labels,
**get_ctest_options(builder_type, build_dir)))
if do_apps:
apps_build_dir = get_halide_build_path("apps")
apps_source_dir = get_halide_source_path("apps")
# We currently don't attempt to build any of the apps with wasm
apps_cmake_defs = get_halide_cmake_definitions(builder_type, halide_target=halide_target)
apps_cmake_defs['CMAKE_PREFIX_PATH'] = get_halide_install_path(builder_type)
# apps/hannk is expensive to build, and doesn't (yet) build on all systems, so special-case it here
want_hannk = (builder_type.has_tflite() and not halide_target.startswith("wasm-"))
apps_cmake_defs['ENABLE_APPS_HANNK'] = 'ON' if want_hannk else 'OFF'
factory.addStep(
CMake(name='Configure apps for %s' % desc,
description='Configure apps for %s' % desc,
locks=[performance_lock.access('counting')],
haltOnFailure=True,
env=env,
workdir=apps_build_dir,
path=apps_source_dir,
generator=get_cmake_generator(builder_type),
definitions=apps_cmake_defs,
options=get_halide_cmake_options(builder_type, build_dir)))
factory.addStep(
ShellCommand(name='Build apps for %s' % desc,
description='Build apps for %s' % desc,
locks=[performance_lock.access('counting')],
haltOnFailure=True,
workdir=apps_build_dir,
env=env,
command=get_cmake_build_command(builder_type, apps_build_dir)))
# Note: do *not* run the apps/ tests in parallel; many of them expect
# to make full use of all cores, and running in parallel will just slow
# things down.
exclude_tests = []
if builder_type.os == 'windows':
# TODO: disable lens_blur_filter on windows for now due to
# https://github.com/halide/Halide/issues/5552
exclude_tests.append('lens_blur_filter')
factory.addStep(
CTest(name='Test apps for %s' % desc,
description='Test apps for %s' % desc,
locks=[performance_lock.access('exclusive')],
workdir=apps_build_dir,
env=env,
timeout=3600,
exclude_tests=exclude_tests,
exclude_labels=['slow_tests'],
**get_ctest_options(builder_type, apps_build_dir)))
def create_halide_make_factory(builder_type):
assert builder_type.os != 'windows'
make_threads = Property('WORKER_BUILD_PARALLELISM')
build_dir = get_halide_build_path()
factory = BuildFactory()
# We never enable sanitizers for Make builds here (only for CMake)
add_env_setup_step(factory, builder_type, enable_ccache=True)
# It's never necessary to use get_msvc_config_steps() for Make,
# since we never use Make with MSVC
add_get_halide_source_steps(factory, builder_type)
# Force a full rebuild of Halide every time
factory.addStep(RemoveDirectory(name="Remove Halide Build Dir",
locks=[performance_lock.access('counting')],
dir=build_dir))
target_label_pairs = [('host', 'build_tests')]
for halide_target, labels_for_target in get_test_labels(builder_type).items():
# For Make we skip every target that isn't plain 'host'
if halide_target != 'host':
continue
_labels_to_skip = [
# auto_schedule and performance requires exclusive machine access and isn't worth it for Make
"autoschedulers_cpu",
"autoschedulers_gpu",
"autoschedulers_cuda",
"performance",
# Make no longer provides support for building the Python bindings,
# regardless of builder_type.handles_python()
"python",
]
if builder_type.bits == 32:
# Don't test autoschedulers on 32-bit systems via Make;
# it's not set up 100% correctly for crosscompilation there
# and the CMake-based coverage is fine.
_labels_to_skip.extend(['autoschedulers_cpu', 'autoschedulers_gpu', 'autoschedulers_cuda'])
for label in labels_for_target:
if label in _labels_to_skip:
continue
target_label_pairs.append((halide_target, label))
for halide_target, label in target_label_pairs:
env = extend_property('env',
LLVM_CONFIG=get_llvm_install_path(builder_type, 'bin/llvm-config'),
HL_TARGET=halide_target,
HL_JIT_TARGET=halide_target)
if is_time_critical_test(label):
p = 1
lock_mode = 'exclusive'
else:
p = make_threads
lock_mode = 'counting'
if label != 'build_tests':
label = 'test_%s' % label
factory.addStep(ShellCommand(name='make ' + label,
description=label + ' ' + halide_target,
locks=[performance_lock.access(lock_mode)],
workdir=build_dir,
env=env,
haltOnFailure=False,
command=['make',
'-f', get_halide_source_path('Makefile'),
'-j', p,
label],
timeout=3600))
return factory
def create_halide_cmake_factory(builder_type):
factory = BuildFactory()
add_env_setup_step(factory, builder_type)
add_get_halide_source_steps(factory, builder_type)
add_halide_cmake_build_steps(factory, builder_type)
add_halide_cmake_test_steps(factory, builder_type)
# If everything else looks ok, build a distrib.
if builder_type.purpose == Purpose.halide_nightly:
add_halide_cmake_package_steps(factory, builder_type)
return factory
def create_halide_factory(builder_type):
if builder_type.buildsystem == BuildSystem.cmake:
return create_halide_cmake_factory(builder_type)
else:
return create_halide_make_factory(builder_type)
def get_interesting_halide_targets():
for arch in ['arm', 'x86']:
for bits in [32, 64]:
for os in ['linux', 'osx', 'windows']:
if arch == 'arm' and os == 'windows':
# No buildbots for windows-on-arm (yet)
continue
if os == 'osx' and bits != 64:
# osx is 64-bit only, period
continue
yield arch, bits, os
def create_halide_builder(arch, bits, os, halide_branch, llvm_branch, purpose, buildsystem=BuildSystem.cmake):
# Always do a build with no sanitizers
sanitizers = [None]
# Also build with sanitizers (but not if we are doing nightlies)
if purpose != Purpose.halide_nightly:
sanitizers.extend(_SANITIZERS)
for san in sanitizers:
builder_type = BuilderType(arch, bits, os, halide_branch, llvm_branch, purpose, san, buildsystem)
if san and purpose == Purpose.llvm_nightly:
continue
if san and not builder_type.handles_sanitizers():
continue
workers = builder_type.get_worker_names()
builder = BuilderConfig(name=builder_type.builder_label(),
workernames=workers,
factory=create_halide_factory(builder_type),
collapseRequests=True,
# We need counting access to our llvm branch during Halide builds.
# (We could probably get by with access during only a subset of
# our steps, but there doesn't appear to be a way to group
# lock requests across multiple-but-not-all-steps in a Build.)
locks=[llvm_build_locks[llvm_branch + str(bits)].access('counting')],
tags=builder_type.builder_tags())
builder.builder_type = builder_type
yield builder
def create_halide_builders():
for arch, bits, os in get_interesting_halide_targets():
# Create builders for build + package of Halide master + release branches
# (but only against their 'native' LLVM versions)
for halide_branch in HALIDE_NIGHTLIES:
for llvm_branch in LLVM_FOR_HALIDE[halide_branch]:
yield from create_halide_builder(arch, bits, os, halide_branch, llvm_branch, Purpose.halide_nightly)
# Create the builders for testing pull requests to releases.
for halide_branch in _HALIDE_RELEASES:
for llvm_branch in LLVM_FOR_HALIDE[halide_branch]:
yield from create_halide_builder(arch, bits, os, halide_branch, llvm_branch, Purpose.halide_testbranch)
# Create the builders for testing pull requests to main.
yield from create_halide_builder(arch, bits, os, HALIDE_MAIN, LLVM_MAIN, Purpose.halide_testbranch)
# Also test Makefiles on x86-linux & osx (but only on Halide main) to ensure they
# stay healthy. (Note: deliberately skip arm-linux, since they are the slowest bots.)
yield from create_halide_builder('x86', 64, 'linux', HALIDE_MAIN, LLVM_MAIN,
Purpose.halide_testbranch, BuildSystem.make)
yield from create_halide_builder('x86', 32, 'linux', HALIDE_MAIN, LLVM_MAIN,
Purpose.halide_testbranch, BuildSystem.make)
yield from create_halide_builder('x86', 64, 'osx', HALIDE_MAIN, LLVM_MAIN,
Purpose.halide_testbranch, BuildSystem.make)
yield from create_halide_builder('arm', 64, 'osx', HALIDE_MAIN, LLVM_MAIN,
Purpose.halide_testbranch, BuildSystem.make)
# Test pull requests for Halide master against the current and previous LLVM, for at least one target.
for llvm_branch in LLVM_BRANCHES:
if abs(LLVM_BRANCHES[llvm_branch].version.major - LLVM_BRANCHES[LLVM_MAIN].version.major) in [1, 2]:
yield from create_halide_builder('x86', 64, 'linux', HALIDE_MAIN, llvm_branch, Purpose.halide_testbranch)
def create_halide_scheduler(halide_branch):
def is_halide_base_branch(br):
return any(br == hl.ref for hl in HALIDE_BRANCHES.values())
def is_halide_pr_branch(br):
# If it's not one of the well-known branches, assume it's a pull request
return not is_halide_base_branch(br)
def github_base_branch_matches(change):
ref = change.properties.getProperty('basename')
return ref == HALIDE_BRANCHES[halide_branch].ref
# ----- nightlies
builders = [b for b in c['builders']
if b.builder_type.halide_branch == halide_branch and b.builder_type.purpose == Purpose.halide_nightly]
if builders:
builder_names = [str(b.name) for b in builders]
# Start the Halide nightlies at 9PM Pacific; our buildbot master uses UTC for
# cron, so that's 0400. Note that this is (deliberately) well before
# the LLVM nightlies get built (currently 11pm start); the idea is
# that Halide nightlies get built using the previous day's LLVM
# nightlies, on the assumption that those are more likely to get at
# least some test coverage (via testbranch) to minimize breakage.
yield Nightly(
name='halide-package-' + halide_branch,
codebases=['halide'],
builderNames=builder_names,
change_filter=ChangeFilter(codebase='halide'),
hour=4,
minute=0)
yield ForceScheduler(
name='force-halide-nightly-' + halide_branch,
builderNames=builder_names,
codebases=['halide'])
# ----- testbranch
builders = [b for b in c['builders']
if b.builder_type.halide_branch == halide_branch
and b.builder_type.purpose == Purpose.halide_testbranch]
if builders:
# NOT SingleBranchScheduler, because this can process changes from many branches (all PRs)
builder_names = [str(b.name) for b in builders]
yield AnyBranchScheduler(
name='halide-testbranch-' + halide_branch,
codebases=['halide'],
change_filter=ChangeFilter(category='pull', codebase='halide',
branch_fn=is_halide_pr_branch,
filter_fn=github_base_branch_matches),
treeStableTimer=60 * 5, # seconds
builderNames=builder_names)
yield ForceScheduler(
name='force-halide-testbranch-' + halide_branch,
builderNames=builder_names,
codebases=['halide'])
def create_llvm_cmake_factory(builder_type):
factory = BuildFactory()
add_env_setup_step(factory, builder_type)
add_get_llvm_source_steps(factory, builder_type)
clean_llvm_rebuild = (builder_type.llvm_branch == LLVM_MAIN)
add_llvm_steps(factory, builder_type, clean_llvm_rebuild)
return factory
def create_llvm_builders():
for arch, bits, os in get_interesting_halide_targets():
# Note that we want these Builders to run on *every* eligible worker;
# the goal is to ensure that all LLVM builds are updated locally
# on all of the workers.
for llvm_branch in LLVM_BRANCHES:
builder_type = BuilderType(arch, bits, os, None, llvm_branch, Purpose.llvm_nightly)
for w in builder_type.get_worker_names():
# Note that we need the builder name to be unique across workers,
# but we want the builddir on the *worker* side to be the same for all workers
# (to simplify things).
label = builder_type.llvm_builder_label()
builder = BuilderConfig(name="%s/%s" % (label, w),
workerbuilddir=label,
workernames=[w],
factory=create_llvm_cmake_factory(builder_type),
collapseRequests=True,
# We want exclusive access to this workerlock
# thru all this Builder's steps. (We could probably
# get by with holding it just during the install phase,
# but we'd have to finesse some details like removing
# the old install directory within the lock, and this
# is much simpler.)
locks=[llvm_build_locks[llvm_branch + str(bits)].access('exclusive')],
tags=builder_type.builder_tags())
builder.builder_type = builder_type
yield builder
def create_llvm_scheduler(llvm_branch):
builders = [str(b.name) for b in c['builders']
if b.builder_type.llvm_branch == llvm_branch and b.builder_type.purpose == Purpose.llvm_nightly]
# Start every day at 11PM Pacific; our buildbot use UTC for cron, so that's 0600
yield Nightly(
name=f'llvm-nightly-{LLVM_BRANCHES[llvm_branch].version.major}',
codebases=['llvm'],
builderNames=builders,
change_filter=ChangeFilter(codebase='llvm'),
hour=6,
minute=0)
for b in builders:
yield ForceScheduler(
name='force-llvm-nightly-' + b.replace('/', '_'),
codebases=['llvm'],
builderNames=[b])
def create_builders():
yield from create_llvm_builders()
yield from create_halide_builders()
def create_schedulers():
for llvm_branch in LLVM_BRANCHES:
yield from create_llvm_scheduler(llvm_branch)
for halide_branch in HALIDE_BRANCHES:
yield from create_halide_scheduler(halide_branch)
c['builders'] = list(create_builders())
c['schedulers'] = list(create_schedulers())
# Set the builder priorities
def prioritize_builders(buildmaster, builders):
def importance(builder):
builder_type = builder.config.builder_type
assert builder_type
# LLVM nightlies run only once a day (late at night) and should always
# get priority over everything else.
if builder_type.purpose == Purpose.llvm_nightly:
return 0
# Branch testers all need to come back before we can merge a PR,
# so they all have equal next-highest priority.
if builder_type.purpose == Purpose.halide_testbranch:
return 1
# non-branch testers are mostly used for bisecting failures that
# didn't show up in the branch testers and doing binary
# releases. We care most about the most recently-released llvm so
# that we have a full set of builds for releases, then llvm main
# for bisection, then older llvm versions.
if builder_type.llvm_branch in LLVM_FOR_HALIDE[HALIDE_RELEASE_15]:
return 2
if builder_type.llvm_branch in LLVM_FOR_HALIDE[HALIDE_RELEASE_16]:
return 2
if builder_type.llvm_branch in LLVM_FOR_HALIDE[HALIDE_MAIN]:
return 3
return 4
return list(sorted(builders, key=importance))
c['prioritizeBuilders'] = prioritize_builders
# GitHub pull request filter
class SafeGitHubEventHandler(GitHubEventHandler):
def handle_push(self, payload, event):
ref = payload['ref']
if re.match(r"^refs/(heads|tags)/(master|main|release/\d+\.x)$", ref):
return super().handle_push(payload, event)
else:
print(f'SafeGitHubEventHandler: ignoring push event for ref: {ref}')
return self.skip()
def handle_pull_request(self, payload, event):
pr = payload['pull_request']
try:
# Skip anything with the 'skip_buildbots' label
if any(label['name'] == 'skip_buildbots' for label in pr['labels']):
# print("PR %s was skipped due to skip_buildbots" % str(pr['html_url']))
return self.skip()
# Test anything (even external) that has 'halidebuildbots' as a reviewer.
if any(r['login'] == 'halidebuildbots' for r in pr['requested_reviewers']):
# print("PR %s was handled due halidebuildbots" % str(pr['html_url']))
if payload['action'] == 'review_requested':
# Pretend it's a synchronize event instead since private buildbot code
# rejects review_requested for no apparent reason.
payload['action'] = 'synchronize'
return super().handle_pull_request(payload, event)
# Skip external pull requests that originate from untrusted forks
trusted_repos = (
'halide/Halide', # the primary repository is obviously trusted
'CodeLinaro/Halide', # the Qualcomm open-source staging fork is trustworthy
)
if pr['head']['repo']['full_name'] not in trusted_repos:
# print("PR %s was skipped due to being external:" % str(pr['head']['repo']['full_name']))
return self.skip()
# print("PR %s is being handled normally" % str(pr['html_url']))
return super().handle_pull_request(payload, event)
except KeyError as e:
print(f'SafeGitHubEventHandler: malformed payload: {payload}')
print(f'SafeGitHubEventHandler: missing key "{e}"')
return self.skip()
@staticmethod
def skip():
return [], 'git'
# WEB SERVER
# 'protocols' contains information about protocols which master will use for communicating with workers.
# You must define at least 'port' option that workers could connect to your master with this protocol.
# 'port' must match the value configured into the buildworkers (with their --master option)
c['protocols'] = {'pb': {'port': 9990}}
authz = Authz(
allowRules=[ems.ForceBuildEndpointMatcher(role="admins"),
ems.StopBuildEndpointMatcher(role="admins"),
ems.RebuildBuildEndpointMatcher(role="admins"),
ems.EnableSchedulerEndpointMatcher(role="admins")],
roleMatchers=[RolesFromUsername(roles=["admins"], usernames=["halidenightly"])])
c['www'] = dict(
auth=UserPasswordAuth({'halidenightly': WWW_PASSWORD}),
authz=authz,
port=8012,
change_hook_dialects={
'github': {
'secret': WEBHOOK_SECRET,
'codebase': 'halide',
'skips': [],
'class': SafeGitHubEventHandler,
# 'github_property_whitelist': ['github.base.ref'],
},
},
)
# PROJECT IDENTITY
# the 'title' string will appear at the top of this buildbot
# installation's html.WebStatus home page (linked to the
# 'titleURL') and is embedded in the title of the waterfall HTML page.
c['title'] = 'Halide'
c['titleURL'] = 'http://halide-lang.org'
# the 'buildbotURL' string should point to the location where the buildbot's
# internal web server (usually the html.WebStatus page) is visible. This
# typically uses the port number set in the Waterfall 'status' entry, but
# with an externally-visible host name which the buildbot cannot figure out
# without some help.
c['buildbotURL'] = 'https://buildbot.halide-lang.org/master/'
# DB URL
c['db'] = {
# This specifies what database buildbot uses to store its state. You can leave
# this at its default for all but the largest installations.
'db_url': 'sqlite:///state.sqlite',
}
# GitHub Integration
# Only testbranch builders need to be considered here
builders = [str(b.name) for b in c['builders'] if b.builder_type.purpose != Purpose.llvm_nightly]
generator = BuildStartEndStatusGenerator(builders=builders,
start_formatter=MessageFormatterRenderable('Build started.'),
end_formatter=MessageFormatterRenderable('Build done.'))
gs = GitHubStatusPush(token=GITHUB_TOKEN,
context=Interpolate("buildbot/%(prop:buildername)s"),
generators=[generator],
verbose=True)
c['services'] = [gs]
# Disable sending usage data
c['buildbotNetUsageData'] = None
|
5,990 | 1ad40ef3aa7c81b6eee4fe0b98bcdd2f1110ef8d | #!/usr/bin/env python
# On CI, you can pass the logging and the password of dockerhub through
# the environment variables DOCKER_USERNAME and DOCKER_PASSWORD
import getpass
import os
import subprocess
import sys
from builtins import input
SCRIPT_DIR = os.path.realpath(os.path.join(__file__, '..'))
ROOT_DIR = os.path.realpath(os.path.join(SCRIPT_DIR, '..'))
def main(arguments):
docker = [
('Dockerfile.ubuntu1804', 'ubuntu1804_ansible_testinfra'),
('Dockerfile.ubuntu1604', 'ubuntu1604_ansible_testinfra'),
]
docker_username = os.environ.get('DOCKER_USERNAME', None)
if docker_username is None:
docker_username = input('docker hub user (DOCKER_USERNAME) ? ')
docker_password = os.environ.get('DOCKER_PASSWORD', None)
if docker_password is None:
docker_password = getpass.getpass('docker hub password (DOCKER_PASSWORD) ? ')
_system('docker login -u {0} -p {1}'.format(docker_username, docker_password), logged=False)
for docker_file, docker_image in docker:
_system('docker build -f {0} -t {1} {2}'.format(docker_file, docker_image, ROOT_DIR))
for _, docker_image in docker:
_system('docker tag {0} {1}/{0}'.format(docker_image, docker_username))
_system('docker push {1}/{0}'.format(docker_image, docker_username))
def _system(cmd, logged = True):
if logged:
print('$ {0}'.format(cmd))
if os.system(cmd) > 0:
raise OSError()
if __name__ == '__main__':
sys.exit(main(sys.argv[1:])) |
5,991 | 2c2ad4b6e8c5055afa3dfb3b540a44bda65fa004 | """
A web-page.
"""
import re
import pkg_resources
from .components import Link, Javascript, inject
class Page:
"""A web-page presenting container.
Args:
favicon (str): The file name for the favorite icon displayed in a
browser tab(default=None)
title (str): The page title, displayed in a browser tab (default=None).
resources (list): The list of `Link` and `Javascript` components which
representing the page resources (default=None).
menu (Menu): The page top level menu (default=None).
container (WebComponent): The page container (default=None).
"""
def __init__(
self,
favicon=None,
resources=None,
title=None,
menu=None,
container=None
):
super().__init__()
self.__favicon = favicon
self.__resources = resources
self.__title = title
self.__menu = menu
self.__container = container
self.__vars = {}
def __html__(self):
"""Renders an HTML page."""
return str(self)
def background(self, color=None, image=None, position=None, size=None,
repeat=None, origin=None, clip=None, attachment=None):
"""Configures the page background.
See <a href="https://www.w3schools.com/cssref/css3_pr_background.asp">
form more information.
Args:
color (str): The background color to used.
image(str): The background images to used.
position(str): The position of the background images.
size(str): The size of the background images.
repeat(str): The parameter to define of how to repeat the
background images.
origin(str): The positioning area of the background images.
clip(str): The painting area of the background images.
attachment (str): The parameter to define whether the background
images are fixed or scrolls with the rest of the page.
Returns:
obj (self): The instance of this class.
"""
if color:
self.__vars['--body-background-color'] = color
if image:
self.__vars['--body-background-image'] = image
if position:
self.__vars['--body-background-position'] = position
if size:
self.__vars['background-size'] = size
if repeat:
self.__vars['--body-background-repeat'] = repeat
if origin:
self.__vars['--body-background-origin'] = origin
if clip:
self.__vars['--body-background-clip'] = clip
if attachment:
self.__vars['--body-background-attachment'] = attachment
return self
def __str__(self):
"""Renders an HTML page."""
# Collects CSS supporting Bootstrap stypes.
links = [
Link('https://maxcdn.bootstrapcdn.com/bootstrap/4.0.0/css/bootstrap.min.css'), # NOQA
Link('https://cdnjs.cloudflare.com/ajax/libs/font-awesome/5.8.2/css/all.min.css'), # NOQA
Link('https://cdnjs.cloudflare.com/ajax/libs/highlight.js/10.5.0/styles/default.min.css') # NOQA
]
# Collects FABICON showing in tab.
if self.__favicon:
links.append(Link(self.__favicon, 'icon', 'image/x-icon'))
# Collects JS scriptis supporting JQuery and code highlights.
scripts = [
Javascript('https://ajax.googleapis.com/ajax/libs/jquery/3.1.0/jquery.min.js'), # NOQA
Javascript('https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.16.0/umd/popper.min.js'), # NOQA
Javascript('https://maxcdn.bootstrapcdn.com/bootstrap/4.0.0/js/bootstrap.min.js'), # NOQA
Javascript('https://cdnjs.cloudflare.com/ajax/libs/highlight.js/10.5.0/highlight.min.js'), # NOQA
Javascript('https://cdnjs.cloudflare.com/ajax/libs/highlight.js/10.5.0/languages/python.min.js') # NOQA
]
# Adds customer defined resources which could be CSS or JS files.
if self.__resources:
for resource in self.__resources:
if isinstance(resource, Link):
links.append(resource)
elif isinstance(resource, Javascript):
scripts.append(resource)
else:
raise TypeError(
'Page resource must be either <class "Link"> or '
f'<class "Javascript">, but got: {type(resource)};',
)
# Sets the page title.
title = None
if self.__title:
if isinstance(self.__title, str):
title = f'''<title>{self.__title}</title>'''
else:
raise TypeError(
f'Page title must be <str>, but got: {type(title)};',
)
# Creates inner style which will be embedded in the page.
root_vars = ''
if len(self.__vars) > 0:
for name, value in self.__vars.items():
root_vars += '%s: %s;' % (name, value)
root_vars += '--container-margin-top: %s' % (
'90px' if self.__menu else '10px'
)
root_vars = ':root{' + root_vars + '}'
inner_style = pkg_resources.resource_string(__name__, 'generic.css').\
decode('utf-8')
inner_style = root_vars + inner_style
inner_style = re.sub('\\n|\\s\\s+', ' ', inner_style)
# Creates inner script which will be embedded in the page.
inner_script = pkg_resources.resource_string(__name__, 'generic.js').\
decode('utf-8')
inner_script = re.sub('\\n|\\s\\s+', ' ', inner_script)
return f'''
<!DOCTYPE html>
<html lang="en">
<head>
<meta charset="utf-8"/>
<meta name="viewport"
content="width=device-width, initial-scale=1,
shrink-to-fit=no"/>
{inject(*links)}
{inject(*scripts)}
{inject(title)}
</head>
<body>
{inject(self.__menu)}
<div class="container-fluid">
{inject(self.__container)}
</div>
</body>
<script>{inner_script}</script>
<style>{inner_style}</style>
</html>
'''
|
5,992 | 652918e09a3506869c939be39b71a06467459f8a | import configparser
# CONFIG
config = configparser.ConfigParser()
config.read('dwh.cfg')
# DROP TABLES
drop_schema="DROP SCHEMA IF EXISTS sparkifydb;"
set_search_path="SET SEARCH_PATH to sparkifydb;"
staging_events_table_drop = "DROP TABLE IF EXISTS staging_events;"
staging_songs_table_drop = "DROP TABLE IF EXISTS staging_songs;"
songplay_table_drop = "DROP TABLE IF EXISTS songplay;"
user_table_drop = "DROP TABLE IF EXISTS sparkifydb.users;"
song_table_drop ="DROP TABLE IF EXISTS sparkifydb.songs;"
artist_table_drop = "DROP TABLE IF EXISTS sparkifydb.artists;"
time_table_drop = "DROP TABLE IF EXISTS sparkifydb.time;"
#CREATE SCHEMA
create_sparkify_schema="CREATE SCHEMA IF NOT EXISTS sparkifydb;"
# CREATE TABLES
staging_events_table_create= ("""
CREATE TABLE staging_events
(
event_id int identity(0,1) SORTKEY,
artist_name text NULL DISTKEY,
auth text NULL,
firstName text NULL,
gender varchar(5) NULL,
itemInSession bigint NULL,
lastName text NULL,
length double precision NULL,
level text NULL,
location text NULL,
method text NULL,
page text NULL,
registration text NULL,
sessionId bigint NULL,
song text NULL,
status int NULL,
ts text NULL,
userAgent text NULL,
userId bigint
);
""")
staging_songs_table_create = ("""
CREATE TABLE staging_songs
(
num_songs int,
artist_id varchar(255) DISTKEY,
artist_latitude varchar(255) NULL,
artist_longitude varchar(255) NULL,
artist_location varchar(255) NULL,
artist_name text NOT NULL,
song_id varchar(255) SORTKEY NOT NULL,
title text NOT NULL,
duration double precision NOT NULL,
year int NULL
);
""")
songplay_table_create = ("""
CREATE TABLE songplay
(
songplay_id int identity(0,1) PRIMARY KEY SORTKEY NOT NULL,
start_time timestamp NOT NULL,
user_id text NOT NULL,
level text,
song_id text NOT NULL,
artist_id text NOT NULL DISTKEY,
session_id text,
location text,
user_agent text);
""")
user_table_create = ("""
CREATE TABLE users(
user_id bigint PRIMARY KEY SORTKEY NOT NULL ,
first_name text,
last_name text,
gender varchar(10),
level text
)diststyle all;
""")
song_table_create = ("""
CREATE TABLE songs(
song_id varchar(255) SORTKEY PRIMARY KEY NOT NULL,
artist_id text NOT NULL,
year int,
duration double precision,
level text
)diststyle all;
""")
artist_table_create = ("""
CREATE TABLE artists(
artist_id text PRIMARY KEY SORTKEY,
artist_name text,
location text,
lattitude text,
longitude text
) diststyle all;
""")
time_table_create = ("""
CREATE TABLE time(
start_time timestamp PRIMARY KEY SORTKEY,
hour int,
day int,
week int,
month int,
year int,
weekday int
) diststyle all;
""")
# STAGING TABLES
staging_events_copy = ("""copy staging_events from '{}'
credentials 'aws_iam_role={}'
compupdate off
region 'us-west-2'
JSON '{}'
""").format(config['S3']['LOG_DATA'],config['IAM_ROLE']['ARN'],config['S3']['LOG_JSONPATH'])
staging_songs_copy = ("""copy staging_songs from '{}'
credentials 'aws_iam_role={}'
compupdate off
region 'us-west-2'
JSON 'auto'
""").format(config['S3']['SONG_DATA'],config['IAM_ROLE']['ARN'])
# FINAL TABLES
songplay_table_insert = ("""
INSERT INTO songplay(start_time,user_id,level,song_id,artist_id,session_id,location,user_agent)
SELECT
TIMESTAMP 'epoch' + se.ts/1000 * INTERVAL '1 Second ' AS start_time,
se.userId AS user_id,
se.level AS level,
ss.song_id AS song_id,
ss.artist_id AS artist_id,
se.sessionId AS session_id,
ss.artist_location AS location,
se.userAgent AS user_agent
FROM staging_songs AS ss
JOIN staging_events AS se ON (ss.title=se.song AND ss.artist_name=se.artist_name)
AND
se.page = 'NextSong';
""")
user_table_insert = ("""
INSERT INTO users(user_id,first_name,last_name,gender,level)
SELECT DISTINCT(s.userId) AS user_id,
s.firstName AS first_name,
s.lastName AS last_name,
s.gender AS gender,
s.level AS level
FROM
staging_events as s
WHERE s.page = 'NextSong'
""")
song_table_insert = ("""
INSERT INTO songs (song_id,artist_id,year, duration)
SELECT DISTINCT(ss.song_id) AS song_id,
ss.artist_id AS artist_id,
ss.year AS year,
ss.duration AS duration
FROM
staging_songs AS ss
""")
artist_table_insert = ("""
INSERT INTO artists (artist_id,artist_name,location,lattitude,longitude)
SELECT DISTINCT(s.artist_id) AS artist_id,
s.artist_name AS artist_name,
s.artist_location AS location,
s.artist_latitude AS lattitude,
s.artist_longitude AS longitude
FROM
staging_songs AS s;
""")
time_table_insert = ("""
INSERT INTO time (start_time,hour,day,week,month,year,weekday)
SELECT DISTINCT(TIMESTAMP 'epoch' + s.ts/1000 * INTERVAL '1 Second ') AS start_time,
EXTRACT(HOUR from start_time) AS hour,
EXTRACT(DAY from start_time) AS day,
EXTRACT(WEEK from start_time) AS week,
EXTRACT(MONTH from start_time) AS month,
EXTRACT(YEAR from start_time) AS year,
EXTRACT(DOW from start_time) AS weekday
FROM
staging_events AS s
WHERE
s.page = 'NextSong';
""")
# QUERY LISTS
create_table_queries =[set_search_path,songplay_table_create, user_table_create, song_table_create, artist_table_create, time_table_create,staging_events_table_create,staging_songs_table_create]
drop_table_queries = [create_sparkify_schema,set_search_path,staging_events_table_drop, staging_songs_table_drop, songplay_table_drop, user_table_drop, song_table_drop, artist_table_drop, time_table_drop]
copy_table_queries = [set_search_path,staging_events_copy, staging_songs_copy]
insert_table_queries = [set_search_path,user_table_insert, song_table_insert, artist_table_insert, time_table_insert,songplay_table_insert]
|
5,993 | c0e1c0c4545777a669fac19900239ab9baade242 | """
Physical units and dimensions
"""
from sympy import *
from sympy.core.basic import Atom
from sympy.core.methods import ArithMeths, RelMeths
class Unit(Atom, RelMeths, ArithMeths):
is_positive = True # make (m**2)**Rational(1,2) --> m
is_commutative = True
def __init__(self, name, abbrev):
self.name = name
self.abbrev = abbrev
def tostr(self, level=0):
return self.abbrev
def __eq__(self, other):
return isinstance(other, Unit) and self.name == other.name
def defunit(value, *names):
u = value
g = globals()
for name in names:
g[name] = u
# Dimensionless
percent = percents = Rational(1,100)
permille = permille = Rational(1,1000)
ten = Rational(10)
yotta = ten**24
zetta = ten**21
exa = ten**18
peta = ten**15
tera = ten**12
giga = ten**9
mega = ten**6
kilo = ten**3
deca = ten**1
deci = ten**-1
centi = ten**-2
milli = ten**-3
micro = ten**-6
nano = ten**-9
pico = ten**-12
femto = ten**-15
atto = ten**-18
zepto = ten**-21
yocto = ten**-24
rad = radian = radians = 1
deg = degree = degrees = pi/180
# Base units
defunit(Unit('meter', 'm'), 'm', 'meter', 'meters')
defunit(Unit('kilogram', 'kg'), 'kg', 'kilogram', 'kilograms')
defunit(Unit('second', 's'), 's', 'second', 'seconds')
defunit(Unit('ampere', 'A'), 'A', 'ampere', 'amperes')
defunit(Unit('kelvin', 'K'), 'K', 'kelvin', 'kelvins')
defunit(Unit('mole', 'mol'), 'mol', 'mole', 'moles')
defunit(Unit('candela', 'cd'), 'cd', 'candela', 'candelas')
# Derived units
defunit(1/s, 'Hz', 'hz', 'hertz')
defunit(m*kg/s**2, 'N', 'newton', 'newtons')
defunit(N*m, 'J', 'joule', 'joules')
defunit(J/s, 'W', 'watt', 'watts')
defunit(N/m**2, 'Pa', 'pa', 'pascal', 'pascals')
defunit(s*A, 'C', 'coulomb', 'coulombs')
defunit(W/A, 'v', 'V', 'volt', 'volts')
defunit(V/A, 'ohm', 'ohms')
defunit(A/V, 'S', 'siemens', 'mho', 'mhos')
defunit(C/V, 'F', 'farad', 'farads')
defunit(J/A, 'Wb', 'wb', 'weber', 'webers')
defunit(V*s/m**2, 'T', 'tesla', 'teslas')
defunit(V*s/A, 'H', 'henry', 'henrys')
# Common length units
defunit(kilo*m, 'km', 'kilometer', 'kilometers')
defunit(deci*m, 'dm', 'decimeter', 'decimeters')
defunit(centi*m, 'cm', 'centimeter', 'centimeters')
defunit(milli*m, 'mm', 'millimeter', 'millimeters')
defunit(micro*m, 'um', 'micrometer', 'micrometers', 'micron', 'microns')
defunit(nano*m, 'nm', 'nanometer', 'nanometers')
defunit(pico*m, 'pm', 'picometer', 'picometers')
defunit(Rational('0.3048')*m, 'ft', 'foot', 'feet')
defunit(Rational('25.4')*mm, 'inch', 'inches')
defunit(3*ft, 'yd', 'yard', 'yards')
defunit(5280*ft, 'mi', 'mile', 'miles')
# Common volume and area units
defunit(m**3 / 1000, 'l', 'liter', 'liters')
defunit(deci*l, 'dl', 'deciliter', 'deciliters')
defunit(centi*l, 'cl', 'centiliter', 'centiliters')
defunit(milli*l, 'ml', 'milliliter', 'milliliters')
# Common time units
defunit(milli*s, 'ms', 'millisecond', 'milliseconds')
defunit(micro*s, 'us', 'microsecond', 'microseconds')
defunit(nano*s, 'ns', 'nanosecond', 'nanoseconds')
defunit(pico*s, 'ps', 'picosecond', 'picoseconds')
defunit(60*s, 'minute', 'minutes')
defunit(60*minute, 'h', 'hour', 'hours')
defunit(24*hour, 'day', 'days')
defunit(Rational('31558149.540')*s, 'sidereal_year', 'sidereal_years')
defunit(Rational('365.24219')*day, 'tropical_year', 'tropical_years')
defunit(Rational('365')*day, 'common_year', 'common_years')
defunit(Rational('365.25')*day, 'julian_year', 'julian_years')
year = years = tropical_year
# Common mass units
defunit(kilogram / kilo, 'g', 'gram', 'grams')
defunit(milli * g, 'mg', 'milligram', 'milligrams')
defunit(micro * g, 'ug', 'microgram', 'micrograms')
#----------------------------------------------------------------------------
# Physical constants
#
c = speed_of_light = 299792458 * m/s
G = gravitational_constant = Rational('6.67428') * ten**-11 * m**3 / kg / s**2
u0 = magnetic_constant = 4*pi * ten**-7 * N/A**2
e0 = electric_constant = 1/(u0 * c**2)
Z0 = vacuum_impedance = u0 * c
planck = Rational('6.2606896') * ten**-34 * J*s
hbar = planck / (2*pi)
avogadro = (Rational('6.02214179') * 10**23) / mol
boltzmann = Rational('1.3806505') * ten**-23 * J / K
gee = gees = Rational('9.80665') * m/s**2
atmosphere = atmospheres = atm = 101325 * pascal
# Other convenient units and magnitudes
defunit(c*julian_year, 'ly', 'lightyear', 'lightyears')
defunit(149597870691*m, 'au', 'astronomical_unit', 'astronomical_units')
|
5,994 | 414fa4021b21cea0dc49380aebfe67f0204f0574 | def multiplica():
one = int(input('1ยบ: '))
two = int(input('2ยบ: '))
print('a multiplicaรงรฃo รฉ: ', one*two)
def soma():
one = int(input('1ยบ: '))
two = int(input('2ยบ: '))
print('a soma รฉ: ', one+two)
def subtra():
one = int(input('1ยบ: '))
two = int(input('2ยบ: '))
print('a subtraรงรฃo รฉ: ', one-two)
ans=True
while ans:
print ("""
1.Multiplicaรงรฃo
2.Soma
3.Subtraรงรฃo
4.Exit/Quit
""")
ans= int(input("What would you like to do? "))
if ans== 1:
multiplica()
elif ans== 2:
print("\n Student Deleted")
elif ans== 3:
print("\n Student Record Found")
elif ans== 4:
print("\n Goodbye")
exit()
else:
print("\n Not Valid Choice Try again")
|
5,995 | 54a6405e3447d488aa4fca88159ccaac2506df2c | #!/usr/bin/env python
import serial
from action import Action
import math
comm = serial.Serial("/dev/ttyACM3", 115200, timeout=1)
#comm = None
robot = Action(comm)
from flask import Flask
from flask import send_from_directory
import os
static_dir = os.path.join(os.getcwd(), "ControlApp")
print "serving from " + static_dir
app = Flask(__name__)
app.debug = False
@app.route('/')
def root():
return send_from_directory(static_dir, "control.html")
@app.route("/stop")
def do_stop():
robot.stop()
return "ok"
@app.route("/forward")
def do_forward():
robot.move(0, 1)
return "ok"
@app.route("/backward")
def do_backward():
robot.move(0, -1)
return "ok"
@app.route("/left")
def do_left():
robot.move(math.pi/2.0, 1)
return "ok"
@app.route("/right")
def do_right():
robot.move(math.pi*3.0/2.0, 1)
return "ok"
@app.route("/turncw")
def do_turncw():
robot.turn(0.5)
return "ok"
@app.route("/turnacw")
def do_turnacw():
robot.turn(-0.5)
return "ok"
@app.route("/kick")
def do_kick():
robot.kick()
return "ok"
@app.route("/catch")
def do_catch():
robot.catch()
return "ok"
if __name__ == "__main__":
app.debug = True
app.run(port=5001)
|
5,996 | 0bc53130a4248178f4c3fabbae7d2546f0d5b8fd | from __future__ import unicode_literals
from django.db import models
from django.utils import timezone
# Create your models here.
class Article(models.Model):
title = models.CharField(max_length=200)
author = models.CharField(max_length=100, default='admin')
content = models.TextField(max_length=5000)
hide_content = models.TextField(max_length=1000, default='', blank=True)
create_time = models.DateTimeField(auto_now_add=True)
visible = models.BooleanField(default=True)
description = models.CharField(max_length=200, default='', blank=True)
# comment = models.ForeignKey(Comment, related_name='article_comment')
cover = models.CharField(max_length=100, default='/')
def __unicode__(self):
return self.title
class Comment(models.Model):
article = models.ForeignKey(Article, related_name='article_comment')
content = models.TextField(max_length=1000, default='')
create_time = models.DateTimeField(auto_now_add=True)
user_id = models.CharField(max_length=100, blank=False)
def __unicode__(self):
return self.content
class ZoneSubject(models.Model):
title = models.CharField(max_length=20, default='', blank=True)
image_url = models.CharField(max_length=500)
create_time = models.DateTimeField(default=timezone.now)
def __unicode__(self):
return self.image_url
class Search_record(models.Model):
title = models.CharField(max_length=100)
url = models.CharField(max_length=100)
searchCount = models.IntegerField(blank=True)
zhihu_type = models.IntegerField(blank=True, null=True)
def __unicode__(self):
return self.title
class DoubanTopic(models.Model):
group_id = models.CharField(max_length=10)
url = models.CharField(max_length=100)
title = models.CharField(max_length=100)
create_time = models.CharField(max_length=20)
author_name = models.CharField(max_length=50)
author_url = models.CharField(max_length=200)
user_img_small = models.CharField(max_length=200)
visible = models.BooleanField(default=True)
def __unicode__(self):
return self.title
class ZhihuSubject(models.Model):
title = models.CharField(max_length=200)
url = models.CharField(max_length=100)
zhihu_type = models.IntegerField()
def __unicode__(self):
return self.title
class ZhihuQuestion(models.Model):
subject = models.ForeignKey(ZhihuSubject, related_name='subject_question')
answer_url = models.CharField(max_length=200)
author = models.CharField(max_length=100)
author_url = models.CharField(max_length=200,null=True)
title = models.CharField(max_length=100, default='')
def __unicode__(self):
return self.title
class ZhihuImage(models.Model):
question = models.ForeignKey(ZhihuQuestion, related_name='question_image')
origin_url = models.CharField(max_length=200)
def __unicode__(self):
return self.origin_url
class DoubanImage(models.Model):
topic = models.ForeignKey(DoubanTopic, related_name='topic_image')
origin_url = models.CharField(max_length=200)
cos_url = models.CharField(max_length=200, default='',blank=True)
type = models.IntegerField(default=0)
def __unicode__(self):
return self.origin_url
|
5,997 | 327e9dcba49419b8a8c320940e333765c1d9b980 | # Standard Library Imports
# Third Party Imports
from kivy.clock import Clock
from kivy.properties import StringProperty
from kivy.uix.screenmanager import Screen, ScreenManager
from kivy.uix.widget import Widget
# Local Imports
from client.source.ui.kv_widgets import ModalPopupButton, SubmissionPopup, FailedSubmissionPopup, ServerShutdownPopup
# ====================================
# CONSTANTS
# ====================================
PORT = 1776
# ====================================
# PARAMETERS
# ====================================
TIME_UNIT = 'MINUTES'
class RootScreen(ScreenManager):
def __init__(self, client_protocol, **kwargs):
super().__init__(**kwargs)
self.client_protocol = client_protocol
class StartScreen(Screen):
def attempt_to_connect(self, server_ip, username, password):
self.parent.client_protocol.start_connection(server_ip, username, password)
self.open_connecting_popup()
self.timeout = 0
self.wait_For_server_response_event = Clock.schedule_interval(self.wait_for_server_response, 1)
def wait_for_server_response(self, *args):
print(self.timeout)
# Login success
if self.parent.client_protocol.login_success:
self.popup.dismiss()
self.wait_For_server_response_event.cancel()
self.parent.current = 'ChatRoomScreen'
# Timeout
elif self.timeout == 5:
self.failed_to_connect(message='Failed to connect to server. Please try again or check your network connection.')
# Invalid credentials
elif self.parent.client_protocol.invalid_credentials:
self.parent.client_protocol.invalid_credentials = False
self.failed_to_connect(message='Invalid username/password combination. Please try again.')
else:
self.timeout += 1
def failed_to_connect(self, message):
print("FAILED TO CONNECT")
self.popup.dismiss()
self.open_failed_popup(message=message)
self.wait_For_server_response_event.cancel()
def open_connecting_popup(self):
self.popup = SubmissionPopup()
self.popup.open()
def open_failed_popup(self, message):
self.popup = FailedSubmissionPopup(message=message)
self.popup.open()
class ChatRoomScreen(Screen):
chat_history = StringProperty('')
user_list = StringProperty('')
def on_enter(self):
Clock.schedule_once(self.schedule_update_display_info)
def schedule_update_display_info(self, *args):
Clock.schedule_interval(self.update_display_info, 1)
def update_user_list_buttons(self):
self.clear_user_list_display()
for user in self.user_list.split("\n"):
button = ModalPopupButton(text=user)
self.ids.user_list.add_widget(button)
self.ids.user_list.add_widget(Widget())
def clear_user_list_display(self):
self.ids.user_list.clear_widgets()
def update_display_info(self, *args):
if self.chat_history != self.parent.client_protocol.chat_history.history_string:
self.chat_history = self.parent.client_protocol.chat_history.history_string
if self.user_list != self.parent.client_protocol.user_list:
print("User List mismatch")
self.user_list = self.parent.client_protocol.user_list
self.update_user_list_buttons()
if self.parent.client_protocol.server_shutdown:
self.server_shutdown()
def next_message_private(self, user):
current_text = self.ids.message.text
self.ids.message.text = ''
current_text = "@{}, ".format(user) + current_text
self.ids.message.text = current_text
def server_shutdown(self):
print("SERVER SHUTDOWN")
self.popup = ServerShutdownPopup()
self.popup.open()
def schedule_clear_input_box(self):
Clock.schedule_once(self.clear_input_box, 0.25)
def clear_input_box(self, *args):
self.ids.message.text = ''
|
5,998 | dc6cbf43424a31f1aefde8bd71b6f1b7ecf8166b | vect = [0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 8.320673301762177, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.287897844304593, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 4.394449154672439, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 1.3862943611198906, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 1.7412592803704001, 2.9957322735539913, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.198469360840316, 0.0, 2.550898738446989, 0, 0, 0.0, 0, 0.0, 3.4011973816621555, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 3.58351893845611, 0, 0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 3.2188758248682006, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6888794541139363, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.649511027115099, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6109179126442243, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.5834963087817, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0, 0.0, 0.0, 2.9957322735539913, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 3.6888794541139363, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.295836866004329, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 4.605170185988092, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0, 0, 12.266590935297321, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0, 0.0, 5.924066185063897, 0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 7.200951859620047, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0, 0, 4.0943445622221, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 4.962844630259907, 0.0, 0.0, 0, 0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0, 0, 0.0, 0.0, 0, 0.0, 3.8501476017100584, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 1.0986122886681098, 2.1972245773362196, 0, 0.0, 0.0, 4.581130849408909, 0.0, 0, 2.5649493574615367, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.6375861597263857, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 8.921925063191328, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9957322735539913, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.367295829986474, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0.0, 10.39720770839918, 2.302585092994046, 2.5649493574615367, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 2.9957322735539913, 0, 0, 4.06534854782536, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.295836866004329, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0, 2.6390573296152584, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.490536906871891, 0.0, 0.0, 0.0, 3.5263605246161616, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 2.550898738446989, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.02535169073515, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 3.258096538021482, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.290459441148391, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.31748811353631, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4339872044851467, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 2.1972245773362196, 3.4825185607408002, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2237778411112, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.9512437185814275, 7.983380992735443, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 7.917171988845775, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.969640753475787, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 5.723585101952381, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.76977456331519, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 7.000208219919599, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 4.143134726391533, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 4.795790545596741, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.044522437723423, 0.0, 0, 0.0, 0.0, 0.0, 4.74493212836325, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 6.516193076042964, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 3.2958368660043296, 0.0, 3.58351893845611, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.51085950651685, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.952096120109145, 0.0, 5.58914919554, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0, 0, 0.0, 1.3862943611198906, 3.258096538021482, 0, 0.0, 0.0, 0.0, 4.394449154672439, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 5.101797476893978, 0.0, 2.302585092994046, 0, 0, 0.0, 4.292158018817389, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 4.06534854782536, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0, 3.5553480614894135, 0.0, 0, 2.5649493574615367, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 5.46286043483228, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 18.767037148656488, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.584967478670572, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 4.0943445622221, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.711235389328078, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.367295829986474, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.9512437185814275, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0, 0, 0, 3.1354942159291497, 3.800574088041945, 0, 0.0, 0.0, 0.0, 0, 4.969640753475787, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 4.631631038266565, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.833213344056216, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.3322045101752034, 0.0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.367295829986474, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.41610040220442, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.833213344056216, 0, 0.0, 0, 3.58351893845611, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.553876891600541, 0, 0.0, 3.367295829986474, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9120230054281455, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.800574088041945, 0, 0.0, 0, 0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.6635616461296467, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0, 0, 0.0, 5.204006687076795, 0.0, 0.0, 8.61362370353681, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0, 0.0, 0, 2.550898738446989, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.44274094706523, 5.679743138077019, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 11.069054569245793, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 5.03709614637473, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.961361141082371, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6109179126442243, 0, 0.0, 0.0, 0.0, 3.931825632724326, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.189654742026425, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.718498871295094, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 4.007333185232471, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 16.237278281910243, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 4.330733340286331, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 1.3862943611198906, 0, 3.8005740880419454, 0.0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 7.454719949364001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.70805020110221, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 11.484086901809196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 4.518263445217987, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 17.287514144901962, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.1972245773362196, 1.7412592803704001, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 13.660472509367466, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 3.7369991058576035, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 7.973471367577775, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.2188758248682006, 0, 3.8005740880419454, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.8005740880419454, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.437751649736401, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.101797476893978, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 11.76620976334845, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 10.559023657635953, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.008260801089284, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.877735781779639, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 3.4339872044851467, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 2.833213344056216, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 3.649511027115099, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 4.06534854782536, 0.0, 5.545177444479562, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 5.16396083649347, 0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.367295829986474, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.111987788356544, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.101797476893978, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 7.917171988845775, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 5.346437018291705, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.215149976722676, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 11.08366673682469, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.4849066497880004, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 5.780743515792329, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 5.41610040220442, 0, 0.0, 0.0, 4.581130849408909, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.991464547107983, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.869976334119211, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 4.330733340286331, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.995732273553991, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.897839799950911, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 4.748123315783208, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693497, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 4.454347296253507, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.6635616461296467, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.871201010907891, 3.2188758248682006, 0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 5.0301047650807, 4.605170185988092, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 3.2188758248682006, 0.0, 3.6375861597263857, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.77912349311153, 1.3862943611198906, 0.0, 0, 1.791759469228055, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 4.394449154672439, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 12.332621592519935, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.7376696182833684, 0.0, 0.0, 0.0, 5.390770307485499, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.804021044733257, 0.0, 0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.800574088041945, 0.0, 4.06534854782536, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.6635616461296467, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 7.217724106087479, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.6635616461296467, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.0301047650807, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.1683892320507745, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 2.833213344056216, 3.4011973816621555, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 3.178053830347946, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.49053690687189, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.6931471805599453, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 4.8991863767100545, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.812184355372417, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 2.1972245773362196, 1.6094379124341003, 0, 0.0, 4.574710978503383, 0, 6.462743943876961, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.262134127775067, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0, 0.0, 0.0, 11.284134957569469, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 6.821864234308754, 0, 0.0, 0.0, 0.0, 3.4965075614664802, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.471502607305074, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 4.976733742420574, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.828641396489095, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 3.8918202981106265, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 2.8398715690385097, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 3.044522437723423, 0.0, 0.0, 5.846735604451319, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 3.367295829986474, 0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 4.969813299576001, 5.346437018291705, 0.0, 1.7412592803704001, 0.0, 1.7412592803704001, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.000208219919599, 2.6390573296152584, 0, 0.0, 0, 0.6931471805599453, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 3.6109179126442243, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 6.287897844304593, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.795790545596741, 0.0, 0, 8.365613809386995, 0.0, 0.0, 0.0, 0.0, 0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.007333185232471, 0, 0, 0.0, 0.0, 3.9512437185814275, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.499809670330265, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.2188758248682006, 0.0, 4.48863636973214, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.952096120109145, 4.828313737302301, 3.4339872044851467, 0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 4.969813299576001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.127134385045092, 0.0, 0, 6.821864234308754, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0, 8.802445120171846, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 12.404515991916155, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0.0, 16.168878379615265, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0, 0.0, 3.8005740880419454, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 1.6094379124341003, 0.0, 0, 16.168230769388487, 0, 0.0, 0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0, 0, 0.0, 4.518263445217987, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.941642422609304, 4.700480365792417, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0, 3.2188758248682006, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 4.828313737302301, 0.0, 0, 0, 5.605802066295998, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 5.101797476893978, 3.0910424533583156, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.101797476893978, 4.969640753475787, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.3694478524670215, 0, 0, 0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 1.6094379124341003, 0, 0.0, 3.2188758248682006, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0, 3.58351893845611, 0.0, 0.0, 0, 3.7369991058576035, 0.0, 4.02535169073515, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.0841946160253877, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.182806904693497, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 2.70805020110221, 0, 0, 0, 0.0, 10.484135188312967, 7.275172319452771, 0.0, 0, 3.0841946160253872, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 7.953835426675504, 0.0, 2.70805020110221, 0.0, 0, 0, 0, 0.0, 0.0, 9.830786204133961, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0, 0, 0, 0, 0.0, 0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.07753744390572, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.356107660695892, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0, 0.0, 0, 0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.127134385045092, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.214935757608986, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.053835369501174, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 2.1972245773362196, 0, 0.0, 2.0794415416798357, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.969640753475787, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.739792912179235, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 5.075173815233827, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.784189633918261, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.847027830639663, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 7.471502607305073, 0.0, 0.0, 1.3862943611198906, 0.0, 3.4339872044851467, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 4.795790545596741, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 3.0841946160253877, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.278114659230517, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.58351893845611, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.833213344056216, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 6.591673732008658, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.465908118654584, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 5.95562797505323, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 4.762173934797756, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.736198448394496, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 4.330733340286331, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.101797476893978, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0.0, 0.0, 6.102339570951937, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.459585514144159, 0, 0.0, 0.0, 0.0, 2.995732273553991, 3.2958368660043296, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 8.73217391546585, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0.0, 0, 0, 1.9459101490553132, 0, 0.0, 0, 4.795790545596741, 0, 0.0, 4.518263445217986, 3.5553480614894135, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0.6931471805599453, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.6931471805599453, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 1.7412592803704001, 0, 0, 3.93848385770662, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 4.160336650881089, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 2.9444389791664403, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 4.204692619390966, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.6888794541139363, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 9.174503799921432, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.8858724694518925, 0.0, 0, 0.0, 0, 1.0986122886681098, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 1.3862943611198906, 0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 4.2626798770413155, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0, 0, 0.0, 0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6888794541139363, 0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.46286043483228, 6.127701357652087, 0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.666426688112432, 2.4849066497880004, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 0.0, 0, 0, 3.6635616461296467, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0, 0.0, 0, 0, 1.0986122886681098, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 2.772588722239781, 0.0, 0, 0.0, 3.5553480614894135, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 4.748123315783209, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 4.66682536764049, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0, 1.0986122886681098, 0, 0, 0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.6375861597263857, 0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 6.54135323573334, 0, 0.0, 2.0794415416798357, 0, 0, 1.9459101490553132, 0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.8066624897703196, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 5.666426688112432, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2237778411112, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.276666119016055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 3.784189633918261, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.0841946160253877, 0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.0841946160253872, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 5.769774563315189, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.127134385045092, 0, 0.0, 0, 0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 5.46286043483228, 0, 0.0, 3.295836866004329, 1.0986122886681098, 0, 0, 0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 2.4849066497880004, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0, 4.828313737302301, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0, 6.198469360840316, 9.129638369467537, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4825185607408002, 5.723585101952381, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 5.346437018291705, 4.490536906871891, 0.0, 5.375278407684165, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 6.711235389328078, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0, 0.0, 1.6094379124341003, 0, 1.6094379124341003, 0, 0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 3.0841946160253872, 0.0, 0.0, 4.06534854782536, 5.1298987149230735, 0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.007333185232471, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.631631038266565, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.346437018291705, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 2.550898738446989, 0.0, 0.0, 1.791759469228055, 0, 0.6931471805599453, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 3.6888794541139363, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0, 0.0, 2.302585092994046, 0.0, 2.772588722239781, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 2.4849066497880004, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 3.58351893845611, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0, 0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.884768704067333, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 3.9318256327243257, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.02535169073515, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 7.9730554676126895, 0.0, 0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 11.613215656391521, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 5.8066078281957605, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.182806904693496, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.970291913552122, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.77912349311153, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 10.73885431325499, 0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.9459101490553132, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.19044141596179, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.804021044733257, 0.0, 0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 3.8918202981106265, 3.649511027115099, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 10.532317184711113, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.924066185063897, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 3.7369991058576035, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.518263445217987, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.969640753475787, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.9384838577066197, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.292763799896557, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9120230054281455, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 5.8377304471659395, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2958368660043296, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.833213344056216, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 6.9558749307258045, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.295836866004329, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 1.3862943611198906, 0, 0, 0, 0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.770684624465665, 0, 0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.3322045101752034, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.454347296253507, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6888794541139363, 0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.795790545596741, 2.833213344056216, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 8.73323621912248, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 8.105134969404936, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 3.2188758248682006, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.07753744390572, 0.0, 0, 0.0, 0, 4.605170185988092, 3.295836866004329, 0, 0, 0.0, 3.7376696182833684, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0.0, 0.0, 3.3322045101752034, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.87326690740586, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.23410650459726, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 2.550898738446989, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0, 0, 0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.257339727119625, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 4.356708826689592, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 2.8398715690385097, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.23410650459726, 0.0, 0.0, 0.0, 0.0, 0, 4.394449154672439, 0.0, 0.0, 0.0, 4.290459441148391, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.941642422609304, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 4.060443010546419, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 3.3322045101752034, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 4.795790545596741, 0, 0.0, 0, 0.0, 0, 0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0, 0.0, 0.0, 0.0, 3.93848385770662, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.7612001156935624, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.99022883006837, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 4.48863636973214, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.219507705176107, 0, 0, 0.0, 3.7376696182833684, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 1.0986122886681098, 4.1588830833596715, 0.0, 3.4011973816621555, 0.0, 0, 0, 0, 3.1354942159291497, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0.0, 3.044522437723423, 3.6888794541139363, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 6.42339050749462, 5.567740402508132, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 3.828641396489095, 0.0, 0.0, 0, 4.160336650881089, 0.0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 4.127134385045092, 0.0, 0, 0, 0, 4.394449154672439, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.3322045101752034, 0, 0, 3.367295829986474, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 3.828641396489095, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 2.550898738446989, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 3.2188758248682006, 0.0, 3.5553480614894135, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.7612001156935624, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.394449154672439, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.564348191467836, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 4.204692619390966, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.9384838577066197, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 3.295836866004329, 0, 3.9889840465642745, 0, 0.0, 0, 0.0, 0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.390770307485499, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 10.55570332597337, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.356708826689592, 0.0, 0, 0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.4849066497880004, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9318256327243257, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.258096538021482, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 3.7369991058576035, 0.0, 2.302585092994046, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0, 0.0, 4.631631038266565, 0, 0, 0.0, 0.0, 0.0, 6.198469360840315, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.6888794541139363, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.787491742782046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.182084906716631, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 5.365976015021851, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 1.9459101490553132, 3.0841946160253877, 0, 0.0, 0, 0.0, 0.0, 0.0, 5.3230099791384085, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 3.4825185607408002, 0, 0.0, 0.0, 5.2237778411112, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.553876891600541, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.368314490550079, 5.2237778411112, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 2.772588722239781, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 4.160336650881089, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 4.859812404361672, 0.0, 0.0, 0.0, 5.493061443340549, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.4339872044851467, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 1.0986122886681098, 0, 0.0, 2.8398715690385097, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.93848385770662, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.6109179126442243, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 1.6094379124341003, 0.0, 1.791759469228055, 4.06534854782536, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 4.06534854782536, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 5.480638923341991, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.9318256327243257, 0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.2574953720277815, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 2.9957322735539913, 0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 9.656627474604601, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 7.3792124757492905, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0, 3.4825185607408002, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.6109179126442243, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.6375861597263857, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 2.4849066497880004, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.666426688112432, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 2.5649493574615367, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.662960480135945, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 9.887510598012987, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.437751649736401, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.553876891600541, 0.0, 0.0, 0, 4.3694478524670215, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.9459101490553132, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 16.025617661073383, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.390770307485499, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.665683717782408, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 7.299022054230198, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.631631038266565, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 4.182806904693497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.20455776256869, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.518263445217987, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 3.8005740880419454, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 4.553876891600541, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.215149976722676, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.649511027115099, 0, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 3.044522437723423, 1.0986122886681098, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.160336650881089, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.2237778411112, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 3.6375861597263857, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 7.16703787691222, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 25.273805172346215, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.899745575730817, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 10.781540614970998, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.969640753475787, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 1.6094379124341003, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.6635616461296467, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0, 1.3862943611198906, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.4339872044851467, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 9.406482647787449, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 2.995732273553991, 6.127701357652087, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 3.4965075614664802, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 1.3862943611198906, 5.442417710521793, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.4965075614664802, 5.723585101952381, 0, 0, 3.800574088041945, 0.0, 4.518263445217986, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.295836866004329, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.969813299576001, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 5.545177444479562, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 4.7535901911063645, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6635616461296467, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.0794415416798357, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.174387269895637, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.430816798843313, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.532599493153256, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 7.193685818395112, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 2.550898738446989, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 2.4849066497880004, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.952096120109145, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0, 4.406719247264253, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.2188758248682006, 1.6094379124341003, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.46286043483228, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 2.8398715690385097, 0.0, 0.0, 0.6931471805599453, 0.0, 1.3862943611198906, 5.101797476893978, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 3.58351893845611, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.912654885736052, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 3.6888794541139363, 0, 4.160336650881089, 3.044522437723423, 0.0, 0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 3.0841946160253877, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.718498871295094, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 2.1972245773362196, 0.0, 0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 4.969813299576001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 6.9558749307258045, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.93848385770662, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0, 0, 0.0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 2.550898738446989, 0, 0, 3.0841946160253877, 0.0, 0.0, 3.295836866004329, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 2.5649493574615367, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.367295829986474, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.160336650881089, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 5.780743515792329, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 6.907755278982138, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 4.2626798770413155, 0, 0, 0, 0, 0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 1.7412592803704001, 4.969640753475787, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 5.567740402508132, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 4.160336650881089, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 8.995948045406804, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.6390573296152584, 0.0, 0.0, 3.7369991058576035, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.970291913552122, 0, 3.7369991058576035, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.7535901911063645, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.423390507494619, 0.0, 0, 0, 0.0, 0, 4.160336650881089, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0, 3.6375861597263857, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 2.1972245773362196, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0, 3.044522437723423, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 2.772588722239781, 0.0, 3.713572066704308, 0.0, 0, 0, 5.03709614637473, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 3.7612001156935624, 0.0, 0.0, 2.772588722239781, 0, 3.2188758248682006, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030104765080701, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.238324625039507, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 2.5649493574615367, 3.8918202981106265, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 6.731743096669168, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.6635616461296467, 0, 0.0, 0, 2.9444389791664403, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.8903717578961645, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 4.890349128221754, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 2.1972245773362196, 0.0, 0, 0, 2.0794415416798357, 5.8888779583328805, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.8066078281957605, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 4.0943445622221, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4339872044851467, 0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.784189633918261, 0, 0.0, 7.454719949364001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.897839799950911, 0.0, 0, 0, 0.0, 0.0, 0, 0, 2.1972245773362196, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0, 0.0, 0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.550898738446989, 0, 0, 4.160336650881089, 1.3862943611198906, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 4.1588830833596715, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.9444389791664403, 0, 0, 0.0, 0.0, 0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.825453896395788, 0, 1.3862943611198906, 1.6094379124341003, 0, 1.6094379124341003, 6.778355426745129, 0, 0, 0.0, 0.0, 2.4849066497880004, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0, 3.2958368660043296, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.110873864173311, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.969813299576001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.105134969404935, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.917171988845775, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.281419193361606, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 6.168389232050775, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.254681213103192, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 16.400167309572016, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4825185607408002, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 5.101797476893978, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.178053830347946, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.9459101490553132, 0, 0.0, 11.29853313840085, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 6.200409765562088, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 8.873266907405862, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.1972245773362196, 6.351472826488934, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 4.828313737302301, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.46286043483228, 3.6375861597263857, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.367295829986474, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.044522437723423, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4965075614664802, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.007333185232471, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 6.4641735942733005, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.70805020110221, 0.0, 4.110873864173311, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.07753744390572, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.465908118654584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.6888794541139363, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.342334251964811, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.49053690687189, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.828641396489095, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.23410650459726, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.825453896395788, 0.0, 0, 0, 0.0, 0.0, 0, 0, 5.101797476893978, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2237778411112, 0, 0.0, 0.0, 0, 0.0, 0, 10.849972553336867, 0, 0.0, 0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 2.8903717578961645, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.520577332514767, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 3.6109179126442243, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 5.723585101952381, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.7430031878094825, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.276666119016055, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.280392111322715, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 6.9558749307258045, 0, 0.0, 0.0, 0.0, 8.791967689147654, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.367295829986474, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.115509720156162, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.367295829986474, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 7.652696215340966, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.2626798770413155, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.258096538021482, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.567740402508133, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.969813299576001, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.961361141082371, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.561728078908178, 0.0, 4.825453896395787, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.68697535633982, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 17.680622364027936, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.825453896395788, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.631631038266565, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.5553480614894135, 0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.736198448394496, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0.0, 0.0, 8.266085260861173, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 4.890349128221754, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4825185607408002, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.6888794541139363, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.060443010546419, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4965075614664802, 0.0, 0.0, 7.965635675306504, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0, 0, 0.0, 0, 4.634728988229636, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 5.101797476893978, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 4.0943445622221, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 6.578517662373903, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4011973816621555, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 3.7369991058576035, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.769774563315189, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 12.912195279612511, 0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.942799375126702, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.709530201312334, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 2.8398715690385097, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 5.4680601411351315, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.160336650881089, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 4.406719247264253, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 4.477336814478207, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.927253685157205, 0.0, 3.58351893845611, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0, 0.0, 0, 0.0, 9.252583848076162, 0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 2.8398715690385097, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.462743943876961, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.069162183664976, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 3.8501476017100584, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 5.0689042022202315, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 10.92572086966456, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.2626798770413155, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 13.17304868542365, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.871201010907891, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.736198448394496, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 2.1972245773362196, 4.795790545596741, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 9.545153519762186, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 1.791759469228055, 0.0, 3.044522437723423, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 2.833213344056216, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.16396083649347, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 5.567740402508132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 1.6094379124341003, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.624972813284271, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0, 3.0841946160253872, 4.969640753475787, 3.0841946160253872, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.713572066704308, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.8918202981106265, 4.06534854782536, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 4.518263445217987, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 18.468344649580203, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 3.4011973816621555, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.871201010907891, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 4.356708826689592, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 6.2166061010848646, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.238324625039507, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.081404364984463, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.6931471805599453, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.70805020110221, 0.6931471805599453, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 6.437751649736401, 0.0, 0.0, 0.0, 2.0794415416798357, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 7.471502607305074, 0.0, 1.3862943611198906, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.330733340286331, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 1.791759469228055, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.545177444479562, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.6931471805599453, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 1.6094379124341003, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.518263445217986, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.0301047650807, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.9459101490553132, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 6.731743096669168, 0.0, 0.0, 0, 0.0, 0, 5.375278407684165, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.578517662373903, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 2.302585092994046, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 5.0301047650807, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 10.112432770990234, 0, 0.0, 0.0, 0.0, 9.840079788958109, 0.0, 0.0, 0.0, 0.0, 0.0, 7.408770583887592, 0.0, 0.0, 0.0, 10.137128175207733, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 9.840079788958109, 0.0, 0.0, 0.0, 0.0, 9.453194522336574, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 11.228574125921016, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.952096120109145, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 9.897636166013237, 0.0, 0.0, 0, 5.952096120109145, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.41610040220442, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.635093354472376, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.1298987149230735, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 6.127701357652087, 0.0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 7.917171988845775, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 7.408770583887592, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.6931471805599453, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0, 0, 0, 0, 0, 0, 1.6094379124341003, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.518263445217987, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 1.3862943611198906, 1.0986122886681098, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.567740402508133, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 1.3862943611198906, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 5.991464547107983, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 5.030437921392435, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 1.7412592803704001, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 5.346437018291705, 0.0, 0.0, 0.0, 1.6094379124341003, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0, 0, 0, 0, 0.0, 1.0986122886681098, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.6931471805599453, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.6931471805599453, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.6931471805599453, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.6931471805599453, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.6931471805599453, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 5.278114659230517, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.0986122886681098, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 6.182084906716631, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.969813299576001, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.825453896395787, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.028278520230698, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 8.266085260861173, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.8971538676367405, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.3978952727983707, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.465908118654584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.475339236566737, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 7.052721049232323, 0.0, 0.0, 0, 0, 3.93848385770662, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.3862943611198906, 0.0, 3.5553480614894135, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.828641396489095, 0.0, 4.74493212836325, 0.0, 0.0, 3.4011973816621555, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0.0, 0, 0.0, 11.851968999389458, 0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 1.9459101490553132, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.356708826689592, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 3.4011973816621555, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.908694592507015, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.828641396489095, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 18.568604526672758, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 13.031161839818749, 0.0, 0.0, 12.949565591960841, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.626454784082686, 0.0, 0.0, 0.0, 5.346437018291705, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.278114659230517, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 7.052721049232323, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 6.028278520230698, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 6.5998704992128365, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 2.1972245773362196, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 2.8398715690385097, 0.0, 3.649511027115099, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.969640753475787, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 6.925410995016817, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 6.984716320118266, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 7.694848072384611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 3.044522437723423, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2832037287379885, 0.0, 0.0, 4.518263445217986, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7376696182833684, 0, 0, 5.780743515792329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.2626798770413155, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 2.833213344056216, 3.8005740880419454, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.02535169073515, 0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.4849066497880004, 0, 0.0, 0.0, 3.784189633918261, 0.0, 2.772588722239781, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.613324979540639, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 6.102339570951937, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.6931471805599453, 0, 0.0, 4.182806904693496, 0.0, 0.0, 0, 3.5553480614894135, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.365976015021851, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.147494476813453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.2237778411112, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.219507705176107, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.219507705176107, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 3.4011973816621555, 0, 3.3322045101752034, 0, 2.8903717578961645, 0, 0, 0.0, 0, 0.0, 3.2188758248682006, 0, 1.791759469228055, 0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 5.655991810819852, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.03709614637473, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.484135188312965, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.833213344056216, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 3.649511027115099, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 3.0841946160253872, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 4.518263445217986, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.795790545596741, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 3.0841946160253872, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.007333185232471, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.7369991058576035, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.365976015021851, 0.0, 1.0986122886681098, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 4.418840607796598, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.7412592803704001, 0, 3.5263605246161616, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0, 0.0, 0.0, 8.317766166719343, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 4.48863636973214, 0.0, 0.0, 3.6109179126442243, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 4.1588830833596715, 12.46359237448458, 0.0, 0.0, 0.0, 0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.846735604451319, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.06534854782536, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 4.672828834461906, 0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.649511027115099, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.518263445217986, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.6913478822291435, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.178053830347946, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.969640753475787, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.970291913552122, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.9459101490553132, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.8903717578961645, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.58351893845611, 3.649511027115099, 0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 4.553876891600541, 0.0, 1.0986122886681098, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 3.8918202981106265, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 3.9384838577066197, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.330408475910399, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.679743138077019, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.3862943611198906, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.442417710521793, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.713572066704308, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4825185607408002, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 9.129638369467537, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.1588830833596715, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 4.04305126783455, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.0841946160253872, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 6.5667131767661875, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0, 0, 4.31748811353631, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 6.578517662373903, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.221747728346623, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 3.367295829986474, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.574710978503383, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.1588830833596715, 1.3862943611198906, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.7612001156935624, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8501476017100584, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4965075614664802, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.952096120109145, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.384291749700655, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.2237778411112, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.575949103146317, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.290459441148391, 0, 0.0, 0, 0.0, 0, 0.0, 2.0794415416798357, 0, 3.800574088041945, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.800574088041945, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 3.649511027115099, 2.995732273553991, 3.367295829986474, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 1.6094379124341003, 2.8903717578961645, 0, 0.0, 0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.800574088041945, 3.8005740880419454, 0, 0.0, 0.0, 3.2188758248682006, 0.0, 3.044522437723423, 4.605170185988092, 1.7412592803704001, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0, 0, 0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.1298987149230735, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 17.402456000857075, 4.8991863767100545, 3.0841946160253872, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 4.77912349311153, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.828641396489095, 0, 0.0, 0, 0.0, 0.0, 5.43372200355424, 0.0, 0, 0, 0, 5.390770307485499, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4965075614664802, 0.0, 2.1972245773362196, 0.0, 0.0, 4.06534854782536, 0.0, 0, 0, 2.1972245773362196, 0.0, 2.5649493574615367, 0, 4.969640753475787, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 7.177178314942233, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0, 0.0, 3.258096538021482, 0, 0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 3.4011973816621555, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.0841946160253877, 2.70805020110221, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.123963979403259, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.5263605246161616, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 0.0, 0.0, 2.833213344056216, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0.0, 0.0, 0, 0.0, 4.1588830833596715, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 3.649511027115099, 4.762173934797756, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 9.620060922111964, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.248495242049359, 0, 0, 0, 2.1972245773362196, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6109179126442243, 7.69484807238461, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 3.0841946160253872, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 4.825453896395788, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 2.5649493574615367, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 3.4825185607408002, 5.0301047650807, 0.0, 5.346437018291705, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 4.343805421853684, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 4.248495242049359, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 2.1972245773362196, 0.0, 4.143134726391533, 0, 0, 0.0, 5.679743138077019, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.03709614637473, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 3.258096538021482, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.23410650459726, 0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 3.8066624897703196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.418840607796598, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0, 0.0, 0.0, 0, 0.0, 0, 4.343805421853684, 4.605170185988092, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.220355825078324, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.970291913552122, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.518263445217987, 4.941642422609304, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 3.931825632724326, 8.921925063191328, 12.820490352323048, 0, 0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.518263445217986, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 3.1354942159291497, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.976014914136014, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 4.584967478670572, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 11.292366238736987, 5.723585101952381, 0.0, 5.346437018291705, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 1.9459101490553132, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.310508262345584, 7.602458061243374, 1.6094379124341003, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 3.4965075614664802, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.9444389791664403, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0, 3.4825185607408002, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 4.59511985013459, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 5.375278407684164, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 4.795790545596741, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.58351893845611, 0, 0, 4.394449154672439, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 1.791759469228055, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.290459441148391, 0.0, 0, 0, 0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.772588722239781, 0.0, 0.0, 6.955874930725805, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.2188758248682006, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 5.76977456331519, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.769774563315189, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.160336650881089, 0, 0.0, 0, 0, 0, 0.0, 4.825453896395787, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.174387269895637, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 3.713572066704308, 0.0, 0.0, 0, 1.3862943611198906, 0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 4.189654742026425, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.631631038266565, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.258096538021482, 0.0, 0.0, 4.189654742026425, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.545177444479562, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0, 0.0, 2.0794415416798357, 4.852030263919617, 0, 0, 0, 0.0, 0.0, 3.0841946160253872, 0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.991464547107983, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.6109179126442243, 1.6094379124341003, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.248495242049359, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0, 0.0, 1.791759469228055, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 3.4657359027997265, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9120230054281455, 5.46286043483228, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.969813299576001, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.198469360840315, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 9.036526890435972, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 10.645964802870076, 0, 3.0910424533583156, 0, 4.394449154672439, 0, 0.0, 5.16396083649347, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 3.0841946160253872, 0.0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.983606621708336, 5.723585101952381, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 6.731743096669168, 0.0, 0.0, 0.0, 4.248495242049359, 2.302585092994046, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.484135188312967, 0.0, 0.0, 4.581130849408909, 0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0, 0.0, 7.3777589082278725, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 4.828313737302301, 0.0, 0, 3.8918202981106265, 0, 0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.6913478822291435, 0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.70805020110221, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0, 0.0, 0, 0.0, 4.748123315783209, 0.0, 2.8903717578961645, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 5.375278407684164, 0.0, 0, 0.0, 0.0, 0.0, 3.649511027115099, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4657359027997265, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.9512437185814275, 0.0, 0, 3.178053830347946, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0, 5.262690188904886, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.8903717578961645, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 4.182806904693496, 0.0, 0.0, 5.541833368412345, 0, 0.0, 0.0, 0.0, 4.0943445622221, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 2.6390573296152584, 0, 0.0, 0.0, 7.652696215340967, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0, 0, 2.302585092994046, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 4.06534854782536, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 1.9459101490553132, 0, 0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 4.394449154672439, 0.0, 0.0, 0, 0.0, 5.101797476893978, 0.0, 0.0, 0.0, 0.0, 0, 4.160336650881089, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 18.10738653744207, 0.0, 0.0, 0.0, 0.0, 15.33168766477724, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 7.783640596221253, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.49964003216865, 5.723585101952381, 16.710753060660316, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.429345628954441, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.1298987149230735, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.515580919909374, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 5.95562797505323, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.631631038266565, 0, 3.1354942159291497, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.390770307485499, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 3.0910424533583156, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 6.976014914136014, 0.0, 0, 0.0, 0.0, 0.0, 4.394449154672439, 3.7369991058576035, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 10.06087584278487, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.812184355372417, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.2237778411112, 0.0, 5.76977456331519, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.8991863767100545, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0, 0, 3.3322045101752034, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 2.6390573296152584, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.770684624465665, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 2.0794415416798357, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 10.163621819966615, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.203592144986466, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 9.26326207653313, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.160336650881089, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 2.833213344056216, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 4.828313737302301, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 7.97305546761269, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0, 4.748123315783209, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.532599493153256, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 4.825453896395787, 0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 3.800574088041945, 0.0, 0.0, 0.0, 1.3862943611198906, 1.791759469228055, 0.0, 0, 0.0, 3.044522437723423, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 6.976014914136014, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.238324625039507, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 5.346437018291705, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 5.8858724694518925, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.5649493574615367, 0, 0.0, 2.6390573296152584, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 4.8991863767100545, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 4.292158018817389, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.2958368660043296, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.017279836814924, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 9.129416400820892, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 3.0841946160253877, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.9318256327243257, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.634728988229636, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.101797476893978, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.332718793265369, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 13.426106100346976, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.04305126783455, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9318256327243257, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 5.58914919554, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.0986122886681098, 0.0, 1.6094379124341003, 0.0, 0.0, 0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 3.9512437185814275, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 2.1972245773362196, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 5.723585101952381, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9889840465642745, 0, 2.833213344056216, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 4.518263445217986, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 4.1588830833596715, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4339872044851467, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 3.4011973816621555, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.7369991058576035, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.351472826488934, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 2.302585092994046, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.0986122886681098, 4.624972813284271, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.4965075614664802, 0, 0.0, 0.0, 0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.178053830347946, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.178053830347946, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 2.1972245773362196, 0.0, 5.030437921392435, 0.0, 6.836775589408022, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 3.8918202981106265, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 2.0794415416798357, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.581130849408909, 4.969640753475787, 0.0, 5.723585101952381, 1.3862943611198906, 0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 1.0986122886681098, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 4.06534854782536, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 1.0986122886681098, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 4.605170185988092, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.83331693749932, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253872, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 3.7376696182833684, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 2.772588722239781, 0.0, 0.0, 7.358193752733032, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.567740402508133, 0.0, 0.0, 5.030104765080701, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.631631038266565, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 2.550898738446989, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.160336650881089, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 5.545177444479562, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 6.356107660695892, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 1.3862943611198906, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 3.7369991058576035, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.931825632724326, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.645446897643238, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 5.0301047650807, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.4825185607408002, 0, 3.970291913552122, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 4.182806904693497, 3.58351893845611, 0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.833213344056216, 0, 0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.101797476893978, 0, 5.375278407684164, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 3.871201010907891, 0, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 3.713572066704308, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 3.4011973816621555, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.0841946160253877, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.3862943611198906, 2.9444389791664403, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0, 4.581130849408909, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 2.302585092994046, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.95562797505323, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0, 3.6375861597263857, 0, 0, 0, 0.0, 1.791759469228055, 0.0, 0, 0.0, 4.8991863767100545, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.93848385770662, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 2.9957322735539913, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0.0, 2.8903717578961645, 0.0, 0.0, 0, 0.0, 0.0, 2.0794415416798357, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.9318256327243257, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.3694478524670215, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.772588722239781, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.61512051684126, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 3.828641396489095, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.423390507494619, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.281419193361606, 0.0, 6.802394763324311, 0.0, 0.0, 5.375278407684165, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 1.9459101490553132, 1.791759469228055, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 2.3978952727983707, 0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 2.833213344056216, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.2188758248682006, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 2.6390573296152584, 0.0, 0.0, 0, 0.0, 5.8066078281957605, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.545177444479562, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 3.4825185607408002, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 5.101797476893978, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 3.800574088041945, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 4.442651256490317, 0, 0.0, 2.302585092994046, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 7.275172319452771, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.952096120109145, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 2.0794415416798357, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.343805421853684, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.828641396489095, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.4339872044851467, 3.5263605246161616, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.4657359027997265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 2.550898738446989, 3.178053830347946, 0, 0, 0.0, 0, 0.0, 4.0943445622221, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.1354942159291497, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.330733340286331, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.375278407684165, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8066624897703196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.605802066295998, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 8.114299381106088, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.581130849408909, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.2958368660043296, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.292158018817389, 3.9318256327243257, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.143134726391533, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5553480614894135, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.204692619390966, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.044522437723423, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.178053830347946, 0, 0.0, 0.0, 0.0, 5.375278407684165, 0.0, 0.0, 0.0, 0.0, 0, 2.4849066497880004, 0.0, 0.0, 4.110873864173311, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 1.0986122886681098, 0.0, 3.58351893845611, 0.0, 0.0, 0, 0.0, 2.0794415416798357, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 4.969813299576001, 0.0, 2.302585092994046, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 5.278114659230517, 0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 9.825309771472105, 0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.4825185607408002, 0, 0, 0, 0.0, 0, 3.0841946160253877, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.9120230054281455, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.6109179126442243, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 8.791967689147654, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.833213344056216, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.5263605246161616, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.941642422609304, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 1.7412592803704001, 0.0, 0.0, 0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.7612001156935624, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 7.052721049232323, 0.0, 2.302585092994046, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.6375861597263857, 5.58914919554, 0.0, 0.0, 0.0, 0.0, 5.1298987149230735, 0, 0.0, 0.0, 3.4825185607408002, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.70805020110221, 3.6375861597263857, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9318256327243257, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.995948045406804, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 3.6888794541139363, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0.0, 1.791759469228055, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 1.791759469228055, 0.0, 0.0, 2.550898738446989, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 3.7369991058576035, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 1.791759469228055, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0.0, 0.0, 2.5649493574615367, 0, 5.679743138077019, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 5.952096120109145, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.6094379124341003, 0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 7.783640596221253, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.499809670330265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 6.6052979209482015, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.833213344056216, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.649511027115099, 5.952096120109145, 0.0, 1.791759469228055, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0301047650807, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.367295829986474, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.8903717578961645, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0.0, 0.0, 0.0, 0, 2.302585092994046, 5.375278407684164, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.7369991058576035, 0, 0, 3.295836866004329, 0.0, 3.5263605246161616, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.581130849408909, 0.0, 0, 0.0, 2.995732273553991, 4.110873864173311, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.0841946160253872, 0.0, 2.4849066497880004, 0.0, 0.0, 5.375278407684164, 0.0, 0.0, 0.0, 5.8377304471659395, 0.0, 0.0, 3.4825185607408002, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.518263445217986, 0.0, 3.295836866004329, 2.9444389791664403, 0.0, 0.0, 0.0, 5.030104765080701, 0, 0, 0.0, 0.0, 2.5649493574615367, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 4.330733340286331, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 4.605170185988092, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 2.1972245773362196, 0, 0.0, 0, 2.4849066497880004, 0.0, 3.8918202981106265, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.9384838577066197, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 4.330733340286331, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 5.952096120109145, 0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.9459101490553132, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0.0, 0.0, 0.0, 3.4011973816621555, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8903717578961645, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.8289456176102075, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.295836866004329, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 0.0, 2.302585092994046, 2.772588722239781, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 4.672828834461906, 0, 0.0, 0.0, 3.649511027115099, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.110873864173311, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 2.5649493574615367, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8005740880419454, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.9444389791664403, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.4849066497880004, 0, 0.0, 0, 2.70805020110221, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.330733340286331, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.8918202981106265, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.1354942159291497, 0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.302585092994046, 1.9459101490553132, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.044522437723423, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.044522437723423, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.3978952727983707, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 3.2958368660043296, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030104765080701, 0.0, 0.0, 3.1354942159291497, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.6443908991413725, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 12.444372333547394, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 2.6390573296152584, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.812184355372417, 0, 3.295836866004329, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 2.0794415416798357, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.2188758248682006, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8398715690385097, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.995732273553991, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 1.7412592803704001, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 3.2188758248682006, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0, 0, 0.0, 1.6094379124341003, 2.70805020110221, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.90527477843843, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.7412592803704001, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.3862943611198906, 1.7412592803704001, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.030437921392435, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 4.969640753475787, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.8888779583328805, 0, 0.0, 0.0, 0.0, 2.550898738446989, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 2.9444389791664403, 0.0, 0.0, 0, 0, 0.0, 0.0, 6.864049944976711, 0, 0.0, 2.3978952727983707, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.631631038266565, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.8903717578961645, 2.8398715690385097, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 0.0, 0.0, 0.0, 0.0, 4.1588830833596715, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0, 0.0, 0.0, 0.6931471805599453, 3.7369991058576035, 0, 0.0, 2.9957322735539913, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0841946160253877, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.9930151229329605, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0.0, 0.0, 0, 0.0, 3.649511027115099, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0, 2.8398715690385097, 0, 0.0, 4.518263445217987, 0.0, 0, 4.748123315783209, 4.292158018817389, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 7.149543163850748, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 1.7412592803704001, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 4.66682536764049, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 7.27447955877387, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.4825185607408002, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.9459101490553132, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 9.722561256775933, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0, 0, 0.0, 0, 0, 1.0986122886681098, 4.795790545596741, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.175867270105761, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.4825185607408002, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 2.772588722239781, 0.0, 0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 2.1972245773362196, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.0910424533583156, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 1.0986122886681098, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.112432770990234, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.5649493574615367, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 3.3322045101752034, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 2.0794415416798357, 1.7412592803704001, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 2.1972245773362196, 0.0, 2.833213344056216, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0, 0.0, 2.772588722239781, 2.550898738446989, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 1.3862943611198906, 0, 0, 0.0, 0.0, 0.0, 0.0, 4.292158018817389, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 4.718498871295094, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 4.624972813284271, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 8.98107381374378, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.7612001156935624, 0.0, 0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.302585092994046, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.8398715690385097, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.784189633918261, 0, 0.0, 0.0, 0.0, 0, 0, 0, 3.58351893845611, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0, 0.0, 0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.382026634673881, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.0794415416798357, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.8918202981106265, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.182806904693496, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0.0, 0.0, 0, 4.418840607796598, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.9459101490553132, 0.0, 0.0, 2.3978952727983707, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 3.784189633918261, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 1.6094379124341003, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.9444389791664403, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 4.828313737302301, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.6931471805599453, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 5.723585101952381, 0.0, 2.772588722239781, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 3.784189633918261, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.70805020110221, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 3.044522437723423, 0.0, 1.0986122886681098, 0.0, 0.0, 0, 0.0, 0.0, 4.394449154672439, 0.0, 4.518263445217987, 0.0, 0.0, 0.0, 0.0, 4.189654742026425, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.10594547390058, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 2.6390573296152584, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.791759469228055, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.6931471805599453, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 3.258096538021482, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.784189633918261, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.58351893845611, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 1.791759469228055, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.3862943611198906, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.3978952727983707, 2.4849066497880004, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 6.059123195581797, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 5.723585101952381, 1.6094379124341003, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.7412592803704001, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.160336650881089, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 1.3862943611198906, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 2.833213344056216, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 3.178053830347946, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 3.5263605246161616, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.976733742420574, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 3.93848385770662, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 3.9120230054281455, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 3.044522437723423, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.1972245773362196, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 2.550898738446989, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 4.394449154672439, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6094379124341003, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 1.0986122886681098, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 5.723585101952381, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0, 1.9459101490553132, 0.0, 0.0, 0.0, 0, 0.0, 2.1972245773362196, 1.9459101490553132, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] |
5,999 | 5b8322761975ebec76d1dccd0290c0fb1da404e5 | # ๋ฌธ์ ์ค๋ช
# ๊ธธ์ด๊ฐ ๊ฐ์ ๋ 1์ฐจ์ ์ ์ ๋ฐฐ์ด a, b๊ฐ ๋งค๊ฐ๋ณ์๋ก ์ฃผ์ด์ง๋๋ค. a์ b์ ๋ด์ ์ return ํ๋๋ก solution ํจ์๋ฅผ ์์ฑํด์ฃผ์ธ์.
# ์ด๋, a์ b์ ๋ด์ ์ a[0]*b[0] + a[1]*b[1] + ... + a[n-1]*b[n-1] ์
๋๋ค. (n์ a, b์ ๊ธธ์ด)
# ์ ํ์ฌํญ
# a, b์ ๊ธธ์ด๋ 1 ์ด์ 1,000 ์ดํ์
๋๋ค.
# a, b์ ๋ชจ๋ ์๋ -1,000 ์ด์ 1,000 ์ดํ์
๋๋ค.
# ์
์ถ๋ ฅ ์
# a b result
# [1,2,3,4] [-3,-1,0,2] 3
# [-1,0,1] [1,0,-1] -2
# ์
์ถ๋ ฅ ์ ์ค๋ช
# ์
์ถ๋ ฅ ์ #1
# a์ b์ ๋ด์ ์ 1*(-3) + 2*(-1) + 3*0 + 4*2 = 3 ์
๋๋ค.
# ์
์ถ๋ ฅ ์ #2
# a์ b์ ๋ด์ ์ (-1)*1 + 0*0 + 1*(-1) = -2 ์
๋๋ค.
def solution(a, b):
answer = 0
for i in range(len(a)):
answer += a[i] * b[i]
return answer
# ๋ฆฌ์คํธ ์ปจํ๋ฆฌํจ์
์ฌ์ฉ
def solution2(a, b):
answer = [a[i] * b[i] for i in range(len(a))]
return sum(answer)
# ๋๋ค ์ฌ์ฉ
def solution3(a, b):
return sum(map(lambda x,y: x * y , a, b))
# zip ์ฌ์ฉ
def solution4(a, b):
answer = 0
for i,j in zip(a,b):
answer += i * j
return answer
# zip + ๋ฆฌ์คํธ ์ปจํ๋ฆฌํจ์
์ฌ์ฉ
def solution5(a, b):
answer = sum([i * j for i,j in zip(a,b)])
return answer |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.