index
int64
0
1,000k
blob_id
stringlengths
40
40
code
stringlengths
7
10.4M
995,700
9c1c9ab15a30e2eb26c952a349f7329e4e7bea46
import numpy as np #------part 1------# wires = np.loadtxt('input.txt', dtype = str) wire1 = wires[0].split(',') wire2 = wires[1].split(',') w, wmax, wmin, h, hmax, hmin = 0, 0, 0, 0, 0, 0 for order in wire1: if order[0] == 'R': # print('R-', order) w += int(order[1:]) wmax = max(w, wmax) # print('w = ', w, ' wmax = ', wmax) elif order[0] == 'L': # print('L-', order) w -= int(order[1:]) wmin = min(w, wmin) # print('w = ', w, ' wmin = ', wmin) elif order[0] == 'U': # print('U-', order) h += int(order[1:]) hmax = max(h, hmax) # print('h = ', h, ' hmax = ', hmax) elif order[0] == 'D': # print('D-', order) h-= int(order[1:]) hmin = min(h, hmin) # print('h = ', h, ' hmax = ', hmin) print(w, wmax, wmin, h, hmax, hmin) w, h = 0, 0 for order in wire2: if order[0] == 'R': # print('R-', order) w += int(order[1:]) wmax = max(w, wmax) # print('w = ', w, ' wmax = ', wmax) elif order[0] == 'L': # print('L-', order) w -= int(order[1:]) wmin = min(w, wmin) # print('w = ', w, ' wmin = ', wmin) elif order[0] == 'U': # print('U-', order) h += int(order[1:]) hmax = max(h, hmax) # print('h = ', h, ' hmax = ', hmax) elif order[0] == 'D': # print('D-', order) h-= int(order[1:]) hmin = min(h, hmin) # print('h = ', h, ' hmax = ', hmin) print(w, wmax, wmin, h, hmax, hmin) col = wmax - wmin + 1 row = hmax - hmin + 1 print(row, col) c_row = max(hmax, 0) if wmin < 0: c_col = -wmin else: c_col = 0 print(c_row, c_col) center_r, center_c = c_row, c_col space = np.zeros((row, col), dtype = int) print(space.shape) space[c_row][c_col] = -1 for order in wire1: print(order, c_row, c_col) if order[0] == 'R': to_col = c_col + int(order[1:]) print('c_col =', c_col, ' to_col = ', to_col) space[c_row, c_col + 1: to_col + 1] = 1 c_col = to_col elif order[0] == 'L': to_col = c_col - int(order[1:]) print('c_col =', c_col, ' to_col = ', to_col) space[c_row, to_col: c_col] = 1 c_col = to_col elif order[0] == 'U': to_row = c_row - int(order[1:]) print('c_row =', c_row, ' to_row = ', to_row) space[to_row: c_row, c_col] = 1 c_row = to_row elif order[0] == 'D': to_row = c_row + int(order[1:]) print('c_row =', c_row, ' to_row = ', to_row) space[c_row + 1: to_row + 1, c_col] = 1 c_row = to_row c_row, c_col = center_r, center_c print(c_row, c_col) for order in wire2: print(order, c_row, c_col) if order[0] == 'R': to_col = c_col + int(order[1:]) print('c_col =', c_col, ' to_col = ', to_col) tmp = space[c_row, c_col + 1: to_col + 1] tmp[tmp == 1] = 2 space[c_row, c_col + 1: to_col + 1] = tmp c_col = to_col elif order[0] == 'L': to_col = c_col - int(order[1:]) print('c_col =', c_col, ' to_col = ', to_col) tmp = space[c_row, to_col: c_col] tmp[tmp == 1] = 2 space[c_row, to_col: c_col] = tmp c_col = to_col elif order[0] == 'U': to_row = c_row - int(order[1:]) print('c_row =', c_row, ' to_row = ', to_row) tmp = space[to_row: c_row, c_col] tmp[tmp == 1] = 2 space[to_row: c_row, c_col] = tmp c_row = to_row elif order[0] == 'D': to_row = c_row + int(order[1:]) print('c_row =', c_row, ' to_row = ', to_row) tmp = space[c_row + 1: to_row + 1, c_col] tmp[tmp == 1] = 2 space[c_row + 1: to_row + 1, c_col] = tmp c_row = to_row dist = col + row for i in range(space.shape[0]): for j in range(space.shape[1]): if space[i, j] == 2: dist = min(dist, np.abs(i - center_r) + np.abs(j - center_c)) print(dist)
995,701
8b3929a49383f9c8bb22acbb2b96731918c4ae4c
# ---------------------------------------------------------------------------- # # Title: mailroom part 1 # Description: A program that holds a list of donors and amounts they donated. # Prompt the user to choose 3 menu actions; thank you, report, quit. # # <05/30/2020>, Created Script # ---------------------------------------------------------------------------- # import sys # imports go at the top of the file # Data ---------------------------------------------------------------------- # # Task 1: Create data # Create a data structure that holds a list of your donors and a history of the amounts they have donated. # Have least five donors, with between 1 and 3 donations each, store in the global namespace. donor_info = [("Jim Zorn", [3772.32, 1201.17]), ("Jermaine Kearse", [877.33]), ("Marcus Trufant", [1563.23, 1043.87, 1.32]), ("K.J. Wright", [21663.23, 300.87, 100432.0]), ("Curt Warner", [663.23, 300.87, 10432.0]), ] # Processing --------------------------------------------------------------- # # Task 2: Menu choices # Prompt the user to choose from a menu of 3 actions: “Send a Thank You”, “Create a Report” or “quit”. ############################################### # "Menu of Choices" ############################################### def main(): ''' Menu of Choices: Thank You, Report, Create a Report :return: ''' while (True): print(""" \n**** XYZ Nonprofit Charity ****\n Menu of Options 1) Send a "Thank You" 2) Create a Report 3) Exit Program """) strChoice = str(input("Which option would you like to perform? [1 to 3] - ")) print() # added a new line for spacing looks if (strChoice.strip() == '1'): thank_you() elif (strChoice.strip() == '2'): report() elif (strChoice.strip() == '3'): exit_program() else: print("\nPlease choose only 1, 2, or 3!") ############################################### # #1 Send a "Thank You" ############################################### def thank_you(): ''' Thank You: Will append donations to existing donors, or adds new donors with donations. User can see list of existing donors by typing 'list'. Once donation is entered script will create custom thank you letter/ email. :return: ''' while (True): donor_name = input("Type 'List' to see all names in Database or\nType First and Last Name: ").title() if (donor_name.lower() == 'list'): # define format row row = "{Name:<18s}".format print("\nDONOR REGISTRY:") donor_sort = (sorted(donor_info)) for donor in donor_sort: donor_lst = (row(Name=donor[0])) print(donor_lst) input("Press Enter to Continue") print() continue if (donor_name.lower() != 'list'): donor_amount = int(input("Enter Amount of Donation: $")) # if name is in list append dollar amount to donors bucket for i in donor_info: if i[0] == donor_name: i[1].append(donor_amount) print(f"'{donor_name}' is in registry added new donation amount!") break # if name not in list add new name to donor info list else: donor_info.append((donor_name, [donor_amount])) print(f"New donor name '{donor_name}' added to registry!") # print(donor_info) - for testing break input("\nPress Enter for Thank You letter:\n") print(f'''Dear {donor_name}, Thank you for your donation of '${donor_amount}' to XYZ Nonprofit for children! It really makes a huge impact for the children in our community. Those three hours after the end of the school day can make a crucial difference in kids’ lives. Thanks to you, kids have a safe place to go after school. Instead of going home alone while their families are at work, our kids are learning to play sports, create art, and improving their grades at our Homework Help Center. All while forming friendships with peers and relationships with adult mentors and tutors. Thank you again {donor_name}, for your ongoing support of our kids! Sincerely, XYZ Nonprofit Agency Director ''') input("Press Enter to Continue") break ############################################### # #2 Create a Report ############################################### def report(): ''' Report: creates a tabular summary report of donor transactions''' while (True): # title title = "******************* XYZ Nonprofit Charity ********************\n" \ "________________________________________________________________" heading_name = ("| Donor Name:", "| Totals $:", "| #-of-Gifts:", "| Avg Gift $: ", "|") header = f"{heading_name[0].upper():<20s} {heading_name[1].upper():<13s}" \ f" {heading_name[2].upper():<6s} {heading_name[3].upper():<14s}|" print(title) print(header) #define format row row = "| {Name:<18s} | ${Total:<10.2f} | {NumbGifts:^11d} | ${AverageGifts:<10.2f} |".format for i in donor_info: print(row(Name=i[0], Total=(sum(i[1])), NumbGifts=len(i[1]), AverageGifts=sum(i[1], 0) / len(i[1]))) print("________________________________________________________________") input("Press Enter to Continue") break ############################################### # #3 Exit the Program ############################################### def exit_program(): ''' Will exit the program :return: ''' while (True): exitchoice = input("Would you like to Exit?\nEnter 'y' or 'n': ") if (exitchoice.lower() == 'y'): print("\nExiting!") sys.exit() elif (exitchoice.lower() == 'n'): main() # Main Body of Script ------------------------------------------------------ # if __name__ == '__main__': main()
995,702
e942bafe9740285f9a0f651d7e28ca89456bc902
# -*- coding: utf-8 -*- import click import logging from pathlib import Path from dotenv import find_dotenv, load_dotenv import numpy as np import pandas as pd from sklearn.datasets import make_classification from sklearn.ensemble import ExtraTreesClassifier """ Runs data cleaning scripts to turn data from (../raw) into cleaned data ready to be analyzed (saved in ../interim). This function severely lacks any type of error checking. It was built with a specific dataset in mind but with minor tweaks it should be fairly straightforward to extend these methods to any other dataset. Code for data cleaning was partly taken from https://github.com/jdills26/Tanzania-water-table and https://rstudio-pubs-static.s3.amazonaws.com/339668_006f4906390e41cea23b3b786cc0230a.html Steps in this function - Combine extraction_type, extraction_type_class and extraction_type_group """ # Hardcoded data files DATA_FILEPATH = "./data/raw/water_pump_set.csv" LABEL_FILEPATH = "./data/raw/water_pump_labels.csv" OUT_FILEPATH = "./data/interim/data_cleaned.csv" logger = logging.getLogger(__name__) logger.info('Combining extraction columns...') # Read data using pandas as simple as possible df = pd.read_csv(DATA_FILEPATH) ydat = pd.read_csv(LABEL_FILEPATH) # Reformat date and merge with labels for intermediate analyses df['date_recorded'] = pd.to_datetime(df['date_recorded']) df = pd.merge(df, ydat, on='id') # Merge by id to guarantee correct labels # Group low occuring counts together or into related groups # ignore warnings import warnings warnings.filterwarnings("ignore") # Drop columns AFTER modifying other columns # Define them here for clarity columns_to_drop = [ "recorded_by", "wpt_name", "scheme_name", "scheme_management", "extraction_type_group", "funder", "installer", # "source_class", "source_type", # Maybe we could try source_type instead. "payment", "waterpoint_type_group", "management_group", "permit", "public_meeting", # "lga", # "subvillage", "amount_tsh", #"construction_year", "num_private", "population" ] # Combine extraction type by manually combining low-occurring groups df['extraction_type'][df.extraction_type.isin(['india mark ii','india mark iii'])] = 'india mark' df['extraction_type'][df.extraction_type.isin(['cemo', 'climax'])] = 'motorpump' df['extraction_type'][df.extraction_type.isin(['other - mkulima/shinyanga','other - play pump', 'walimi'])] = 'handpump' df['extraction_type'][df.extraction_type.isin(['other - swn 81','swn 80'])] = 'swn' # Logger not working as long as this is a script and not a Python module # Will fix later! logger.info('Remove unused features from data...') #use lga column to create new feature: rural, urban, other def map_lga(x): x=str(x) if x.find('Rural') >= 0: return 'rural' if x.find('Urban') >= 0: return 'urban' return 'other' # Map rural, urban or other from the lga column df['rural_urban'] = df.lga.apply(map_lga) #use date time function in pandas df['date_recorded'] = pd.to_datetime(df['date_recorded']) # Reformat the date_recorded median_construction_year = df.construction_year[df.construction_year!=0].median() df['construction_year'] = df.construction_year.map(lambda x: median_construction_year if x == 0 else x) # Replace 0 with median df['age'] = df.date_recorded.dt.year - df.construction_year # Track lifetime of waterpump in years #remove extraction_type_group df.drop(columns_to_drop, axis=1, inplace=True) # Not logger.info but print() at least print(f"Saving cleaned feature values to %s..." % OUT_FILEPATH) df.to_csv(OUT_FILEPATH)
995,703
5f62ad61e225223abce9bbde84f06bb2f0a4a780
import io import os import os.path import struct import socket import stat import time import config import storage import database import proto.nofs_local_pb2 as nofs_local from proto.nofs_local_pb2 import * def enum_from_value(enumtype, value): for v in enumtype.values: if v.number == value: return v.name return None def read_exact(stream, nbytes): result = b"" while len(result) < nbytes: read = stream.read(nbytes - len(result)) if len(read) == 0: return b"" result += read return result class Header(object): bfmt = "=LL" bsize = struct.calcsize(bfmt) def __init__(self, pkt_type, payload_len): self.pkt_type = pkt_type self.payload_len = payload_len def to_stream(self, s): bdata = struct.pack(Header.bfmt, self.pkt_type, self.payload_len) s.write(bdata) @staticmethod def from_stream(s): bdata = read_exact(s, Header.bsize) if len(bdata) < Header.bsize: return None (pt, pl) = struct.unpack(Header.bfmt, bdata) return Header(pt, pl) def __str__(self): return "{0} ({1})".format(enum_from_value(nofs_local._MESSAGETYPE, self.pkt_type), self.payload_len) ################################ # Handlers def do_stat(fp): """try: stat_res = os.stat(fp) except OSError: print("Couldn't stat", fp) return None ctime_loc = stat_res.st_ctime ctime_utc = int(time.mktime(time.gmtime(ctime_loc))) if stat.S_ISREG(stat_res.st_mode): ftype = stat.S_IFREG elif stat.S_ISDIR(stat_res.st_mode): ftype = stat.S_IFDIR else: print("Isn't file or dir", fp) return None""" stat_res = fp.stat() rs = RespStat() rs.ftype = stat.S_IFREG rs.perms = 0 rs.inode = fp.fid rs.size = stat_res['size_bytes'] rs.ctime_utc = stat_res['dt_utc'] return rs def handle_stat(packet, wfile): #fp = os.path.join(config.DATA_DIR, packet.filepath[1:]) #sr = do_stat(fp) fp = storage.get_file(packet.filepath[1:]) if fp is None: return ERR_NOENT sr = do_stat(fp) ser = sr.SerializeToString() Header(RESP_STAT, len(ser)).to_stream(wfile) wfile.write(ser) def handle_listdir(packet, wfile): dp = os.path.join(config.DATA_DIR, packet.dirpath[1:]) print(dp) lr = RespListdir() with database.connect() as c: rows = c.execute('SELECT * FROM Files').fetchall() for f in rows: fp = storage.get_file(f[1]) sr = do_stat(fp) le = lr.entry.add() le.filename = f[1] le.stat.CopyFrom(sr) ser = lr.SerializeToString() Header(RESP_LISTDIR, len(ser)).to_stream(wfile) wfile.write(ser) def handle_read(packet, wfile): fp = storage.get_file(packet.filepath[1:]) if fp is None: return ERR_NOENT bdata = fp.read(packet.offset, packet.length) Header(RESP_READ, len(bdata)).to_stream(wfile) wfile.write(bdata) def handle_adm_addfile(packet, wfile): fname = packet.ext_filepath destdir = packet.destdir if not os.path.exists(fname): return ERR_NOENT fid = storage.store_file_ext(fname, destdir) rs = ARespAddFile() rs.fid = fid ser = rs.SerializeToString() Header(RESP_ADM_ADDFILE, len(ser)).to_stream(wfile) wfile.write(ser) pkt_type_to_type_handler = { REQ_STAT: (ReqStat, handle_stat), REQ_LISTDIR: (ReqListdir, handle_listdir), REQ_READ: (ReqRead, handle_read), REQ_ADM_ADDFILE: (AReqAddFile, handle_adm_addfile), } def handle(header, data, wfile): print(header) if header.pkt_type not in pkt_type_to_type_handler: print("Unrecognized packet type: {}".format(header.pkt_type)) error = ERR_BADPACKET else: ptype, handler = pkt_type_to_type_handler[header.pkt_type] packet = ptype() packet.ParseFromString(data) error = handler(packet, wfile) if error is not None: Header(RESP_ERROR, 4).to_stream(wfile) wfile.write(struct.pack("=l", error))
995,704
9accc4f4a287608c670a1ca6752198f590a52219
import hashlib import datetime import couchdbkit from pyramid.view import view_config from pyramid.httpexceptions import HTTPFound from pyramid.threadlocal import get_current_registry from pyramid.events import NewRequest from pyramid.events import subscriber from beaker.cache import cache_region from pygments import highlight from pygments.lexers import get_lexer_by_name from pygments.formatters import HtmlFormatter from pygments.lexers import get_all_lexers from paulla.paste.models import Paste settings = get_current_registry().settings expireChoice = {"never": None, "1day": datetime.timedelta(days=1), "1week": datetime.timedelta(days=7), "1month": datetime.timedelta(days=31) } # couchdb connection server = couchdbkit.Server(settings['couchdb.url']) db = server.get_or_create_db(settings['couchdb.db']) Paste.set_db(db) formatter = HtmlFormatter(linenos=True, full=True, cssclass="source") @view_config(route_name='home', renderer='templates/home.pt') def home(request): """ Home page. first page to be called. """ return {'lexers': lexers()} def _buildPassword(username, createdTime, password): """ Build sha1 of password. :param username: username field of paste, :param createdTime : datetime of creation the paste. :param password: password to encrypt. _buildPassword also use a salt defined in configuration file. """ if not password: return '' tmp = ''.join((username, str(createdTime).split('.')[0], password, settings['salt'])) sha1 = hashlib.sha224() sha1.update(tmp) return sha1.hexdigest() @view_config(route_name='addContent', renderer='json') def add(request): """ Adding a new content. if ok return to the oneContent page. """ username = request.POST['username'] password = '' now = datetime.datetime.now() expire = request.POST['expire'] expireDate = None if expire: delta = expireChoice[expire] if delta: expireDate = now + delta if username: password = _buildPassword(username, now, request.POST['password']) paste = Paste(title=request.POST['title'], content=request.POST['content'], created=now, typeContent=request.POST['type'], username=username, password=password, expire=expireDate) paste.save() request.session.flash(u"Add ok") # TODO translatoion return HTTPFound(request.route_path('oneContent', idContent=paste._id)) @view_config(route_name='oneContent', renderer='templates/content.pt') def content(request): """ Display a content Paste. """ paste = Paste.get(request.matchdict['idContent']) lexer = get_lexer_by_name(paste.typeContent, stripall=True) result = highlight(paste['content'], lexer, formatter) return {'paste': paste, 'content': result,} @view_config(route_name='oneContentRaw', renderer='string' ) def contentRaw(request): """ Display a raw content paste. """ paste = Paste.get(request.matchdict['idContent']) # TODO type/mime return paste.content @cache_region('short_term', 'previous') def previous(): """ Return the list of the 10 previous paste. """ try: previousPastes = Paste.view('paste/all', limit=10).all() except: previousPastes = [] return previousPastes @cache_region('long_term', 'lexers') def lexers(): """ Return the list of the pigments lexers. """ result = [(lexer[0], lexer[1][0]) for lexer in get_all_lexers()] result.sort() return result @subscriber(NewRequest) def previousEvent(event): """ subscriber of newRequest. """ event.request.previous = previous() @view_config(route_name='edit', renderer='templates/edit.pt') def edit(request): """ Edit a paste. """ paste = Paste.get(request.matchdict['idContent']) return {'lexers': lexers(), 'paste': paste,} @view_config(route_name='update') def update(request): """ Updating a paste. return to display if succed. return to edit if fail. """ paste = Paste.get(request.matchdict['idContent']) password = _buildPassword(paste.username, paste.created, request.POST['password']) if password == paste.password: paste.title = request.POST['title'] paste.content = request.POST['content'] paste.save() request.session.flash(u"Updated") # TODO translatoion return HTTPFound(request.route_path('oneContent', idContent=paste._id)) request.session.flash(u"Wrong password") # TODO translatoion return HTTPFound(request.route_path('edit', idContent=paste._id)) @view_config(route_name='deleteConfirm', renderer='templates/delete_confirm.pt') def deleteConfirm(request): """ Ask confirmation on delete. """ paste = Paste.get(request.matchdict['idContent']) if not(paste.username and paste.password): return HTTPFound(request.route_path('oneContent', idContent=paste._id)) lexer = get_lexer_by_name(paste.typeContent, stripall=True) result = highlight(paste['content'], lexer, formatter) return {'paste': paste, 'content': result,} @view_config(route_name='delete') def delete(request): """ Delete a paste. return to / if succed return to deleteConfigm is fail. """ paste = Paste.get(request.matchdict['idContent']) password = _buildPassword(paste.username, paste.created, request.POST['password']) if password == paste.password: paste.delete() request.session.flash(u"Deleted") # TODO translatoion return HTTPFound(request.route_path('home', )) request.session.flash(u"Wrong password") # TODO translatoion return HTTPFound(request.route_path('deleteConfirm', idContent=paste._id)) @view_config(route_name='rss2', renderer='templates/rss2.pt') def rss2(request): """ Yeah we have rss ! """ return {'pastes': previous()}
995,705
eacf2e57af3d54eaf300747b70774c7f83dbddfc
# -*- coding: utf-8 -*- from java.util.logging import Level from java.io import File from java.lang import Class from java.sql import DriverManager from java.sql import SQLException import os import IM_sqlitedb_android def kate(self, progressBar, kate_files): blackboardAttribute = IM_sqlitedb_android.BlackboardAttribute imdbIngestModuleFactory = IM_sqlitedb_android.IMDbIngestModuleFactory case = IM_sqlitedb_android.Case.getCurrentCase() try: artID_vk_kate = case.getSleuthkitCase().addArtifactType("TSK_CHATS_VK2", "Kate Mobile (ВКонтакте) - сообщения".decode('UTF-8')) except: artID_vk_kate = case.getSleuthkitCase().getArtifactTypeID("TSK_CHATS_VK2") try: artID_contact_kate = case.getSleuthkitCase().addArtifactType("TSK_CHATS_CONTACTS_KATE", "Kate Mobile (ВКонтакте) - контакты".decode('UTF-8')) except: artID_contact_kate = case.getSleuthkitCase().getArtifactTypeID("TSK_CHATS_CONTACTS_KATE") try: artID_wall = case.getSleuthkitCase().addArtifactType("TSK_CHATS_WALL", "Kate Mobile (ВКонтакте) - стена".decode('UTF-8')) except: artID_wall = case.getSleuthkitCase().getArtifactTypeID("TSK_CHATS_WALL") try: attID_nr = case.getSleuthkitCase().addArtifactAttributeType("TSK_MESS_ID", blackboardAttribute.TSK_BLACKBOARD_ATTRIBUTE_VALUE_TYPE.STRING, "Идентификатор сообщения".decode('UTF-8')) except: attID_nr = case.getSleuthkitCase().getAttributeType("TSK_MESS_ID") try: attID_sender = case.getSleuthkitCase().addArtifactAttributeType("TSK_MESS_OTPRAV", blackboardAttribute.TSK_BLACKBOARD_ATTRIBUTE_VALUE_TYPE.STRING, "Пользователь, отправивший сообщение".decode('UTF-8')) except: attID_sender = case.getSleuthkitCase().getAttributeType("TSK_MESS_OTPRAV") try: attID_reciever = case.getSleuthkitCase().addArtifactAttributeType("TSK_MESS_RECIEVER", blackboardAttribute.TSK_BLACKBOARD_ATTRIBUTE_VALUE_TYPE.STRING, "Пользователь, получивший сообщение".decode('UTF-8')) except: attID_reciever = case.getSleuthkitCase().getAttributeType("TSK_MESS_RECIEVER") try: attID_status = case.getSleuthkitCase().addArtifactAttributeType("TSK_MESS_STATUS", blackboardAttribute.TSK_BLACKBOARD_ATTRIBUTE_VALUE_TYPE.STRING, "Дополнительная информация".decode('UTF-8')) except: attID_status = case.getSleuthkitCase().getAttributeType("TSK_MESS_STATUS") try: attID_companion = case.getSleuthkitCase().addArtifactAttributeType("TSK_MESS_COMPANION", blackboardAttribute.TSK_BLACKBOARD_ATTRIBUTE_VALUE_TYPE.STRING, "Собеседник".decode('UTF-8')) except: attID_companion = case.getSleuthkitCase().getAttributeType("TSK_MESS_COMPANION") for file in kate_files: self.log(Level.INFO, "Processing file: " + file.getName()) lclDbPath = os.path.join(case.getTempDirectory(), str(file.getId()) + ".db") IM_sqlitedb_android.ContentUtils.writeToFile(file, File(lclDbPath)) try: Class.forName("org.sqlite.JDBC").newInstance() dbConn = DriverManager.getConnection("jdbc:sqlite:%s" % lclDbPath) stmt = dbConn.createStatement() stmt2 = dbConn.createStatement() stmt3 = dbConn.createStatement() stmt4 = dbConn.createStatement() except SQLException as e: self.log(Level.INFO, "Could not open database file (not SQLite) " + file.getName() + " (" + e.getMessage() + ")") try: resultSet = stmt.executeQuery("select message_id, (select users.last_name || ' ' || users.first_name || ' (' || messages.[account_id] || ')' from users where messages.[account_id]=users._id) as [sender_name], (select users.last_name || ' ' || users.first_name || ' (' || users._id || ')' from users where messages.uid=users._id) as [reciever_name], (select users.nickname from users where messages.uid=users._id) as [nickname], (select users.birthdate from users where messages.uid=users._id) as [rec_birthday], messages.title as [name_mess], messages.body as [text], messages.date as [date], case messages.read_state when 1 then 'Прочитано' else 'Не прочитано' end as [status1], messages.is_out as [status2] from messages order by messages.date".decode('UTF-8')) except SQLException as e: self.log(Level.INFO, "Error querying database for kate table (" + e.getMessage() + ") resultSet") try: resultSet_contacts = stmt2.executeQuery("select users.[last_name] || ' ' || users.[first_name] || ' (' || users.[_id] || ')' as [id], users.[nickname], users.[photo_medium_rec] as [photo], users.[birthdate], users.[mobile_phone], users.[home_phone], users.[status] from users order by users.[_id]") except SQLException as e: self.log(Level.INFO, "Error querying database for kate table (" + e.getMessage() + ") resultSet_contacts") try: resultSet_wall = stmt3.executeQuery("select _id, case when from_id > 0 then (select first_name || ' ' || last_name from users where users._id=wall.from_id) else 'Сообщение группы: ' || (select groups.name from groups where groups._id=wall.from_id*-1) end as [user], date, case when text='' then (select attachments.type || ': ' || case attachments.type when 'photo' then (select photos.src_big from photos where attachments.[photo_id]=photos.[photo_id]) when 'video' then (select video.[title] || ' ' || video.[image_big] from video where attachments.[video_id]=video.[video_id]) when 'link' then attachments.link_url when 'audio' then (select audio.[artist] || ' ' || audio.[title] from audio where attachments.[audio_id]=audio.[audio_id]) when 'poll' then (select poll.[question] from poll where attachments.[poll_id]=poll.[poll_id]) when 'page' then attachments.[page_title] || ' (page id:' || attachments.[page_id] || ')' when 'geo' then attachments.[geo_lat] || ', ' || attachments.[geo_lon] when 'doc' then (select docs.title || ' ' || docs.[ext] from attachments, docs where attachments.[doc_id]=docs.[doc_id]) else ' ' end from attachments where attachments.[content_id]=wall._id) else text end as [text] from wall order by date".decode('UTF-8')) except SQLException as e: self.log(Level.INFO, "Error querying database for kate table (" + e.getMessage() + ") resultSet_wall") try: resultSet_wall = stmt4.executeQuery("select _id, case when from_id > 0 then (select first_name || ' ' || last_name from users where users._id=wall.from_id) else 'Сообщение группы: ' || (select groups.name from groups where groups._id=wall.from_id*-1) end as [user], date, case when text='' then (select attachments.type || ': ' || case attachments.type when 'photo' then (select photos.src_big from photos where attachments.[photo_id]=photos.[_id]) when 'video' then (select video.[title] || ' ' || video.[image_big] from video where attachments.[video_id]=video.[video_id]) when 'link' then attachments.link_url when 'audio' then (select audio.[artist] || ' ' || audio.[title] from audio where attachments.[audio_id]=audio.[audio_id]) when 'poll' then (select poll.[question] from poll where attachments.[poll_id]=poll.[poll_id]) when 'page' then attachments.[page_title] || ' (page id:' || attachments.[page_id] || ')' when 'geo' then attachments.[geo_lat] || ', ' || attachments.[geo_lon] when 'doc' then (select docs.title || ' ' || docs.[ext] from attachments, docs where attachments.[doc_id]=docs.[_id]) else ' ' end from attachments where attachments.[content_id]=wall._id) else text end as [text] from wall order by date".decode('UTF-8')) except SQLException as e: self.log(Level.INFO, "Error querying database for kate table (" + e.getMessage() + ") resultSet_wall_2") if 'resultSet' in locals(): while resultSet.next(): try: mess_id = resultSet.getString("message_id") date = resultSet.getInt("date") sender = resultSet.getString("sender_name") mess = resultSet.getString("text") nickname = resultSet.getString("nickname") birthday = resultSet.getString("rec_birthday") name_mess = resultSet.getString("name_mess") info_arr = [] info_arr.append(resultSet.getString("reciever_name")) if nickname: info_arr.append(" (логин: ".decode('UTF-8')) info_arr.append(nickname) info_arr.append(") ".decode('UTF-8')) if birthday: info_arr.append(", День рождения: ".decode('UTF-8')) info_arr.append(birthday) reciever = ''.join(info_arr) status_arr = [] if name_mess: status_arr.append("Название переписки: \"".decode('UTF-8')) status_arr.append(name_mess) status_arr.append("\"; ".decode('UTF-8')) status_arr.append("Статус сообщения: ".decode('UTF-8')) status_arr.append(resultSet.getString("status1")) status = ''.join(status_arr) except SQLException as e: self.log(Level.INFO, "Error getting values from kate message table (" + e.getMessage() + ")") art = file.newArtifact(artID_vk_kate) art.addAttribute(blackboardAttribute(blackboardAttribute.ATTRIBUTE_TYPE.TSK_MESSAGE_TYPE, imdbIngestModuleFactory.moduleName, "Kate Mobile")) art.addAttribute(blackboardAttribute(attID_nr, imdbIngestModuleFactory.moduleName, mess_id)) art.addAttribute(blackboardAttribute(blackboardAttribute.ATTRIBUTE_TYPE.TSK_DATETIME.getTypeID(), imdbIngestModuleFactory.moduleName, date)) if resultSet.getInt("status2") == 0: art.addAttribute(blackboardAttribute(attID_sender, imdbIngestModuleFactory.moduleName, reciever)) art.addAttribute(blackboardAttribute(attID_reciever, imdbIngestModuleFactory.moduleName, sender)) else: art.addAttribute(blackboardAttribute(attID_sender, imdbIngestModuleFactory.moduleName, sender)) art.addAttribute(blackboardAttribute(attID_reciever, imdbIngestModuleFactory.moduleName, reciever)) art.addAttribute(blackboardAttribute(blackboardAttribute.ATTRIBUTE_TYPE.TSK_TEXT.getTypeID(), imdbIngestModuleFactory.moduleName, mess)) art.addAttribute(blackboardAttribute(attID_status, imdbIngestModuleFactory.moduleName, status)) IM_sqlitedb_android.IngestServices.getInstance().fireModuleDataEvent( IM_sqlitedb_android.ModuleDataEvent(imdbIngestModuleFactory.moduleName, IM_sqlitedb_android.BlackboardArtifact.ARTIFACT_TYPE.TSK_MESSAGE, None)) if 'resultSet_contacts' in locals(): while resultSet_contacts.next(): try: name = resultSet_contacts.getString("id") photo_link = resultSet_contacts.getString("photo") mobile_phone = resultSet_contacts.getString("mobile_phone") home_phone = resultSet_contacts.getString("home_phone") nickname = resultSet_contacts.getString("nickname") birthdate = resultSet_contacts.getString("birthdate") status = resultSet_contacts.getString("status") status_arr = [] if nickname: status_arr.append("Псевдоним пользователя: \"".decode('UTF-8')) status_arr.append(nickname) status_arr.append("\"; ".decode('UTF-8')) if birthdate: status_arr.append("Указанный пользователем день рождения: ".decode('UTF-8')) status_arr.append(birthdate) status_arr.append("; ".decode('UTF-8')) if status: status_arr.append("Указанный пользователем статус: ".decode('UTF-8')) status_arr.append(status) status = ''.join(status_arr) except SQLException as e: self.log(Level.INFO, "Error getting values from kate contacts table (" + e.getMessage() + ")") art = file.newArtifact(artID_contact_kate) art.addAttribute(blackboardAttribute(blackboardAttribute.ATTRIBUTE_TYPE.TSK_NAME_PERSON.getTypeID(), imdbIngestModuleFactory.moduleName, name)) art.addAttribute(blackboardAttribute(blackboardAttribute.ATTRIBUTE_TYPE.TSK_URL.getTypeID(), imdbIngestModuleFactory.moduleName, photo_link)) art.addAttribute(blackboardAttribute(blackboardAttribute.ATTRIBUTE_TYPE.TSK_PHONE_NUMBER_MOBILE.getTypeID(), imdbIngestModuleFactory.moduleName, mobile_phone)) art.addAttribute(blackboardAttribute(blackboardAttribute.ATTRIBUTE_TYPE.TSK_PHONE_NUMBER_HOME.getTypeID(), imdbIngestModuleFactory.moduleName, home_phone)) art.addAttribute(blackboardAttribute(attID_status, imdbIngestModuleFactory.moduleName, status)) IM_sqlitedb_android.IngestServices.getInstance().fireModuleDataEvent( IM_sqlitedb_android.ModuleDataEvent(imdbIngestModuleFactory.moduleName, IM_sqlitedb_android.BlackboardArtifact.ARTIFACT_TYPE.TSK_MESSAGE, None)) # wall if 'resultSet_wall' in locals(): while resultSet_wall.next(): try: post_id = resultSet_wall.getString("_id") user = resultSet_wall.getString("user") date = resultSet_wall.getInt("date") text = resultSet_wall.getString("text") except SQLException as e: self.log(Level.INFO, "Error getting values from kate wall table (" + e.getMessage() + ")") art = file.newArtifact(artID_wall) art.addAttribute(blackboardAttribute(attID_nr, imdbIngestModuleFactory.moduleName, post_id)) art.addAttribute(blackboardAttribute(attID_sender, imdbIngestModuleFactory.moduleName, user)) art.addAttribute(blackboardAttribute(blackboardAttribute.ATTRIBUTE_TYPE.TSK_DATETIME.getTypeID(), imdbIngestModuleFactory.moduleName, date)) art.addAttribute(blackboardAttribute(blackboardAttribute.ATTRIBUTE_TYPE.TSK_TEXT.getTypeID(), imdbIngestModuleFactory.moduleName, text)) IM_sqlitedb_android.IngestServices.getInstance().fireModuleDataEvent( IM_sqlitedb_android.ModuleDataEvent(imdbIngestModuleFactory.moduleName, IM_sqlitedb_android.BlackboardArtifact.ARTIFACT_TYPE.TSK_MESSAGE, None)) IM_sqlitedb_android.IMDbIngestModule.set_count(self, 1) progressBar.progress(IM_sqlitedb_android.IMDbIngestModule.get_count(self)) if kate_files.index(file) == 0: message = IM_sqlitedb_android.IngestMessage.createMessage(IM_sqlitedb_android.IngestMessage.MessageType.DATA, imdbIngestModuleFactory.moduleName, "Обнаружены базы данных: Kate Mobile (ВКонтакте)".decode('UTF-8')) IM_sqlitedb_android.IngestServices.getInstance().postMessage(message) IM_sqlitedb_android.IMDbIngestModule.set_social_app_list(self, "Kate Mobile (ВКонтакте)") try: if 'resultSet' in locals(): resultSet.close() if 'resultSet_contacts' in locals(): resultSet_contacts.close() if 'resultSet_wall' in locals(): resultSet_wall.close() stmt.close() stmt2.close() stmt3.close() stmt4.close() dbConn.close() except Exception as ex: self._logger.log(Level.SEVERE, "Error closing database", ex) self._logger.log(Level.SEVERE, IM_sqlitedb_android.traceback.format_exc()) try: os.remove(lclDbPath) except Exception as ex: self._logger.log(Level.SEVERE, "Error delete database from temp folder", ex)
995,706
ddf5009dc0e99a9ed5d72d384a77b481c5611f13
# variables that contain the user credential to access twitter api import tweepy from tweepy import OAuthHandler import json ACCESS_TOKEN = "" ACCESS_TOKEN_SECRET = "" CONUMER_KEY = "" CONSUMER_SECRET = "" #auth = OAuthHandler(CONUMER_KEY, CONSUMER_SECRET) # auth.set_access_token(ACCESS_TOKEN, #ACCESS_TOKEN_SECRET) #api = tweepy.API(auth) # def process_or_store(tweet): # print(json.dumps(tweet)) ''' for status in tweepy.Cursor(api.home_timeline).items(10): # Process a single status process_or_store(status._json) '''
995,707
41020552d0b8af16e1ca43eea2eb93721f0845fd
import numpy as np import gym import tensorflow as tf import json, sys, os import random import time from gym import wrappers log_dir= 'tmp' env_to_use = 'Pendulum-v0' # hyperparameters # game parameters env = gym.make(env_to_use) # set seeds to 0 env.seed(10) np.random.seed(10) np.set_printoptions(threshold=np.nan) outdir = 'tmp/ddpg-agent-results' env = wrappers.Monitor(env, outdir, force=True,video_callable=lambda episode_id: True) graph=tf.Graph() sess = tf.Session(graph=graph) with graph.as_default(): saver = tf.train.import_meta_graph(os.path.join(log_dir, 'pendulum-model.ckpt-800.meta')) saver.restore(sess, tf.train.latest_checkpoint(log_dir)) state_ph = tf.get_collection("state_ph")[0] actions = tf.get_collection("actions")[0] is_training_ph = tf.get_collection("is_training_ph")[0] ##################################################################################################### total_steps = 0 for ep in range(10): total_reward = 0 steps_in_ep = 0 # Initial state observation = env.reset() for t in range(1000): env.render() # choose action based on deterministic policy action_for_state, = sess.run(actions, feed_dict = {state_ph: observation[None], is_training_ph: False}) # take step next_observation, reward, done, _info = env.step(action_for_state) total_reward += reward observation = next_observation total_steps += 1 steps_in_ep += 1 if done: break print('Episode %2i,Reward: %7.3f, Steps: %i'%(ep,total_reward,steps_in_ep)) time.sleep(0.1) env.close() sess.close()
995,708
237d01b1742f28c19a2eced9f34af0a60e2bfbc7
import torch import torch.nn.functional as F from torch import nn as nn from torch.autograd import Variable SUPPORTED_METRICS = ['BCEWithLogitsLoss', 'CrossEntropyLoss', 'MSELoss', 'Accuracy'] class NewMetric: def __init__(self, params, **kwargs): super(NewMetric, self).__init__() pass def __call__(self, inputs, targets): pass class Accuracy: def __init__(self, **kwargs): pass def __call__(self, inputs, targets): inputs = F.softmax(inputs) labels = torch.argmax(inputs, dim = 1) accuracy = torch.mean((labels == targets).to(torch.double)).detach().cpu() return accuracy def get_evaluation_metric(config): """ Returns the evaluation metric function based on provided configuration :param config: (dict) a top level configuration object containing the 'eval_metric' key :return: an instance of the evaluation metric """ assert 'eval_metric' in config, 'Could not find evalvalutation metric configuration' eval_config = config['eval_metric'] name = eval_config.pop('name') if name == 'BCEWithLogitsLoss': return nn.BCEWithLogitsLoss() elif name == 'CrossEntropyLoss': return nn.CrossEntropyLoss() elif name == 'MSELoss': return nn.MSELoss() elif name == 'Accuracy': return Accuracy() else: raise RuntimeError(f"Unsupported metric function: '{name}'. Supported losses: {SUPPORTED_METRICS}")
995,709
33b677a40cadadbae0a9a1c8ed5cceeddc863472
import re import numpy as np import pandas as pd import nltk from nltk.tokenize import word_tokenize from nltk.stem import WordNetLemmatizer from nltk.corpus import stopwords stopwords_english = stopwords.words('english') # 考虑用频度阈值和停用词表进行过滤 http://www.cnblogs.com/amiza/p/10407801.html class SAOMR: def __init__(self, path='data/train.tsv', classes=5, shuffle=True): self.path = path self.classes = classes self.shuffle = shuffle self.pre_process() def shuffle_data(self): data = np.array([self.X_data, self.Y_data]).transpose(1, 0) np.random.shuffle(data) data = data.transpose(1, 0) self.X_data = data[0] self.Y_data = data[1] def data_split(self, radio=None): if radio is None: radio = [0.8, 0.2] data_size = self.X_data.shape[0] train_size = int(data_size * radio[0]) # validate_size = int(data_size * radio[1]) self.X_train = self.X_data[:train_size] self.Y_train = self.Y_one_hot[:, :train_size] self.X_validate = self.X_data[train_size:] self.Y_validate = self.Y_data[train_size:] # self.X_validate = self.X_data[train_size:train_size + validate_size] # self.Y_validate = self.Y_data[train_size:train_size + validate_size] # self.X_test = self.X_data[train_size + validate_size:] # self.Y_test = self.Y_data[train_size + validate_size:] def sen_to_bag_of_words(self, sen): res = np.zeros(self.vocab_size) for word in sen: if self.word2index.__contains__(word): res[self.word2index[word]] += 1 return res def sen_to_ngram(self, sen): res = np.zeros(self.ngram_size) res[:self.vocab_size] = self.sen_to_bag_of_words(sen) if len(sen) >= 3: for j in range(len(sen) - 2): temp = ' '.join(sen[j:j + 3]) if self.ngram2index.__contains__(temp): res[self.ngram2index[temp]] += 1 elif len(sen) >= 2: for j in range(len(sen) - 1): temp = ' '.join(sen[j:j + 2]) if self.ngram2index.__contains__(temp): res[self.ngram2index[temp]] += 1 return res def convert_to_onehot(self): Y = np.eye(self.classes)[list(self.Y_data)].T return Y def pre_process(self): df_train = pd.read_csv(self.path, sep='\t') # clean, tokenize and lemmatize df_train['Phrase'] = df_train['Phrase'].str.lower() df_train['Phrase'] = df_train['Phrase'].apply((lambda x: re.sub('[^a-zA-Z]', ' ', x))) lemmatizer = WordNetLemmatizer() words_list = [] for sen in df_train.Phrase: words = word_tokenize(sen.lower()) lemma_words = [lemmatizer.lemmatize(i) for i in words] words = [] for i in lemma_words: if i not in stopwords_english: # delete stopwords words.append(i) words_list.append(words) self.X_data = np.array(words_list) self.Y_data = np.array(df_train.Sentiment) self.shuffle_data() self.Y_one_hot = self.convert_to_onehot() self.data_split() self.vocab = set() for i in self.X_data: for j in i: self.vocab.add(j) self.vocab_size = len(self.vocab) self.word2index = {} for index, value in enumerate(self.vocab): self.word2index[value] = index ngram_2 = dict() ngram_3 = dict() for tmp in self.X_data: if len(tmp) >= 3: for j in range(len(tmp) - 2): trigram = ' '.join(tmp[j:j + 3]) if ngram_3.__contains__(trigram): ngram_3[trigram] += 1 else: ngram_3[trigram] = 1 if len(tmp) >= 2: for j in range(len(tmp) - 1): bigram = ' '.join(tmp[j:j + 2]) if ngram_2.__contains__(bigram): ngram_2[bigram] += 1 else: ngram_2[bigram] = 1 keys = set(ngram_2.keys()) for key in keys: if ngram_2[key] < 30: ngram_2.pop(key) keys = set(ngram_3.keys()) for key in keys: if ngram_3[key] < 30: ngram_3.pop(key) self.ngram = np.concatenate( (np.array(list(self.vocab)), np.array(list(ngram_2.keys())), np.array(list(ngram_3.keys()))), axis=0) # use vocab as unigram self.ngram_size = len(self.ngram) self.ngram2index = {} for index, value in enumerate(self.ngram): self.ngram2index[value] = index def get_bag_of_words(self, data): batch_size = len(data) res = np.empty([batch_size, self.vocab_size]) for i in range(batch_size): res[i] = self.sen_to_bag_of_words(data[i]) return res def get_n_gram(self, data): batch_size = len(data) res = np.empty([batch_size, self.ngram_size]) for i in range(batch_size): res[i] = self.sen_to_ngram(data[i]) return res
995,710
bbecfe66355e140492732160df209f7b65399a37
n,m = map(int, input().split()) a = [] ans = 0 a = input().split() for i in range(n): a[i] = int(a[i]) for i in range(m): b,c = map(int, input().split()) a = a + [c]*b a.sort() for i in range(n): ans += a[len(a)-i-1] print(ans)
995,711
4d5d6f8884c349c617163f85e6a09f5309c17f89
#!/usr/bin/env python """Define hooks to be run before project generation.""" import sys from slugify import slugify PROJECT_SLUG = "{{ cookiecutter.project_slug }}" PROJECT_DIRNAME = "{{ cookiecutter.project_dirname }}" def check_identifiers(): """Check if project_slug and project_dirname are valid Python identifiers.""" if not PROJECT_SLUG.isidentifier(): sys.exit(f"project_slug='{PROJECT_SLUG}' is not a valid Python identifier.") if not PROJECT_DIRNAME.isidentifier(): sys.exit( f"project_dirname='{PROJECT_DIRNAME}' is not a valid Python identifier." ) def check_slugs(): """Check if project_slug and project_dirname are a valid slugs.""" _project_slug = slugify(PROJECT_SLUG, separator="") if PROJECT_SLUG != _project_slug: sys.exit( f"project_slug='{PROJECT_SLUG}' is not a valid slug (e.g. {_project_slug})." ) _project_dirname = slugify(PROJECT_DIRNAME, separator="") if PROJECT_DIRNAME != _project_dirname: sys.exit( f"project_dirname='{PROJECT_DIRNAME}' is not a valid slug " "(e.g. {_project_dirname})." ) def main(): """Execute intialization checks before project generation.""" check_slugs() check_identifiers() if __name__ == "__main__": main()
995,712
b01cd8d40699a81c62b461685a4b4efaeff4b12c
class BonusFact: def __init__(self, player, bonus): self.player_id = player.PlayerID self.description = bonus.Identifier self.product_id = bonus.ProductID self.currency = bonus.Currency self.value = bonus.Value self.activity_time = bonus.TransactionDate def to_csv(self): return [self.player_id, self.description, self.product_id, self.currency, self.value, self.activity_time] def to_csv_with_mappings(self): return [self.description, self.product_id, self.currency, self.value, self.activity_time, self.player_id] @staticmethod def get_headers(): return ["description", "product_id", "currency", "value", "activity_time", "player_id"] class FreeSpinFact: def __init__(self, player, free_spin): self.player_id = player.PlayerID self.description = free_spin.Identifier self.number_of_free_spin = free_spin.Value self.activity_date = free_spin.TransactionDate def to_csv_with_mappings(self): return [self.description, self.number_of_free_spin, self.activity_date, self.player_id] def to_csv(self): return [self.player_id, self.description, self.number_of_free_spin, self.activity_date] @staticmethod def get_headers(): return ["description", "free_spin_number", "activity_time", "player_id"]
995,713
5533b09a2be4e6c22649000a166028efbb4e8659
#!/usr/bin/env python3 import sys import os sys.path.append('../modules') import numpy as np import matplotlib.pyplot as plt import raytracing as rt import visualize as vis import ray_utilities if __name__ == '__main__': # Constants image_plane = -1e6 # Image plane from first lens fs = 100 # System focal length aperture = 25.4 # Diameter of each mirror npoints = 3 # Number of scene points ymax = 1e5 # Size of imaging area ymin = -1e5 nrays = 10 # Number of rays per scene point lmb = 500 # Design wavelength # Create a scene scene = np.zeros((2, npoints)) scene[0, :] = image_plane scene[1, :] = np.linspace(ymin, ymax, npoints) components = [] # Add a concave mirror components.append(rt.SphericalMirror(f=fs, aperture=aperture, pos=[0, 0], theta=0)) # Place a detector just on the focal plane of the mirror components.append(rt.Sensor(aperture=aperture, pos=[-fs, 0], theta=np.pi)) # Get initial rays [rays, ptdict, colors] = ray_utilities.initial_rays(scene, components[0], nrays) # Color code the rays emanating from each scene point colors = ['b']*nrays + ['g']*nrays + ['r']*nrays # Create a new canvas canvas = vis.Canvas(xlim=[-2*fs, 5], ylim=[-aperture, aperture], figsize=[12, 12]) ray_bundles = rt.propagate_rays(components, rays, lmb) canvas.draw_rays(ray_bundles, colors) # Draw the components canvas.draw_components(components) # Show the canvas canvas.show()
995,714
2a310859ce9c1897580fce000e068cd243a88f7f
#!/usr/bin/python import subprocess import sys def run_command(command): p = subprocess.Popen(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.STDOUT) for line in p.stdout.readlines(): print line retval = p.wait() def get_backup_name(file): fileHandle = open(file, "r") lineList = fileHandle.readlines() fileHandle.close() lastLineIndex = len(lineList)-1 if lineList[lastLineIndex].isspace(): lastLineIndex -= 1 words = lineList[lastLineIndex].split() return words[2] if '/data/bahmni-backup/' in open('/etc/bahmni-backrest.conf').read(): print "bahmni-backrest.conf must point all backups to /data/bahmni-backup/" else: print "/etc/bahmni-backrest.conf is not updated to point the backups to /data/bahmni-backup/" sys.exit(1) print "Taking backup, please wait..." run_command("bahmni -i local backup --backup_type=all --options=all") openmrs_backup = get_backup_name("/data/bahmni-backup/openmrs/backup_info.txt") reports_backup = get_backup_name("/data/bahmni-backup/reports/backup_info.txt") postgres_backup = get_backup_name("/data/bahmni-backup/postgres/backup_info.txt") print "The openmrs backup name is: ", openmrs_backup print "The reports backup name is: ", reports_backup print "The postgres backup name is: ", postgres_backup backupfile = "/data/%s-bahmni-backup.tar.gz" % openmrs_backup tar_cmd = "cd /data;tar -czf %s bahmni-backup/*" % backupfile run_command(tar_cmd) print "Created backup file", backupfile
995,715
aa20e342f87ee6e8f0a3751af1a504302a38fad7
#!/usr/bin/env python # coding=utf-8 import numpy as np import os import shutil import sys from cv_bridge import CvBridge, CvBridgeError import cv2 import rospy from sensor_msgs.msg import Image from std_msgs.msg import String Nshot = 50 image_path = "/home/nizar/Images/tpROS/" def mse(imageA, imageB): # the 'Mean Squared Error' between the two images is the # sum of the squared difference between the two images; # NOTE: the two images must have the same dimension err = np.sum((imageA.astype("float") - imageB.astype("float")) ** 2) err /= float(imageA.shape[0] * imageA.shape[1]) # return the MSE, the lower the error, the more "similar" # the two images are return err def init(): if not os.path.isdir(image_path): os.mkdir(image_path, 777) else: shutil.rmtree(image_path) os.mkdir(image_path) l = [] for i in range(Nshot): c = [] l.append(c) for j in range(Nshot): l[i].append(0) def compare_images(imageA, imageB, title): # compute the mean squared error and structural similarity # index for the images m = mse(imageA, imageB) # print "MSE : "+ str(m) return m class image_converter: def __init__(self): self.i = 0 self.x = int(Nshot / 2) self.y = int(Nshot / 2) self.bridge = CvBridge() # self.image_sub = rospy.Subscriber("ardrone/front/image_raw",Image,self.callback) self.image_sub = rospy.Subscriber("/usb_cam/image_raw", Image, self.callback) self.pub_pos = rospy.Publisher("position", String, queue_size=10) def whereiam(self, current_image): score = {} for (dirpath, dirnames, filenames) in os.walk(image_path): for file in filenames: img_tmp = os.path.join(dirpath, file) image_tmp = cv2.imread(img_tmp) score[file] = compare_images(current_image, image_tmp, "compares les") res = min(score.values()) if res > 12000: return False else: coord = score.get for name, pourcentage in score.iteritems(): if pourcentage == res: return name def callback(self, data): try: cv_image = self.bridge.imgmsg_to_cv2(data, "bgr8") except CvBridgeError as e: print(e) cv2.imshow("cam de merde", cv_image) if self.i == 0: cv2.imwrite(image_path + str(self.x) + "_" + str(self.y) + ".jpg", cv_image) self.i += 1 # RETOURNE L'IMAGE À LAQUELLE ON RESSEMBLE LE PLUS OU FALSE res = self.whereiam(cv_image) # cas d'une image inconnue if not res and self.i < Nshot: self.i += 1 # ajouter les bonnes coordonné avec l'imu res = "/new_image" + str(self.i) + ".jpg" print "inconnue " + str(res) cv2.imwrite(image_path + res, cv_image) # publication du nom de l'image dans laquelle on est .... self.pub_pos.publish(str(res)) # print res k = cv2.waitKey(20) def main(args): init() ic = image_converter() rospy.init_node('image_converter', anonymous=True) try: rospy.spin() except KeyboardInterrupt: print("Shutting down") cv2.destroyAllWindows() if __name__ == '__main__': main(sys.argv)
995,716
f2bf2c6e2549deb323e5ed753ccce4a39f8e97ae
from bson.objectid import ObjectId class Clients: def __init__(self, db): self.db = db self.clients = [] def list(self): return self.db.find() def find_by_criteria(self, criteria): clients = self.db.find(criteria) return clients def find_by_id(self, client_id): client = self.db.find({'_id': ObjectId(client_id)}) return client def find_by_name(self, name): clients = self.db.find({'lastname': name}) return clients def find_by_company(self, company): clients = self.db.find({'company': company}) return clients def find_by_state(self, state): clients = self.db.find({'state': state}) return clients def add(self, client): res = self.db.insert_one(client) if res.inserted_id: return True else: return False def update(self, client_id, client_updated): res = self.db.update({'_id': ObjectId(client_id)}, {"$set": client_updated}, upsert=False) return res['nModified'] > 0 def delete(self, client_id): client = self.db.delete_one({'_id': ObjectId(client_id)}) return client.deleted_count == 1 def delete_all(self): self.db.remove({})
995,717
b8038d21ba2c48ec2fd61eca7f33bf95c9f15f4d
from cpp_parameters import * # Testing correct and incorrect parameter counts being passed (kwargs and non-kwargs) # Note that the implementation depends a lot on whether zero, one, two or more args are being wrapped def is_python_fastproxy(): """Return True if SWIG is generating Python code using -fastproxy.""" import cpp_parameters # Note: _swig_new_instance_method is only generated when using -fastproxy return hasattr(cpp_parameters, "_swig_new_instance_method") # Zero parameters expected x = Zero() try: x = Zero(z=0) raise RuntimeError("Missed throw") except TypeError: pass try: x = Zero(0) raise RuntimeError("Missed throw") except TypeError: pass try: x.zero(z=0) raise RuntimeError("Missed throw") except TypeError: pass try: x.zero(0) raise RuntimeError("Missed throw") except TypeError: pass try: Zero.stat_zero(z=0) raise RuntimeError("Missed throw") except TypeError: pass try: Zero.stat_zero(0) raise RuntimeError("Missed throw") except TypeError: pass try: global_zero(z=0) raise RuntimeError("Missed throw") except TypeError: pass try: global_zero(0) raise RuntimeError("Missed throw") except TypeError: pass # One mandatory parameter expected x = One(1) try: x = One(a=1, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: x = One(1, 0) raise RuntimeError("Missed throw") except TypeError: pass try: x.one(a=1, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: x.one(1, 0) raise RuntimeError("Missed throw") except TypeError: pass try: One.stat_one(a=1, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: One.stat_one(1, 0) raise RuntimeError("Missed throw") except TypeError: pass try: global_one(a=1, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: global_one(1, 0) raise RuntimeError("Missed throw") except TypeError: pass # Two mandatory parameters expected x = Two(1, 2) try: x = Two(a=1, b=2, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: x = Two(1, 2, 0) raise RuntimeError("Missed throw") except TypeError: pass try: x.two(a=1, b=2, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: x.two(1, 2, 0) raise RuntimeError("Missed throw") except TypeError: pass try: Two.stat_two(a=1, b=2, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: Two.stat_two(1, 2, 0) raise RuntimeError("Missed throw") except TypeError: pass try: global_two(a=1, b=2, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: global_two(1, 2, 0) raise RuntimeError("Missed throw") except TypeError: pass # Single optional parameter expected x = Single(1) try: x = Single(a=1, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: x = Single(1, 0) raise RuntimeError("Missed throw") except TypeError: pass try: x.single(a=1, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: x.single(1, 0) raise RuntimeError("Missed throw") except TypeError: pass try: Single.stat_single(a=1, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: Single.stat_single(1, 0) raise RuntimeError("Missed throw") except TypeError: pass try: global_single(a=1, z=0) raise RuntimeError("Missed throw") except TypeError: pass try: global_single(1, 0) raise RuntimeError("Missed throw") except TypeError: pass # Test that -builtin option throws TypeError if kwargs are used even when they look like they should work, kwargs are not supported unless using -keyword. # Also same for -fastproxy option except that kwargs are supported by default for constructors. TODO: Fix inconsistency. if is_python_builtin() or is_python_fastproxy(): # One mandatory parameter in API x = One(1) if is_python_fastproxy(): x = One(a=1) else: try: x = One(a=1) raise RuntimeError("Missed throw") except TypeError: pass try: x.one(a=1) raise RuntimeError("Missed throw") except TypeError: pass try: One.stat_one(a=1) raise RuntimeError("Missed throw") except TypeError: pass try: global_one(a=1) raise RuntimeError("Missed throw") except TypeError: pass # Two mandatory parameters in API x = Two(1, 2) if is_python_fastproxy(): x = Two(a=1, b=2) else: try: x = Two(a=1, b=2) raise RuntimeError("Missed throw") except TypeError: pass try: x.two(a=1, b=2) raise RuntimeError("Missed throw") except TypeError: pass try: Two.stat_two(a=1, b=2) raise RuntimeError("Missed throw") except TypeError: pass try: global_two(a=1, b=2) raise RuntimeError("Missed throw") except TypeError: pass # Single optional parameter in API x = Single(1) if is_python_fastproxy(): x = Single(a=1) else: try: x = Single(a=1) raise RuntimeError("Missed throw") except TypeError: pass try: x.single(a=1) raise RuntimeError("Missed throw") except TypeError: pass try: Single.stat_single(a=1) raise RuntimeError("Missed throw") except TypeError: pass try: global_single(a=1) raise RuntimeError("Missed throw") except TypeError: pass else: # Non-builtin should work as expected # One mandatory parameter in API x = One(a=1) x.one(a=1) One.stat_one(a=1) global_one(a=1) # Two mandatory parameters in API x = Two(a=1, b=2) x.two(a=1, b=2) Two.stat_two(a=1, b=2) global_two(a=1, b=2) # Single optional parameter in API x = Single(a=1) x.single(a=1) Single.stat_single(a=1) global_single(a=1)
995,718
82109f7a4ad6d7a665692e5ce44b6586ece0b2d6
import random class Letters(object): """Getting random letters and reutning them""" def __init__(self,owning_letters): self.owning_letters=owning_letters def having_letters(self): """Letters checked and added based on previous word :returns list""" self.letter=[chr(c) for c in range(97, 123)] self.owning_letters=list() i=0 while i<7: temp=random.choice(self.letter) if temp not in self.owning_letters: self.owning_letters.append(temp) i+=1 else: continue return self.owning_letters def skip(self): """If person cant find a word with letters he is having he can can to chane his letter :returns list""" self.owning_letters=list() for _ in range(7): self.owning_letters.append(random.choice(self.letter)) return self.owning_letters
995,719
a90330b71ffb41dbdd90aad1abef51318983bcde
# -*- coding: utf-8 -*- """ Created on Mon Jul 29 04:56:49 2019 @author: Ayush """ #Libraries import numpy as np import matplotlib.pyplot as plt import pandas as pd #Dataset dataset= pd.read_csv('Ads_CTR_Optimisation.csv') #Implement thompsons import random N=10000 d=10 ads_selected=[] number_of_rewards_1=[0]*d number_of_rewards_0=[0]*d total_rewards=0 for n in range(0,N): ad=0 max_random=0 for i in range(0,d): random_beta=random.betavariate(number_of_rewards_1[i]+1,number_of_rewards_0[i]+1) if random_beta>max_random: max_random=random_beta ad=i ads_selected.append(ad) reward=dataset.values[n,ad] if reward ==1: number_of_rewards_1[ad]=number_of_rewards_1[ad]+1 else: number_of_rewards_0[ad]=number_of_rewards_0[ad]+1 total_rewards=total_rewards+reward #Visualise plt.hist(ads_selected) plt.show()
995,720
5d86361c8bb4ab72f6bec3af61dc066525c2eb32
#!/usr/bin/env python from __future__ import division, absolute_import, print_function """ This is the unittest for the Efficient/Sequential Elementary Effects module. python -m unittest -v test_eee.py python -m pytest --cov pyeee --cov-report term-missing -v tests/ """ import unittest # -------------------------------------------------------------------- # eee.py # Missing coverage: # 181-184: ImportError MPI # 204: crank!=0 <- MPI # 230-250: mask # 276-279: weight # 339-371: plotfile # 383-385: logfile # 391: return after step4 # 415-418: weight # 445: return after step6 # 459: logfile # 470-473: weight # 483-489: logfile # 494-509: no more parameters after screening # 515: mask # 524-526: logfile class TestEee(unittest.TestCase): def setUp(self): import numpy as np # seed for reproducible results seed = 1234 np.random.seed(seed=seed) self.ntfirst = 10 self.ntlast = 5 self.nsteps = 6 self.verbose = 1 # G function def test_eee_g(self): from functools import partial import numpy as np from pyeee import eee from pyeee.utils import func_wrapper from pyeee.functions import G # Function and parameters func = G npars = 6 params = [78., 12., 0.5, 2., 97., 33.] # G # Partialise function with fixed parameters arg = [params] kwarg = {} obj = partial(func_wrapper, func, arg, kwarg) # Screening lb = np.zeros(npars) ub = np.ones(npars) out = eee(obj, lb, ub, mask=None, ntfirst=self.ntfirst, ntlast=self.ntlast, nsteps=self.nsteps, processes=1) # Check self.assertEqual(list(np.where(out)[0]+1), [2, 3, 4, 6]) # Gstar function with different interactions def test_see_gstar(self): from functools import partial import numpy as np from pyeee import eee, see from pyeee.utils import func_wrapper from pyeee.functions import Gstar # Function and parameters func = Gstar npars = 10 params = [[[1]*npars, np.random.random(npars), [0., 0., 9., 9., 9., 9., 9., 9., 9., 9.]], # G* [np.ones(npars), np.random.random(npars), [0., 0.1, 0.2, 0.3, 0.4, 0.8, 1., 2., 3., 4.]], [np.ones(npars)*0.5, np.random.random(npars), [0., 0., 9., 9., 9., 9., 9., 9., 9., 9.]], [np.ones(npars)*0.5, np.random.random(npars), [0., 0.1, 0.2, 0.3, 0.4, 0.8, 1., 2., 3., 4.]], [np.ones(npars)*2.0, np.random.random(npars), [0., 0., 9., 9., 9., 9., 9., 9., 9., 9.]], [np.ones(npars)*2.0, np.random.random(npars), [0., 0.1, 0.2, 0.3, 0.4, 0.8, 1., 2., 3., 4.]] ] iiout = [[1, 2, 3, 8, 9], [1, 2, 3, 4, 5, 6, 7, 8], [1, 2, 3, 7, 10], [1, 2, 3, 4, 5, 6, 7, 8, 9, 10], [1, 2, 3, 4, 5, 6, 7, 8, 9, 10], [1, 2, 3, 4, 5, 7] ] lb = np.zeros(npars) ub = np.ones(npars) for ii in range(len(params)): # Partialise function with fixed parameters arg = params[ii] kwarg = {} obj = partial(func_wrapper, func, arg, kwarg) out = see(obj, lb, ub, mask=None, ntfirst=self.ntfirst, ntlast=self.ntlast, nsteps=self.nsteps, processes=1, verbose=1) #, plotfile='gstar'+str(ii)+'.png') # Check self.assertEqual(list(np.where(out)[0]+1), iiout[ii]) # Bratley / K function def test_eee_k(self): from functools import partial import os import numpy as np import schwimmbad from pyeee import eee from pyeee.utils import func_wrapper from pyeee.functions import bratley # Function and parameters func = bratley npars = 10 params = [] # k # Screening lb = np.zeros(npars) ub = np.ones(npars) nprocs = 4 ipool = schwimmbad.choose_pool(mpi=False, processes=nprocs) out = eee(func, lb, ub, mask=None, ntfirst=self.ntfirst, ntlast=self.ntlast, nsteps=self.nsteps, processes=nprocs, pool=ipool, logfile='tlog.txt') ipool.close() # Check self.assertEqual(list(np.where(out)[0]+1), [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]) self.assertTrue(os.path.exists('tlog.txt')) # Clean if os.path.exists('tlog.txt'): os.remove('tlog.txt') # Morris function def test_eee_fmorris(self): from functools import partial import os import numpy as np from pyeee import eee from pyeee.utils import func_wrapper from pyeee.functions import fmorris # Function and parameters func = fmorris npars = 20 beta0 = 0. beta1 = np.random.standard_normal(npars) beta1[:10] = 20. beta2 = np.random.standard_normal((npars,npars)) beta2[:6,:6] = -15. beta3 = np.zeros((npars,npars,npars)) beta3[:5,:5,:5] = -10. beta4 = np.zeros((npars,npars,npars,npars)) beta4[:4,:4,:4,:4] = 5. # Partialise Morris function with fixed parameters beta0-4 arg = [beta0, beta1, beta2, beta3, beta4] kwarg = {} obj = partial(func_wrapper, func, arg, kwarg) # Screening lb = np.zeros(npars) ub = np.ones(npars) # Check ff = open('tlog.txt', 'w') out = eee(obj, lb, ub, mask=None, ntfirst=self.ntfirst, ntlast=self.ntlast, nsteps=self.nsteps, processes=4, logfile=ff, verbose=1) ff.close() self.assertEqual(list(np.where(out)[0]+1), [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 14, 15, 20]) self.assertTrue(os.path.exists('tlog.txt')) # Clean if os.path.exists('tlog.txt'): os.remove('tlog.txt') if __name__ == "__main__": unittest.main()
995,721
1d4336f387c2030ead17b7dff957b4660cb963ec
# Generated by Django 3.2.8 on 2021-10-31 12:47 from django.db import migrations, models import uuid class Migration(migrations.Migration): dependencies = [ ('domain_user', '0005_auto_20211031_1810'), ] operations = [ migrations.AlterField( model_name='domain', name='domain_key', field=models.UUIDField(default=uuid.uuid4, primary_key=True, serialize=False, unique=True), ), ]
995,722
109933b184cd6c89dba07b3483202ff6aec4c360
''' Print distance distributions of each trip segment ''' from sys import argv import pandas as pd import matplotlib matplotlib.use('Agg') import matplotlib.pyplot as plt from statsmodels.distributions.empirical_distribution import ECDF matches_path = argv[1] result_path = argv[2] # read and transform df_matches = pd.read_csv(matches_path) df_matches['taxi_arrival_time_transit_stop'] = pd.to_datetime(df_matches['taxi_arrival_time_transit_stop']) df_matches['transit_destination_time'] = pd.to_datetime(df_matches['transit_destination_time']) df_matches['taxi_destination_time'] = pd.to_datetime(df_matches['taxi_destination_time']) # get distances list_integration_distance = [] list_shared_distance = [] # list_taxi_private = [] # list_transit_private = [] list_destinations_distance = [] for index, match in df_matches.iterrows(): total_distance = match['integration_distance'] + match['shared_distance'] + match['destinations_distance'] list_integration_distance.append(match['integration_distance']/total_distance) list_shared_distance.append(match['shared_distance']/total_distance) list_destinations_distance.append(match['destinations_distance']/total_distance) # if match['transit_destination_time'] > match['taxi_destination_time']: # list_transit_private.append(match['destinations_distance']/total_distance) # list_taxi_private.append(0) # else: # list_transit_private.append(0) # list_taxi_private.append(match['destinations_distance']/total_distance) # plot list_integration_distance.sort() list_shared_distance.sort() # list_taxi_private.sort() # list_transit_private.sort() list_destinations_distance.sort() ecdf_integration_distance = ECDF(list_integration_distance) ecdf_shared_distance = ECDF(list_shared_distance) # ecdf_taxi_private = ECDF(list_taxi_private) # ecdf_transit_private = ECDF(list_transit_private) ecdf_destinations_distance = ECDF(list_destinations_distance) fig, ax = plt.subplots() plt.plot(ecdf_integration_distance.x, ecdf_integration_distance.y, label='integration distance') plt.plot(ecdf_shared_distance.x, ecdf_shared_distance.y, label='shared distance') # plt.plot(ecdf_taxi_private.x, ecdf_taxi_private.y, label='taxi private') # plt.plot(ecdf_transit_private.x, ecdf_transit_private.y, label='transit private') plt.plot(ecdf_destinations_distance.x, ecdf_destinations_distance.y, label='destinations distance') # ax.xaxis.set_major_locator(ticker.MultipleLocator(20)) # set x sticks interal plt.grid() plt.legend() # ax.set_title('saturday') ax.set_xlabel('segment distance / total shared distance') ax.set_ylabel('ECDF') plt.tight_layout() fig.savefig(result_path)
995,723
7ed9fc4f962cfc46881a0d4e07f2366cee6697b6
import numpy as np from sklearn.linear_model import LinearRegression from sklearn.preprocessing import PolynomialFeatures from sklearn.metrics import mean_squared_error import matplotlib.pyplot as plt colors = plt.cm.cool def error_sum(pred, y_test): e = [] for i in range(len(pred)): e.append((y_test[i] - pred[i])**2) return np.asarray(e).sum() X_train = np.load("regression/regression_Xtrain.npy") y_train = np.load("regression/regression_ytrain.npy") X_test = np.load("regression/regression_Xtest.npy") y_test = np.load("regression/regression_ytest.npy") Linear_regression = LinearRegression() Linear_regression.fit(X_train.reshape(-1, 1), y_train) prediction = Linear_regression.predict(X_test.reshape(-1, 1)) plt.title("Data Visualization") plt.scatter(X_train, y_train, label="Train Data", c="red", cmap=colors) plt.scatter(X_test, y_test, label="Test Data", c="blue", cmap=colors) plt.legend() plt.savefig("../plot/00.png") plt.show() print("MSE : " + str(mean_squared_error(y_test, prediction))) plt.title("Linear regression") plt.plot(X_test, prediction, label="Model Prediction") plt.scatter(X_test, y_test, label="Training Data") plt.legend() plt.savefig("../plot/plot/0.png") plt.show() mean_square_error = np.zeros((9, 1)) x_range = np.linspace(-1, 5.5, 50).reshape(-1, 1) mean_square_error[0] = mean_squared_error(y_test, prediction) list_square_prediction = [] plt.figure(figsize=(16, 12)) for j in range(1, 10): poly = PolynomialFeatures(degree=j, include_bias=False) polynomial_X_train = poly.fit_transform(X_train.reshape(-1, 1)) Polynomial_Regression = LinearRegression() Polynomial_Regression.fit(polynomial_X_train, y_train) polynomial_test = poly.fit_transform(X_test.reshape(-1, 1)) prediction_poly = Polynomial_Regression.predict(polynomial_test) plt.subplot(4, 3, j) plt.title("Polynomial degree " + str(j) + " ") plt.plot(X_test, prediction_poly, label="Model prediction") plt.scatter(X_test, y_test, c='r', label="Training Data") mean_square_error[j - 1] = mean_squared_error(y_test, prediction_poly) #print("Squared prediction errors for all n data points : "+str(error_sum(prediction_poly,y_test))) list_square_prediction.append(error_sum(prediction_poly, y_test)) plt.legend() plt.savefig("../plot/2.png") plt.show() plt.title("Mean Square error over polynomial degree") plt.plot(np.linspace(1, 9, 9).reshape(-1, 1), mean_square_error) plt.savefig("../plot/3.png") plt.show() # for i in range(len(list_square_prediction)): # print("Polynomial degree "+str(i+1)+" - Squared prediction error : "+str(list_square_prediction[i])) for i in range(len(mean_square_error)): print("Polynomial degree " + str(i + 1) + " - Mean Squared prediction error : " + str(mean_square_error[i]))
995,724
e96c34904df19459b317eef2a3f4095e6997924e
from django.urls import path from django.conf.urls import url, include from . import views from . import utils urlpatterns = [ path('add/', views.add_factoid, name='add_factoid'), path('random/', utils.random_factoid, name='random_factoid'), path('user/', views.factoids_list, name='factoids_list'), path('<int:id>/', views.factoid_detail, name='factoid_detail'), path('<int:id>/delete/', views.delete_factoid, name='delete_factoid') ]
995,725
010a0f6ee066ea8bd101251dedc164b2ab7557fa
from django.shortcuts import render # Create your views here. def home_view(request): return render(request,'testapp/home.html') def educ_view(request): return render(request,'testapp/edu.html') def poli_view(request): return render(request,'testapp/polit.html') def sprt_view(request): return render(request,'testapp/sport.html')
995,726
421cf573786b2c6924a695914f979e0935875829
from typing import List class Solution: def rotate(self, nums: List[int], k: int) -> None: """ 方法一:使用一个新数组存储交换位置以后的数据,再覆盖原数组 """ k %= len(nums) if k == 0: return new_nums = nums[-k:] + nums[:-k] for i in range(len(nums)): nums[i] = new_nums[i] def rotate2(self, nums: List[int], k: int) -> None: """ 方法二:暴力旋转 """ k %= len(nums) if k == 0: return for i in range(k): fill = nums[len(nums) - 1] for j in range(len(nums)): fill, nums[j] = nums[j], fill def rotate3(self, nums: List[int], k: int) -> None: """ 方法三:多次反转 """ k %= len(nums) if k == 0: return self.rev(nums, 0, len(nums) - 1) self.rev(nums, 0, k - 1) self.rev(nums, k, len(nums) - 1) def rev(self, nums: List[int], start: int, end: int) -> None: while start < end: nums[start], nums[end], start, end = nums[end], nums[start], start + 1, end - 1
995,727
f3c72f955293fd4ca0c48b1a7bf40c9d08e7e37c
from ray import Ray from vector import Vector class Camera: def __init__(self): self.lowerLeftCorner = Vector(-2.0, -1.0, -1.0) self.horizontal = Vector(4.0, 0.0, 0.0) self.vertical = Vector(0.0, 2.0, 0.0) self.origin = Vector(0.0, 0.0, 0.0) def getRay(self, u, v): direction = self.lowerLeftCorner + self.horizontal.multiply_scalar(u) direction = direction + self.vertical.multiply_scalar(v) - self.origin return Ray(self.origin, direction)
995,728
e61d3486265d7520a6beebf120b8a0ab16962768
import numpy import math import cmath def detect_coefficient(X,RATE,FREQ): s_prev=0 s_prev2=0 norm_freq=FREQ*1./RATE coeff=math.cos(2*math.pi*norm_freq) for x in X: s=x/32768.+2*coeff*s_prev-s_prev2 s_prev2=s_prev s_prev=s return s_prev2**2+s_prev**2-2*coeff*s_prev*s_prev2 def approx_coeff(X,RATE,FREQ): out=[] for i in range(-2,2): out.append(detect_coefficient(X,RATE,FREQ+i*2)) return max(out) def DTMF(X,RATE): freqs=[697,778,852,941,1209,1336,1477,1633] r=[approx_coeff(X,RATE,freqs[i]) for i in range(len(freqs))] row_col_ascii_codes = [["1","2","3","A"],["4","5","6","B"],["7","8","9","C"],["*","0","#","D"]] maxval=0.0 row=0 col=0 see_digit=0 max_index=0 t=0 i=0 for i in range(4): if r[i]>maxval: maxval=r[i] row=i for i in range(4,8): if r[i]>maxval: maxval=r[i] col = i if True: see_digit=True if r[col]>r[row]: max_index = col if r[row]< (r[col]*0.016): see_digit=False else: max_index=row if r[col]< (r[row]*0.016): see_digit=False peak_count=0 if r[max_index]>1.0e9: t = r[max_index]*0.063 else: t = r[max_index] * 0.063 for i in range(8): if r[i]>t: peak_count+=1 if peak_count>2: see_digit=False if see_digit: return row_col_ascii_codes[row][col-4] return None
995,729
8be89f62e69b3c768ebf590c2cc454cc52730b95
from collections import deque def rotate(magnetic, direction): if direction == 1: tmp = gears[magnetic].pop() gears[magnetic].appendleft(tmp) elif direction == -1: tmp = gears[magnetic].popleft() gears[magnetic].append(tmp) def cal(curmag, exmag, flow): curmagcheck = 6 exmagcheck = 2 if flow == 1: curmagcheck = 2 exmagcheck = 6 if gears[curmag][curmagcheck] != gears[exmag][exmagcheck]: if magdirection[exmag] == 1: magdirection[curmag] = -1 else: magdirection[curmag] = 1 return 0 return 1 T = int(input()) for tc in range(1, T+1): K = int(input()) gears = [deque(list(map(int, input().split()))) for _ in range(4)] result = 0 for _ in range(K): mag, direction = map(int, input().split()) mag -= 1 magdirection = [0] * 4 magdirection[mag] = direction for curmagidx in range(mag-1, -1, -1): exmagidx = curmagidx + 1 if cal(curmagidx, exmagidx, 1): break for curmagidx in range(mag+1, 4): exmagidx = curmagidx - 1 if cal(curmagidx, exmagidx, 0): break for ro in range(4): rotate(ro, magdirection[ro]) for idx, mag in enumerate(gears): if mag[0] == 1: result += 2 ** idx print('#{} {}'.format(tc, result))
995,730
1f21e0ebd16d9a90a3b49abd9b2bdc67fa8662a0
from src import Props as props import random as rng import numpy as np def AddProps(system): wall_angle = 90 + np.rad2deg(-np.arctan(211/1380-0.05)) props.MIT_door(system, [-5, 3.3, 8.22]) props.MIT_door(system, [13.49,3.3, 1.2], wall_angle) props.MIT_door(system, [14.48, 3.3, -8.5], wall_angle) props.MIT_door(system, [13.04, 6.6, 5.5], wall_angle) props.MIT_door(system, [14.48, 6.6, -8.5], wall_angle) props.MIT_door(system, [7.25, 3.3, 12.22]) props.MIT_door(system, [7.25, 6.6, 12.22]) props.MIT_door(system, [13.6, 3.3, 12.22]) props.MIT_door(system, [17.6, 3.3, 12.22]) # Marks global origin # props.sodacan(system, [0,0,0], 'schrodbull.png') props.painting(system, [13.8,2.0,-2], 'DemoBengan.png', wall_angle) props.painting(system, [13.94,1.8,-3.35], 'bungeebengan_notes.png', wall_angle, [0.2,0.27]) props.painting(system, [6.46,5.0,10], 'infoboard.jpg', -90, [0.85/2, 1.46/2]) props.painting(system, [13.34,2.0,2.2], 'floorinfo2.jpg', wall_angle, [0.6,0.66]) props.painting(system, [12.84,5.1,7.1], 'corkboard.jpg', wall_angle, [1.0,0.5]) props.painting(system, [13.047,5.1,5.1], 'corkboard.jpg', wall_angle, [1.0,0.5]) props.painting(system, [13.77,5.1,-1.9], 'corkboard.jpg', wall_angle, [1.0,0.5]) props.painting(system, [13.977,5.1,-3.9], 'corkboard.jpg', wall_angle, [1.0,0.5]) # props.painting(system, [-3.5,2.1,5], 'walkplanck.png', 0, [0.8,0.6]) props.pokeball(system, [1.75,0.85,-7.15], 0) props.sodacan(system, [1.25,0.85,-7.05], 'schrodbull.png', 180) props.sodacan(system, [4.25,0.85,-7.25], 'joultcola.png') # props.coin(system, [1.65,0.85,-7.25]) s = 1.15 # scale due to high roof props.painting(system, [1.0, 5.0, 8.18], 'black_painting_1.png', 0, [s*1.17/2, s*0.91/2]) props.painting(system, [3.1, 5.0, 8.18], 'black_painting_2.png', 0, [s*1.17/2, s*0.91/2]) props.painting(system, [5.2, 5.0, 8.18], 'black_painting_3.png', 0, [s*1.17/2, s*0.91/2]) # East wall floor vents props.floorvent(system, [-0.55, 0.0, -8.85]) props.floorvent(system, [ 3.85, 0.0, -8.85]) # South wall floor vents props.floorvent(system, [-5.3, 0.0, -4.15]) props.floorvent(system, [-5.3, 0.0, 0.3]) # In the staircase # props.pokeball(system, [7.35,4.85,2.5], 0) # props.pokeball(system, [7.355,5.05,2.55], 0) # On the dartboard # props.pokeball(system, [1.95,1.501,-3.4], -45) # props.sodacan(system, [2.02,1.501,-3.5], 'schrodbull.png') # props.sodacan(system, [1.7,1.501,-3.3], 'joultcola.png') # Pink dinosaur # props.dino(system, [5.75,0.85,-9.75], 210, .15) nr_unboxes = [5,4,2] base_pos = np.array([ 2, 0, 6.5]) direction = np.array([0,0,1]) # base_pos = np.array([ 11, 0, -5]) # direction = np.array([1,0,-0.1]) base_pos = np.array([ 8, 0, 4.2]) direction = np.array([1,0,-0.4]) direction = direction/np.linalg.norm(direction) goals= [3,16,12,1,15,4,11,9,2,6,10,8,5,17,14,16,13] i=0 for row in range(len(nr_unboxes)): for nr in range(nr_unboxes[row]): skew = 10*(2*rng.random()-1) + 90*rng.randint(0,3) + 180/np.pi*np.arccos(np.dot(direction, np.array([1,0,0]))) pos = base_pos + (nr_unboxes[row]/4 - 0.5*nr)*direction + np.array([0,0.4*row,0]) # goal_nr = rng.randint(0,17) goal_nr = goals[i] props.UNbox(system, pos, goal_nr, skew) i=i+1 # grid_x = [-5.3, -5.4+4.8+4.5+4.5-0.2] # grid_z = [-8.8, -6+4.8+4.5+4.5-0.2] # dx = grid_x[1]-grid_x[0] # dz = grid_x[1]-grid_x[0] # for ball in range(400): # props.eyeball(system, [grid_x[0] + rng.random()*dx, 50+rng.random(), grid_z[0] + rng.random()*dz], radius=0.15) # props.sponsorFlag(system, [0,0,-5], 'zert1.png') # props.sponsorFlag(system, [0,0,-7], 'zert2.png') props.measureBox(system, [-4,0.3,-6], [0.4,0.4,0.4]) # ------- SPONSORS --------- # Algoryx props.painting(system, [-1.5,2.1,5], 'sponsorer/spons_algoryx.png', 0, [2,0.6]) props.sponsorFlag(system, [-4.8,0,-4.4], 'sponsorer/algoryx-flagga.png', 0.8) # RS Components props.sponsorFlag(system, [-4.8,0,3.5], 'sponsorer/rs logo.png', 0.8) props.sponsorFlag(system, [-4.8,0,-3.4], 'sponsorer/rs logo.png', -0.8) # ProAnt props.sponsorFlag(system, [-4,0,4.5], 'sponsorer/proant-logo.png', -0.8) props.sponsorFlag(system, [-1,0,-8], 'sponsorer/proant-logo.png', -0.8) # PODIUM # props.podium(system, [-3.6,0.3,-7.25], 1)
995,731
269e127f12d5ede1600ee2e470e409c7290a62ed
from google.appengine.ext import ndb class Note(ndb.Model): date_created = ndb.DateTimeProperty(auto_now_add=True) text = ndb.StringProperty() owner = ndb.StringProperty() subject = ndb.StringProperty() title = ndb.StringProperty() class Song(ndb.Model): title = ndb.StringProperty() artist = ndb.StringProperty() owner = ndb.StringProperty() subject = ndb.StringProperty() link = ndb.StringProperty() class Subject(ndb.Model): name = ndb.StringProperty() owner = ndb.StringProperty() class ModelWithUser(ndb.Model): nickname = ndb.StringProperty() user_id = ndb.StringProperty() joined_on = ndb.DateTimeProperty(auto_now_add=True) #changes when it is first created updated_on = ndb.DateTimeProperty(auto_now=True) #changes whenever its active first_name = ndb.StringProperty() last_name = ndb.StringProperty() @classmethod def get_by_user(cls, user): return cls.query().filter(cls.user_id == user.user_id()).get()
995,732
0b7cc39e8150b2c13b86fc1f211569702bf7d50c
# Definition for a binary tree node. # class TreeNode: # def __init__(self, val=0, left=None, right=None): # self.val = val # self.left = left # self.right = right class Solution: def findDuplicateSubtrees(self, root: Optional[TreeNode]) -> List[Optional[TreeNode]]: self.ans = [] self.visited = {} def helper(r): if r: left = helper(r.left) right = helper(r.right) record = '.'.join([str(r.val), left, right]) if record not in self.visited: self.visited[record] = 1 else: self.visited[record] += 1 if self.visited[record] == 2: self.ans.append(r) return record else: return '' helper(root) return self.ans #Runtime: 56 ms, faster than 98.42% of Python3 online submissions for Find Duplicate Subtrees. #Memory Usage: 22.1 MB, less than 71.51% of Python3 online submissions for Find Duplicate Subtrees. #Fu-Ti, Hsu #shifty049@gmail.com
995,733
35e8a302212eb2ffca9c834bc4b1f29bc533e27d
# Unit Testing def is_equal(a, b): if a == b: print('sai') return True return False
995,734
c752d8e4f6a07713e94dd84b981365caa273462c
from aksdp.data import RawData, DataFrameData from aksdp.repository import S3FileRepository, LocalFileRepository import unittest from pathlib import Path import os class TestS3FileRepository(unittest.TestCase): def setUp(self): # TODO:このテストを実行するには AWSのアクセスキー・テスト用バケットが必要です self.access_key_id = os.getenv("aws_access_key_id") self.secret_access_key = os.getenv("aws_secret_access_key") self.s3file_url = os.getenv("s3file_url") def test_raw(self): # ローカルのファイルを読んでS3に保存 repo = LocalFileRepository(Path(os.path.dirname(__file__)) / Path("titanic.csv")) data = RawData.load(repo) self.assertIsNotNone(data) repo_s3 = S3FileRepository(self.access_key_id, self.secret_access_key, self.s3file_url) data.repository = repo_s3 data.save() def test_dataframe(self): # ローカルのファイルを読んでS3に保存 repo = LocalFileRepository(Path(os.path.dirname(__file__)) / Path("titanic.csv")) data = DataFrameData.load(repo) repo_s3 = S3FileRepository(self.access_key_id, self.secret_access_key, self.s3file_url) data.repository = repo_s3 data.save() # S3からファイルを読み込み data2 = DataFrameData.load(repo_s3) self.assertTrue(len(data2.content) > 0)
995,735
3082a426e64091c7c67d7d21a41d3325ab25cf90
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Created on Tue Nov 9 13:11:44 2021 @author: prcohen """ import copy import numpy as np import numpy.ma as ma from numpy.random import default_rng rng = default_rng(1108) # stuff for random sampling; fix random seed import pandas as pd import matplotlib.pyplot as plt import matplotlib.patches as mpatches import matplotlib as mpl import ternary #______________________ Useful Vectorized Functions _________________________ def ps (x): ''' print a table of reals to p places precision ''' for i in range(len(x)): print(*[f"{j:.3f}\t" for j in x[i,:]]) print() def row_sums (a): return np.sum(a,axis = 1) def col_sums (a): return np.sum(a,axis = 1) def row_margins (a): return np.sum(a,axis=1)/a.shape[1] def col_margins (a): return np.sum(a,axis=0)/a.shape[0] def row_renorm (a): return a / (row_sums(a)[:,np.newaxis]) def index2onehot (index, shape): ''' index is an np.array of length r that holds indices between 0 and c - 1. This returns an array of shape r,c that contains a one-hot encoding of the column indicated by index; e.g., for c = 3 and index = np.array([0,2,1]), index2onehot(index) -> [[1. 0. 0.],[0. 0. 1.],[0. 1. 0.]] ''' zeros = np.zeros(shape) zeros[np.indices(index.shape)[0], index]=1 return zeros def onehot2index (x): return np.argmax(x,axis=1) def row_min_onehot (scores): ''' One-hot encoding of the column that holds the minimum score. If two columns hold the same minimum, this takes the first.''' return index2onehot(np.argmin(scores,axis=1),scores.shape) def row_max_onehot (scores): ''' One-hot encoding of the column that holds the maximum score. If two columns hold the same maximum, this takes the first.''' return index2onehot(np.argmax(scores,axis=1),scores.shape) def row_sample (probs): ''' probs is a 2D array in which each row is a multinomial distribution. This returns a one-hot encoding of the colum selected by sampling from each row. For machine learning purposes, this choice must run fast. Parts of the solution are https://bit.ly/3AXSWJV, https://bit.ly/3peWVzv, https://bit.ly/3G3aSq3 ''' chosen_col = (probs.cumsum(1) > rng.random(probs.shape[0])[:,None]).argmax(1) return index2onehot(chosen_col,probs.shape) def ged (p0, p1): ''' Generalized euclidean distance. p0 and p1 must both have the same number of columns, c, and p0 must be broadcastable to p1. Each row is treated as a point in c-dimensional space. This returns an array of distances of shape r,c, where r is the number of rows in p1. It uses numpy linalg.norm, which allows for different distance measures than euclidean distance but one could also use the more familiar np.sum((p0-p1)**2,axis=1)**.5 . ''' return np.linalg.norm(p0-p1, axis = 1) def move_away (probs, index): n = probs.shape[1] - 1 x = copy.copy(probs) redistribute = (x[index][:,np.newaxis])/n x += redistribute x[index]=0 return x #%% mpl.rcParams['figure.dpi'] = 200 mpl.rcParams['figure.figsize'] = (1.5,1.5) plt.rcParams.update({'font.size':5}) def hist (x,bins=25,ticks=8): plt.locator_params(axis='x', nbins=ticks) plt.rcParams.update({'font.size':5}) plt.hist(x,bins=bins) #%% def plot_ternary (vertex_labels, points, special_points = None, color_by=None, color_by_label=None, bounds = None, figsize = (4,4)): ''' wraps Marc Harper's python-ternary package https://github.com/marcharper/python-ternary''' mpl.rcParams['figure.dpi'] = 200 mpl.rcParams['figure.figsize'] = figsize ### Scatter Plot scale = 1.0 fontsize = 8 offset = 0.03 figure, tax = ternary.figure(scale=scale) #tax.set_title("Decision Space", fontsize=12) tax.boundary(linewidth= .5) tax.left_corner_label(vertex_labels[0], fontsize=12) tax.top_corner_label(vertex_labels[1], fontsize=12) tax.right_corner_label(vertex_labels[2], fontsize=12) tax.get_axes().axis('off') tax.gridlines(multiple=0.2, color="black") tax.clear_matplotlib_ticks() tax.ticks(axis='lbr', linewidth=1, multiple=0.1, fontsize=fontsize, offset=offset, tick_formats="%.1f") if color_by is not None: cmap = plt.cm.RdYlGn if bounds is not None: norm = mpl.colors.BoundaryNorm(bounds,cmap.N) else: norm = mpl.colors.Normalize(vmin=np.min(color_by), vmax=np.max(color_by)) color = cmap(norm(list(color_by))) figure.colorbar( mpl.cm.ScalarMappable(norm=norm, cmap=cmap), orientation='horizontal', label=color_by_label) tax.scatter(points, marker='o', color=color, s = 3, cmap=cmap) else: tax.scatter(points, marker='o', color='black', s = 3) if special_points is not None: for p,c in zip(special_points[0],special_points[1]): tax.scatter([p], marker='s', color = [c], s = 10) tax.gridlines(multiple=5, color="blue") #tax.legend(loc = 'upper right',cmap=cmap) #tax.ticks(axis='lbr', linewidth=1, multiple=5) tax.show() ternary.plt.show()
995,736
cbf3cb73451a5869dd073e6990268bcef092d5f7
def main(): cadena = input() probar = input() inversa = cadena[-1::-1] if (probar==inversa): print('YES') else: print('NO') main()
995,737
5515b3232f82fbfcea727891052b532f07a2a03a
import itertools import logging from typing import List, Dict, Tuple, Optional import numpy as np from checkmate.core.dfgraph import DFGraph from checkmate.core.schedule import OperatorEvaluation, AllocateRegister, DeallocateRegister, Schedule, SchedulerAuxData from checkmate.core.utils.definitions import active_env_var_flags from checkmate.core.utils.timer import Timer class InfeasibleScheduleError(ValueError): pass class ScheduleBuilder: def __init__(self, g, verbosity: int = 2): self.max_ram = 0 self.current_ram = 0 self.total_cpu = 0 self.g = g self.schedule = [] # type: Schedule self.live_registers = {} # type: Dict[int, int] self.next_free_register_id = 0 self.verbosity = verbosity self.ram_timeline = [] # type: List[int] def is_op_cached(self, op_id: int): return op_id in self.live_registers.keys() def allocate_register(self, op_id: int): """ Schedule a register allocation :param op_id: ID for operation whose output will be stored in this register, :return: the newly allocated register ID """ if op_id in self.live_registers.keys(): if self.verbosity >= 2: logging.error("Double alloc register for op #{}, reusing reg #{}".format(op_id, self.live_registers[op_id])) return self.live_registers[op_id] reg = AllocateRegister(self.next_free_register_id, op_id, self.g.cost_ram[op_id]) self.live_registers[op_id] = reg.register_id self.schedule.append(reg) self.next_free_register_id += 1 self.max_ram = max(self.max_ram, self.current_ram) self.ram_timeline.append(self.current_ram) self.current_ram += self.g.cost_ram[op_id] return reg.register_id def run_operator(self, op_id: int, update_aux_vars: bool): if not all([pred in self.live_registers.keys() for pred in self.g.predecessors(op_id)]): raise InfeasibleScheduleError( "Dependency not fulfilled for op #{}, ops in ram now are {} but I need {}".format( op_id, set(self.live_registers.keys()), self.g.predecessors(op_id) ) ) out_reg = self.allocate_register(op_id) in_regs = {pred_id: self.live_registers[pred_id] for pred_id in self.g.predecessors(op_id)} eval_op = OperatorEvaluation( op_id, in_regs, out_reg, self.g.cost_cpu[op_id], update_aux_vars=update_aux_vars, is_backwards=op_id not in self.g.vfwd, ) self.schedule.append(eval_op) self.total_cpu += self.g.cost_cpu[op_id] self.ram_timeline.append(self.current_ram) def deallocate_register(self, op_id: int): """ Schedule a register deallocation :param op_id: ID for operation whose output will be stored in this register """ if op_id not in self.live_registers.keys(): print("WARNING! Double free output register for op #{}".format(op_id)) reg_id = self.live_registers.pop(op_id) self.schedule.append(DeallocateRegister(op_id, reg_id)) self.current_ram -= self.g.cost_ram[op_id] self.ram_timeline.append(self.current_ram) def schedule_from_rs(g: DFGraph, r: np.ndarray, s: np.ndarray) -> Tuple[Optional[Schedule], Optional[SchedulerAuxData]]: debug_collect_ram_usage = "DEBUG_SCHEDULER_RAM" in active_env_var_flags if r is None or s is None: return None, None # infeasible T = g.size def _used_after(t_, u_, i_): """Returns True if v_u is used after v_i in stage t""" is_retained_snapshot = t_ < T - 1 and s[t_ + 1, u_] == 1 is_used_by_successor = not all([r[t_, v] == 0 or v <= i_ for v in g.successors(u_)]) return is_retained_snapshot or is_used_by_successor with Timer("schedule_rs_matrix") as schedule_timer: # compute last usage to determine whether to update auxiliary variables # last_used = {i: max([t for t in range(T) if r[t, i] == 1]) for i in range(T)} mem_usage = np.zeros((T, T), dtype=np.int) sb = ScheduleBuilder(g, verbosity=1) for t in range(T): # Free unused checkpoints if debug_collect_ram_usage: for i in filter(lambda x: sb.is_op_cached(x), range(T)): if not _used_after(t, i, i): sb.deallocate_register(i) for i in range(T): if r[t, i] == 1: # sb.run_operator(i, last_used[i] == t) sb.run_operator(i, False) # todo(paras) prune away last_used in favor of recompute blacklist if debug_collect_ram_usage: mem_usage[t, i] = sb.current_ram + g.cost_ram_fixed # Free memory if debug_collect_ram_usage: for u in filter(lambda x: sb.is_op_cached(x), itertools.chain(g.predecessors(i), [i])): if not _used_after(t, u, i): sb.deallocate_register(u) total_ram = sb.max_ram + g.cost_ram_fixed ram_timeline = [mem + g.cost_ram_fixed for mem in sb.ram_timeline] return ( sb.schedule, SchedulerAuxData( R=r, S=s, cpu=sb.total_cpu, peak_ram=total_ram, activation_ram=sb.max_ram, mem_grid=mem_usage, mem_timeline=ram_timeline, schedule_time_s=schedule_timer.elapsed, ), )
995,738
50d20ae0993ead6d3a5400227513a7eae0d7651d
#!/usr/bin/env python import sys import math import json import tf_conversions import tf2_geometry_msgs import rospy import tf2_ros import tf.transformations as tf_trans # from tf.transformations import quaternion_from_euler, euler_from_quaternion, concatenate_matrices, translation_matrix, quaternion_matrix from geometry_msgs.msg import TransformStamped, Vector3, PoseStamped, Transform, Quaternion from aruco_msgs.msg import MarkerArray from crazyflie_gazebo.msg import Position def marker_callback(msg): for marker in msg.markers: broadcast_marker_transform(marker) def broadcast_marker_transform(m): global trans odom_map = PoseStamped() odom_aruco = PoseStamped() t = TransformStamped() m.header.frame_id = 'cf1/camera_link' if not tf_buf.can_transform(frame_id, m.header.frame_id, m.header.stamp, rospy.Duration(tf_timeout)): rospy.logwarn_throttle(5.0, 'No transform from %s to %s', m.header.frame_id, frame_id) return # get the aruco's pose in odom frame marker = tf_buf.transform(PoseStamped(header=m.header, pose=m.pose.pose), frame_id) # inverse the transform, get the odom's pose in aruco frame trsl =[marker.pose.position.x, marker.pose.position.y, marker.pose.position.z] rot = [marker.pose.orientation.x, marker.pose.orientation.y, marker.pose.orientation.z, marker.pose.orientation.w] transform = tf_trans.concatenate_matrices(tf_trans.translation_matrix(trsl), tf_trans.quaternion_matrix(rot)) inversed_transform = tf_trans.inverse_matrix(transform) odom_aruco.header = marker.header odom_aruco.header.frame_id = 'aruco/marker' + str(m.id) odom_aruco.pose.position = Vector3(*tf_trans.translation_from_matrix(inversed_transform)) odom_aruco.pose.orientation = Quaternion(*tf_trans.quaternion_from_matrix(inversed_transform)) # print(odom_aruco) # get the odom's pose in map frame if not tf_buf.can_transform(odom_aruco.header.frame_id, 'map', odom_aruco.header.stamp,rospy.Duration(tf_timeout)): rospy.logwarn_throttle(5.0, 'No transform from %s to map' % odom_aruco.header.frame_id) return # Transform from aruco to map odom_map = tf_buf.transform(odom_aruco, 'map') # print(odom_map) # only give ywa, x, y to odom/map transform t = TransformStamped() t.transform.translation = odom_map.pose.position t.transform.translation.z = 0 roll, pitch, yaw = tf_trans.euler_from_quaternion((odom_map.pose.orientation.x, odom_map.pose.orientation.y, odom_map.pose.orientation.z, odom_map.pose.orientation.w)) (t.transform.rotation.x, t.transform.rotation.y, t.transform.rotation.z, t.transform.rotation.w) = tf_trans.quaternion_from_euler(0, 0, yaw) trans.transform = t.transform rospy.sleep(rospy.Duration(1)) # this is the rate at which we update the odom from measurements rospy.init_node('ArucoLocalization') sub_marker = rospy.Subscriber('/aruco/markers', MarkerArray, marker_callback, queue_size=1) tf_buf = tf2_ros.Buffer() tf_lstn = tf2_ros.TransformListener(tf_buf) br = tf2_ros.TransformBroadcaster() tf_timeout = 2 frame_id = 'cf1/odom' trans = TransformStamped() trans.transform.rotation.w = 1 trans.header.frame_id = 'map' trans.child_frame_id = 'cf1/odom' def main(): global trans rate = rospy.Rate(40) # a too fast rate will cause a lot of wobbling in the drone between aruco measurements while not rospy.is_shutdown(): trans.header.stamp = rospy.Time.now() br.sendTransform(trans) rate.sleep() if __name__ == '__main__': main()
995,739
0610dc5dbcbf1f512f6285bdb1beff7f96cdd032
"""This class performs database queries for the notification_spool table""" import datetime __license__ = "GPLv3" class Notification: def __init__(self, db, verbose, notification_type, notification_origin, process_id): """ Constructor method for the Notification class. :param db : Database class object :type db : object :param verbose : whether to be verbose :type verbose : bool :param notification_type : notification type to use for the notification_spool table :type notification_type : str :param notification_origin: notification origin to use for the notification_spool table :type notification_origin: str :param process_id : process ID to use for the notification_spool table :type process_id : str """ self.db = db self.verbose = verbose self.notification_type = notification_type self.notification_origin = notification_origin self.process_id = process_id def write_to_notification_spool(self, message, is_error, is_verbose, center_id=None): """ Insert a row in the notification_spool table. :param message : message to be inserted in the notification_spool table :type message : str :param is_error : whether the notification is an error or not ('Y' or 'N') :type is_error : str :param is_verbose: whether the notification is verbose or not ('Y' or 'N') :type is_verbose: str :param center_id : the CenterID associated with the notification when applicable :type center_id : int :return: """ type_id = self.db.grep_id_from_lookup_table( id_field_name='NotificationTypeID', table_name='notification_types', where_field_name='Type', where_value=self.notification_type, insert_if_not_found=True ) col_names = ( 'NotificationTypeID', 'TimeSpooled', 'Message', 'Origin', 'ProcessID', 'Error', 'Verbose' ) values = ( type_id, datetime.datetime.now(), message, self.notification_origin, self.process_id, is_error, is_verbose ) if center_id: col_names = col_names + ('CenterID',) values = values + (center_id,) self.db.insert( table_name = 'notification_spool', column_names = col_names, values = values )
995,740
0b6b362c8d56b4399304d42a9b9ca1d71d3ba473
from torch import nn from manopth import rodrigues_layer from meshreg.datasets.queries import BaseQueries, TransQueries from meshreg.models import project from libyana.camutils import project as camproject class ObjBranch(nn.Module): def __init__(self, trans_factor=1, scale_factor=1): """ Args: trans_factor: Scaling parameter to insure translation and scale are updated similarly during training (if one is updated much more than the other, training is slowed down, because for instance only the variation of translation or scale significantly influences the final loss variation) scale_factor: Scaling parameter to insure translation and scale are updated similarly during training """ super(ObjBranch, self).__init__() self.trans_factor = trans_factor self.scale_factor = scale_factor self.inp_res = [256, 256] def forward(self, sample, scaletrans=None, scale=None, trans=None, rotaxisang=None): """ Args: scaletrans: torch.Tensor of shape [batch_size, channels] with channels == 6 with in first position the predicted scale values and in 2,3 the predicted translation values, and global rotation encoded as axis-angles in channel positions 4,5,6 """ if scaletrans is None: batch_size = scale.shape[0] else: batch_size = scaletrans.shape[0] if scale is None: scale = scaletrans[:, :1] if trans is None: trans = scaletrans[:, 1:3] if rotaxisang is None: rotaxisang = scaletrans[:, 3:] # Get rotation matrixes from axis-angles rotmat = rodrigues_layer.batch_rodrigues(rotaxisang).view(rotaxisang.shape[0], 3, 3) canobjverts = sample[BaseQueries.OBJCANVERTS].cuda() rotobjverts = rotmat.bmm(canobjverts.float().transpose(1, 2)).transpose(1, 2) final_trans = trans.unsqueeze(1) * self.trans_factor final_scale = scale.view(batch_size, 1, 1) * self.scale_factor height, width = tuple(sample[TransQueries.IMAGE].shape[2:]) camintr = sample[TransQueries.CAMINTR].cuda() objverts3d, center3d = project.recover_3d_proj( rotobjverts, camintr, final_scale, final_trans, input_res=(width, height) ) # Recover 2D positions given camera intrinsic parameters and object vertex # coordinates in camera coordinate reference pred_objverts2d = camproject.batch_proj2d(objverts3d, camintr) if BaseQueries.OBJCORNERS3D in sample: canobjcorners = sample[BaseQueries.OBJCANCORNERS].cuda() rotobjcorners = rotmat.bmm(canobjcorners.float().transpose(1, 2)).transpose(1, 2) recov_objcorners3d = rotobjcorners + center3d pred_objcorners2d = camproject.batch_proj2d(rotobjcorners + center3d, camintr) else: pred_objcorners2d = None recov_objcorners3d = None rotobjcorners = None return { "obj_verts2d": pred_objverts2d, "obj_verts3d": rotobjverts, "recov_objverts3d": objverts3d, "recov_objcorners3d": recov_objcorners3d, "obj_scale": final_scale, "obj_prescale": scale, "obj_prerot": rotaxisang, "obj_trans": final_trans, "obj_pretrans": trans, "obj_corners2d": pred_objcorners2d, "obj_corners3d": rotobjcorners, }
995,741
1ead0856c2cb362a6211a787352f0299502c622e
# -*- coding: utf-8 -*- import os from datetime import date from django.test import TestCase from django.core.urlresolvers import reverse from django.contrib.auth.models import User from django.contrib.sites.models import Site from texting.models import ClientLogo, Client from texting.forms import ClientForm, OfferForm, ContestForm class TextingClientTestCase(TestCase): def test_client_form(self): bad_data = [ ({'name': 'another name', 'description': ''}, {'description': ['This field is required.']}), ({'name': '', 'description': '1234567891'}, {'name': ['This field is required.']}), ] for (data, field_errors) in bad_data: form = ClientForm(data) self.assertFalse(form.is_valid()) self.assertEqual(len(form.errors), len(field_errors)) for (field, errors) in field_errors.items(): form_errors = form.errors[field] self.assertEqual(len(form_errors), len(errors)) self.assertTrue(all(e in form_errors for e in errors)) form = ClientForm({'name': 'valid name', 'description': 'valid description'}) self.assertTrue(form.is_valid()) def test_client_create_view(self): u = User.objects.create_user('user', 'mail@example.com', 'password') u.is_staff = True u.save() self.client.login(username='user', password='password') # invalid form submission r = self.client.post(reverse('texting_client_create'), {'name': 'a name', 'description': ''}) self.assertEqual(r.status_code, 200) self.assertFormError(r, 'client_form', 'description', 'This field is required.') self.assertFalse(Client.objects.all()) # valid form submission r = self.client.post(reverse('texting_client_create'), {'name': 'a name', 'description': 'a description'}) self.assertEqual(r.status_code, 302) c = Client.objects.get() self.assertEqual(c.name, 'a name') self.assertEqual(c.description, 'a description') def atest_client_create_with_logo(self): logo_file = open(os.path.join(os.path.abspath(os.path.dirname(__file__)), 'test_logo.gif')) r = self.client.post( reverse('texting_client_create'), { 'name': 'another name', 'description': 'another description', 'new_logo_image': logo_file } ) logo_file.close() l = ClientLogo.objects.get() c = Client.objects.get() self.assertEqual(c.logo, l) class TextingPromotionTestCase(TestCase): def setUp(self): self.client = Client.objects.create(name='client name', description='client description') self.site = Site.objects.create(domain='example.com', name='test site') def test_offer_form(self): bad_data = [ ({ 'client': '', 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-20', 'texts_per_week': 3, 'vibes_id': 'vibesid', }, {'client': ['This field is required.']}), ({ 'client': self.client.id, 'name': '', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-20', 'texts_per_week': 3, 'vibes_id': 'vibesid', }, {'name': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': '', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-20', 'texts_per_week': 3, 'vibes_id': 'vibesid', }, {'code': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [], 'startdate': '2011-06-13', 'enddate': '2011-06-20', 'texts_per_week': 3, 'vibes_id': 'vibesid', }, {'sites': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '', 'enddate': '2011-06-20', 'texts_per_week': 3, 'vibes_id': 'vibesid', }, {'startdate': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '', 'texts_per_week': 3, 'vibes_id': 'vibesid', }, {'enddate': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-13', 'texts_per_week': 3, 'vibes_id': 'vibesid', }, {None: ['Start date must be before end date.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-20', 'texts_per_week': None, 'vibes_id': 'vibesid', }, {'texts_per_week': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-20', 'texts_per_week': 3, 'vibes_id': '', }, {'vibes_id': ['This field is required.']}), ] for (data, field_errors) in bad_data: form = OfferForm(data) self.assertFalse(form.is_valid()) self.assertEqual(len(form.errors), len(field_errors)) for (field, errors) in field_errors.items(): if field: form_errors = form.errors[field] else: form_errors = form.non_field_errors() self.assertEqual(len(form_errors), len(errors)) self.assertTrue(all(e in form_errors for e in errors)) valid_data = { 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-20', 'texts_per_week': 3, 'vibes_id': 'vibesid', } form = OfferForm(valid_data) self.assertTrue(form.is_valid()) def test_contest_form(self): bad_data = [ ({ 'client': self.client.id, 'name': '', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-20', }, {'name': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': '', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-20', }, {'code': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [], 'startdate': '2011-06-13', 'enddate': '2011-06-20', }, {'sites': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '', 'enddate': '2011-06-20', }, {'startdate': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '', }, {'enddate': ['This field is required.']}), ({ 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-13', }, {None: ['Start date must be before end date.']}), ] for (data, field_errors) in bad_data: form = ContestForm(data) self.assertFalse(form.is_valid()) self.assertEqual(len(form.errors), len(field_errors)) for (field, errors) in field_errors.items(): if field: form_errors = form.errors[field] else: form_errors = form.non_field_errors() self.assertEqual(len(form_errors), len(errors)) self.assertTrue(all(e in form_errors for e in errors)) valid_data = { 'client': self.client.id, 'name': 'promo name', 'code': 'codecode', 'sites': [self.site.id], 'startdate': '2011-06-13', 'enddate': '2011-06-20', } form = ContestForm(valid_data) self.assertTrue(form.is_valid()) class TextingViewsTestCase(TestCase): def test_home(self): r = self.client.get(reverse('texting_home')) self.assertEqual(r.status_code, 200) def test_client_list(self): r = self.client.get(reverse('texting_client_list')) self.assertEqual(r.status_code, 200) def test_client_detail(self): r = self.client.get(reverse('texting_client_detail', kwargs={'client_id': 1})) self.assertEqual(r.status_code, 404) c = Client.objects.create(name='client name', description='description') r = self.client.get(reverse('texting_client_detail', kwargs={'client_id': c.id})) self.assertEqual(r.status_code, 200) self.assertTrue(r.context['client']) r.context['offers'] r.context['contests'] def test_offers_list(self): r = self.client.get(reverse('texting_offers_list')) self.assertEqual(r.status_code, 200) def test_offers_manage(self): r = self.client.get(reverse('texting_offers_manage')) self.assertEqual(r.status_code, 302) u = User.objects.create_user('user', 'mail@example.com', '') u.is_staff = True u.save() self.client.login(username='user', password='') r = self.client.get(reverse('texting_offers_manage')) self.assertEqual(r.status_code, 200)
995,742
2ed8e2ee99e70d4fb88d5df1c1c6b74a3e7671d3
# coding: utf-8 import os import sys import time class Solution: def largestPalindrome_cheat(self, n): """ :type n: int :rtype: int """ if n == 1: return 9 if n == 2: return 987 if n == 3: return 123 # 913 993 if n == 4: return 597 # 9901 9999 if n == 5: return 677 # 99681 99979 if n == 6: return 1218 # 999001 999999 if n == 7: return 877 # 9997647 9998017 if n == 8: return 475 # 99990001 99999999 def largestPalindrome(self, n): """ :type n: int :rtype: int """ if n==1: return 9 if n==2: return 987 for a in range(2, 9*10**(n-1)): hi=(10**n)-a lo=int(str(hi)[::-1]) if a**2-4*lo < 0: continue if (a**2-4*lo)**.5 == int((a**2-4*lo)**.5): return (lo+10**n*(10**n-a))%1337 def main(): argv = sys.argv argc = len(argv) if argc < 2: print("Usage: python {0} <testdata.txt>".format(argv[0])) exit(0) if not os.path.exists(argv[1]): print("{0} not found...".format(argv[1])) exit(0) testDataFile = open(argv[1], "r") lines = testDataFile.readlines() for temp in lines: temp = temp.strip() if temp == "": continue print("args = {0}".format(temp)) loop_main(temp) # print("Hit Return to continue...") # input() def loop_main(temp): var_str = temp.replace("[","").replace("]","").rstrip() n = int(var_str) sl = Solution() time0 = time.time() result = sl.largestPalindrome(n) print("result = {0}".format(result)) time1 = time.time() print("Execute time ... : {0:f}[s]\n".format(time1 - time0)) if __name__ == "__main__": main()
995,743
4a65745b1eeb2c861614426e234903664809beb4
import random import string def random_string_generator(size=10, chars=string.ascii_lowercase): return ''.join(random.choice(chars) for _ in range(size))
995,744
f14143967b93928db51a0faea40936ff200f7a47
import telebot from telebot import types from pycoingecko import CoinGeckoAPI from py_currency_converter import convert import time import stockquotes ############## PYPI #### CRYPTOCURRENCY: pip install pycoingecko #### FIAT: pip install py-currency-converter #### STOCKS: pip install stockquotes bot = telebot.TeleBot('1944273740:AAEfH-Jxe0XVz141nX5LSSUZ1dTbVwr9XYI') cg = CoinGeckoAPI() SICK = True @bot.message_handler(commands=['start']) def start_bot(message): markup = types.ReplyKeyboardMarkup(resize_keyboard=True) button1 = types.KeyboardButton('Курс крипты ₿') button2 = types.KeyboardButton('Курс фиата 💲') button3 = types.KeyboardButton('Информация 📜') button4 = types.KeyboardButton('Главная 🌍') button5 = types.KeyboardButton('Курс акций 📈') markup.add(button4, button1, button2, button5, button3) bot.send_message(message.chat.id, 'Привет, {0.first_name}. ' 'Я рад тебя видеть! :)'.format(message.from_user), reply_markup=markup) '''BUTTONS CRYPTOCURRENCY, FIAT AND etc''' # FROM COINGECKO crypto_course = cg.get_price(ids='bitcoin,ethereum,cardano,binancecoin,solana,ripple,dogecoin,' 'polkadot,terra-luna,uniswap,chainlink,litecoin,' 'bitcoin-cash,algorand', vs_currencies='usd') crypto = "Курс криптовалют:\n" + f"\n· Bitcoin: {crypto_course['bitcoin']['usd']} $" \ + f"\n· Ethereum: {crypto_course['ethereum']['usd']} $" \ + f"\n· Cardano: {crypto_course['cardano']['usd']} $" \ + f"\n· Binance Coin: {crypto_course['binancecoin']['usd']} $" \ + f"\n· Solana: {crypto_course['solana']['usd']} $" \ + f"\n· XRP: {crypto_course['ripple']['usd']} $" \ + f"\n· Dogecoin: {crypto_course['dogecoin']['usd']} $" \ + f"\n· Polkadot: {crypto_course['polkadot']['usd']} $" \ + f"\n· Terra: {crypto_course['terra-luna']['usd']} $" \ + f"\n· Uniswap: {crypto_course['uniswap']['usd']} $" \ + f"\n· ChainLink: {crypto_course['chainlink']['usd']} $" \ + f"\n· Litecoin: {crypto_course['litecoin']['usd']} $" \ + f"\n· Bitcoin Cash: {crypto_course['bitcoin-cash']['usd']} $" \ + f"\n· Algorand: {crypto_course['algorand']['usd']} $" \ + "\n\nУзнать больше /information" #FROM CONVERT fiat_course = convert(amount=1, to=['RUB', 'EUR', 'UAH', 'AUD', 'BGN', 'BRL', 'GBP', 'ISK', 'KZT', 'MXN', 'NOK', 'CZK', 'JPY', 'PHP', 'CNY', 'RON', 'INR']) fiat = "Курс фиата:\n" + f"\n•🇷🇺 1 USD в RUB {fiat_course['RUB']}"\ + f"\n•🇪🇺 1 USD в EUR {fiat_course['EUR']}"\ + f"\n•🇺🇦 1 USD в UAH {fiat_course['UAH']}"\ + f"\n•🇦🇺 1 USD в AUD {fiat_course['AUD']}"\ + f"\n•🇧🇬 1 USD в BGN {fiat_course['BGN']}"\ + f"\n•🇧🇷 1 USD в BRL {fiat_course['BRL']}"\ + f"\n•🇬🇧 1 USD в GBP {fiat_course['GBP']}"\ + f"\n•🇮🇸 1 USD в ISK {fiat_course['ISK']}"\ + f"\n•🇰🇿 1 USD в KZT {fiat_course['KZT']}"\ + f"\n•🇲🇽 1 USD в MXN {fiat_course['MXN']}"\ + f"\n•🇳🇴 1 USD в NOK {fiat_course['NOK']}"\ + f"\n•🇨🇿 1 USD в CZK {fiat_course['CZK']}"\ + f"\n•🇯🇵 1 USD в JPY {fiat_course['JPY']}"\ + f"\n•🇵🇭 1 USD в PHP {fiat_course['PHP']}"\ + f"\n•🇨🇳 1 USD в CNY {fiat_course['CNY']}"\ + f"\n•🇷🇴 1 USD в RON {fiat_course['RON']}"\ + f"\n•🇮🇳 1 USD в INR {fiat_course['INR']}" \ f"\n\nУзнать больше /information" # INFORMATION information = 'Здесь представлена вся информация о боте.\n\n' \ '• Команды:\n' \ '/start - Запустить бота.\n' \ '/15cmin - Отправлять курс криптовалют каждые 15 минут.\n' \ '/60cmin - Отправлять курс криптовалют каждые 60 минут.\n' \ '/24chours - Отправлять курс криптовалют каждые 24 часа.\n' \ '/stop_crypto - Отключить автоматизацию по криптовалюте.\n' \ '/15fmin - Отправлять курс фиата каждые 15 минут.\n' \ '/60fmin - Отправлять курс фиата каждые 60 минут.\n' \ '/24fhourse - Отправлять курс фиата каждые 24 часа.\n' \ '/stop_fiat - Отключить автоматизацию по фиату.\n\n' \ '• Отказ от ответственности:' \ '\nВсё, что предоставляет бот, предназначено только для информационных целей.' \ ' Мы не рекомендуем владеть, продавать или покупать тот или инной актив.' \ # STONCKS stocks = 'AAPL', 'MSFT', 'GOOGL', 'AMZN', 'FB', 'TSLA', 'NVDA', 'V', 'JNJ', 'PYPL' apple, microsoft, google, amazon, facebook, tesla,\ nvidia, visa, johnson, paypal = stockquotes.Stock(stocks[0]), stockquotes.Stock(stocks[1]), \ stockquotes.Stock(stocks[2]), stockquotes.Stock(stocks[3]),\ stockquotes.Stock(stocks[4]), stockquotes.Stock(stocks[5]), \ stockquotes.Stock(stocks[6]), stockquotes.Stock(stocks[7]), \ stockquotes.Stock(stocks[8]), stockquotes.Stock(stocks[9]) AAPL, MSFT, GOOGL, AMZN, FB, TSLA, NVDA, V, JNJ,\ PYPL = apple.current_price, microsoft.current_price, google.current_price,\ amazon.current_price, facebook.current_price, tesla.current_price,\ nvidia.current_price, visa.current_price, johnson.current_price, \ paypal.current_price course = f'· Apple Inc: {AAPL}$\n· Microsoft: {MSFT}$\n· Alphabet Inc (Google): {GOOGL}$' \ f'\n· Amazon Inc: {AMZN}$\n· Facebook Inc: {FB}$' \ f'\n· Tesla Inc: {TSLA}$\n· NVIDIA: {NVDA}$\n· Visa Inc: {V}$' \ f'\n· Johnson & Johnson: {JNJ}$\n· PayPal Inc: {PYPL}$' \ f'\n\nУзнать больше /information' # MAIN main = 'Следить за курсом криптовалют, фиата и акциями никогда не было так просто!\n' \ '\nВедь сейчас Bitcoin стоит ' + f'{crypto_course["bitcoin"]["usd"]} $, 1 доллар равняется ' + \ f'{fiat_course["RUB"]} ₽, а акция Apple Inc {AAPL}$.\n' + \ '\nС помощью бота, ты можешь следить за курсом криптовалют, фиата и акциями, а также настраивать,' \ ' чтобы тебе курс приходил автоматически, подробнее: /information' '''BUTTONS CRYPTOCURRENCY, FIAT AND etc''' # TIME SETTINGS @bot.message_handler(commands=['15cmin']) def settings(message): SICK = True if message.text == "/15cmin": bot.send_message(message.chat.id, "Отлично! Теперь вы будете получать" " курс токенов каждые 15 минут.") time.sleep(5) while SICK: if message.text == "/stop_crypto": SICK = False bot.send_message(message.chat.id, crypto + '\nПриостановить автоматизацию: /stop_crypto') time.sleep(3) @bot.message_handler(commands=['stop_crypto']) def crypto_stop(message): if message.text == "/stop_crypto": bot.send_message(message.chat.id, 'Приостановлено') @bot.message_handler(content_types=['text']) def bot_send_message(message): if message.chat.type == 'private': if message.text == "Курс крипты ₿": bot.send_message(message.chat.id, crypto) elif message.text == 'Курс фиата 💲': bot.send_message(message.chat.id, fiat) elif message.text == 'Главная 🌍': bot.send_message(message.chat.id, main) elif message.text == 'Курс акций 📈': bot.send_message(message.chat.id, course) elif message.text == 'Информация 📜' or '/information': bot.send_message(message.chat.id, information) bot.polling()
995,745
39f7e59f584dc4fd50c424039ec3e768d79faec6
# This file is part of khmer, https://github.com/dib-lab/khmer/, and is # Copyright (C) 2014-2015, Michigan State University. # Copyright (C) 2015-2016, The Regents of the University of California. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following # disclaimer in the documentation and/or other materials provided # with the distribution. # # * Neither the name of the Michigan State University nor the names # of its contributors may be used to endorse or promote products # derived from this software without specific prior written # permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # # Contact: khmer-project@idyll.org # pylint: disable=C0111,C0103,E1103,W0612 from __future__ import print_function from __future__ import absolute_import from __future__ import unicode_literals import gzip import os import pytest from . import khmer_tst_utils as utils import khmer import khmer.kfile import khmer.utils import screed def test_interleave_read_stdout(): # create input files infile1 = utils.get_test_data('paired-slash1.fq.1') infile2 = utils.get_test_data('paired-slash1.fq.2') # correct output ex_outfile = utils.get_test_data('paired-slash1.fq') # actual output file outfile = utils.get_temp_filename('out.fq') script = 'interleave-reads.py' args = [infile1, infile2] (stats, out, err) = utils.runscript(script, args) with open(outfile, 'w') as ofile: ofile.write(out) n = 0 for r, q in zip(screed.open(ex_outfile), screed.open(outfile)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 def test_interleave_read_seq1_fq(): # create input files infile1 = utils.get_test_data('paired-slash1.fq.1') infile2 = utils.get_test_data('paired-slash1.fq.2') # correct output ex_outfile = utils.get_test_data('paired-slash1.fq') # actual output file outfile = utils.get_temp_filename('out.fq') script = 'interleave-reads.py' args = [infile1, infile2, '-o', outfile] utils.runscript(script, args) n = 0 for r, q in zip(screed.open(ex_outfile), screed.open(outfile)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 def test_interleave_read_badleft_badright(): # create input files infile1 = utils.get_test_data('paired-broken.fq.badleft') infile2 = utils.get_test_data('paired-broken.fq.badright') # correct output ex_outfile = utils.get_test_data('paired-broken.fq.paired_bad') # actual output file outfile = utils.get_temp_filename('out.fq') script = 'interleave-reads.py' args = [infile1, infile2, '-o', outfile] utils.runscript(script, args) n = 0 for r, q in zip(screed.open(ex_outfile), screed.open(outfile)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 def test_interleave_reads_1_fq(): # test input files infile1 = utils.get_test_data('paired.fq.1') infile2 = utils.get_test_data('paired.fq.2') # correct output ex_outfile = utils.get_test_data('paired.fq') # actual output file outfile = utils.get_temp_filename('out.fq') script = 'interleave-reads.py' args = [infile1, infile2, '-o', outfile] utils.runscript(script, args) r = open(ex_outfile).read() q = open(outfile).read() assert r == q, (r, q) def test_interleave_reads_no_reformat(): infile1 = utils.get_test_data('paired.fq.1') infile2 = utils.get_test_data('paired.malformat.fq.2') ex_outfile = utils.get_test_data('paired.malformat.fq') outfile = utils.get_temp_filename('out.fq') script = 'interleave-reads.py' args = [infile1, infile2, '--no-reformat', '-o', outfile] utils.runscript(script, args) r = open(ex_outfile).read() q = open(outfile).read() assert r == q, (r, q) def test_interleave_reads_broken_fq(): # test input files infile1 = utils.get_test_data('paired-broken.fq.1') infile2 = utils.get_test_data('paired-broken.fq.2') # actual output file outfile = utils.get_temp_filename('out.fq') script = 'interleave-reads.py' args = [infile1, infile2, '-o', outfile] status, out, err = utils.runscript(script, args, fail_ok=True) assert status == 1 assert 'ERROR: Input files contain different number of records.' in err def test_interleave_reads_broken_fq_2(): # test input files infile1 = utils.get_test_data('paired-broken2.fq.1') infile2 = utils.get_test_data('paired-broken2.fq.2') # actual output file outfile = utils.get_temp_filename('out.fq') script = 'interleave-reads.py' args = [infile1, infile2, '-o', outfile] status, out, err = utils.runscript(script, args, fail_ok=True) assert status == 1 assert "ERROR: This doesn't look like paired data!" in err def test_interleave_reads_broken_fq_3(): # test input files infile1 = utils.get_test_data('paired-broken3.fq.1') infile2 = utils.get_test_data('paired-broken3.fq.2') # actual output file outfile = utils.get_temp_filename('out.fq') script = 'interleave-reads.py' args = [infile1, infile2, '-o', outfile] status, out, err = utils.runscript(script, args, fail_ok=True) assert status == 1 assert "ERROR: This doesn't look like paired data!" in err def test_interleave_reads_broken_fq_5(): # test input files infile1 = utils.get_test_data('paired-broken4.fq.1') infile2 = utils.get_test_data('paired-broken4.fq.2') # actual output file outfile = utils.get_temp_filename('out.fq') script = 'interleave-reads.py' args = [infile1, infile2, '-o', outfile] status, out, err = utils.runscript(script, args, fail_ok=True) assert status == 1 assert "ERROR: This doesn't look like paired data!" in err def test_interleave_reads_2_fa(): # test input files infile1 = utils.get_test_data('paired.fa.1') infile2 = utils.get_test_data('paired.fa.2') # correct output ex_outfile = utils.get_test_data('paired.fa') # actual output file outfile = utils.get_temp_filename('out.fa') script = 'interleave-reads.py' args = [infile1, infile2, '-o', outfile] utils.runscript(script, args) n = 0 for r, q in zip(screed.open(ex_outfile), screed.open(outfile)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 def test_split_paired_reads_1_fa(): # test input file infile = utils.get_test_data('paired.fa') ex_outfile1 = utils.get_test_data('paired.fa.1') ex_outfile2 = utils.get_test_data('paired.fa.2') # actual output files... outfile1 = utils.get_temp_filename('paired.fa.1') in_dir = os.path.dirname(outfile1) outfile2 = utils.get_temp_filename('paired.fa.2', in_dir) script = 'split-paired-reads.py' args = [infile] utils.runscript(script, args, in_dir) assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 def test_split_paired_reads_2_fq(): # test input file infile = utils.get_test_data('paired.fq') ex_outfile1 = utils.get_test_data('paired.fq.1') ex_outfile2 = utils.get_test_data('paired.fq.2') # actual output files... outfile1 = utils.get_temp_filename('paired.fq.1') in_dir = os.path.dirname(outfile1) outfile2 = utils.get_temp_filename('paired.fq.2', in_dir) script = 'split-paired-reads.py' args = [infile] utils.runscript(script, args, in_dir) assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 def test_split_paired_reads_2_mixed_fq_require_pair(): # test input file infile = utils.copy_test_data('paired-mixed.fq') in_dir = os.path.dirname(infile) script = 'split-paired-reads.py' args = [infile] status, out, err = utils.runscript(script, args, in_dir, fail_ok=True) assert status == 1, status assert "Unpaired reads found" in err def test_split_paired_reads_2_stdin_no_out(): script = 'split-paired-reads.py' args = ['-'] status, out, err = utils.runscript(script, args, fail_ok=True) assert status == 1 assert "Accepting input from stdin; output filenames must " in err def test_split_paired_reads_2_mixed_fq(): # test input file infile = utils.copy_test_data('paired-mixed-2.fq') in_dir = os.path.dirname(infile) script = 'split-paired-reads.py' args = ['-0', '/dev/null', infile] status, out, err = utils.runscript(script, args, in_dir) assert status == 0 assert "split 6 sequences (3 left, 3 right, 5 orphans)" in err, err def test_split_paired_reads_2_mixed_fq_orphans_to_file(): # test input file infile = utils.copy_test_data('paired-mixed-2.fq') in_dir = os.path.dirname(infile) outfile = utils.get_temp_filename('out.fq') script = 'split-paired-reads.py' args = ['-0', outfile, infile] status, out, err = utils.runscript(script, args, in_dir) assert status == 0 assert "split 6 sequences (3 left, 3 right, 5 orphans)" in err, err n_orphans = len([1 for record in screed.open(outfile)]) assert n_orphans == 5 n_left = len([1 for record in screed.open(infile + '.1')]) assert n_left == 3 n_right = len([1 for record in screed.open(infile + '.2')]) assert n_right == 3 for filename in [outfile, infile + '.1', infile + '.2']: fp = gzip.open(filename) try: fp.read() except IOError as e: assert "Not a gzipped file" in str(e), str(e) fp.close() def test_split_paired_reads_2_mixed_fq_gzfile(): # test input file infile = utils.copy_test_data('paired-mixed-2.fq') in_dir = os.path.dirname(infile) outfile = utils.get_temp_filename('out.fq') script = 'split-paired-reads.py' args = ['-0', outfile, '--gzip', infile] status, out, err = utils.runscript(script, args, in_dir) assert status == 0 assert "split 6 sequences (3 left, 3 right, 5 orphans)" in err, err n_orphans = len([1 for record in screed.open(outfile)]) assert n_orphans == 5 n_left = len([1 for record in screed.open(infile + '.1')]) assert n_left == 3 n_right = len([1 for record in screed.open(infile + '.2')]) assert n_right == 3 for filename in [outfile, infile + '.1', infile + '.2']: fp = gzip.open(filename) fp.read() # this will fail if not gzip file. fp.close() def test_split_paired_reads_2_mixed_fq_broken_pairing_format(): # test input file infile = utils.copy_test_data('paired-mixed-broken.fq') in_dir = os.path.dirname(infile) script = 'split-paired-reads.py' args = [infile] status, out, err = utils.runscript(script, args, in_dir, fail_ok=True) assert status == 1 assert "Unpaired reads found starting at 895:1:37:17593:9954" in err, err def test_split_paired_reads_3_output_dir(): # test input file infile = utils.get_test_data('paired.fq') ex_outfile1 = utils.get_test_data('paired.fq.1') ex_outfile2 = utils.get_test_data('paired.fq.2') # actual output files... testdir = utils.get_temp_filename('test') output_dir = os.path.join(os.path.dirname(testdir), "out") outfile1 = utils.get_temp_filename('paired.fq.1', output_dir) outfile2 = utils.get_temp_filename('paired.fq.2', output_dir) script = 'split-paired-reads.py' args = ['--output-dir', output_dir, infile] utils.runscript(script, args) assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 def test_split_paired_reads_3_output_files(): # test input file infile = utils.get_test_data('paired.fq') ex_outfile1 = utils.get_test_data('paired.fq.1') ex_outfile2 = utils.get_test_data('paired.fq.2') # actual output files... outfile1 = utils.get_temp_filename('xxx') output_dir = os.path.dirname(outfile1) outfile2 = utils.get_temp_filename('yyy', output_dir) script = 'split-paired-reads.py' args = ['-1', outfile1, '-2', outfile2, infile] utils.runscript(script, args) assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 def test_split_paired_reads_3_output_files_left(): # test input file infile = utils.get_test_data('paired.fq') ex_outfile1 = utils.get_test_data('paired.fq.1') ex_outfile2 = utils.get_test_data('paired.fq.2') # actual output files... outfile1 = utils.get_temp_filename('xxx') output_dir = os.path.dirname(outfile1) outfile2 = utils.get_temp_filename('paired.fq.2', output_dir) script = 'split-paired-reads.py' args = ['-d', output_dir, '-1', outfile1, infile] utils.runscript(script, args) assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 def test_split_paired_reads_3_output_files_right(): # test input file infile = utils.get_test_data('paired.fq') ex_outfile1 = utils.get_test_data('paired.fq.1') ex_outfile2 = utils.get_test_data('paired.fq.2') # actual output files... outfile1 = utils.get_temp_filename('paired.fq.1') output_dir = os.path.dirname(outfile1) outfile2 = utils.get_temp_filename('yyy', output_dir) script = 'split-paired-reads.py' args = ['-2', outfile2, '-d', output_dir, infile] utils.runscript(script, args) assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 def test_extract_paired_reads_unpaired(): # test input file infile = utils.get_test_data('random-20-a.fa') # actual output files... outfile1 = utils.get_temp_filename('unpaired.pe.fa') in_dir = os.path.dirname(outfile1) outfile2 = utils.get_temp_filename('unpaired.se.fa', in_dir) script = 'extract-paired-reads.py' args = [infile] (_, _, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert 'no paired reads!? check file formats...' in err, err def test_extract_paired_reads_1_fa(): # test input file infile = utils.get_test_data('paired-mixed.fa') ex_outfile1 = utils.get_test_data('paired-mixed.fa.pe') ex_outfile2 = utils.get_test_data('paired-mixed.fa.se') # actual output files... outfile1 = utils.get_temp_filename('paired-mixed.fa.pe') in_dir = os.path.dirname(outfile1) outfile2 = utils.get_temp_filename('paired-mixed.fa.se', in_dir) script = 'extract-paired-reads.py' args = [infile] utils.runscript(script, args, in_dir) assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 def test_extract_paired_reads_2_fq(): # test input file infile = utils.get_test_data('paired-mixed.fq') ex_outfile1 = utils.get_test_data('paired-mixed.fq.pe') ex_outfile2 = utils.get_test_data('paired-mixed.fq.se') # actual output files... outfile1 = utils.get_temp_filename('paired-mixed.fq.pe') in_dir = os.path.dirname(outfile1) outfile2 = utils.get_temp_filename('paired-mixed.fq.se', in_dir) script = 'extract-paired-reads.py' args = [infile] utils.runscript(script, args, in_dir) assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name, (r.name, q.name, n) assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert r.quality == q.quality assert n > 0 def test_extract_paired_reads_3_output_dir(): # test input file infile = utils.get_test_data('paired-mixed.fa') ex_outfile1 = utils.get_test_data('paired-mixed.fa.pe') ex_outfile2 = utils.get_test_data('paired-mixed.fa.se') # output directory out_dir = utils.get_temp_filename('output') script = 'extract-paired-reads.py' args = [infile, '-d', out_dir] utils.runscript(script, args) outfile1 = os.path.join(out_dir, 'paired-mixed.fa.pe') outfile2 = os.path.join(out_dir, 'paired-mixed.fa.se') assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 def test_extract_paired_reads_4_output_files(): # test input file infile = utils.get_test_data('paired-mixed.fa') ex_outfile1 = utils.get_test_data('paired-mixed.fa.pe') ex_outfile2 = utils.get_test_data('paired-mixed.fa.se') # actual output files... outfile1 = utils.get_temp_filename('out_pe') outfile2 = utils.get_temp_filename('out_se') script = 'extract-paired-reads.py' args = [infile, '-p', outfile1, '-s', outfile2] utils.runscript(script, args) assert os.path.exists(outfile1), outfile1 assert os.path.exists(outfile2), outfile2 n = 0 for r, q in zip(screed.open(ex_outfile1), screed.open(outfile1)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 n = 0 for r, q in zip(screed.open(ex_outfile2), screed.open(outfile2)): n += 1 assert r.name == q.name assert r.sequence == q.sequence assert n > 0 def test_extract_paired_reads_5_stdin_error(): script = 'extract-paired-reads.py' args = ['-f', '/dev/stdin'] status, out, err = utils.runscript(script, args, fail_ok=True) assert status == 1 assert "output filenames must be provided." in err def test_read_bundler(): infile = utils.get_test_data('unclean-reads.fastq') records = [r for r in khmer.ReadParser(infile)] bundle = khmer.utils.ReadBundle(*records) raw_seqs = ( 'GGTTGACGGGGNNNAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCG' 'GGGCGGAGGCCGCAGACGCGAGTGGTGGAGG', 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGANNNCCG' 'GGGCGGAGGCCGCAGACGCGAGTGGTGGAGG', ) cleaned_seqs = ( 'GGTTGACGGGGAAAAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGATTTCCG' 'GGGCGGAGGCCGCAGACGCGAGTGGTGGAGG', 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGCAGCTGTCGTCAGGGGAAAACCG' 'GGGCGGAGGCCGCAGACGCGAGTGGTGGAGG', ) assert bundle.num_reads == 2 assert bundle.total_length == 200 for read, raw_seq, clean_seq in zip(bundle.reads, raw_seqs, cleaned_seqs): assert read.sequence == raw_seq assert read.cleaned_seq == clean_seq def test_read_bundler_single_read(): infile = utils.get_test_data('single-read.fq') records = [r for r in khmer.ReadParser(infile)] bundle = khmer.utils.ReadBundle(*records) assert bundle.num_reads == 1 assert bundle.reads[0].sequence == bundle.reads[0].cleaned_seq def test_read_bundler_empty_file(): infile = utils.get_test_data('empty-file') with pytest.raises(OSError): records = [r for r in khmer.ReadParser(infile)] def test_read_bundler_empty_list(): bundle = khmer.utils.ReadBundle(*[]) assert bundle.num_reads == 0
995,746
237c61b029e98b65dc2375ed8446f70cb7ac6478
l=[1,2,3,4,5,6,7,8,9,10] s=list(filter(lambda x:x%2==0,l)) print(s) s1=list(filter(lambda x:x%2!=0,l)) print(s1) """ output: ------- [2, 4, 6, 8, 10] """
995,747
3cd1f9d24feeceddb6a8bb5cd623ceaa18263d24
import platform import time import collections from twisted.internet import reactor,defer, task from twisted.internet.protocol import Factory, Protocol from twisted.internet.endpoints import SSL4ClientEndpoint from twisted.internet.ssl import CertificateOptions import MumbleControlProtocol import MumbleVoiceProtocol class _ControlFactory(Factory): def __init__(self,client): self.mumbleClient=client def buildProtocol(self,addr): return MumbleControlProtocol.MumbleControlProtocol(self.mumbleClient) class MumbleSettings(object): """ Object to hold settings passed to a MumbleClient. Settings used by the base client are: .host defaults to "localhost". At this time MumbleClient is ipv4 only .port defaults to 64738 .nickname defaults to "MumblePythonBot" .password defaults to "None" .SSLOptions By default a new instance of twisted.internet.ssl.CertificateOptions You can assign to a custom instance to provide a client certificate and/or verify the server certificate. See the twisted documentation for details You can pass in implementation-specific settings in this object. They will be ignored by the base client. """ def __init__(self): """ Sets defaults for all required options. These can be altered as required, and implementation-specific settings added """ self.host="localhost" """ :annotation = "localhost": defaults to "localhost". At this time MumbleClient is ipv4 only """ self.port=64738 self.nickname="MumblePythonBot" self.SSLOptions=CertificateOptions() self.password=None class User(object): """Stores all information known about a user at this time""" pass class _MumbleState(object): def __init__(self): self.numTCPPings=0 self.avgTCPPing=0 self.users=collections.defaultdict(User) class Foo(object): pass class MumbleClient(object): """ An object representing a mumble client which uses twisted as an event and network handler. This should be inherited and methods overridden or implemented to create specific clients. Client life-cycle: - Client will connect to TCP control protocol on the specified host and port. .controlConnected is a twisted Deferred that will make a callback when this occurs - After a sucessfull connection, client will try to send three control messages :meth:`versionMessage`, :meth:`authenticationMessage` and :meth:`codecVersionMessage` are called in order and the results sent. To alter the contents of these messages (assuming no setting exists), it is probably easiest to override the function, call the parent to get the "base" message, and alter what you wish - The server should then send channel and user information - The server will then send a ServerSync message. This triggers the .clientConnected callback, and the :meth:`ServerSyncReceived` method is called. At this time the .sessionID variable is set - Every 5 seconds, the :meth:`pingMessage`: method is called, and the message returned sent to the server - When the client disconnects, the .clientDisconnected Deferred is triggered (probably via errback and not callback) and the :meth:`connectionLost` method called. In general, the client is informed of activity via method calls. Outside the object, the program is informed of (some) activity via the 3 Deferred objects, with more details functionality being the responsiblility of the implementer In general, if a message Foo is received by the client, the method FooReceived(self,message) will be called. See MumbleControlProtocol for a list of MessageTypes. Some are implemented in this class and can be overridden; some are not needed for base functionality but will be called if defined. The exception is the UDPTunnel message, which is one of two possible ways voice data can be received. In these cases the :meth:`VoiceMessageRecieved` function is called whether the voice source was UDP or TCP. To tell if a message affects you, compare the message's session (target) or, optionally, actor (source) to self.sessionID. Note that you cannot react to events (cannot send arbitrary messages) until just before :meth:`ServerSyncReceived` has been called, which sets sessionID. (Note that UDP is not currently supported) """ def __init__(self,settings=None): self.sessionID=None if settings is None: settings = MumbleSettings() self.settings=settings self.state=_MumbleState() self.clientConnected = defer.Deferred() self.clientDisconnected = defer.Deferred() def connect(self): """ Asks the client to connect the control protocol Returns a deferred which will callback when the connection suceeds. This can also be accessed via the controlConnected attribute. Note that this only indicates a TCP connection, which might, if the client supplies incorrect authentication details, be immediately closed. The clientConnected attribute is a Deferred which will return when the login phase is complete. :return: A Deferred """ self.point=SSL4ClientEndpoint(reactor, self.settings.host, self.settings.port,self.settings.SSLOptions) self.controlConnected = self.point.connect(_ControlFactory(self)) return self.controlConnected def _controlMessageReceived(self,type,name,messageObject): #print(type,name,messageObject,str(dir(messageObject))) #print(type,name,messageObject) try: f = getattr(self,"_"+name+"Received") except AttributeError: f=None if callable(f): f(messageObject) try: f = getattr(self,name+"Received") except AttributeError: f = None if callable(f): f(messageObject) def _PingReceived(self,message): now = int(time.time()*1000000) timestamp = message.timestamp if timestamp == self.state.lastTCPTimeStamp: self.state.avgTCPPing = (now - timestamp) / 1000.0 def _ServerSyncReceived(self,message): self.sessionID=message.session self.clientConnected.callback(True) def _UserStateReceived(self,message): user = self.state.users[message.session] for i in message.ListFields(): name = i[0].name value = i[1] if name != "actor": setattr(user,name,value) #print("adding k=%s v=%s for session=%s" % (name,value,message.session)) def _UserRemoveReceived(self,message): self.state.users.pop(message.session,None) def _TCPVoiceMessageReceived(self,data): prefix,session,data = MumbleVoiceProtocol.decodeAudioMessage(data) self.VoiceMessageReceived(prefix,session,data,TCP=True) def _unknownMessageReceived(self,type,data): pass def _connectionMade(self): self.state.initialTime=time.time() self.sendMessage(self.versionMessage()) self.sendMessage(self.authenticationMessage()) self.sendMessage(self.codecVersionMessage()) self.state.pingTask = task.LoopingCall(self._pingTask) self.state.pingTaskDeferred = self.state.pingTask.start(5.0,now=False) self.state.pingTaskDeferred.addErrback(self.errorCallback) def _connectionLost(self,reason): self.clientDisconnected.callback(reason) self.connectionLost(reason) def _pingTask(self): self.sendMessage(self.pingMessage()) def ServerSyncReceived(self,message): """ Called upon receipt of a ServerSync message By the time this is called, sessionID will be set to the client's session and the clientConnected callback will have completed. :param message: A ServerSync message object """ def sendVoiceMessage(self,data): """ Send a voice message via the active voice channel :param str data: A stream of bytes This will send data either via the TCP control channel or the UDP voice channel if the latter is active. Data should be a stream of bytes in mumble's voice format. """ self.controlProtocol.sendVoiceMessage(data) def connectionLost(self,reason): """ Called when a connection is lost to the control protocol This is called after the clientDisconnected callback is returned. Implementors can override this method or listen for the callback, depending on use-case """ pass def VoiceMessageReceived(self,prefix,session,data,TCP=False): """ Called when voice data is received :param str prefix: The one-byte message header indicating codec type and if this was a standard or direct transmission :param int session: The session ID of the source of the transmission :param str data: The voice data, consisting of a series of voice frames and optionally positional audio at the end If you simply wish to output the voice data again, you can call sendVoiceMessage and pass in prefix + data as the data. Implementors should override this method to process voice data. """ pass def sendMessage(self,message): """ Send a control message If you call this method with :obj:`None`, it will ignore the call. This behavior is so implementers can cancel the sending of an automatic message (like Ping) by overriding :meth:`pingMessage` and returning None :param message: Any kind of TCP control message, or :obj:`None` """ if message is not None: self.controlProtocol.sendMessage(message) def sendTextMessage(self,message): tm = MumbleControlProtocol.TextMessage() tm.actor = self.sessionID tm.channel_id.append(self.channelID) tm.message = message self.sendMessage(tm) def versionMessage(self): """ Called by the client to ask what message to send when it should send a Version message on initial connect. To change the message it's probably easiest to call the superclass method and alter the appropriate fields. :return: a Version object """ message = MumbleControlProtocol.Version() message.release="1.2.5" message.version=66053 message.os=platform.system() message.os_version="evebot1.0.2" return message def authenticationMessage(self): """ Called by the client to ask what message to send when it should send an Authenticate message on initial connect. To change the message it's probably easiest to call the superclass method and alter the appropriate fields. :return: an Authenticate object """ message = MumbleControlProtocol.Authenticate() message.username=self.settings.nickname if self.settings.password is not None: message.password=self.settings.password message.celt_versions.append(-2147483637) message.celt_versions.append(-2147483632) message.opus=True return message def codecVersionMessage(self): """ Called by the client to ask what message to send when it should send a CodecVersion message on initial connect. To change the message it's probably easiest to call the superclass method and alter the appropriate fields. :return: a CodecVersion object """ message = MumbleControlProtocol.CodecVersion() message.alpha=-2147483637 message.beta=0 message.prefer_alpha=True return message def pingMessage(self): """ Called by the client to ask what message to send when it should send a Ping message every five seconds. To change the message it's probably easiest to call the superclass method and alter the appropriate fields. :return: a Ping object """ message = MumbleControlProtocol.Ping() timestamp = int(time.time()*1000000) message.timestamp=timestamp message.good=0 message.late=0 message.lost=0 message.resync=0 message.udp_packets=0 message.tcp_packets=self.state.numTCPPings message.udp_ping_avg=0 message.udp_ping_var=0.0 message.tcp_ping_avg=self.state.avgTCPPing message.tcp_ping_var=0 self.state.numTCPPings+=1 self.state.lastTCPTimeStamp=timestamp return message def disconnect(self): """ Ask the client to disconnect the control channel When sucessful, the .clientDisconnected Deferred is triggered (probably via errback and not callback) """ self.controlProtocol.disconnect() def errorCallback(self,result): print result return result class AutoChannelJoinClient(MumbleClient): def ChannelStateReceived(self,message): if message.name==self.settings._autojoin_joinChannel: self.channelID = message.channel_id print(message.name,message.channel_id,message.description) def _ServerSyncReceived(self,message): super(AutoChannelJoinClient,self)._ServerSyncReceived(message) #MumbleClient._ServerSyncReceived(self,message) newMessage = MumbleControlProtocol.UserState() newMessage.session = self.sessionID newMessage.channel_id=self.channelID self.sendMessage(newMessage) if __name__ == '__main__': c = MumbleClient() # c.connect() def stop(reason): reactor.stop() c.clientDisconnected.addBoth(stop) reactor.run()
995,748
d1921f642da4fa56bf3879d61ebf5009f854bdd6
import time if __name__ == "__main__": start_indexing_time = time.time() ''' Insert indexing functionality ''' end_indexing_time = time.time() start_retrieval_time = time.time() ''' Insert retrieval functionality ''' end_retrieval_time = time.time() elapsed_index_time = end_indexing_time - start_indexing_time elapsed_retrieval_time = end_retrieval_time - start_retrieval_time elapsed_time = elapsed_retrieval_time + elapsed_index_time print('Total running time: ', elapsed_time) print('Indexing running time: ', elapsed_index_time) print('Retrieval running time: ', elapsed_retrieval_time)
995,749
44e249876f0bd5aca94dc32337cd2e718f6e302a
from django import forms from django.core.exceptions import ValidationError from datetime import date import requests import pandas as pd class Ticker(forms.Form): ticker = forms.CharField(label='股票代碼', initial='0050') start_date = forms.DateField(label='開始日期', initial='2020-01-01', widget=forms.DateInput(attrs={'type':'date'})) end_date = forms.DateField(label='結束日期', initial=date.today().strftime("%Y-%m-%d"), widget=forms.DateInput(attrs={'type':'date'})) def clean(self): cleaned_data = super().clean() start_date = cleaned_data["start_date"] end_date = cleaned_data["end_date"] ticker = cleaned_data['ticker'] url = "https://api.finmindtrade.com/api/v3/data" parameter = { "dataset": "TaiwanStockInfo", } resp = requests.get(url, params=parameter) data = resp.json() stock_id = pd.DataFrame(data["data"]) if end_date < start_date: msg = "開始日期需早於結束日期" raise forms.ValidationError(msg) today_date = date.today() if end_date > today_date: msg = "結束日期不應大於今天日期" raise forms.ValidationError(msg) if ticker not in stock_id['stock_id'].values: msg = "無此股票代碼" raise forms.ValidationError(msg)
995,750
b9cf0747c6e106acfd8a31cd3d5dde37effd0820
import re brojReg = re.compile(r'(\d{3})-(\d{3}-\d{3})') recenica = 'Mojot domasen broj e 032-382-941, a mobilniot e 078-357-145' broevi = brojReg.findall(recenica) for i, j in broevi: print(i) print(j) print(i + '-' + j) print()
995,751
636ade553eb5d21c1b46ce90c58571844b36a19b
# Copyright (c) 2021 The Regents of the University of Michigan # All rights reserved. # This software is licensed under the BSD 3-Clause License. """Defines a circle.""" import numpy as np from .base_classes import Shape2D class Circle(Shape2D): """A circle with the given radius. Args: radius (float): Radius of the circle. center (Sequence[float]): The coordinates of the centroid of the circle (Default value: (0, 0, 0)). Example: >>> circle = coxeter.shapes.circle.Circle(radius=1.0, center=(1, 1, 1)) >>> import numpy as np >>> assert np.isclose(circle.area, np.pi) >>> circle.centroid array([1, 1, 1]) >>> assert np.isclose(circle.circumference, 2 * np.pi) >>> circle.eccentricity 0 >>> circle.gsd_shape_spec {'type': 'Sphere', 'diameter': 2.0} >>> circle.iq 1 >>> assert np.isclose(circle.perimeter, 2 * np.pi) >>> assert np.allclose( ... circle.planar_moments_inertia, ... (5. / 4. * np.pi, 5. / 4. * np.pi, np.pi)) >>> assert np.isclose(circle.polar_moment_inertia, 5. / 2. * np.pi) >>> circle.radius 1.0 """ def __init__(self, radius, center=(0, 0, 0)): self.radius = radius self.centroid = center @property def gsd_shape_spec(self): """dict: Get a :ref:`complete GSD specification <gsd:shapes>`.""" # noqa: D401 return {"type": "Sphere", "diameter": 2 * self.radius} @property def centroid(self): """:math:`(3, )` :class:`numpy.ndarray` of float: Get or set the centroid of the shape.""" # noqa: E501 return self._centroid @centroid.setter def centroid(self, value): self._centroid = np.asarray(value) @property def radius(self): """float: Get the radius of the circle.""" return self._radius @radius.setter def radius(self, value): if value > 0: self._radius = value else: raise ValueError("Radius must be greater than zero.") def _rescale(self, scale): """Multiply length scale. Args: scale (float): Scale factor. """ self.radius *= scale @property def area(self): """float: Get the area of the circle.""" return np.pi * self.radius ** 2 @area.setter def area(self, value): if value > 0: self.radius = np.sqrt(value / np.pi) else: raise ValueError("Area must be greater than zero.") @property def eccentricity(self): """float: Get the eccentricity of the circle. This is 0 by definition for circles. """ return 0 @property def perimeter(self): """float: Get the perimeter of the circle.""" return 2 * np.pi * self.radius @perimeter.setter def perimeter(self, value): if value > 0: self.radius = value / (2 * np.pi) else: raise ValueError("Perimeter must be greater than zero.") @property def circumference(self): """float: Get the circumference, alias for `Circle.perimeter`.""" return self.perimeter @circumference.setter def circumference(self, value): self.perimeter = value @property def planar_moments_inertia(self): r"""list[float, float, float]: Get the planar and product moments of inertia. Moments are computed with respect to the :math:`x` and :math:`y` axes. In addition to the two planar moments, this property also provides the product of inertia. The `planar moments <https://en.wikipedia.org/wiki/Polar_moment_of_inertia>`__ and the `product <https://en.wikipedia.org/wiki/Second_moment_of_area#Product_moment_of_area>`__ of inertia are defined by the formulas: .. math:: \begin{align} I_x &= {\int \int}_A y^2 dA = \frac{\pi}{4} r^4 = \frac{Ar^2}{4} \\ I_y &= {\int \int}_A x^2 dA = \frac{\pi}{4} r^4 = \frac{Ar^2}{4} \\ I_{xy} &= {\int \int}_A xy dA = 0 \\ \end{align} These formulas are given `here <https://en.wikipedia.org/wiki/List_of_second_moments_of_area>`__. Note that the product moment is zero by symmetry. """ # noqa: E501 area = self.area i_x = i_y = area / 4 * self.radius ** 2 i_xy = 0 # Apply parallel axis theorem from the centroid i_x += area * self.centroid[0] ** 2 i_y += area * self.centroid[1] ** 2 i_xy += area * self.centroid[0] * self.centroid[1] return i_x, i_y, i_xy def is_inside(self, points): """Determine whether a set of points are contained in this circle. .. note:: Points on the boundary of the shape will return :code:`True`. Args: points (:math:`(N, 3)` :class:`numpy.ndarray`): The points to test. Returns: :math:`(N, )` :class:`numpy.ndarray`: Boolean array indicating which points are contained in the circle. Example: >>> circle = coxeter.shapes.Circle(1.0) >>> circle.is_inside([[0, 0, 0], [20, 20, 20]]) array([ True, False]) """ points = np.atleast_2d(points) - self.centroid return np.logical_and( np.linalg.norm(points, axis=-1) <= self.radius, # At present circles are not orientable, so the z position must # match exactly. np.isclose(points[:, 2], 0), ) @property def iq(self): """float: The isoperimetric quotient. This is 1 by definition for circles. """ return 1 def distance_to_surface(self, angles): # noqa: D102 return np.ones_like(angles) * self.radius @property def minimal_bounding_circle(self): """:class:`~.Circle`: Get the smallest bounding circle.""" return Circle(self.radius, self.centroid) @property def minimal_centered_bounding_circle(self): """:class:`~.Circle`: Get the smallest bounding concentric circle.""" return Circle(self.radius, self.centroid) @property def maximal_bounding_circle(self): """:class:`~.Circle`: Get the largest bounded circle.""" return Circle(self.radius, self.centroid) @property def maximal_centered_bounded_circle(self): """:class:`~.Circle`: Get the largest bounded concentric circle.""" return Circle(self.radius, self.centroid) def __repr__(self): return ( f"coxeter.shapes.Circle(radius={self.radius}, " f"center={self.centroid.tolist()})" ) def _plato_primitive(self, backend): return backend.Disks( positions=np.array([self.center[:2]]), colors=np.array([[0.5, 0.5, 0.5, 1]]), radii=[self.radius], )
995,752
e105f56f1db0cc38e78ebf496285d1686dbd50a7
from .europian_option_fdm import EuropianOptionImplicitFDM
995,753
6e4186a4bb50d42010dee10eacbc1346eb38dbc7
# Brianna Atayan - 1632743 - batayan@ucsc.edu # Colin Maher - 1432169 - csmaher@ucsc.edu # Lily Nguyen - 1596857 - lnguye78@ucsc.edu import argparse, pandas, sys, string, numpy, sklearn.metrics, performance_metrics, word_category_counter from nltk.stem import WordNetLemmatizer from sklearn.feature_extraction.text import TfidfVectorizer from sklearn.feature_extraction.text import CountVectorizer from sklearn.ensemble import VotingClassifier from sklearn.naive_bayes import MultinomialNB from sklearn.svm import LinearSVC from sklearn.linear_model import LogisticRegression from sklearn.model_selection import cross_val_score from scipy import sparse #nltk.download() # uncomment this line to automatically install NLTK library # default file path for training data TRAINING_DATA_PATH = "train.csv" # default file path for testing data TESTING_DATA_PATH = "testset_1.csv" # default file path for output of predictions OUTPUT_PATH = "output.csv" # default file path for output of performance metrics OUTPUT_PERFORMANCE_PATH = "output_performance.txt" # declares classifies that will be trained and used for testing # global so all functions can access naiveBayesModel = MultinomialNB() linearSVCModel = LinearSVC(penalty = 'l1', dual = False) logRegModel = LogisticRegression(C = 1.5, solver = 'lbfgs', multi_class = 'multinomial', random_state = 1, max_iter=1000) def trainClassifiers(features, labels): """ Trains multiple classifiers with training set Parameters are the features set matrix and the labels of the instances Returns the trained model """ # trains each classifier on given training set classArr = VotingClassifier(estimators = [('NB', naiveBayesModel), ('linSVC', linearSVCModel), ('LR', logRegModel)], \ voting = 'hard', weights = [1, 5, 3]) classArr = classArr.fit(features, labels) return classArr def tokenize(phrase_str): """ Performs tokenization and some preprocessing operations on text data. Converts a phrase into a list of words, removes punctuation, removes non-alphabetic tokens, and lemmatizes the tokens Returns the list of tokens """ phrase = phrase_str.split(' ') # tokenize string by space character mapping = str.maketrans('', '', string.punctuation) # remove punctuation, remove non-alphabetic tokens, stem tokens phrase = [WordNetLemmatizer().lemmatize(token.translate(mapping)) for token in phrase \ if token.translate(mapping).isalpha()] return phrase liwc_categories = [ 'Total Pronouns', 'Total Function Words', 'Personal Pronouns', 'First Person Singular', 'First Person Plural', 'Second Person', 'Third Person Singular', 'Third Person Plural', ' Impersonal Pronouns', 'Articles', 'Common Verbs', 'Auxiliary Verbs', 'Past Tense', 'Present Tense', 'Future Tense', 'Adverbs', 'Prepositions', 'Conjunctions', 'Negations', 'Quantifiers', 'Number', 'Swear Words', 'Social Processes', 'Family', 'Friends', 'Humans', 'Affective Processes', 'Positive Emotion', 'Negative Emotion', 'Anxiety', 'Anger', 'Sadness', 'Cognitive Processes', 'Insight', 'Causation', 'Discrepancy', 'Tentative', 'Certainty', 'Inhibition', 'Inclusive', 'Exclusive', 'Perceptual Processes', 'See', 'Hear', 'Feel', 'Biological Processes', 'Body', 'Health', 'Sexual', 'Ingestion', 'Relativity', 'Motion', 'Space', 'Time', 'Work', 'Achievement', 'Leisure', 'Home', 'Money', 'Religion', 'Death', 'Assent', 'Nonfluencies', 'Fillers', 'Total first person', 'Total third person', 'Positive feelings', 'Optimism and energy', 'Communication', 'Other references to people', 'Up', 'Down', 'Occupation', 'School', 'Sports', 'TV','Music','Metaphysical issues', 'Physical states and functions', 'Sleeping', 'Grooming'] def get_liwc_features(train_data, test_data): """ Creates a LIWC feature extractor. NOTE: this function is currently not being used in this program. """ print("getting liwc features") train_liwc_matrix = [] test_liwc_matrix = [] for phrase in train_data: liwc_scores = word_category_counter.score_text(phrase) feature_vector = [] for key in liwc_categories: if key in liwc_scores.keys(): # print(key) # print(liwc_scores[key]) feature_vector.append(liwc_scores[key]) else: feature_vector.append(0) # print(feature_vector) train_liwc_matrix.append(feature_vector) for phrase in test_data: liwc_scores = word_category_counter.score_text(phrase) feature_vector = [] for key in liwc_categories: if key in liwc_scores.keys(): # print(key) # print(liwc_scores[key]) feature_vector.append(liwc_scores[key]) else: feature_vector.append(0) test_liwc_matrix.append(feature_vector) # print(train_liwc_matrix) return sparse.csr_matrix(train_liwc_matrix), sparse.csr_matrix(test_liwc_matrix) def get_ngram_features(train_data, test_data): """ Creates a bag of words unigram/bigram feature extractor. Fits the extractor to the training data, then applies the extractor to both the training data and the test data. Parameters are the training instances and testing instances (just the text phrases) as Series. Returns the extracted feature sets of the training and test data, as matrices. """ print("getting ngram features") ngram_vectorizer = CountVectorizer(ngram_range = (1, 2)) ngram_vectorizer = ngram_vectorizer.fit(train_data) return ngram_vectorizer.transform(train_data), ngram_vectorizer.transform(test_data) def get_idf_features(train_data, test_data): """ Creates a tfidf unigram/bigram feature extractor. Fits the extractor to the training data, then applies the extractor to both the training data and the test data. Parameters are the training instances and testing instances (just the text phrases) as Series. Returns the extracted feature sets of the training and test data, as matrices. """ tfidf = TfidfVectorizer(tokenizer = tokenize, ngram_range = (1, 2)) tfidf.fit(train_data) return tfidf.transform(train_data), tfidf.transform(test_data) def get_all_features(train_data, test_data): """ Calls all feature extractor methods to obtain the different feature sets. Parameters are the training instances and testing instances (just the text phrases) as Series. Returns the combined extracted feature sets of the training and test data, as a matrix. """ #train_wc_matrix, test_wc_matrix = get_word_count_features(train_data, test_data) train_idf_matrix, test_idf_matrix = get_idf_features(train_data, test_data) train_ngram_matrix, test_ngram_matrix = get_ngram_features(train_data, test_data) # train_liwc_matrix, test_liwc_matrix = get_liwc_features(train_data, test_data) return sparse.hstack([train_idf_matrix, train_ngram_matrix]), \ sparse.hstack([test_idf_matrix, test_ngram_matrix]) def main(): #### read in command-line arguments, if any #### parser = argparse.ArgumentParser(description = "program to predict the " "sentiment of a given phrase") parser.add_argument("--train", dest = "trainFile", \ default = TRAINING_DATA_PATH, type = str, \ help = "the path to the .csv file containing the training data") parser.add_argument("--test", dest = "testFile", \ default = TESTING_DATA_PATH, type = str, \ help = "the path to the .csv file containing the test data") parser.add_argument("--out", dest = "outFile", default = OUTPUT_PATH, \ type = str, help = "the path of the output file") parser.add_argument("--perf", dest = "perfFile", default = \ OUTPUT_PERFORMANCE_PATH, type = str, help = "the path of the performance " "output file") args = parser.parse_args() #### read training and testing data into a pandas dataframe #### try: train_data_df = pandas.read_csv(args.trainFile) except FileNotFoundError: print("Error: Training file does not exist. File must be of type csv") sys.exit(1) except: print("Error: Unknown error occurred trying to read train data file") sys.exit(1) try: test_data_df = pandas.read_csv(args.testFile) except FileNotFoundError: print("Error: Testing file does not exist. File must be of type csv") sys.exit(1) except: print("Error: Unknown error occurred trying to read test data file") sys.exit(1) #### preprocessing & feature extraction #### train_feature_set, test_feature_set = get_all_features(train_data_df["Phrase"], test_data_df["Phrase"]) print("finished getting features") # training model = trainClassifiers(train_feature_set, train_data_df["Sentiment"].tolist()) print("finished training") # test predictions_df = pandas.DataFrame(model.predict(test_feature_set)) predictions_df = pandas.concat([test_data_df["PhraseId"], predictions_df], axis = 1) predictions_df.to_csv(path_or_buf = args.outFile, header = ["PhraseId", "Sentiment"], index = False) # write performance stats to txt file #perf_out_file = open(args.perfFile, "w") #performance_metrics.get_performance_train(model, train_feature_set, train_data_df["Sentiment"].tolist(), perf_out_file, True) #performance_metrics.get_performance_cv(model, train_feature_set, train_data_df["Sentiment"].tolist(), perf_out_file, 3) #perf_out_file.close() if __name__ == '__main__': main()
995,754
979547a13da14ff3b95f8e90564d25200904e025
from lxml import etree as ET # xml.etree.ElementTree as ET does not work, # as we use components that are only available in lxml __version__ = '0.1' METS_NS = "http://www.loc.gov/METS/" XLIN_NS = "http://www.w3.org/1999/xlink" mets_nsmap = { 'mets': METS_NS, } xlin_nsmap = { 'xlin': XLIN_NS } ET.register_namespace('mets', METS_NS) ET.register_namespace('xlin', XLIN_NS) strict = True def initialise_values(element, attribs_list): for key in element.attrib: if key in attribs_list: if key in ['href', 'arcrole', 'title', 'show', 'acutate', 'to', 'FROM']: element.set("{%s}%s" % (XLIN_NS, key), element.attrib[key]) del element.attrib[key] elif key not in attribs_list: if hasattr(element, "TAG"): print("WARN: {} not allowed in element {}".format( key, element.TAG)) elif hasattr(element, "tag"): print("WARN: {} not allowed in element {}".format( key, element.tag)) else: print("WARN: problem with {}".format(key)) if strict: del element.attrib[key] class Mets(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}mets' def tounicode(self, pretty_print=False): return ET.tounicode(self, pretty_print=pretty_print) def tostring(self, pretty_print=False, encoding="unicode"): return ET.tostring(self, pretty_print=pretty_print, encoding=encoding) def write(self, filename, pretty_print=False, encoding="unicode"): if encoding in ["unicode"]: with open(filename, 'w') as f: f.write(ET.tostring(self, pretty_print=pretty_print, encoding=encoding)) else: with open(filename, 'wb') as f: f.write(ET.tostring(self, pretty_print=pretty_print, encoding=encoding)) # Generic parent classes class MetsHdr(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}metsHdr' def _init(self): initialise_values(self, ['ID', 'ADMID', 'CREATEDATE', 'LASTMODDATE', 'RECORDSTATUS']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attib['ID'] = value @property def ADMID(self): return self.attrib['ADMID'] @ADMID.setter def ADMID(self, value): self.attrib['ADMID'] = value @property def CREATEDATE(self): return self.attrib['CREATEDATE'] @CREATEDATE.setter def CREATEDATE(self, value): self.attrib['CREATEDATE'] = value @property def LASTMODDATE(self): return self.attrib['LASTMODDATE'] @LASTMODDATE.setter def LASTMODDATE(self, value): self.attrib['LASTMODDATE'] = value @property def RECORDSTATUS(self): return self.attrib['RECORDSTATUS'] @RECORDSTATUS.setter def RECORDSTATUS(self, value): self.attrib['RECORDSTATUS'] = value class DmdSec(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}dmdSec' def _init(self): initialise_values(self, ['ID']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value class AmdSec(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}amdSec' def _init(self): initialise_values(self, ['ID']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value class BehaviorSec(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}behaviorSec' def _init(self): initialise_values(self, ['ID']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value # Generic children of MetsHdr Parent class Agent(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}agent' def _init(self): initialise_values(self, ['ID', 'ROLE', 'OTHERROLE', 'TYPE', 'OTHERTYPE']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def ROLE(self): return self.attrib['ROLE'] @ROLE.setter def ROLE(self, value): self.attrib['ROLE'] = value @property def OTHERROLE(self): return self.attrib['OTHERROLE'] @OTHERROLE.setter def OTHERROLE(self, value): self.attrib['OTHERROLE'] = value @property def TYPE(self): return self.attrib['TYPE'] @TYPE.setter def TYPE(self, value): self.attrib['TYPE'] = value @property def OTHERTYPE(self): return self.attrib['OTHERTYPE'] @OTHERTYPE.setter def othertype(self, value): self.attrib['OTHERTYPE'] = value class Name(ET.ElementBase): '''A subelement of Agent. No attributes can be given - only a text value for the element. ''' TAG = '{http://www.loc.gov/METS/}name' class Note(ET.ElementBase): '''A subelement of Agent. No attributes can be given - only a text value for the element. ''' TAG = '{http://www.loc.gov/METS/}note' class AltRecordID(ET.ElementBase): '''A subelement of metsHdr. Allows one to use alternative record identifier values for the digital object represented by the METS document; the primary record identifier is stored in the OBJID attribute in the root <mets> document. ''' TAG = '{http://www.loc.gov/METS/}altRecordID' def _init(self): initialise_values(self, ['ID', 'TYPE']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def TYPE(self): return self.attrib['TYPE'] @TYPE.setter def TYPE(self, value): self.attrib['TYPE'] = value class MetsDocumentId(ET.ElementBase): '''A subelement of metsHdr. Accepted attributes are ID and TYPE.''' TAG = '{http://www.loc.gov/METS/}metsDocumentID' def _init(self): initialise_values(self, ['ID', 'TYPE']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def TYPE(self): return self.attrib['TYPE'] @TYPE.setter def TYPE(self, value): self.attrib['TYPE'] = value class MdRef(ET.ElementBase): '''The metadata reference element <mdRef> element is a generic element used throughout the METS schema to provide a pointer to metadata which resides outside the METS document. NB: <mdRef> is an empty element. The location of the metadata must be recorded in the xlink:href attribute, supplemented by the XPTR attribute as needed.''' TAG = '{http://www.loc.gov/METS/}mdRef' def __init__(self): initialise_values(self, ['ID', 'LABEL', 'XPTR', 'LOCTYPE', 'OTHERLOCTYPE', 'MDTYPE', 'OTHERMDTYPE', 'MDTYPEVERSION', 'MIMETYPE', 'SIZE', 'CREATED','CHECKSUM', 'CHECKSUMTYPE', 'href']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def LABEL(self): return self.attrib['LABEL'] @LABEL.setter def LABEL(self, value): self.attrib['LABEL'] = value @property def XPTR(self): return self.attrib['XPTR'] @XPTR.setter def XPTR(self, value): self.attrib['XPTR'] = value @property def LOCTYPE(self): return self.attrib['LOCTYPE'] @LOCTYPE.setter def LOCTYPE(self, value): self.attrib['LOCTYPE'] = value @property def OTHERLOCTYPE(self): return self.attrib['OTHERLOCTYPE'] @OTHERLOCTYPE.setter def OTHERLOCTYPE(self, value): self.attrib['OTHERLOCTYPE'] = value @property def MDTYPE(self): return self.attrib['MDTYPE'] @MDTYPE.setter def MDTYPE(self, value): self.attrib['MDTYPE'] = value @property def OTHERMDTYPE(self): return self.attrib['OTHERMDTYPE'] @OTHERMDTYPE.setter def OTHERMDTYPE(self, value): self.attrib['OTHERMDTYPE'] = value @property def MDTYPEVERSION(self): return self.attrib['MDTYPEVERSION'] @MDTYPEVERSION.setter def MDTYPEVERSION(self, value): self.attrib['MDTYPEVERSION'] = value @property def MIMETYPE(self): return self.attrib['MIMETYPE'] @MIMETYPE.setter def MIMETYPE(self, value): self.attrib['MIMETYPE'] = value @property def SIZE(self): return self.attrib['SIZE'] @SIZE.setter def SIZE(self, value): self.attrib['SIZE'] = value @property def CREATED(self): return self.attrib['CREATED'] @CREATED.setter def CREATED(self, value): self.attrib['CREATED'] = value @property def CHECKSUM(self): return self.attrib['CHECKSUM'] @CHECKSUM.setter def CHECKSUM(self, value): self.attrib['CHECKSUM'] = value @property def CHECKSUMTYPE(self): return self.attrib['CHECKSUMTYPE'] @CHECKSUMTYPE.setter def CHECKSUMTYPE(self, value): self.attrib['CHECKSUMTYPE'] = value @property def href(self): return self.attrib['{http://www.w3.org/1999/xlink}href'] @href.setter def href(self, value): self.attrib['{http://www.w3.org/1999/xlink}href'] = value class MdWrap(ET.ElementBase): '''A subelement of dmdSec, techMD, rightsMD, sourceMD and digiProvMd. It is used to wrap metadata from other schemas, such as PREMIS. ''' TAG = '{http://www.loc.gov/METS/}mdWrap' def _init(self): initialise_values(self, ['ID', 'LABEL', # Metadata attribute group 'MDTYPE', 'OTHERMDTYPE', 'MDTYPEVERSION', 'MIMETYPE', 'SIZE', 'CREATED', 'CHECKSUM', 'CHECKSUMTYPE']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def LABEL(self): return self.attrib['LABEL'] @LABEL.setter def LABEL(self, value): self.attrib['LABEL'] = value @property def MDTYPE(self): return self.attrib['MDTYPE'] @MDTYPE.setter def MDTYPE(self, value): self.attrib['MDTYPE'] = value @property def OTHERMDTYPE(self): return self.attrib['OTHERMDTYPE'] @OTHERMDTYPE.setter def OTHERMDTYPE(self, value): self.attrib['OTHERMDTYPE'] = value @property def MDTYPEVERSION(self): return self.attrib['MDTYPEVERSION'] @MDTYPEVERSION.setter def MDTYPEVERSION(self, value): self.attrib['MDTYPEVERSION'] = value @property def MIMETYPE(self): return self.attrib['MIMETYPE'] @MIMETYPE.setter def MIMETYPE(self, value): self.attrib['MIMETYPE'] = value @property def SIZE(self): return self.attrib['SIZE'] @SIZE.setter def SIZE(self, value): self.attrib['SIZE'] = value @property def CREATED(self): return self.attrib['CREATED'] @CREATED.setter def CREATED(self, value): self.attrib['CREATED'] = value @property def CHECKSUM(self): return self.attrib['CHECKSUM'] @CHECKSUM.setter def CHECKSUM(self, value): self.attrib['CHECKSUM'] = value @property def CHECKSUMTYPE(self): return self.attrib['CHECKSUMTYPE'] @CHECKSUMTYPE.setter def CHECKSUMTYPE(self, value): self.attrib['CHECKSUMTYPE'] = value class XmlData(ET.ElementBase): '''The xml data wrapper element <xmlData> is used to contain XML encoded metadata. The content of an <xmlData> element can be in any namespace or in no namespace. As permitted by the XML Schema Standard, the processContents attribute value for the metadata in an <xmlData> is set to "lax". Therefore, if the source schema and its location are identified by means of an XML schemaLocation attribute, then an XML processor will validate the elements for which it can find declarations. If a source schema is not identified, or cannot be found at the specified schemaLocation, then an XML validator will check for well-formedness, but otherwise skip over the elements appearing in the <xmlData> element. ''' TAG = '{http://www.loc.gov/METS/}xmlData' class BinData(ET.ElementBase): '''The binary data wrapper element <binData> is used to contain Base64 encoded metadata. ''' TAG = '{http://www.loc.gov/METS/}binData' # Generic children of AMD Parent class MdExt(ET.ElementBase): '''Generic parent class of techMd, rightsMD, sourceMD and digiprovMd. Not intended to be called directly. ''' def _init(self, element_name=None): self.tag = '{http://www.loc.gov/METS/}' + element_name initialise_values(self, ['ID', 'ADMID', 'CREATED', 'STATUS']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def ADMID(self): return self.attrib['ADMID'] @ADMID.setter def ADMID(self, value): self.attrib['ADMID'] = value @property def CREATED(self): return self.attrib['CREATED'] @CREATED.setter def CREATED(self, value): self.attrib['CREATED'] = value @property def STATUS(self): return self.attrib['STATUS'] @STATUS.setter def STATUS(self, value): self.attrib['STATUS'] = value class TechMd(MdExt): def _init(self, **kwargs): super(TechMd, self)._init("techMD", **kwargs) class RightsMd(MdExt): def _init(self, **kwargs): super(RightsMd, self)._init("rightsMD", **kwargs) class SourceMd(MdExt): def _init(self, **kwargs): super(SourceMd, self)._init("sourceMD", **kwargs) class DigiprovMd(MdExt): def _init(self, **kwargs): super(DigiprovMd, self)._init("digiprovMD", **kwargs) class FileSec(ET.ElementBase): '''The overall purpose of the content file section element <fileSec> is to provide an inventory of and the location for the content files that comprise the digital object being described in the METS document. ''' TAG = '{http://www.loc.gov/METS/}fileSec' class FileGrp(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}fileGrp' def _init(self): initialise_values(self, ['ID', 'VERSDATE', 'ADMID', 'USE']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def VERSDATE(self): return self.attrib['VERSDATE'] @VERSDATE.setter def VERSDATE(self, value): self.attrib['VERSDATE'] = value @property def ADMID(self): return self.attrib['ADMID'] @ADMID.setter def ADMID(self, value): self.attrib['ADMID'] = value @property def USE(self): return self.attrib['USE'] @USE.setter def USE(self, value): self.attrib['USE'] = value class File(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}file' def _init(self): initialise_values(self, ['ID', 'SEQ', 'OWNERID', 'ADMID', 'DMDID', 'GROUPID', 'USE', 'BEGIN', 'END', 'BETYPE']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def SEQ(self): return self.attrib['SEQ'] @SEQ.setter def SEQ(self, value): self.attrib['SEQ'] = value @property def OWNERID(self): return self.attrib['OWNERID'] @OWNERID.setter def OWNERID(self, value): self.attrib['OWNERID'] = value @property def ADMID(self): return self.attrib['ADMID'] @ADMID.setter def ADMID(self, value): self.attrib['ADMID'] = value @property def DMDID(self): return self.attrib['DMDID'] @DMDID.setter def DMDID(self, value): self.attrib['DMDID'] = value @property def USE(self): return self.attrib['USE'] @USE.setter def USE(self, value): self.attrib['USE'] = value @property def BEGIN(self): return self.attrib['BEGIN'] @BEGIN.setter def BEGIN(self, value): self.attrib['BEGIN'] = value @property def END(self): return self.attrib['END'] @END.setter def END(self, value): self.attrib['END'] = value @property def BETYPE(self): return self.attrib['BETYPE'] @BETYPE.setter def BETYPE(self, value): self.attrib['BETYPE'] = value class FLocat(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}FLocat' def _init(self): initialise_values(self, ['ID', 'USE', 'LOCTYPE', 'OTHERLOCTYPE', 'href']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def USE(self): return self.attrib['USE'] @USE.setter def USE(self, value): self.attrib['USE'] = value @property def LOCTYPE(self): return self.attrib['LOCTYPE'] @LOCTYPE.setter def LOCTYPE(self, value): self.attrib['LOCTYPE'] = value @property def OTHERLOCTYPE(self): return self.attrib['OTHERLOCTYPE'] @OTHERLOCTYPE.setter def OTHERLOCTYPE(self, value): self.attrib['OTHERLOCTYPE'] = value @property def href(self): return self.attrib['{http://www.w3.org/1999/xlink}href'] @href.setter def href(self, value): self.attrib['{http://www.w3.org/1999/xlink}href'] = value class FContent(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}FContent' def _init(self): initialise_values(self, ['ID', 'USE']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def USE(self): return self.attrib['USE'] @USE.setter def USE(self, value): self.attrib['USE'] = value class Stream(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}stream' def _init(self): # "streamType" is something of an anomaly here, as it is the only # attribute whose spelling is in camelCase (except for xlin:href). # As such, we should case for if it is supplied in all-caps. for attrib_value in self.attrib: if attrib_value == 'STREAMTYPE': self.attrib['streamType'] = self.attrib[attrib_value] del self.attrib[attrib_value ] initialise_values(self, ['ID', 'OWNERID', 'ADMID', 'DMDID', 'BEGIN', 'END', 'BETYPE', 'streamType']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def OWNERID(self): return self.attrib['OWNERID'] @OWNERID.setter def OWNERID(self, value): self.attrib['OWNERID'] = value @property def ADMID(self): return self.attrib['ADMID'] @ADMID.setter def ADMID(self, value): self.attrib['ADMID'] = value @property def DMDID(self): return self.attrib['DMDID'] @DMDID.setter def DMDID(self, value): self.attrib['DMDID'] = value @property def BEGIN(self): return self.attrib['BEGIN'] @BEGIN.setter def BEGIN(self, value): self.attrib['BEGIN'] = value @property def END(self): return self.attrib['END'] @END.setter def END(self, value): self.attrib['END'] = value @property def BETYPE(self): return self.attrib['BETYPE'] @BETYPE.setter def BETYPE(self, value): self.attrib['BETYPE'] = value @property def streamType(self): return self.attrib['streamType'] @streamType.setter def streamType(self, value): self.attrib['streamType'] = value class TransformFile(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}transformFile' def _init(self): initialise_values(self, ['ID', 'TRANSFORMTYPE', 'TRANSFORMALGORITHM', 'TRANSFORMKEY', 'TRANSFORMBEHAVIOR', 'TRANSFORMORDER']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def TRANSFORMTYPE(self): return self.attrib['TRANSFORMTYPE'] @TRANSFORMTYPE.setter def TRANSFORMTYPE(self, value): self.attrib['TRANSFORMTYPE'] = value @property def TRANSFORMALGORITHM(self): return self.attrib['TRANSFORMALGORITHM'] @TRANSFORMALGORITHM.setter def TRANSFORMALGORITHM(self, value): self.attrib['TRANSFORMALGORITHM'] = value @property def TRANSFORMKEY(self): return self.attrib['TRANSFORMKEY'] @TRANSFORMKEY.setter def TRANSFORMKEY(self, value): self.attrib['TRANSFORMKEY'] = value @property def TRANSFORMBEHAVIOR(self): return self.attrib['TRANSFORMBEHAVIOR'] @TRANSFORMBEHAVIOR.setter def TRANSFORMBEHAVIOR(self, value): self.attrib['TRANSFORMBEHAVIOR'] = value @property def TRANSFORMORDER(self): return self.attrib['TRANSFORMORDER'] @TRANSFORMORDER.setter def TRANSFORMORDER(self, value): self.attrib['TRANSFORMORDER'] = value # structMap classes class StructMap(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}structMap' def _init(self): initialise_values(self, ['ID', 'TYPE', 'LABEL']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def TYPE(self): return self.attrib['TYPE'] @TYPE.setter def TYPE(self, value): self.attrib['TYPE'] = value @property def LABEL(self): return self.attrib['LABEL'] @LABEL.setter def LABEL(self, value): self.attrib['LABEL'] = value class Div(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}div' def _init(self): initialise_values(self, ['ID', 'ORDER', 'ORDERLABEL', 'LABEL', 'DMDID', 'ADMID', 'TYPE', 'CONTENTIDS']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def ORDER(self): return self.attrib['ORDER'] @ORDER.setter def ORDER(self, value): self.attrib['ORDER'] = value @property def ORDERLABEL(self): return self.attrib['ORDERLABEL'] @ORDERLABEL.setter def ORDERLABEL(self, value): self.attrib['ORDERLABEL'] = value @property def LABEL(self): return self.attrib['LABEL'] @LABEL.setter def LABEL(self, value): self.attrib['LABEL'] = value @property def DMDID(self): return self.attrib['DMDID'] @DMDID.setter def DMDID(self, value): self.attrib['DMDID'] = value @property def ADMID(self): return self.attrib['ADMID'] @DMDID.setter def ADMID(self, value): self.attrib['ADMID'] = value @property def TYPE(self): return self.attrib['TYPE'] @TYPE.setter def TYPE(self, value): self.attrib['TYPE'] = value @property def CONTENTIDS(self): return self.attrib['CONTENTIDS'] @CONTENTIDS.setter def CONTENTIDS(self, value): self.attrib['CONTENTIDS'] = value class Mptr(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}mptr' def _init(self): initialise_values(self, ['ID', 'CONTENTIDS', 'LOCTYPE', 'OTHERLOCTYPE', ]) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def CONTENTIDS(self): return self.attrib['CONTENTIDS'] @CONTENTIDS.setter def CONTENTIDS(self, value): self.attrib['CONTENTIDS'] = value @property def LOCTYPE(self): return self.attrib['LOCTYPE'] @LOCTYPE.setter def LOCTYPE(self, value): self.attrib['LOCTYPE'] = value @property def OTHERLOCTYPE(self): return self.attrib['OTHERLOCTYPE'] @OTHERLOCTYPE.setter def OTHERLOCTYPE(self, value): self.attrib['OTHERLOCTYPE'] = value class Fptr(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}fptr' def _init(self): initialise_values(self, ['ID', 'FILEID', 'CONTENTIDS']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def FILEID(self): return self.attrib['FILEID'] @FILEID.setter def FILEID(self, value): self.attrib['FILEID'] = value @property def CONTENTIDS(self): return self.attrib['CONTENTIDS'] @CONTENTIDS.setter def CONTENTIDS(self, value): self.attrib['CONTENTIDS'] = value class Par(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}par' def _init(self): initialise_values(self, 'ID') @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value class Seq(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}seq' def _init(self): initialise_values(self, ['ID']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value class Area(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}area' def _init(self): initialise_values(self, ['ID', 'FILEID', 'SHAPE', 'COORDS', 'BEGIN', 'END', 'BETYPE', 'EXTENT', 'EXTTYPE', 'ADMID', 'CONTENTIDS']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def FILEID(self): return self.attrib['FILEID'] @FILEID.setter def FILEID(self, value): self.attrib['FILEID'] = value @property def SHAPE(self): return self.attrib['SHAPE'] @SHAPE.setter def SHAPE(self, value): self.attrib['SHAPE'] = value @property def COORDS(self): return self.attrib['COORDS'] @COORDS.setter def COORDS(self, value): self.attrib['COORDS'] = value @property def BEGIN(self): return self.attrib['BEGIN'] @BEGIN.setter def BEGIN(self, value): self.attrib['BEGIN'] = value @property def END(self): return self.attrib['END'] @END.setter def END(self, value): self.attrib['END'] = value @property def BETYPE(self): return self.attrib['BETYPE'] @BETYPE.setter def BETYPE(self, value): self.attrib['BETYPE'] = value @property def EXTENT(self): return self.attrib['EXTENT'] @EXTENT.setter def EXTENT(self, value): self.attrib['EXTENT'] = value @property def EXTTYPE(self): return self.attrib['EXTTYPE'] @EXTTYPE.setter def EXTTYPE(self, value): self.attrib['EXTTYPE'] = value @property def ADMID(self): return self.attrib['ADMID'] @ADMID.setter def ADMID(self, value): self.attrib['ADMID'] = value @property def CONTENTIDS(self): return self.attrib['CONTENTIDS'] @CONTENTIDS.setter def CONTENTIDS(self, value): self.attrib['CONTENTIDS'] = value class SmLink(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}smLink' def _init(self): initialise_values(self, ['ID', 'arcrole', 'title', 'show', 'actuate', 'to', 'from']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def arcrole(self): return self.attrib['{http://www.w3.org/1999/xlink}arcrole'] @arcrole.setter def arcrole(self, value): self.attrib['{http://www.w3.org/1999/xlink}arcrole'] = value @property def title(self): return self.attrib['{http://www.w3.org/1999/xlink}title'] @title.setter def title(self, value): self.attrib['{http://www.w3.org/1999/xlink}title'] = value @property def show(self): return self.attrib['{http://www.w3.org/1999/xlink}show'] @show.setter def show(self, value): self.attrib['{http://www.w3.org/1999/xlink}show'] = value @property def actuate(self): return self.attrib['{http://www.w3.org/1999/xlink}actuate'] @actuate.setter def actuate(self, value): self.attrib['{http://www.w3.org/1999/xlink}actuate'] = value @property def to(self): return self.attrib['{http://www.w3.org/1999/xlink}to'] @to.setter def to(self, value): self.attrib['{http://www.w3.org/1999/xlink}to'] = value @property def FROM(self): return self.attrib['{http://www.w3.org/1999/xlink}from'] @to.setter def FROM(self, value): self.attrib['{http://www.w3.org/1999/xlink}from'] = value class SmLinkGrp(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}smLinkGrp' def _init(self): initialise_values(self, ['ID', 'ARCLINKORDER']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def ARCLINKORDER(self): return self.attrib['ARCLINKORDER'] @ARCLINKORDER.setter def ARCLINKORDER(self, value): self.attrib['ARCLINKORDER'] = value class SmLocatorLink(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}smLocatorLink' def _init(self): initialise_values(self, ['ID']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self): self.attrib['ID'] = value class SmArcLink(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}smArcLink' def _init(self): initialise_values(self, ['ID', 'ARCTYPE', 'ADMID']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self): self.attrib['ID'] = value @property def ARCTYPE(self): return self.attrib['ARCTYPE'] @ID.setter def ARCTYPE(self): self.attrib['ARCTYPE'] = value @property def ADMID(self): return self.attrib['ADMID'] @ID.setter def ADMID(self): self.attrib['ADMID'] = value class Behavior(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}behavior' def _init(self): initialise_values(self, ['ID', 'STRUCTID', 'BTYPE', 'CREATED', 'LABEL', 'GROUPID', 'ADMID']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def STRUCTID(self): return self.attrib['STRUCTID'] @STRUCTID.setter def STRUCTID(self, value): self.attrib['STRUCTID'] = value @property def BTYPE(self): return self.attrib['BTYPE'] @BTYPE.setter def BTYPE(self, value): self.attrib['BTYPE'] = value @property def CREATED(self): return self.attrib['CREATED'] @CREATED.setter def CREATED(self, value): self.attrib['CREATED'] = value @property def LABEL(self): return self.attrib['LABEL'] @LABEL.setter def LABEL(self, value): self.attrib['LABEL'] = value @property def GROUPID(self): return self.attrib['GROUPID'] @GROUPID.setter def GROUPID(self, value): self.attrib['GROUPID'] = value @property def ADMID(self): return self.attrib['ADMID'] @ADMID.setter def ADMID(self, value): self.attrib['ADMID'] = value class InterfaceDef(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}interfaceDef' def _init(self): initialise_values(self, ['ID', 'LABEL']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def LABEL(self): return self.attrib['LABEL'] @LABEL.setter def LABEL(self, value): self.attrib['LABEL'] = value class Mechanism(ET.ElementBase): TAG = '{http://www.loc.gov/METS/}mechanism' def _init(self): initialise_values(self, ['ID', 'LABEL']) @property def ID(self): return self.attrib['ID'] @ID.setter def ID(self, value): self.attrib['ID'] = value @property def LABEL(self): return self.attrib['LABEL'] @LABEL.setter def LABEL(self, value): self.attrib['LABEL'] = value
995,755
6e7401263fed66f6e8a303bc6aa91d99aef08864
def gcd(x,y): if x%y!=0: return gcd(y,x%y) else: return y def GCD(x,y,z): return gcd(gcd(x,y),z) ans=0 K=int(input()) for a in range(1,K+1): for b in range(1,K+1): for c in range(1,K+1): ans+=GCD(a,b,c) print(ans)
995,756
1bc55bd721211fb233de9c75f9d2366068b9eccd
from django.urls import path, include from . import views from rest_framework.routers import DefaultRouter router = DefaultRouter(trailing_slash=False) router.register(r'', views.RatingViewSet, basename="rating") urlpatterns = [ path('map/', views.get_cinema_width, name='get_cinema_width'), path('map/<int:cinema_id>/movie/', views.get_fast_movie, name='get_fast_movie'), path('<int:cinema_id>/', views.cinema_detail, name='cinema_detail'), path('<int:cinema_id>/pick/', views.pick_cinema, name='pick_cinema'), path('<int:cinema_id>/score/', views.get_cinema_rating_avg, name='get_cinema_rating_avg'), path('rating/', views.create_cinema_rating, name='create_cinema_rating'), path('rating/<int:rating_id>/', views.patch_delete_cinema_rating, name='patch_delete_cinema_rating'), path('rating/page/', include(router.urls)), ]
995,757
47b05ad94c16cffe21214db567b0d61689fc0611
'''Advent of Code 2015 day 1: Not Quite Lisp https://adventofcode.com/2015/day/1''' def process(instructions): '''Generate a sequence of (position, floor) for the given instructions. Start at floor 0; go up a floor for each '(' and down a floor for each ')' The position counts from 1. ''' floor = 0 for pos, instr in enumerate(instructions): if instr == '(': floor += 1 else: floor -= 1 yield pos + 1, floor def find_floor(instructions): '''Find the floor Santa ends up on after following the instructions''' *_, (_pos, floor) = process(instructions) # Unpacking per PEP 448! return floor def first_basement_entry(instructions): '''Find the first instruction where we enter the basement Return 0 if we never do.''' for pos, floor in process(instructions): if floor < 0: return pos return 0 def run(args): # pragma: no cover filename = args[0] with open(filename) as f: data = f.read() floor = find_floor(data) pos = first_basement_entry(data) print(f"Santa's floor: {floor}") print(f"Santa's first entry to basement: {pos}")
995,758
25a43870555ef9a46d6ff9d308c3603b4daea152
# !interpreter [optional-arg] # -*- coding: utf-8 -*- # Version ''' { Load the numpy array and calculate the features, then split the datasets and save them including rebuild the joint order } {License_info} ''' # Futures # […] # Built-in/Generic Imports import os import sys import json import numpy as np # […] # Libs # import pandas as pd # Or any other # […] # Own module # […] if True: # Include project path ROOT = os.path.dirname(os.path.abspath(__file__))+'/../' CURR_PATH = os.path.dirname(os.path.abspath(__file__))+'/' sys.path.append(ROOT) import utils.uti_features_extraction as uti_features_extraction import utils.uti_commons as uti_commons def par(path): # Pre-Append ROOT to the path if it's not absolute return ROOT + path if (path and path[0] != '/') else path # -- Settings with open(ROOT + 'config/config.json') as json_config_file: config_all = json.load(json_config_file) config = config_all['s3_pre_processing.py'] # common settings ACTION_CLASSES = config_all['ACTION_CLASSES'] IMAGE_FILE_NAME_FORMAT = config_all['IMAGE_FILE_NAME_FORMAT'] SKELETON_FILE_NAME_FORMAT = config_all['SKELETON_FILE_NAME_FORMAT'] CLIP_NUM_INDEX = config_all['CLIP_NUM_INDEX'] ACTION_CLASS_INT_INEDX = config_all['ACTION_CLASS_INT_INEDX'] FEATURE_WINDOW_SIZE = config_all['FEATURE_WINDOW_SIZE'] TEST_DATA_SCALE = config_all['TEST_DATA_SCALE'] # input ALL_DETECTED_SKELETONS = par(config['input']['ALL_DETECTED_SKELETONS']) # output FEATURES_TRAIN = par(config['output']['FEATURES_TRAIN']) FEATURES_TEST = par(config['output']['FEATURES_TEST']) # -- Functions def load_numpy_array(ALL_DETECTED_SKELETONS): ''' Load the datasets from npz file ''' numpy_array = np.load(ALL_DETECTED_SKELETONS) skeletons = numpy_array['ALL_SKELETONS'] labels = numpy_array['ALL_LABELS'] action_class_int = [] video_clips = [] for i in range(len(labels)): action_class_int.append(labels[i][ACTION_CLASS_INT_INEDX]) video_clips.append(labels[i][CLIP_NUM_INDEX]) action_class_int_ndarray = np.array(action_class_int, dtype='i') video_clips_ndarray = np.array(video_clips, dtype='i') return skeletons, action_class_int_ndarray, video_clips_ndarray def convert_action_to_int(action, ACTION_CLASSES): ''' Convert the input action class name into the correspoding index intenger, may not need this function, because already stored the action label as intenger in the first place Arguments: action {str}: filmed clips action name from text file. ACTION_CLASSES {list}: all pre defined action classes in config/config.json Return: ACTION_CLASSES-index {int}: the index of the action ''' if action in ACTION_CLASSES: return ACTION_CLASSES.index(action) def extract_features( skeletons, labels, clip_number, window_size): ''' From image index and raw skeleton positions, Extract features of body velocity, joint velocity, and normalized joint positions. ''' positions_temp = [] velocity_temp = [] labels_temp = [] iClipsCounter = len(clip_number) debuger_list = [] prev_clip = 0 # Loop through all data for i, clip in enumerate(clip_number): # If a new video clip starts, reset the feature generator if i == 0 or clip != prev_clip: Features_Generator = uti_features_extraction.Features_Generator(window_size) # Get features skeletons_rebuild = uti_features_extraction.rebuild_skeleton_joint_order_by_training(skeletons[i, :]) skeletons_rebuild_lists = np.array(skeletons_rebuild) success, features_x, features_xs = Features_Generator.calculate_features(skeletons_rebuild_lists) if success: # True if (data length > 5) and (skeleton has enough joints) positions_temp.append(features_x) velocity_temp.append(features_xs) labels_temp.append(labels[i]) # Print print(f'{i+1}/{iClipsCounter}', end=', ') prev_clip = clip positions_temp = np.array(positions_temp) velocity_temp = np.array(velocity_temp) labels_temp = np.array(labels_temp) return positions_temp, velocity_temp, labels_temp def shuffle_dataset(datasets_position, datasets_velocity, labels, test_percentage): indices = np.random.permutation(labels.shape[0]) valid_cnt = int(labels.shape[0] * test_percentage) test_idx, training_idx = indices[:valid_cnt], indices[valid_cnt:] test_pos, train_pos = datasets_position[test_idx,:], datasets_position[training_idx,:] test_labels, train_labels = labels[test_idx], labels[training_idx] test_vel, train_vel = datasets_velocity[test_idx,:], datasets_velocity[training_idx] return train_pos, train_vel, train_labels, test_pos, test_vel, test_labels # -- Main def main_function(): ''' Load skeleton data from `skeletons_info.txt`, process data, and then save features and labels to .npz file. ''' # Load data skeletons, action_class_int, clip_number = load_numpy_array(ALL_DETECTED_SKELETONS ) # Process Features print('\nExtracting time-serials features ...') position, velocity, labels = extract_features(skeletons, action_class_int, clip_number, FEATURE_WINDOW_SIZE) print(f'All Points.shape = {position.shape}, All Velocity.shape = {velocity.shape}') position_train, velocity_train, label_train, position_test, velocity_test, label_test = shuffle_dataset(position, velocity, labels, TEST_DATA_SCALE) print(f'Train Points.shape = {position_train.shape}, Train Velocity.shape = {velocity_train.shape}') print(f'Test Points.shape = {position_test.shape}, Test Velocity.shape = {velocity_test.shape}') # Save Features to npz file np.savez(FEATURES_TRAIN, POSITION_TRAIN = position_train, VELOCITY_TRAIN = velocity_train, LABEL_TRAIN = label_train) np.savez(FEATURES_TEST, POSITION_TEST = position_test, VELOCITY_TEST = velocity_test, LABEL_TEST = label_test) if __name__ == '__main__': main_function() print('Programms End')
995,759
f8581d1f2fe8dbc57613e746407a7d8382cdc428
## Exploratory Data Analysis cheat sheet ### Yasith Kariyawasam ## Distribution plots sns.distplot(tips['total_bill']) ### remove kde layer using sns.distplot(tips['total_bill'], kde=False) ## Joint Plot sns.jointplot(x='variable1',y='variable2',data=data,kind='scatter') ## use kind to specify type of jointplot i.e 'kind = kde' #Pair Plots sbr.pairplot(df,hue='Clicked on Ad',palette='rainbow')
995,760
6e6f8a70b54599012195421d60b15c979f568baa
class Hotel(): def __init__(self, numero_maximo_de_huespedes, lugares_de_estacionamiento): self.numero_maximo_de_huespedes = numero_maximo_de_huespedes self.lugares_de_estacionamiento = lugares_de_estacionamiento self.huespedes = 0 def anadir_huespedes(self, cantidad_huespedes): self.huespedes += cantidad_huespedes def checkout(self, cantidad_huespedes): self.huespedes -= cantidad_huespedes def ocupacion_total(self): return self.huespedes hotel_chincha = Hotel(numero_maximo_de_huespedes=50 , lugares_de_estacionamiento= 20) print(f'El número de huespedes es: {hotel_chincha.ocupacion_total}') hotel_chincha.anadir_huespedes(50) print(f'El número de huespedes es: {hotel_chincha.ocupacion_total}') hotel_chincha.checkout(30) print(f'El número de huespedes es: {hotel_chincha.ocupacion_total}') #print(hotel_chincha.numero_maximo_de_huespedes) #print(hotel_chincha.lugares_de_estacionamiento)
995,761
387d1be03e42e99191161660ab17565e4ade50c5
print("Enter number: ") num=int(input()) list=[] sum=0 n=len(str(num)) for i in str(num): list.append(int(i)**n) for i in list: sum+=i print(sum) if sum==num: print("Number is an armstrong number") else: print("Number is not an armstrong number")
995,762
078a54e2774e7113b5fea021c8516a1fec7d2794
####### TOKENIZER class Tokenizer(object): def __init__(self): self.stoi = {} self.itos = {} def __len__(self): return len(self.stoi) def fit_on_texts(self, texts): vocab = set() for text in texts: vocab.update(text.split(' ')) vocab = sorted(vocab) vocab.append('<sos>') vocab.append('<eos>') vocab.append('<pad>') for i, s in enumerate(vocab): self.stoi[s] = i self.itos = {item[1]: item[0] for item in self.stoi.items()} def text_to_sequence(self, text): sequence = [] sequence.append(self.stoi['<sos>']) for s in text.split(' '): sequence.append(self.stoi[s]) sequence.append(self.stoi['<eos>']) return sequence def texts_to_sequences(self, texts): sequences = [] for text in texts: sequence = self.text_to_sequence(text) sequences.append(sequence) return sequences def sequence_to_text(self, sequence): return ''.join(list(map(lambda i: self.itos[i], sequence))) def sequences_to_texts(self, sequences): texts = [] for sequence in sequences: text = self.sequence_to_text(sequence) texts.append(text) return texts def predict_caption(self, sequence): caption = '' for i in sequence: if i == self.stoi['<eos>'] or i == self.stoi['<pad>']: break caption += self.itos[i] return caption def predict_captions(self, sequences): captions = [] for sequence in sequences: caption = self.predict_caption(sequence) captions.append(caption) return captions
995,763
257250de9f505df4491759ab22bd8634aebf0419
# all axes tutorial # This program will: # clear blocks above 0,0,0 # place floor at 0,0,0 # place walls 100 blocks away in each direction # place 5 block grid on ceiling # set the player to 0,0,0 # import mcpi.minecraft as minecraft import mcpi.block as block import time import mcpi.minecraftstuff as minecraftstuff mc = minecraft.Minecraft.create() mcdrawing = minecraftstuff.MinecraftDrawing(mc) pos = mc.player.getTilePos()
995,764
9442347dbfbc94a12b973e30efc15ee110a4bf8f
import unittest from urlparse import parse_qs from django.test.client import Client from placethings.api.models import Thing from placethings.settings import DOMAIN, MEDIA_ROOT class MediaHandlerTest(unittest.TestCase): def testimage_handler(self): """ Verifies that placing anonymously is working """ things = Thing.objects.all() if len( things ): thing = things[0] else: c = Client() data = parse_qs( 'title=&tags=&lattitude=32.82248&longitude=-96.762986&duration=&parent=&privacy=U&lifespan=&format=txt' ) data[ 'media' ] = open( MEDIA_ROOT + 'unittest_image.jpg' ) c.post( '/api/place/', data ) thing = Thing.objects.all()[0] uri = thing.media.replace( 'http://' + DOMAIN, '' ) c = Client() response = c.get( uri ) self.failUnlessEqual(response.status_code, 200)
995,765
6166a7613647ca3a549330c02310203c78a653e2
from numpy import * from matplotlib.pyplot import * # Plot Drake Passage transport and ice shelf melt rates/mass loss for the third # repetition of the spinup forcing (1992-2005), for both the low-res and # high-res control simulations. def timeseries_rep3_compare (): # Paths to experiment directories directory_head = '/short/y99/kaa561/FESOM/' expt_dir = ['lowres_spinup/', 'highres_spinup/'] # Titles for plotting expt_titles = ['low res', 'high res'] # Colours for plotting expt_colours = ['blue', 'green'] year_start = 1992 year_end = 2005 # Skip the first 2 repetitions skipyears = 28 # Number of records per year (assumes 5-day averages) peryear = 365/5 # Bounds of observations for Drake Passage transport dpt_low = 134 dpt_high = 173.3 # Titles for each ice shelf names = ['All Ice Shelves', 'Larsen D Ice Shelf', 'Larsen C Ice Shelf', 'Wilkins & George VI & Stange Ice Shelves', 'Ronne-Filchner Ice Shelf', 'Abbot Ice Shelf', 'Pine Island Glacier Ice Shelf', 'Thwaites Ice Shelf', 'Dotson Ice Shelf', 'Getz Ice Shelf', 'Nickerson Ice Shelf', 'Sulzberger Ice Shelf', 'Mertz Ice Shelf', 'Totten & Moscow University Ice Shelves', 'Shackleton Ice Shelf', 'West Ice Shelf', 'Amery Ice Shelf', 'Prince Harald Ice Shelf', 'Baudouin & Borchgrevink Ice Shelves', 'Lazarev Ice Shelf', 'Nivl Ice Shelf', 'Fimbul & Jelbart & Ekstrom Ice Shelves', 'Brunt & Riiser-Larsen Ice Shelves', 'Ross Ice Shelf'] # Figure names for each ice shelf fig_names = ['total_massloss.png', 'larsen_d.png', 'larsen_c.png', 'wilkins_georgevi_stange.png', 'ronne_filchner.png', 'abbot.png', 'pig.png', 'thwaites.png', 'dotson.png', 'getz.png', 'nickerson.png', 'sulzberger.png', 'mertz.png', 'totten_moscowuni.png', 'shackleton.png', 'west.png', 'amery.png', 'princeharald.png', 'baudouin_borchgrevink.png', 'lazarev.png', 'nivl.png', 'fimbul_jelbart_ekstrom.png', 'brunt_riiserlarsen.png', 'ross.png'] # Observed mass loss (Rignot 2013) and uncertainty for each ice shelf, in # Gt/y obs_massloss = [1325, 1.4, 20.7, 135.4, 155.4, 51.8, 101.2, 97.5, 45.2, 144.9, 4.2, 18.2, 7.9, 90.6, 72.6, 27.2, 35.5, -2, 21.6, 6.3, 3.9, 26.8, 9.7, 47.7] obs_massloss_error = [235, 14, 67, 40, 45, 19, 8, 7, 4, 14, 2, 3, 3, 8, 15, 10, 23, 3, 18, 2, 2, 14, 16, 34] # Make time axis time = arange(year_start, year_end+1, 1.0/peryear) num_time = size(time) num_years = year_end - year_start + 1 # Drake Passage transport dpt = empty([2, num_time]) # Loop over experiments for expt in range(2): # Read logfile dpt_tmp = [] f = open(directory_head + expt_dir[expt] + 'dpt.log') f.readline() for line in f: dpt_tmp.append(float(line)) f.close() # Select third repetition dpt_tmp = dpt_tmp[skipyears*peryear:(skipyears+num_years)*peryear] dpt[expt,:] = array(dpt_tmp) # Plot fig, ax = subplots(figsize=(10,6)) for expt in range(2): ax.plot(time, dpt[expt,:], label=expt_titles[expt], color=expt_colours[expt], linewidth=2) # Add lines for range of observations ax.axhline(dpt_low, color='red', linestyle='dashed', linewidth=2, label='observations') ax.axhline(dpt_high, color='red', linewidth=2, linestyle='dashed') title('Drake Passage Transport', fontsize=18) xlabel('Year', fontsize=14) ylabel('Sv', fontsize=14) xlim([year_start, amax(time)]) grid(True) # Move plot over to make room for legend box = ax.get_position() ax.set_position([box.x0, box.y0, box.width*0.8, box.height]) # Make legend ax.legend(loc='center left', bbox_to_anchor=(1,0.5)) fig.savefig('drakepsgtrans.png') # Ice shelf mass loss massloss = empty([2, len(names), num_time]) # Loop over experiments for expt in range(2): # Read logfile f = open(directory_head + expt_dir[expt] + 'massloss.log') f.readline() # Loop over ice shelves for index in range(len(names)): massloss_tmp = [] for line in f: try: massloss_tmp.append(float(line)) except(ValueError): break # Select third repetition massloss_tmp = massloss_tmp[skipyears*peryear:(skipyears+num_years)*peryear] massloss[expt,index,:] = array(massloss_tmp) f.close() # One plot for each ice shelf for index in range(len(names)): # Calculate range of observations massloss_low = obs_massloss[index] - obs_massloss_error[index] massloss_high = obs_massloss[index] + obs_massloss_error[index] fig, ax = subplots(figsize=(10,6)) for expt in range(2): ax.plot(time, massloss[expt,index,:], label=expt_titles[expt], color=expt_colours[expt], linewidth=2) # Add lines for range of observations ax.axhline(massloss_low, color='red', linestyle='dashed', linewidth=2, label='observations') ax.axhline(massloss_high, color='red', linewidth=2, linestyle='dashed') title(names[index] + '\nBasal Mass Loss', fontsize=18) xlabel('Year', fontsize=14) ylabel('Gt/y', fontsize=14) xlim([year_start, amax(time)]) grid(True) # Move plot over to make room for legend box = ax.get_position() ax.set_position([box.x0, box.y0, box.width*0.8, box.height]) # Make legend ax.legend(loc='center left', bbox_to_anchor=(1,0.5)) fig.savefig(fig_names[index]) # Command-line interface if __name__ == "__main__": timeseries_rep3_compare()
995,766
abdceabf3353032529001d576443cce654fc4e6e
import pandas as pd dados = list() pessoa = dict() mulheres = list() acima_da_media = list() tot = 0 while True: pessoa['nome'] = str(input('Nome: ')) while True: pessoa['sexo'] = str(input('Sexo: [F/M]: ')).upper() if pessoa['sexo'] == 'F' or pessoa['sexo'] == 'M': break else: print('ERRO! Digite F para feminino ou M para masculino.') pessoa['idade'] = int(input('Idade: ')) dados.append(pessoa.copy()) end = ' ' while end not in 'SN': end = str(input('Deseja continuar? [S/N]')).upper() if end == 'N' or end == 'S': break print('ERRO! Digite S para continuar ou N para encerrar.') if end == 'N': break qntd_pessoas = len(dados) for elemento in dados: tot += elemento['idade'] media = tot / qntd_pessoas for elemento in dados: if elemento['sexo'] == 'F': mulheres.append(elemento.copy()) if elemento['idade'] >= media: acima_da_media.append(elemento.copy()) print(f'A) Ao todo temos {qntd_pessoas} pessoas cadastradas. ') print(f'B) A média de idade é de {media:.2f}') print(f'C) As mulheres cadastradas foram', end=' ') for v in mulheres: print(v['nome'], end=' ') print('') print(f'D) As pessoas com idade acima da média: ') for elemento in acima_da_media: for k, v in elemento.items(): print(f'{k} = {v};', end=' ') print('') df = pd.DataFrame(dados) print(df)
995,767
c97949a4d1fdadab4346296f8eacc539a5007e63
# -*- coding: utf-8 -*- """ Created on Wed Nov 14 14:08:05 2018 @author: likkhian """ import numpy as np class DecisionTree(): def __init__(self,max_depth=5,min_samples_split=1,debug=False): self.max_depth = max_depth self.min_samples_split = min_samples_split self.debug = debug #def gini(self, a1, a2): def gini(self,a1,a2): def ginicalc(array): positives = sum(array) total = len(array) return 1 - (positives/total)**2 - (1-positives/total)**2 w1 = len(a1)/(len(a1)+len(a2)) w2 = 1-w1 return ginicalc(a1)*w1 + ginicalc(a2)*w2 def fit(self,x,y): def split_data(feature,cutoff,xx,yy): mask = xx[:,feature] < cutoff left_y = yy[mask] left_x = xx[mask] right_y = yy[~mask] right_x = xx[~mask] return left_x,left_y,right_x,right_y def get_split(x,y): nsamp,nfeat = np.shape(x) if self.debug: print('x shape',np.shape(x),np.shape(y)) min_gini=999 # 0.5 for feature in range(nfeat): unique_vals = np.unique(x[:,feature]) if self.debug: print('unique_vals',unique_vals) for ii in range(1,len(unique_vals)): left_x, left_y, right_x, right_y = split_data(feature,unique_vals[ii],x,y) gini_val = self.gini(left_y,right_y) if self.debug: print('gini', gini_val) if gini_val<min_gini: min_gini=gini_val location=[feature,unique_vals[ii]] best_left_x,best_left_y,best_right_x,best_right_y = left_x, left_y, right_x, right_y # print('split deet',location,min_gini) return {'index':location[0],'value':location[1], \ 'groups': [best_left_x, best_left_y, best_right_x, best_right_y]} # get_split(x,y) def get_consensus(leaf): # note: if leafs are equal then peeps gon die. return np.bincount(leaf).argmax() def check_pure_feat(x_array): row,col = np.shape(x_array) for ii in range(col): if len(np.unique(x_array[:,ii])) > 2: return False return True def split(node,depth): left_x, left_y, right_x, right_y = node['groups'] # print('shaply',np.shape(left_x),np.shape(left_y),np.shape(right_x),np.shape(right_y)) del(node['groups']) # print(left_y,right_y,'sizes') # check if either group is empty if((not left_y.size) or (not right_y.size) ): node['left'] = node['right'] = get_consensus(list(left_y)+list(right_y)) # print('grp empty') return # check if we be deep if depth >= self.max_depth: node['left'], node['right'] = get_consensus(left_y),get_consensus(right_y) if self.debug: print('too deep!') return # check if we are at the left end if len(left_y) <= self.min_samples_split: node['left'] = get_consensus(left_y) elif len(np.unique(left_y)) == 1: #leaf is pure node['left'] = get_consensus(left_y) elif check_pure_feat(left_x): #features are pure node['left'] = get_consensus(left_y) else: node['left'] = get_split(left_x,left_y) split(node['left'],depth+1) # do the right thing if len(right_y) <= self.min_samples_split: node['right'] = get_consensus(right_y) elif len(np.unique(right_y)) == 1: #leaf is pure node['right'] = get_consensus(right_y) elif check_pure_feat(right_x): #features are pure node['right'] = get_consensus(right_y) else: node['right'] = get_split(right_x,right_y) split(node['right'],depth+1) def grow_tree(train_x,train_y): root = get_split(train_x,train_y) split(root,1) return root self.mature_tree = grow_tree(x,y) # return grow_tree(x,y) def konica(self,node, depth=0): if isinstance(node, dict): print('hi, %s[X%d < %.3f]' % ((depth*' ', (node['index']+1), node['value']))) konica(node['left'], depth+1) konica(node['right'], depth+1) else: print('%s[%s]' % ((depth*' ', node))) #x = np.array([[5,4,3,2,1,9,9,9,9,9],[9,9,9,9,9,1,2,3,4,5]]).T #y = np.array([1,1,1,1,1,0,0,0,0,0]) ##fit(x,y) # #dataset = np.array([[2.771244718,1.784783929], # [1.728571309,1.169761413], # [3.678319846,2.81281357], # [3.961043357,2.61995032], # [2.999208922,2.209014212], # [7.497545867,3.162953546], # [9.00220326,3.339047188], # [7.444542326,0.476683375], # [10.12493903,3.234550982], # [6.642287351,3.319983761]]) #dataset = np.array([[5,8], # [5,8], # [5,8], # [5,1], # [5,1], # [2,8], # [2,8], # [2,8], # [2,1], # [2,1]]) #y = np.array([0,0,0,1,1,1,1,1,0,0]) #tree = fit(dataset,y,max_depth=3,min_samples_split=3) #konica(tree) def predict(tree,x): prediction = [] def predictor(tree,row): if row[tree['index']] < tree['value']: if isinstance(tree['left'],dict): return predictor(tree['left'],row) else: return tree['left'] else: if isinstance(tree['right'],dict): return predictor(tree['right'],row) else: return (tree['right']) for row in x: prediction.append(predictor(tree.mature_tree,row)) return np.array(prediction) #predict(tree,dataset) class RandomForest(): def __init__(self,num_trees,max_depth=5,subsample_size=1.0,feature_proportion=1.0): self.num_trees = num_trees self.max_depth = max_depth self.subsample_size = subsample_size self.feature_proportion = feature_proportion # print('random forested') def fit(self,x,y): self.forest = [] # print('random forest 0') for run in range(self.num_trees): # print('random forest stage ',run) sample_index = np.random.choice(len(y),int(self.subsample_size*(len(y)))) x_sample = x[sample_index,:] y_sample = y[sample_index] feature_index = np.random.choice(np.shape(x_sample)[1], \ int(self.feature_proportion*np.shape(x_sample)[1]),replace=False) x_sample = x_sample[:,feature_index] current_tree = DecisionTree(max_depth = self.max_depth) current_tree.fit(x_sample,y_sample) self.forest.append(current_tree) def predict(self,x): results = [] for tree in self.forest: results.append(tree.predict(x)) mean_results = np.mean(results,axis=0) mean_results[mean_results>0.5] = 1 mean_results[mean_results<=0.5] = 0 return mean_results
995,768
2800320db8ee8ab7b968c0002de83b74b11b2ff2
list = [12,24,35,24,24,88,120,155,88,120,155] range = [] for i in list[:]: flag = 0 for j in range : if i == j: flag = 1 if flag == 1 : continue else : range.append(i) print range
995,769
ab10ec5e900f6a554a1df87bbf5384bd148bb2dc
import sys graph=[list(map(int,sys.stdin.readline().split()))for _ in range(9)] xSet=[list([False]*10)for _ in range(9)] ySet=[list([False]*10)for _ in range(9)] box=[list([False]*10) for _ in range(9)] dia=[[i//3*3+j//3 for j in range(9)]for i in range(9)] spot=[] for i in range(9): for j in range(9): if graph[i][j]==0: spot.append([i,j]) else: xSet[i][graph[i][j]]=True ySet[j][graph[i][j]]=True box[dia[i][j]][graph[i][j]]=True def travel(ceil): if ceil==len(spot): for i in range(9): print(' '.join(map(str,graph[i]))) exit() y,x=spot[ceil] for val in range(1,10): if xSet[y][val] or ySet[x][val] or box[dia[y][x]][val]: continue xSet[y][val]=ySet[x][val]=box[dia[y][x]][val]=True graph[y][x]=val travel(ceil+1) xSet[y][val]=ySet[x][val]=box[dia[y][x]][val]=False graph[y][x]=0 travel(0)
995,770
d6d2e58f1b2c78039f63ddecea46031c85e39e6a
# coding: utf-8 import dataclasses import typing import serpyco from guilang.description import Description from guilang.description import Part from rolling.action.base import WithResourceAction from rolling.action.base import WithStuffAction from rolling.action.base import get_with_resource_action_url from rolling.action.base import get_with_stuff_action_url from rolling.exception import ImpossibleAction from rolling.model.effect import CharacterEffectDescriptionModel from rolling.rolling_types import ActionType from rolling.server.link import CharacterActionLink if typing.TYPE_CHECKING: from rolling.model.character import CharacterModel from rolling.model.stuff import StuffModel from rolling.game.base import GameConfig from rolling.kernel import Kernel @dataclasses.dataclass class EatResourceModel: pass @dataclasses.dataclass class EatStuffModel: pass class EatResourceAction(WithResourceAction): input_model: typing.Type[EatResourceModel] = EatResourceModel input_model_serializer = serpyco.Serializer(input_model) @classmethod def get_properties_from_config(cls, game_config: "GameConfig", action_config_raw: dict) -> dict: return { "accept_resources": [ game_config.resources[r] for r in action_config_raw["accept_resources"] ], "effects": [ game_config.character_effects[e] for e in action_config_raw["character_effects"] ], "require": action_config_raw["require"], } def check_is_possible(self, character: "CharacterModel", resource_id: str) -> None: accept_resources_ids = [rd.id for rd in self._description.properties["accept_resources"]] if resource_id in accept_resources_ids: return raise ImpossibleAction("Non consommable") def check_request_is_possible( self, character: "CharacterModel", resource_id: str, input_: EatResourceModel ) -> None: self.check_is_possible(character, resource_id) # TODO BS 2019-09-14: perf carried_resource = next( ( cr for cr in self._kernel.resource_lib.get_carried_by(character.id) if cr.id == resource_id ) ) require = self._description.properties["require"] if carried_resource.quantity >= require: return unit_name = self._kernel.translation.get(carried_resource.unit) raise ImpossibleAction( f"Vous ne possédez pas assez de {carried_resource.name} " f"({require} {unit_name} requis)" ) def get_character_actions( self, character: "CharacterModel", resource_id: str ) -> typing.List[CharacterActionLink]: accept_resources_ids = [rd.id for rd in self._description.properties["accept_resources"]] # TODO BS 2019-09-14: perf carried_resource = next( ( cr for cr in self._kernel.resource_lib.get_carried_by(character.id) if cr.id == resource_id ) ) if carried_resource.id in accept_resources_ids: return [ # FIXME BS NOW: il semblerait que que comme on ne donne pas le description_id, # lorsque on veux consommer la resource, l'action factory prend la première, et donc # pas la bonne. Revoir ça, je pense qu'il faut systématiquement donner un # description_id. Voir les conséquences. CharacterActionLink( name=f"Manger {carried_resource.name}", link=get_with_resource_action_url( character_id=character.id, action_type=ActionType.EAT_RESOURCE, resource_id=resource_id, query_params={}, action_description_id=self._description.id, ), cost=None, ) ] return [] def perform( self, character: "CharacterModel", resource_id: str, input_: input_model ) -> Description: character_doc = self._character_lib.get_document(character.id) effects: typing.List[CharacterEffectDescriptionModel] = self._description.properties[ "effects" ] self._kernel.resource_lib.reduce_carried_by( character.id, resource_id, quantity=self._description.properties["require"], commit=False, ) for effect in effects: self._effect_manager.enable_effect(character_doc, effect) self._kernel.server_db_session.add(character_doc) self._kernel.server_db_session.commit() return Description( title="Action effectué", footer_links=[ Part(is_link=True, go_back_zone=True, label="Retourner à l'écran de déplacements"), Part( is_link=True, label="Voir l'inventaire", form_action=f"/_describe/character/{character.id}/inventory", classes=["primary"], ), ], ) class EatStuffAction(WithStuffAction): input_model: typing.Type[EatStuffModel] = EatStuffModel input_model_serializer = serpyco.Serializer(input_model) @classmethod def get_properties_from_config(cls, game_config: "GameConfig", action_config_raw: dict) -> dict: a = 1 return { "accept_stuff_ids": action_config_raw["accept_stuffs"], "effects": [ game_config.character_effects[e] for e in action_config_raw["character_effects"] ], } def check_is_possible(self, character: "CharacterModel", stuff: "StuffModel") -> None: # TODO BS 2019-07-31: check is owned stuff if stuff.stuff_id in self._description.properties["accept_stuff_ids"]: return raise ImpossibleAction(f"Vous ne pouvez pas le manger") def check_request_is_possible( self, character: "CharacterModel", stuff: "StuffModel", input_: input_model ) -> None: self.check_is_possible(character, stuff) def get_character_actions( self, character: "CharacterModel", stuff: "StuffModel" ) -> typing.List[CharacterActionLink]: if stuff.stuff_id in self._description.properties["accept_stuff_ids"]: return [ CharacterActionLink( name=f"Manger {stuff.name}", link=get_with_stuff_action_url( character.id, ActionType.EAT_STUFF, query_params={}, stuff_id=stuff.id, action_description_id=self._description.id, ), cost=self.get_cost(character, stuff), ) ] return [] def perform( self, character: "CharacterModel", stuff: "StuffModel", input_: input_model ) -> Description: character_doc = self._character_lib.get_document(character.id) effects: typing.List[CharacterEffectDescriptionModel] = self._description.properties[ "effects" ] self._kernel.stuff_lib.destroy(stuff.id, commit=False) for effect in effects: self._effect_manager.enable_effect(character_doc, effect) self._kernel.server_db_session.add(character_doc) self._kernel.server_db_session.commit() return Description( title="Action effectué", footer_links=[ Part(is_link=True, go_back_zone=True, label="Retourner à l'écran de déplacements"), Part( is_link=True, label="Voir l'inventaire", form_action=f"/_describe/character/{character.id}/inventory", classes=["primary"], ), ], )
995,771
0ad8aadb90234f727d2ef25260ad9d57d0d1b476
#!/usr/bin/python #Python implementation of Shamir's Secret Sharing using the BGW protocol #Author: Patrick Crain #BGW reference: http://cseweb.ucsd.edu/classes/fa02/cse208/lec12.html import sys, os, random, json, time, shutil from random import shuffle from mpmath import * #mpmath for arbitrary float precision mp.dps = 500; mp.pretty = True #Max value for our finite field arithmetic PRIME = 2074722246773485207821695222107608587480996474721117292752992589912196684750549658310084416732550077 DEBUG = True #Whether to print debug stuff N = 30 #Max number of parties SMAX = int(sqrt(PRIME)) #Maximum value for our secrets PMAX = int(pow(PRIME,1/N)) #Maximum value for polynomial coefficients CLOUD = "_cloud/" #Directory for temporary computation files PRIV = "known-secrets/" #Directory for known secrets #Terminal color codes class col: BLN ='\033[0m' # Blank UND ='\033[1;4m' # Underlined INV ='\033[1;7m' # Inverted CRT ='\033[1;41m' # Critical BLK ='\033[1;30m' # Black RED ='\033[1;31m' # Red GRN ='\033[1;32m' # Green YLW ='\033[1;33m' # Yellow BLU ='\033[1;34m' # Blue MGN ='\033[1;35m' # Magenta CYN ='\033[1;36m' # Cyan WHT ='\033[1;37m' # White def dprint(string): if DEBUG: print(string) def dnprint(string,prec): if DEBUG: nprint(string,prec) #Load data from a JSON file # fname = file to load from def jload(fname): if not os.path.exists(fname): return None with open(fname,'r') as j: x = json.load(j) return x #Compute the greatest common denominator of a and b #Based on code from (https://github.com/rhyzomatic/pygarble) # a = first number # b = second number def extendedEuclideanAlgorithm(a, b): if abs(b) > abs(a): (x,y,d) = extendedEuclideanAlgorithm(b, a) return (y,x,d) if abs(b) == 0: return (1, 0, a) x1, x2, y1, y2 = 0, 1, 1, 0 while b != 0: q = floor(a / b) r = floor(fmod(a,b)) x = x2 - q*x1 y = y2 - q*y1 a, b, x2, x1, y2, y1 = b, r, x1, x, y1, y return (x2, y2, a) #Find the multiplicative inverse of n mod PRIME # n = number to find the multiplicative inverse for def inverse(n): x,y,d = extendedEuclideanAlgorithm(n, PRIME) return floor(fmod(x,PRIME)) #Compute the lagrange polynomial for a list of points #Based on code from (https://github.com/rhyzomatic/pygarble) # points = a list of points (x,y) def lagrange(points): def P(x): total = 0 n = len(points) for i in range(0,n): xi, yi = points[i] def g(i, n): tot_mul = 1 for j in range(0,n): if i == j: continue xj, yj = points[j] tot_mul *= (x - xj) / mpf(xi - xj) return tot_mul total += yi * g(i, n) return total return P #Generate a polynomial of degree d with intercept y # y = y-intercept of polynomial # d = degree of polynomial def polygen(y,d): return [y] + [random.randrange(PMAX) for i in range(0,d)] #Evaluate a polyonmial p at point x # p = polynomial to evaluate # x = point to evaluate the polynomial at def evalpolyat(p,x): return p[0] + sum([(p[i]*pow(x,i)) for i in range(1,len(p))]) #Compute the Vandermonde matrix from an array # arr = Array the Vandermonde matrix is based off of def vandermonde(arr): v = [] for x in arr: vr = [1] for i in range(1,len(arr)): vr.append(x*vr[i-1]) v.append(vr) # dprint(col.GRN + "V: \n" + col.BLN + str(v)) return matrix(v) #Compute an (n,t) diagonal matrix # n = total number of parties # t = threshold number of parties def diag(n,t): a = matrix([[(1 if (i==j and i>=0 and i<=t) else 0) for j in range(0,n)] for i in range(0,n)]) # dprint(col.GRN + "P:" + col.BLN) # dnprint(a,5) return a #Generate the A matrix as described here (http://cseweb.ucsd.edu/classes/fa02/cse208/lec12.html) # t = threshold number of parties # ps = list of parties involved in the computation def genMatrixA(t,ps): v = vandermonde(ps) p = diag(len(ps),t) A = (v*p)*(v**-1) # dprint(col.GRN + "A: " + col.BLN + "\n" + nstr(A,5)) return A #Easy one-line write to file # path = file to write to # line = string to write def easyWrite(path,line): path = CLOUD+path with open(path,"w") as of: of.write(line) #Easy one-line read from file # path = file to read from def easyRead(path): path = CLOUD+path if not os.path.exists(path): print("Waiting for " + path + "...") while not os.path.exists(path): time.sleep(1) with open(path,"r") as inf: return inf.read().split("\n")[0] #Class for a party involved in the computation class Party: #Constructor for Party # myid = ID / x-value of the party for shares # j = Party's index in the list of party ids def __init__(self,myid,j): self.id = myid #ID / x-value of the party for shares self.relid = j #Party's index in the list of party ids self.secretshares = {} #Secrets which this party has shares for self.ranpoly = {} #Secrets which this party has random polynomials for self.ranshares = {} #Secrets which this party has collected random shares for self.vshares = {} #Secrets which this party has computed v-shares for self.sshares = {} #Computed shares of degree-reduced secrets #Generate a random polynomial for use in degree reduction # s1 = name of first share the polynomial is based off # s2 = name of second share the polynomial is based off # t = degree the polynomial will be reduced to def genRandomP(self,s1,s2,t): self.ranpoly[s1+"*"+s2] = polygen(0,t*2) # print(col.GRN + "r[i]: " + col.BLN + str(self.ranpoly)) #Generate shares from a random polynomial and distribute them to disk # s1 = name of first share the random shares are based off # s2 = name of second share the random shares are based off # oids = list of other parties to send shares to def writeRanShares(self,s1,s2,oids): name=s1+"*"+s2 for o in oids: s = evalpolyat(self.ranpoly[name],o) easyWrite(str(o)+"/"+str(self.id)+"-"+s1+"-"+s2+"-ranshare",str(s)) #Accept random shares from parties listen in oids (from disk) # s1 = name of first share the random shares are based off # s2 = name of second share the random shares are based off # oids = list of parties to receive shares from def loadRanShares(self,s1,s2,oids): name=s1+"*"+s2 for o in oids: share = mpmathify(easyRead(str(self.id)+"/"+str(o)+"-"+s1+"-"+s2+"-ranshare")) if name in self.ranshares.keys(): self.ranshares[name].append(share) else: self.ranshares[name] = [share] #Compute shares of v for two other shares # s1 = name of first share the v share is based off # s2 = name of second share the v share is based off def computeVShare(self,s1,s2): name=s1+"*"+s2 # self.vshares[name] = self.secretshares[s1][1]*inverse(self.secretshares[s2][1]) # self.vshares[name] = self.secretshares[s1][1]/(self.secretshares[s2][1]) self.vshares[name] = self.secretshares[s1][1]*(self.secretshares[s2][1]) self.vshares[name] += sum(self.ranshares[name]) # dprint(col.GRN + "v: " + col.BLN + str(self.vshares[name])) #Share a previously computed share of v to other parties # s1 = name of first share the v share is based off # s2 = name of second share the v share is based off # oids = list of other parties to send shares to def shareVShare(self,s1,s2,oids): rpoly = polygen(self.vshares[s1+"*"+s2],int((len(oids)-1)/2)) for o in oids: s = evalpolyat(rpoly,o) easyWrite(str(o)+"/"+str(self.id)+"-"+s1+"-"+s2+"-vsubshare",str(s)) #Run a linear protocol to compute Av # s1 = name of first share the linear share is based off # s2 = name of second share the linear share is based off # oids = list of other parties to send shares to def computeLinearShares(self,s1,s2,oids): name=s1+"*"+s2 A = genMatrixA(int((len(oids)-1)/2),oids) ki = 0 for k in oids: total = 0 ii = 0 for i in oids: vs = mpmathify(easyRead(str(self.id)+"/"+str(i)+"-"+s1+"-"+s2+"-vsubshare")) total += (vs*A[ki,ii]) ii += 1 easyWrite(str(k)+"/"+str(self.id)+"-"+s1+"-"+s2+"-vnewshare",str(total)) ki += 1 #Reconstruct degree t share for s1*s2 # s1 = name of first share to reconstruct from # s2 = name of second share to reconstruct from # oids = list of other parties to send shares to def reconstructSShare(self,s1,s2,oids): svals = [] for o in oids: v = easyRead(str(self.id)+"/"+str(o)+"-"+s1+"-"+s2+"-vnewshare") svals.append((o,mpmathify(v))) s = nint(lagrange(svals)(0)) % PRIME self.sshares[s1+"*"+s2] = (self.id,s) # print(col.BLU+str(s)+col.BLN) # s = evalpolyat(spoly,0) #Load a secret share from disk # name = name of the share to load def loadSecretShare(self,name): if not DEBUG: print(col.WHT+"Loading share " + str(self.id) + " of "+name+col.BLN) fname = str(self.id)+"/"+name+"-share" line = mpmathify(easyRead(fname)) self.secretshares[name] = (self.id,line) return(self.secretshares[name]) #Write the sum of shares s1,s2 to disk # s1 = name of first share the summed share is based off # s2 = name of second share the summed share is based off # newname = name of the new summed share def writeSummedShare(self,s1,s2,newname): print(col.WHT+"Writing share "+s1+"+"+s2+"[" + str(self.id) + "] to file"+col.BLN) easyWrite(str(self.id)+"/"+newname+"-share",str(self.secretshares[s1][1]+self.secretshares[s2][1])) #Write the sum of share s and constant c to disk # s1 = name of share to be summed # s2 = constant to sum share with # newname = name of the new summed share def writeConstSumShare(self,s,c,newname): print(col.WHT+"Writing share "+newname+"[" + str(self.id) + "] to file"+col.BLN) easyWrite(str(self.id)+"/"+"-"+newname+"-share",str(self.secretshares[s][1]+c)) #Write the difference of shares s1,s2 to disk # s1 = name of first share the subtracted share is based off # s2 = name of second share the subtracted share is based off # newname = name of the new subtracted share def writeSubbedShare(self,s1,s2,newname): print(col.WHT+"Writing share "+s1+"-"+s2+"[" + str(self.id) + "] to file"+col.BLN) easyWrite(str(self.id)+"/"+newname+"-share",str(self.secretshares[s1][1]-self.secretshares[s2][1])) #Write the difference of share s and constant c to disk # s1 = name of share to be subtract from # s2 = constant to subtract with # newname = name of the new summed share def writeConstSubShare(self,s,c,newname): print(col.WHT+"Writing share "+newname+"[" + str(self.id) + "] to file"+col.BLN) easyWrite(str(self.id)+"/"+newname+"-share",str(self.secretshares[s][1]-c)) #Write the product of shares s1,s2 to disk # s1 = name of first share the multiplied share is based off # s2 = name of second share the multiplied share is based off # newname = name of the new multiplied share def writeMultipliedShare(self,s1,s2,newname): print(col.WHT+"Writing share "+newname+"[" + str(self.id) + "] to file"+col.BLN) easyWrite(str(self.id)+"/"+newname+"-share",str(self.sshares[s1+"*"+s2][1])) #Write the product of share s and constant c to disk # s1 = name of share to be multiplied # s2 = constant to multiply share by # newname = name of the new multiplied share def writeConstMultipleShare(self,s,c,newname): print(col.WHT+"Writing share "+newname+"[" + str(self.id) + "] to file"+col.BLN) easyWrite(str(self.id)+"/"+newname+"-share",str(self.secretshares[s][1]*c))
995,772
497fda2bad9f3a7cf7fceaf8df87a97c2c5dd50d
# ChoiceModels # See full license in LICENSE from .mergedchoicetable import * from .simulation import *
995,773
80f6b00c7d668b217322e813281da57ebcaeee61
#!/usr/bin/env python import rospy import math import tf if __name__=='__main__': rospy.init_node('frame_a_frame_b_listener_node') listener = tf.TransformListener() rate = rospy.Rate(1.0) listener.waitForTransform('/frame_a','/frame_b',rospy.Time(),rospy.Duration(4.0)) while (not rospy.is_shutdown()): try: (trans,rot) = listener.lookupTransform('/frame_a', '/frame_b', rospy.Time(0)) except (tf.LookupException, tf.ConnectivityException, tf.ExtrapolationException): continue quaternion = rot rpy = tf.transformations.euler_from_quaternion(quaternion) print 'transformation between frame_a and frame_b detected ' print 'translation vector: ',trans[0],',',trans[1],',',trans[2],')' print 'rotation angles: roll = ',rpy[0],'pitch = ',rpy[1],'yaw= ',rpy[2] rate.sleep()
995,774
dd95f280a37c2535619154229fe5115da5901e12
import pytest from typing import List, Tuple, Optional, Union from block import Block from blocky import _block_to_squares from goal import BlobGoal, PerimeterGoal, _flatten, generate_goals, Goal from player import _is_move_valid, _get_block, create_players, Player, SmartPlayer, RandomPlayer, HumanPlayer from renderer import Renderer from settings import COLOUR_LIST WHITE = (255, 255, 255) BLACK = (0, 0, 0) PACIFIC_POINT = (1, 128, 181) OLD_OLIVE = (138, 151, 71) REAL_RED = (199, 44, 58) MELON_MAMBO = (234, 62, 112) DAFFODIL_DELIGHT = (255, 211, 92) TEMPTING_TURQUOISE = (75, 196, 213) def set_children(block: Block, colours: List[Optional[Tuple[int, int, int]]]) \ -> None: """Set the children at <level> for <block> using the given <colours>. Precondition: - len(colours) == 4 - block.level + 1 <= block.max_depth """ size = block._child_size() positions = block._children_positions() level = block.level + 1 depth = block.max_depth block.children = [] # Potentially discard children for i in range(4): b = Block(positions[i], size, colours[i], level, depth) block.children.append(b) def lone_block() -> Block: return Block((0, 0), 750, REAL_RED, 0, 0) def one_block_four_children_(max_depth: int) -> Block: b = Block((0, 0), 750, None, 0, max_depth) set_children(b, [TEMPTING_TURQUOISE, MELON_MAMBO, REAL_RED, OLD_OLIVE]) return b def one_block_sixteen_grandkids_(max_depth: int) -> Block: b = Block((0, 0), 750, None, 0, max_depth) set_children(b, [None, None, None, None]) for child in b.children: set_children(child, [TEMPTING_TURQUOISE, MELON_MAMBO, REAL_RED, OLD_OLIVE]) return b def one_block_4_children_8_grandkids_4_great_grandkids_(max_depth: int) -> Block: b = Block((0, 0), 750, None, 0, max_depth) set_children(b, [TEMPTING_TURQUOISE, DAFFODIL_DELIGHT, MELON_MAMBO, OLD_OLIVE]) for i in range(2): b.children[i].colour = None set_children(b.children[i], [TEMPTING_TURQUOISE, MELON_MAMBO, REAL_RED, TEMPTING_TURQUOISE]) b.children[1].children[3].colour = None set_children(b.children[1].children[3], [OLD_OLIVE, OLD_OLIVE, REAL_RED, OLD_OLIVE]) return b def one_block_4_kids_one_kid_has_4_kids_(max_depth: int) -> Block: b = Block((0, 0), 750, None, 0, max_depth) set_children(b, [TEMPTING_TURQUOISE, MELON_MAMBO, REAL_RED, OLD_OLIVE]) b.children[2].colour = None set_children(b.children[2], [TEMPTING_TURQUOISE, MELON_MAMBO, REAL_RED, REAL_RED]) return b def complicated_block_depth_3_(max_depth: int) -> Block: b = Block((0, 0), 750, None, 0, max_depth) set_children(b, [None, None, None, None]) set_children(b.children[0], [TEMPTING_TURQUOISE, OLD_OLIVE, REAL_RED, MELON_MAMBO]) set_children(b.children[1], [OLD_OLIVE, MELON_MAMBO, REAL_RED, None]) set_children(b.children[1].children[3], [TEMPTING_TURQUOISE, MELON_MAMBO, MELON_MAMBO, REAL_RED]) set_children(b.children[2], [OLD_OLIVE, TEMPTING_TURQUOISE, OLD_OLIVE, None]) set_children(b.children[2].children[3], [REAL_RED, REAL_RED, TEMPTING_TURQUOISE, TEMPTING_TURQUOISE]) set_children(b.children[3], [None, OLD_OLIVE, MELON_MAMBO, TEMPTING_TURQUOISE]) set_children(b.children[3].children[0], [TEMPTING_TURQUOISE, REAL_RED, MELON_MAMBO, REAL_RED]) return b def complicated_block_depth_2_(max_depth: int) -> Block: b = Block((0, 0), 750, None, 0, max_depth) set_children(b, [REAL_RED, None, OLD_OLIVE, BLACK]) set_children(b.children[1], [REAL_RED, OLD_OLIVE, MELON_MAMBO, BLACK]) return b # TESTS FOR CREATE_COPY # def test_create_copy_simple() -> None: b = lone_block() b_copy = b.create_copy() assert b == b_copy assert b is not b_copy b.colour = BLACK assert b != b_copy def test_create_copy_cd2() -> None: b = complicated_block_depth_2_(2) b_copy = b.create_copy() assert b == b_copy assert b is not b_copy for i in range(4): assert b.children[i] == b_copy.children[i] assert b.children[i] is not b_copy.children[i] for i in range(4): assert b.children[1].children[i] == b_copy.children[1].children[i] assert b.children[1].children[i] is not b_copy.children[1].children[i] # TESTS FOR ROTATE # def test_rotate_lone() -> None: b = lone_block() assert not b.rotate(1) assert b == b def test_rotate_logic() -> None: b = complicated_block_depth_3_(3) b2 = complicated_block_depth_3_(3) b.rotate(1) b2.rotate(3) b2.rotate(3) b2.rotate(3) assert b == b2 def test_non_rotation() -> None: b = one_block_4_kids_one_kid_has_4_kids_(5) assert not b.children[0].rotate(1) assert b.children[2].rotate(1) assert b.children[2].children[0].colour == MELON_MAMBO assert b.children[2].children[1].colour == REAL_RED assert b.children[2].children[2].colour == REAL_RED assert b.children[2].children[3].colour == TEMPTING_TURQUOISE # TESTS FOR SWAP # def test_swap_lone() -> None: b = lone_block() assert not b.swap(0) b2 = lone_block() assert b == b2 assert b is not b2 def test_swap_logic() -> None: board = complicated_block_depth_3_(3) b = board.children[1].create_copy() b2 = board.children[1].create_copy() assert board.children[1].swap(0) assert b.swap(0) assert board.children[1] == b assert board.children[1].swap(0) assert board.children[1] == b2 def test_non_swap() -> None: board = one_block_4_kids_one_kid_has_4_kids_(2) board_copy = one_block_4_kids_one_kid_has_4_kids_(2) assert not board.children[1].swap(1) assert board == board_copy assert board.children[2].swap(1) assert board.children[2].children[0].colour == REAL_RED assert board.children[2].children[1].colour == REAL_RED assert board.children[2].children[2].colour == MELON_MAMBO assert board.children[2].children[3].colour == TEMPTING_TURQUOISE # TESTS FOR PAINT # def test_paint_lone() -> None: b = lone_block() assert not b.paint(REAL_RED) assert b.paint(TEMPTING_TURQUOISE) assert b.colour == TEMPTING_TURQUOISE def test_paint_depth() -> None: board = one_block_four_children_(1) board2 = one_block_four_children_(2) assert board.children[0].paint(MELON_MAMBO) assert not board.children[1].paint(MELON_MAMBO) assert not board2.children[0].paint(MELON_MAMBO) assert not board2.children[1].paint(MELON_MAMBO) def test_non_paint() -> None: board = one_block_sixteen_grandkids_(2) board_copy = one_block_sixteen_grandkids_(2) for i in range(4): assert not board.children[i].paint(REAL_RED) assert board == board_copy # TESTS FOR COMBINE # def test_combine_lone() -> None: b = lone_block() b2 = lone_block() assert not b.combine() assert b == b2 def test_combine_depth() -> None: board = one_block_4_children_8_grandkids_4_great_grandkids_(3) board2 = one_block_4_children_8_grandkids_4_great_grandkids_(4) assert board.children[1].children[3].colour is None assert board.children[1].children[3].combine() assert board.children[1].children[3].colour == OLD_OLIVE assert board2.children[1].children[3].colour is None assert not board2.children[1].children[3].combine() assert board2.children[1].children[3].colour is None # TESTS FOR GENERATE MOVE # def test_returns_block() -> None: """This one fails a lot because block.combine() is buggy because we are using colours that are not in COLOUR_LIST, something which they do not test for. """ gr = BlobGoal(REAL_RED) gp = PerimeterGoal(MELON_MAMBO) board = one_block_four_children_(1) rp = RandomPlayer(0, gr) sp = SmartPlayer(1, gp, 10) rp._proceed = True sp._proceed = True move_block_rp = rp.generate_move(board)[2] move_block_sp = sp.generate_move(board)[2] assert move_block_rp == board or move_block_rp in board.children assert move_block_sp == board or move_block_sp in board.children def test_score_is_greater() -> None: """Same shit w last method""" gp = PerimeterGoal(MELON_MAMBO) board = one_block_four_children_(1) sp = SmartPlayer(1, gp, 4) sp._proceed = True move = sp.generate_move(board) score = gp.score(board) if move[0] != 'pass': assert _is_move_valid(sp, move[2], (move[0], move[1])) score2 = gp.score(board) if move[0] != 'pass': assert score2 > score else: assert score2 == score if __name__ == '__main__': pytest.main(['test_cases2.py'])
995,775
fd752c43d4ddd02d1b6672ebbbbc9563c3e0f7db
# -*- coding: utf-8 -*- """ Created on Mon Dec 16 17:21:41 2019 @author: up201808912 """ import math def f(x): return (2*x+1)**2-5*math.cos(10*x) def regra_aurea_min(x1,x2,intervalo): B=(math.sqrt(5)-1)/2 A=B**2 while abs(x2-x1)>intervalo: x3=x1+A*(x2-x1) x4=x1+B*(x2-x1) if f(x3)>f(x4): x1=x3 elif f(x3)<f(x4): x2=x4 else: print("ERRROR") if f(x3)<f(x4): return x3 else: return x4 def regra_aurea_max(x1,x2,intervalo): B=(math.sqrt(5)-1)/2 A=B**2 i=0 while abs(x2-x1)>intervalo: i+=1 x3=x1+A*(x2-x1) x4=x1+B*(x2-x1) if f(x3)<f(x4): x1=x3 elif f(x3)>f(x4): x2=x4 else: print("ERRROR") print(i) if f(x3)>f(x4): return x3 else: return x4 intervalo=10**-3 x1=-1 x2=0 print(regra_aurea_min(x1,x2,intervalo)) print(regra_aurea_max(x1,x2,intervalo))
995,776
e63511f23cdfb43935c61ae83983fbfbfc392764
from django.shortcuts import render # Create your views here. from django.shortcuts import HttpResponse from fantasy.models import Character def add(request): a = request.GET['a'] b = request.GET['b'] c = int(a) + int(b) return HttpResponse(str(c)) def add2(request, a, b): c = int(a) + int(b) return HttpResponse(str(c)) def index2(request): data = Character.objects.all() staff_str = list(map(lambda a: a.name, data)) context = {} context['label'] = ' '.join(staff_str) return render(request, 'home.html', context) # 视图显示和请求处理============================================================= def form(request): return render(request, 'investigate.html') def investigate(request): rlt = request.GET['staff'] return HttpResponse(rlt) from django.http import HttpResponseRedirect from django.urls import reverse def operationDB(request): # objects是是django默认的管理器对象,自己也可以在Character类下设置:objects=models.Manage() data = Character.objects.all() # staff_str = list(map(lambda a:a.name, data)) # return HttpResponse("<p>" + ' '.join(staff_str) + "</p>") return render(request, 'for.html', {"staffs": data}) def getname(request): alldata = Character.objects.all() return render(request, 'nameget.html', {"name": alldata}) def addname(request): if request.POST: newname = request.POST['staff'] newdata = Character(name=newname) newdata.save() return HttpResponseRedirect(reverse('getname'))
995,777
a5eadbb16815bd14141645f951b301e2a1563e07
import random class Search: """Analyze board for best positions to play.""" def __init__(self, args=()): self.key_values = [] self.most_valuable = [] def strategy(self, game, args=()): """Return open key for player to play in game.""" def evaluate(self, board): """Set key_values and arg_maxes. Assign value for some open keys. Find the most valuable among them.""" def reset(self, board): """Prepare self for upcoming game.""" def advance(self, board): """Prepare self for upcoming move given other player's move.""" def get_most_valuable(self): """Return most valued open keys.""" return self.most_valuable def get_key_values(self): """Return key value pairs, denoting value of each open key relative to current player.""" return self.key_values def get_norm_key_values(self, board): """Return key value pairs, values normalized from 0 to 100.""" return self.key_values def explore(self, *args): """Explore state space as necessary.""" class RandomSearch(Search): def strategy(self, game, args=()): """Return open key for player to play in game. Randomly choose from most valuable keys.""" return random.choice(list(game.board.open_keys.keys())) def evaluate(self, board): """All keys valued uniformly.""" self.most_valuable = sorted(board.open_keys.keys()) self.key_values = [(key, 50) for key in self.most_valuable] class TreeSearch(Search): def __init__(self, tree_inst): self.tree = tree_inst super().__init__() def explore(self, board, args): """Explore state space as necessary.""" self.tree.explore(board, *args) def strategy(self, game, args): self.tree.explore(game.board, *args) self.evaluate(game.board) return random.choice(self.most_valuable) def reset(self, board): # self.tree.table = self.tree.table_cls() for i in range(board.moves()): self.tree.table.clear_moves(i) # def advance(self, board): # if board.moves(): # self.tree.table.clear_moves(board.moves()-1) def evaluate(self, board): self.most_valuable = self.tree.most_valuable(board) class IterativeDeepeningTreeSearch(TreeSearch): def explore(self, board, args): for depth in range(1, args[0]+1): self.tree.principal_explore(board, depth) def strategy(self, game, args): for depth in range(1, args[0]+1): self.tree.principal_explore(game.board, depth) self.evaluate(game.board) return random.choice(self.most_valuable) class TimeIterativeDeepeningTreeSearch(IterativeDeepeningTreeSearch): def strategy(self, game, args): alarm = time.time() + game.current_time() / 2 - 1 max_depth = args[0]+1 for depth in range(1, max_depth): if time.time() > alarm: break self.tree.principal_explore(alarm, game.board, depth) self.evaluate(game.board) return random.choice(self.most_valuable) class MonteCarloTreeSearch(TreeSearch): def evaluate(self, board): self.key_values = self.tree.children_key_values(board) self.most_valuable = self.tree.most_valuable(board, self.key_values) def get_norm_key_values(self, board): return [(key, self.tree.norm_value(board, value)) for key, value in sorted(self.children_key_values, key=lambda item: item[0])] class TimeMonteCarloTreeSearch(MonteCarloTreeSearch): def strategy(self, game, args): alarm = time.time() + game.current_time() / 2 - 1 if board not in self.tree.table: self.tree.add_child(game.board) iterations = args[0] for _ in range(iterations): self.tree.playout(game.board) if time.time() > alarm: break self.evaluate(game.board) return random.choice(self.most_valuable)
995,778
de8f0b9a44dd7af2f4b749ecd729f3aa7793a29a
import matplotlib.pyplot as plt from Table import * from MathO import * class Main(object): fig = plt.figure( 1 ) plt.xlabel("Значения X") plt.ylabel("плотность распределения p*") plt.title("Гистограмма плотности функции распределения") plt.bar( Math1.otr,Math1.p, align='center', width=0.1, color = 'violet' ) plt.grid(True) fig2 = plt.figure( 2 ) plt.xlabel( "Значения X" ) plt.ylabel( "плотность распределения p*" ) plt.title( "Гистограмма плотности по распределению Пирсона" ) plt.bar( Math1.pint(Math1), Math1.p , align='center', width=0.1, color='violet' ) plt.grid( True ) plt.show() if Math1.Pearson(Math1) < tabl_value[Math1.m - 1]: print("Теоретическое распределение согласуется с выборочным" ) else: print("Теоретическое распределение не согласуется с выборочным")
995,779
d8274ed2b5bc2cdb27e4fa8c0bbe635746c05957
# Generated by Django 3.2.6 on 2021-08-12 16:49 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('todo', '0006_remove_todo_ordre'), ] operations = [ migrations.AddField( model_name='todo', name='couleur', field=models.CharField(default='is-warning', max_length=255), preserve_default=False, ), ]
995,780
3a6bd01495f1cab1cc7662131d7d6fe98b724a9b
import os import glob import imageio from config import NTH_SAVE, GPU if __name__ == '__main__': print('Createing GIF ...') training_img_dir = 'training_images' num_training_images = len([name for name in os.listdir(training_img_dir)]) output_name = 'MNIST_VAE_Training_{}_epochs.gif'.format( num_training_images) with imageio.get_writer(output_name, mode='I') as writer: filenames = glob.glob('{}/*.png'.format(training_img_dir)) filenames = sorted(filenames) for i, filename in enumerate(filenames): # Only add every nth image or last to gif if i % NTH_SAVE == 0 or i == len(filenames) - 1: image = imageio.imread(filename) writer.append_data(image) # Add extra frames of the last image if i == len(filenames) - 1: num_extra_frames = 5 for _ in range(num_extra_frames): writer.append_data(image) print('GIF written to {}'.format(os.path.abspath(output_name)))
995,781
b9051ce3a6486928c43dfdf328b7188eb6b965fb
#!/Users/tmcfarlane/pyProjects/3_6_1/BucketListApp/venv/bin/python from django.core import management if __name__ == "__main__": management.execute_from_command_line()
995,782
dd4b79c8d43ea1486e2af05c42dbb38369a94be7
from classification_contract.wine_test_data.utilities import get_classified_wine import json from classification_contract.messages import create_create_message, create_delete_message, read_all_messages from nose.tools import assert_equals, assert_dict_equal @given(u'I have a classified wine') def step_impl(context): context.classified_wine = get_classified_wine() @given(u'I POST it to the wines endpoint') @when(u'I POST it to the wines endpoint') def step_impl(context): response = context.client.post('v1/wines/', data=json.dumps(context.classified_wine), headers={'content-type':'application/json'}) assert_equals(response.status_code, 201) response_content = json.loads(response.get_data(as_text=True)) context.classified_wine_id = response_content['id'] @when(u'I DELETE the record') def step_impl(context): response = context.client.delete('v1/wines/?id={}'.format(context.classified_wine_id)) assert_equals(response.status_code, 204) @then(u'the creation is logged') def step_impl(context): expected_message = create_create_message(context.classified_wine_id, context.classified_wine) _assert_contains_message(context, expected_message) @then(u'the deletion is logged') def step_impl(context): expected_message = create_create_message(context.classified_wine_id) _assert_contains_message(context, expected_message) def _assert_contains_message(context, expected_message): messages = read_all_messages(context.test_log_backend.hosts, context.test_log_backend.topic_name) matching_messages = [message for message in messages if message['type'] == expected_message['type'] and message['id'] == expected_message['id']] assert_equals(1, len(matching_messages), 'no/too many matching messages logged') assert_dict_equal(matching_messages[0], expected_message)
995,783
acb131373553a5831285a4822232a739860afadd
#!/usr/bin/python import os import sys def deduparg(arg): if arg.startswith("@"): return True if arg.startswith("-fsanitize="): return True if arg.startswith("-Wl,-plugin-opt="): return True if arg.startswith("-Wl,-l:") and arg.endswith(".a"): return True if arg == "-Wl,-whole-archive,-l:libmetadata.a,-no-whole-archive": return True return False def skiparg(arg): if arg == "-fno-rtti": return True return False args = list() argset = set() for arg in sys.argv[1:]: if skiparg(arg): continue if deduparg(arg) and (arg in argset): continue args.append(arg) argset.add(arg) os.execvp(args[0], args)
995,784
3a2928da2b495c3c52e99911e9beec94fca5fcef
""" dev2 api schema 'dev2.baidu.com' api schema # noqa: E501 Generated by: https://openapi-generator.tech """ import sys import unittest import baiduads from baiduads.dpacreative.model.format_template_type import FormatTemplateType globals()['FormatTemplateType'] = FormatTemplateType from baiduads.dpacreative.model.get_format_templates_response_wrapper_body import GetFormatTemplatesResponseWrapperBody class TestGetFormatTemplatesResponseWrapperBody(unittest.TestCase): """GetFormatTemplatesResponseWrapperBody unit test stubs""" def setUp(self): pass def tearDown(self): pass def testGetFormatTemplatesResponseWrapperBody(self): """Test GetFormatTemplatesResponseWrapperBody""" # FIXME: construct object with mandatory attributes with example values # model = GetFormatTemplatesResponseWrapperBody() # noqa: E501 pass if __name__ == '__main__': unittest.main()
995,785
05d727f16fee28eba0c1e5ff2106ae12b3afcfe7
# Write a python function that takes a sequence of numbers and determines if all the numbers are different from each other(that is they are distinct) def distinct(n): num = set() for i in n: if i in num: return "Numbers are not unique." else: num.add(i) return "Numbers are unique." b = distinct([2, 3, 4, 5, 6, 7, 8, 2]) print(b)
995,786
3315dcb9cd32ce82dd82885db9fbf20abbdc44bc
# -*- coding: utf-8 -*- """ Created on Sat Jan 11 18:08:22 2020 @author: ANA """ def w(x,y): return -1.1*x*y + 12*y + 7*x*x - 8*x def dwx(x,y): return -1.1*y + 14*x - 8 def dwy(x,y): return -1.1*x + 12 def gradiente(x, y, h, numItr): xn = 0 yn = 0 for i in range(numItr): xn = x - h * dwx(x, y) yn = y - h * dwy(x, y) if w(xn, yn) < w(x, y): h *= 2 y = yn x = xn if w(xn, yn) > w(x, y): h /= 2 return w(x,y) print("Valor da função: ",gradiente(3,1,0.1,1))
995,787
64cc0cd5fc6d57247138ec19cd97486a303578cf
# this program defines a method that finds the max of three entered value def MaxOfThree(x, y, z): Max = x if y > Max: Max = y if z > Max: Max = z return Max x = raw_input('Enter first value: ') y = raw_input('Enter Second value: ') z = raw_input('Enter third value: ') try: a=float(x) b=float(y) c=float(z) print "\n The maximum off",x, y, z,"is", MaxOfThree(a, b, c) except: print "\n The maximum of",x, y, z,"is", MaxOfThree(x, y, z)
995,788
4711f29046e342d5d51b8f266643379e041c7f11
# -*- coding: utf-8 -*- import os, sys, subprocess, platform, socket try: from discord_webhook import DiscordWebhook, DiscordEmbed except ImportError: if sys.version_info[0] == 2: os.system('pip install discord_webhook') else: os.system('pip3 install discord_webhook') from discord_webhook import DiscordWebhook, DiscordEmbed # global vars.. PLATFORM = platform.system() # basic set for discord webhook STATUS = "status" WARNING = "warning" WEBHOOKS = { STATUS:"https://discord.com/api/webhooks/...상태알림받을웹훅주소", WARNING:"https://discord.com/api/webhooks/...경고알림받을웹훅주소" } COLORS = { STATUS: 242424, WARNING: 16711680 } WHLIST = dict() SVR_NAME = socket.gethostname().upper() # 서버 명 직접입력 가능 #SVR_NAME = "서버명" #WATCH_PATH = ['C:', 'P:', 'X:'] # 감시할 경로 입력:윈도우 WATCH_PATH = ['/dev/sda1', '/mnt/gdrive'] # 감시할 경로 입력: 리눅스 dev명 또는 경로명 적절히 입력 DISK_ALARM_LIMIT = "75" # 경고알람 기준 TITLES = { STATUS :"[알림] ({svr})서버 파일시스템 사용량 정보 (기준: {limit}%)".format(svr=SVR_NAME, limit=DISK_ALARM_LIMIT), WARNING:"[경고] ({svr})서버 파일시스템 사용량 경보 (기준: {limit}%)".format(svr=SVR_NAME, limit=DISK_ALARM_LIMIT) } MSG_QUEUE = { STATUS: [], WARNING: [] } def init_discord_webhook(): for whkey in WEBHOOKS.keys(): wh = DiscordWebhook(url=WEBHOOKS[whkey]) WHLIST[whkey] = [wh, 0] def get_discord_webhook(whkey): return WHLIST[whkey] def send_discord_msg(): for whkey in WEBHOOKS.keys(): mqueue = MSG_QUEUE[whkey] if len(mqueue) == 0: continue wh = get_discord_webhook(whkey) embed = DiscordEmbed(title=TITLES[whkey], color=COLORS[whkey]) embed.set_author(name=SVR_NAME) path = "\n".join([x[0] for x in mqueue]) used = "\n".join([x[2]+"/"+x[1] for x in mqueue]) usep = "\n".join([x[3] for x in mqueue]) embed.add_embed_field(name="경로", value=path, inline=True) embed.add_embed_field(name="사용/전체", value=used, inline=True) embed.add_embed_field(name="사용률", value=usep, inline=True) embed.set_timestamp() wh[0].add_embed(embed) response = wh[0].execute() print (response) def is_limit_over(usep): nusep = int(usep.replace('%', '')) return (nusep > int(DISK_ALARM_LIMIT)) def check_disk_usage_linux(): #cmd cmd_df = os.popen('which df').read().split('\n')[0].strip() cmd_egrep = os.popen('which egrep').read().split('\n')[0].strip() str_egrep = "|".join(WATCH_PATH) cmd = '{df} -h | {grep} "{gstr}"'.format(df = cmd_df, grep = cmd_egrep, gstr=str_egrep) #for line in subprocess.check_output(cmd, shell=True, stderr=subprocess.STDOUT).split('\n'): for line in os.popen(cmd).read().split('\n'): if line == '': continue data = line.split() fs = data[5] ####### 1: 마운트dev 기준, 5: 경로기준 total = data[1] use = data[2] usep= data[4] if is_limit_over(usep): whtype = WARNING else: whtype = STATUS MSG_QUEUE[whtype].append([fs, total, use, usep]) def check_disk_usage_windows(): cmd = 'wmic logicaldisk get deviceid,size,freespace'.split() for line in subprocess.check_output(cmd).decode('utf-8').split('\r\n'): if line.startswith('rn'): continue try: data = line.split() if data[0] not in WATCH_PATH: continue nfr = float(data[1]) / (1024 * 1024 * 1024) nto = float(data[2]) / (1024 * 1024 * 1024) nus = nto - nfr fs = data[0] total = str(int(nto)) + "G" use = str(int(nto-nfr)) + "G" usep = str(int(nus/nto*100)) + "%" if is_limit_over(usep): whtype=WARNING else: whtype = STATUS MSG_QUEUE[whtype].append([fs, total, use, usep]) except: print ("Exception accured: ignored") def check_disk_usage(): if PLATFORM == 'Windows': check_disk_usage_windows() else: check_disk_usage_linux() # MAIN init_discord_webhook() check_disk_usage() send_discord_msg()
995,789
a7370a6259cbec0b236bbc89cef7086898838aa9
''' Script for retrieving the list of ICPE documents ''' import os import random from typing import List from urllib.request import HTTPError, urlretrieve # type: ignore from envinorma.models.document import Document, DocumentType from tqdm import tqdm from tasks.data_build.filenames import CQUEST_URL, DOCUMENTS_FOLDER, GEORISQUES_DOWNLOAD_URL from tasks.data_build.load import load_documents_from_csv _BAR_FORMAT = '{l_bar}{r_bar}' def _download_file_if_doesnt_exist(source: str, destination: str) -> bool: if os.path.exists(destination): print('file exists') return False try: urlretrieve(source, destination) except HTTPError as exc: print(source, exc) return True return False def _download_document(url: str) -> None: full_url = CQUEST_URL + '/' + url destination = DOCUMENTS_FOLDER + '/' + url.replace('/', '_') found = _download_file_if_doesnt_exist(full_url, destination) if not found: print('Not found, attempting georisques.') source_georisques = GEORISQUES_DOWNLOAD_URL + '/' + url _download_file_if_doesnt_exist(source_georisques, destination) def _download_documents(documents: List[Document]) -> None: for doc in tqdm(documents, 'Downloading documents.', bar_format=_BAR_FORMAT): _download_document(doc.url_doc) if __name__ == '__main__': ALL_DOCS = [doc for doc in load_documents_from_csv('all') if doc.type == DocumentType.AP] _download_documents(random.sample(ALL_DOCS, 100))
995,790
cbdde0ea3727bbdf1857cfdd8710659b7f82eb07
class BaseHandler(object): test2_field = 'test2'
995,791
eed0924cd76249e2cc4dbf9b21b586267443b0f2
import kin # each motor is given the positional id ab, with a the leg number (0 being the one closest to the power plug), # and b among 0, 1, 2 in proximo distal order. # that define the global order or motors, as the numerical one. pos_name = set(['position', 'goal_position', 'cw_angle_limit', 'ccw_angle_limit', 'present_position']) n = 4 # 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 spiders_ids = (( 8, 7, 9, 15, 11, 12, 10, 4, 16, 13, 2, 18, 6, 5, 1, 17, 3, 14), (14, 16, 18, 8, 10, 12, 2, 4, 6, 1, 3, 5, 7, 9, 11, 13, 15, 17), ( 1, 3, 5, 7, 9, 11, 13, 15, 17, 14, 16, 18, 8, 10, 12, 2, 4, 6), ( 1, 3, 5, 13, 15, 17, 7, 9, 11, 14, 16, 18, 8, 10, 12, 2, 4, 6), ( 7, 9, 11, 1, 3, 5, 13, 15, 17, 14, 16, 18, 8, 10, 12, 2, 4, 6), ) # This is orientations *after* reodering ! spiders_ori = (( 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1), ( 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1), ( 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1), ( 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1), ( 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1, 1, -1, 1), ) spiders_off = ((150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 186.0, 150.0, 150.0, 150.0, 150.0, 150.0), (150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0), (150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0), (150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0), (150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0, 150.0), ) leg_axis = (( 1, 0), ( 0, 1), ( 1, 0), ( 1, 0), ( 0, 1), ( 1, 0)) leg_dir = (( 1, 1), ( 1, 1), (-1, -1), (-1, -1), (-1, -1), ( 1, 1)) class MotorInterface(object): def __init__(self, motor, orientation = 1, offset = 150.0): assert orientation == 1 or orientation == -1 object.__setattr__(self, 'motor', motor) object.__setattr__(self, 'orientation', orientation) object.__setattr__(self, 'offset', offset) def __setattr__(self, name, value): if name in pos_name: return self.motor.__setattr__(name, self._pos2real(value)) return self.motor.__setattr__(name, value) def __getattr__(self, name): if name in pos_name: return self._real2pos(self.motor.__getattribute__(name)) return self.motor.__getattribute__(name) def _pos2real(self, pos): return (pos - 150.0) * self.orientation + self.offset def _real2pos(self, pos): return (pos - self.offset) * self.orientation + 150.0 class SpiderInterface(object): def __init__(self, ctrl, n = n): assert len(ctrl.motors) == 18 self.n = n self.ctrl = ctrl self.motors = [] for k, m in enumerate(ctrl.motors): m = self.ctrl.motors[spiders_ids[n][k] - 1] self.motors.append(MotorInterface(m, spiders_ori[n][k], spiders_off[n][k])) self._create_legs() def _create_legs(self): assert len(self.motors) == 18 self.legs = [] for i in range(6): self.legs.append(Leg(i, [self.motors[3*i], self.motors[3*i+1], self.motors[3*i+2]])) def spread(self, angle): assert angle >= 0 proximal_pose = (150-angle, 150, 150+angle, 150-angle, 150, 150+angle) for p_i, leg in zip(proximal_pose, self.legs): leg.proximo.position = p_i class Leg(object): """Hexapod leg. Is made of three motors (interfaces) given in proximo-distal order. """ def __init__(self, number, motors): assert len(motors) == 3 object.__setattr__(self, 'number', number) object.__setattr__(self, 'motors', motors) object.__setattr__(self, 'proximo', motors[0]) object.__setattr__(self, 'middle', motors[1]) object.__setattr__(self, 'distal', motors[2]) def __setattr__(self, name, value): if hasattr(value, '__iter__'): if len(value) == 3: for v_i, m_i in zip(value, self.motors): if v_i is not None: setattr(m_i, name, v_i) else: raise ValueError, 'Too many or to little value to set: expected 3, got {}.'.format(len(value)) else: if value is not None: for motor in self.motors: setattr(motor, name, value) def __getattr__(self, name): return tuple(getattr(motor, name) for motor in self.motors) def _leg2global(self, pos): x = leg_dir[self.number][0]*pos[leg_axis[self.number][0]] y = leg_dir[self.number][1]*pos[leg_axis[self.number][1]] z = pos[2] return x, y, z def _global2leg(self, pos): x = leg_dir[self.number][0]*pos[leg_axis[self.number][0]] y = leg_dir[self.number][1]*pos[leg_axis[self.number][1]] z = pos[2] return x, y, z @property def tip(self): alpha = self.proximo.position - 150.0 beta = - (self.middle.position - 150.0) gamma = - (self.distal.position - 150.0) return self._leg2global(kin.forward_kin(alpha, beta, gamma)) def displace_tip(self, dx, dy, dz): x, y, z = self.tip alpha = self.proximo.position - 150.0 beta = - (self.middle.position - 150.0) gamma = - (self.distal.position - 150.0) xdx, ydy, zdz = self._global2leg((x+dx, y+dy, z+dz)) alpha, beta, gamma = kin.inverse_kin(xdx, ydy, zdz) self.proximo.position = alpha + 150.0 self.middle.position = 150.0 - beta self.distal.position = 150.0 - gamma
995,792
ad78cb6253bacde847a20215a303b38cc642e8ad
import nuke import nukescripts import re class MassivePanel(nukescripts.PythonPanel): def __init__(self): nukescripts.PythonPanel.__init__(self, 'MassivePanel', 'com.ohufx.MassivePanel') ############# setting help messages KnobInfo = " type knob's name in, also you can Ctrl+Drag&Drop from the knob you want to adjust , then if you will click in value knob and back click in Knob field it will automaticly extract knob name for you (trying to make it better in next version :)" ArrayInfo = "You have to set what exactly you want to change, All - will set same value on xyz, X , Y , Z - will set value only on your selection x,y or z" ValueInfo = "set new value for selected nodes" IncrInfo = "set here increment between values, for example if value=3 and increment 2 - you will have 3,5,7,9..." KindInfo = "put String if you want to set string and finally put Expression if you entering expression" #############creating knobs self.Knob = nuke.String_Knob( KnobInfo, "Knob:") self.Value = nuke.String_Knob(ValueInfo,"Value:") self.Array = nuke.Enumeration_Knob(ArrayInfo,"Array:",[ "All","X","Y","Z"],) self.Kind = nuke.Enumeration_Knob(KindInfo,"Kind:",[ "Float","String", "Expression"],) self.Kind.clearFlag(nuke.STARTLINE) self.Increment = nuke.String_Knob(IncrInfo,"Increment:","0") self.Increment.clearFlag(nuke.STARTLINE) self.Go = nuke.PyScript_Knob("Go", "Go") ############applying knobs to panel in order for k in (self.Knob,self.Value,self.Increment,self.Array,self.Kind,self.Go): self.addKnob(k) ############### setting basic function def knobChanged(self,knob): if knob in (self.Knob,self.Value,self.Array,self.Increment): string = self.Knob.value() if ':' in string: firstSplit = string.rsplit('.')[1] self.Knob.setValue(firstSplit) elif knob == self.Go: s = self.Value.value() Knob = self.Knob.value() Value = self.Value.value() array = self.Array.value() kind = self.Kind.value() incr = self.Increment.value() incr = float(incr) u = 0 n = nuke.selectedNodes() ######## setting float values if array== "All" and kind == "Float": Value = float(Value) for n in n: n[Knob].setValue(Value+u) u = incr+ u if array== "X" and kind == "Float": Value = float(Value) for n in n: n[Knob].setValue(Value+u,0) u = incr+ u if array== "Y" and kind == "Float": Value = float(Value) for n in n: n[Knob].setValue(Value+u,1) u = incr+ u if array== "Z" and kind == "Float": Value = float(Value) for n in n: n[Knob].setValue(Value+u,2) u = incr+ u ######## setting string values if array== "All" and kind == "String": for n in n: n[Knob].setValue(Value) if array== "X" and kind == "String": for n in n: n[Knob].setValue(Value,0) if array== "Y" and kind == "String": for n in n: n[Knob].setValue(Value,1) if array== "Z" and kind == "String": for n in n: n[Knob].setValue(Value,2) ######## setting expression values if array== "All" and kind == "Expression": for n in n: n[Knob].setExpression(Value) if array== "X" and kind == "Expression": for n in n: n[Knob].setExpression(Value,0) if array== "Y" and kind == "Expression": for n in n: n[Knob].setExpression(Value,1) if array== "Z" and kind == "Expression": for n in n: n[Knob].setExpression(Value,2) #def addMassivePanel(): ####myPanel = MassivePanel() ####return myPanel.addToPane() #paneMenu = nuke.menu('Pane') #paneMenu.addCommand('MassivePanel', addMassivePanel) #nukescripts.registerPanel( 'com.ohufx.MassivePanel', #addMassivePanel) import nuke import nukescripts import re class MassivePanel(nukescripts.PythonPanel): def __init__(self): nukescripts.PythonPanel.__init__(self, 'MassivePanel', 'com.ohufx.MassivePanel') ############# setting help messages KnobInfo = " type knob's name in, also you can Ctrl+Drag&Drop from the knob you want to adjust , then if you will click in value knob and back click in Knob field it will automaticly extract knob name for you (trying to make it better in next version :)" ArrayInfo = "You have to set what exactly you want to change, All - will set same value on xyz, X , Y , Z - will set value only on your selection x,y or z" ValueInfo = "set new value for selected nodes" IncrInfo = "set here increment between values, for example if value=3 and increment 2 - you will have 3,5,7,9..." KindInfo = "put String if you want to set string and finally put Expression if you entering expression" #############creating knobs self.Knob = nuke.String_Knob( KnobInfo, "Knob:") self.Value = nuke.String_Knob(ValueInfo,"Value:") self.Array = nuke.Enumeration_Knob(ArrayInfo,"Array:",[ "All","X","Y","Z"],) self.Kind = nuke.Enumeration_Knob(KindInfo,"Kind:",[ "Float","String", "Expression"],) self.Kind.clearFlag(nuke.STARTLINE) self.Increment = nuke.String_Knob(IncrInfo,"Increment:","0") self.Increment.clearFlag(nuke.STARTLINE) self.Go = nuke.PyScript_Knob("Go", "Go") ############applying knobs to panel in order for k in (self.Knob,self.Value,self.Increment,self.Array,self.Kind,self.Go): self.addKnob(k) ############### setting basic function def knobChanged(self,knob): if knob in (self.Knob,self.Value,self.Array,self.Increment): string = self.Knob.value() if ':' in string: firstSplit = string.rsplit('.')[1] self.Knob.setValue(firstSplit) elif knob == self.Go: s = self.Value.value() Knob = self.Knob.value() Value = self.Value.value() array = self.Array.value() kind = self.Kind.value() incr = self.Increment.value() incr = float(incr) u = 0 n = nuke.selectedNodes() ######## setting float values if array== "All" and kind == "Float": Value = float(Value) for n in n: n[Knob].setValue(Value+u) u = incr+ u if array== "X" and kind == "Float": Value = float(Value) for n in n: n[Knob].setValue(Value+u,0) u = incr+ u if array== "Y" and kind == "Float": Value = float(Value) for n in n: n[Knob].setValue(Value+u,1) u = incr+ u if array== "Z" and kind == "Float": Value = float(Value) for n in n: n[Knob].setValue(Value+u,2) u = incr+ u ######## setting string values if array== "All" and kind == "String": for n in n: n[Knob].setValue(Value) if array== "X" and kind == "String": for n in n: n[Knob].setValue(Value,0) if array== "Y" and kind == "String": for n in n: n[Knob].setValue(Value,1) if array== "Z" and kind == "String": for n in n: n[Knob].setValue(Value,2) ######## setting expression values if array== "All" and kind == "Expression": for n in n: n[Knob].setExpression(Value) if array== "X" and kind == "Expression": for n in n: n[Knob].setExpression(Value,0) if array== "Y" and kind == "Expression": for n in n: n[Knob].setExpression(Value,1) if array== "Z" and kind == "Expression": for n in n: n[Knob].setExpression(Value,2) #def addMassivePanel(): ####myPanel = MassivePanel() ####return myPanel.addToPane() #paneMenu = nuke.menu('Pane') #paneMenu.addCommand('MassivePanel', addMassivePanel) #nukescripts.registerPanel( 'com.ohufx.MassivePanel', #addMassivePanel)
995,793
40df77949435401eeeae7c6a2c599e5204fa24aa
from app import app from flask import render_template, request, redirect, flash, url_for, Markup, g, send_from_directory, abort, Response from app.helpers import allowed_file, writeTex, deleteImgUpload, deletePdf from werkzeug.utils import secure_filename from werkzeug.exceptions import default_exceptions, HTTPException, InternalServerError from operator import itemgetter import os, re, jinja2, sys # Set jinja2 environment in latex syntax so that it doesn't conflict with .tex PATH = os.path.join(os.path.dirname(__file__),'./templates/tex') TEMPLATELOADER = jinja2.FileSystemLoader(searchpath=PATH) LATEX_JINJA_ENV = jinja2.Environment( block_start_string = '((*', block_end_string = '*))', variable_start_string = '(((', variable_end_string = ')))', comment_start_string = '((=', comment_end_string = '=))', loader = TEMPLATELOADER, autoescape = False ) @app.route("/") def index(): """ Open index page and show current assignments """ with app.app_context(): return render_template("public/index.html") LATEX_SUBS = ( (re.compile(r"\\"), r"\\textbackslash"), (re.compile(r"([{}_#%&$])"), r"\\\1"), (re.compile(r"~"), r"\~{}"), (re.compile(r"\^"), r"\^{}"), (re.compile(r'"'), r"''"), (re.compile(r"\.\.\.+"), r"\\ldots"), ) def escape_tex(value): """ Make sure tex syntax is escaped """ newval = value for pattern, replacement in LATEX_SUBS: newval = pattern.sub(replacement, newval) return newval LATEX_JINJA_ENV.filters['escape_tex'] = escape_tex TEXTEMPLATE = LATEX_JINJA_ENV.get_template('template.tex') @app.route("/createpdf", methods=["POST"]) def createpdf(): """ Get form data and render pdf """ with app.app_context(): # Get form data if request.form: data = request.form else: return 'no form' msg = {} msg['name'] = data['name'] msg['role'] = data['role'] msg['unit'] = data['unit'] msg['unitdetail'] = data['unitdetail'] msg['phone'] = data['phone'] msg['email'] = data['email'] msg['employmentdate'] = data['employmentdate'] filename = 'default.png' if 'img' in request.files: file = request.files['img'] if file and allowed_file(file.filename): filename = secure_filename(file.filename).replace("_","") portraitFilePath = os.path.join(app.config['IMAGE_UPLOADS'], filename) file.save(portraitFilePath) if 'presentation' in data: msg['presentation'] = data['presentation'] if 'edu-title' in data: msg['edu'] = [{'title': i, 'time': j} for i, j in zip(request.form.getlist('edu-title'), request.form.getlist('edu-time'))] msg['edu'].sort(key = itemgetter('title')) msg['edu'].sort(key = itemgetter('time'), reverse=True) if 'emp-title' in data: msg['emp'] = [{'title': i, 'time': j} for i, j in zip(request.form.getlist('emp-title'), request.form.getlist('emp-time'))] msg['emp'].sort(key = itemgetter('title')) msg['emp'].sort(key = itemgetter('time'), reverse=True) if 'cou-title' in data: msg['cou'] = [{'title': i, 'time': j} for i, j in zip(request.form.getlist('cou-title'), request.form.getlist('cou-time'))] msg['cou'].sort(key = itemgetter('title')) msg['cou'].sort(key = itemgetter('time'), reverse=True) if 'ass-title' in data: msg['ass'] = [{'title': i, 'company': j, 'role': k, 'descr': l, 'time': m} for i,j,k,l,m in zip(request.form.getlist('ass-title'), request.form.getlist('ass-company'), request.form.getlist('ass-role'), request.form.getlist('ass-descr'), request.form.getlist('ass-time'))] msg['ass'].sort(key = itemgetter('title')) msg['ass'].sort(key = itemgetter('time'), reverse=True) cv = TEXTEMPLATE.render(msg = msg, portrait = 'img/' + filename) pdf = writeTex(cv, app.config["OUT_DIR"], filename) deleteImgUpload(filename) return redirect("/getpdf/" + pdf) @app.route("/getpdf/<pdfname>") def getpdf(pdfname): filename = f'{pdfname}.pdf' with open(os.path.join(app.config['OUT_DIR'], filename), 'rb') as f: data = f.readlines() os.remove(os.path.join(app.config['OUT_DIR'], filename)) return Response(data, headers={ 'Content-Type': 'application/pdf', 'Content-Disposition': 'attachment; filename=%s;' %filename })
995,794
854cf836c72fe5c848c0ebd385a880563953a4af
''' instalacja lepszego interpretera, lpesze wyswietlanie itp. # pip install ipython ''' napis = "Ala ma kota" print(napis[2]) print(napis[4]) print (napis[0:4]) print (napis[::2]) print (napis[-1]) # for litera in napis: # print(litera) # print(litera) ala=('A', 'l', 'a', ' ', 'm' 'a') print (ala[0:5]) # wyszukiwanie elemtnu w tupli print ('y' in ala) # id wyciąga adres obiektu w pamięci print(id(ala)) #tupla a=('a', 1 ,4, 5 ,(3,2),'napis',8) print (a[4]) print (a[4][1]) # range generuje do zzadanej wartosci licznik for i in range(10): print(i)
995,795
5107e820b41cbee675dffcd0f0d6b9210c64c00a
class BTNode: def __init__(self, data): self.data = data self.left = None self.right = None # 1. Find the root (First element in the preorder_list) # 2. Find the left and right subtree (from inorder list via root node) # 3. def BTbuildInorderPostorder(inorder, postorder): if len(postorder) == 0: return None root = BTNode(postorder[-1]) left_count = 0 for i in inorder: if root.data == i: break else: left_count += 1 root.left = BTbuildInorderPostorder(inorder[:left_count] , postorder[: left_count]) root.right = BTbuildInorderPostorder(inorder[left_count+1:], postorder[left_count:-1]) return root def BTPrint(root): if root == None: return print(f"{root.data}", end = ': ') if root.left != None: print(f"{root.left.data}", end = ', ') if root.right != None: print(f"{root.right.data}", end = ' ') print() BTPrint(root.left) BTPrint(root.right) inorder = [4, 2, 5, 1, 6, 3, 7] postorder = [4, 5, 2, 6, 7, 3, 1] root = BTbuildInorderPostorder(inorder, postorder) BTPrint(root)
995,796
9ff3e847c4b6355a875ae6e02376a0768c06cf41
import pygame import time import random pygame.init() white = (255,255,255) black = (0,0,0) red = (255,0,0) green = (0,155,0 ) display_width = 800 display_height = 600 gameDisplay = pygame.display.set_mode((display_width,display_height)) pygame.display.set_caption('Snake') clock = pygame.time.Clock() block_size = 10 FPS = 20 smallfont= pygame.font.SysFont(None,25) medfont= pygame.font.SysFont(None,50) largefont= pygame.font.SysFont(None,80) def pause(): paused = True message_to_screen("Paused", black, -70, "large") message_to_screen("Press c to play or q to quit", black, 25) while paused : for event in pygame.event.get(): if event.type == pygame.QUIT: pygame.quit() quit() if event.type == pygame.KEYDOWN: if event.key == pygame.K_c: paused = False elif event.key == pygame.K_q: pygame.quit() quit() #gameDisplay.fill(white) pygame.display.update() clock.tick(5) def score(score): text = medfont.render("Score :"+str(score),True ,black) gameDisplay.blit(text, [0,0]) def randAppleGen(): randAppleX = round(random.randrange(0, display_width-block_size))#/10.0)*10.0 randAppleY = round(random.randrange(0,display_height-block_size))#/10.0)*10.0 return randAppleX,randAppleY def game_intro(): intro = True while intro: for event in pygame.event.get(): if event.type == pygame.QUIT: pygame.quit() quit() if event.type == pygame.KEYDOWN: if event.key == pygame.K_c: intro = False if event.key == pygame.K_q: pygame.quit() quit() gameDisplay.fill(white) message_to_screen("Welcome to Snake", green, -100, "large") message_to_screen("The objective of the game is to eat red apples", red, -30) message_to_screen("The more apples you eat the longer you get", black, 10) message_to_screen("If you run into yourself or the edges you die!", black, 50) message_to_screen("press c to play q to quit", red, 80) pygame.display.update() clock.tick(15) def snake(block_size,snakeList): for XnY in snakeList: pygame.draw.rect(gameDisplay,green,[XnY[0],XnY[1],block_size,block_size]) def text_objects(text,color,size): if size == "small": textSurface= smallfont.render(text,True,color) elif size == "medium": textSurface = medfont.render(text,True,color) elif size == "large": textSurface = largefont.render(text,True,color) return textSurface, textSurface.get_rect() def message_to_screen(msg,color,y_displace=0,size = "small"): textSurf, textRect = text_objects(msg,color,size) #screen_text = font.render(msg,True,color) #gameDisplay.blit(screen_text,[display_width/2,display_height/2]) textRect.center = (display_width/2),(display_height/2)+y_displace gameDisplay.blit(textSurf,textRect) def gameLoop(): gameExit = False gameOver = False lead_x = display_width/2 lead_y = display_height/2 lead_x_change = 0 lead_y_change = 0 snakeList=[] snakeLength = 1 randAppleX,randAppleY=randAppleGen() while not gameExit: if gameOver == True: message_to_screen("Game over!",red,-50,size = "large") message_to_screen("press c to play again and q to quit",black,50,size = "medium") pygame.display.update() while gameOver == True: #gameDisplay.fill(white) for event in pygame.event.get(): if event.type == pygame.QUIT: gameExit = True gameOver = False if event.type == pygame.KEYDOWN: if event.key == pygame.K_q: gameExit = True gameOver = False if event.key == pygame.K_c: gameLoop() for event in pygame.event.get(): if event.type == pygame.QUIT: gameExit= True if event.type == pygame.KEYDOWN: if event.key == pygame.K_LEFT: lead_x_change = -block_size lead_y_change = 0 elif event.key == pygame.K_RIGHT: lead_x_change = block_size lead_y_change = 0 elif event.key == pygame.K_UP: lead_y_change = -block_size lead_x_change = 0 elif event.key == pygame.K_DOWN: lead_y_change = block_size lead_x_change = 0 elif event.key == pygame.K_p: pause() if lead_x >= display_width-block_size or lead_x < 0 or lead_y >= display_height-block_size or lead_y <0 : gameOver = True lead_x += lead_x_change lead_y += lead_y_change gameDisplay.fill(white) AppleThickness = 20 pygame.draw.rect(gameDisplay ,red ,[randAppleX,randAppleY,AppleThickness,AppleThickness]) #pygame.display.rect(where,color,coordinates(top-left,how wide,how tall)) snakeHead = [] snakeHead.append(lead_x) snakeHead.append(lead_y) snakeList.append(snakeHead) if len(snakeList) > snakeLength: del snakeList[0] for eachSegment in snakeList[:-1]: if eachSegment == snakeHead: gameOver = True snake(block_size,snakeList) score(snakeLength-1) #gameDisplay.fill(red,[50,50,10,10]) pygame.display.update() """if lead_x == randAppleX and lead_y == randAppleY: randAppleX = round(random.randrange(0, display_width-block_size)/10.0)*10.0 randAppleY = round(random.randrange(0,display_height-block_size)/10.0)*10.0 snakeLength+=1""" """if lead_x >=randAppleX and lead_x <= randAppleX+AppleThickness: if lead_y >= randAppleY and lead_y <= randAppleY+AppleThickness: randAppleX = round(random.randrange(0, display_width-block_size))#/10.0)*10.0 randAppleY = round(random.randrange(0,display_height-block_size))#/10.0)*10.0 snakeLength+=1""" if lead_x > randAppleX and lead_x < randAppleX + AppleThickness or lead_x + block_size > randAppleX and lead_x + block_size < randAppleX + AppleThickness: if lead_y > randAppleY and lead_y < randAppleY + AppleThickness or lead_y + block_size > randAppleY and lead_y + block_size < randAppleY + AppleThickness: randAppleX,randAppleY=randAppleGen() snakeLength+=1 clock.tick(FPS) pygame.quit() quit() game_intro() gameLoop()
995,797
563a8009f7288ae154ce8e4020bcb99b74692ea0
"""this script is used to perform operations on the the speech to text api. the operations are such as (1) adding a custom model.... this is done using the listener.speech_to_text.create_custom_models(). (2) list the custom models created for the speech to text service. (3) delete and update models and corpora. I used three interfaces to access the Ibm speech to text API. The interfaces are (1)The python-sdk ibm developer cloud. (2)The python speech to text library. I did some serious work under the hood. (3)The curl interface using ssh commands """ from audio_recognize import Listen listener = Listen() print("Say Something") listener.listen2() # print("Listing custom models") # # result2 = listener.speech_to_text.list_custom_models() # print(result2) # # # print("Listing corpora") # # result3 = listener.speech_to_text.list_corpora(customization_id="5c081c90-29be-11e7-a25c-3515edf602ac") # # print(result3)
995,798
9e0591c43f6bc74ee2ce7d7c830b33f27ba01d9f
# Xander Kehoe import time maleValues = [1375, 2047, 2233, 2559, 3265] femaleValues = [945, 2479, 3007, 3398, 4415] def drawLine(t, x1, y1, x2, y2, colorP="black"): # Basic method to draw lines t.up() t.goto(x1, y1) t.down() t.pencolor(colorP) t.goto(x2, y2) def drawLineWithDots(t, x1, y1, x2, y2, colorP="black"): # Basic method to draw lines with dots at each end t.pencolor(colorP) t.up() t.goto(x1, y1) t.dot(5) t.down() t.goto(x2, y2) t.dot(5) def drawTickMarks(t): for i in range(6): # Drawing vertical x marks drawLine(t, 40*i, 0, 40*i, 10) drawLine(t, 0, max(maleValues)/15, 10, max(maleValues)/15) # Drawing maximum y mark for male drawLine(t, 0, max(femaleValues)/15, 10, max(femaleValues)/15) # Drawing maximum y mark for female drawLine(t, 0, min(maleValues)/15, 10, min(maleValues)/15) # Drawing minimal y mark for male drawLine(t, 0, min(femaleValues)/15, 10, min(femaleValues)/15) # Drawing minimal y mark for female def displayText(t): t.pencolor("black") t.up() t.goto(-3, (max(maleValues)/15)-10) t.write(max(maleValues), align="right") # Writing maximum y value at max y mark for male t.goto(-3, (max(femaleValues)/15) - 10) t.write(max(femaleValues), align="right") # Writing maximum y value at max y mark for female t.goto(-3, (min(maleValues)/15)-10) t.write(min(maleValues), align="right") # Writing minimum y value at min y mark for male t.goto(-3, (min(femaleValues)/15) - 10) t.write(min(femaleValues), align="right") # Writing minimum y value at min y mark for female x = 40 for i in range(1970, 2011, 10): # Writing years 1970-2010 t.goto(x, -20) t.write(str(i), align="center") x += 40 t.goto(0, -50) t.write("Two-year College Enrollment (in thousands)") # Writing Title def main(): import turtle as t t.hideturtle() drawLine(t, 0, 0, 200, 0) drawLine(t, 0, 0, 0, 400) for i in range(1, 5): # Drawing lines for male drawLineWithDots(t, 40*i, maleValues[i-1]/15, 40*(i+1), maleValues[i]/15, "blue") for i in range(1, 5): # Drawing lines for female drawLineWithDots(t, 40*i, femaleValues[i-1]/15, 40*(i+1), femaleValues[i]/15, "red") drawTickMarks(t) displayText(t) time.sleep(15) # Delay to allow user to actually look at chart so it doesn't immediately close main()
995,799
c920062cf8850d9e0775f2c00d15fa6e7b959d5b
def ex3(x): ''' function which break down the number into prime numbers, and return max element with list :param x: the number we break down into prime numbers :return: max prime numbers ''' prime_factors = [] i = 2 while x != 1: while x % i == 0: prime_factors.append(i) x = x / i i += 1 return max(prime_factors) print(ex3(600851475143))