index
int64
0
1,000k
blob_id
stringlengths
40
40
code
stringlengths
7
10.4M
996,400
30105423a5646175f94f5a48e52fb7c2549d0c67
from django.apps import AppConfig class ForignrelationshipConfig(AppConfig): name = 'ForignRelationShip'
996,401
bf0f0e1a7a9e8bfa71ceee0956621e3a3e615d1d
from glob import glob import cv2 def get_imgs(path): """ - returns a dictionary of all files having key => value as objectname => image path - returns total number of files. """ imlist = {} for each in glob(path + "*"): word = each.split("/")[-1] imlist[word] = [] for imagefile in glob(path+word+"/*"): im = cv2.imread(imagefile, 0) imlist[word].append(im) return imlist
996,402
40421d8fc79cfb13bbb8fcdaec1fa230ba3efd63
# String a = "Python Programming" # # Slice Constructor # sub = slice(0, 6, 2) # # Using indexing sequence # print(a[-5 : -2 : 2]) l = [10, 20 , 30 , 40, 50] # sub = slice(-3, -1, 2) # # Using indexing sequence # print(l[-3]) t = (10, 20, 30, 40, 50) # Slice Constructor sub = slice(-4, -1) # Using indexing sequence # print(t[-5:]) print(t[::-1]) print(a[::-1]) print(l[::-1])
996,403
4186c7f45f59f354a34cf1462c0c61d6512c6a39
from django.urls import reverse from django.contrib.auth import get_user_model from rest_framework import status from rest_framework.test import APITestCase from orders.models import Order, Customer, Device, DeviceType, Manufacturer User = get_user_model() class OrdersList(APITestCase): def setUp(self): self.url = reverse('orders-list') @classmethod def setUpTestData(cls): user = User.objects.create_user('usr', 'usr@screwman.test', 'usr') manufacturer = Manufacturer.objects.create(title='Test', description='Test manufacturer') device_type = DeviceType.objects.create(title='cell phone') device1 = Device.objects.create(device_type=device_type, manufacturer=manufacturer, serial='sn-00001', model='d-00001', description='test device') device2 = Device.objects.create(device_type=device_type, manufacturer=manufacturer, serial='sn-00002', model='d-00002', description='test device') customer1 = Customer.objects.create(name='Customer 1', phone='+380000000') customer2 = Customer.objects.create(name='Customer 2', phone='+380000001') Order.objects.create(customer=customer1, device=device1, accept_by=user, state=Order.STATE_NEW, malfunction_description='description', updated_by=user) Order.objects.create(customer=customer2, device=device2, accept_by=user, state=Order.STATE_NEW, malfunction_description='description', updated_by=user) def test_unauthenticated_access(self): response = self.client.get(self.url) self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED) response = self.client.post(self.url, {'customer': 1, 'device': 1, 'state': Order.STATE_NEW, 'malfunction_description': 'description'}) self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED) def test_authenticated_get(self): self.client.login(username='usr', password='usr') response = self.client.get(self.url) self.assertEqual(response.status_code, status.HTTP_200_OK) def test_authenticated_create(self): self.client.login(username='usr', password='usr') response = self.client.post(self.url, {'customer': 1, 'device': 1, 'state': Order.STATE_NEW, 'malfunction_description': 'description'}) self.assertEqual(response.status_code, status.HTTP_201_CREATED)
996,404
9a4412f438398c959e78429d432c060692c47eac
#=======INPUT Parameter===================================================================================== #---n1=ref index Core, n2=ref index cladding kiri, n3=ref index cladding kanan--------------------------- from scipy import* n1=1.55e0 n2=1.545e0 n3=1.545e0 wle=1.55e-6 nmoda=4 rentang=4000 lim=(n1)-0.00001 hasil = open("beta.txt", 'w') #=======mencari fx1(x)==================================================================================== def fx1(x): vf1=k0*sqrt(n1*n1-n2*n2) vf2=k0*sqrt(n1*n1-n3*n3) fx1=fx1=2.0e0*t*k0*sqrt(n1*n1-x*x)-(arctan(sqrt(vf1*vf1-k0*k0*(n1*n1-x*x))/(k0*sqrt(n1*n1-x*x))))-(arctan(sqrt(vf2*vf2-k0*k0*(n1*n1-x*x))/(k0*sqrt(n1*n1-x*x))))-kk*pi return fx1 #=======mencari dne======================================================================================= def dne(): a=(n2)+0.0000001 b=(n1) c=0 e=1.0e-10 npn=(log10((b-a)/e))/(log10((2.0e0)+0.5e0)) npn=int(npn) #print ("npn=",npn) fa=fx1(a) #print ("fa=",fa) for i in range(1,npn,1): #print (m) c=(a+b)/2.0e0 fc=fx1(c) #print ("c=",c) if (fa*fc)<0.0: b=c else: a=c dne=c return dne #=======Perhitungan LOOP Moda-moda--- MAIN PROGRAM======================================================== for kk in range(0,nmoda,1): # print ("i=",i) hasil.write("\n\n") df=0.5e-6 for k in range (1,rentang,1): #print ("j=",j) df=df+0.01e-6 k0=2*pi/wle t=df/2.0 dne_val=dne() #print (dne_val) if dne_val<lim: # print(df,"\t",dne_val) hasil.write(str(df)) hasil.write("\t") hasil.write(str(dne_val)) hasil.write("\n")
996,405
987c1309ff4f33d0bce6d4210a4a38cc521d4bce
/home/gurpreet/anaconda3/lib/python3.6/re.py
996,406
0ede0ad1c7dd99be3ec569a16e45bba4510495a5
from flask.ext.script import Manager from clapperboard import app manager = Manager(app)
996,407
a4597a73fac258c42d3a5a9a3c5e102d32182401
print "import numpy" import numpy as np #from numpy.lib.recfunctions import stack_arrays #from root_numpy import root2array, root2rec #import glob print "import keras stuff" from keras.layers import Dense, Input, Activation from keras.models import Model from keras.utils import plot_model from keras.callbacks import ModelCheckpoint, EarlyStopping from keras import regularizers, losses from keras.layers import Dropout, add, BatchNormalization from matplotlib import pyplot as plt from sklearn.metrics import roc_curve, auc, roc_auc_score import glob, time, argparse import ROOT filepath = "hist-MiniNtuple.h5" def options(): parser = argparse.ArgumentParser() parser.add_argument("--inputdir", default="") return parser.parse_args() def getHyperParameters(): nodes=30 alpha=0.01 regularizer=regularizers.l2(alpha) return (nodes, regularizer) def makeNetwork(inputwidth, nodes, regularizer): # we define the input shape (i.e., how many input features) **without** the batch size x = Input(shape=(inputwidth, )) # all Keras Ops look like z = f(z) (like functional programming) h = Dense(nodes, kernel_regularizer=regularizer)(x) h = Activation('relu')(h) h = BatchNormalization()(h) h = Dense(nodes, kernel_regularizer=regularizer)(h) h = Activation('relu')(h) h = BatchNormalization()(h) ##modify turn on of the node's output h = Dense(nodes,kernel_regularizer=regularizer)(h) h = Activation('relu')(h) h = BatchNormalization()(h) # our output is a single number, the house price. y = Dense(1)(h) y = Activation('sigmoid')(y) net = Model(input=x, output=y) net.compile(optimizer='adam', loss=losses.binary_crossentropy) return net def main(): '''here is where everything is setup, basic options of plots and direcotries, fits''' start_time = time.time() ops = options() ##or just load the matricies print "load the npy file directly" X_train = np.load("X_sig_train.npy") X_test = np.load("X_sig_test.npy") y_train = np.load("y_sig_train.npy") y_test = np.load("y_sig_test.npy") Z_train = np.load("Z_sig_train.npy") Z_test = np.load("Z_sig_test.npy") ##get the list lst_0b = [] lst_2b = [] for k in range(y_train.shape[0]): if y_train[k] == 0: lst_0b.append(k) else: lst_2b.append(k) ##check the variables inputs = ['j0_trk0_pt','j0_trk1_pt','j1_trk0_pt','j1_trk1_pt','j0_trkdr','j1_trkdr','j0_nTrk','j1_nTrk','detaHH','mHH', 'j1_m', 'j0_m'] # ##seperate the two training # X_0b = X_train[lst_0b, :] # X_2b = X_train[lst_2b, :] # for i in range(X_train.shape[1]): # bins = np.linspace(-5, 5, 100) # plt.hist(X_0b[:, i], bins, alpha=0.5, label=inputs[i] + "_0b") # plt.hist(X_2b[:, i], bins, alpha=0.5, label=inputs[i] + "_2b") # plt.legend() # plt.savefig(inputs[i] + "_var" + ".png") # plt.clf() ##setup the constants nodes, regularizer = getHyperParameters() #regularizer=None ##setup the neutral net # ##setup the epoc # callbacks = [ # # if we don't have a decrease of the loss for 10 epochs, terminate training. # EarlyStopping(verbose=True, patience=10, monitor='val_loss'), # # Always make sure that we're saving the model weights with the best val loss. # ModelCheckpoint('model.h5', monitor='val_loss', verbose=True, save_best_only=True)] # net = makeNetwork(X_train.shape[1], nodes, regularizer) # ##train # history = net.fit(X_train, y_train, validation_split=0.2, epochs=40, verbose=1, callbacks=callbacks, batch_size=128) # plt.plot(history.history['val_loss'], label='val_loss') # plt.plot(history.history['loss'], label='loss') # plt.legend() # plt.savefig("loss.png") # plt.clf() #plt.show() #raw_input() # nodes, regularizer = getHyperParameters() # net = makeNetwork(X_train.shape[1], nodes, regularizer) # net.load_weights("model.h5") # yhat_test = net.predict(X_test) # yhat_test_round = np.array([1 if x>0.5 else 0 for x in yhat_test]) # correct_test = np.logical_not(np.logical_xor(y_test,yhat_test_round)) # yhat_train = net.predict(X_train) # yhat_train_round = np.array([1 if x>0.5 else 0 for x in yhat_train]) # correct_train = np.logical_not(np.logical_xor(y_train,yhat_train_round)) # print "(train) Fraction Correct =",np.average(correct_train),"+/-",correct_train.size**-0.5 # print " (test) Fraction Correct =",np.average(correct_test),"+/-",correct_test.size**-0.5 # _, bins, _ = plt.hist(y_test, histtype='step', label=r'$y_{\mathsf{true}}$') # plt.hist(yhat_test, bins=bins, histtype='step', label=r'$\hat{y}$') # plt.hist(correct_test,bins=bins, histtype='step', label=r'NXOR') # plt.legend() # plt.savefig("output.png") # plt.clf() # net2 = makeNetwork(2, nodes, regularizer) # callbacks2 = [ # # if we don't have a decrease of the loss for 10 epochs, terminate training. # EarlyStopping(verbose=True, patience=10, monitor='val_loss'), # # Always make sure that we're saving the model weights with the best val loss. # ModelCheckpoint('model2.h5', monitor='val_loss', verbose=True, save_best_only=True)] # ##train # history2 = net2.fit(X_train[:, -2:], y_train, validation_split=0.2, epochs=100, verbose=1, callbacks=callbacks2, batch_size=128) ##or, load the neutral net nodes, regularizer = getHyperParameters() net2 = makeNetwork(2, nodes, regularizer) net2.load_weights("model2.h5") yhat_test2 = net2.predict(X_test[:, -2:]) ##make the roc curve #print y_test, yhat_test #fpr, tpr, thresholds = roc_curve(y_test, yhat_test) fpr2, tpr2, thresholds2 = roc_curve(y_test, yhat_test2) ##cut based temp_lst = [] for k in X_test: #print k if (abs(k[-3] - 1) < 0.5): temp_lst.append(1) # if np.sqrt(((k[-2])/0.3) ** 2 + ((k[-1])/0.3) ** 2) < 1.6: # temp_lst.append(1) # else: # temp_lst.append(0) else: temp_lst.append(0) yhat_test_cut = np.array(temp_lst) fpr3, tpr3, thresholds3 = roc_curve(y_test, yhat_test_cut) #print fpr, tpr, thresholds #roc_auc = auc(fpr, tpr) roc_auc2 = auc(fpr2, tpr2) roc_auc3 = auc(fpr3, tpr3) #plt.plot(fpr, tpr, color='green', lw=2, label='Full curve (area = %0.2f)' % roc_auc) plt.plot(fpr2, tpr2, color='darkorange', lw=2, label='Slice curve (area = %0.2f)' % roc_auc2) #plt.plot(fpr3, tpr3, color='red', lw=2, label='Cut curve (area = %0.2f)' % roc_auc3) plt.plot([0, 0], [1, 1], color='navy', lw=2, linestyle='--') plt.xlim([0.0, 1.0]) plt.ylim([0.0, 1.05]) plt.xlabel('False Positive Rate--BKG') plt.ylabel('True Positive Rate--Sig') plt.title('ROC curves for Signal vs BKG') plt.legend(loc="lower right") plt.savefig("roc.png") plt.clf() #plt.show() #raw_input() ##check the outputs canv = ROOT.TCanvas("test", "test", 800, 800) grid_Xtest = [] for i in np.arange(-5, 5, 0.1): for j in np.arange(-5, 5, 0.1): grid_Xtest.append([i, j]) grid_Xtest = np.array(grid_Xtest) grid_ytest = net2.predict(grid_Xtest) hist_mass = ROOT.TH2F("j0m_j1m", ";j0 m;j1 m ", 50, -5, 5, 50, -5, 5) for i in range(grid_Xtest.shape[0]): hist_mass.Fill(grid_Xtest[i][0], grid_Xtest[i][1], grid_ytest[i]) hist_mass.Draw("colz") canv.SaveAs("mHH.png") ###check the weights # yhat_0b = net.predict(X_0b) # yhat_2b = net.predict(X_2b) # fig, ax = plt.subplots() # bins = np.array([0.0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0]) # plt.hist(yhat_0b, bins=bins, histtype='step', label=r'$\hat{y}_{0}$', normed=True) # plt.hist(yhat_2b, bins=bins, histtype='step', label=r'$\hat{y}_{1}$', normed=True) # plt.legend() # ax.set_xlim([0,1]) # ax.set_xlabel("NN Score") # ax.set_ylabel("Arb. Units") # plt.savefig("separation.png") # plt.clf() print("--- %s seconds ---" % (time.time() - start_time)) if __name__ == "__main__": main()
996,408
f5992ee510b8088d0662303e0b1cbe07298f2c91
# encoding: utf8 from rest_framework import serializers from rest_framework.serializers import ValidationError from .models import Employee, Daily def md5(string): import hashlib m = hashlib.md5() m.update(string) return m.hexdigest() class LoginSerializer(serializers.HyperlinkedModelSerializer): part = serializers.ReadOnlyField(source='part.part_id') """ Over write to_internal_value(). """ def to_internal_value(self, data): emp_id = data.get('emp_id') emp_pass = data.get('emp_pass') name = '' if not emp_id: raise ValidationError({ 'emp_id': '请输入工号!' }) if not emp_pass: raise ValidationError({ 'emp_pass': '请输入密码!' }) try: employee = Employee.objects.get(emp_id=emp_id) name = employee.name except: raise ValidationError({ 'emp_id': '工号不存在!' }) if md5(emp_pass) != employee.emp_pass: raise ValidationError({ 'emp_pass': '密码错误!' }) return { 'emp_id': emp_id, 'name': name, } class Meta: model = Employee fields = ('emp_id', 'name', 'part', 'sex') extra_kwargs = {'emp_pass': {'write_only': True}, } class DailySerializer(serializers.HyperlinkedModelSerializer): part = serializers.ReadOnlyField(source='part.part_id') class Meta: model = Daily fields = ('daily_id', 'part', 'create_date', 'update_date', 'content', 'original_content', 'status')
996,409
2e649c7d588da3a35dbcad6ae0d53c8d6235fed7
# -*- coding: utf-8 -*- #__author__ = 'basearch' import os import sys import xlrd import pyutil.common.sys_utf8 as sys_utf8 import pyconf.db.manna as manna import pyutil.db.mellow as mellow eng_name_map = { "enum_company_online_status" : "eng_status", "enum_device_online_status" : "eng_status", "enum_user_status" : "eng_status", } mysql = mellow.mellow(manna.config) def parse(): for root, dirs, files in os.walk("pyutil/tools/import_manna_eng/manna_eng/", topdown=False): for f_name in files: table_name = f_name[:f_name.find(".")] print table_name field_name = eng_name_map.get(table_name, "eng_name") data = xlrd.open_workbook('pyutil/tools/import_manna_eng/manna_eng/%s.xls' % (table_name)) table = data.sheets()[0] for i in range(0, table.nrows): print i record = table.row_values(i) id, eng_val = record[0], record[-1] print table_name, {field_name: eng_val}, {"id":id} mysql.Update(table_name, {field_name: eng_val}, {"id":int(id)}) print record if __name__ == '__main__': parse()
996,410
6ed65d10eb348dcd9a3f7c18081da6ca0cf22da7
# coding=utf-8 import yaml def yaml_parser(file): with open(file, 'r') as stream: try: print(yaml.load(stream)) except yaml.YAMLError as ye: print(ye) if __name__ == '__main__': yaml_parser('./test.yml')
996,411
feb4d51a34966e168dc060d7d717f9e9e11e8e36
#!/usr/bin/python done = False sum = 0 print("Please enter a number (999 to Quit)") while not done: value = eval(input()) if value < 0: print("Value Entered", value, "is a Negative Number") continue if value != 999: print("The Value goes on here: ") sum += value else: done = (value == 999); print("Sum is =", sum)
996,412
b6f326810dd2975896befbd1cf3b7ac63082d94f
import sys import operator import load_data import random import itertools import structures import numpy as np import matplotlib.pyplot as plt import pickle from sklearn.linear_model import LogisticRegression from sklearn.externals import joblib from sklearn.model_selection import train_test_split from sklearn.model_selection import cross_val_score from sklearn import metrics def predict_sentences(model_file,sentence_file,entity_1,entity_1_file,entity_1_col, entity_2,entity_2_file,entity_2_col,symmetric): if entity_1_file.upper() != "NONE": entity_1_ids = load_data.load_id_list(entity_1_file,entity_1_col) else: entity_1_ids = None if entity_2_file.upper() != "NONE": entity_2_ids = load_data.load_id_list(entity_2_file,entity_2_col) else: entity_2_ids = None predict_candidate_sentences = load_data.load_xml(sentence_file, entity_1, entity_2) model, dep_dictionary, dep_word_dictionary, between_word_dictionary = joblib.load(model_file) predict_instances = load_data.build_instances_predict(predict_candidate_sentences, dep_dictionary, dep_word_dictionary, between_word_dictionary, entity_1_ids, entity_2_ids, symmetric) X = [] instance_sentences = set() for p in predict_instances: X.append(p.features) instance_sentences.add(p.get_sentence()) X_predict = np.array(X) predicted_labels = model.predict(X_predict) print('Number of Sentences') print(len(instance_sentences)) print('Number of Instances') print(len(predict_instances)) return predict_instances, predicted_labels def distant_train(model_out,sentence_file,distant_file,distant_e1_col,distant_e2_col,entity_1,entity_1_file,entity_1_col, entity_2,entity_2_file,entity_2_col,symmetric): if entity_1_file.upper() != "NONE": entity_1_ids = load_data.load_id_list(entity_1_file,entity_1_col) else: entity_1_ids = None if entity_2_file.upper() != "NONE": entity_2_ids = load_data.load_id_list(entity_2_file,entity_2_col) else: entity_2_ids = None distant_interactions = load_data.load_distant_kb(distant_file,distant_e1_col,distant_e2_col) training_sentences = load_data.load_xml(sentence_file,entity_1,entity_2) training_instances, dep_dictionary, dep_word_dictionary, between_word_dictionary = load_data.build_instances_training( training_sentences, distant_interactions, entity_1_ids, entity_2_ids, symmetric ) X = [] y = [] instance_sentences = set() for t in training_instances: instance_sentences.add(t.get_sentence()) X.append(t.features) y.append(t.label) X_train = np.array(X) y_train = np.ravel(y) model = LogisticRegression() model.fit(X_train, y_train) print('Number of Sentences') print(len(instance_sentences)) print('Number of Instances') print(len(training_instances)) print('Number of Positive Instances') print(y.count(1)) print(model.get_params) joblib.dump((model,dep_dictionary,dep_word_dictionary,between_word_dictionary),model_out) print("trained model") ''' sorted_dep_dictionary = sorted(dep_dictionary.items(), key=operator.itemgetter(1)) dep_dictionary_keys = [] for s in sorted_dep_dictionary: dep_dictionary_keys.append('Dep_path: ' + s[0]) sorted_word_dep_dictionary = sorted(dep_word_dictionary.items(), key=operator.itemgetter(1)) word_dep_keys = [] for s in sorted_word_dep_dictionary: word_dep_keys.append('Word in Dependency Path: ' + s[0]) sorted_between_word_dictionary = sorted(between_word_dictionary.items(), key=operator.itemgetter(1)) between_word_keys = [] for s in sorted_between_word_dictionary: between_word_keys.append('Word Between Entities: ' + s[0]) feature_values = dep_dictionary_keys + word_dep_keys + between_word_keys print(feature_values) print(len(feature_values)) print(model.coef_.size) feature_dict = {} for i in range(model.coef_.size): feature_dict[feature_values[i]] = abs(model.coef_.item(i)) sorted_feature_dict = sorted(feature_dict.items(), key=operator.itemgetter(1)) for s in sorted_feature_dict: print(s[0] + '\t' + str(s[1])) ''' def main(): mode = sys.argv[1] if mode.upper() == "DISTANT_TRAIN": model_out = sys.argv[2] sentence_file = sys.argv[3] distant_file = sys.argv[4] distant_e1_col = int(sys.argv[5]) distant_e2_col = int(sys.argv[6]) entity_1 = sys.argv[7].upper() entity_1_file = sys.argv[8] entity_1_col = int(sys.argv[9]) entity_2 = sys.argv[10].upper() entity_2_file = sys.argv[11] entity_2_col = int(sys.argv[12]) symmetric = sys.argv[13].upper() in ['TRUE','Y','YES'] distant_train(model_out,sentence_file,distant_file,distant_e1_col,distant_e2_col,entity_1,entity_1_file,entity_1_col, entity_2,entity_2_file,entity_2_col,symmetric) elif mode.upper() == "TEST": model_file = sys.argv[2] sentence_file = sys.argv[3] entity_1 = sys.argv[4].upper() entity_1_file = sys.argv[5] entity_1_col = int(sys.argv[6]) entity_2 = sys.argv[7].upper() entity_2_file = sys.argv[8] entity_2_col = int(sys.argv[9]) symmetric = sys.argv[10].upper() in ['TRUE','Y','YES'] print('testing function not developed yet') elif mode.upper() == "PREDICT": model_file = sys.argv[2] sentence_file = sys.argv[3] entity_1 = sys.argv[4].upper() entity_1_file = sys.argv[5] entity_1_col = int(sys.argv[6]) entity_2 = sys.argv[7].upper() entity_2_file = sys.argv[8] entity_2_col = int(sys.argv[9]) symmetric = sys.argv[10].upper() in ['TRUE','Y','YES'] predicted_instances, predicted_labels = predict_sentences(model_file,sentence_file,entity_1,entity_1_file,entity_1_col, entity_2,entity_2_file,entity_2_col,symmetric) ''' #trying to assemble list of relations outfile = open('/Users/kiblawi/Workspace/Data/predicted_interactions.txt','w') outfile2 = open('/Users/kiblawi/Workspace/Data/predicted_interactions2.txt','w') for i in range(len(predicted_labels)): if predicted_labels[i] == 1: pi = predicted_instances[i] sp = [] ep = [] start_point = pi.get_sentence().get_token(pi.start) end_point = pi.get_sentence().get_token(pi.end) outfile2.write(start_point.get_normalized_ner() + '\t' + end_point.get_normalized_ner() + '\n') for e in pi.get_sentence().entities: for l in pi.get_sentence().entities[e]: if pi.start in l: sp = l elif pi.end in l: ep = l outfile.write(' '.join(pi.get_sentence().get_token(a).get_word() for a in sp).encode('utf-8') + '\t' + ' '.join( pi.get_sentence().get_token(b).get_word() for b in ep).encode('utf-8') + '\n') outfile.close() ''' outfile = open('/Users/kiblawi/Workspace/Data/predicted_sentences.txt','w') for i in range(len(predicted_labels)): pi = predicted_instances[i] sp = [] ep = [] for e in pi.get_sentence().entities: for l in pi.get_sentence().entities[e]: if pi.start in l: sp = l elif pi.end in l: ep = l outfile.write('Instance: ' + str(i) + '\n') outfile.write('Label: ' + str(predicted_labels[i]) + '\n') outfile.write( ' '.join('Human_gene:' + pi.get_sentence().get_token(a).get_word() for a in sp).encode('utf-8') + '\t' + 'Viral_gene:' + ' '.join( pi.get_sentence().get_token(b).get_word() for b in ep).encode('utf-8') + '\n') outfile.write('Human_gene_index: ' + str(pi.start) + '\t' + 'Viral_gene_index: ' + str(pi.end) + '\n') outfile.write(pi.get_sentence().get_sentence_string().encode('utf-8') + '\n') outfile.write('Accuracy: \n\n') outfile.close() else: print("usage error") if __name__=="__main__": main()
996,413
db977a8f128c741f29d22cb8663a91a2efddac49
#!/usr/bin/env python import feedparser from cgi import FieldStorage, escape from time import ctime ENTRY_TEMPLATE = ''' <a href="%(link)s" onmouseover="$('#%(eid)s').show();" onmouseout="$('#%(eid)s').hide();" target="_new" > %(title)s </a> <br /> <div class="summary" id="%(eid)s"> %(summary)s </div> ''' def main(): print "Content-type: text/html\n" form = FieldStorage() url = form.getvalue("url", "") if not url: raise SystemExit("error: not url given") feed = feedparser.parse(url) for enum, entry in enumerate(feed.entries): entry.eid = "entry%d" % enum try: html = ENTRY_TEMPLATE % entry print html except Exception, e: # FIXME: Log errors pass print "<br />%s" % ctime() if __name__ == "__main__": main()
996,414
5e4dd44923100278cae8e3580495706a1dba69e3
name = raw_input("Enter file:") if len(name) < 1 : name = "mbox-short.txt" handle = open(name) dic = dict() for x in handle: if x .startswith("From") and len (x.split()) > 2: list = x.split() if not dic.has.key(1[5][:2]) dic[1[5][:2]]=1 else: dic[1[5][:2]]+=1 key = sorted(dic) for x in key: print "%s %d" % (x,dic[x])
996,415
584d8cd860dc3f50227af8989ff11418374d53c9
from nabl.nabladmin.models import * from django.contrib import admin admin.site.register(Members, MembersAdmin) admin.site.register(Teams, TeamsAdmin) admin.site.register(Leagues, LeaguesAdmin) admin.site.register(Divisions, DivisionsAdmin) admin.site.register(Transactions, TransactionsAdmin) admin.site.register(Players, PlayersAdmin) admin.site.register(Rotowire, RotowireAdmin) admin.site.register(Rotowiremissing, RotowiremissingAdmin) admin.site.register(Rosterassign, RosterassignAdmin) admin.site.register(Rostermove, RostermoveAdmin) admin.site.register(Teamresults, TeamresultsAdmin) admin.site.register(Schedules, SchedulesAdmin) admin.site.register(CardedPlayers, CardedPlayersAdmin) admin.site.register(Draftpicks, DraftpicksAdmin)
996,416
3e26ad73eea8e54bef2ca074a48a439f2251b9f9
for i in range (0,15 , 2): print(i) if i == 6: break i = 0 while True: print(i) i = i + 1 if i == 5: break
996,417
633bc6122d515ebb82e96799fab0813a4fed953e
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Created on Wed Feb 9 13:58:55 2022 @author: jtm545 """ import pandas as pd from pysilsub.devices import StimulationDevice from pysilsub.observers import _Observer # Choose device # sd = StimulationDevice.from_json("../data/STLAB_1_York.json") # sd = StimulationDevice.from_json("../data/STLAB_2_York.json") # sd = StimulationDevice.from_json("../data/STLAB_1_Oxford.json") #sd = StimulationDevice.from_json("../data/STLAB_2_Oxford.json") # sd = StimulationDevice.from_json("../data/BCGAR_8_bit_linear_config.json") # sd = StimulationDevice.from_json("../data/VirtualSky.json") # sd = StimulationDevice.from_json("../data/OneLight.json") # sd = StimulationDevice.from_json('../data/LEDCube.json') sd = StimulationDevice.from_package_data("STLAB_Oxford") sd = StimulationDevice.from_package_data('OneLight') # Plot the spds spd_fig = sd.plot_calibration_spds() # Plot the gamut gamut_fig = sd.plot_gamut() sd.do_gamma() sd.do_gamma(fit="polynomial") sd.plot_gamma(show_corrected=True) rgb = [ (0.5, 0.5, 0.5), (0.5, 0.5, 0.5), (1.0, 0.5, 0.5), (1.0, 0.5, 0.5), (0.5, 0.5, 0.5), ] rgb2 = [(50, 50, 50), (50, 50, 50), (50, 50, 50), (50, 50, 50), (50, 50, 50)] col = ["red", 2, "blue", 3, 5] sd = StimulationDevice( calibration="../data/BCGAR_5_Primary_8_bit_linear.csv", calibration_wavelengths=[380, 781, 1], primary_resolutions=[255, 255, 255, 255, 255], primary_colors=rgb, observer=Observer(), ) file = StimulationDevice.load_calibration_file( "../data/BCGAR_5_Primary_8_bit_linear.csv" ) print(sd) sd.do_gamma(fit="polynomial")
996,418
68b12cb7a9ba6316e07e70d3487aaca5e4c1c612
#!/usr/bin/env python # -*- coding: utf-8 -*- # @Date : 2018-04-25 18:14:59 # @Author : guangqiang_xu (981886190@qq.com) # @Version : $Id$ import requests from hashlib import sha1 # import http.cookiejar as cookielib import time import hmac import json import re from lxml import etree from retrying import retry import sys reload(sys) sys.setdefaultencoding('utf-8') sys.path.append('../') from crawl_xiciip import get_ip from config import * from log import spider_log spider_name = 'zhihu' log_folder_name = '%s_logs' % spider_name logger = spider_log(log_name=spider_name, log_folder_name=log_folder_name) class ZhiHuLogin(object): def __init__(self, username, password, client_id='c3cef7c66a1843f8b3a9e6a1e3160e20', key='d1b964811afb40118a12068ff74a12f4'): self.login_url = 'https://www.zhihu.com/signup?next=%2F' self.captcha_url = 'https://www.zhihu.com/api/v3/oauth/captcha?lang=cn' self.sign_in_url = 'https://www.zhihu.com/api/v3/oauth/sign_in' self.captcha_flag = 1 self.sess = None self.key = key self.log = logger self.form_data = {} self.form_data['username'] = username self.form_data['password'] = password self.form_data['client_id'] = client_id self.form_data['grant_type'] = 'password' self.form_data['source'] = 'com.zhihu.web' self.form_data['captcha'] = None self.form_data['lang'] = 'en' self.form_data['ref_source'] = 'homepage' self.form_data['utm_source'] = None self.form_data['timestamp'] = str(int(time.time())) self.headers = self.get_headers() def get_headers(self): return {'User-Agent':'Mozilla/5.0 (Windows NT 6.1; WOW64; rv:50.0) Gecko/20100101 Firefox/50.0','HOST':'www.zhihu.com',\ 'Referer':'https://www.zhihu.com/signin?next=%2F','Authorization':'oauth c3cef7c66a1843f8b3a9e6a1e3160e20'} def get_sess(self): i = 1 while self.captcha_flag: self.log.info('开始尝试第{}次'.format(i)) i += 1 self.headers = self.get_headers() self.sess = requests.Session() # self.sess.cookies = cookielib.LWPCookieJar(filename = 'cookies_res.txt') response = self.sess.get(self.login_url, headers=self.headers) try: x_udid = re.findall(r'{&quot;xUDID&quot;:&quot;([^;&]*)&quot;}', response.text)[0] if not x_udid: continue self.headers['x-udid'] = x_udid except: pass cap_response = self.sess.get(self.captcha_url, headers=self.headers, verify=True) dic = json.loads(cap_response.text) self.log.info('请求参数: '.format(dic)) if not dic['show_captcha']: self.captcha_flag = 0 return True def get_captcha(self): try: # 获取验证码图片 self.headers = self.get_headers() self.sess = requests.Session() t = str(int(time.time() * 1000)) captcha_url = "https://www.zhihu.com/captcha.gif?r={0}&type=login".format(t) t = self.sess.get(captcha_url, headers=self.headers) with open("zhihu_captcha.jpg", "wb") as f: f.write(t.content) try: from PIL import Image im = Image.open("zhihu_captcha.jpg") im.show() im.close() except: pass except Exception as error: self.log.error('获取验证码失败: {}'.format(error)) captcha = raw_input("输入验证码:") return captcha # 计算 signature 值 def get_signature(self): myhmac = hmac.new(self.key, digestmod=sha1) myhmac.update(bytes(self.form_data['grant_type'])) myhmac.update(bytes(self.form_data['client_id'])) myhmac.update(bytes(self.form_data['source'])) myhmac.update(bytes(self.form_data['timestamp'])) return myhmac.hexdigest() def get_data(self,data,keyword): for d in data: item = {} try: question_title = d['object']['question']['name'] except: try: question_title = d['highlight']['title'] except: continue try: question_id = d['object']['question']['id'] except: question_id = "" try: question_type = d['object']['question']['type'] except: question_type = "" try: content_summary = d['object']['excerpt'] except: content_summary = "" try: up_content = d['object']['content'] except: up_content = "" try: up_author_name = d['object']['author']['name'] except: up_author_name = "" try: up_author_url = 'https://www.zhihu.com/people/' + d['object']['author']['url_token'] except: up_author_url = "" try: up_author_headline = d['object']['author']['headline'] except: up_author_headline = "" try: up_comment_count = d['object']['comment_count'] except: up_comment_count = "" try: up_create_time = d['object']['created_time'] except: up_create_time = "" try: up_voteup_count = d['object']['voteup_count'] except: up_voteup_count = "" try: up_update_time = d['object']['updated_time'] except: up_update_time = "" # 帖子标题 item['question_title'] = question_title # 帖子id item['question_id'] = question_id # 帖子链接 item['question_url'] = 'https://www.zhihu.com/question/' + question_id # 帖子类型 item['question_type'] = question_type # 最高答案得赞数 item['up_voteup_count'] = up_voteup_count # 回答赞数最高帖子摘要 item['content_summary'] = content_summary # 回答赞数最高帖子内容 item['up_content'] = up_content # 回答赞数最高的用户昵称 item['up_author_name'] = up_author_name # 回答赞数最高的用户个人主页 item['up_author_url'] = up_author_url # 回答赞数最高的用户个人简介 item['up_author_headline'] = up_author_headline # 回答赞数最高答案的评论数 item['up_comment_count'] = up_comment_count # 赞数最高答案的创建时间 item['up_create_time'] = up_create_time # 赞数最高答案的最后更新时间 item['up_update_time'] = up_update_time item['keyword'] = keyword with open('./ZhiHu.json', 'a') as f: f.write(json.dumps(item, ensure_ascii=False) + '\n') def sign_in(self): item = {} signature = self.get_signature() self.form_data['signature'] = signature self.form_data['captcha'] = self.get_captcha() #self.get_sess() # print self.form_data self.sess.post(self.sign_in_url, data=self.form_data, headers=self.headers) # self.sess.cookies.save(ignore_expires=True,ignore_discard=True) # page URL # https://www.zhihu.com/api/v4/search_v3?t=general&q=%E5%9C%9F%E8%80%B3%E5%85%B6&correction=1&offset=35&limit=10&search_hash_id=f4404ae2ce377b03c1ec63796a153b35 # 以土耳其为关键字的url for keyword in search_list: limit = 10 offset = 0 query_key = keyword basic_url = "https://www.zhihu.com/api/v4/search_v3?t=general&q=%s&correction=1" \ "&search_hash_id=4507b273793a743841253e912a8edf5e&offset=%s&limit=%s" while 1: url = basic_url % (query_key, offset, limit) response = self.sess.get(url, headers=self.headers) response_rm_em = response.content.decode("utf-8").replace("<em>", "").replace("<\/em>", "") data = json.loads(response_rm_em)['data'] if len(data) == 0: self.log.info('关键词:{} 爬取结束!') break self.get_data(data,keyword) self.log.info('request {}, page: {}'.format(url, offset/10 + 1)) offset += limit time.sleep(1) login = ZhiHuLogin(zh_username, zh_password) if __name__=="__main__": login = ZhiHuLogin(zh_username, zh_password) login.sign_in()
996,419
ed4eb0bcfc0bae64639a6bec0c52ce12cadc8aa9
class WordDictionary: def __init__(self): """ Initialize your data structure here. """ self.kids = dict() self.val = None self.isWord = False def addWord(self, word): """ Adds a word into the data structure. :type word: str :rtype: void """ current_node = self for idx, letter in enumerate(word): if letter not in current_node.kids: current_node.kids[letter] = WordDictionary() current_node.kids[letter].val = letter current_node = current_node.kids[letter] if idx == len(word) - 1: current_node.isWord = True def search(self, word): """ Returns if the word is in the data structur.e. A word could contain the dot character '.' to represent any one letter. :type word: str :rtype: bool """ if len(word) == 0: return False todo = [self] for idx, letter in enumerate(word): if len(todo) == 0: break new_todo = [] if letter == '.': for node in todo: new_todo += list(node.kids.values()) else: for node in todo: if letter in node.kids: new_todo.append(node.kids[letter]) if idx == len(word) - 1 and node.kids[letter].isWord: return True todo = new_todo if len(todo) > 0 and word[-1] == '.': for ele in todo: if ele.isWord: return True return False # Your WordDictionary object will be instantiated and called as such: obj = WordDictionary() print(obj.addWord("at")) print(obj.addWord("and")) print(obj.addWord("an")) print(obj.addWord("add")) print(obj.search("a")) print(obj.search(".at")) print(obj.addWord("bat")) print(obj.search(".at")) print(obj.search("an.")) print(obj.search("a.d.")) print(obj.search("b.")) print(obj.search("a.d")) print(obj.search("."))
996,420
4c505a5340f5d5fd6e7089be972eb84d4effb948
from random import randint from time import sleep # # Made by Filiph Wallsten 2019-09-19 # i = 0 k = 0 total_wins = 0 dice_numbers = { 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, } running = True rounds = int(input('How many games do you want to play? (20 is max) ')) while running: dice_result = randint(1, 6) dice_numbers[dice_result] += 1 player_dice = int(input('Select number 1-6 ')) print('Dice rolling...') sleep(1) print('You rolled: ', player_dice) print('House rolled: ', dice_result) if dice_result == player_dice: print('Its a match! You win!') total_wins+=1 else: print('Aw, better luck next time!') i+=1 if i == rounds: for x in dice_numbers: k+=1 print('Dice landed on ', k, ' :', dice_numbers[x], 'times') print('Average of correct guesses ', total_wins/rounds) break
996,421
ef06fd154cbb230502b3789f6120c537d30fb773
import setuptools long_description = "Functions to estimate the expected best-out-of-n (Boon) result from a set of validation and " \ "test results for a machine learning architecture. The measure is fully described in the paper" \ "Bajgar, O., Kadlec, R., and Kleindienst, J. A Boo(n) for Evaluating Architecture Performance. " \ "ICML 2018." setuptools.setup( name="boon", version="0.1.0", author="Ondrej Bajgar", author_email="OBajgar@cz.ibm.com", description="Functions to estimate the expected best-out-of-n result from a set of validation and test results.", long_description=long_description, long_description_content_type="text/markdown", license='Apache-2.0', url="https://gitlab.com/obajgar/boon/", packages=setuptools.find_packages(), install_requires=['numpy'], classifiers=( "Programming Language :: Python", "Operating System :: OS Independent", ), )
996,422
60e89c916d6a09eaca23c3d36cce0213c0833019
from django.urls import path # from apps.users.api.api import UserAPIView # Aqui se esta importando la clase que sirve como ruta para el JSON from apps.users.api.api import user_api_view # Metodo con decorador para el JSON from apps.users.api.api import user_detail_view # Metodo para realizar la actualizacion """ Este archivo servira para poner las rutas urls que estan enlazadas con el archivo urls.py del proyecto principal """ urlpatterns = [ # path('usuario/', UserAPIView.as_view(), name='usuario_api'), path('usuario/', user_api_view, name='usuario_api'), # Metodo con decorador para la ruta path('usuario/<int:pk>/', user_detail_view, name='usuario_detail_api_view'), # Metodo con parametro ]
996,423
77ad1af86a304a68460ba6dbc8ce457e0eebc952
""" Created on 25 Aug, 2021 @author : Sai Vikhyath """ """ This code must be refactored Refactored code in PythonRefactoredCode.py """ import time def main(): print(' ______') print(' / \\') print('/ \\') print('\ /') print(' \_______/') print() print('\ /') print(' \______/') print("+--------+") print() print(" ______") print(" / \\") print("/ \\") print("| STOP |") print("\ /") print(" \_______/") print() print(" ______") print(" / \\") print("/ \\") print("+--------+") t1 = time.time() for i in range(1000): main() t2 = time.time() print('Time elasped : ', t2 - t1)
996,424
f604f04ca839e2575f48ccbe58bf5409bc1e6e99
# -*- coding: utf-8 -*- # @Author: xiweibo # @Date: 2018-08-29 14:25:37 # @Last Modified by: Clarence # @Last Modified time: 2018-08-29 23:53:10 """ python2 实现xml解析 python3实现模块相同,与示例代码相同(除了print) Python使用SAX解析xml SAX是一种基于事件驱动的API 利用SAX解析XML文档牵涉到两部分:解析器和事件处理器 解析器负责读取XML文档,并向事件处理器发送事件,如元素开始跟元素结束事件 而事件处理器则负责对事件作出响应,对传递的XML数据进行处理 1.对大型文件进行处理 2.只需要文件的部分内容 3.想建立自己的对象模型的时候 在Python中使用sax方式处理xml要先引入xml.sax中的parse函数,还有xml.sax.handler中的ContentHandler ContentHandler类方法介绍 characters(content)方法 调用时机: 从行开始,遇到标签之前,存在字符,content的值为这些字符串 从一个标签,遇到下一个标签之前,存在字符,content的值为这些字符串 从一个标签,遇到行结束符之前,存在字符,content的值为这些字符串 标签可以是开始标签,也可以是结束标签 startDocument()方法 文档启动的时候调用 endDocument()方法 解析器到达文档结尾时调用 startElement(name, attrs)方法 遇到XML开始标签时调用,name是标签的名字,attrs是标签的属性值字典 endElement(name)方法 遇到XML结束标签时调用 make_parser方法 xml.sax.make_parser([parser_list]) 创建一个新的解析器对象并返回 参数: parser_list-可选参数,解析器列表 parser方法 xml.sax.parse(xmlfile, contenthandler[, errorhandler]) 创建一个新的SAX解析器并解析xml文档 参数: xmlfile-xml文件名 contenthandler-必须是一个ContentHandler的对象 errorhandler-如果指定该参数,errorhandler必须是一个SAX ErrorHandler对象 parseString方法 xml.sax.parseString(xmlstring, contenthandler[, errorhandler]) 创建一个新的SAX解析器并解析xml字符串 参数: xmlstring-xml字符串 contenthandler-必须是一个ContentHandler的对象 errorhandler-如果指定该参数,errorhandler必须是一个SAX ErrorHandler对象 """ import xml.sax class MovieHandler( xml.sax.ContentHandler ): def __init__(self): self.CurrentData = "" self.type = "" self.format = "" self.year = "" self.rating = "" self.starts = "" self.description = "" # 元素开始事件处理 tag元素标签名 attrbutes元素标签所在的属性字典 def startElement(self, tag, attributes): self.CurrentData = tag if tag == "movie": print "******Movie******" title = attributes['title'] print "Title:", title # 元素结束事件处理 def endElement(self, tag): if self.CurrentData == "type": print "Type:", self.type elif self.CurrentData == "format": print "Format:", self.format elif self.CurrentData == "year": print "Year:", self.year elif self.CurrentData == "rating": print "Rating:", self.rating elif self.CurrentData == "starts": print "Starts:", self.starts elif self.CurrentData == "description": print "Description:", self.description self.CurrentData = "" # 内容事件处理 def characters(self, content): if self.CurrentData == "type": self.type = content elif self.CurrentData == "format": self.format = content elif self.CurrentData == "year": self.year = content elif self.CurrentData == "rating": self.rating = content elif self.CurrentData == "starts": self.starts = content elif self.CurrentData == "description": self.description = content if __name__ == "__main__": # 创建一个XMLReader parser = xml.sax.make_parser() # turn off namespaces parser.setFeature(xml.sax.handler.feature_namespaces, 0) # 重写ContextHandler Handler = MovieHandler() parser.setContentHandler(Handler) parser.parse("movies.xml")
996,425
99b878e579a053c917e75baebf9d0cc854d6b077
from django import forms from .models import Snap,Profile from django.db import models from django.contrib.auth.models import User class PostForm(forms.ModelForm): class Meta: model = Snap exclude = ['editor', 'pub_date'] widgets = { 'tags': forms.CheckboxSelectMultiple(), } class ProfileForm(forms.ModelForm): class Meta: model = Profile fields = ['bio', 'profilepicture'] # widgets = { # 'tags': forms.CheckboxSelectMultiple(), # } # class VoteForm(forms.ModelForm): # class Meta: # model = Snap # fields = ['design','usability','content']
996,426
bb0f37b1ab12ad03f0366b8d9b3fe687690b8786
''' Created on Thu Jan 30 2020 @author: https://blog.floydhub.com/gentle-introduction-to-text-summarization-in-machine-learning/ ''' # importing libraries from nltk.tokenize import sent_tokenize from src.text_processing.preprocess_word import stem, lower, stop from src.text_processing.preprocess_phrase import tokenize def _create_dictionary_table(text_string) -> dict: words = tokenize(text_string, [], [stem, lower, stop]) # creating dictionary for the word frequency table frequency_table = dict() for wd in words: if wd in frequency_table: frequency_table[wd] += 1 else: frequency_table[wd] = 1 return frequency_table def _calculate_sentence_scores(sentences, frequency_table) -> dict: # algorithm for scoring a sentence by its words sentence_weight = dict() for sentence in sentences: sentence_wordcount_without_stop_words = 0 for word_weight in frequency_table: if word_weight in sentence.lower(): sentence_wordcount_without_stop_words += 1 if sentence[:7] in sentence_weight: sentence_weight[sentence[:7] ] += frequency_table[word_weight] else: sentence_weight[sentence[:7] ] = frequency_table[word_weight] sentence_weight[sentence[:7]] = sentence_weight[sentence[:7] ] / sentence_wordcount_without_stop_words return sentence_weight def _calculate_average_score(sentence_weight) -> int: # calculating the average score for the sentences sum_values = 0 for entry in sentence_weight: sum_values += sentence_weight[entry] # getting sentence average value from source text average_score = (sum_values / len(sentence_weight)) return average_score def _get_article_summary(sentences, sentence_weight, threshold,): sentence_counter = 0 article_summary = '' for sentence in sentences: if sentence[:7] in sentence_weight and sentence_weight[sentence[:7]] >= (threshold): article_summary += " " + sentence sentence_counter += 1 if sentence_counter == 2: break return article_summary def summarize(text): """very basic algorithm based on word frequencies. it extracts a number of phrases from a text Arguments: text {[string]} -- """ # creating a dictionary for the word frequency table frequency_table = _create_dictionary_table(text) # tokenizing the sentences sentences = sent_tokenize(text) # algorithm for scoring a sentence by its words sentence_scores = _calculate_sentence_scores(sentences, frequency_table) # getting the threshold threshold = _calculate_average_score(sentence_scores) # producing the summary article_summary = _get_article_summary( sentences, sentence_scores, 0.7 * threshold) return article_summary
996,427
9905baba0a25251b774bef786a8268764a837673
from selenium import webdriver from selenium.webdriver.common.action_chains import ActionChains from time import sleep driver=webdriver.Chrome (executable_path="C:\\Users\\Sanket\\Desktop\\sele_python\\webdriver\\chromedriver.exe") driver.get("https://jqueryui.com/") driver.maximize_window() sortable_link=driver.find_element_by_xpath("//a[text()='Sortable']") sortable_link.click() sleep(3) driver.switch_to.frame(0) actions=ActionChains(driver) sortable_items=driver.find_element_by_xpath("(//ul[@id='sortable']/li)[1]") #sortable_drag=driver.find_element_by_xpath("(//ul[@id='sortable']/li)[1]") #sortable_drop=driver.find_element_by_xpath("(//ul[@id='sortable']/li)[7]") actions=ActionChains(driver) #actions.drag_and_drop(sortable_drag,sortable_drop).perform() actions.drag_and_drop_by_offset(sortable_items,0,300).perform() sleep(5) driver.close() driver.quit()
996,428
be9f3d503ec86b21a5a6d5b535871338969410c1
""" https://leetcode.com/problems/contains-duplicate Related: - lt_219_contains-duplicate-ii - lt_220_contains-duplicate-iii """ """ Given an array of integers, find if the array contains any duplicates. Your function should return true if any value appears at least twice in the array, and it should return false if every element is distinct. """ from collections import defaultdict class Solution: def containsDuplicate(self, nums): """ :type nums: List[int] :rtype: bool """ # Time: O(n) # Space: O(n) # Approaches: # Time Space # 1) Brute force O(n^2) O(1) # 2) Sort O(nlogn) O(1) # 3) Hash Table O(n) O(n) return len(nums) > len(set(nums)) def containsDuplicate_sort(self, nums): """ :type nums: List[int] :rtype: bool """ nums.sort() for i in range(1, len(nums)): if nums[i] == nums[i-1]: return True return False if __name__ == '__main__': test_cases = [ ([1, 1], True), ([1, 1, 2], True), ([1], False), ([1, 2], False) ] for test_case in test_cases: print('case:', test_case) output = Solution().containsDuplicate(test_case[0]) print('output:', output) assert output == test_case[1]
996,429
73a23c024b4e1057b383d09a40d4de9730547b26
# # Copyright (c) 2017 Sebastian Muniz # # This code is part of point source decompiler # import abc from traceback import format_exc from output_media.output_media_base import OutputMediaBase, \ OutputMediaBaseException try: import idaapi except ImportError, err: raise OutputMediaBaseException("TextOutputMedia only available under IDA") class TextOutputMediaException(OutputMediaBaseException): """Generic exception for text output media.""" pass class TextOutputMedia(OutputMediaBase, idaapi.simplecustviewer_t): """ Translate the MIR into a C/C++ readable code, display it appropiately and perform callbacks if applicable. """ __metaclass__ = abc.ABCMeta def __init__(self): """Initialize instance.""" OutputMediaBase.__init__(self) idaapi.simplecustviewer_t.__init__(self) self.title = "" self.statements = self.STATEMENTS self.keywords = self.KEYWORDS self.types = self.TYPES def generate_output(self, title): """Generate readble output in a new IDA view window.""" try: # First create the window inside the application used to hold it. # Then proceed to show the newly created window and fill it with # the data we want to display. self.title = title crea = self.create() if not crea: self.ClearLines() #self.add_line("hola manola") self.refresh() else: #print "1 OK..." pass self.show() self.colorize() # This must be implemented in the # derived class. #self.refresh() except Exception, err: if self.debug: print format_exc() self.close() raise TextOutputMediaException( "Error creating viewer called \"%s\"" % title) def close(self): """Close the current window.""" self.Close() def create(self): """Create the new window with the specified title.""" if not self.Create(self.title): #raise TextOutputMediaException("Unable to create custom viewer") return False return True def show(self): """Display the window inside the current application.""" self.Show() @abc.abstractmethod def colorize(self): """Fill the recently created window with the text.""" return def add_lines(self, lines): """Add multiple lines to the current display.""" # Make sure this is a line or a list of lines. if isinstance(lines, str): self.add_lines(lines) else: for line in lines: self.add_line(line) def add_line(self, string=None): """Display the specified text at the current line.""" if not string: string = "" # Invoke the simple viewer method. self.AddLine(string) @abc.abstractmethod def on_close(self): return def OnClose(self): """Handle close event.""" self.on_close() def OnKeydown(self, vkey, shift): """Handle every key pressed in the newly created window.""" if vkey == 27: # The ESC key was pressed so close the window and leave. self.Close() else: # An unknown key was pressed. return self.on_key_down(vkey, shift) return True def OnCursorPosChanged(self): """ Cursor position changed. @return: Nothing """ self.on_curor_position_changed() def refresh(self): """Refresh the current output.""" self.Refresh() # # Colorize specific output. # def as_comment(self, s): """Display the specified text as a comment.""" return idaapi.COLSTR(s, idaapi.SCOLOR_RPTCMT) def as_identifier(self, string): """Display the specified text as an id.""" t = string.lower() if t in self.keywords: return idaapi.COLSTR(string, idaapi.SCOLOR_ASMDIR) elif t in self.statements: return idaapi.COLSTR(string, idaapi.SCOLOR_LOCNAME) elif t in self.types: return idaapi.COLSTR(string, idaapi.SCOLOR_IMPNAME) else: return string def as_string(self, string): """Display the specified text as a string.""" return idaapi.COLSTR(string, idaapi.SCOLOR_CHAR) def as_number(self, string): """Display the specified text as a number.""" return idaapi.COLSTR(string, idaapi.SCOLOR_NUMBER) def as_directive(self, string): """Display the specified text as a directive.""" return idaapi.COLSTR(string, idaapi.SCOLOR_KEYWORD) def as_default(self, string): """Display the specified text as a default text.""" return idaapi.COLSTR(string, idaapi.SCOLOR_DEFAULT) def as_variable_name(self, string): """Display the specified text as a variable name.""" return idaapi.COLSTR(string, idaapi.SCOLOR_REG) def as_function_name(self, string): """Display the specified text as a function name.""" return idaapi.COLSTR(string, idaapi.SCOLOR_CNAME) def get_colour(self, address): """Return the items colour.""" return idaapi.get_item_color(address) def set_colour(self, address, colour): """Store an item colour.""" idaapi.set_item_color(address, colour)
996,430
67d945eb5ec50584393a8926eba8276ed5d29a68
#!/usr/bin/env python # -*- coding: utf-8 -*- import pytest from datetime import datetime from datetime import timedelta from trader.collector import GCollector @pytest.fixture def collector(): return GCollector() def test_get_error_historical_quote(collector): c = collector hist_data = c.get_histrical_data( 3371, datetime.now() - timedelta(days=2), datetime.now(), 10) print(hist_data) assert hist_data is None
996,431
0195b59c69466274c33ac795864b3ddf7c141617
import random import sys size = int(sys.argv[1]) arr = [] f = open("./in.txt",'w') items = 0 for i in range(size): operation = random.randint(1,3) if operation == 1: #insert data = random.randint(1,20) loc = random.randint(0,items+5) items += 1 if operation == 2: data = 0 loc = random.randint(0,items+5) if items >= 1: items -= 1 if operation == 3: data = 0 loc = 0 if operation == 4: data = 0 loc = 0 f.write(str(operation) + ' ' + str(data) + ' ' + str(loc) + '\n') # for i in range(0,size): # temp = random.randint(0,100) # f.write(str(temp) + '\n') # arr.append(temp) # arr.sort() # fo = open("./std.txt",'w') # for i in range(0,size): # te = arr[i] # fo.write(str(te) + '\n')
996,432
46b7dcd7d71af55be676097874345e77a32ca712
### LAB 9 GROUP WORK ### PROBLEM 2 class Robot(object): """this is a blueprint for a program that models virtual fighting robots""" robot_list = [] @staticmethod def contenders(): if len(Robot.robot_list) == 0: print("There are 0 robots.") else: print("There are " + str(len(Robot.robot_list)) + " robots.") print("Here's a list of them:") for robot in Robot.robot_list: print(robot) def __init__(self, name, weapon, strength, status = "ONLINE"): self.name = name self.weapon = weapon self.strength = strength self.status = status print("Robot created!" + self.name) Robot.robot_list.append(self) def __str__(self): reply = "-" * 20 + "\n" reply += "Fighting Robot\n" reply += "Name: " + self.name + "\n" reply += "Weapon: " + self.weapon + "\n" reply += "Strength: " + str(self.strength) + "\n" reply += "Status: " + self.status + "\n" reply += "-" * 20 return reply # main Robot.contenders() r2d2 = Robot("Optimus", "Fists", 2) c3po = Robot("C3PO", "Conversation", 2) ##print(r2d2) ##print(c3po) Robot.contenders()
996,433
ed5bafa16aad4eba449ce2436fbb6b4ad490efa7
from .HistoryBuffer import HistoryBuffer from .OperationEngineException import OperationEngineException from .factory import factory from .Operation import Operation class Queue(HistoryBuffer): """docstring for Queue""" def __init__(self, log): HistoryBuffer.__init__(self) self.log = log def enqueue(self,op): key = factory.createHistoryKey(op.siteId, op.seqId) self.ops[key] = op op.immutable = True self.size += 1 def getProcessable(self, cv): """ Pop and returns the operations whose context vectors now allows processing """ ops = self.getMorrisSortedOperations() for op in ops: skip = False for other in ops: comp = other.compareByMorris(op) if comp == -1: skip = True break if skip: continue else: comp = op.contextVector.morrisCompare(cv) if comp < 0: return self.remove(op) if comp == 0 : return self.remove(op) return None
996,434
f4c664eaa2a7846c63d2f15d3b879ca1e82adbda
# a ideia é cirar um cronometro, q ao apertar no butao a contagem se inicia, e no outro finaliza. e depois ir deixando mais complexo. # descobrir o pq o visual nao esta lendo a biblioteca; import pygame import tkinter pygame.init() janela = pygame.display.set_mode((800,400))# assim eu crio uma janela e começo a criar meu app (largura, tamanho) pygame.display.set_caption('Cronometro') janela_aberta = True while janela_aberta:# condição para poder fechar a janela button(master = None, activebackground = blue) for event in pygame.event.get(): if event.type == pygame.QUIT: janela_aberta = False pygame.quit()
996,435
6a1ec8455545820bdd74d4205c7658b0787ada9b
from dlrobot.common.remote_call import TRemoteDlrobotCallList from dlrobot.common.dl_robot_round import TDeclarationRounds from source_doc_http.source_doc_client import TSourceDocClient from common.logging_wrapper import setup_logging import argparse import plotly.express as px import pandas as pd import datetime import os import sys import json from collections import defaultdict import time #this script is used for monitoring dlrobot (downloading declaration files) #see examples in crontab.txt, how to run it def build_html(args, fig, output_file): output_file = os.path.join(args.output_folder, output_file) fig.write_html(output_file, include_plotlyjs='cdn') class TDlrobotStats: def __init__(self, args, min_date=None, min_total_minutes=0, logger=None): self.args = args self.min_date = min_date self.logger = logger rounds = TDeclarationRounds(args.round_file) self.remote_calls = TRemoteDlrobotCallList(file_name=args.central_stats_file, logger=self.logger, min_start_time_stamp=rounds.start_time_stamp) self.logger.debug("read {} records from {}".format(len(list(self.remote_calls.get_all_calls())), args.central_stats_file)) self.cumulative_declaration_files_count = [] self.cumulative_processed_websites_count = [] self.end_times = [] self.end_time_stamps = [] self.websites = [] self.total_minutes = [] self.host_names = [] self.declaration_files_by_workers = [] self.exported_files_counts = [] self.failures = [] self.failures_by_hostnames = defaultdict(int) self.successes_by_hostnames = defaultdict(int) self.build_stats(min_date) def build_stats(self, min_date=None, min_total_minutes=0): min_time_stamp = min_date.timestamp() if min_date is not None else 0 website_count = 0 sum_count = 0 all_calls_sorted_by_end_time = sorted(self.remote_calls.get_all_calls(), key=lambda x: x.file_line_index) self.logger.info("build_stats for {} records".format(len(all_calls_sorted_by_end_time))) for remote_call in all_calls_sorted_by_end_time: if remote_call.end_time is None or remote_call.end_time < min_time_stamp: continue if remote_call.get_total_minutes() < min_total_minutes: continue end_time = datetime.datetime.fromtimestamp(remote_call.end_time) self.end_times.append(pd.Timestamp(end_time)) self.end_time_stamps.append(end_time.strftime("%Y-%m-%d %H:%M:%S")) self.websites.append(remote_call.get_website()) self.host_names.append(remote_call.worker_host_name) # len (self.declaration_files_by_workers) != len(self.remote_calls) self.declaration_files_by_workers.extend([remote_call.worker_host_name] * remote_call.result_files_count) self.total_minutes.append(remote_call.get_total_minutes()) self.exported_files_counts.append(remote_call.result_files_count) sum_count += remote_call.result_files_count self.cumulative_declaration_files_count.append(sum_count) website_count += 1 self.cumulative_processed_websites_count.append(website_count) if not remote_call.task_was_successful(): self.failures.append(remote_call.worker_host_name) self.failures_by_hostnames[remote_call.worker_host_name] += 1 else: self.successes_by_hostnames[remote_call.worker_host_name] += 1 self.logger.debug("build_stats: min_date={} web_sites_count={} sel".format(min_date, website_count)) def write_declaration_crawling_stats(self, html_file): df = pd.DataFrame({'Date': self.end_times, "DeclarationFileCount": self.cumulative_declaration_files_count, "website": self.websites}) title = 'Declaration Count' if self.min_date is not None: title += " (recent)" else: title += " (history)" fig = px.line(df, x='Date', y='DeclarationFileCount', hover_data=["website"], title=title) build_html(self.args, fig, html_file) def write_website_progress(self, html_file): df = pd.DataFrame({ 'Date': self.end_times, "WebSiteCount": self.cumulative_processed_websites_count, "website": self.websites}) title = 'Web Site Progress' if self.min_date is not None: title += " (recent)" else: title += " (history)" fig = px.line(df, x='Date', y='WebSiteCount', title=title, hover_data=["website"]) build_html(self.args, fig, html_file) def get_project_error_rates(self): error_rates = dict() worker_hosts = set(self.host_names) self.logger.debug("build get_project_error_rates for {} worker hosts".format(len(worker_hosts))) for host_name in worker_hosts: f = self.failures_by_hostnames[host_name] s = self.successes_by_hostnames[host_name] self.logger.debug("host {} fail count={} success count={}".format(host_name, f, s)) error_rates[host_name] = 100 * (f / (s + f)) return error_rates class TDlrobotAllStats: @staticmethod def parse_args(arg_list): parser = argparse.ArgumentParser() parser.add_argument("--central-stats-file", dest='central_stats_file', required=False, help="for example /home/sokirko/declarator_hdd/declarator/dlrobot_central/processed_projects/dlrobot_remote_calls.dat") parser.add_argument("--conversion-server-stats", dest='conversion_server_stats', required=False, help="for example /home/sokirko/declarator_hdd/declarator/convert_stats.txt") parser.add_argument("--central-server-cpu-and-mem", dest='central_server_cpu_and_mem', required=False, help="for example /tmp/glances.dat") parser.add_argument("--output-folder", dest='output_folder', required=False, default=".", help="for example ~/smart_parser.disclosures_prod/tools/disclosures_site/disclosures/static") parser.add_argument("--central-stats-history", dest='central_stats_history', required=False, help="for example /tmp/dlrobot_central_stats_history.txt") parser.add_argument("--log-file-name", dest='log_file_name', required=False, default="dl_monitoring.log") parser.add_argument("--round-file", dest="round_file", default=TDeclarationRounds.default_dlrobot_round_path) return parser.parse_args(arg_list) def __init__(self, args): self.args = args self.logger = setup_logging(log_file_name=args.log_file_name) def build_source_doc_stats(self): history_file = "/tmp/source_doc.history" if os.path.exists(history_file): with open (history_file) as inp: history = json.load(inp) else: history = list() source_doc_client = TSourceDocClient(TSourceDocClient.parse_args([]), logger=self.logger) stats = source_doc_client.get_stats() now = int(time.time()) stats['ts'] = now history.append(stats) while len(history) > 0: if now - history[0]['ts'] > 60*60*24: # 24 hours history.pop(0) else: break with open (history_file, "w") as out: json.dump(history, out) timestamps = list() source_doc_count = list() for l in history: dttime = datetime.datetime.fromtimestamp(l['ts']) timestamps.append(pd.Timestamp(dttime)) source_doc_count.append(l['source_doc_count']) df = pd.DataFrame({'Time': timestamps, "source_doc_count": source_doc_count}) fig = px.line(df, x='Time', y='source_doc_count', title='Source Document Count') build_html(self.args, fig, "source_doc_count.html") def process_dlrobot_central_history_stats(self): self.logger.info("process_dlrobot_central_history_stats") times = list() left_projects_count = list() with open(self.args.central_stats_history, "r") as inp: for line_str in inp: h = json.loads(line_str) if len(left_projects_count) > 0 and h['input_tasks'] > left_projects_count[-1]: times.clear() left_projects_count.clear() dttime = datetime.datetime.fromtimestamp(h['last_service_action_time_stamp']) times.append(pd.Timestamp(dttime)) left_projects_count.append(h['input_tasks']) df = pd.DataFrame({'Time': times, "Input Tasks": left_projects_count}) fig = px.line(df, x='Time', y='Input Tasks', title='Left projects count') build_html(self.args, fig, "left_projects_count.html") def process_dlrobot_stats(self): self.logger.info("process_dlrobot_stats") stats = TDlrobotStats(self.args, logger=self.logger) stats.write_declaration_crawling_stats('declaration_crawling_stats.html') stats.write_website_progress('file_progress.html') min_time = datetime.datetime.now() - datetime.timedelta(hours=12) stats12hours = TDlrobotStats(self.args, min_time, logger=self.logger) stats12hours.write_declaration_crawling_stats('declaration_crawling_stats_12h.html') stats12hours.write_website_progress('file_progress_12h.html') df = pd.DataFrame({'host_names': stats12hours.host_names}) fig = px.histogram(df, x="host_names", title="Projects By Workers (12 hours)") build_html(self.args, fig, "worker_stats_12h.html") df = pd.DataFrame({'declaration_files_by_workers': stats12hours.declaration_files_by_workers}) fig = px.histogram(df, x="declaration_files_by_workers", title="Declaration Files By Workers (12 hours)") build_html(self.args, fig, "declaration_files_by_workers_12h.html") df = pd.DataFrame({'failures': stats12hours.failures}) fig = px.histogram(df, x="failures", title="Worker Failures (12 hours)") build_html(self.args, fig, "failures_12h.html") host2error_rates = stats12hours.get_project_error_rates() df = pd.DataFrame({'hostnames': list(host2error_rates.keys()), 'error_rate_in_percent': list(host2error_rates.values()), }) fig = px.bar(df, x='hostnames', y='error_rate_in_percent', title="Dlrobot error rate in percent") build_html(self.args, fig, "error_rates_12h.html") self.build_source_doc_stats() def process_convert_stats(self): self.logger.info("process_convert_stats") with open(self.args.conversion_server_stats, encoding="utf8") as inp: timestamps = list() ocr_pending_all_file_sizes = list() line_no = 1 for l in inp: try: (timestamp, stats) = l.split("\t") dttime = datetime.datetime.fromtimestamp(int(timestamp)) timestamps.append(pd.Timestamp(dttime)) ocr_pending_all_file_sizes.append( json.loads(stats)['ocr_pending_all_file_size']) line_no += 1 except Exception as exp: print("cannot parse line index {} file {}".format(line_no, self.args.conversion_server_stats)) raise df = pd.DataFrame({'Time': timestamps, "ocr_pending_file_sizes": ocr_pending_all_file_sizes}) fig = px.line(df, x='Time', y='ocr_pending_file_sizes', title='Ocr Conversion Server') build_html(self.args, fig, "ocr_pending_file_sizes.html") def process_cpu_and_mem_stats(self): self.logger.info("process_cpu_and_mem_stats") # input file is built by ~/smart_parser/tools/workstation_monitoring.py with open(self.args.central_server_cpu_and_mem) as inp: data_points = json.load(inp) cpu_stats = list() mem_stats = list() timestamps = list() for x in data_points: dttime = datetime.datetime.fromtimestamp(x.pop('ts')) timestamps.append(pd.Timestamp(dttime)) cpu_stats.append(x['cpu']) mem_stats.append(x['mem']) df = pd.DataFrame({'Time': timestamps, "cpu_stats": cpu_stats, "mem_stats": mem_stats}) fig = px.line(df, x='Time', y='cpu_stats', title='Dlrobot central cpu(%)') build_html(self.args, fig, "dlrobot_central_cpu.html") fig = px.line(df, x='Time', y='mem_stats', title='Dlrobot central memory(%)') build_html(self.args, fig, "dlrobot_central_mem.html") def build_stats(self): if self.args.central_stats_history is not None: self.process_dlrobot_central_history_stats() if self.args.central_stats_file is not None: self.process_dlrobot_stats() if self.args.conversion_server_stats is not None: self.process_convert_stats() if self.args.central_server_cpu_and_mem is not None: self.process_cpu_and_mem_stats() if __name__ == "__main__": args = TDlrobotAllStats.parse_args(sys.argv[1:]) TDlrobotAllStats(args).build_stats()
996,436
c7cdeb7933626b7a7a8cf0e41f0d0b070682f56b
''' Laboratorium 6 (kalkulator po telnet) Na podstawie kalkulatora RPN opracuj serwer dostępny dla jednego użytkownika zapewniający dostęp przez protokół telnet na wybranym porcie. ''' import socket HEADERSIZE = 10 HOST = '127.0.0.1' PORT = 9990 ENTER = b'\r\n' SPACE = b' ' BACKSPACE = b'\x08' import operator ops = {'+': operator.add, '-': operator.sub, '*': operator.mul, '/': operator.truediv } def byte_encode(stack): exp = '' for i in stack: exp += str(i) + ' ' exp += '\n\r' return exp.encode('utf-8') def is_not_special_char(character): if character == SPACE: return False if character == BACKSPACE: return False return True s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.bind((HOST, PORT)) s.listen(5) def calculate(tokens, stack): for token in tokens: if set(token).issubset(set("0123456789.")): stack.append(float(token)) elif token in ops: if len(stack) < 2: msg = 'Must have at least two parameters to perform operation' clientsocket.send(msg.encode('utf-8')) raise ValueError(msg) a = stack.pop() b = stack.pop() op = ops[token] stack.append(op(b, a)) else: msg = 'Incorrect input!' clientsocket.send(msg.encode('utf-8')) raise ValueError(msg) return stack while True: clientsocket, address = s.accept() print(f"Connection from {address} has been established!") msg = "-----------------------------------------\n\r" msg += "Welcome to RPN calculator!\n\r" msg += "q - to exit \n\r" msg += "clear - to clear stack\n\r" msg += "-----------------------------------------\n\r" msg = bytes(msg, 'utf-8') clientsocket.send(msg) while True: stack = [] numbers = [] expression = '' while True: data = clientsocket.recv(512) while data != ENTER: decoded = data.decode() if len(decoded) > 0: numbers.append(decoded) temp = clientsocket.recv(512) if temp == BACKSPACE: if len(numbers) > 0: numbers.pop() data = b'' continue if temp == SPACE: continue data = temp for i in numbers: expression += i if expression == 'q': exit() elif expression == 'clear': stack = [] expression = '' numbers = [] continue elif len(expression) == 0: continue stack = calculate(expression.split(), stack) print(str(stack)) clientsocket.send(byte_encode(stack)) expression = '' numbers = []
996,437
451c377dad2a27a8a3c3b7641760f951067c092a
n = int(input()) for i in range(n): linha = input() for j in range(len(linha)): c = "" if (linha[j] >= "A" and linha[j]<="Z"): linha[j] =
996,438
8c10526cf7d0303cdc78ab21b366668a66fee1f8
""" Created by Danny on 2018/12/11 """ from app.models.base import db, Base from app.libs.helper import get_current_date __author__ = 'Danny' class MemberCart(Base): __tablename__ = 'member_cart' id = db.Column(db.Integer, primary_key=True) member_id = db.Column(db.BigInteger, nullable=False, index=True, server_default=db.FetchedValue()) food_id = db.Column(db.Integer, nullable=False, server_default=db.FetchedValue()) quantity = db.Column(db.Integer, nullable=False, server_default=db.FetchedValue()) updated_time = db.Column(db.DateTime, nullable=False, server_default=db.FetchedValue()) created_time = db.Column(db.DateTime, nullable=False, server_default=db.FetchedValue()) @staticmethod def set_items(member_id=0, food_id=0, number=0): if member_id < 1 or food_id < 1 or number < 1: return False cart_info = MemberCart.query.filter_by(food_id=food_id, member_id=member_id).first() if cart_info: model_cart = cart_info else: model_cart = MemberCart() model_cart.member_id = member_id model_cart.created_time = get_current_date() model_cart.food_id = food_id model_cart.quantity = number model_cart.updated_time = get_current_date() with db.auto_commit(): db.session.add(model_cart) return True @staticmethod def delete_item(member_id=0, items=None): if member_id < 1 or not items: return False with db.auto_commit(): for item in items: MemberCart.query.filter_by(food_id=item['id'], member_id=member_id).delete() return True
996,439
6fdaebb0c00244241d8026fff729ce6cf606e61e
from queue import Queue from threading import Thread q_result = Queue() str_list=['222','444','333','666','888'] def str_to_int(arg, queue): result = int(arg) queue.put({arg: result}) def main(): thread_list=[] for s in str_list: t=Thread(target=str_to_int,args=(s,q_result)) t.start() thread_list.append(t) for i in thread_list: i.join() # print(q_result) print([q_result.get() for _ in range(len(str_list))]) if __name__ == '__main__': main()
996,440
2b77419539b4dbd3c410df1ada1be72e9baa0701
class EstadoRepartidor: INACTIVO = 'INACTIVO' ACTIVO = 'ACTIVO' OCUPADO = 'OCUPADO'
996,441
7b1630f4ac189657919cc7e8d3648dc56b672baa
# coding: utf-8 from django.http import HttpResponse from django.template.loader import get_template from django.utils.six.moves.urllib.parse import parse_qsl, urlparse, urlunparse from django.utils.cache import patch_cache_control from django.views.decorators.csrf import csrf_exempt import urllib.request, time, base64, json def do_general(request, body): t = get_template('general.html') html = t.render({'body': body}) response = HttpResponse(html, content_type='text/html') patch_cache_control(response, max_age=0) return response def debug_page(request): return do_general(request, 'debug.html') def video_page(request): return do_general(request, 'video.html') def main_page(request): return do_general(request, 'main.html') def Solve(cube): try: if not cube: return None request = urllib.request.Request("http://localhost:17071/solve?cube={}".format(cube), method='GET') response = urllib.request.urlopen(request) if response.status != 200: return None return response.read() except Exception as e: return None def solve_page(request): cube = request.GET.get("cube", "") answer = Solve(cube) if not answer: answer = """{"state": "fail", "message": "could not reach backend or bad parameters"}""" return HttpResponse(answer, content_type="text/json") def Log(data): try: if not data: return None data = json.loads(base64.b64decode(data)) data["server_timestamp"] = time.time() data = base64.b64encode(json.dumps(data)) request = urllib.request.Request("http://localhost:17071/log".format(cube), data=data) response = urllib.request.urlopen(request) if response.status != 200: return None return ressponse.read() except Exception as e: return None @csrf_exempt def log_page(request): data = request.body answer = Log(data) if not answer: answer = """{"state": "fail", "message": "could not reach backend or bad parameters"}""" return HttpResponse(answer, content_type="text/json")
996,442
20e633ef8b8f7fbb8854d0cadeb6fa4ec1357526
import franka_interface import rospy import itertools import pickle import pyrealsense2 as rs import numpy as np import cv2 from cv2 import aruco import os from std_msgs.msg import String import tf2_ros import geometry_msgs.msg from tf2_geometry_msgs import PoseStamped import pb_robot import numpy from rotation_util import * from panda_vision.msg import NamedPose from panda_vision.srv import GetBlockPosesWorld, GetBlockPosesWrist from pb_robot.panda import Panda def move_to_blocks(arm, gripper, block_poses): block_id = 6 # options: 0, 2, 6 world_pose = None for block_pose in block_poses: if block_pose.block_id == str(block_id): world_pose = block_pose.pose if not world_pose: print('Service did not return desired block pose') return pb_robot.utils.connect(use_gui=False) robot = Panda() robot_pose = numpy.eye(4) robot.set_transform(robot_pose) # First move to where we think the block is in the global frame. p_w = [world_pose.pose.position.x, world_pose.pose.position.y, world_pose.pose.position.z] o_w = [world_pose.pose.orientation.x, world_pose.pose.orientation.y, world_pose.pose.orientation.z, world_pose.pose.orientation.w] R_w = quat_to_rot(o_w) X_w = Rt_to_pose_matrix(R_w, p_w) print('T:', X_w) # For now, keep orientation the same as it initially is. curr_q = arm.joint_angles() curr_tform = robot.arm.ComputeFK(arm.convertToList(curr_q)) curr_tform[0:3, 3] = p_w curr_tform[2, 3] += 0.098 + 0.065 + 0.1 # 0.098 approach_world = robot.arm.ComputeIK(curr_tform) x = input('Move?') if x == 'y': arm.move_to_joint_positions(arm.convertToDict(approach_world)) # Then update the pose using the wrist frame. rospy.wait_for_service('get_block_poses_wrist') try: get_block_poses = rospy.ServiceProxy('get_block_poses_wrist', GetBlockPosesWrist) block_poses = get_block_poses() except rospy.ServiceException as e: print("Service call failed: %s"%e) wrist_pose = None for block_pose in block_poses.poses: if block_pose.block_id == str(block_id): wrist_pose = block_pose.pose if not wrist_pose: print('Wrist camera did not detect the desired pose.') return p_w = [wrist_pose.pose.position.x, wrist_pose.pose.position.y, wrist_pose.pose.position.z] o_w = [wrist_pose.pose.orientation.x, wrist_pose.pose.orientation.y, wrist_pose.pose.orientation.z, wrist_pose.pose.orientation.w] R_w = quat_to_rot(o_w) X_w = Rt_to_pose_matrix(R_w, p_w) print('T:', X_w) # For now, keep orientation the same as it initially is. curr_q = arm.joint_angles() curr_tform = robot.arm.ComputeFK(arm.convertToList(curr_q)) curr_tform[0:3, 3] = p_w curr_tform[2, 3] += 0.098 + 0.065 + 0.1 # 0.098 approach_wrist = robot.arm.ComputeIK(curr_tform, seed_q=approach_world) curr_tform[2, 3] -= 0.1 grasp_wrist = robot.arm.ComputeIK(curr_tform, seed_q=approach_wrist) print('goal:', curr_tform) x = 'y'#input('Correct to wrist pose?') if x == 'y': arm.move_to_joint_positions(arm.convertToDict(approach_wrist)) #input('Move to grasp.') arm.move_to_joint_positions(arm.convertToDict(grasp_wrist)) arm.hand.grasp(0.02, 10, epsilon_inner=0.1, epsilon_outer=0.1) #input('Return to neutral?') arm.move_to_joint_positions(arm.convertToDict(approach_wrist)) arm.move_to_neutral() arm.hand.open() if __name__ == '__main__': rospy.init_node('aruco_pick') arm = franka_interface.ArmInterface() gripper = franka_interface.GripperInterface() rospy.wait_for_service('get_block_poses_world') try: get_block_poses = rospy.ServiceProxy('get_block_poses_world', GetBlockPosesWorld) block_poses = get_block_poses() move_to_blocks(arm, gripper, block_poses.poses) except rospy.ServiceException as e: print("Service call failed: %s"%e)
996,443
61d5b0bda1cf4ad71b2fce4566fa2dd75c04d03b
ba1107.pngMap = [ '11111111111111111111111111111111111111111111111111111100111111111100111111111111111111111111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111111111100111111111100111111111111111111111111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111111111100000000000000000011111111111111111111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111111110000000000000000000000011111111111111111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111111000000000000000000000000000011111111111111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111110000000000000000000000000000011111111111111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111110000000000000000000000000000001111000001111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111110000000000000000000000000000011010000000111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111100000000000000000000000000000000000000000111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111100000000000000000000000000000000000000001111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111100000000000000000000000000000000000000001011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111100000000000000000000000000000000000000001011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111000000000000000000000000000000000000000001011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111100000000000000000000000000000000000000000011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111000000000000000000000000000000000000000000000011111111111111111111111111111111111111', '11111111111111111111111111111111111111111110000000000000000000000000000000000000000000000011111111111111111111111111111111111111', '11111111111111111111111111111111111111111100000000000000000000000000000000000000000000001111111111111111111111111111111111111111', '11111111111111111111111111111111111111111101000000000000000000000000000000000000000000000111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111000000000000000000000000000000000010000000001011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111110100000000000000000000000000000000000000000011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111100000000000000000000000000000000000000000011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111000000000000000000000000000000000000000000011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111100000000000000000000000000000000000000000011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111111000000000000000000000000000111000000000011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111111110000000000000000000000011110100000000001111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111111110000000000000000000000111111000000000011111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111111111000000000000000000011111111100000001111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111111111110010000000000000011111111100000001111111111111111111111111111111111111111', '11111111000010111111111111111111111111111111111111111100000000000000000000111111100000001111111111111111111111111100000000111111', '11111111000000101111111111111111111111111111111111111000000000000000000000011111110000001111111111111111111111000000000000111111', '11111100000000000000111111111111111111111111111111100000000000000000000000010111111100111111111111111111111110000000000000001111', '11110000000100000000011111111111111111111111111111100000000000000000000000001111111111111111111111111111010000000000110000000111', '11000000101100100000000000001111111111111111111100000000000000000000000000000000001111111111111111111100000000000111111100000000', '00000000001111100001000000001111111111111111111010000000000000000000000000000000001111111111111111000000001000000000111000000000', '00000000001111000000101000000000001100010000000000000000000000000000000000000000100000000100000010000000010000000001100000000000', '00000000001100000000001100000000000000000000000000000000000000000000000000000000000000000000000000000100110000000000100000000000', '00010000000000000000001111000000000000000000000000000000000000000000000000000000000000000000110000000011110000000001000000000000', '00000000000111000000001100000000000000000000100000000000000000000000000000000000001010000000000000000011111000000001000000000010', '01100000000011000000100100000000111000000010110000000000000000000000000000000000001100000000001000000000110000000011000000000100', '11110000001111000000001000000000101000000000100000000000000000000000000000000000001100000000101000000000111000000011000000001100', '00100000000011000000111100000000000000000000100000000000000000000000000000000000001100000000000000000000011100000011100000010110', '00110000000011000000111100000000001000000010000000000000000000000000000000000000000100000000000000000000011100001011110000001100', '00110000001111100000111100000000110100000001100000000000000000000000000000000000000100000000011100000000111110000011110000101100', '00110000001111100000111100000010111000000001110000000000000000000000000000000000001101000000111100000000111100000011110000001000', '11110000111111110001111100000000111100000011000000000000000000000000000000000000000100100000001111000011111100001111110000111110', '11110100111111110011111111000010111100000011000000000000000000000000000000000000000001100000001110000011111111011111110100111111', '11111000111111111111111111000011111110000011000000000000000000000000000000000000000011100000001111100111111111111111111001111111', '11111111111111111111111111000011111100010010000000000000000000000000000000000000000101111000001111000011111111111111111111111111', '11111111111111111111111111100111111110000100000000000000000000000000000000000000000000000001111111100111111111111111111111111111', '11111111111111111111111111001111111101000000000000000000000000000000000000000000000000000110111111111111111111111111111111111111', '11111111111111111111111111111111111101000000000000110000000000000000000000001000000000000000111111110111111111111111111111111111', '11111111111111111111111111111111111000000000000000110000000000000000000000000100000000000000001111111111111111111111111111111111', '11111111111111111111111111111111000000000000000111110000000000000000000000001011100000000000000000000000111111111111111111111111', '11111111111111111111111111111110000000000000001111100000000000000000000000000011110000000000000000000000111111111111111111111111', '11111111111111111111000000000000000000000011111111110000000000000000000000000011111111000000000000000000001111111111111111111111', '11111111111111111111000000000000000000000011111111000000000000000000000000000011111111000000000000000000001111111111111111111111', '11111111111111111111010000000000000000011111111111000000000000000000000000000000111111111101000000000000001111111111111111111111', '11111111111110010010000000000000000011111111111101000000000000000000000000000000111111111111000000000000000100011111111111111111', '11111111111000000000000000000000011111111111111100000000000000000000000000000000111111111111111110000000000000000000111111111111', '11111111111100000000000000000000111111111111111100000000000000000000000000000001011111111111111111100000000000000010111111111111', '11111111111111101000000001111111111111111111111000000000000000000000000000000000001111111111111111111110010011111111111111111111', '11111111111111111111100011111111111111111111111000000000000000000000000000000000001111111111111111111111110011111111111111111111', '11111111111111111111111111111111111111111111110000000000000000000000000000000000001111111111111111111111111111111111111111111111', '11111111111111111111111111111111111111111111111000000000000000000000000000000000011111111111111111111111111111111111111111111111', ]
996,444
76456f04d141f1e18b50d948d872ffec3cb10683
#coding:utf-8 import sys import festival print("talking") festival.execCommand("(voice_el_diphone)") string = unicode("Hola mundo, esta es una prueba del criticon, con una canción", "ascii") festival.sayText(string)
996,445
91d64f1150ec00e308b809209ccb7ff465787131
# -*- coding: utf-8 -*- import scrapy from scraper.items import AllNewsItem from all_news.models import Category, News class JaijaidinSpider(scrapy.Spider): category = '' name = 'jaijaidin' allowed_domains = ['jaijaidinbd.com'] start_urls = [ 'http://www.jaijaidinbd.com/todays-paper/sports', 'http://www.jaijaidinbd.com/todays-paper/homeland', 'http://www.jaijaidinbd.com/todays-paper/abroad', 'http://www.jaijaidinbd.com/todays-paper/trade-commerce', 'http://www.jaijaidinbd.com/todays-paper/entertainment', 'http://www.jaijaidinbd.com/feature/rong-berong', 'http://www.jaijaidinbd.com/feature/science-and-technology', 'http://www.jaijaidinbd.com/todays-paper/editorial', ] user_agent = "Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/537.1 (KHTML, like Gecko) Chrome/22.0.1207.1 Safari/537.1" try: news_db_urls = News.objects.filter(source='jaijaidin').values_list('url', flat=True) news_db_urls = list(news_db_urls) news_db_urls = [x.rsplit('/', 1)[0] for x in news_db_urls] except Exception as e: news_db_urls = [] def parse(self, response): crawled_urls = response.css('#cat_parent_content_list a::attr("href")').extract() news_urls = [x.rsplit('/', 1)[0] for x in crawled_urls] unique_urls = list(set(news_urls) - set(self.news_db_urls)) for news_url in unique_urls: if 'all-news' not in news_url: yield response.follow(news_url, callback=self.parse_news) else: pass def parse_news(self, response): def listToString(s): # initialize an empty string str1 = " " # return string return (str1.join(s)) item = AllNewsItem() item['title'] = response.css('.headline_section h1::text').extract_first() description = response.css('#myText ::text').extract() description = [x.strip() + '\n\n' for x in description] description = listToString(description) item['description'] = description image = response.css('.dtl_img_section img::attr(src)').extract_first() if image: image = 'http://www.jaijaidinbd.com' + image item['image'] = image item['url'] = response.request.url + '/' item['source'] = 'jaijaidin' if 'sports' in response.request.url: self.category = 'sports' if 'homeland' in response.request.url: self.category = 'bangladesh' if 'politics' in response.request.url: self.category = 'politics' if 'rong-berong' in response.request.url: self.category = 'lifestyle' if 'abroad' in response.request.url: self.category = 'international' if 'trade-commerce' in response.request.url: self.category = 'economy' if 'entertainment' in response.request.url: self.category = 'entertainment' if 'science-and-technology' in response.request.url: self.category = 'technology' if 'editorial' in response.request.url: self.category = 'opinion' item['category'] = Category.objects.get(name=self.category) if description: if 'বিস্তারিত আসছে...' not in description: yield item else: pass
996,446
d74f2b88ba0b2df5456d075426790feff9c7930c
import hashlib import json from app.main import db from app.main.location.models import Location class JsonModel(object): def as_dict(self): return {c.name: getattr(self, c.name) for c in self.__table__.columns} class Person(db.Model, JsonModel): """ Person Model for storing user related details """ __tablename__ = 'person' id = db.Column(db.String, primary_key=True, nullable=False) key = db.Column(db.String, primary_key=False, nullable=False) name = db.Column(db.String(50), unique=False, nullable=False) surname = db.Column(db.String(150), unique=False, nullable=False) birthday = db.Column(db.DateTime, unique=False, nullable=True) location_id = db.Column(db.String, db.ForeignKey(Location.id), nullable=False) father_id = db.Column(db.String, db.ForeignKey(__tablename__+'.id'), index=True) father = db.relationship('Person', remote_side="Person.id", primaryjoin=('person.c.id==person.c.father_id'), backref="backref('children_of_father')", uselist=False) # father = db.relation("Person", remote_side="Person.id") mother_id = db.Column(db.String, db.ForeignKey(__tablename__+'.id'), index=True) mother = db.relationship('Person', remote_side="Person.id", primaryjoin=('person.c.id==person.c.mother_id'), backref="backref('children_of_mother')", uselist=False) def __repr__(self): return self.name def build_key(data): return hashlib.sha1(json.dumps(data, sort_keys=True).encode('utf-8')).hexdigest()
996,447
ef7d04c24040e6aaed950f80fd6358dc91e0bfca
#!/usr/bin/env python # coding: utf-8 # In[23]: help("reduce") # In[ ]: """ 1.1 Write a Python Program to implement your own myreduce() function which works exactly like Python's built-in function reduce() """ # In[106]: def My_reduce(func,b): a=b[0] # store first index value from list in a for i in range(1,len(b)): a=func(a,b[i]) # calling the function return a # In[107]: # use of My_reduce function : lis=range(3) My_reduce(lambda a,b:a+b,lis) # In[108]: # use of orignal reduce function : import functools lis=range(3) print(functools.reduce(lambda a,b : a+b,lis)) # In[ ]: """ 1.2 Write a Python program to implement your own myfilter() function which works exactly like Python's built-in function filter() """ # In[95]: # To Build my own Filter Function def my_filter(func,lt): empty=[] # Emplty list for i in lt: if func(i): # condition empty.append(i) # adding element to the empty list return empty # In[94]: # use of My_filter function : lst=[1,2,3,4,5,6,7,8,9] list(my_filter(lambda a: a+5,lst)) # In[98]: # use of orignal filter function : lst=[1,2,3,4,5,6,7,8,9] list(filter(lambda a: a+5,lst)) # In[ ]: # In[42]: """ 2. Implement List comprehensions to produce the following lists. Write List comprehensions to produce the following Lists ['x', 'xx', 'xxx', 'xxxx', 'y', 'yy', 'yyy', 'yyyy', 'z', 'zz', 'zzz', 'zzzz'] ['x', 'y', 'z', 'xx', 'yy', 'zz', 'xxx', 'yyy', 'zzz', 'xxxx', 'yyyy', 'zzzz'] [[2], [3], [4], [3], [4], [5], [4], [5], [6]] [[2, 3, 4, 5], [3, 4, 5, 6],[4, 5, 6, 7], [5, 6, 7, 8]] [(1, 1), (2, 1), (3, 1), (1, 2), (2, 2), (3, 2), (1, 3), (2, 3), (3, 3)] """ # In[99]: print("Answer :-") [str(j)*i for j in "xyz" for i in range(1,5)] # In[102]: print("Answer :-") [str(i)*j for j in range(1,5) for i in "xyz"] # In[103]: print("Answer :-") [[j for j in range(i,i+4)] for i in range(2,6)] # In[104]: print("Answer :-") [[i+j] for j in range(1,4) for i in range(1,4)] # In[105]: print("Answer :-") [(i,j) for j in range(1,4) for i in range(1,4)] # In[ ]:
996,448
9b2e4530df1993457c33b8df202580e1526846b2
''' Created on 9.4.2012 @author: xaralis ''' from django import template from django.conf import settings from django.templatetags.static import static from versioned_static.conf import ASSETS, USE_MINIFIED, USE_VERSIONING register = template.Library() @register.inclusion_tag('versioned_static/render_asset.html') def asset(atype, aname): """ Renders CSS/JS asset with it's enclosing HTML tag (link/script). If asset is composed from multiple files, this will be preserved (unless minifyed). Respects settings if versioning should be incorporated or not. """ if atype not in ('css', 'js'): raise template.TemplateSyntaxError('Type can only be one of css or js.') if aname not in ASSETS[atype]: raise ValueError('Invalid asset: %r' % aname) meta = ASSETS[atype][aname] return { 'USE_MINIFIED': USE_MINIFIED, 'type': atype, 'asset': aname, 'meta': meta, } @register.simple_tag def versioned(filename, version, force_version=False, full_path=True): """ Returns filename enriched with version given as second argument. """ if not '.' in filename: return None if USE_VERSIONING or force_version: dotindex = filename.rindex('.') filename = u'%s.%s%s' % (filename[:dotindex], version, filename[dotindex:]) if full_path: return static(filename) return filename
996,449
e0d353c64381eee404eb4d86264ab55142b6f26c
from timeit import Timer def test1(): dict1 = {"a":1, "b":2} dict2 = dict1.copy() def test2(): dict1 = {"a":1, "b":2} a = dict1.get('a') def test3(): dict1 = {"a":1, "b":2} dict1['a'] = 3 def test4(): dict1 = {"a":1, "b":2} del dict1['a'] t1 = Timer('test1()','from __main__ import test1') print('copy',t1.timeit(number=1000),'毫秒') t2 = Timer('test2()','from __main__ import test2') print('get',t2.timeit(number=1000),'毫秒') t3 = Timer("test3()", "from __main__ import test3") print("set",t3.timeit(number=1000), "毫秒") t4 = Timer("test4()", "from __main__ import test4") print("delete",t4.timeit(number=1000), "毫秒")
996,450
ffceb0accb6f828a84f30ccf8cf801b1f92832fd
#!/usr/bin/env python import sys, os, time from optparse import OptionParser from contextlib import closing from seqtools import solid, fastq from seqtools.io import xopen # Process the DGE data. # This duplicates functionality in clean-dge-fastq, but uses lots less # memory # # This funciontality requires that the "cutadapt" library is installed: # http://code.google.com/p/cutadapt/ def trim_dpnii(read, *args, **kwargs): if read.sequence.startswith('CGATC'): try: read = read.trim(1, 'left') except ValueError: read = None return read ## Make sure you trim the dpnii adapter first def filter_anchor(read, anchors, *args, **kwargs): is_good = [read.sequence.startswith(x) for x in anchors] if any(is_good): return read return None def process(infile, outfile, funcs, trashfile=None, parser='fastq', minlength=0, *args, **kwargs): if parser == 'fastq': parser = fastq.parse else: raise NotImplementedError("Only doing FASTQ for now") count, good, bad = 0, 0, 0 for read in parser(infile): count += 1 is_good = True for func in funcs: pread = func(read, *args, **kwargs) if pread is None or (minlength > 0 and len(pread) < minlength): if trashfile is not None: trashfile.write("@%s\n%s\n+\n%s\n" % \ (read.id, read.sequence, read.quality)) is_good = False bad +=1 break if is_good: good += 1 outfile.write("@%s\n%s\n+\n%s\n" % \ (pread.id, pread.sequence, pread.quality)) return (count, good, bad) if __name__ == '__main__': usage = """usage: %prog [options] [CMD] INPUT.fastq[.gz] Runs the given CMD step in the cleaning of DGE data. If CMD is missing then the entire pipeline is run. All files can be read and output in gzip format -- the names of the files just have to end in *.gz NOTE: You will have to remove the sequencing adapter either before or after running the steps in this script. You can use the python cutadapt library, or the fastx-toolkit (faster) for that. The commands CMD to be run are as follows (in order): dpnii : Trims the 5' C of the CGATC reads filter-anchor : Only keeps reads with successful 5' restriction sites By default the anchors are defined as GATC and CATG, so we assume that dpnii was run before. If you want to run this first, use --anchors=CATG,CGATC """ parser = OptionParser(usage=usage) parser.add_option('-a', '--adapter', dest='adapter', default="TCGTATGCCGTCTTCTGCTTG", help="The sequence of the 3' adapter.") parser.add_option('-r', '--anchors', dest='anchors', default="GATC,CATG", help="Comma separated list of expected anchor sites at 5' end") parser.add_option('-o', '--outfile', dest='outfile', default=None, help="Name of file to dump output, defaults to STDOUT") parser.add_option('-t', '--trashfile', dest='trashfile', default=None, help="Optional name of file to put 'bad' reads into") parser.add_option('-m', '--minimum-length', dest='minlength', type=int, default=0, help="Reads < this length are discarded.") (options, args) = parser.parse_args() steps = {'dpnii' : trim_dpnii, 'filter' : filter_anchor} if len(args) < 1: parser.error("Need at least one argument for input filename") if args[0] in steps: pfuncs = (steps[args[0]],) infile = args[1] else: pfuncs = (steps['dpnii'], steps['filter']) infile = args[0] if not os.path.isfile(infile): parser.error("Cannot read input file.") if options.outfile is None: outfile = sys.stdout else: outfile = xopen(options.outfile, 'w') if options.trashfile is None: trashfile = None else: trashfile = xopen(options.trashfile, 'w') anchors = options.anchors.split(',') elapsed = time.time() (total, good, bad) = process(infile, outfile, pfuncs, trashfile, anchors=anchors, minlength=options.minlength) elapsed = time.time() - elapsed if options.outfile is not None: outfile.close() if options.trashfile is not None: trashfile.close() sys.stderr.write('=== DGE Processing Done (%.2f seconds) ===\n' % elapsed) sys.stderr.write(' Processed %d sequences.\n' % total) sys.stderr.write(' Kept %d\n' % good) sys.stderr.write(' Tossed %d\n' %bad)
996,451
0adc52856d0f86f30610d5dc31112752efe02e54
#! /usr/bin/env python # ## Begin copyright ## ## /home/jrf/Documents/books/Books20/Tools/python/aabooks/lib/isbn.py ## ## Part of the Books20 Project ## ## Copyright 2021 James R. Fowler ## ## All rights reserved. No part of this publication may be ## reproduced, stored in a retrival system, or transmitted ## in any form or by any means, electronic, mechanical, ## photocopying, recording, or otherwise, without prior written ## permission of the author. ## ## ## End copyright '''Some useful utility functions for working with ISBN numbers that are not supplied in the module isbnlib. https://isbnsearch.com/search?s=0-667-02340-5 will return the book's information if this is a valid ISBN ''' from math import fmod import isbnlib as isbn # # for ISBN-10 the checksum is calculated by # ISBN-10 is of the form a-bcd-efghi-j # checksum is j = remainder of ([abcdefghi] x [123456789]) MOD 11 # Valid results are '0'-'9' and 'X' # isbn10_mults = [1, 2, 3, 4, 5, 6, 7, 8, 9] def checksum_10(isbnlike): '''Calculate the proper ISBN-10 check sum for a test ISBN 10 string. The input string must be 10 legal characters with or without dashes but the checksum character need not be valid. Return a string character of the checksum digit or 'X' ''' isbndigits = isbn.canonical(isbnlike) tmp_sum = 0 for num, value in zip(isbn10_mults, isbndigits[:9]): tmp_sum += num * int(value) chksum = int(fmod(tmp_sum, 11)) if chksum == 10: return 'X' return str(chksum) # # ISBN-13 is of the form abc-def-ghijkl-m (where abc will usually be 978 or 979) # checksum is m = 10 - the remainder of ([abcdefghiklm] x [131313131313]) MOD 10 # Valid results are '0'-'9' # isbn13_mults = [1, 3, 1, 3, 1, 3, 1, 3, 1, 3, 1, 3] def checksum_13(isbnlike): '''Calculate the proper ISBN-13 check sum for a test ISBN 13 string. The input string must have 13 legal characters with or without dashes but the checksum character need not be valid. Return a string character of the checksum digit. ''' isbndigits = isbn.canonical(isbnlike) tmp_sum = 0 for num, value in zip(isbn13_mults, isbndigits[:12]): tmp_sum += num * int(value) return str(int(10 - fmod(tmp_sum, 10))) # # Generate a checksum for either a 10 or 13 digit ISBN # def checksum(isbnlike): '''Calculate the proper ISBN-check sum for a test ISBN string. The input string must have 10 or 13 legal characters with or without dashes but the checksum character need not be valid. Return a string character of the checksum digit. ''' isbndigits = isbn.canonical(isbnlike) isbnlen = len(isbndigits) # get length, choose 10 or 13 checksum if isbnlen == 10: chksum = checksum_10(isbndigits) elif isbnlen == 13: chksum = checksum_13(isbndigits) else: return None return chksum # # # if __name__ == '__main__': import sys import unittest import argparse # check for command line argument. Run checksum rather # than unit tests parser = argparse.ArgumentParser(description='parse and validate ISBN values') parser.add_argument('isbn', type=str, help='''An ISBN value to test''', default='', nargs='?') args = parser.parse_args() if args.isbn: cksum = checksum(args.isbn) if cksum is None: print('This ISBN value', args.isbn, 'does not seem to be a proper value') else: print('The proper ISBN checksum is', cksum) sys.exit() # still missing a checksum of 8 isbn10_list = [ ('0-8357-0331', '2'), ('0-08-024620', '6'), ('3-540-09830', '5'), ('0-387-09830', '5'), ('3-540-09831', '3'), ('0-387-09831', '3'), ('0-292-75507', '4'), ('0-8243-0917', '0'), ('0-521-22285', '0'), ('0-262-02137', '4'), ('0-471-04492', 'X'), ('0-7167-1006', '4'), ('0-7167-1062', '5'), ('3-12-983890', '2'), ('3-12-983840', '6'), ('0-442-30215', '0'), ('0-442-30216', '9'), ('0-89490-027', '7'), ('0-7188-2433', '4'), ('3-519-02346', '6'), ('90-277-1001', '5'), ('90-277-1044', '9'), ('90-277-0957', '2'), ('90-277-0997', '1'), ('0-85264-244', 'X'), ('0-201-05674', '7'), ('0-444-85115', '1'), ('0-444-85266', '2'), ('0-444-85267', '0'), ('0-19-851462', 'X'), ('0-387-90369', '0'), ('3-540-90369', '0'), ('0-19-857553', 'X'), ('0-471-04815', '1'), ('3-411-01570', '5'), ('3-528-17236', '3'), ('3-528-17214', '2'), ('3-211-81430', '2'), ('0-387-81430', '2'), ('3-211-81475', '2'), ('0-387-81475', '2'), ('0-86008-258', 'X'), ('2-01-003860', '6'), ('0-86961-109', '7'), ('0-444-41802', '4'), ('0-08-026341', '0'), ('0-08-026342', '9'), ] isbn13_list = [ ('978-1-62040-593-', '2'), ('978-0-691-15271-', '4'), ('978-0-521-38200-', '1'), ('978-1-137-28008-', '4'), ('978-0-262-04318-', '2'), ('978-0-06-236359-', '6'), ('978-0-375-42429-', '8'), ('978-0-670-01695-', '2'), ('978-1-61614-739-', '6'), ('978-1-61636-023-', '5'), ('978-1-250-09896-', '2'), ('978-0-684-83252-', '4'), ('978-0-8229-4552-', '9'), ('978-1-108-47154-', '1'), ] # check valid and invalid checksum values class ISBNTestCase(unittest.TestCase): '''The test suite for isbn.py.''' def setUp(self): '''Set up for the tests.''' def tearDown(self): '''Tear down for the next test.''' def test_a_checksum_10(self): '''Test checksum_10() function.''' for isbntest, csum in isbn10_list: self.assertEqual(checksum_10(isbntest + '0'), csum) def test_b_checksum_13(self): '''Test checksum_13() function.''' for isbntest, csum in isbn10_list: self.assertEqual(checksum_10(isbntest + '0'), csum) unittest.main()
996,452
2ec8713c105612ba4b628282997c54babb667578
#Morgan Baughman #12/6/17 #fileDemo.py - how to read a file dictionary = open('engmix.txt') longest = 0 word = '' for words in dictionary: length = len(word) if length > longest: lenght = longest words = word print('The longest word is', word)
996,453
98537429586c2a9e294d03d734b71072f05be235
from onegov.api.models import ApiEndpoint from onegov.api.models import ApiEndpointCollection from onegov.api.models import ApiEndpointItem from onegov.api.models import ApiException, ApiInvalidParamException from onegov.core.utils import Bunch def test_api_exceptions(): exception = ApiException() assert exception.message == 'Internal Server Error' assert exception.status_code == 500 exception = ApiException(exception=ValueError('foo')) assert exception.message == 'Internal Server Error' assert exception.status_code == 500 exception = ApiException(exception=ApiInvalidParamException('foo')) assert exception.message == 'foo' assert exception.status_code == 400 exception = ApiException(exception=ApiInvalidParamException('foo'), status_code=299) assert exception.message == 'foo' assert exception.status_code == 400 exception = ApiException( exception=ApiInvalidParamException('foo', status_code=300)) assert exception.message == 'foo' assert exception.status_code == 300 exception = ApiInvalidParamException() assert exception.message == 'Invalid Parameter' assert exception.status_code == 400 exception = ApiInvalidParamException('Invalid Param x', status_code=99) assert exception.message == 'Invalid Param x' assert exception.status_code == 99 def test_api_endpoint_collection(app, endpoint_class): collection = ApiEndpointCollection(app) assert collection.endpoints == {'endpoint': endpoint_class} def test_api_endpoint_item(app, endpoint_class): item = ApiEndpointItem(app, 'endpoint', 1) assert item.api_endpoint.__class__ == endpoint_class assert item.item.id == 1 assert item.data == {'a': 1, 'title': 'First item'} assert item.links == {'b': '2'} def test_api_endpoint(app, endpoint_class): # ... for_page new = ApiEndpoint(app).for_page(None) assert new.page is None assert new.extra_parameters == {} new = ApiEndpoint(app).for_page(1) assert new.page == 1 assert new.extra_parameters == {} new = ApiEndpoint(app).for_page('1') assert new.page == 1 assert new.extra_parameters == {} new = ApiEndpoint(app, {'a': 1}, 4).for_page(5) assert new.page == 5 assert new.extra_parameters == {'a': 1} new = ApiEndpoint(app).for_page(1).for_filter(a=1) assert new.page is None assert new.extra_parameters == {'a': 1} # ... for_filter new = ApiEndpoint(app).for_filter() assert new.page is None assert new.extra_parameters == {} new = ApiEndpoint(app).for_filter(a=1) assert new.page is None assert new.extra_parameters == {'a': 1} new = ApiEndpoint(app, {'a': 1}, 4).for_filter(b=2) assert new.page is None assert new.extra_parameters == {'b': 2} new = ApiEndpoint(app).for_filter(a=1).for_filter(b=2) assert new.page is None assert new.extra_parameters == {'b': 2} new = ApiEndpoint(app).for_filter(a=1).for_page(1) assert new.page == 1 assert new.extra_parameters == {'a': 1} # ... for_item assert ApiEndpoint(app).for_item(None) is None assert endpoint_class(app).for_item(Bunch(id=1)).id == '1' assert endpoint_class(app).for_item(Bunch(id='1')).id == '1' assert endpoint_class(app).for_item(Bunch(id=Bunch(hex='1'))).id == '1' assert endpoint_class(app).for_item(Bunch(id=1)).endpoint == 'endpoint' # ... get_filter assert ApiEndpoint(app).get_filter('a') is None assert ApiEndpoint(app, {'a': 1}).get_filter('a') == 1 # ... by_id assert endpoint_class(app).by_id(1).id == 1 assert endpoint_class(app).by_id(2).id == 2 assert endpoint_class(app).by_id(3) is None # .... item_data assert endpoint_class(app).item_data(Bunch(title=1, a=2)) == { 'title': 1, 'a': 2 } # .... item_links assert endpoint_class(app).item_links(Bunch(b=2)) == {'b': 2} # ... links assert endpoint_class(app).links == {'next': None, 'prev': None} endpoint = endpoint_class(app) endpoint._collection.previous = Bunch(page=3) endpoint._collection.next = Bunch(page=5) assert endpoint.links['prev'].page == 3 assert endpoint.links['next'].page == 5 # ... batch batch = endpoint_class(app).batch assert {endpoint.id: item.title for endpoint, item in batch.items()} == { '1': 'First item', '2': 'Second item' }
996,454
1fe1b0d754768e407a92a7acd1832aa2863b1c30
#!/usr/bin/env python # coding: utf-8 ''' This is a simple arithmetic expression interpreter very much inspired by Peter Norvig's lis.py [1]. It implements the arithmetic expression subset of the language described in Chapter 1 of Samuel Kamin's book Programming Languages book [2]. [1] http://norvig.com/lispy.html [2] Samuel Kamin, "Programming Languages, An Interpreter-Based Approach", Addison-Wesley, Reading, MA, 1990. ISBN 0-201-06824-9. BNF of this mini-language: <expression> ::= <integer> | `(` <value-op> <expression>* `)` <value-op> ::= `+` | `-` | `*` | `/` | `=` | `<` | `>` <integer> ::= sequence of digits, possibly preceded by minus sign ''' import operator as op import re REGEX_INTEGER = re.compile(r'-?\d+$') class InterpreterError(Exception): """generic interpreter error""" def __init__(self, value=None): self.value = value def __str__(self): msg = self.__class__.__doc__ if self.value is not None: return msg + ': ' + repr(self.value) return msg class InputError(InterpreterError): """generic parsing error""" class UnexpectedEndOfInput(InputError): """unexpected end of input""" class UnexpectedRightParen(InputError): """unexpected )""" class EvaluationError(InterpreterError): """generic evaluation error""" class InvalidOperator(EvaluationError): """invalid operator""" class NullExpression(EvaluationError): """null expression""" class MissingArguments(EvaluationError): """missing arguments""" class TooManyArguments(EvaluationError): """too many arguments""" def tokenize(source_code): """Convert a string into a list of tokens.""" return source_code.replace('(',' ( ').replace(')',' ) ').split() def parse(source_code): """Convert a string into expressions represented as (nested) lists""" tokens = tokenize(source_code) return read(tokens) def read(tokens): """Read tokens building recursively nested expressions""" if len(tokens) == 0: raise UnexpectedEndOfInput() token = tokens.pop(0) if token == '(': parsed = [] if len(tokens) == 0: raise UnexpectedEndOfInput() while tokens[0] != ')': parsed.append(read(tokens)) if len(tokens) == 0: raise UnexpectedEndOfInput() tokens.pop(0) # pop off ')' return parsed elif token == ')': raise UnexpectedRightParen() else: return atom(token) def atom(token): """Return numbers as numbers, everything else as symbols""" if REGEX_INTEGER.match(token): return int(token) else: return token operators = { '+': op.add, '-': op.sub, '*': op.mul, '/': op.floordiv, '=': lambda a, b: 1 if a == b else 0, '<': lambda a, b: 1 if a < b else 0, '>': lambda a, b: 1 if a > b else 0, } def evaluate(expression): """Calculate the value of an expression""" if isinstance(expression, int): return expression elif isinstance(expression, str): # operator try: return operators[expression] except KeyError: raise InvalidOperator(expression) else: exps = [evaluate(exp) for exp in expression] if len(exps) == 0: raise NullExpression() operator = exps.pop(0) if callable(operator): if len(exps) == 2: arg1, arg2 = exps return operator(arg1, arg2) elif len(exps) < 2: raise MissingArguments() else: raise TooManyArguments() else: raise InvalidOperator(operator) def repl(prompt='> '): """A read-eval-print loop""" while True: try: value = evaluate(parse(input(prompt))) except (InterpreterError, ZeroDivisionError) as exc: print('! ' + str(exc)) except KeyboardInterrupt: print() raise SystemExit else: print(value) if __name__=='__main__': repl()
996,455
8f92f40e89419ebb9c3de5c1cdd492d06ffd08d4
import databases import sqlalchemy from fastapi_users.db import OrmarBaseUserModel, OrmarUserDatabase from User.schemas import UserDB DATABASE_URL = "sqlite:///sqlite2.db" metadata = sqlalchemy.MetaData() database = databases.Database(DATABASE_URL) class UserModel(OrmarBaseUserModel): class Meta: tablename = "users_21" metadata = metadata database = database engine = sqlalchemy.create_engine(DATABASE_URL) metadata.create_all(engine) def get_user_db(): yield OrmarUserDatabase(UserDB, UserModel)
996,456
9a1319df4aee90eb1676d95a514c796aaa0d05eb
import json import urllib2 from collections import namedtuple def _json_object_hook(d): return namedtuple('X', d.keys())(*d.values()) def json2obj(data): return json.loads(data, object_hook=_json_object_hook) def getJsonResponse(substr, page): contents = urllib2.urlopen("https://jsonmock.hackerrank.com/api/movies/search/?Title=" + substr +"&page=" + str(page)).read() return json2obj(contents) def getMovieTitles(substr): pageOne = getJsonResponse(substr, 1) data = pageOne.data titles=[] for x in data: titles.append(x.Title) if pageOne.total_pages > 1: for i in range(2, pageOne.total_pages+1): extraPage = getJsonResponse(substr, i) data = extraPage.data for x in data: titles.append(x.Title) titles.sort() return titles #Enter the desired search term below titles = getMovieTitles("spiderman") for x in titles: print x
996,457
f635d055c4febe42a130fc485493369a3a24a773
/home/mohammed/anaconda3/lib/python3.7/rlcompleter.py
996,458
2f4f16d577e41d4c9823496f5e8c6ef73224f26c
import logging, numpy, openravepy, time, math from openravepy.databases import inversereachability from openravepy import IkFilterOptions #from openravepy.databases import inversereachability class GraspPlanner(object): def __init__(self, robot, base_planner, arm_planner): self.robot = robot self.env = self.robot.GetEnv() self.manip = self.robot.GetActiveManipulator() self.base_planner = base_planner self.arm_planner = arm_planner #self.task_manipulation = openravepy.interfaces.TaskManipulation(self.robot) def GetBasePoseForObjectGrasp(self, obj): # Load grasp database self.gmodel = openravepy.databases.grasping.GraspingModel(self.robot, obj) if not self.gmodel.load(): self.gmodel.autogenerate() base_pose = None grasp_config = None ################################################################### # TODO: Here you will fill in the function to compute # a base pose and associated grasp config for the # grasping the bottle ################################################################### #get the ordered valid grasp from homework1 print "robot start transformation -----------------" print self.robot.GetTransform() self.graspindices = self.gmodel.graspindices self.grasps = self.gmodel.grasps self.order_grasps() # get the grasp transform Tgrasp = self.gmodel.getGlobalGraspTransform(self.grasps_ordered[10],collisionfree=True) # load inverserechability database irmodel = openravepy.databases.inversereachability.InverseReachabilityModel(robot=self.robot) starttime = time.time() print 'loading irmodel' if not irmodel.load(): irmodel.autogenerate() loaded = irmodel.load() print "irmodel loaded? {}".format(loaded) densityfn,samplerfn,bounds = irmodel.computeBaseDistribution(Tgrasp) #find the valid pose and joint states # initialize sampling parameters goals = [] numfailures = 0 N = 3 with self.robot.GetEnv(): while len(goals) < N: poses,jointstate = samplerfn(N-len(goals)) for pose in poses: self.robot.SetTransform(pose) self.robot.SetDOFValues(*jointstate) # validate that base is not in collision if not self.manip.CheckIndependentCollision(openravepy.CollisionReport()): q = self.manip.FindIKSolution(Tgrasp,filteroptions=IkFilterOptions.CheckEnvCollisions) if q is not None: values = self.robot.GetDOFValues() values[self.manip.GetArmIndices()] = q goals.append((Tgrasp,pose,values)) elif self.manip.FindIKSolution(Tgrasp,0) is None: numfailures += 1 # To do still #base_pose = goals[0][1] #grasp_config = goals[0][2] for i,goal in enumerate(goals): grasp_with_pose,pose,values =goal self.robot.SetTransform(pose) self.robot.SetJointValues(values) trans_pose = self.robot.GetTransform() angle_pose = openravepy.axisAngleFromRotationMatrix(trans_pose) pose = [trans_pose[0,3],trans_pose[1,3],angle_pose[2]] base_pose = numpy.array(pose) grasp_config = q #import IPython #IPython.embed() print "grasping result" print base_pose print grasp_config return base_pose, grasp_config def PlanToGrasp(self, obj): # Next select a pose for the base and an associated ik for the arm base_pose, grasp_config = self.GetBasePoseForObjectGrasp(obj) if base_pose is None or grasp_config is None: print 'Failed to find solution' exit() # Now plan to the base pose start_pose = numpy.array(self.base_planner.planning_env.herb.GetCurrentConfiguration()) base_plan = self.base_planner.Plan(start_pose, base_pose) base_traj = self.base_planner.planning_env.herb.ConvertPlanToTrajectory(base_plan) print 'Executing base trajectory' self.base_planner.planning_env.herb.ExecuteTrajectory(base_traj) # Now plan the arm to the grasp configuration start_config = numpy.array(self.arm_planner.planning_env.herb.GetCurrentConfiguration()) arm_plan = self.arm_planner.Plan(start_config, grasp_config) arm_traj = self.arm_planner.planning_env.herb.ConvertPlanToTrajectory(arm_plan) print 'Executing arm trajectory' print arm_traj self.arm_planner.planning_env.herb.ExecuteTrajectory(arm_traj) print "execute trajectory----------------" # Grasp the bottle task_manipulation = openravepy.interfaces.TaskManipulation(self.robot) print "task manipulation---------------------" task_manipulation.CloseFingers() raw_input('') print "close fingers" #Code copied from hw1(the following two functions) # order the grasps - call eval grasp on each, set the 'performance' index, and sort def order_grasps(self): self.grasps_ordered = self.grasps.copy() #you should change the order of self.grasps_ordered for grasp in self.grasps_ordered: grasp[self.graspindices.get('performance')] = self.eval_grasp(grasp) # sort! order = numpy.argsort(self.grasps_ordered[:,self.graspindices.get('performance')[0]]) order = order[::-1] self.grasps_ordered = self.grasps_ordered[order] def eval_grasp(self, grasp): with self.robot: #contacts is a 2d array, where contacts[i,0-2] are the positions of contact i and contacts[i,3-5] is the direction try: contacts,finalconfig,mindist,volume = self.gmodel.testGrasp(grasp=grasp,translate=True,forceclosure=False) obj_position = self.gmodel.target.GetTransform()[0:3,3] num_contacts = len(contacts) # for each contact G = numpy.zeros([6, num_contacts]) #the wrench matrix for idx, c in enumerate(contacts): pos = c[0:3] - obj_position # print pos dir = -c[3:] #this is already a unit vector #TODO fill G G[0:3,idx] = dir.T G[3:6,idx] = numpy.cross(pos,dir).T #TODO use G to compute scrores as discussed in class U, s, V = numpy.linalg.svd(G, full_matrices=True) # print U.shape, s.shape, V.shape # Metric 1 minimum singular value if s.all() >= 0: m1 = numpy.amin(s) else: m1 = 0 # Metric 2: volume of the ellipsoid if numpy.linalg.det(numpy.dot(G,G.T)) >= 0: m2 = numpy.sqrt(numpy.linalg.det(numpy.dot(G,G.T))) else: m2 = 0; #Metric 3: Isotropy sigma_min = numpy.amin(s) sigma_max = numpy.amax(s) if sigma_max > 0: m3 = sigma_min / sigma_max else: m3 = 0 # print U.shape, s.shape, V.shape #Need to come up with weights for each of the metric for evaluation function # print 'm1: ' + repr(m1) + '\nm2: ' + repr(m2) + '\nm3: ' + repr(m3) # rationale, m1 and m3 are highly correlated so I bring them to about the same order of magnitude # m2, is very small and boosted to about the same order of magnitude as well if numpy.linalg.matrix_rank(G) == 6: return 100*m1+50000*m2+1000*m3 else: return 0 except openravepy.planning_error,e: #you get here if there is a failure in planning #example: if the hand is already intersecting the object at the initial position/orientation return 0.00 # TODO you may want to change this
996,459
3100b8d145292509c26dca3093853b3442ff815d
# -*- coding: utf-8 -*- """ Created on Wed Apr 18 13:30:03 2018 @author: hsseo """ from __future__ import absolute_import from __future__ import division from __future__ import print_function from batch import * from Network_D import * # pylint: disable=missing-docstring import argparse import os.path import os import sys import time import math from six.moves import xrange # pylint: disable=redefined-builtin import tensorflow as tf import scipy.io as sio import numpy as np #tf.device('/cpu:0'): os.environ["CUDA_DEVICE_ORDER"]="PCI_BUS_ID" os.environ["CUDA_VISIBLE_DEVICES"]="2,3" #os.environ["CUDA_lISIBLE_DEVICES"]="2,3" image_size = 512 # Basic model parameters as external flags. FLAGS = None X = sio.loadmat('/raid/seo/CT/lung/TrainInput_l1.mat') X1 = X['TrainInput_l1'] X_train_s = np.concatenate([X1],axis=0) Y = sio.loadmat('/raid/seo/CT/lung/TrainOutput_l1.mat') Y1 = Y['TrainOutput_l1'] Y_train_s = np.concatenate([Y1],axis=0) X_t = sio.loadmat('/raid/seo/CT/lung/TestInput_l1.mat') X_test = X_t['TestInput_l1'] Y_t = sio.loadmat('/raid/seo/CT/lung/TestOutput_l1.mat') Y_test = Y_t['TestOutput_l1'] def placeholder_inputs(batch_size): images_placeholder = tf.placeholder(tf.float32, shape=(batch_size,512,512)) labels_placeholder = tf.placeholder(tf.float32, shape=(batch_size,512,512)) return images_placeholder,labels_placeholder def run_training(): # Tell TensorFlow that the model will be built into the default Graph. with tf.Graph().as_default(): # Generate placeholders for the images and labels. images_placeholder, labels_placeholder = placeholder_inputs(FLAGS.batch_size) phase_train = tf.placeholder(tf.bool, name='phase_train') keep_prob = tf.placeholder(tf.float32) # Build a Graph that computes predictions from the inference model. logits = deepnn(images_placeholder, image_size, FLAGS.batch_size, keep_prob, phase_train) alpha_p = tf.placeholder(tf.float32, shape=()) alpha_n = tf.placeholder(tf.float32, shape=()) beta_sq = tf.placeholder(tf.float32, shape=()) # Add to the Graph the Ops for loss calculation. loss, updated_alpha_p, updated_alpha_n, updated_beta_sq = lossfn(logits, labels_placeholder,alpha_p, alpha_n, beta_sq) # Add to the Graph the Ops that calculate and apply gradients. train_op = training(loss, FLAGS.learning_rate) # calculate prediction error #pred_err = prediction(logits, labels_placeholder, labels_mean, labels_std) # Build the summary Tensor based on the TF collection of Summaries. summary = tf.summary.merge_all() # Add the variable initializer Op. init = tf.global_variables_initializer() #init = tf.initialize_all_variables # Create a saver for writing training checkpoints. saver = tf.train.Saver() # Create a session for running Ops on the Graph. sess = tf.Session() # And then after everything is built: # Run the Op to initialize the variables. sess.run(init) TRAIN_DATASIZE = X_train_s.shape[0] batchtrain = Batchdata(np.arange(0,TRAIN_DATASIZE)) alpha_p_value = 1.0 alpha_n_value = 1.0 beta_sq_value = 1.0 for step in xrange(FLAGS.max_step): start_time = time.time() idxs = batchtrain.next_batch(FLAGS.batch_size) #shuffled ordering batch_X = X_train_s[idxs,:,:] batch_Y = Y_train_s[idxs,:,:] feed_dict = {images_placeholder: batch_X, labels_placeholder: batch_Y, keep_prob: 0.6, phase_train: True, alpha_p: alpha_p_value, alpha_n: alpha_n_value, beta_sq: beta_sq_value} _, loss_value, alpha_p_value, alpha_n_value, beta_sq_value = sess.run([train_op, loss, updated_alpha_p, updated_alpha_n, updated_beta_sq], feed_dict=feed_dict) duration = time.time() - start_time if (step + 1) % 5 == 0: checkpoint_file = os.path.join(FLAGS.log_dir, 'model.ckpt') saver.save(sess, checkpoint_file, global_step=step) print('%%%% save the model paramters ... ') print('Step %d: loss = %.7f (%.3f sec)' % (step, loss_value, duration)) if (step + 1) % 5 == 0: feed_dict = {images_placeholder: X_test, labels_placeholder: Y_test, keep_prob: 1.0, phase_train: False, alpha_p: alpha_p_value, alpha_n: alpha_n_value, beta_sq: beta_sq_value} Test_results = sess.run([logits, updated_alpha_p, updated_alpha_n, updated_beta_sq], feed_dict=feed_dict) loss_value = sess.run(loss, feed_dict=feed_dict) print('alpha_p2_value %f' % (alpha_p_value)) print('alpha_n_value %f' % (alpha_n_value)) print('beta_sq_value %f' % (beta_sq_value)) sio.savemat('Test_results.mat', {'pred': Test_results}) ################################################################ #####################run_kernel################################# ################################################################ def main(_): tf.gfile.MakeDirs(FLAGS.log_dir) run_training() if __name__ == '__main__': parser = argparse.ArgumentParser() parser.add_argument( '--learning_rate', type=float, default=0.00001, help='Initial learning rate.' ) parser.add_argument( '--max_step', type=int, default=2000000000, help='Number of steps to run trainer.' ) parser.add_argument( '--batch_size', type=int, default=10, help='Batch size. Must divide evenly into the dataset sizes.' ) parser.add_argument( '--log_dir', type=str, default='logs', help='Directory to put the log data.' ) FLAGS, unparsed = parser.parse_known_args() tf.app.run(main=main, argv=[sys.argv[0]] + unparsed)
996,460
35c413fabce495d1e4e2450c6a3805895dadd4eb
from flask import render_template, request from ui import webapp @webapp.route("/login") def login_register(): return render_template("login.html") @webapp.route('/login', methods=['POST']) def login_attempt(): username = request.form.get("username") password = request.form.get("password") # TODO # if users.authenticate(username, password): # configure_user_session(username) # return redirect(url_for("main")) # else: # return render_template("home.html", title="Welcome to Easy Text Recognition", # error_msg="You have entered an incorrect password or username") @webapp.route('/register', methods=['POST']) def register_new_user(): username = request.form.get("username") password = request.form.get("password") # TODO # if users.get_user(username) is not None: # print("Failed to register - username is already taken!") # return render_template("home.html", title="Welcome to Easy Text Recognition", # error_msg="Selected username is already taken. Please choose a different username") # # if validator.registration(username, password) and users.create_new_user(username, password): # configure_user_session(username) # return redirect(url_for("main")) # # , error_msg="Registration Successful!") # # return render_template("registration_success.html", title="Registration Successful!") # else: # return render_template("home.html", title="Welcome to Easy Text Recognition", # error_msg="Registration could not be completed at this time. Please try again later")
996,461
9b4eb876e4dbb27afc3fa40393fc227f77d1f5bb
# -*- coding: utf-8 -*- from __future__ import unicode_literals, print_function, division import unicodedata from nltk import word_tokenize import sys, re import pandas as pd import numpy as np import json import argparse import json import torch ''' Change of this file. 1. simplify the preprocessing process 2. generate one sentence everytime. 3. remove the degree of lemmatize 4. 5. Down sampling the popular response. ''' #text = clean_str(text.strip()) if clean else text.strip() def tokenize_url(instring): reg = re.compile(r'http[s]?:(//)?(?:[a-zA-Z]|[0-9]|[$-_@.&+]|[!*\(\),]|(?:%[0-9a-fA-F][0-9a-fA-F]))+', re.IGNORECASE) reg1=re.compile("([0-9]{1,3}\\.[0-9]{1,3}\\.[0-9]{1,3}\\.[0-9]{1,3}|(((news|telnet|nttp|file|http|ftp|https)://)|(www|ftp)[-A-Za-z0-9]*\\.)[-A-Za-z0-9\\.]+)(:[0-9]*)?/[-A-Za-z0-9_\\$\\.\\+\\!\\*\\(\\),;:@&=\\?/~\\#\\%]*[^]'\\.}>\\),\\\"]") reg2=re.compile("([0-9]{1,3}\\.[0-9]{1,3}\\.[0-9]{1,3}\\.[0-9]{1,3}|(((news|telnet|nttp|file|http|ftp|https)://)|(www|ftp)[-A-Za-z0-9]*\\.)[-A-Za-z0-9\\.]+)(:[0-9]*)?") #reg3=re.compile("(~/|/|\\./)([-A-Za-z0-9_\\$\\.\\+\\!\\*\\(\\),;:@&=\\?/~\\#\\%]|\\\\)+") reg4= re.compile("'\\<((mailto:)|)[-A-Za-z0-9\\.]+@[-A-Za-z0-9\\.]+") instring = re.sub(reg, '_url_', instring) instring = re.sub(reg1, '_url_', instring) instring = re.sub(reg2, '_url_', instring) #instring = re.sub(reg3, '_url_', instring) #instring = re.sub(reg4, '_url_', instring) return instring def tokenize_email(instring): reg = re.compile (r"([a-zA-Z0-9_.+-]+@[a-zA-Z0-9-]+\.[a-zA-Z0-9-.]+)") return re.sub(reg, '_email_', instring) def tokenize_date(instring): reg = re.compile(r'[0-9]+\/[0-9]+(\/\*\*\*\*|\/[0-9]+)?', re.IGNORECASE) return re.sub(reg, '_date_', instring) def tokenize_cost(instring): outstring = instring reg = re.compile(r'\$?[0-9]+(\.[0-9]+)?\/mo(nth)?', re.IGNORECASE) outstring = re.sub(reg, '_cost_', outstring) reg1 = re.compile(r'\$[0-9]+(\.[0-9]+)?') return re.sub(reg1, '_cost_', outstring) def tokenize_ispeed(instring): reg = re.compile(r'[0-9]+(\.[0-9]+)? ?(mb(\/)?s|[km]bps)', re.IGNORECASE) return re.sub(reg, '_ispeed_', instring) def tokenize_phonenum(instring): reg = re.compile (r'([0-9*]{3}[-\.\s]??[0-9*]{3}[-\.\s]??[0-9*]{4}|[0-9*]{1,2}[-\.\s]??[0-9*]{3}[-\.\s]??[0-9*]{3}[-\.\s]??[0-9*]{4})') instring = re.sub(reg, '_phone_', instring) reg1 = re.compile (r'([a-zA-Z0-9*]{3}[-][a-zA-Z0-9*]{3}[-][a-zA-Z0-9*]{4}|[0-9*]{1,2}[-][a-zA-Z0-9*]{3}[-][a-zA-Z0-9*]{3}[-][a-zA-Z0-9*]{4})') instring = re.sub(reg1, '_phone_', instring) reg2 = re.compile (r'(\([a-zA-Z0-9*]{3}\)\s*[a-zA-Z0-9*]{3}[-\.\s]??[a-zA-Z0-9*]{4}|[a-zA-Z0-9*]{3}[-\.\s]??[a-zA-Z0-9*]{4})') #instring = re.sub(reg1, '_phone_', instring) #reg = re.compile (r'[a-zA-Z0-9*]{3}[-\.\s]??\d{3}[-\.\s]??\d{4}|\(\d{3}\)\s*\d{3}[-\.\s]??\d{4}|\d{3}[-\.\s]??\d{4})') #reg = re.compile (r'(XXXXXX[0-9]{4})|(\\(XXXX\\)[0-9]{3}-[0-9]{4})|(XXXX [0-9]{3} [0-9]{4})') return instring rgx_DataVolume = re.compile ('[0-9]*gb', re.IGNORECASE) rgx_Percentage = re.compile ('[0-9]+\.[0-9]*%') rgx_Day = re.compile ('[0-9]?[0-9](st|nd|rd|th)', re.IGNORECASE) #rgx_Month = re.compile ('(january)|(jan)|(february)|(feb)|(march)|(mar)|(april)|(apr)|(may)|(june)|(jun)|(july)|(jul)|(august)|(aug)|(september)|(sep)|(october)|(oct)|(november)|(nov)|(december)|(dec)', re.IGNORECASE) rgx_Year = re.compile ('(19[0-9]{2})|(20[0-9]{2})') rgx_Num = re.compile(r'[0-9]+(\.[0-9]+)?') rgx_Accountnum = re.compile(r'[0-9*]{13,18}') rgx_Time = re.compile(r'([0-9]|0[0-9]|1[0-9]|2[0-3]):[0-5][0-9]') # ----------------------------------------------------- def preclean_text (_text): # nltk.word_tokenize doesn't seem to handle these correctly. ?? # Tokenization/string cleaning _text = _text.replace ("I'm ", "I am ") _text = re.sub(r"\'s", " \'s", _text) _text = re.sub(r"\'ve", " \'ve", _text) _text = re.sub(r"n\'t", " n\'t", _text) _text = re.sub(r"\'re", " \'e", _text) _text = re.sub(r"\'d", " \'d", _text) _text = re.sub(r"\'ll", " \'ll", _text) _text = re.sub(r"\s{2,}", " ", _text) _text = re.sub(r"[-]{8,}", "--", _text) _text = tokenize_url(_text) _text = tokenize_email(_text) _text = tokenize_date(_text) _text = tokenize_cost(_text) _text = tokenize_ispeed(_text) _text = re.sub(rgx_Accountnum, "_account_", _text) _text = tokenize_phonenum(_text) _text = re.sub(rgx_DataVolume, "_data_", _text) _text = re.sub(rgx_Time, "_time_", _text) _text = re.sub(rgx_Percentage, "_percentage_", _text) _text = re.sub(rgx_Day, "_day_", _text) #_text = re.sub(rgx_Month, "_month_", _text) _text = re.sub(rgx_Year, "_year_", _text) _text = re.sub(rgx_Num, "_num_", _text) _text = re.sub(r",", " , ", _text) _text = re.sub(r"!", " ! ", _text) _text = re.sub(r"\(", " \( ", _text) _text = re.sub(r"\)", " \) ", _text) _text = re.sub(r"\?", " \? ", _text) _text = _text.replace ('.', ' . ') #_text = _text.replace (',', ' , ') _text = _text.replace (':', ' : ') _text = _text.replace (';', ' ; ') #_text = _text.replace ('?', ' ? ') #_text = _text.replace ('!', ' ! ') #_text = _text.replace ('(', ' ( ') #_text = _text.replace (')', ' ) ') _text = _text.replace ('"', ' " ') _text = _text.replace ('[', ' [ ') _text = _text.replace (']', ' ] ') _text = _text.replace ('{', ' { ') _text = _text.replace ('}', ' } ') _text = _text.replace ('-', ' - ') _text = _text.replace ('=', ' = ') _text = _text.replace ('+', ' + ') _text = _text.replace ('*', ' * ') _text = _text.replace ('~', ' ~ ') _text = _text.replace ('|', ' | ') _text = _text.replace ('#', ' # ') _text = _text.replace ('\\n', ' ') _text = _text.replace ('\\', ' ') _text = _text.replace ('…', ' ') _text = _text.replace ('“', ' ') _text = _text.replace ('”', ' ') _text = _text.replace (',', ' , ') #_text = _text.replace ('_', ' _ ') _text = _text.replace ('#', ' # ') ''' _text = _text.replace ('’', ' \' ') _text = _text.replace ('\'', ' \' ') ''' _text = re.sub(r"\s{2,}", " ", _text) return _text.strip() # ----------------------------------------------------- def load_conversations(csv_file='/D/data/autosuggest_data/cc/cc_20170204/'): df = pd.read_csv(csv_file) print('Finish reading csv file: {}.'.format(csv_file)) #df = df[["RowKey","eventflagfromrep","text"]] df = df[[not x for x in df['isautogenerated']]] df = df[["rowkey","eventflagfromrep","text"]] df.columns = ["conversationid","eventflagfromrep","text"] df = df[~pd.isnull(df.text)] return df def conversation_save(data1, file, args, MAX_wps = 50, MAX_turn =50, saving_starts_turnn=6 ): conversation_begin_symbol = "__SOC__" customer_begin_symbol = "<cus__" customer_end_symbol = "__cus>" agent_begin_symbol = "<agent__" agent_end_symbol = "__agent>" indicator = file.split('_')[0] #fileout = args.dir+indicator+'_v'+args.version #f_tgt = open(args.outdir +'/'+ 'tgt-'+indicator+'_v'+args.version+'.txt', 'w') #f_src = open(args.outdir +'/'+ 'src-'+indicator+'_v'+args.version+'.txt', 'w') conv_n = 0 pairn = 0 context_stats = [] Autt_stats = [] utter_n = 0 old_id = -1 #data1.iloc[0]['conversationid'] last_speaker = int(data1.iloc[0]['eventflagfromrep']) context = [] conversation = [] replies = [] all_turn = [] turns = [] speaker = [] all_speaker = [] #with open('prob_dict.json', 'r') as f: # prob_dict = json.load(f) #print(prob_dict) for i in range(len(data1)): #print(i) new_id = data1.iloc[i]['conversationid'] this_speaker = int(data1.iloc[i]['eventflagfromrep']) text = data1.iloc[i]['text'] utt = preclean_text(text.lower()).split(' ') if len(utt)> MAX_wps: utt = utt[-MAX_wps:] if new_id != old_id: conv_n += 1 utter_n = 0 context=[] turns = [] speaker = [] #context = conversation_begin_symbol context.append(conversation_begin_symbol) turns.append(utter_n) speaker.append(this_speaker) # customer is speaking if this_speaker == False: c_utt = [customer_begin_symbol] + utt + [customer_end_symbol] #context = context + ' ' + c_utt context.append(c_utt) turns.append(utter_n) speaker.append(this_speaker) if this_speaker == True: a_utt = [agent_begin_symbol] + utt + [agent_end_symbol] if utter_n >= saving_starts_turnn: ''' #'save the status' if a_utt in prob_dict: #print(a_utt) p = prob_dict[a_utt] if p<1 and np.random.binomial(1, p, 1) == 0: #print(a_utt) continue ''' pairn +=1 Autt_stats.append(len(a_utt)) context_arr = [w for sent in context for w in sent] context_stats.append(len(context_arr)) if len(context) > MAX_turn: context = context[-MAX_turn:] conversation.append(context) all_turn.append(turns) all_speaker.append(speaker) replies.append(a_utt) context.append(a_utt) turns.append(utter_n) speaker.append(this_speaker) utter_n += 1 old_id = new_id last_speaker = this_speaker filename=args.outdir +'/'+ 'conv-'+indicator+'_v'+args.version+'.pt' data = {'context':conversation, 'replies':replies, 'speaker':all_speaker, 'conv_turns':all_turn} torch.save(data, filename) filename2=args.outdir +'/'+ 'conv-'+indicator+'_v'+args.version+'_debug.pt' data_debug = {'context':conversation[:200], 'replies':replies[:200], 'speaker':all_speaker[:200], 'conv_turns':all_turn[:200]} torch.save(data_debug, filename2) print('In total {} conversations'.format(conv_n)) print('Built {} seq-to-seq pairs'.format(pairn)) print('==simple data stats: ==') print('Context: ') hist, bin_edges = np.histogram(context_stats, bins=5) print('length ranges of: ') print(bin_edges) print('Counts of context: ') print(hist) print('Replies: ') hist, bin_edges = np.histogram(Autt_stats, bins=5) print('length ranges of: ') print(bin_edges) print('Counts of replies: ') print(hist) print('File saved to: {}'.format(filename)) #return pairs def main (): parser = argparse.ArgumentParser(description='process from raw data for seq2seq training') parser.add_argument('-indir', default='/D/home/lili/mnt/DATA/convaws/dialogue_csv', type=str, help='location of the file, e.g awsnas') parser.add_argument('-outdir', default='/D/home/lili/mnt/DATA/convaws/convdata', type=str, help='location of the file, e.g awsnas') parser.add_argument('--files', default=[], nargs='+', type=str, help='name of files to process') parser.add_argument('--version', default='', type=str, help='version of the file') args = parser.parse_args() print(args.files) for file in args.files: filein = args.indir+'/'+str(file) #indicator = file.split('_')[0] #fileout = args.dir+indicator+'_v'+args.version dff= load_conversations(filein) conversation_save(dff, file, args) if __name__ == '__main__': sys.exit (main ())
996,462
fb981aea379bca73f7dcf5f23ff75c964f8e49c0
#!/usr/bin/env python # coding=utf-8 import pytesseract from PIL import Image image=Image.open('./image.jpg') vcode =pytesseract.image_to_string(image) print (vcode)
996,463
d0d65d2717f6ffeee17c6588f461b2fcf6798823
MAX = 10006 _data = [0] * MAX pos = 0 def push(val): global pos if pos >= MAX: return _data[pos] = val pos += 1 def pop(): global pos if pos <= 0: return -1 pos -= 1 val = _data[pos] return val def size(): return pos def top(): if pos <= 0: return -1 return _data[pos-1] def empty(): if pos == 0: return 1 return 0 n = int(input()) while n > 0: string = input() cmd = string.split() if cmd[0] == 'push': push(cmd[1]) elif cmd[0] == "top": print(top()) elif cmd[0] == "empty": print(empty()) elif cmd[0] == "pop": print(pop()) elif cmd[0] == "size": print(size()) n -= 1
996,464
e32d7d60bdc5328090431478a62b73211aed4d00
import os from PIL import Image, ImageDraw, ImageFont WATERMARK_POSITION = ( "top left", "top right", "center", "bottom left", "bottom right", ) class CustomImage: """The CustomImage class implements the image watermark operation. Attributes: **image** *(Image)*: The image object from PIL. **width** *(int)*: The width of the image. **height** *(int)*: The height of the image. **path** *(str)*: The path of the image. **margin** *(int)*: The margin between the image border and the watermark. **output_path** *(str)*: The path of the watermarked image. """ def __init__(self, path, margin=25, folder="output"): """The constructor of the custom image object. :param path: The path of the image file. :param margin: The margin between the image border and the watermark. :param folder: The name of the output folder. :type path: str :type margin: int :type folder: str """ self.image = Image.open(path) self.width, self.height = self.image.size self.path = path self.margin = margin self.output_path = os.path.join(os.path.dirname(self.path), folder, os.path.basename(self.path)) def watermark_text(self, text, color, font_type, font_size, pos_name): """Write text on the image. :param text: The text to write on the image. :param color: The color of the text. :param font_type: The font type of the text. :param font_size: The font size of the text. :param pos_name: The position name of the text. :type text: str :type color: (int, int, int) :type font_type: str :type font_size: int :type pos_name: str :return: True if the path of the reduced image exists else False. :rtype: bool """ image = Image.open(self.path) drawing = ImageDraw.Draw(image) text = text font = ImageFont.truetype(font_type, font_size) self.watermark_width, self.watermark_height = drawing.textsize(text, font) pos = self.watermark_position(pos_name) drawing.text(pos, text, fill=color, font=font) parent_dir = os.path.dirname(self.output_path) if not os.path.exists(parent_dir): os.makedirs(parent_dir) image.save(self.output_path) return os.path.exists(self.output_path) def watermark_image(self, watermark_path, pos_name): """Add an image watermark on the image. Supports only PNG and JPG files. :param watermark_path: The path of the image watermark. :param pos_name: The position name of the image watermark. :type watermark_path: str :type pos_name: str :return: True if the path of the reduced image exists else False. :rtype: bool """ image = Image.open(self.path) watermark = Image.open(watermark_path) self.watermark_width, self.watermark_height = watermark.size pos = self.watermark_position(pos_name) parent_dir = os.path.dirname(self.output_path) if not os.path.exists(parent_dir): os.makedirs(parent_dir) watermark_ext = os.path.splitext(watermark_path)[-1] if watermark_ext in (".png", ".PNG"): transparent = Image.new('RGBA', (self.width, self.height), (0, 0, 0, 0)) transparent.paste(image, (0, 0)) transparent.paste(watermark, pos, mask=watermark) self.output_path = ".".join([os.path.splitext(self.output_path)[0], "png"]) transparent.save(self.output_path) elif watermark_ext in (".jpg", ".JPG", ".jpeg", ".JPEG"): image.paste(watermark, pos) image.save(self.output_path) return os.path.exists(self.output_path) def watermark_position(self, pos_name): if pos_name == "top left": return self.margin, self.margin if pos_name == "top right": return self.width - self.margin - self.watermark_width, self.margin if pos_name == "center": return (round(self.width/2) - round(self.watermark_width/2), round(self.height/2) - round(self.watermark_height/2)) if pos_name == "bottom left": return self.margin, self.height - self.margin - self.watermark_height if pos_name == "bottom right": return self.width - self.margin - self.watermark_width, self.height - self.margin - self.watermark_height if __name__ == '__main__': img1 = CustomImage("F:/Workspaces/devenv/qt_for_python/source/_sample_images/bretagne-01.jpg") # img1.watermark_text(text="My watermark", # color=(0, 0, 0), # font_type="C:/Windows/Fonts/arial.ttf", # font_size=700, # pos_name="center") img1.watermark_image(watermark_path="F:/Workspaces/devenv/qt_for_python/source/_sample_images/python.png", pos_name="center") img2 = CustomImage("F:/Workspaces/devenv/qt_for_python/source/_sample_images/bretagne-02.jpg") img2.watermark_image(watermark_path="F:/Workspaces/devenv/qt_for_python/source/_sample_images/python.jpg", pos_name="top right")
996,465
6becc2073be8b0e8b40080f1d21d12a3159583a8
import os import numpy as np import pickle import matplotlib.pyplot as plt import matplotlib def zero_pad(a, length): z = np.zeros(length) offset = len(z)//2 - len(a)//2 if offset < 0: offset = 0 z[offset:offset+len(a)] = a return z def cached(cachefile): """ A function that creates a decorator which will use "cachefile" for caching the results of the decorated function "fn". """ def decorator(fn): # define a decorator for a function "fn" def wrapped(*args, **kwargs): # define a wrapper that will finally call "fn" with all arguments # if cache exists -> load it and return its content if os.path.exists(cachefile): with open(cachefile, 'rb') as cachehandle: print("using cached result from '%s'" % cachefile) return pickle.load(cachehandle) # execute the function with all arguments passed res = fn(*args, **kwargs) # write to cache file with open(cachefile, 'wb') as cachehandle: print("saving result to cache '%s'" % cachefile) pickle.dump(res, cachehandle) return res return wrapped return decorator # return this "customized" decorator that uses "cachefile" def plot_confusion_matrix_raw(cm, title="", path=None, fileName='confusion_matrix.png'): colormap = "viridis" sc = 1/np.sum(cm, axis=1) cm_norm = sc[None].T * cm plt.figure() plt.title(title) plt.imshow(cm_norm, cmap=colormap) plt.xlabel("Predicted Label") plt.ylabel("True Label") plt.colorbar() plt.xticks(np.arange(len(cm_norm))) plt.yticks(np.arange(len(cm_norm))) cmap = matplotlib.cm.get_cmap(colormap) for x in range(len(cm_norm)): for y in range(len(cm_norm)): plt.text(x, y, "{:.2f}".format(cm_norm[y, x]), horizontalalignment='center', verticalalignment='center', fontsize=10, c=cmap(1-np.round(cm_norm[y, x])))
996,466
b35564543de5a9afcb9b650a03bb42d0e97a2cd1
# -*- coding: utf-8 -*- # Copyright 2023 Cohesity Inc. class ProtectedObjectsByEnv(object): """Implementation of the 'ProtectedObjectsByEnv' model. Number of Protected Objects by Type. Attributes: env_type (string): Environment Type. protected_count (int): Number of Protected Objects. protected_size_bytes (long|int): Size of Protected Objects. unprotected_count (int): Number of Unprotected Objects. unprotected_size_bytes (long|int): Size of Unprotected Objects. """ # Create a mapping from Model property names to API property names _names = { "env_type":'envType', "protected_count":'protectedCount', "protected_size_bytes":'protectedSizeBytes', "unprotected_count":'unprotectedCount', "unprotected_size_bytes":'unprotectedSizeBytes', } def __init__(self, env_type=None, protected_count=None, protected_size_bytes=None, unprotected_count=None, unprotected_size_bytes=None, ): """Constructor for the ProtectedObjectsByEnv class""" # Initialize members of the class self.env_type = env_type self.protected_count = protected_count self.protected_size_bytes = protected_size_bytes self.unprotected_count = unprotected_count self.unprotected_size_bytes = unprotected_size_bytes @classmethod def from_dictionary(cls, dictionary): """Creates an instance of this model from a dictionary Args: dictionary (dictionary): A dictionary representation of the object as obtained from the deserialization of the server's response. The keys MUST match property names in the API description. Returns: object: An instance of this structure class. """ if dictionary is None: return None # Extract variables from the dictionary env_type = dictionary.get('envType') protected_count = dictionary.get('protectedCount') protected_size_bytes = dictionary.get('protectedSizeBytes') unprotected_count = dictionary.get('unprotectedCount') unprotected_size_bytes = dictionary.get('unprotectedSizeBytes') # Return an object of this model return cls( env_type, protected_count, protected_size_bytes, unprotected_count, unprotected_size_bytes )
996,467
074441104bddc0bfd06538fc0ea004af9ddba05d
from matplotlib import cm, rcParams import matplotlib.pyplot as plt from matplotlib.ticker import FormatStrFormatter import numpy as np import math as math import random as rand import os import csv rcParams.update({'figure.autolayout': True}) # Button palette c = ['#aa3863', '#d97020', '#ef9f07', '#449775', '#3b7d86'] times_plot1, times_plot2 = [], [] V1_plot1, V2_plot1, V3_plot1, V4_plot1, V5_plot1 = [], [], [], [], [] V1_plot2, V2_plot2, V3_plot2, V4_plot2, V5_plot2 = [], [], [], [], [] Vth = 1 Vr = 0 fig, ax = plt.subplots(1, 2, figsize=(16,3.5), sharey='row') with open('antiphase.dat', newline='') as file: datareader = csv.reader(file, delimiter=' ') for row in datareader: if float(row[0]) <= 20 : times_plot1.append(float(row[0])) V1_plot1.append(float(row[1])) V2_plot1.append(float(row[2])) V3_plot1.append(float(row[3])) V4_plot1.append(float(row[4])) V5_plot1.append(float(row[5])) if float(row[0]) >= 180 and float(row[0]) <= 200 : times_plot2.append(float(row[0])) V1_plot2.append(float(row[1])) V2_plot2.append(float(row[2])) V3_plot2.append(float(row[3])) V4_plot2.append(float(row[4])) V5_plot2.append(float(row[5])) """ Plot 1 """ ax[0].plot(times_plot1, V1_plot1, alpha=0.75, color=c[0], linestyle='-', label='$V_1$') ax[0].plot(times_plot1, V2_plot1, alpha=0.75, color=c[1], linestyle='-', label='$V_2$') ax[0].plot(times_plot1, V3_plot1, alpha=0.75, color=c[2], linestyle='-', label='$V_3$') ax[0].plot(times_plot1, V4_plot1, alpha=0.75, color=c[3], linestyle='-', label='$V_4$') ax[0].plot(times_plot1, V5_plot1, alpha=0.75, color=c[4], linestyle='-', label='$V_5$') # A spike occurs iff there was a reset spike_times_V1 = [times_plot1[i] for i in range(1,len(V1_plot1)) if abs(V1_plot1[i]-V1_plot1[i-1]) > (Vth-Vr)/2] spike_times_V2 = [times_plot1[i] for i in range(1,len(V2_plot1)) if abs(V2_plot1[i]-V2_plot1[i-1]) > (Vth-Vr)/2] spike_times_V3 = [times_plot1[i] for i in range(1,len(V3_plot1)) if abs(V3_plot1[i]-V3_plot1[i-1]) > (Vth-Vr)/2] spike_times_V4 = [times_plot1[i] for i in range(1,len(V4_plot1)) if abs(V4_plot1[i]-V4_plot1[i-1]) > (Vth-Vr)/2] spike_times_V5 = [times_plot1[i] for i in range(1,len(V5_plot1)) if abs(V5_plot1[i]-V5_plot1[i-1]) > (Vth-Vr)/2] for t in spike_times_V1: ax[0].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[0]) for t in spike_times_V2: ax[0].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[1]) for t in spike_times_V3: ax[0].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[2]) for t in spike_times_V4: ax[0].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[3]) for t in spike_times_V5: ax[0].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[4]) """ Plot 2 """ ax[1].plot(times_plot2, V1_plot2, alpha=0.75, color=c[0], linestyle='-', label='$V_1$') ax[1].plot(times_plot2, V2_plot2, alpha=0.75, color=c[1], linestyle='-', label='$V_2$') ax[1].plot(times_plot2, V3_plot2, alpha=0.75, color=c[2], linestyle='-', label='$V_3$') ax[1].plot(times_plot2, V4_plot2, alpha=0.75, color=c[3], linestyle='-', label='$V_4$') ax[1].plot(times_plot2, V5_plot2, alpha=0.75, color=c[4], linestyle='-', label='$V_5$') # A spike occurs iff there was a reset spike_times_V1 = [times_plot2[i] for i in range(1,len(V1_plot2)) if abs(V1_plot2[i]-V1_plot2[i-1]) > (Vth-Vr)/2] spike_times_V2 = [times_plot2[i] for i in range(1,len(V2_plot2)) if abs(V2_plot2[i]-V2_plot2[i-1]) > (Vth-Vr)/2] spike_times_V3 = [times_plot2[i] for i in range(1,len(V3_plot2)) if abs(V3_plot2[i]-V3_plot2[i-1]) > (Vth-Vr)/2] spike_times_V4 = [times_plot2[i] for i in range(1,len(V4_plot2)) if abs(V4_plot2[i]-V4_plot2[i-1]) > (Vth-Vr)/2] spike_times_V5 = [times_plot2[i] for i in range(1,len(V5_plot2)) if abs(V5_plot2[i]-V5_plot2[i-1]) > (Vth-Vr)/2] for t in spike_times_V1: ax[1].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[0]) for t in spike_times_V2: ax[1].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[1]) for t in spike_times_V3: ax[1].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[2]) for t in spike_times_V4: ax[1].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[3]) for t in spike_times_V5: ax[1].plot([t, t], [Vth, Vth+0.5], alpha=0.75, color=c[4]) """ Figure Details """ ax[0].set_xlabel('Time ($10^{-2}$ seconds)', size=11) ax[1].set_xlabel('Time ($10^{-2}$ seconds)', size=11) ax[0].set_ylabel('Voltage $V_k, k \in \{1,..,5\}$', size=11) fig.suptitle('Network of 5 electrically coupled neurons, $\\beta=0.1$ and $\gamma=0.1$', size=15) ax[1].legend(loc='upper right') #bbox_to_anchor=(1, 1) plt.tight_layout() plt.savefig('5_neurons_anti.svg') plt.show()
996,468
c6c7b4e5ffc7955ad1ceb77f6c6e9be268af66b9
import logging import pytest from kale.evaluate.uncertainty_metrics import evaluate_bounds, evaluate_jaccard from kale.prepdata.tabular_transform import generate_struct_for_qbin # from kale.utils.download import download_file_by_url from kale.utils.seed import set_seed # import os LOGGER = logging.getLogger(__name__) seed = 36 set_seed(seed) ERRORS = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10] UNCERTAINTIES = [0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1] @pytest.fixture(scope="module") def dummy_test_preds(landmark_uncertainty_tuples_path): bins_all_targets, bins_targets_sep, bounds_all_targets, bounds_targets_sep = generate_struct_for_qbin( ["U-NET"], [0, 1], landmark_uncertainty_tuples_path[2], "SA" ) return bins_all_targets, bounds_all_targets class TestEvaluateJaccard: # Using one uncertainty type, test numerous bins @pytest.mark.parametrize("num_bins", [2, 3, 4, 5]) def test_one_uncertainty(self, dummy_test_preds, num_bins): jacc_dict = evaluate_jaccard( dummy_test_preds[0], [["S-MHA", "S-MHA Error", "S-MHA Uncertainty"]], num_bins, [0, 1], num_folds=8 ) all_jaccard_data = jacc_dict["Jaccard All"] all_jaccard_bins_targets_sep = jacc_dict["Jaccard targets seperated"] assert list(all_jaccard_data.keys()) == ["U-NET S-MHA"] assert len(all_jaccard_data["U-NET S-MHA"]) == num_bins assert list(all_jaccard_bins_targets_sep.keys()) == ["U-NET S-MHA"] assert len(all_jaccard_bins_targets_sep["U-NET S-MHA"]) == num_bins assert ( len(all_jaccard_bins_targets_sep["U-NET S-MHA"][0]) == 8 * 2 ) # because each landmark has 8 folds - they are seperate def test_one_fold(self, dummy_test_preds): jacc_dict = evaluate_jaccard( dummy_test_preds[0], [["S-MHA", "S-MHA Error", "S-MHA Uncertainty"]], 5, [0, 1], num_folds=1 ) all_jaccard_data = jacc_dict["Jaccard All"] all_jaccard_bins_targets_sep = jacc_dict["Jaccard targets seperated"] assert list(all_jaccard_data.keys()) == ["U-NET S-MHA"] assert len(all_jaccard_data["U-NET S-MHA"]) == 5 assert list(all_jaccard_bins_targets_sep.keys()) == ["U-NET S-MHA"] assert len(all_jaccard_bins_targets_sep["U-NET S-MHA"]) == 5 assert ( len(all_jaccard_bins_targets_sep["U-NET S-MHA"][0]) == 2 ) # because each landmark has 1 folds - they are sep def test_multiple_uncerts(self, dummy_test_preds): jacc_dict = evaluate_jaccard( dummy_test_preds[0], [["S-MHA", "S-MHA Error", "S-MHA Uncertainty"], ["E-MHA", "E-MHA Error", "E-MHA Uncertainty"]], 5, [0, 1], num_folds=1, ) all_jaccard_data = jacc_dict["Jaccard All"] all_jaccard_bins_targets_sep = jacc_dict["Jaccard targets seperated"] assert list(all_jaccard_data.keys()) == ["U-NET S-MHA", "U-NET E-MHA"] assert len(all_jaccard_data["U-NET S-MHA"]) == len(all_jaccard_data["U-NET E-MHA"]) == 5 assert list(all_jaccard_bins_targets_sep.keys()) == ["U-NET S-MHA", "U-NET E-MHA"] assert len(all_jaccard_bins_targets_sep["U-NET S-MHA"]) == len(all_jaccard_bins_targets_sep["U-NET E-MHA"]) == 5 assert ( len(all_jaccard_bins_targets_sep["U-NET S-MHA"][0]) == len(all_jaccard_bins_targets_sep["U-NET E-MHA"][0]) == 2 ) # because each landmark has 8 folds - they are sep class TestEvaluateBounds: @pytest.mark.parametrize("num_bins", [2, 3, 4, 5]) def test_one_uncertainty(self, dummy_test_preds, num_bins): bound_dict = evaluate_bounds( dummy_test_preds[1], dummy_test_preds[0], [["S-MHA", "S-MHA Error", "S-MHA Uncertainty"]], num_bins, [0, 1], num_folds=8, ) all_bound_percents = bound_dict["Error Bounds All"] all_bound_percents_notargetsep = bound_dict["all_bound_percents_notargetsep"] assert list(all_bound_percents.keys()) == ["U-NET S-MHA"] assert len(all_bound_percents["U-NET S-MHA"]) == num_bins assert list(all_bound_percents_notargetsep.keys()) == ["U-NET S-MHA"] assert len(all_bound_percents_notargetsep["U-NET S-MHA"]) == num_bins assert ( len(all_bound_percents_notargetsep["U-NET S-MHA"][0]) == 8 * 2 ) # because each landmark has 8 folds - they are seperate def test_one_fold(self, dummy_test_preds): bound_dict = evaluate_bounds( dummy_test_preds[1], dummy_test_preds[0], [["S-MHA", "S-MHA Error", "S-MHA Uncertainty"]], 5, [0, 1], num_folds=1, ) all_bound_percents = bound_dict["Error Bounds All"] all_bound_percents_notargetsep = bound_dict["all_bound_percents_notargetsep"] assert list(all_bound_percents.keys()) == ["U-NET S-MHA"] assert len(all_bound_percents["U-NET S-MHA"]) == 5 assert list(all_bound_percents_notargetsep.keys()) == ["U-NET S-MHA"] assert len(all_bound_percents_notargetsep["U-NET S-MHA"]) == 5 assert ( len(all_bound_percents_notargetsep["U-NET S-MHA"][0]) == 2 ) # because each landmark has 1 folds - they are sep def test_multiple_uncerts(self, dummy_test_preds): bound_dict = evaluate_bounds( dummy_test_preds[1], dummy_test_preds[0], [["S-MHA", "S-MHA Error", "S-MHA Uncertainty"], ["E-MHA", "E-MHA Error", "E-MHA Uncertainty"]], 5, [0, 1], num_folds=8, ) all_bound_percents = bound_dict["Error Bounds All"] all_bound_percents_notargetsep = bound_dict["all_bound_percents_notargetsep"] assert list(all_bound_percents.keys()) == ["U-NET S-MHA", "U-NET E-MHA"] assert len(all_bound_percents["U-NET S-MHA"]) == len(all_bound_percents["U-NET E-MHA"]) == 5 assert list(all_bound_percents_notargetsep.keys()) == ["U-NET S-MHA", "U-NET E-MHA"] assert ( len(all_bound_percents_notargetsep["U-NET S-MHA"]) == len(all_bound_percents_notargetsep["U-NET E-MHA"]) == 5 ) assert ( len(all_bound_percents_notargetsep["U-NET S-MHA"][0]) == len(all_bound_percents_notargetsep["U-NET E-MHA"][0]) == 8 * 2 ) # because each landmark has 8 folds - they are sep
996,469
ca08a5357cd71b0a045c3abcce418950c921aa62
# Functions for co-reference resolution # Called by create_narrative_turtle.py import uuid import re from typing import Union import word2number as w2n from dna.create_noun_turtle import create_noun_ttl from dna.database import query_database from dna.get_ontology_mapping import get_agent_or_loc_class, get_noun_mapping from dna.nlp import get_head_word from dna.queries import query_specific_noun from dna.utilities_and_language_specific import dna_prefix, empty_string, family_members, female_titles, \ male_titles, names_to_geo_dict, ontologies_database, owl_thing2, personal_pronouns, space, underscore def _account_for_cardinal_noun(elem_dict: dict, phrase: str, cardinal: str, alet_dict: dict, last_nouns: list, last_events: list, turtle: list, ext_sources: bool) -> tuple: """ Get the semantics/mapping for the object of a prepositional phrase associated with a cardinal number, such as "one of the band". :param elem_dict: The dictionary (holding the details for the noun/verb containing the cardinal text) :param phrase: The full text of the noun phrase :param cardinal: The text of the cardinal :param alet_dict: A dictionary holding the agents, locations, events & times encountered in the full narrative - For co-reference resolution; Keys = 'agents', 'locs', 'events', 'times' and Values vary by the key :param last_nouns: An array of tuples of noun texts, types, class mappings and IRIs, found in the narrative :param last_events: An array of verb texts, mappings and IRIs from the current paragraph :param turtle: A list of Turtle statements which will be updated in this function if a new noun is found :param ext_sources: A boolean indicating that data from GeoNames, Wikidata, etc. should be added to the parse results if available :return: A tuple of the resulting noun phrase's text, spaCy type, mappings and IRI; Also, the Turtle is likely updated """ # noinspection PyBroadException try: card_number = w2n.word_to_num(cardinal) except Exception: card_number = 1 # TODO: Improve default # Evaluate the object of any preposition related to the cardinal; Future: Need to handle > 1 prep? prep_text = elem_dict['preps'][0]['prep_details'][0]['detail_text'] prep_type = elem_dict['preps'][0]['prep_details'][0]['detail_type'] if card_number < 2: # Account for the cardinality prep_type = prep_type.replace('PLURAL', 'SING') # Get the noun info for the prepositional object prep_ttl = [] # check_nouns result = an array of tuples of the noun's texts, types, mappings and IRIs result = check_nouns({'objects': [{'object_text': prep_text, 'object_type': prep_type}]}, 'objects', alet_dict, last_nouns, last_events, prep_ttl, ext_sources)[0] # Should only need 1 # Adjust the label to reflect the text with the cardinal, and add the stmts to the current elem_dict's Turtle for ttl_stmt in prep_ttl: if 'rdfs:label' in ttl_stmt: turtle.append(f'{ttl_stmt.split(" rdfs:label")[0]} rdfs:label "{phrase}" .') else: turtle.append(ttl_stmt) return phrase, prep_type, result[2], result[3] # Return the mapping and IRI def _check_alet_dict(text: str, text_type: str, alet_dict: dict, last_nouns: list) -> (list, str): """ Get the most likely co-reference for the text using the alet_dict details to resolve co-references/anaphora. Subject/object information (the noun, and its types and IRI) is returned. The acronym, alet, stands for agent-location-event-time. :param text: String holding the noun text :param text_type: String holding the noun type (such as 'FEMALESINGPERSON') :param alet_dict: A dictionary holding the agents, locations, events & times encountered in the full narrative - For co-reference resolution; Keys = 'agents', 'locs', 'events', 'times' and Values vary by the key :param last_nouns: An array of tuples of noun texts, types, mappings and IRI, from the narrative :return: A tuple that consists of the matched noun's class mappings and IRI, or an empty array and string """ agent_match = [] # Match of text and type agent_text_match = [] # Match of text only, not type loc_text_match = [] event_text_match = [] if not text_type or 'PERSON' in text_type or text_type.endswith('ORG') or \ text_type.endswith('GPE') or text_type.endswith('NORP') or text_type.endswith('NOUN'): agent_arrays = alet_dict['agents'] if 'agents' in alet_dict else [] for agent_array in agent_arrays: alt_names = agent_array[0] agent_type = agent_array[1] if text not in personal_pronouns and text in alt_names: if text_type and (text_type in agent_type or agent_type in text_type): agent_match.append((agent_type, agent_array[2])) # index 2 holds the IRI break else: agent_text_match.append((agent_type, agent_array[2])) if not text_type or 'LOC' in text_type or 'GPE' in text_type or 'FAC' in text_type or 'NOUN' in text_type: loc_arrays = alet_dict['locs'] if 'locs' in alet_dict else [] for loc_array in loc_arrays: alt_names = loc_array[0] loc_map = loc_array[1] if text in alt_names: loc_text_match.append((loc_map, loc_array[2])) # index 2 holds the IRI if not text_type or 'EVENT' in text_type or 'NOUN' in text_type: event_arrays = alet_dict['events'] if 'events' in alet_dict else [] for event_array in event_arrays: alt_names = event_array[0] if text in alt_names: # event_array[1] holds the class mappings and [2] holds the IRI event_text_match.append((event_array[1], event_array[2])) return (_update_last_nouns(text, agent_match[-1][0], agent_match[-1][1], [get_agent_or_loc_class(text_type)], last_nouns) if agent_match else (_update_last_nouns(text, agent_text_match[-1][0], agent_text_match[-1][1], [get_agent_or_loc_class(text_type)], last_nouns) if agent_text_match else (_update_last_nouns(text, text_type, loc_text_match[-1][1], loc_text_match[-1][0], last_nouns) if loc_text_match else (_update_last_nouns(text, text_type, event_text_match[-1][1], event_text_match[-1][0], last_nouns) if event_text_match else [], empty_string)))) def _check_criteria(text: str, last_nouns: list, looking_for_singular: Union[bool, None], looking_for_female: Union[bool, None], looking_for_person: bool) -> list: """ Checks the values of the nouns in the last_nouns array for matches of the specified gender/number criteria. :param text: A string with the noun text :param last_nouns: A list of noun texts, types, class mappings and IRIs, from the narrative :param looking_for_singular: Boolean indicating that a singular noun is needed :param looking_for_female: Boolean indicating that a female gender noun is needed :param looking_for_person: Boolean indicating that a 'matched' noun should be a person :return: Array of tuples of texts, types, class_mappings and IRIs of already processed nouns that match the criteria; Note that an array is returned to support matching the pronouns 'they'/'them' """ poss_nouns = [] alt_nouns = [] # Fallback nouns that do not exactly match the criteria but are 'last resort' for noun_tuple in reversed(last_nouns): noun_text, noun_type, noun_mapping, noun_iri = noun_tuple if noun_text == 'new_line': # new_line marks a paragraph boundary; Keep going if no match has been found if poss_nouns or alt_nouns: break else: continue # Pronoun text already lower case, but may be called with other text such as 'Her father' if text not in personal_pronouns and (text.lower() not in noun_text.lower() or noun_text.lower() not in text.lower()): continue # First match the text if not a pronoun; If no match, skip the rest of the criteria if (looking_for_person and 'PERSON' not in noun_type) or \ (not looking_for_person and 'PERSON' in noun_type): continue # Check number found_number = False if looking_for_singular is None or (looking_for_singular and 'SING' in noun_type) or \ (not looking_for_singular and 'PLURAL' in noun_type): found_number = True found_gender = False if looking_for_female is None or (looking_for_female and 'FEMALE' in noun_type) or \ (not looking_for_female and 'FEMALE' not in noun_type and 'MALE' in noun_type): found_gender = True # Check criteria if found_gender and found_number: poss_nouns.append(noun_tuple) elif found_gender or found_number: alt_nouns.append(noun_tuple) if poss_nouns: return [poss_nouns[0]] if looking_for_singular else poss_nouns elif alt_nouns: return [alt_nouns[0]] if looking_for_singular else alt_nouns return [] def _check_last_nouns(text: str, text_type: str, last_nouns: list) -> list: """ Get the most likely co-reference for the noun text using the last_nouns details. Subject/object information (the noun, and its type, mapping and IRI) is returned. :param text: String holding the noun text :param text_type: String holding the noun type (such as 'FEMALESINGPERSON') :param last_nouns: An array of tuples of noun texts, types, mappings and IRI, from the narrative :return: A tuple that is the 'matched' noun mapping and IRI, or two empty strings (if no match is found) """ looking_for_female = True if 'FEMALE' in text_type else (False if 'MALE' in text_type else None) looking_for_singular = False if 'PLURAL' in text_type else (True if 'SING' in text_type else None) looking_for_person = True if 'PERSON' in text_type else False match_nouns = _check_criteria(text, last_nouns, looking_for_singular, looking_for_female, looking_for_person) final_nouns = [] for match_noun in match_nouns: # Don't need the noun texts or entity types (those are used for pronouns) final_nouns.append((match_noun[2], match_noun[3])) return final_nouns def _check_personal_pronouns(pronoun: str, last_nouns: list) -> list: """ Get the most likely co-reference(s) for the pronoun using the last_nouns details. Subject/object information (the noun, and its types, mappings and IRI) is returned. :param pronoun: String holding the pronoun text :param last_nouns: An array of tuples of noun texts, types, mappings and IRI, from the narrative :return: Array of tuples of text, spaCy type, class_mappings and IRIs of already processed nouns that match the criteria; Note that an array is returned to support matching the pronouns 'they'/'them' """ pronoun_details = [] pronoun_lower = pronoun.lower() if pronoun == 'I' or pronoun_lower in ('me', 'myself', 'my'): pronoun_details.append(('Narrator', 'SINGPERSON', ':Person', ':Narrator')) elif pronoun_lower in ('we', 'us', 'ourselves', 'our'): # Find singular or plural person nouns (any gender) pronoun_details.extend(_check_criteria(pronoun_lower, last_nouns, None, None, True)) pronoun_details.append(('Narrator', 'SINGPERSON', ':Person', ':Narrator')) elif pronoun_lower in ('they', 'them', 'themselves', 'their'): # Give preference to persons (any gender or number) noun_list = _check_criteria(pronoun_lower, last_nouns, None, None, True) if noun_list: pronoun_details.extend(noun_list) else: # Check for non-persons pronoun_details.extend(_check_criteria(pronoun_lower, last_nouns, None, None, False)) elif pronoun_lower in ('she', 'herself', 'her'): # Find singular, feminine, person nouns pronoun_details.extend(_check_criteria(pronoun_lower, last_nouns, True, True, True)) elif pronoun_lower in ('he', 'himself', 'him'): # Find singular, masculine, person nouns pronoun_details.extend(_check_criteria(pronoun_lower, last_nouns, True, False, True)) elif pronoun_lower in ('it', 'itself', 'its'): # Find singular, non-person nouns (no gender) pronoun_details.extend(_check_criteria(pronoun_lower, last_nouns, True, None, False)) final_details = [] # May be duplicates in the list due to duplicates in last_nouns for pronoun_detail in pronoun_details: if pronoun_detail in final_details: continue final_details.append(pronoun_detail) return final_details def _process_family_role(head_text: str, full_text: str, person_type: str, alet_dict: dict) -> tuple: """ Return the noun information for individual(s) in a family role. :param head_text: String holding the full text's head word's text :param full_text: String holding the full text :param person_type: String holding the noun type from spaCy (such as 'FEMALESINGPERSON') :param alet_dict: A dictionary holding the agents, locations, events & times encountered in the full narrative; Keys = 'agents', 'locs', 'events' and 'times; Only concerned with the values for 'agents' in this function (which are an array of arrays with index 0 holding an array of labels associated with the agent (variations on their name), index 1 storing the agent's entity type and index 2 storing the agent's IRI :return: A tuple holding the text, spaCy type, class_mappings and an IRI for family members in the specified role """ if 'agents' not in alet_dict: # Nothing to check return tuple() role_matches = [] if head_text in family_members.keys(): # Looking for singular family role for alet in alet_dict['agents']: alet_names, alet_type, alet_iri = alet if f'_{head_text}' in alet_iri: role_matches.append((full_text, person_type, [':Person'], alet_iri)) if len(role_matches) == 1: return role_matches[0] # TODO: Handle family role plurals # No match or multiple matches found return tuple() def _remove_title_from_name(titles: tuple, text: str) -> str: """ Check for a male/female title (such as 'Ms' or 'Mr') in the noun string, and if present, remove it. :param titles: Tuple of male or female titles :param text: String holding the noun text :return: The updated text with the title removed (if present) or the original text """ for title in titles: if f'{title}.' in text: return text.replace(f'{title}.', empty_string).replace(' ', space).strip() elif title in text: return text.replace(title, empty_string).replace(' ', space).strip() return text def _separate_possessives(text: str) -> (dict, str): """ If a noun text contains a possessive reference, separate it out, since proper noun processing will override the details of the noun. :param text: String holding the noun text :return: A tuple with a dictionary holding the noun to which a possessive is a modifier (the noun is the key, and the possessive is the value; this is a dictionary since a clause may have more than 1 possessive), and a string with the possessive(s) removed from the noun text """ possessive_dict = dict() # Dictionary of nouns (keys) with their possessive modifiers (values) revised_words = [] if '/poss/' in text: space_splits = text.split() for index in range(0, len(space_splits)): if '/poss/' in space_splits[index]: possessive_dict[space_splits[index + 1]] = space_splits[index].replace('/poss/', empty_string) else: revised_words.append(space_splits[index]) return possessive_dict, space.join(revised_words) return possessive_dict, text def _update_last_nouns(text: str, text_type: str, text_iri: str, class_maps: list, last_nouns: list) -> (list, str): """ Update the last_nouns array and return the class mappings and IRI. :param text: String holding the noun text :param text_type: String holding the noun type (such as 'FEMALESINGPERSON') :param text_iri: String holding the noun IRI :param class_maps: An array of strings holding the mapping(s) to the DNA ontology for the text :param last_nouns: An array of tuples of noun texts, types, mappings and IRI, from the narrative :return: A tuple that consists of the matched noun's class mappings and IRI, or an empty array and string """ last_nouns.append((text, text_type, class_maps, text_iri)) return class_maps, text_iri def check_event(text: str, last_events: list) -> (list, str): """ Get a possible verb/event mapping for the noun and check it against any events (from the current paragraph) that have a type = mapping. :param text: The text which is possibly mapped to an event :param last_events: The list/array of tuples defining event types and IRIs from the current paragraph :return: A tuple specifying the event class mappings and IRI if there is a type match, or an empty list and string otherwise """ # Get the event class to which the noun may be mapped ontol_classes, noun_ttl = get_noun_mapping(text, empty_string, False) if not ontol_classes: return [], empty_string poss_events = [] for event_type, event_iri in last_events: if event_type in ontol_classes: poss_events.append(event_iri) if poss_events: return ontol_classes, poss_events[-1] return [], empty_string def check_nouns(elem_dictionary: dict, key: str, alet_dict: dict, last_nouns: list, last_events: list, turtle: list, ext_sources: bool) -> list: """ Get the subject or object nouns (as indicated by the key input parameter) in the dictionary, using last_nouns, alet_dict and last_events details to attempt to resolve co-references/anaphora. Subject/object information (the nouns and their types and IRIs) is returned. The order of checking for a match is last_nouns, alet_dict and then last_events. If there are no matches, a new noun is created and added to either last_nouns or last_events. The acronym, alet, stands for agent-location-event-time. For example, consider the sentence/chunk "She was sickly." following "Mary was born on June 12, 1972, in Znojmo, Czechia." If the function parameters are (chunk_dictionary, 'subjects', alet_dict, last_events), then the tuple, 'Mary', 'FEMALESINGPERSON' and ':Mary' will be returned since 'she' should be resolved to Mary. :param elem_dictionary: The dictionary (holding the details for the noun text and type from the spaCy parse) :param key: Either 'subjects' or 'objects' :param alet_dict: A dictionary holding the agents, locations, events & times encountered in the full narrative - For co-reference resolution; Keys = 'agents', 'locs', 'events', 'times' and Values vary by the key :param last_nouns: An array of tuples of noun texts, types, class mappings and IRIs, found in the narrative :param last_events: An array of verb texts, mappings and IRIs from the current paragraph :param turtle: A list of Turtle statements which will be updated in this function if a new noun is found :param ext_sources: A boolean indicating that data from GeoNames, Wikidata, etc. should be added to the parse results if available :return: An array of tuples of the noun's texts, types, mappings and IRIs (also, the last_nouns and last_events arrays may be updated) """ nouns = [] for elem in elem_dictionary[key]: # The subject or object nouns elem_key = key[0:-1] # Create dictionary key = 'subject' or 'object' elem_type = elem[f'{elem_key}_type'] elem_text = elem[f'{elem_key}_text'] # Get rid of titles (such as Ms, Miss, Mr, ...) if 'FEMALE' in elem_type: elem_text = _remove_title_from_name(female_titles, elem_text) elif 'MALE' in elem_type: elem_text = _remove_title_from_name(male_titles, elem_text) head_lemma, head_text = get_head_word(elem_text) # poss_dict = Dictionary of nouns (keys) with their possessive modifiers (values) # Revised elem_text = noun text with possessives removed poss_dict, elem_text = _separate_possessives(elem_text) new_tuple = tuple() possible_name = empty_string # For a proper name, may contain shortened form = given + surname (any order) if elem_type == 'CARDINAL': # For example, 'one' in 'he has one' or in 'one of the band' if 'preps' in elem: new_tuple = _account_for_cardinal_noun(elem, elem_text, head_lemma, alet_dict, last_nouns, last_events, turtle, ext_sources) else: iri = re.sub(r'[^:a-zA-Z0-9_]', '_', f':{elem_text}_{str(uuid.uuid4())[:13]}').replace('__', '_') new_tuple = (elem_text, 'CARDINAL', [owl_thing2], iri) turtle.extend([f'{iri} a owl:Thing .', f'{iri} rdfs:label "{elem_text}" .']) elif elem_text.lower() in personal_pronouns: # Array of tuples of matched text, type, mappings and IRIs new_tuples = _check_personal_pronouns(elem_text, last_nouns) nouns.extend(new_tuples) last_nouns.extend(new_tuples) continue # More than 1 new tuple, so handled specifically in this code block; No need to 'drop through' # Not a pronoun; Check for a match in instances of the ontology elif ('PERSON' in elem_type or elem_type.endswith('GPE') or elem_type.endswith('ORG') or elem_type.endswith('NORP')): if space in head_lemma: # Get last two words in the name (for given+surname or surname+given name, Eastern or Western ordering) names = head_lemma.split(space) possible_name = f'{names[-2]} {names[-1]}' match_iri, match_type = check_specific_match(head_lemma, elem_type) if not match_iri and possible_name: match_iri, match_type = check_specific_match(possible_name, elem_type) if match_iri: new_tuple = (elem_text, elem_type, match_type, match_iri) else: # Check for family role and match to a name new_tuple = _process_family_role(head_text, elem_text, elem_type, alet_dict) if not new_tuple: # No match - Try to match text and type in last_nouns match_noun_tuples = _check_last_nouns(elem_text, elem_type, last_nouns) if match_noun_tuples: new_tuple = (elem_text, elem_type, match_noun_tuples[0][0], match_noun_tuples[0][1]) elif possible_name: # Also check given + surname match_noun_tuples = _check_last_nouns(possible_name, elem_type, last_nouns) if match_noun_tuples: new_tuple = (possible_name, elem_type, match_noun_tuples[0][0], match_noun_tuples[0][1]) if not new_tuple: # No match - Try to match text and type in alet_dict match_maps, match_iri = _check_alet_dict(elem_text, elem_type, alet_dict, last_nouns) # Updates last nouns if match_iri: new_tuple = (elem_text, elem_type, match_maps, match_iri) elif possible_name: # Also check given + surname match_maps, match_iri = _check_alet_dict(possible_name, elem_type, alet_dict, last_nouns) if match_iri: new_tuple = (possible_name, elem_type, match_maps, match_iri) if not new_tuple: # No match - Check if the noun is aligned with an event that has already been described event_classes, event_iri = check_event(elem_text, last_events) if event_iri: new_tuple = (elem_text, elem_type, event_classes, event_iri) if not new_tuple: # No match - Create new entity iri = re.sub(r'[^:a-zA-Z0-9_]', underscore, f':{elem_text.lower()}_{str(uuid.uuid4())[:13]}').\ replace('__', '_') noun_mappings, noun_turtle = create_noun_ttl(iri, elem_text, elem_type, alet_dict, ext_sources) new_tuple = (elem_text, elem_type, noun_mappings, iri) turtle.extend(noun_turtle) nouns.append(new_tuple) last_nouns.append(new_tuple) return nouns def check_specific_match(noun: str, noun_type: str) -> (str, str): """ Checks if the concept/Agent/Location/... is already defined in the DNA ontologies. :param noun: String holding the text to be matched :param noun_type: String holding the noun type (PERSON/GPE/LOC/...) from spacy's NER :return: A tuple consisting of the matched IRI and its class mapping (if a match is found), or two empty strings """ if noun_type.endswith('GPE') and noun in names_to_geo_dict: return f'geo:{names_to_geo_dict[noun]}', ':Country' class_type = get_agent_or_loc_class(noun_type).replace('+:Collection', empty_string) # PLURAL details ignored here match_details = query_database( 'select', query_specific_noun.replace('keyword', noun).replace('class_type', class_type), ontologies_database) if len(match_details) > 0: return match_details[0]['iri']['value'].replace(dna_prefix, ':'), match_details[0]['type']['value'] return empty_string, empty_string
996,470
b78520ac7a60efc06f5b38a47f7449df544b109e
import os Import('env lib') # boost libraries may be named differently BOOST_LIBS = ['boost_system','boost_date_time','boost_program_options','boost_filesystem'] if hasattr(os,'uname') and os.uname()[0] == 'Darwin': BOOST_LIBS = [x + "-mt" for x in BOOST_LIBS] # clone environment and add libraries for modules menv = env.Clone() menv.Append(CPPPATH=['#'], LIBS=['jack','samplerate','hdf5','hdf5_hl','sndfile','zmq','pthread'] + BOOST_LIBS, ) programs = {'jdelay' : ['jdelay.cc'], 'jdetect' : ['jdetect.cc'], 'jstim' : ['jstim.cc'], 'jrecord' : ['jrecord.cc'], 'jclicker' : ['jclicker.cc'], 'jmonitor' : ['monitor_client.c'], 'jfilter' : ['jfilter.cc'], 'jflip' : ['jflip.cc'] } out = [] for progname,srcs in programs.items(): prog = menv.Program(progname,srcs+[lib]) menv.Alias(progname,prog) out.append(prog) env.Alias('install', env.Install(env['BINDIR'],prog)) env.Alias('modules',out)
996,471
c02da3824e59a4e3b6590e0150e83cade351b2d8
''' desispec.image ============== Lightweight wrapper class for preprocessed image data. ''' import copy import numpy as np from desispec.maskbits import ccdmask from desispec import util class Image(object): def __init__(self, pix, ivar, mask=None, readnoise=0.0, camera='unknown', meta=None): """ Create Image object Args: pix : 2D numpy.ndarray of image pixels Optional: ivar : inverse variance of pix, same shape as pix mask : 0 is good, non-0 is bad; default is (ivar==0) readnoise : CCD readout noise in electrons/pixel (float) camera : e.g. 'b0', 'r1', 'z9' meta : dict-like metadata key/values, e.g. from FITS header """ if pix.ndim != 2: raise ValueError('pix must be 2D, not {}D'.format(pix.ndim)) if pix.shape != ivar.shape: raise ValueError('pix.shape{} != ivar.shape{}'.format(pix.shape, ivar.shape)) if (mask is not None) and (pix.shape != mask.shape): raise ValueError('pix.shape{} != mask.shape{}'.format(pix.shape, mask.shape)) self.pix = pix self.ivar = ivar self.meta = meta if mask is not None: self.mask = util.mask32(mask) else: self.mask = np.zeros(self.ivar.shape, dtype=np.uint32) self.mask[self.ivar == 0] |= ccdmask.BAD #- Optional parameters self.readnoise = readnoise self.camera = camera #- Allow image slicing def __getitem__(self, xyslice): #- Slices must be a slice object, or a tuple of (slice, slice) if isinstance(xyslice, slice): pass #- valid slice elif isinstance(xyslice, tuple): #- tuples of (slice, slice) are valid if len(xyslice) > 2: raise ValueError('Must slice in 1D or 2D, not {}D'.format(len(xyslice))) else: if not isinstance(xyslice[0], slice) or \ not isinstance(xyslice[1], slice): raise ValueError('Invalid slice for Image objects') else: raise ValueError('Invalid slice for Image objects') pix = self.pix[xyslice] ivar = self.ivar[xyslice] mask = self.mask[xyslice] meta = copy.copy(self.meta) if np.isscalar(self.readnoise): readnoise = self.readnoise else: readnoise = self.readnoise[xyslice] #- NAXIS1 = x, NAXIS2 = y; python slices[y,x] = [NAXIS2, NAXIS1] if meta is not None and (('NAXIS1' in meta) or ('NAXIS2' in meta)): #- image[a:b] instead of image[a:b, c:d] if isinstance(xyslice, slice): ny = xyslice.stop - xyslice.start meta['NAXIS2'] = ny else: slicey, slicex = xyslice #- slices ranges could be None if using : instead of a:b if (slicex.stop is not None): nx = slicex.stop - slicex.start meta['NAXIS1'] = nx if (slicey.stop is not None): ny = slicey.stop - slicey.start meta['NAXIS2'] = ny return Image(pix, ivar, mask, \ readnoise=readnoise, camera=self.camera, meta=meta)
996,472
d8e412371adb810ddc618ecefac431303ea629a4
# -*- coding: utf-8 -*- """ Created on Mon Apr 27 21:35:05 2020 @author: VICTOR """ import numpy as np from numpy import * import matplotlib.pyplot as plt from scipy import stats import pandas as pd from pandas import DataFrame, Series import seaborn as sns; sns.set() from numpy import random df = random.rand(1000) figure = sns.distplot(df,bins = 10).get_figure() figure.savefig('Data Visualization 5') plt.show() figure1 = sns.distplot(df,hist = True, bins = 10, rug=True, rug_kws={'color':'blue', 'label':'Rug Plot'}, hist_kws={'color':'red', 'label':'Hist Plot'}, kde_kws= {'color':'green', 'label':'KDE Plot'} ).get_figure() # You will observe that kde and hist plots are by default enabled in distplot and can only be excluded using False in the statement. figure.savefig('Data Visualization 5_1') plt.show() df2 = random.rand(1000) sns.boxplot(df2).get_figure().savefig('BoxPlot1.png') plt.show() #You can use orient function here: ie orient ='v' for vertical and orient='h' for horizontal sns.boxplot(df2, whis= np.inf, color ='yellow', order = 8).get_figure().savefig('BoxPlot2.png') plt.show() # Boxplot is usually used in stock market analysis or business analysis. # The left-half of the box plot is the 25th percentile, the middle line is the 50th percentile, and the right- half of the plot is the 75th percentile. # You can do well to look on the internet for the working principle of all the plot you want to use. '''Violin Plots (Combination of box plot and KDE plot)''' df3 = random.rand(100) sns.violinplot(df3).get_figure().savefig('Violin Plot 1') plt.show() '''Changing bandwith''' sns.violinplot(df3,bw= 0.2, color= 'red').get_figure().savefig('Violin Plot 2') # You will observe a distortion in the plot. plt.show() sns.violinplot(df3, color='green',inner= 'stick').get_figure().savefig('Violin Plot 3') # The thick line parts are the concentrated parts. plt.show() '''Heatmaps visualization''' df4= pd.read_csv("C:\\Users\\VICTOR\\Documents\\Programming\\Python Programming\\FlightData.csv") print(df4) df5 = ([df4['DISTANCE'],df4['ACTUAL_ELAPSED_TIME']]) sns.heatmap(df5).get_figure().savefig('Heat Map 1.png') plt.show() '''Using annotation function''' sns.heatmap(df5,fmt='d').get_figure().savefig('Heat Map 2.png') plt.show() # fmt function can take 'd' or 'c'. That is, diverging or converging. Here, we used diverging. #Functions you can use with heatmap '''data, vmin, vmax, cmap, center, robust, annot, fmt, annot_kws, linewidths, linecolor, cbar, cbar_kws, cbar_ax, square, xticklabels, yticklabels, mask, ax, **kwargs''' '''You can use the center function by: center = df5.loc[1995,'January']. I didn't implement that here because i'm not using a real example just a modified one.'''
996,473
063f977797be18455cb3cebeb060eeea8182ba74
from __future__ import absolute_import from celery import Celery from converter.corelib import YoutubeConverter,DownloadAudioInfoDTO from converter.coreconfig import CONFIG from celery import shared_task # TODO : nofify that youtube conversion is success or fail to client @shared_task def convert_youtube_video(video_url): conv = YoutubeConverter(CONFIG['path']) result = conv.convert_youtube(video_url) if "video_id" in result: download_dto = DownloadAudioInfoDTO() download_dto.insert(result["video_id"],result)
996,474
8502ea2c4c640f1455ee1edd6be4acb3b5bb222c
#! /usr/bin/env python import pymesh, argparse import numpy as np import fix_mesh as FM from circ_helix import create_helix def parse_args(): parser = argparse.ArgumentParser(description='Create a sphere with circular-section helix') parser.add_argument('--out', help='output file name', type=str, required=True) parser.add_argument('--pitch', type=float, default = 2.5) parser.add_argument('--height', type=float, default = 10.0) parser.add_argument('--nL', type=float, default = 64) parser.add_argument('--nR', type=float, default = 6) parser.add_argument('--radius', type=float, default = 1.0) parser.add_argument('--smallRadiusStart', type=float, default = 0.7) parser.add_argument('--smallRadiusEnd', type=float, default = 0.7) parser.add_argument('--sphereRadius', type=float, default = 1.5) return parser.parse_args() if __name__ == '__main__': args = parse_args() Hmesh, _ = create_helix(args.nL, args.height, args.radius, args.pitch, args.nR, args.smallRadiusStart, args.smallRadiusEnd) R = args.sphereRadius H = args.height Smesh = pymesh.generate_icosphere(R, [0.0, 0.0, H/2], refinement_order=2) mesh = pymesh.boolean(Hmesh, Smesh, operation="union", engine="igl") mesh = pymesh.subdivide(mesh, order=2, method="loop") #mesh = FM.fix_mesh(mesh, "low") mesh = FM.fix_mesh_target_length(mesh, 0.1) pymesh.save_mesh(args.out, mesh)
996,475
311e6600189e4e01a9418cd830629d8aa2cc3634
import sys import time import datetime import exceptions from mongosync.config import Config from mongosync.logger import Logger from mongosync.mongo_utils import get_optime, gen_namespace from mongosync.optime_logger import OptimeLogger try: import gevent except ImportError: pass log = Logger.get() class Synchronizer(object): """ Common synchronizer. Other synchronizer entities should implement methods: - __init__ - __del__ - _sync_database - _sync_collection - _sync_oplog """ def __init__(self, conf): if not isinstance(conf, Config): raise Exception('invalid config type') self._conf = conf self._ignore_dbs = ['admin', 'local'] self._ignore_colls = ['system.indexes', 'system.profile', 'system.users'] if conf.optime_logfilepath: self._optime_logger = OptimeLogger(conf.optime_logfilepath) else: self._optime_logger = None self._optime_log_interval = 10 # default 10s self._last_optime = None # optime of the last oplog has been replayed self._last_optime_logtime = time.time() self._log_interval = 2 # default 2s self._last_logtime = time.time() # use in oplog replay @property def from_to(self): return "%s => %s" % (self._conf.src_hostportstr, self._conf.dst_hostportstr) @property def log_interval(self): return self._log_interval @log_interval.setter def log_interval(self, n_secs): if n_secs < 0: n_secs = 0 self._log_interval = n_secs def run(self): """ Start to sync. """ # never drop database automatically # you should clear the databases manually if necessary try: self._sync() except exceptions.KeyboardInterrupt: log.info('keyboard interrupt') def _sync(self): """ Sync databases and oplog. """ if self._conf.start_optime: # TODO optimize log.info("locating oplog, it will take a while") oplog_start = self._conf.start_optime doc = self._src.client()['local']['oplog.rs'].find_one({'ts': {'$gte': oplog_start}}) if not doc: log.error('no oplogs newer than the specified oplog') return oplog_start = doc['ts'] log.info('start timestamp is %s actually' % oplog_start) self._last_optime = oplog_start self._sync_oplog(oplog_start) else: oplog_start = get_optime(self._src.client()) if not oplog_start: log.error('get oplog_start failed, terminate') sys.exit(1) self._last_optime = oplog_start self._sync_databases() if self._optime_logger: self._optime_logger.write(oplog_start) log.info('first %s' % oplog_start) self._sync_oplog(oplog_start) def _sync_databases(self): """ Sync databases excluding 'admin' and 'local'. """ host, port = self._src.client().address log.info('sync databases from %s:%d' % (host, port)) for dbname in self._src.client().database_names(): if dbname in self._ignore_dbs: log.info("skip database '%s'" % dbname) continue if not self._conf.data_filter.valid_db(dbname): log.info("skip database '%s'" % dbname) continue self._sync_database(dbname) log.info('all databases done') def _sync_database(self, dbname): """ Sync a database. """ raise Exception('you should implement %s.%s' % (self.__class__.__name__, self._sync_database.__name__)) def _sync_collections(self, dbname): """ Sync collections in the database excluding system collections. """ collnames = self._src.client()[dbname].collection_names(include_system_collections=False) for collname in collnames: if collname in self._ignore_colls: log.info("skip collection '%s'" % gen_namespace(dbname, collname)) continue if not self._conf.data_filter.valid_coll(dbname, collname): log.info("skip collection '%s'" % gen_namespace(dbname, collname)) continue self._sync_collection(dbname, collname) def _sync_collection(self, dbname, collname): """ Sync a collection until success. """ raise Exception('you should implement %s.%s' % (self.__class__.__name__, self._sync_collection.__name__)) def _sync_oplog(self, oplog_start): """ Replay oplog. """ raise Exception('you should implement %s.%s' % (self.__class__.__name__, self._sync_oplog.__name__)) def _log_progress(self, tag=''): """ Print progress. """ now = time.time() if now - self._last_logtime >= self._log_interval: delay = now - self._last_optime.time time_unit = 'second' if delay <= 1 else 'seconds' if tag: log.info('%s - sync to %s - %d %s delay - %s - %s' % (self.from_to, datetime.datetime.fromtimestamp(self._last_optime.time), delay, time_unit, self._last_optime, tag)) else: log.info('%s - sync to %s - %d %s delay - %s' % (self.from_to, datetime.datetime.fromtimestamp(self._last_optime.time), delay, time_unit, self._last_optime)) self._last_logtime = now def _log_optime(self, optime): """ Record optime. """ if not self._optime_logger: return now = time.time() if now - self._last_optime_logtime >= self._optime_log_interval: self._optime_logger.write(optime) self._last_optime_logtime = now log.info("flush optime into file '%s': %s" % (self._optime_logger.filepath, optime))
996,476
b5099c8b63fd47b996313000a01ac833522fe0a6
from django import forms from .models import project, teams from pagedown.widgets import PagedownWidget class projectForm(forms.ModelForm): project_description = forms.CharField(widget=PagedownWidget) class Meta: model = project fields = [ 'team_name', 'project_title', 'project_description', 'source_code', 'webpage', 'image', 'developing_or_developed', 'key', ] class teamsForm(forms.ModelForm): class Meta: model = teams fields = [ 'Team_Name', 'Name', 'Facebook_Profile_Link', 'Github_Profile_Link', 'Linkedin_Profile_Link', 'Image', 'Key', ] class edit(forms.ModelForm): class Meta: model = project fields = [ 'key', ] class editForm(forms.ModelForm): project_description = forms.CharField(widget=PagedownWidget) class Meta: model = project fields = [ 'team_name', 'project_title', 'project_description', 'source_code', 'webpage', 'image', 'developing_or_developed', ]
996,477
1fdef670b7f8ddd4f0cc48e88018855c1f4c3a48
# Definition for a binary tree node. # class TreeNode: # def __init__(self, x): # self.val = x # self.left = None # self.right = None #iterative class Solution: def preorderTraversal(self, root: TreeNode) -> List[int]: stack=[root, ] res=[] while stack: print(stack) root=stack.pop() if root is not None: res.append(root.val) if(root.right is not None): stack.append(root.right) if(root.left is not None): stack.append(root.left) return res # Definition for a binary tree node. # class TreeNode: # def __init__(self, x): # self.val = x # self.left = None # self.right = None #recursive class Solution: def preorderTraversal(self, root: TreeNode) -> List[int]: def preorder(root,res): if not root: return res.append(root.val) preorder(root.left,res) preorder(root.right,res) return res res=[] res=preorder(root,res) return res
996,478
536ff6e0e97fc690bcaf3a9a411f32a72900f129
""" @Project :data_visualization @File :mpl_squares.py @Description:绘制简单的折线图 @Author :Life @Date :2021/4/18 14:43 """ import matplotlib.pyplot as plt input_values = [1, 2, 3, 4, 5] squares = [1, 4, 9, 16, 25] print(squares[-1]) # 同时传入横纵坐标 plt.plot(input_values, squares, linewidth=3) # 设置图像的标签和横纵坐标 plt.title("square of numbers", fontsize=24) plt.xlabel("x", fontsize=14) plt.ylabel("square", fontsize=14) # 设置刻度大小 plt.tick_params(axis="both", labelsize=14) plt.show()
996,479
6eaf399ac2fe9461dea1aa94eb80556918a7ec34
#!/usr/bin/python3.5 from shapedetector import ShapeDetector import argparse import imutils import numpy as np import cv2 import matplotlib.pyplot as plt from time import sleep def auto_canny(image, sigma=0.95): # compute the median of the single channel pixel intensities v = np.median(image) # apply automatic Canny edge detection using the computed median lower = int(max(0, (1.0 - sigma) * v)) upper = int(min(255, (1.0 + sigma) * v)) edged = cv2.Canny(image, lower, upper) # return the edged image return edged if __name__ == "__main__": video = cv2.VideoCapture('Video_sample.mp4') while(video.isOpened()): ret, img = video.read() mask = np.zeros_like(img) gray = cv2.cvtColor(img, cv2.COLOR_BGR2GRAY) gray = cv2.equalizeHist(gray) thresh = cv2.threshold(gray, 25, 255, cv2.THRESH_BINARY)[1] edge = auto_canny(thresh) (_, cnts, _) = cv2.findContours(edge.copy(), cv2.RETR_EXTERNAL, cv2.CHAIN_APPROX_SIMPLE) for c in cnts: # compute the center of the contour, then detect the name of the # shape using only the contour M = cv2.moments(c) if M['m00'] != 0: cx = int(M['m10']/M['m00']) cy = int(M['m01']/M['m00']) area = cv2.contourArea(c) if (32<area) & (area < 40960): print("(%3d, %3d): %3d"%(cx, cy, area)) cv2.circle(img,(cx,cy), 1, (0,0,255), 6) location = '('+str(cx)+', '+str(cy)+')' cv2.putText(img,location,(cx,cy),cv2.FONT_HERSHEY_SIMPLEX,0.5, (255, 255, 255), 2) cv2.drawContours(img, cnts, -1, (0, 255, 0), 2) cv2.imshow("thresh", img) if cv2.waitKey(1) & 0xFF == ord('q'): break video.release() cv2.destroyAllWindows()
996,480
7d5b2788c4546ea8b198cbdd50d9eef279dcca25
# Configuration file for the Sphinx documentation builder. # # This file only contains a selection of the most common options. For a full # list see the documentation: # https://www.sphinx-doc.org/en/master/usage/configuration.html # -- Path setup -------------------------------------------------------------- # If extensions (or modules to document with autodoc) are in another directory, # add these directories to sys.path here. If the directory is relative to the # documentation root, use os.path.abspath to make it absolute, like shown here. # # import os # import sys # sys.path.insert(0, os.path.abspath('.')) # import sphinx_rtd_theme # -- Project information ----------------------------------------------------- project = 'Maillage et Éléments Finis' copyright = '2020, Bertrand Thierry' author = 'Bertrand Thierry' # -- General configuration --------------------------------------------------- # Add any Sphinx extension module names here, as strings. They can be # extensions coming with Sphinx (named 'sphinx.ext.*') or your custom # ones. extensions = [ "sphinxcontrib.proof", ] # Add any paths that contain templates here, relative to this directory. templates_path = ['_templates'] # The language for content autogenerated by Sphinx. Refer to documentation # for a list of supported languages. # # This is also used if you do content translation via gettext catalogs. # Usually you set "language" from the command line for these cases. language = 'fr' # List of patterns, relative to source directory, that match files and # directories to ignore when looking for source files. # This pattern also affects html_static_path and html_extra_path. exclude_patterns = [] numfig = True # -- Options for HTML output ------------------------------------------------- # The theme to use for HTML and HTML Help pages. See the documentation for # a list of builtin themes. # html_theme = "furo" html_title = "Maillage et Éléments Finis" proof_theorem_types = { "algorithm": "Algorithm", "conjecture": "Conjecture", "corollary": "Corollary", "definition": "Definition", "example": "Example", "lemma": "Lemma", "observation": "Observation", "proof": "Proof", "property": "Property", "theorem": "Theorem", "remark":"Remarque", "proposition":"Proposition", "exercise":"Exercice", } proof_latex_notheorem = ["proof"] #proof_html_nonumbers = ["exercise"] # Add any paths that contain custom static files (such as style sheets) here, # relative to this directory. They are copied after the builtin static files, # so a file named "default.css" will overwrite the builtin "default.css". html_static_path = ['_static'] html_css_files = [ 'https://cdnjs.cloudflare.com/ajax/libs/font-awesome/5.15.2/css/all.min.css', 'css/proof.css', 'css/custom.css', ] html_js_files = [ 'js/proof.js', # 'js/custom.js', # 'js/basis-function/main.js', # 'js/jacobian/main.js', # 'js/loc2glob/main.js', # 'https://cdn.jsdelivr.net/npm/mermaid/dist/mermaid.min.js', ] # Additional stuff for the LaTeX preamble. latex_engine = 'lualatex' latex_elements = {} latex_elements['preamble'] = '\\usepackage{amsmath}\n\\usepackage{amssymb}\n\\usepackage{amsthm}\n' latex_elements['babel'] = '\\usepackage{babel}' latex_additional_files = ['mystyle.sty', 'img/normal/normal.tex'] latex_elements['extrapackages'] = '\\usepackage{tikz}\n\\usetikzlibrary{arrows, calc, fit}\n\\usepackage{standalone}\n\\usepackage{mathrsfs}\n\\usepackage{mystyle}' latex_toplevel_sectioning = "part" # copy to mathjax mathjax3_config = { "tex": { "macros": { 'dsp' : '{\\displaystyle}', 'gD': '{g_D}', 'gN': '{g_N}', 'GammaN': '{\\Gamma_N}', 'GammaD': '{\\Gamma_D}', 'GammaF':'\Gamma_F', 'Lo':'{L^2(\\Omega)}', 'Ho':'{H^1(\\Omega)}', 'Hoz':'{H^1_{0}(\\Omega)}', 'HoD':'{H^1_{\\GammaD}(\\Omega)}', 'Hog':'{H^1_{\\gD}(\\Omega)}', 'Hoo':'{H^2(\\Omega)}', 'Vh': '{V_h}', 'Vhz': '{V_{h,0}}', 'VhD': '{V_{h,\GammaD}}', 'abs': ['{\\left|#1\\right|}',1], 'norm': ['{\\left\\|#1\\right\\|}',1], 'PS': ['{\\left(#1,#2\\right)}',2], 'PSL': ['{\\PS{#1}{#2}_{\Lo}}',2], 'PSLd': ['{\\PS{#1}{#2}_{\Lo^d}}',2], 'PSH': ['{\\PS{#1}{#2}_{\Ho}}',2], 'PSV': ['{\\PS{#1}{#2}_{V}}',2], 'normL': ['{\\norm{#1}_{\Lo}}',1], 'normLd': ['{\\norm{#1}_{(\Lo)^d}}',1], 'normH': ['{\\norm{#1}_{\Ho}}',1], 'normV': ['{\\norm{#1}_{V}}',1], 'ut': '{u_t}', 'uh': '{u_h}', 'vh': '{v_h}', 'Ahh': '{A}', 'Bh': '{B}', 'Uh': '{U}', 'Rb': '{\\mathbb{R}}', 'Nb': '{\\mathbb{N}}', 'nn': '{\\mathbf{n}}', 'dn': '{\\partial_{\\nn}}', 'ee': '{\\mathbf{e}}', 'xx': '{\\mathbf{x}}', 'yy': '{\\mathbf{y}}', 'zz': '{\\mathbf{z}}', 'diff': '{\\mathrm{d}}', 'Cscr': '{\\mathscr{C}}', 'Ccal': '{\\mathcal{C}}', 'mphi': '{\\varphi}', 'mphih': '{\\widehat{\\varphi}}', 'psih': '{\\widehat{\\psi}}', 'gh': '{\\widehat{g}}', 'deltaij': '{\\delta_{ij}}', 'tri': '{K}', 'trih': '{\\widehat{K}}', 'vertice': '{\\mathbf{s}}', 'verticeK': ['{\\vertice^{#1}}', 1], 'verticeh': '{\\widehat{\\vertice}}', 'grandO': ['{O\\left(#1\\right)}', 1], 'Nh':'{N_h}', 'Ns':'{N_s}', 'Nt':'{N_t}', 'Pb':'{\mathbb{P}}', 'Sh':'{\mathscr{S}_h}', 'Th':'{\mathscr{T}_h}', 'Ah':'{\mathscr{A}_h}', 'card':'{\\textrm{card}}', 'supp': '{\\textrm{supp}}', 'diam': '{\\textrm{diam}}', 'Image': '{\\textrm{Im}}', 'locToGlob':'{\\texttt{L2G}}', 'trihToTri':['{T_{#1}}',1], 'JK':['{J_{#1}}',1], 'BK':['{B_{#1}}',1], 'Meh':'{\\widehat{M}^e}', 'Deh':'{\\widehat{D}^e}', 'Me':['{M^e_{#1}}', 1], 'De':['{D^e_{#1}}', 1], 'enstq':['{\\left\\{#1 \\mathrel{}\\middle|\\mathrel{}#2\\right\\}}',2] } } }
996,481
bb0c5155111e0c6ad0be0dcc95af68e9fde7e24b
from django.test import TestCase from django.urls import reverse from .models import State STATES = ['AK','AL','AR','AZ','BI','CA','CO','CT','DC','DE','FL','GA','HI','IA','ID','IL','IN','KS','KY','LA','MA','MD','ME','MI','MN','MO','MS','MT','NC','ND','NE','NH','NJ','NM','NV','NY','OH','OK','OR','PA','RI','SC','SD','TN','TX','UT','VA','VT','WA','WI','WV','WY'] def create_null_states(): """ Create data for the State database. """ for s in STATES: State.objects.create(state=s,all_cohort=1,mam_cohort=0,mas_cohort=0, mbl_cohort=0,mhi_cohort=0,mtr_cohort=0,mwh_cohort=0,cwd_cohort=0, ecd_cohort=0,lep_cohort=0,num_schools=0,all_rate=0,mam_rate=None, mas_rate=None,mbl_rate=None,mhi_rate=None,mtr_rate=None,mwh_rate=None, cwd_rate=None,ecd_rate=None,lep_rate=None) def create_states(): """ Create data for the State database. """ for s in STATES: State.objects.create(state=s,all_cohort=1000,mam_cohort=100,mas_cohort=100, mbl_cohort=100,mhi_cohort=100,mtr_cohort=100,mwh_cohort=100,cwd_cohort=100, ecd_cohort=100,lep_cohort=100,num_schools=10,all_rate=0.9,mam_rate=0.9, mas_rate=0.9,mbl_rate=0.9,mhi_rate=0.9,mtr_rate=0.9,mwh_rate=0.9, cwd_rate=0.9,ecd_rate=0.9,lep_rate=0.9) class EducationIndexViewTests(TestCase): def test_no_data(self): """ If no data is in the database, no content is displayed but there is no map of graudation rates. """ response = self.client.get(reverse('education:index')) self.assertEqual(response.status_code, 200) self.assertEqual(response.context.get("json_data"), None) self.assertContains(response, "High School Graduation") self.assertContains(response, "How Rates Were Calculated") self.assertContains(response, "Home") self.assertNotContains(response, '<svg id="graduation_rate_map"') def test_with_data(self): """ If state data is in the database, make sure the conents renders and a graph of the graudation rates is displayed. """ create_states() response = self.client.get(reverse('education:index')) self.assertEqual(response.status_code, 200) self.assertNotEqual(response.context.get("json_data"), None) self.assertContains(response, "High School Graduation") self.assertContains(response, "How Rates Were Calculated") self.assertContains(response, '<svg id="graduation_rate_map"') class EducationStatesViewTest(TestCase): def test_no_data(self): """ Make sure the page renders and gives an error message if no data is available. """ response = self.client.get(reverse('education:states')) self.assertEqual(response.status_code, 200) self.assertEqual(response.context.get("states").count(), 0) self.assertContains(response, "No Data Available") self.assertNotContains(response, "Number of Public High Schools") def test_with_data(self): """ Make sure page renders when state database is filled. """ create_states() response = self.client.get(reverse('education:states')) self.assertEqual(response.status_code, 200) self.assertEqual(response.context.get("states").count(), 52) self.assertContains(response, "Home") self.assertNotContains(response, "No Data Available") self.assertContains(response, "Number of Public High Schools") self.assertContains(response, "Mississippi") self.assertContains(response, "90.0%") self.assertContains(response, "1,000") self.assertContains(response, "10") class EducationStateDetailsViewTest(TestCase): def test_no_data(self): """ Make sure each state page renders if there is no database data. """ for s in STATES: response = self.client.get(reverse('education:state_detail',args=(s,))) self.assertEqual(response.status_code, 200) self.assertNotEqual(response.context.get("message"), None) self.assertContains(response, "Error: No data for state {}".format(s)) def test_with_null_data(self): """ Make sure each state page renders if there is data in the database. """ create_null_states() for s in STATES: response = self.client.get(reverse('education:state_detail',args=(s,))) self.assertEqual(response.status_code, 200) self.assertNotEqual(response.context.get("data"), None) self.assertNotEqual(response.context.get("json_data"), None) self.assertContains(response, "Students in 15-16 Cohort") self.assertNotContains(response, ">Native American</a></td>") def test_with_data(self): """ Make sure each page renders if there is non-null data in the databasese """ create_states() for s in STATES: response = self.client.get(reverse('education:state_detail',args=(s,))) self.assertEqual(response.status_code, 200) self.assertNotEqual(response.context.get("data"), None) self.assertNotEqual(response.context.get("json_data"), None) self.assertContains(response, "Students in 15-16 Cohort") self.assertContains(response, ">Native American</a></td>") class EducationDemographicsViewTest(TestCase): def test_no_data(self): """ Make sure demographics page renders even if there is no data in the database. """ response = self.client.get(reverse('education:demographics')) self.assertEqual(response.status_code, 200) self.assertEqual(response.context.get("json_data"), None) self.assertEqual(response.context.get("all_cohort"), None) self.assertEqual(response.context.get("all_rate"), None) for demo in State.GROUP_NAMES: self.assertEqual(response.context.get(demo+"_cohort"), None) self.assertEqual(response.context.get(demo+"_rate"), None) self.assertContains(response, "Home") self.assertContains(response, "No Data Available") self.assertNotContains(response, "Students in 15-16 Cohort") def test_with_data(self): """ Make sure demographics page renders if there is data in the database. """ create_states() response = self.client.get(reverse('education:demographics')) self.assertEqual(response.status_code, 200) self.assertNotEqual(response.context.get("json_data"), None) self.assertNotEqual(response.context.get("all_cohort"), None) self.assertNotEqual(response.context.get("all_rate"), None) for demo in State.GROUP_NAMES: self.assertNotEqual(response.context.get(demo+"_cohort"), None) self.assertNotEqual(response.context.get(demo+"_rate"), None) self.assertContains(response, "Home") self.assertContains(response, "Students in 15-16 Cohort") self.assertNotContains(response, "No Data Available") class EducationDemographicDetailsViewTest(TestCase): def test_fake_group(self): """ Make sure the page gives an error message if a group is specified that does not actually exist. """ response = self.client.get(reverse('education:demographic_detail',args=("XYZ",))) self.assertEqual(response.status_code, 200) self.assertEqual(response.context.get("json_rate_data"), None) self.assertNotEqual(response.context.get("message"), None) self.assertContains(response, "Home") self.assertContains(response, "Error: No such group XYZ") self.assertNotContains(response, '<svg id="popsvg"') def test_no_data(self): """ Make sure all demographic pages render even when there is no data in the database. """ for demo in State.GROUP_NAMES: response = self.client.get(reverse('education:demographic_detail',args=(demo,))) self.assertEqual(response.status_code, 200) self.assertEqual(response.context.get("json_rate_data"), None) self.assertNotEqual(response.context.get("message"), None) self.assertContains(response, "Home") self.assertContains(response, "No Data Available") self.assertNotContains(response, '<svg id="popsvg"') def test_with_data(self): """ Make sure all demographic pages render if there is data in the database. """ create_states() for demo in State.GROUP_NAMES: response = self.client.get(reverse('education:demographic_detail',args=(demo,))) self.assertEqual(response.status_code, 200) self.assertEqual(response.context.get("group"), State.GROUP_NAMES[demo]) self.assertNotEqual(response.context.get("json_rate_data"), None) self.assertNotEqual(response.context.get("json_population_data"), None) self.assertContains(response, "Home") self.assertNotContains(response, "No Data Available") self.assertContains(response, '<svg id="popsvg"')
996,482
f613ae5862e264c80d6a86ffa0a06ff92edbc026
# -*- coding: utf-8 -*- # Generated by Django 1.11.6 on 2017-11-12 03:33 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('critical_list', '0001_initial'), ] operations = [ migrations.AlterField( model_name='part', name='shop', field=models.CharField( choices=[('MDT ENGINE', 'MDT ENGINE'), ('HDT ENGINE', 'HDT ENGINE'), ('TRANSMISSION', 'TRANSMISSION'), ('CASTING AND FORGING', 'CASTING AND FORGING'), ('AXLE', 'AXLE')], default=1, help_text='Enter Text', max_length=30), ), migrations.AlterField( model_name='part', name='status', field=models.CharField(blank=True, choices=[(1, 'Normal'), (2, 'Warning'), (3, 'Critical')], help_text='Select the part Status', max_length=10), ), ]
996,483
9e9157c287c6543bdd00982b4e7a09231034ebd8
import functools from typing import ( Callable, TypeVar, ) from asks import Session from p2p import trio_utils from trinity.components.builtin.metrics.service.base import BaseMetricsService T = TypeVar('T') # temporary workaround to support decorator typing until we can use # @functools.cached_property with python version >= 3.8 # https://github.com/python/mypy/issues/5858 def cache(func: Callable[..., T]) -> T: return functools.lru_cache()(func) # type: ignore class TrioMetricsService(BaseMetricsService): @property # type: ignore @cache def session(self) -> Session: url = self.reporter._get_post_url() auth_header = self.reporter._generate_auth_header() return Session(url, headers=auth_header) async def async_post(self, data: str) -> None: # use trio-compatible asks library for async http calls await self.session.post(data=data) async def continuously_report(self) -> None: async for _ in trio_utils.every(self._reporting_frequency): await self.report_now()
996,484
f00c703b8c207d63395937f3c6b0b12e498bf6c7
#!/usr/bin/env python import findgtk import gtk class ClickCountGUI: CLICK_COUNT = "Click count: %d" def __init__(self): "Set up the window and the button within" self.window = gtk.Window() self.button = gtk.Button(self.CLICK_COUNT %0) self.button.timesClicked = 0 self.window.add(self.button) self.button.connect("clicked", self.buttonClicked) self.window.connect("destroy", self.destroy) #Show the GUI self.button.show() self.window.show() def buttonClicked(self, button): "This button was clicked; increment the message on its lable" self.button.timesClicked += 1 self.button.set_label(self.CLICK_COUNT %self.button.timesClicked) def destroy(self, window): window.hide() gtk.main_quit() if __name__ == "__main__": ClickCountGUI() gtk.main()
996,485
00237701cf15d706b5677935a2f6c7ae2c797d8d
def modify(k): k.append(39) print("K =", k)
996,486
3536c8ca8aa4a27e086f804e0c9e0d8ab039d113
# -*- coding: utf-8 -*- # Copyright 2020 Huawei Technologies Co., Ltd # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================ import math import torch import torch.nn as nn import numpy as np #from skimage.measure.simple_metrics import compare_psnr from skimage.measure import compare_psnr #from skimage.metrics import peak_signal_noise_ratio #一个数据管理的类 class AverageMeter(object): """Computes and stores the average and current value""" def __init__(self, name, fmt=':f'): self.name = name self.fmt = fmt self.reset() self.val = 0 self.avg = 0 self.sum = 0 def reset(self): """ clear """ self.val = 0 self.avg = 0 self.sum = 0 self.count = 0 def update(self, val, n=1): """ and one val""" self.val = val self.sum += val * n self.count += n self.avg = self.sum / self.count def __str__(self): fmtstr = '{name} {val' + self.fmt + '} ({avg' + self.fmt + '})' return fmtstr.format(**self.__dict__) def weights_init_kaiming(m): """ init layers """ classname = m.__class__.__name__ if classname.find('Conv') != -1: nn.init.kaiming_normal(m.weight.data, a=0, mode='fan_in') elif classname.find('Linear') != -1: nn.init.kaiming_normal(m.weight.data, a=0, mode='fan_in') elif classname.find('BatchNorm') != -1: # nn.init.uniform(m.weight.data, 1.0, 0.02) m.weight.data.normal_(mean=0, std=math.sqrt(2. / 9. / 64.)).clamp_(-0.025, 0.025) nn.init.constant(m.bias.data, 0.0) def batch_PSNR(img, imclean, data_range): """ comprare two data """ Img = img.data.cpu().numpy().astype(np.float32) Iclean = imclean.data.cpu().numpy().astype(np.float32) PSNR = 0 for i in range(Img.shape[0]): PSNR += compare_psnr(Iclean[i, :, :, :], Img[i, :, :, :], data_range=data_range) return (PSNR / Img.shape[0]) def data_augmentation(image, mode): """ change numpy matrix """ out = np.transpose(image, (1, 2, 0)) if mode == 0: # original out = out elif mode == 1: # flip up and down out = np.flipud(out) elif mode == 2: # rotate counterwise 90 degree out = np.rot90(out) elif mode == 3: # rotate 90 degree and flip up and down out = np.rot90(out) out = np.flipud(out) elif mode == 4: # rotate 180 degree out = np.rot90(out, k=2) elif mode == 5: # rotate 180 degree and flip out = np.rot90(out, k=2) out = np.flipud(out) elif mode == 6: # rotate 270 degree out = np.rot90(out, k=3) elif mode == 7: # rotate 270 degree and flip out = np.rot90(out, k=3) out = np.flipud(out) return np.transpose(out, (2, 0, 1)) def changePose(out, mode): """ change numpy matrix """ out = np.squeeze(out, 0) if mode == 0: out=out elif mode == 1: out = np.flipud(out) elif mode == 2: out = np.rot90(out, axes=(1, 0)) elif mode == 3: out = np.rot90(out, axes=(1, 0)) out = np.flipud(out) elif mode == 4: out = np.rot90(out, k=2, axes=(1, 0)) elif mode == 5: out = np.rot90(out, k=2, axes=(1, 0)) out = np.flipud(out) elif mode == 6: out = np.rot90(out, k=3, axes=(1, 0)) elif mode == 7: out = np.rot90(out, k=3, axes=(1, 0)) out = np.flipud(out) out=np.expand_dims(out, axis=0) return out
996,487
768d2fe0beaf356c7d334f7cbbb6354f954c7c19
#Written for Python 3.4.2 data = [line.rstrip('\n') for line in open("input.txt")] totalpaper = 0 totalribbon = 0 for present in data: dimensions = sorted([int(x) for x in present.split('x')]) f1 = dimensions[0]*dimensions[1] f2 = dimensions[1]*dimensions[2] f3 = dimensions[2]*dimensions[0] extra = min(f1,f2,f3) wraplenght = 2*(dimensions[0]+dimensions[1]) bow = dimensions[0]*dimensions[1]*dimensions[2] totalpaper += 2*(f1+f2+f3)+extra totalribbon += wraplenght+bow print(totalpaper) print(totalribbon)
996,488
aff505c770117474282db460dc67f75620b11136
from redis import StrictRedis from sqlalchemy.orm import Session, scoped_session, Query from m2core.utils.decorators import classproperty from m2core.utils.error import M2Error class SessionMixin: __abstract__ = True @classmethod def set_db_session(cls, session) -> scoped_session or Session: """ Sets DB Session during M2Core initialization with this method """ cls._db_session = session @classproperty def s(cls) -> scoped_session or Session: """ Returns DB Session """ if cls._db_session: return cls._db_session else: raise M2Error('No DB session defined') @classmethod def set_redis_session(cls, session) -> scoped_session or Session: """ Sets Redis Session during M2Core initialization with this method """ cls._redis_session = session @classproperty def r(cls) -> StrictRedis: """ Returns Redis Session """ if cls._redis_session: return cls._redis_session else: raise M2Error('No Redis session defined') @classproperty def sh(cls): """ Returns instance of Session Helper :return: """ if not cls.r: raise M2Error('No Redis session defined') return cls._sh_cls(cls.r['connector'], cls.r['scheme']) @classmethod def set_sh(cls, sh_cls): """ Sets DB Session during M2Core initialization with this method """ cls._sh_cls = sh_cls @classproperty def q(cls) -> Query: """ Returns prepared Query taken from DB Session """ if not cls.s: raise M2Error('No DB session defined') return cls.s.query(cls)
996,489
3f03f657184fd651d438487d59f60979dc1d7ece
__author__ = 'jsuit' import Corpus import numpy as np from numpy import matlib import json #set up Corpus corpus = Corpus.Corpus() corpus.get_articles() corpus.vectorize_articles() bow = corpus.get_vect_articles() n_docs = corpus.get_num_articles() corpus.calc_num_terms() n_terms = corpus.get_num_terms() #pick number of topics k=51 alpha = .01 beta = .001 DTMatrix = matlib.zeros((n_docs,k),dtype='float_') TTMatrix =matlib.zeros((n_terms,k),dtype='float_') DocVocab={} w_tokens = False if w_tokens: word_tokens = np.sum(bow.sum(axis=0)) else: word_tokens = n_terms for doc_num in xrange(bow.shape[0]): #get the indexes of word that occur in document words_i = np.nonzero(bow[doc_num])[0] for indx in words_i: #for each time the word occurs in document randomly sample p = 0 if w_tokens: for j in range(bow[doc_num][indx]): z = np.random.multinomial(1, [1/float(k)]*k, size=1).argmax() DTMatrix[doc_num,z]+=1 TTMatrix[indx,z]+=1 if (doc_num,indx) not in DocVocab: DocVocab[(doc_num,indx)] = [z] else: DocVocab[(doc_num,indx)].append(z) else: z = np.random.multinomial(1, [1/float(k)]*k, size=1).argmax() DTMatrix[doc_num,z]+=1 TTMatrix[indx,z]+=1 if (doc_num,indx) not in DocVocab: DocVocab[(doc_num,indx)] = [z] else: DocVocab[(doc_num,indx)].append(z) iters = 400 #DTMatrix.dump('DTMatrix.txt') #TTMatrix.dump('TTMatrix.txt') for i in range(iters): print i for doc_num in xrange(bow.shape[0]): words_i = np.nonzero(bow[doc_num])[0] for indx in words_i: topics = DocVocab[(doc_num,indx)] for count, topic in enumerate(topics): #take the word,topic count and decrement TTMatrix[indx,topic]-=1 #take the document and the topic and decrement DTMatrix[doc_num,topic] -=1 #math happens here thanks to the dirchlet being a conjugate prior to the multinomial #pz is a vector representing each the probability of each topic k #print DTMatrix[doc_num,:], TTMatrix[indx,:] pz = np.divide(np.multiply(DTMatrix[doc_num,:] + alpha,TTMatrix[indx,:] + beta),DTMatrix.sum(axis=0)+beta*word_tokens) sample_pz = np.random.multinomial(21, np.asarray(pz/pz.sum())[0],1) topic = sample_pz.argmax() #DocVocab[(doc_num,indx)] = topic topics[count] = topic TTMatrix[indx,topic]+=1 DTMatrix[doc_num,topic]+=1 DocVocab[(doc_num,indx)] = topics #DTrow = np.nonzero(DTMatrix[doc_num,:])[0] #compute Document distribution TopicDict = {} Topic_DictMax = {} for doc_num in xrange(bow.shape[0]): x = (DTMatrix[doc_num,:] + alpha) / (DTMatrix[doc_num,:].sum() + alpha) #theta_d_z t = np.asarray(x/x.sum())[0] if np.argmax(t) not in Topic_DictMax: Topic_DictMax[np.argmax(t)] = [doc_num] else: Topic_DictMax[np.argmax(t)].append(doc_num) #print x #print DTMatrix[doc_num,:] #print DTMatrix[doc_num,:].sum() #print doc_num,DTMatrix[doc_num,:] #print doc_num, DTMatrix[doc_num,:].argmax() #amax = DTMatrix[doc_num,:].argmax() arr = np.asarray(DTMatrix[doc_num,:]) #amax = np.argpartition(array, -3)[-3:] amax = np.argsort(arr[0])[-3:] for m in amax: if m not in TopicDict: TopicDict[m] = [doc_num] else: TopicDict[m].append(doc_num) from pprint import pprint #pprint(TopicDict) pprint(Topic_DictMax) """ [17, 29, 38, 46, 48, 53, 101, 122], 1: [15, 22, 27, 37, 47, 49], 2: [1, 11, 32, 33, 69], 3: [77], 4: [51, 93, 95, 105, 110], """
996,490
caa724a8c0b8659ea2e360d92af59d1ebab5e293
'''Tests figures.settings These are currently just simple tests that make sure the basics are working. They could use elaboration to make sure that the individual settings within each of the Figures entries to ``WEBPACK_LOADER`` and ``CELERYBEAT_SCHEDULE`` are correctly assigned ''' import mock import pytest from figures import update_settings from figures import settings as figures_settings @pytest.mark.parametrize('env_tokens, expected ', [ ({'LOG_PIPELINE_ERRORS_TO_DB': True}, True), ({'LOG_PIPELINE_ERRORS_TO_DB': False}, False), ]) def test_log_pipeline_errors_to_db_true(env_tokens, expected): with mock.patch('figures.settings.env_tokens', env_tokens): assert figures_settings.log_pipeline_errors_to_db() == expected class TestUpdateSettings(object): ''' figures.settings.update_settings is a convenience method that wraps around: :: figures.settings.update_webpack_loader figures.settings.update_celerybeat_schedule ''' def setup(self): self.webpack_loader_settings = {} self.celerybeat_schedule_settings = {} self.celery_task_name = figures_settings.DAILY_METRICS_CELERY_TASK_LABEL def test_update_in_package_init(self): '''Make sure that the ``update_settings`` method in the package init module is the same as in ``figures.settings`` ''' assert update_settings == figures_settings.update_settings def validate_webpack_loader_settings(self): assert 'FIGURES_APP' in self.webpack_loader_settings for key in ['BUNDLE_DIR_NAME', 'STATS_FILE']: assert key in self.webpack_loader_settings['FIGURES_APP'] def validate_celerybeat_schedule_settings(self): assert self.celery_task_name in self.celerybeat_schedule_settings for key in ['task', 'schedule']: assert key in self.celerybeat_schedule_settings['figures-populate-daily-metrics'] @pytest.mark.parametrize('figures_env_tokens, run_celery,', [ (None, True), ({}, True), ({'ENABLE_DAILY_METRICS_IMPORT': True}, True), ({'ENABLE_DAILY_METRICS_IMPORT': False}, False), ]) def test_update_settings(self, figures_env_tokens, run_celery): ''' ''' figures_settings.env_tokens = dict() update_settings( webpack_loader_settings=self.webpack_loader_settings, celerybeat_schedule_settings=self.celerybeat_schedule_settings, figures_env_tokens=figures_env_tokens, ) self.validate_webpack_loader_settings() if run_celery: self.validate_celerybeat_schedule_settings() else: assert self.celery_task_name not in self.celerybeat_schedule_settings assert figures_settings.env_tokens == figures_env_tokens
996,491
0d99bd7861ddf980e568fd9f37a05900dea559d5
STATIC_ROOT_DIR = "/home/banban" class Application(object): def __call__(self, env, start_response): path = env.get("PATH") # if path.startswith("/static"): # path_way = path[7:] file_name = STATIC_ROOT_DIR + path print(file_name) try: file = open(file_name, "rb") except: status = "404 CANT FOUND" headers = [] start_response(status, headers) return("error name") else: status = "404 OK" headers = [ ("Content-Type", "text/plain") ] start_response(status, headers) response_date = file.read().decode("utf-8") return response_date app = Application()
996,492
3f0e2599577e098a0b913943fb14eaa4ac4d91d1
import sys def main(): n = int(sys.stdin.readline().strip()) A,B = [0 for i in xrange(101)], [0 for i in xrange(101)] for line in sys.stdin: a,b = [int(i) for i in line.split()] A[a] += 1 B[b] += 1 a,b = 100, 1 ca, cb = 0, 0 curr_ans = 0 while True: while a>0 and A[a] == 0: a -= 1 while b<101 and B[b] == 0: b +=1 if (a == 0 or b == 101): break if ca == 0: ca = A[a] if cb == 0: cb = B[b] if a+b > curr_ans: curr_ans = a+b if ca > cb: ca -= cb cb = 0 b+=1 elif cb > ca: cb -= ca ca = 0 a-=1 else: a -= 1 b += 1 ca,cb = 0,0 print curr_ans if __name__ == '__main__': main()
996,493
c16c56d95e1d1bbf1feb89f5416ea8ff93ddc683
def countdown(n): if n > 0: print(n) countdown(n-1) n = int(input("Insira n ")) countdown(n)
996,494
8ea27274a45664cebe6bc18db2e0ac8024941c17
#!/usr/bin/python3 """ Datetime example """ import datetime import pytz if __name__=="__main__": fmt = "%Y %m %d %H:%M" current_time = datetime.datetime(2017, 1, 5, 9, 35, 44) timezone = pytz.timezone('US/Pacific') localized_time = timezone.localize(current_time) print(localized_time.astimezone(pytz.timezone('US/Central')).strftime(fmt)) print(localized_time.astimezone(pytz.timezone('US/Eastern')).strftime(fmt)) print(localized_time.astimezone(pytz.timezone('Asia/Calcutta')).strftime(fmt)) print(localized_time.astimezone(pytz.timezone('Europe/Amsterdam')).strftime(fmt)) print(localized_time.astimezone(pytz.timezone('Australia/Sydney')).strftime(fmt)) print(localized_time.astimezone(pytz.timezone('America/St_Johns')).strftime(fmt))
996,495
86834805bc6abed63d64497ac74202dfb982fab7
# -*- coding:utf-8 -*- # @Author: clark # @Time: 2021/5/26 5:53 下午 # @File: demo_1.py # @project demand: import requests headers = { 'Proxy-Connection': 'keep-alive', 'Accept': 'application/json, text/javascript, */*; q=0.01', 'X-Requested-With': 'XMLHttpRequest', 'User-Agent': 'Mozilla/5.0 (Macintosh; Intel Mac OS X 11_2_3) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/89.0.4389.114 Safari/537.36', 'Content-Type': 'application/x-www-form-urlencoded; charset=UTF-8', 'Origin': 'http://deal.ggzy.gov.cn', 'Referer': 'http://deal.ggzy.gov.cn/ds/deal/dealList.jsp', 'Accept-Language': 'zh-CN,zh;q=0.9', } data = { # 'TIMEBEGIN_SHOW': '2021-03-24', # 'TIMEEND_SHOW': '2021-04-02', # 'TIMEBEGIN': '2021-03-24', # 'TIMEEND': '2021-04-02', 'SOURCE_TYPE': '1', 'DEAL_TIME': '02', 'DEAL_CLASSIFY': '00', 'DEAL_STAGE': '0000', 'DEAL_PROVINCE': '0', 'DEAL_CITY': '0', 'DEAL_PLATFORM': '0', 'BID_PLATFORM': '0', 'DEAL_TRADE': '0', 'isShowAll': '1', 'PAGENUMBER': '8181', 'FINDTXT': '' } response = requests.post('http://deal.ggzy.gov.cn/ds/deal/dealList_find.jsp', headers=headers, data=data, verify=False, ) from pprint import pprint pprint(response.json())
996,496
7d00546eca2ce0dc2eb5cd6cb56ba09d044bc49f
#-----------------------------------------------------------------------------# #projection.py # #NPS Night Skies Program # #Last updated: 2021/02/22 # #This script plots the fits images in fisheye and Hammer projections. # #Input: # (1) reading in the mask to get the x,y center and the fisheye view radius # (2) all the processed fisheye fit images # #Output: # (1) *fisheye.png # (2) *hammer.png # #History: # Li-Wei Hung -- Created # #------------------------------------------------------------------------------# import copy import matplotlib as mpl import numpy as n import warnings from astropy.io import fits from glob import glob from matplotlib import pyplot as plt from skimage.transform import rotate # Local Source import colormaps import process_input as p import upper_hammer #------------------------------------------------------------------------------# def main(): """ This script plots fits images in fisheye and Hammer projection. See the script description for detail. """ #--------------------------------------------------------------------------# # Generate Polar Coordinates # #--------------------------------------------------------------------------# #Mask - read in the fisheye mask center coordinates and radius mask = fits.open(p.mask,uint=False)[0].header xc, yc, r0 = int(mask['CENTERX']), int(mask['CENTERY']), int(mask['RADIUS']) X, Y = n.meshgrid(n.arange(-r0,r0),n.arange(-r0,r0)) #Polar coordinates r = n.sqrt(X**2+Y**2) / r0 theta = -n.arctan2(Y,X) #Fisheye takes r in degree r_deg = 90 * r theta_f = theta + n.pi/2 #Hammer plot requires the values to be sorted r_str = n.pi/2 - r * n.pi/2 inds = n.argsort(theta[:,0]) theta_s = theta[inds,:] r_s = r_str[inds,:] #--------------------------------------------------------------------------# # Define Plot settings # #--------------------------------------------------------------------------# #General plot settings plt.close('all') plt.style.use('dark_background') plt.rcParams['image.cmap'] = 'NPS_mag' cmap = copy.copy(mpl.cm.get_cmap("NPS_mag")) cmap.set_bad(color='black') #Fisheye plot setting fig0 = plt.figure('fisheye') ax0 = fig0.add_subplot(111, projection='polar') ax0.set_rlim(0,90) ax0.set_yticklabels([]) ax0.tick_params(colors='darkgray') ax0.set_theta_zero_location('N') #Hammer plot setting fig1 = plt.figure('hammer',figsize=(15,5.2)) ax1 = fig1.add_subplot(111, projection="upper_hammer") fig1.tight_layout(rect=(0.03,-0.6,0.98,0.97)) #Suppressing a MatPlotLib benign warning about pcolormesh shading warnings.filterwarnings("ignore",category=UserWarning) #--------------------------------------------------------------------------# # Plot the image in fisheye and Hammer projections # #--------------------------------------------------------------------------# for f in glob(p.data_cal+'*sky*.fit'): print('projecting ' + f[len(p.data_cal):]) img = fits.open(f,uint=False)[0].data[yc-r0:yc+r0,xc-r0:xc+r0] img_hammer = rotate(img.astype('float32'),-90,cval=n.nan)[inds,:] #plot fisheye ax0.pcolormesh(theta_f,r_deg,img,shading='auto',vmin=14,vmax=24) ax0.grid(True, color='gray', linestyle='dotted', linewidth=.5) fig0.savefig(f[:-4]+'_fisheye.png', dpi=250) #plot hammer ax1.pcolormesh(theta_s,r_s,img_hammer,shading='auto',vmin=14,vmax=24) ax1.grid(True) fig1.savefig(f[:-4]+'_hammer.png') if __name__ == '__main__': main()
996,497
e59f29d53f9820350705693e96d1671f7514336d
import os import codecs import ntpath import logging import numpy import logging import cPickle import theano.tensor as tensor import theano from blocks.extensions import SimpleExtension from blocks.extensions.monitoring import DataStreamMonitoring from blocks.monitoring.evaluators import DatasetEvaluator from blocks.theano_expressions import l2_norm from blocks.algorithms import Scale from picklable_itertools.extras import equizip logger = logging.getLogger('extensions.SaveLoadParams') #region Extension class EpochMonitor(SimpleExtension): def __init__(self, max_epoch, **kwargs): super(EpochMonitor, self).__init__(after_epoch = True, **kwargs) self.cur_epoch = 0 self.max_epoch = max_epoch def do(self, which_callback, *args): if which_callback == "after_epoch": self.cur_epoch += 1 if self.cur_epoch >= self.max_epoch: self.main_loop.status['epoch_interrupt_received'] = True class MyDataStreamMonitoring(DataStreamMonitoring): """Monitors Theano variables and monitored-quantities on a data stream. By default monitoring is done before the first and after every epoch. Parameters ---------- variables : list of :class:`~tensor.TensorVariable` and :class:`MonitoredQuantity` The variables to monitor. The variable names are used as record names in the logs. updates : list of tuples or :class:`~collections.OrderedDict` or None :class:`~tensor.TensorSharedVariable` updates to be performed during evaluation. This parameter is only for Theano variables. Be careful not to update any model parameters as this is not intended to alter your model in any meaningful way. A typical use case of this option arises when the theano function used for evaluation contains a call to :func:`~theano.scan` which might have returned shared variable updates. data_stream : instance of :class:`.DataStream` The data stream to monitor on. A data epoch is requested each time monitoring is done. """ PREFIX_SEPARATOR = '_' def __init__(self, variables, data_stream, updates=None, coverage=1., **kwargs): super(MyDataStreamMonitoring, self).__init__(variables, data_stream, updates, **kwargs) self.coverage = coverage def do(self, callback_name, *args): """Write the values of monitored variables to the log.""" value_dict = self._evaluator.evaluate(self.data_stream) print("Train test coverage:{0}".format(self.coverage)) for key, value in value_dict.items(): print("{0}:{1}".format(key, value * self.coverage)) class BasicSaveLoadParams(SimpleExtension): ''' Only save or load word, user and haashtag embeddings and parameters of bricks ''' def __init__(self, load_from, save_to, model, dataset, **kwargs): super(BasicSaveLoadParams, self).__init__(**kwargs) self.load_from = load_from self.save_to = save_to self.model = model self.dataset = dataset def do_save(self): if not os.path.exists(os.path.dirname(self.save_to)): os.makedirs(os.path.dirname(self.save_to)) with open(self.save_to, 'wb+') as f: logger.info('Saving parameters to %s...'%self.save_to) # Save model and necessary dataset information cPickle.dump(self.model.get_parameter_values(), f) cPickle.dump(self.dataset.get_parameter_to_save(), f) def do_load(self): try: with open(self.load_from, 'rb') as f: logger.info('Loading parameters from %s...'%self.load_from) last_model_params = cPickle.load(f) last_dataset_params = cPickle.load(f) self.do_initialize(last_model_params, last_dataset_params) except IOError as e: print("Cannot load parameters!") def do_initialize(self, last_model_params, last_dataset_params): cur_dataset_params = self.dataset.get_parameter_to_save() cur_model_params = self.model.get_parameter_values() # Initialize LSTM params self._initialize_other(last_model_params,last_dataset_params, cur_model_params, cur_dataset_params) #region Initialize embedding params # Initialize hashtag embedding self._initialize_hashtag(last_model_params,last_dataset_params,cur_model_params, cur_dataset_params) # Initialize user embedding self._initialize_user(last_model_params,last_dataset_params,cur_model_params, cur_dataset_params) # Initialize word embedding self._initialize_word(last_model_params,last_dataset_params,cur_model_params, cur_dataset_params) #endregion self.model.set_parameter_values(cur_model_params) def _initialize_hashtag(self, last_model_params, last_dataset_params, cur_model_params, cur_dataset_params): last_hashtag_embed = last_model_params['/hashtag_embed.W'] cur_hashtag_embed = cur_model_params['/hashtag_embed.W'] last_hashtag2index = last_dataset_params['hashtag2index'] cur_hashtag2index = cur_dataset_params['hashtag2index'] for hashtag, index in last_hashtag2index.iteritems(): if hashtag in cur_hashtag2index: cur_hashtag_embed[cur_hashtag2index[hashtag]] = last_hashtag_embed[index] def _initialize_user(self,last_model_params, last_dataset_params, cur_model_params, cur_dataset_params): last_user_embed = last_model_params['/user_embed.W'] cur_user_embed = cur_model_params['/user_embed.W'] last_user2index = last_dataset_params['user2index'] cur_user2index = cur_dataset_params['user2index'] for user, index in last_user2index.iteritems(): if user in cur_user2index: cur_user_embed[cur_user2index[user]] = last_user_embed[index] def _initialize_word(self,last_model_params, last_dataset_params, cur_model_params, cur_dataset_params): last_word_embed = last_model_params['/word_embed.W'] cur_word_embed = cur_model_params['/word_embed.W'] last_word2index = last_dataset_params['word2index'] cur_word2index = cur_dataset_params['word2index'] for word, index in last_word2index.iteritems(): if word in cur_word2index: cur_word_embed[cur_word2index[word]] = last_word_embed[index] def _initialize_other(self, last_model_params, last_dataset_params, cur_model_params, cur_dataset_params): for key, value in last_model_params.iteritems(): if key != "/hashtag_embed.W" and key != "/user_embed.W" and key != '/word_embed.W': cur_model_params[key] = value def do(self, which_callback, *args): if which_callback == 'before_training': self.do_load() else: self.do_save() class UHSaveLoadParams(BasicSaveLoadParams): def __init__(self, load_from, save_to, model, dataset, **kwargs): super(UHSaveLoadParams, self).__init__(load_from, save_to, model, dataset) def _initialize_word(self,last_model_params, last_dataset_params, cur_model_params, cur_dataset_params): pass def _initialize_other(self, last_model_params, last_dataset_params, cur_model_params, cur_dataset_params): pass class ExtendSaveLoadParams(BasicSaveLoadParams): ''' Save or load character, word, user and haashtag embeddings and parameters of bricks ''' def __init__(self, load_from, save_to, model, dataset, **kwargs): super(ExtendSaveLoadParams, self).__init__(load_from, save_to, model, dataset,**kwargs) def _initialize_other(self, last_model_params, last_dataset_params, cur_model_params, cur_dataset_params): last_char_embed = last_model_params['/char_embed.W'] cur_char_embed = cur_model_params['/char_embed.W'] last_char2index = last_dataset_params['char2index'] cur_char2index = cur_dataset_params['char2index'] for char, index in last_char2index.iteritems(): if char in cur_char2index: cur_char_embed[cur_char2index[char]] = last_char_embed[index] for key, value in last_model_params.iteritems(): if key not in ("/hashtag_embed.W", "/user_embed.W", '/word_embed.W', '/char_embed.W'): cur_model_params[key] = value class ETHSaveLoadParams(ExtendSaveLoadParams): ''' Save or load character, word, haashtag embeddings and parameters of bricks ''' def __init__(self, load_from, save_to, model, dataset, **kwargs): super(ETHSaveLoadParams, self).__init__(load_from, save_to, model, dataset,**kwargs) def do_initialize(self, last_model_params, last_dataset_params): cur_dataset_params = self.dataset.get_parameter_to_save() cur_model_params = self.model.get_parameter_values() # Initialize LSTM params self._initialize_other(last_model_params,last_dataset_params, cur_model_params, cur_dataset_params) #region Initialize embedding params # Initialize hashtag embedding self._initialize_hashtag(last_model_params,last_dataset_params,cur_model_params, cur_dataset_params) # Initialize word embedding self._initialize_word(last_model_params,last_dataset_params,cur_model_params, cur_dataset_params) #endregion self.model.set_parameter_values(cur_model_params) class EarlyStopMonitor(DataStreamMonitoring): PREFIX_SEPARATOR = '_' def __init__(self, variables, monitor_variable, data_stream, updates=None, saver=None, tolerate_time = 5, **kwargs): super(DataStreamMonitoring, self).__init__(**kwargs) self._evaluator = DatasetEvaluator(variables, updates) self.data_stream = data_stream self.saver = saver self.best_result = -numpy.inf self.last_result = -numpy.inf self.wait_time = 0 self.tolerate_time = tolerate_time self.monitor_variable = monitor_variable def do(self, callback_name, *args): """Write the values of monitored variables to the log.""" logger.info("Monitoring on auxiliary data started") value_dict = self._evaluator.evaluate(self.data_stream) self.add_records(self.main_loop.log, value_dict.items()) self.check_stop(value_dict) logger.info("Monitoring on auxiliary data finished") def check_stop(self, value_dict): result = value_dict[self.monitor_variable.name] if result > self.last_result: self.last_result = result self.wait_time = 0 if result > self.best_result: self.best_result = result if self.saver is not None: self.saver.do_save() else: pass else: pass else: self.wait_time += 1 self.last_result = result if self.wait_time > self.tolerate_time: self.main_loop.status['batch_interrupt_received'] = True self.main_loop.status['epoch_interrupt_received'] = True class EvaluatorWithEarlyStop(EarlyStopMonitor): def __init__(self, coverage, **kwargs): super(EvaluatorWithEarlyStop, self).__init__(**kwargs) self.coverage = coverage def do(self, callback_name, *args): """Write the values of monitored variables to the log.""" logger.info("Monitoring on auxiliary data started") value_dict = self._evaluator.evaluate(self.data_stream) for key in value_dict.keys(): value_dict[key] *= self.coverage value_dict['coverage'] = self.coverage logging.info("coverage:{0}".format(self.coverage)) for key, value in value_dict.items(): logging.info("{0}:{1}".format(key,value)) self.add_records(self.main_loop.log, value_dict.items()) self.check_stop(value_dict) logger.info("Monitoring on auxiliary data finished") #endregion
996,498
3dd394c59838e2e8dca2bc077b5a2cc6d366327c
# Generated by the protocol buffer compiler. DO NOT EDIT! # source: demo.proto import sys _b=sys.version_info[0]<3 and (lambda x:x) or (lambda x:x.encode('latin1')) from google.protobuf import descriptor as _descriptor from google.protobuf import message as _message from google.protobuf import reflection as _reflection from google.protobuf import symbol_database as _symbol_database from google.protobuf import descriptor_pb2 # @@protoc_insertion_point(imports) _sym_db = _symbol_database.Default() DESCRIPTOR = _descriptor.FileDescriptor( name='demo.proto', package='', syntax='proto2', serialized_pb=_b('\n\ndemo.proto\"\x0f\n\x01\x42\x12\n\n\x02\x62\x32\x18\x02 \x01(\t\"\x1e\n\x01\x41\x12\r\n\x01\x62\x18\x01 \x01(\x0b\x32\x02.B\x12\n\n\x02id\x18\x02 \x01(\t') ) _B = _descriptor.Descriptor( name='B', full_name='B', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='b2', full_name='B.b2', index=0, number=2, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ ], options=None, is_extendable=False, syntax='proto2', extension_ranges=[], oneofs=[ ], serialized_start=14, serialized_end=29, ) _A = _descriptor.Descriptor( name='A', full_name='A', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='b', full_name='A.b', index=0, number=1, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='id', full_name='A.id', index=1, number=2, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ ], options=None, is_extendable=False, syntax='proto2', extension_ranges=[], oneofs=[ ], serialized_start=31, serialized_end=61, ) _A.fields_by_name['b'].message_type = _B DESCRIPTOR.message_types_by_name['B'] = _B DESCRIPTOR.message_types_by_name['A'] = _A _sym_db.RegisterFileDescriptor(DESCRIPTOR) B = _reflection.GeneratedProtocolMessageType('B', (_message.Message,), dict( DESCRIPTOR = _B, __module__ = 'demo_pb2' # @@protoc_insertion_point(class_scope:B) )) _sym_db.RegisterMessage(B) A = _reflection.GeneratedProtocolMessageType('A', (_message.Message,), dict( DESCRIPTOR = _A, __module__ = 'demo_pb2' # @@protoc_insertion_point(class_scope:A) )) _sym_db.RegisterMessage(A) # @@protoc_insertion_point(module_scope)
996,499
d5632c715716c891565a52dbdae58f41f494c855
import io import re import requests def get_props_split_by_60_chars(prop): prop = prop.replace('\n', '') prop = prop.replace('"', '.') prop = prop.replace('“', '.') prop = prop.replace('”', '.') prop = prop.replace('\'', '') prop = prop.replace(':', '.') prop = prop.replace(',', '.') list = [] while len(prop) > 0: first_space = prop.find('.', 0, 60) if first_space == -1: first_space = prop.find(' ', 60) if first_space == -1: list.append(prop) break else: first_space += 1 list.append(prop[0:first_space]) prop = prop[first_space:].strip() if prop.find('.') == -1: if len(prop) >= 1: list.append(prop) break final_res = [] for p in list: marks = re.findall("[?!.]", p[-1]) if len(marks) == 0: p += '.' final_res.append(p) print(final_res) return final_res file = io.open('text.txt', 'r', encoding="utf-8") for p_index, prop in enumerate(file): props = get_props_split_by_60_chars(prop) for s_index, sentence in enumerate(props): payload = {'text': sentence} doc = requests.get('http://localhost:5002/api/tts', params=payload) with open(f"audio\{p_index}-{s_index}.mp3", 'wb') as f: f.write(doc.content)