text
stringlengths
1
1.05M
#!/bin/bash # # The laradockctl command to view application logs. set -Ceuo pipefail local NAME='logs' local DESCRIPTION='View application logs' handle() { # Laravel application logs if file_exists_in_workspace storage/logs/laravel.log; then docker-compose exec -u laradock workspace tail "$@" storage/logs/laravel.log fi }
function generateChatboxMarkup(messages) { let markup = `<div class="message__chatbox-section padding-bottom"> <div class="container"> <div class="message__chatbox"> <div class="message__chatbox__body"> <ul class="reply-message-area">`; messages.forEach(message => { if (message.admin_id === 0) { markup += `<li class="user-message"> <div class="message-content">${message.content}</div> </li>`; } else { markup += `<li class="admin-message"> <div class="message-content">${message.content}</div> </li>`; } }); markup += `</ul> </div> </div> </div> </div>`; return markup; } const messages = [ { admin_id: 0, content: "Hello there!" }, { admin_id: 1, content: "Welcome to our website." }, { admin_id: 0, content: "How can we assist you today?" } ]; console.log(generateChatboxMarkup(messages));
require 'spec_helper' describe 'puppet_metrics_collector::pe_metric' do let(:title) { 'test-service' } let(:params) { {metrics_port: 9000} } # This define has an undeclared dependency on the main # puppet_metrics_collector class. let(:pre_condition) { 'include puppet_metrics_collector' } it 'compiles with minimal parameters set' do expect(subject).to compile end describe 'remote metric collection' do it 'is disabled by default due to CVE-2020-7943' do expect(subject).to contain_file('/opt/puppetlabs/puppet-metrics-collector/config/test-service.yaml').with_content(/remote_metrics_enabled: false/) end context 'when the PE version is 2019.8.5 or newer' do let(:facts) { {pe_server_version: '2019.8.5'} } it 'is enabled by default' do expect(subject).to contain_file('/opt/puppetlabs/puppet-metrics-collector/config/test-service.yaml').with_content(/remote_metrics_enabled: true/) end end context 'when the PE version is 2019.8.4 or older' do let(:facts) { {pe_server_version: '2019.8.4'} } it 'is disabled by default' do expect(subject).to contain_file('/opt/puppetlabs/puppet-metrics-collector/config/test-service.yaml').with_content(/remote_metrics_enabled: false/) end end end end
#!/bin/sh # Replace the API and APP keys below # with the ones for your account api_key=<YOUR_API_KEY> app_key=<YOUR_APP_KEY> slo_id=<YOUR_SLO_ID> # Get a SLO curl -X GET \ -H "DD-API-KEY: ${api_key}" \ -H "DD-APPLICATION-KEY: ${app_key}" \ "https://api.datadoghq.com/api/v1/slo/${slo_id}"
#!/bin/sh -ex setup-xorg-base \ xorg-server xf86-video-vesa xf86-input-evdev xf86-input-mouse \ xf86-input-keyboard udev xinit if [ -z "$DWM" ]; then DWM=dwm; fi if [ -z "$ST" ]; then ST=st; fi if [ -z "$DMENU" ]; then DMENU=dmenu; fi if [ -z $"XRANDR" ]; then XRANDR=xrandr; fi if [ -z $"XRDP" ]; then XRDP=xrdp; fi apk add $DWM $ST $DMENU $XRANDR $XRDP cat << EOF > /home/$VAGRANT_USERNAME/.xinitrc #!/bin/sh st & exec dwm EOF chmod +x /home/$VAGRANT_USERNAME/.xinitrc chown $VAGRANT_USERNAME /home/$VAGRANT_USERNAME/.xinitrc
<reponame>josebright/tulip_foundation_website import { Modal } from 'react-bootstrap'; import React, { useState } from 'react'; import styled from 'styled-components'; //import { Project } from '../../Redux/constant'; import { Link } from 'react-router-dom'; import CountDown from '../CountDown/EventTimer'; const ProjectStyled = styled.div` /* border: 2px solid blue; */ margin: 30px 0; padding: 10px 0; `; const ProjectImg = styled.div` width: 100%; height: 400px; overflow: hidden; img { width: 100%; height: 100%; object-fit: cover; } @media (max-width: 360px) { margin: 10px 0; } `; const ProjectContent = styled.div` .date { opacity: 0.5; } button { background: transparent; color: orange; border-bottom: 1px solid; transition: 0.3s; } button:hover { transform: scale(1.2); } @media (max-width: 360px) { h3 { font-size: 20px; } } `; export default function Projects({ image, order, title, date, desc, modal, link, companyname, }) { const [show, setShow] = useState(false); const handleClose = () => setShow(false); const handleShow = () => setShow(true); const handleModal = () => { if (show) { return ( <Modal show={show} onHide={handleClose} size='lg'> <Modal.Header image={image} closeButton> {/* <img src={image} alt='' /> */} <img src={image} alt='' className='img-fluid' /> <Modal.Title> <div className='row'> <div className='col-md-12'> <h2>{title}</h2> </div> </div> {date ? ( <CountDown events={date .replace('rd', '') .replace('th', '') .replace('st', '') .replace('nd', '')} /> ) : null} {/* str.replace(/#|_/g,''); */} </Modal.Title> </Modal.Header> <Modal.Body> <div className='row'> <div className='col-12'> <p>{modal.article}</p> </div> </div> </Modal.Body> <Modal.Footer> <div className='row'> {!link ? ( <> {' '} <div className='col-md-6'> <Link to='/volunteer' className='btn1 btn-d' onClick={handleClose} > Volunteer </Link> </div> <div className='col-md-6'> <Link to='/donation' className='btn1 btn-d' onClick={handleClose} > Donate </Link> </div> </> ) : ( <div className='col-md-12'> <button className='btn1 btn-d' onClick={handleClose}> Close </button> </div> )} </div> </Modal.Footer> </Modal> ); } }; return ( <div className='container'> <ProjectStyled> <div className='row d-flex justify-content-start'> {/* {console.log(date.replace('th', ''))} */} <div className={ order ? ` col-md-6 order-md-0 order-lg-3 ${order}` : 'col-md-6 ' } > <ProjectImg> <img src={image} alt='' /> </ProjectImg> </div> <div className='col-md-6 '> <ProjectContent> <h3>{title}</h3> {date ? ( <p className='date'> <span>Program Date: </span> {date ? date : 'Check back for the date'} </p> ) : null} {companyname ? ( <p className='companyname'> {/* <span>By: </span> */} <a href={link} rel='noreferrer' target='_blank' onClick={handleClose} style={{ color: '#000 !' }} > {companyname} </a> </p> ) : null} <p>{desc}</p> <button className='read-more' onClick={handleShow}> Read More </button> </ProjectContent> </div> </div> </ProjectStyled> {handleModal()} </div> ); }
import requests from PIL import Image from io import BytesIO import os # Function to apply box shadow effect to an image def apply_box_shadow(image_path, output_path): img = Image.open(image_path) img_with_shadow = Image.new("RGBA", img.size) img_with_shadow.paste(img, (0, 0), img) shadow = Image.new("RGBA", img.size, (0, 0, 0, 0)) for x in range(-10, 11, 5): for y in range(-10, 11, 5): shadow.paste((204, 204, 204, 255), (x, y, x + img.size[0], y + img.size[1]), img) img_with_shadow = Image.alpha_composite(img_with_shadow, shadow) img_with_shadow.save(output_path) # Function to process image URLs and apply box shadow effect def process_image_urls(input_file, output_directory): with open(input_file, 'r') as file: image_urls = file.readlines() for url in image_urls: url = url.strip() try: response = requests.get(url) if response.status_code == 200: image = Image.open(BytesIO(response.content)) output_path = os.path.join(output_directory, os.path.basename(url)) apply_box_shadow(image, output_path) else: print(f"Failed to download image from {url}") except Exception as e: print(f"Error processing {url}: {e}") # Example usage input_file_path = 'image_urls.txt' output_directory_path = 'modified_images' process_image_urls(input_file_path, output_directory_path)
<reponame>decosterkevin/foodtrack-back<filename>core/migrations/0002_remove_product_exploitation.py # Generated by Django 2.2.4 on 2019-08-16 16:02 from django.db import migrations class Migration(migrations.Migration): dependencies = [ ('core', '0001_initial'), ] operations = [ migrations.RemoveField( model_name='product', name='exploitation', ), ]
PART_NAME=firmware platform_machine() { grep "machine" /proc/cpuinfo | sed "s/.*:[ \t]*//" | sed "s/-.*//g" } platform_expected_image() { local machine=$(platform_machine) case "$machine" in # this is from dts "GL") [ -e /dev/ubi0 ] && echo "siwifi-1688a-nand" || echo "siwifi-1688a"; return;; "sf16a18") echo "siwifi-1688a"; return;; "sf19a28") echo "siwifi-1688a"; return;; esac } siwifixx_identify() { local magic magic=$(get_magic_long "$1") case "$magic" in "27051956") echo "a18" return ;; "xxxxxxxx") echo "w18" return ;; esac echo "Sysupgrade is unknown" } platform_check_image() { [ "$#" -gt 1 ] && return 1 local file_type=$(siwifixx_identify "$1") local magic local error=0 case "$file_type" in "a18") local dev_siwifi_id=$(platform_expected_image) #echo "Found A18 image with device siwifi_id $dev_siwifi_id" if [ "$dev_siwifi_id" != "siwifi-1688a" ]; then echo "Invalid image type." error=1 fi ;; "w18") local dev_siwifi_id=$(platform_expected_image) if [ "$dev_siwifi_id" != "siwifi-xxxxx" ]; then echo "Invalid image type." error=1 fi ;; *) local dev_siwifi_id=$(platform_expected_image) if [ "$dev_siwifi_id" != "siwifi-1688a-nand" ]; then echo "Invalid image type. Please use only .trx files" error=1 fi ;; esac return $error } platform_do_upgrade() { local siwifi_id=$(platform_expected_image) local cmd="" case "$siwifi_id" in "siwifi-1688a-nand") cmd=$ARGV nand_do_upgrade "$cmd" ;; "siwifi-1688a" |\ "siwifi-1688b") cmd=$ARGV default_do_upgrade "$cmd" ;; *) default_do_upgrade "$cmd" ;; esac } disable_watchdog() { killall watchdog ( ps | grep -v 'grep' | grep '/dev/watchdog' ) && { echo 'Could not disable watchdog' return 1 } }
set -u set -e debootstrap --components=main,universe,multiverse --include=vim,build-essential,git,redis-server,lua5.1,postgresql,libpq-dev,python-dev,python3-dev,memcached,mongodb,libperl-dev,ruby2.0,ruby2.0-dev,wget,language-pack-en,libcurl4-openssl-dev,mysql-server,libyajl-dev,beanstalkd,ssh,rsync,libluajit-5.1-dev,curl,ipython,liblocal-lib-perl,python-virtualenv,python-pip,libpcre3-dev,libjansson-dev,quota,gawk,libreadline6-dev,libyaml-dev,libsqlite3-dev,sqlite3,autoconf,libgdbm-dev,libncurses5-dev,automake,libtool,bison,libffi-dev,libphp5-embed,php5-memcached,php5-memcache,php5-json,php5-mysql,php5-gd,php5-pgsql,php5-dev,libxml2-dev,libdb-dev,libbz2-dev,libjpeg-dev,libpng12-dev,ruby-rack,postgresql-contrib,postgis,libxslt-dev,libsphinxclient-dev,sphinxsearch,libmysqlclient-dev,imagemagick,libgraphicsmagick1-dev,libgraphicsmagick++1-dev,libmagick++-dev,libmagickcore-dev,libmagickwand-dev,libreoffice,tesseract-ocr,tesseract-ocr-ita,pdftk,wkhtmltopdf,graphicsmagick,poppler-utils,ghostscript,language-pack-it,language-pack-de,language-pack-es,language-pack-pt,language-pack-pl,nullmailer,nodejs,nano,htop,emacs,mercurial,screen,apache2-utils,unzip,erlang-nox,libdatetime-perl,libmemcached-dev,libapache2-svn,libapache2-mod-gnutls,apache2-mpm-prefork,libapache2-mod-xsendfile,libapache2-mod-php5,php-pear,db5.1-util,libcap2-bin,libcap2-dev,libode-dev,gettext saucy /distros/saucy chroot /distros/saucy /bin/bash -x <<'EOF' set -u set -e echo "exit 101" > /usr/sbin/policy-rc.d chmod 755 /usr/sbin/policy-rc.d mkdir /.old_root mkdir /containers mkdir -p /opt/unbit/uwsgi/plugins rm /etc/hosts /etc/hostname ln -s /run/resolvconf/hostname /etc/hostname ln -s /run/resolvconf/hosts /etc/hosts cd /root git clone https://github.com/unbit/nss-unbit cd nss-unbit make EOF cp nsswitch.conf /distros/saucy/etc/nsswitch.conf cp shortcuts.ini /distros/saucy/opt/unbit/uwsgi/shortcuts.ini
#!/bin/sh -xe if [ ! -f /etc/ssh/ssh_host_rsa_key ]; then echo "No RSA Host Key found - generating." ssh-keygen -f /etc/ssh/ssh_host_rsa_key -N '' -t rsa fi if [ ! -f /etc/ssh/ssh_host_ecdsa_key ]; then echo "No ECDSA Host Key found - generating." ssh-keygen -f /etc/ssh/ssh_host_ecdsa_key -N '' -t ecdsa fi if [ ! -f /etc/ssh/ssh_host_ed25519_key ]; then echo "No ED25519 Host Key found - generating." ssh-keygen -f /etc/ssh/ssh_host_ed25519_key -N '' -t ed25519 fi /usr/sbin/sshd tail -f /dev/null
var _layer_test_result_8hpp = [ [ "LayerTestResult", "struct_layer_test_result.xhtml", "struct_layer_test_result" ], [ "GetTensorShapeAsArray", "_layer_test_result_8hpp.xhtml#ae0f8e7277a6e4c91446af326de42b811", null ] ];
class Genotype < ApplicationRecord belongs_to :gene has_many :cards has_many :users, :through => :cards validates :allele1, length: {is: 1} validates :allele2, length: {is: 1} validates :allele1, :allele2, presence: true validates :title, presence: true, uniqueness: true def repute_gradient case repute when 1 then ["rgb(235,255,235)", "rgb(180,255,180)", "rgb(140,255,140)", "rgb(80,225,80)", "rgb(0,200,0)"] when 2 then ["rgb(255,235,235)", "rgb(255,180,180)", "rgb(255,140,140)", "rgb(225,80,80)", "rgb(200,0,0)"] end end def color case magnitude when 0 then repute_gradient[0] when 0.1..1.5 then repute_gradient[1] when 1.6..3.5 then repute_gradient[2] when 3.6..5.9 then repute_gradient[3] else repute_gradient[4] end end def rep_text case repute when 1 then "+" when 2 then "-" when 0 then "~" end end def page_text result = page_content link_format = /(?<=\[\[)(.*?)(?=\]\])/ links = result.match(link_format) { |m| m.captures } unless links.nil? links.each do |l| result.gsub!(l, make_link(l)) end result.gsub! "[[", "&nbsp" result.gsub! "]]", "&nbsp" end result += "&nbsp" + read_more result.strip.delete("\t\r\n").html_safe end def make_link(text, page=nil) page = text.gsub " ", "_" if page.nil? ' <a href="' + "http://snpedia.com/index.php/#{page}" + '" target="_blank"' + "> #{' ' + text + ' '} </a> " end def read_more if page_content.empty? make_link("Read about the Gene", gene.title) else make_link(" ...read more", title) end end end
import assert from 'assert'; import { NowRequest, NowResponse } from '@now/node'; import Hashids from 'hashids/cjs'; import _ from 'lodash/fp'; import octokit from '../common/octokit'; import { getConfig, generatePost } from '../common/utils'; const { owner, repo, site } = getConfig(); const hashids = new Hashids(owner, 8, '0123456789abcedf'); const query = ` query ($owner: String!, $repo: String!, $number: Int!) { repository(owner: $owner, name: $repo) { issue(number: $number) { id number title body labels(first: 5) { nodes { name } } createdAt updatedAt } } } `; export default async (req: NowRequest, res: NowResponse) => { const id = _.toString(req.query.id); assert(id, 'id is required'); const issueNumber = _.toNumber(hashids.decodeHex(id)); const data = await octokit(query, { owner, repo, number: issueNumber, }); const { issue } = data.repository; res.status(200).json(generatePost(issue)); };
<gh_stars>0 /** @module event/MouseInputManager */ import { initFromConfig } from "/scripts/util/config.js" import Vec2 from "/scripts/geom/Vec2.js" export default class MouseInputManager { static defaultPreventContextMenuDefault = true static defaultPreventWheelDefault = true #target #pressed #scroll #move #onMouseDown #onMouseUp #onFocusOut #onContextMenu #onWheel #onMouseMove constructor(target = window, config = {}) { initFromConfig(this, config, MouseInputManager, "preventContextMenuDefault", "preventWheelDefault") this.#target = target this.#pressed = new Set() this.#scroll = Vec2.zero() this.#move = Vec2.zero() this.#onMouseDown = e => this.#pressed.add(`Mouse${e.button}`) this.#onMouseUp = e => this.#pressed.delete(`Mouse${e.button}`) this.#onFocusOut = e => this.#pressed.clear() this.#onContextMenu = e => { if (this.preventContextMenuDefault) e.preventDefault() } this.#onWheel = e => { if (this.preventWheelDefault) e.preventDefault() this.#scroll.assign(e.wheelDeltaX, e.wheelDeltaY) } this.#onMouseMove = e => { this.#move.assign(e.movementX, e.movementY) } target.addEventListener("mousedown", this.#onMouseDown ) target.addEventListener("mouseup", this.#onMouseUp ) target.addEventListener("focusout", this.#onFocusOut ) target.addEventListener("contextmenu", this.#onContextMenu, { passive: false }) target.addEventListener("wheel", this.#onWheel, { passive: false }) target.addEventListener("mousemove", this.#onMouseMove ) } disable() { this.target.removeEventListener("mousedown", this.#onMouseDown ) this.target.removeEventListener("mouseup", this.#onMouseUp ) this.target.removeEventListener("focusout", this.#onFocusOut ) this.target.removeEventListener("contextmenu", this.#onContextMenu) this.target.removeEventListener("wheel", this.#onWheel ) this.target.removeEventListener("mousemove", this.#onMouseMove ) return this } isPressed(code) { const syns = { MouseLeft: "Mouse0", MouseMiddle: "Mouse1", MouseRight: "Mouse2", MousePrevious: "Mouse3", MouseNext: "Mouse4" } code = syns[code] ?? code return this.#pressed.has(code) } move() { return this.#move.clone() } scroll() { return this.#scroll.clone() } reset() { this.#scroll.assign(0) this.#move.assign(0) return this } get target() { return this.#target } }
#!/bin/bash ##------------------------------------------------## # Author: Mark Nguyen ##------------------------------------------------## # This script takes a list of date-time values and # convert each to epoc equivalent. It then # prints out the longest length of time between # any two date-time in the list. ##------------------------------------------------## # File name: datetime_epoc.sh # # Usage: $0 [infile] # infile should contain a list of date-time values # ##------------------------------------------------## #-----------------------function show_usage---------------------# # This shows the program usage when invalid input args occured. # #---------------------------------------------------------------# function show_usage() { cat << EOF This script takes an input text file containing date-time values Usage: $0 [in_file] Options: -h Show this message. e.g. $0 ./datetime.dat EOF } export -f show_usage #-----------------------function find_longest_time---------------------# # Note: # bash --date and -d option expects the date in US or ISO8601 format, # i.e. mm/dd/yyyy or yyyy-mm-dd, not in UK, EU, or any other format. #----------------------------------------------------------------------# function find_longest_time() { local infile=$1 if test -f $infile; then # read all line in file into an array IFS=$'\n' read -d '' -r -a std_dt < $infile # Explicitly report array content. let idx=0 let MAX=0 let MIN=$((X=2**32)) if [[ "${#std_dt[@]}" -gt 0 ]]; then #-- process each line --# for line in "${std_dt[@]}" ; do # ignore comment line [[ "$line" =~ ^#.*$ ]] && continue # convert to epoc value epoc_dt=$(date --date "${line}" +%s) # find max value if [ ${epoc_dt} -gt $MAX ] ; then MAX=${epoc_dt} fi # find min value if [ ${epoc_dt} -lt $MIN ] ; then MIN=${epoc_dt} fi done # calculate long length of time between for two set of date-time DIFF=$(( $MAX - $MIN )) echo "The longest distance past (time length) is ${DIFF} seconds; starting from $(date -d @$MAX) and going back to $(date -d @$MIN)." fi else echo "Input not found" fi } export -f find_longest_time #-- main program --# # Checking input parameters if [ $# -lt 1 ]; then show_usage exit 1; fi find_longest_time $1 exit 0; ' Run-time output: =============== markn@raspberrypi3:~/devel/py-src/DailyCodingChallenge/bash_scripts $ bash datetime_epoc.sh ./datetime.dat The longest distance past (time length) is 751565047 seconds; starting from Sat 1 Jan 21:51:09 PST 2022 and going back to Tue 10 Mar 05:47:02 PST 1998. '
<filename>DiscountApp.java /* * @author <NAME> * 11/05/2017 * DiscountApp.java */ import javax.swing.JOptionPane; //Imports GUI input/output window //Class Name public class DiscountApp{ //Main method public static void main (String args[]){ //Users Inputs String member=""; String time=""; int cost=0; double discount=0.0; //Declare Objects Discount myDiscount=new Discount(); //Input - Welcome JOptionPane.showMessageDialog(null, "Welcome to your local Market. Please enter iwhether or not, you are a member; followed by the time of day; and finally the total cost of your shopping. We will then calculate your discount!"); //Asking of the questions and storing answers member=JOptionPane.showInputDialog(null, "Are you a Market member? Please answer 'Yes' or 'No'."); //Sends to instan class myDiscount.setMember(member); time=JOptionPane.showInputDialog(null, "What time of day is it? Please answer 'Morning' or 'Evening'."); myDiscount.setTime(time); cost=Integer.parseInt(JOptionPane.showInputDialog(null, "Please enter the total cost of your shopping.")); myDiscount.setCost(cost); //Compute the process myDiscount.compute(); //Output discount=myDiscount.getDiscount(); JOptionPane.showMessageDialog(null, " Your total discount for the cost of your shopping is " +discount); } }
import IndexCardBox from './IndexCardBox' export default IndexCardBox
from RFEM.initModel import * from tkinter import * from tkinter import ttk, Entry def window(mainFunc): color = '#F2F3F4' # Creating tkinter window win = Tk() win.resizable(False, False) win.title('Power of automation with RFEM6') win.geometry("520x160") win.configure(bg=color) win.grid_columnconfigure(index=0, minsize=140) win.grid_columnconfigure(index=1, minsize=80) win.grid_columnconfigure(index=2, minsize=80) win.grid_columnconfigure(index=3, minsize=70) win.grid_columnconfigure(index=4, minsize=139) # Separators y = 3 rh = 0.76 ttk.Separator(win, orient=VERTICAL).place(x=140, y=y, relheight=rh) ttk.Separator(win, orient=VERTICAL).place(x=220, y=y, relheight=rh) ttk.Separator(win, orient=VERTICAL).place(x=295, y=y, relheight=rh) ttk.Separator(win, orient=VERTICAL).place(x=400, y=y, relheight=rh) Label(text="Params Type", justify=CENTER, font="Segoe 9 bold", bg=color).grid(row=0, column=0) Label(text="Data Type", justify=CENTER, font="Segoe 9 bold", bg=color).grid(row=0, column=1) Label(text="Symbol", justify=CENTER, font="Segoe 9 bold", bg=color).grid(row=0, column=2) Label(text="Units", justify=CENTER, font="Segoe 9 bold", bg=color).grid(row=0, column=3) Label(text="Magnitude", justify=CENTER, font="Segoe 9 bold", bg=color).grid(row=0, column=4) Label(text="hall width", bg=color).grid(row=1, column=0) Label(text="hall height", bg=color).grid(row=2, column=0) Label(text="hall height", bg=color).grid(row=3, column=0) Label(text="frame spacing", bg=color).grid(row=4, column=0) Label(text="number of frames", bg=color).grid(row=5, column=0) Label(text="float", bg=color).grid(row=1, column=1) Label(text="float", bg=color).grid(row=2, column=1) Label(text="float", bg=color).grid(row=3, column=1) Label(text="float", bg=color).grid(row=4, column=1) Label(text="integer", bg=color).grid(row=5, column=1) Label(text="L", bg=color).grid(row=1, column=2) Label(text="h_o", bg=color).grid(row=2, column=2) Label(text="h_m", bg=color).grid(row=3, column=2) Label(text="f_s", bg=color).grid(row=4, column=2) Label(text="n", bg=color).grid(row=5, column=2) Label(text="meters", bg=color).grid(row=1, column=3) Label(text="meters", bg=color).grid(row=2, column=3) Label(text="meters", bg=color).grid(row=3, column=3) Label(text="meters", bg=color).grid(row=4, column=3) Label(text="-", bg=color).grid(row=5, column=3) def validateAll(val): # 1 mandatory argument, not used try: float(e1.get()) float(e2.get()) float(e3.get()) float(e4.get()) int(e5.get()) button1['state']="normal" return 1 except: button1['state']="disabled" print("disabled") return 0 # Setting entry points e1 = Entry(relief=FLAT, justify=CENTER, bg=color) e1.grid(row=1, column=4) e1.insert(INSERT, 20.0) e2 = Entry(relief=FLAT, justify=CENTER, bg=color) e2.grid(row=2, column=4) e2.insert(INSERT, 5.2) e3 = Entry(relief=FLAT, justify=CENTER, bg=color) e3.grid(row=3, column=4) e3.insert(INSERT, 7.3) e4 = Entry(relief=FLAT, justify=CENTER, bg=color) e4.grid(row=4, column=4) e4.insert(INSERT, 6.0) e5 = Entry(relief=FLAT, justify=CENTER, bg=color) e5.grid(row=5, column=4) e5.insert(INSERT, 6) def start(val): mainFunc(float(e1.get()),float(e2.get()),float(e3.get()),int(e5.get()),float(e4.get())) def close_window(val): win.destroy() # substitute for validatecommand and validation options of Entry (e1-e5) e1.bind('<FocusOut>', validateAll) e1.bind('<Key>', validateAll) e2.bind('<FocusOut>', validateAll) e2.bind('<Key>', validateAll) e3.bind('<FocusOut>', validateAll) e3.bind('<Key>', validateAll) e4.bind('<FocusOut>', validateAll) e4.bind('<Key>', validateAll) e5.bind('<FocusOut>', validateAll) e5.bind('<Key>', validateAll) button1=Button(text='Run', anchor=CENTER, width=12, height=1, bg=color, state="normal") # width=16 button1.grid(row=6, column=4) button1.bind('<ButtonRelease-1>', start) button2=Button(text='Close', anchor=CENTER, width=12, height=1, bg=color, state="normal") button2.grid(row=6, column=3) button2.bind('<ButtonRelease-1>', close_window) win.mainloop()
#!/usr/bin/env bash # Copyright 2019 Kohl's Department Stores, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. set -euxo pipefail TAG_OWNER="gitopsconfig.eunomia.kohls.io/owner" TAG_APPLIED="gitopsconfig.eunomia.kohls.io/applied" # this is needed because we want the current namespace to be set as default if a namespace is not specified. function setContext { $kubectl config set-context current --namespace="$(cat /var/run/secrets/kubernetes.io/serviceaccount/namespace)" $kubectl config use-context current } function kube { $kubectl \ -s https://kubernetes.default.svc:443 \ --token "$(cat /var/run/secrets/kubernetes.io/serviceaccount/token)" \ --certificate-authority=/var/run/secrets/kubernetes.io/serviceaccount/ca.crt \ "$@" } # addLabels OWNER TIMESTAMP - patches the YAML&JSON files in $MANIFEST_DIR, # adding labels tracking the OWNER and TIMESTAMP. The labels are intended to be # used later in function deleteByOldLabels. function addLabels { local owner="$1" local timestamp="$2" local tmpdir="$(mktemp -d)" for file in $(find "$MANIFEST_DIR" -iregex '.*\.\(ya?ml\|json\)'); do cat "$file" | yq -y -s "map(select(.!=null)|setpath([\"metadata\",\"labels\",\"$TAG_OWNER\"]; \"$owner\"))|.[]" | yq -y -s "map(select(.!=null)|setpath([\"metadata\",\"labels\",\"$TAG_APPLIED\"]; \"$timestamp\"))|.[]" \ > "$tmpdir/labeled" # We must use a helper file (can't do this in single step), as the file would be truncated if we read & write from it in one pipeline cat "$tmpdir/labeled" > "$file" done } # deleteByOldLabels OWNER [TIMESTAMP] - deletes all kubernetes resources which have # the OWNER label as provided [optional: but TIMESTAMP label different than provided]. function deleteByOldLabels { local owner="$1" local timestamp="${2:-}" # NOTE: removing componentstatus because it shows up unintended in ownedKinds: https://github.com/kubernetes/kubectl/issues/151#issuecomment-562578617 local allKinds="$(kube api-resources --verbs=list -o name | egrep -iv '^componentstatus(es)?$' | paste -sd, -)" local ownedKinds="$(kube get "$allKinds" --ignore-not-found \ -l "$TAG_OWNER==$owner" \ -o custom-columns=kind:.kind \ --no-headers=true | sort -u | paste -sd, -)" if [ -z "$ownedKinds" ]; then return fi local filter="${TAG_OWNER}==${owner}" if [[ "${timestamp}" ]]; then filter="${filter},${TAG_APPLIED}!=${timestamp}" fi kube delete --wait=false "${ownedKinds}" -l "${filter}" } function createUpdateResources { local owner="$1" local timestamp="$(date +%s)" case "$CREATE_MODE" in Apply) addLabels "$owner" "$timestamp" kube apply -R -f "$MANIFEST_DIR" deleteByOldLabels "$owner" "$timestamp" ;; Create) kube create -R -f "$MANIFEST_DIR" ;; Delete) kube delete --wait=false -R -f "$MANIFEST_DIR" ;; Patch) kube patch -R -f "$MANIFEST_DIR" ;; Replace) kube replace -R -f "$MANIFEST_DIR" ;; esac } if [ "$CREATE_MODE" == "None" ] || [ "$DELETE_MODE" == "None" ]; then echo "CREATE_MODE and/or DELETE_MODE is set to None; This means that the template processor already applied the resources. Skipping the Manage Resources step." exit 0 fi echo "Managing Resources" setContext # NOTE: Kubernetes currently requires that first *and last* character of # label values are alphanumerical - we're adding the "own" prefix & suffix to # ensure that. Also, Kubernetes requires it to be <=63 chars long, so we're # taking a MD5 hash of actual name (MD5 hash is 33 chars long). # See: https://kubernetes.io/docs/concepts/overview/working-with-objects/labels/#syntax-and-character-set owner="own.$( echo "$NAMESPACE $GITOPSCONFIG_NAME" | md5sum | awk '{print$1}' ).own" case "$ACTION" in create) createUpdateResources "$owner";; delete) deleteByOldLabels "$owner";; esac
python convnet.py --load-file "$1" \ --multiview-test 0 --test-only 1 --logreg-name logprob --test-range 10 python convnet.py --load-file "$1" \ --multiview-test 1 --test-only 1 --logreg-name logprob --test-range 10
<filename>camunda-user-task-demo/src/test/java/de/frvabe/bpm/camunda/UserTaskTest.java package de.frvabe.bpm.camunda; import static org.camunda.bpm.engine.test.assertions.ProcessEngineAssertions.assertThat; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertFalse; import static org.junit.Assert.assertNotNull; import static org.junit.Assert.assertNull; import static org.junit.Assert.assertTrue; import java.util.Date; import java.util.Map; import org.camunda.bpm.engine.RuntimeService; import org.camunda.bpm.engine.TaskService; import org.camunda.bpm.engine.runtime.ProcessInstance; import org.camunda.bpm.engine.task.Task; import org.junit.Test; import org.junit.runner.RunWith; import org.springframework.beans.factory.annotation.Autowired; import org.springframework.boot.test.context.SpringBootTest; import org.springframework.test.context.junit4.SpringRunner; @RunWith(SpringRunner.class) @SpringBootTest(classes = {Main.class}) public class UserTaskTest { @Autowired RuntimeService runtimeService; @Autowired TaskService taskService; /** * Checks if an unblocking outbound event of a User Task gets fired on the follow up date. * * @throws InterruptedException */ @Test public void timerWithTimerDate() throws InterruptedException { // start a process; the follow up date of the Demo Task will be set to 3 seconds from now ProcessInstance processInstance = runtimeService.startProcessInstanceByKey("demoProcessWithTimerDate"); assertThat(processInstance).isNotNull(); Task task = taskService.createTaskQuery().processInstanceId(processInstance.getId()) .singleResult(); Map<String, Object> variables = runtimeService.getVariables(processInstance.getId()); assertTrue(variables.containsKey("demoTask.followUpDate")); Map<String, Object> variablesLocal = runtimeService.getVariablesLocal(task.getExecutionId()); assertFalse(variablesLocal.containsKey("demoTaskBoundaryEvent.fired")); Thread.sleep(2500); // nothing should have changed variables = runtimeService.getVariables(processInstance.getId()); assertTrue(variables.containsKey("demoTask.followUpDate")); variablesLocal = runtimeService.getVariablesLocal(task.getExecutionId()); assertFalse(variablesLocal.containsKey("demoTaskBoundaryEvent.fired")); Thread.sleep(7500); // timer is expected to have been fired after this sleep variables = runtimeService.getVariables(processInstance.getId()); assertTrue(variables.containsKey("demoTask.followUpDate")); variablesLocal = runtimeService.getVariablesLocal(task.getExecutionId()); assertTrue(variablesLocal.containsKey("demoTaskBoundaryEvent.fired")); // cleanup after test runtimeService.deleteProcessInstance(processInstance.getId(), "JUnit test"); } /** * Checks if a Timer with cycle detects the maturity of a User Task. * * @throws InterruptedException */ @Test public void timerWithTimeCycle() throws InterruptedException { // start a process; the follow up date of the Demo Task will be set to 3 seconds from now ProcessInstance processInstance = runtimeService.startProcessInstanceByKey("demoProcessWithTimerCycle"); assertThat(processInstance).isNotNull(); Task task = taskService.createTaskQuery().processInstanceId(processInstance.getId()) .singleResult(); assertNotNull(task.getFollowUpDate()); assertTrue(task.getFollowUpDate().after(new Date())); Map<String, Object> variablesLocal = runtimeService.getVariablesLocal(task.getExecutionId()); assertFalse(variablesLocal.containsKey("demoTaskBoundaryEvent.followUpDateReached")); Thread.sleep(2000); // nothing should have changed variablesLocal = runtimeService.getVariablesLocal(task.getExecutionId()); assertFalse(variablesLocal.containsKey("demoTaskBoundaryEvent.followUpDateReached")); Thread.sleep(7500); // timer is expected to have been fired after this sleep variablesLocal = runtimeService.getVariablesLocal(task.getExecutionId()); assertTrue(variablesLocal.containsKey("demoTaskBoundaryEvent.followUpDateReached")); // cleanup after test runtimeService.deleteProcessInstance(processInstance.getId(), "JUnit test"); } /** * Test to update the followUp date of a given user task instance. Also check of task scope * variables are not changed. */ @Test public void updateFollowUpDate() { ProcessInstance processInstance = runtimeService.startProcessInstanceByKey("demoProcessWithTimerCycle"); Task task = taskService.createTaskQuery().processInstanceId(processInstance.getId()) .singleResult(); runtimeService.setVariableLocal(task.getExecutionId(), "foo", "bar"); String taskInstanceId = task.getId(); String taskExecutionId = task.getExecutionId(); // followUpDate is set in BPM diagram assertNotNull(task.getFollowUpDate()); // now unset followUpDate task.setFollowUpDate(null); taskService.saveTask(task); // request task Task task1 = taskService.createTaskQuery().processInstanceId(processInstance.getId()) .singleResult(); // check task properties assertEquals(taskInstanceId, task1.getId()); assertEquals(taskExecutionId, task1.getExecutionId()); assertNull(task.getFollowUpDate()); // check task scope variable assertEquals("bar", runtimeService.getVariableLocal(task.getExecutionId(), "foo")); // cleanup after test runtimeService.deleteProcessInstance(processInstance.getId(), "JUnit test"); } }
var foods = ['Apples', 'Bananas', 'Oranges']; 1 for (var i=0; i<foods.length; i++) { 2 if (foods[i] == 'Apples') { 3 alert(foods[i] + ' are my favorite!'); 4 } else { alert(foods[i] + ' are okay.'); 5 } }
<gh_stars>100-1000 import { Span } from '@opentelemetry/api'; import { callHookOnlyOnRecordingSpan } from '../payload-collection/recording-span'; import { AwsSdkInstrumentationConfig, NormalizedRequest, NormalizedResponse, } from '@opentelemetry/instrumentation-aws-sdk'; import { DbExtendedAttribute, MessagingExtendedAttribute } from '../enums'; import { AutoInstrumentationOptions } from '../types'; const enum AttributeNames { AWS_REQUEST_PARAMS = 'aws.request.params', } const whiteListParams: Record<string, string[]> = { sqs: ['QueueUrl', 'DelaySeconds', 'MaxNumberOfMessages', 'WaitTimeSeconds'], s3: ['Bucket', 'Key', 'ACL', 'ContentType', 'ResponseContentType'], sns: ['TopicArn'], kinesis: ['StreamName', 'PartitionKey'], firehose: ['DeliveryStreamName'], ebs: ['SnapshotId'], ssm: ['Name'], lambda: ['FunctionName'], athena: ['WorkGroup', 'QueryString'], sts: ['RoleArn'], }; const getRequestWhitelistedParams = (serviceName: string, requestParams: Record<string, any>): Record<string, any> => { const paramsToCapture: string[] = whiteListParams[serviceName]; if (!paramsToCapture || !requestParams) return; return paramsToCapture.reduce((whiteListParams: Record<string, any>, currParamName: string) => { const val = requestParams[currParamName]; if (val !== undefined) { whiteListParams[currParamName] = val; } return whiteListParams; }, {}); }; const addSqsPayload = (span: Span, request: NormalizedRequest) => { let payload; switch (request.commandName) { case 'sendMessage': { payload = request.commandInput?.MessageBody; if (typeof payload !== 'string') return; break; } case 'sendMessageBatch': { let messagesPayload = request.commandInput?.Entries?.map((entry) => ({ msgId: entry.Id, payload: entry.MessageBody, })); try { payload = JSON.stringify(messagesPayload); } catch {} break; } } if (payload === undefined) return; span.setAttribute(MessagingExtendedAttribute.MESSAGING_PAYLOAD, payload); }; const awsSdkRequestHook = (options: AutoInstrumentationOptions) => (span: Span, request: NormalizedRequest) => { const paramsToAttach = getRequestWhitelistedParams(request.serviceName, request.commandInput); if (paramsToAttach) { try { span.setAttribute(AttributeNames.AWS_REQUEST_PARAMS, JSON.stringify(paramsToAttach)); } catch {} } switch (request.serviceName) { case 'sqs': if (options.collectPayloads) { addSqsPayload(span, request); } break; } }; const awsSdkResponseHook = (span: Span, response: NormalizedResponse) => { if (response.request.serviceName === 'dynamodb') { if (typeof response.data !== 'object') return; span.setAttribute(DbExtendedAttribute.DB_RESPONSE, JSON.stringify(response.data)); } }; interface SqsMessage { Body?: string; } const sqsProcessCapturePayload = (span: Span, message: SqsMessage) => { if (message.Body === undefined) return; span.setAttribute(MessagingExtendedAttribute.MESSAGING_PAYLOAD, message.Body); }; export const awsSdkInstrumentationConfig = (options: AutoInstrumentationOptions): AwsSdkInstrumentationConfig => ({ preRequestHook: callHookOnlyOnRecordingSpan(awsSdkRequestHook(options)), responseHook: options.collectPayloads && callHookOnlyOnRecordingSpan(awsSdkResponseHook), sqsProcessHook: options.collectPayloads && callHookOnlyOnRecordingSpan(sqsProcessCapturePayload), suppressInternalInstrumentation: options.suppressInternalInstrumentation, });
#!/bin/sh # Detect on which platform you are to do multiplatform script case `uname` in Darwin) echo "You are on a mac -> Darwin" ;; Linux) echo "You are on linux" ;; esac
package org.hiro.input.keyboard.equipment; import org.hiro.Pack; import org.hiro.RingMethod; import org.hiro.character.Player; import org.hiro.input.keyboard.KeyboardCommand; import org.hiro.things.ObjectType; import org.hiro.things.Thing; public class PutOnRingCommand implements KeyboardCommand { @Override public void execute(Player player) { Thing obj = Pack.get_item("put on", ObjectType.RING); RingMethod.ring_on(player, obj); } }
<reponame>andrewjohnston99/SouthfaceEquityEvaluator<filename>resources/js/app.js<gh_stars>1-10 /** * Load Javascript dependencies */ require('./bootstrap'); require('flatpickr/dist/flatpickr');
#!/bin/bash # Copyright 2019 The VKB Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. set -e # fail on error set -x # display commands SCRIPT_DIR=`dirname "$BASH_SOURCE"` source $SCRIPT_DIR/../scripts/linux/build.sh RELEASE gcc
/* problem: Seven different symbols (known) I = 1 Iv = 4 V = 5 IX = 9 X = 10 XL = 40 L = 50 XC = 90 C = 100 CD = 400 D = 500 CM = 900 M = 1000 Make the number by combining largest possible symbols Largest to smallest, left to right questions: are we only doing this for positive numbers? YES can the string be invalid roman numeral? NO can the string be empty? NO we return the NUMBER from the roman numeral roman numeral always fits in int? YES can you have combinations that would equal another numeral? ex. IVI = 5? NO test cases: I = 1 IV = 4 XIV = 14 XXIV = 24 XXIII = 23 solutions: loop through string, match against know symbol, add to int improvements: could build up an array of changes to improve debugging Just print the array to see how solution was arrived ordered array of romanNumeral structs where romanNumeral is the string "CM" and value 901 loop over ordered array to find match, apply value don't repeat j++ and continue, see if a 2 letter match was found, do in one place analysis: linear time loops through array len(s) times linear space number of strings increases with length of strings could reference chars or bytes directly to improve thsi */ func romanToInt(s string) int { var i int for j := 0; j < len(s); j++ { if j < len(s) - 1 { switch fmt.Sprintf("%c%c", s[j], s[j + 1]) { case "CM": i += 900 j++ continue case "CD": i += 400 j++ continue case "XC": i += 90 j++ continue case "XL": i += 40 j++ continue case "IX": i += 9 j++ continue case "IV": i += 4 j++ continue } } switch s[j] { case 'M': i += 1000 case 'D': i += 500 case 'C': i += 100 case 'L': i += 50 case 'X': i += 10 case 'V': i += 5 case 'I': i += 1 } } return i }
alias reload='source ~/.zshrc' # tmux alias tmuxa='tmux attach -t' alias tmuxn='tmux new-session -s' alias tmuxl='tmux ls' # tmuxinator alias mux='tmuxinator' alias editmux='code ~/.tmuxinator' # code # ssh alias sshdev='' # misc # from: https://remysharp.com/2018/08/23/cli-improved alias cat='bat' alias preview="fzf --preview 'bat --color \"always\" {}'" alias help='tldr' # Heads and tails :D # From paulmillr/dotfiles alias -g f2='| head -n 2' alias -g f10='| head -n 10' alias -g l10='| tail -n 10'
#!/bin/bash # # Author: vencol,neucrack # #################################### # help info function help() { echo "Usage:" echo "use './build.sh PROJECTNAME' to build the project in ./PROJECTNAME " echo " eg: ./build.sh app " echo "use './build.sh demo PROJECTNAME' to build demo in ./demo/PROJECTNAME " echo "use './build.sh clean PROJECTNAME' to clean the project PROJECTNAME build files" echo "use './build.sh clean all' to clean all the project build files " echo "use './build.sh ... release' to build release software " echo " eg: './build.sh demo gpio release' " } if [[ "$1x" == "helpx" || "$1x" == "-hx" || "$1x" == "-helpx" || "$1x" == "--helpx" ]]; then help exit 0 fi ###################################### compileMode='debug' paramNum=$# if [[ "${!#}x" == "releasex" ]]; then compileMode='release' paramNum=$(($paramNum-1)) fi #################################### # check lib files CSDK_MEM_DEF_PATH=./platform/csdk CSDK_LIB_PATH=./platform/csdk/$compileMode memdef_file=$(ls $CSDK_MEM_DEF_PATH|grep -w 'memd.def') elf_file=$(ls $CSDK_LIB_PATH|grep '.elf') lib_file=$(ls $CSDK_LIB_PATH|grep '.lod') if [[ "${memdef_file}aa" = "aa" || "${elf_file}aa" = "aa" || "${lib_file}aa" = "aa" ]]; then echo "!!!!!!!!!!!!!!" echo "NO LIB FILES" echo "!!!!!!!!!!!!!!" echo "please check platform/csdk folder, it can not be empty" echo "" echo "Plese download again from " echo "" echo " https://github.com/Ai-Thinker-Open/GPRS_C_SDK/releases" echo "" exit 1 fi ##################################### start_time=`date +%s` #where the cygwin install in unix path,example if windows path is G:\CSDTK\cygwin,cygwin path may be /cygdrive/g/CSDTK/cygwin # CYGWIN_HOME= # if [[ ! -d $CYGWIN_HOME ]]; then # echo PATH $CYGWIN_HOME is not exist # exit # fi #set the path # export PATH=$CYGWIN_HOME/bin:$CYGWIN_HOME/crosscompiler/bin:$CYGWIN_HOME/cooltools:/bin:/usr/bin; export PATH=/bin:/crosscompiler/bin:/cooltools:/bin:/usr/bin:$PATH; # echo path:$PATH export SOFT_WORKDIR=`pwd` echo "param number:$paramNum" echo "compileMode:$compileMode" if [[ $paramNum -eq 1 ]]; then export IS_PROJECT_DIR=$SOFT_WORKDIR/$1 if [[ ! -d $IS_PROJECT_DIR ]]; then echo "project $1 error path:$IS_PROJECT_DIR"; exit fi if [[ "$1x" == "initx" ]]; then sed -i '15d' Makefile sed -i "15i\#" Makefile else sed -i '15d' Makefile sed -i "15i\LOCAL_MODULE_DEPENDS += $1" Makefile fi export PROJ_NAME=$1 elif [[ $paramNum -eq 2 ]]; then if [[ "$1x" == "cleanx" ]]; then if [[ "$2x" == "allx" ]]; then rm -rf $SOFT_WORKDIR/build rm -rf $SOFT_WORKDIR/hex else rm -rf $SOFT_WORKDIR/build/$2 rm -rf $SOFT_WORKDIR/hex/$2 rm -f $SOFT_WORKDIR/build/$2_build.log fi echo "clear project $2 end"; exit elif [[ "$1x" == "demox" ]]; then export IS_PROJECT_DIR=$SOFT_WORKDIR/demo/$2 if [[ ! -d $IS_PROJECT_DIR ]]; then echo "demo $2 error path $IS_PROJECT_DIR"; exit fi export PROJ_NAME=$2 # sed -i '5d' Makefile # sed -i "5i\LOCAL_LIBS += platform/lib/libinit.a" Makefile sed -i '15d' Makefile sed -i "15i\LOCAL_MODULE_DEPENDS += demo/$2" Makefile elif [[ "$1x" == "projectx" ]]; then export IS_PROJECT_DIR=$SOFT_WORKDIR/project/$2 if [[ ! -d $IS_PROJECT_DIR ]]; then echo "demo $2 error path $IS_PROJECT_DIR"; exit fi export PROJ_NAME=$2 # sed -i '5d' Makefile # sed -i "5i\LOCAL_LIBS += platform/lib/libinit.a" Makefile sed -i '15d' Makefile sed -i "15i\LOCAL_MODULE_DEPENDS += project/$2" Makefile fi else help exit 0 fi # if [[ ! -d target/$PROJ_NAME ]]; then # cp -rf target/init target/$PROJ_NAME # echo "user default for init-target"; # fi #build path and log LOG_FILE_PATH=$SOFT_WORKDIR/build if [ ! -d ${LOG_FILE_PATH} ]; then mkdir ${LOG_FILE_PATH} fi LOG_FILE=${LOG_FILE_PATH}/${PROJ_NAME}_build.log echo "compile project $PROJ_NAME"; echo "compile path $IS_PROJECT_DIR"; MAKE_J_NUMBER=`cat /proc/cpuinfo | grep vendor_id | wc -l` echo "core number:$MAKE_J_NUMBER" rm -rf $SOFT_WORKDIR/hex/$PROJ_NAME cd $SOFT_WORKDIR if [ ${MAKE_J_NUMBER} -gt 1 ]; then make -j${MAKE_J_NUMBER} CT_RELEASE=$compileMode 2>&1 | tee ${LOG_FILE} else make CT_RELEASE=$compileMode 2>&1 | tee ${LOG_FILE} fi rm -f $SOFT_WORKDIR/hex/${PROJ_NAME}_${compileMode}/* rm -rf $SOFT_WORKDIR/hex/${PROJ_NAME}_${compileMode} mkdir $SOFT_WORKDIR/hex/${PROJ_NAME}_${compileMode} cp -f $SOFT_WORKDIR/hex/$PROJ_NAME/* $SOFT_WORKDIR/hex/${PROJ_NAME}_${compileMode} rm -rf $SOFT_WORKDIR/hex/$PROJ_NAME # if [[ "$1x" == "initx" ]]; then # cp build/init/init/lib/libinit_*.a platform/lib/libinit.a # fi end_time=`date +%s` time_distance=`expr ${end_time} - ${start_time}` date_time_now=$(date +%F\ \ %H:%M:%S) echo === Build Time: ${time_distance}s at ${date_time_now} === | tee -a ${LOG_FILE} # print RAM and ROM info if [[ $paramNum -eq 1 ]]; then if [[ "$1aa" != "cleanaa" ]]; then mapPathName=$1 else exit 0 fi else mapPathName=$2 fi MAP_FILE_PATH=./build/$mapPathName/$mapPathName.map MEMD_DEF_PATH=./platform/csdk/memd.def map_file=$(ls ./build/$mapPathName|grep '.map') if [[ "${map_file}aa" = "aa" ]]; then echo "!!!!!!!!!!!!!!!!!!!!" echo " BUILD FAILED" echo "!!!!!!!!!!!!!!!!!!!!" exit 1 fi ram_total=$(grep -n "USER_RAM_SIZE" $MEMD_DEF_PATH | awk '{print $3}') rom_total=$(grep -n "USER_ROM_SIZE" $MEMD_DEF_PATH | awk '{print $3}') rom_start=$(grep -n "__rom_start = ." $MAP_FILE_PATH | awk '{print $2}') rom_rw_start=$(grep -n "__user_rw_lma = ." $MAP_FILE_PATH | awk '{print $2}') ram_start=$(grep -n "__user_rw_start = ." $MAP_FILE_PATH | awk '{print $2}') ram_rw_data_end=$(grep -n "__user_rw_end = ." $MAP_FILE_PATH | awk '{print $2}') ram_end=$(grep -n "__user_bss_end = ." $MAP_FILE_PATH | awk '{print $2}') # echo $ram_start $ram_end ram_used=$(($ram_end-$ram_start)) ram_used_percent=$(awk 'BEGIN{printf "%.2f%\n",('$ram_used'/'$ram_total')*100}') rw_data_size=$(($ram_rw_data_end-$ram_start)) rom_used=$(($rom_rw_start-$rom_start+$rw_data_size)) rom_used_percent=$(awk 'BEGIN{printf "%.2f%\n",('$rom_used'/'$rom_total')*100}') echo ROM total: ${rom_total}\($((${rom_total}))\) Bytes, used: $rom_used Bytes \($rom_used_percent\) echo RAM total: ${ram_total}\($((${ram_total}))\) Bytes, used: $ram_used Bytes \($ram_used_percent\) exit
import { CanActivate, ExecutionContext, Injectable, Logger, UnauthorizedException } from '@nestjs/common'; import { Observable } from 'rxjs'; import { LoggerMiddleware } from './middelware/logger.middleware'; import { Reflector } from '@nestjs/core'; @Injectable() export class AuthGuard implements CanActivate { constructor(private reflector: Reflector){} canActivate( context: ExecutionContext, ): boolean | Promise<boolean> | Observable<boolean> { const roles = this.reflector.get<string[]>('roles', context.getHandler()); const req = context.switchToHttp().getRequest() const user = req.body["role"] console.log("AuthGurd user name :" ,req.body["username"] ); // console.log(user,"AuthGurd User"); if (!roles) { console.log('There is no Role field'); return true; } else{ if (roles == user) { console.log("You are admin"); return true } else{ console.log("is Not Auth Gard"); throw new UnauthorizedException() } } } }
/* * Copyright 2016-2019 the original author or authors. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.glowroot.instrumentation.jaxrs; import java.io.File; import java.io.Serializable; import com.ning.http.client.AsyncHttpClient; import org.apache.catalina.Context; import org.apache.catalina.loader.WebappLoader; import org.apache.catalina.startup.Tomcat; import org.glowroot.instrumentation.test.harness.AppUnderTest; import org.glowroot.instrumentation.test.harness.util.Ports; public class InvokeJaxrsResourceInTomcat implements AppUnderTest { @Override public void executeApp(Serializable... args) throws Exception { String webapp = (String) args[0]; String contextPath = (String) args[1]; String path = (String) args[2]; executeApp(webapp, contextPath, path); } private void executeApp(String webapp, String contextPath, String url) throws Exception { int port = Ports.getAvailable(); Tomcat tomcat = new Tomcat(); tomcat.setBaseDir("target/tomcat"); tomcat.setPort(port); Context context = tomcat.addWebapp(contextPath, new File("src/test/resources/" + webapp).getAbsolutePath()); WebappLoader webappLoader = new WebappLoader(InvokeJaxrsResourceInTomcat.class.getClassLoader()); context.setLoader(webappLoader); tomcat.start(); AsyncHttpClient asyncHttpClient = new AsyncHttpClient(); int statusCode = asyncHttpClient.prepareGet("http://localhost:" + port + contextPath + url) .execute().get().getStatusCode(); asyncHttpClient.close(); if (statusCode != 200) { throw new IllegalStateException("Unexpected status code: " + statusCode); } tomcat.stop(); tomcat.destroy(); } }
#!/bin/sh sed -e 's/}}/}/g' -e 's/{{/\${/g' config/$ENVIRONMENT-config.json > config/$ENVIRONMENT-config-tmp.json && mv config/$ENVIRONMENT-config-tmp.json config/$ENVIRONMENT-config.json envsubst < config/$ENVIRONMENT-config.json > config/$ENVIRONMENT-config-tmp.json && mv config/$ENVIRONMENT-config-tmp.json config/$ENVIRONMENT-config.json java -Xms32m \ -Xmx$JVM_XMX \ -Dfile.encoding=UTF-8 \ -Duser.timezone=Asia/Ho_Chi_Minh \ -Duser.language=en \ -Duser.country=US \ -Djava.io.tmpdir=/tmp \ -Denv=$ENVIRONMENT \ -Dmode=DEPLOY \ -jar app.jar
# Pipeline started at 06-15 07:17:11 ln -sf /project/shefflab/data//guertin/fastq/K562_70pctRNA.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/K562_RNA-seq_70.fastq.gz pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/K562_RNA-seq_70.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1.fastq cutadapt --version (cutadapt -j 12 -m 2 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt seqtk trimfq -b 0 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_noadap.fastq | seqtk seq -L 2 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_processed.fastq grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{print $(NF-1)}' grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{print $(NF-1)}' awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_short.fastq | awk '{print $1}' echo '### Calculate the number of trimmed reads' fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_processed.fastq touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/processed_R1.flag Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}' awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}' awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}' awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}' awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}' awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}' (bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id K562_RNA-seq_70 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/prealignments/K562_RNA-seq_70_human_rDNA_unmap.fq 2>&1 > /dev/null) bowtie2 -p 12 --very-sensitive --rg-id K562_RNA-seq_70 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/prealignments/K562_RNA-seq_70_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/tmpzz7s0tum -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}' pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/prealignments/K562_RNA-seq_70_human_rDNA_unmap.fq samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3 samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/chr_sizes.bed samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_noMT.bam mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2- awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_bamQC.tsv awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_bamQC.tsv awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_bamQC.tsv awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_bamQC.tsv samtools view -b -@ 12 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_unmap.bam samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_plus_TssEnrichment.txt /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_minus_TssEnrichment.txt Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_minus_TssEnrichment.txt samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_tss.bed grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_gene_body.bed bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_TSS_density.bed bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_gene_body_density.bed join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/tmp43ogt6mm awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/tmp43ogt6mm | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' awk -v OFS=' ' '{ if ($5 > 0.0384066) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/tmp43ogt6mm > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }' Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_gene_sort.bed bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_gene_coverage.bed ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed.gz pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed | sort -u awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer_sort.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_plus_coverage.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_minus_coverage.bed cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_sort.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_plus_coverage.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_minus_coverage.bed mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region" cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region_sort.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_plus_coverage.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_minus_coverage.bed mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR" cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR_sort.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_plus_coverage.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_minus_coverage.bed mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR" cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR_sort.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_plus_coverage.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_minus_coverage.bed cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon_sort.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_plus_coverage.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_minus_coverage.bed cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron_sort.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_plus_coverage.bed bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_minus_coverage.bed samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_RNA-seq_70 -z 3099922541 -n 22361014 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_plus_coverage.bed Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_RNA-seq_70 -z 3099922541 -n 22361014 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_plus_coverage.bed grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_exons_sort.bed grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_introns_sort.bed bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_coverage.bed bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_coverage.bed awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/47.298385)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_rpkm.bed awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/47.298385)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_rpkm.bed join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }' Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed --annotate pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 47298385.0 samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 47298385.0
<gh_stars>1-10 import React, {PureComponent, MouseEvent} from "react"; import {Workspace} from "../../types"; import {SelectionContext} from "./SelectionContext"; import CollectionMenuItem from "./CollectionMenuItem"; import EditWorkspace from "./Workspace/EditWorkspace"; import CreateCollection from "./Collection/CreateCollection"; import {IconButton, ListItem, ListItemSecondaryAction} from "@material-ui/core"; import CreateNewFolder from "@material-ui/icons/CreateNewFolder"; import EditIcon from "@material-ui/icons/Edit"; import {ExpandLess, ExpandMore} from "@material-ui/icons"; import ListSubheader from "@material-ui/core/ListSubheader"; import {ReactComponent as WorkspaceImg} from "../../images/icons/workspace.svg"; import Icon from "../ui/Icon"; export type WorkspaceMenuItemProps = {} & Workspace; type State = { expanded: boolean, editing: boolean, addCollection: boolean, } export default class WorkspaceMenuItem extends PureComponent<WorkspaceMenuItemProps, State> { static contextType = SelectionContext; context: React.ContextType<typeof SelectionContext>; state: State = { expanded: true, editing: false, addCollection: false, }; expandWorkspace = async (force = false): Promise<void> => { this.setState((prevState: State) => ({ expanded: !prevState.expanded || force, })); } onClick = (e: MouseEvent): void => { this.context.selectWorkspace(this.props.id, this.context.selectedWorkspace === this.props.id); this.expandWorkspace(true); } onExpandClick = (e: MouseEvent) => { e.stopPropagation(); this.expandWorkspace(); } edit = (e: MouseEvent): void => { e.stopPropagation(); this.setState({editing: true}); } closeEdit = () => { this.setState({editing: false}); } addCollection = (e: MouseEvent): void => { e.stopPropagation(); this.setState({addCollection: true}); } closeCollection = () => { this.setState({addCollection: false}); } render() { const { id, name, capabilities, collections, } = this.props; const {editing, expanded, addCollection} = this.state; const selected = this.context.selectedWorkspace === id; return <> <ListSubheader disableGutters={true} className={'workspace-item'} > <ul> <ListItem onClick={this.onClick} selected={selected} button > <Icon component={WorkspaceImg} /> {name} <ListItemSecondaryAction> {capabilities.canEdit && <IconButton title={'Add collection in this workspace'} onClick={this.addCollection} className={'c-action'} aria-label="add-child"> <CreateNewFolder/> </IconButton>} {capabilities.canEdit && <IconButton title={'Edit this workspace'} onClick={this.edit} className={'c-action'} aria-label="edit"> <EditIcon/> </IconButton>} {collections.length > 0 ? <IconButton onClick={this.onExpandClick} aria-label="expand-toggle"> {!expanded ? <ExpandLess onClick={this.onExpandClick} /> : <ExpandMore/>} </IconButton> : ''} </ListItemSecondaryAction> </ListItem> </ul> </ListSubheader> {editing && <EditWorkspace id={this.props.id} onClose={this.closeEdit} />} {addCollection && <CreateCollection workspaceId={this.props['@id']} onClose={this.closeCollection} />} {expanded && collections.map(c => <CollectionMenuItem {...c} key={c.id} absolutePath={c.id} level={0} />)} </> } }
/*============================================================================= Copyright (c) 2003 <NAME> Copyright (c) 2004 <NAME> Use, modification and distribution is subject to the Boost Software License, Version 1.0. (See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) ==============================================================================*/ #if !defined(FUSION_ALGORITHM_FOLD_HPP) #define FUSION_ALGORITHM_FOLD_HPP #include <boost/spirit/fusion/algorithm/detail/fold.ipp> namespace boost { namespace fusion { namespace meta { template <typename Sequence, typename State, typename F> struct fold { typedef typename detail::static_fold< typename meta::begin<Sequence>::type , typename meta::end<Sequence>::type , State , F >::type type; }; } namespace function { struct fold { template <typename Sequence, typename State, typename F> struct apply : meta::fold<Sequence, State, F> {}; template <typename Sequence, typename State, typename F> inline typename apply<Sequence const, State, F>::type operator()(Sequence const& seq, State const& state, F const& f) const { return detail::fold( fusion::begin(seq) , fusion::end(seq) , state , f , is_same< BOOST_DEDUCED_TYPENAME meta::begin<Sequence const>::type , BOOST_DEDUCED_TYPENAME meta::end<Sequence const>::type>() ); } template <typename Sequence, typename State, typename F> inline typename apply<Sequence, State, F>::type operator()(Sequence& seq, State const& state, F const& f) const { return detail::fold( fusion::begin(seq) , fusion::end(seq) , state , f , is_same< BOOST_DEDUCED_TYPENAME meta::begin<Sequence>::type , BOOST_DEDUCED_TYPENAME meta::end<Sequence>::type>() ); } }; } function::fold const fold = function::fold(); }} #endif
<gh_stars>0 /////////////////////////////////////////////////////////////////////////////// // Name: src/generic/activityindicator.cpp // Purpose: Generic wxActivityIndicator implementation. // Author: <NAME> // Created: 2015-03-06 // Copyright: (c) 2015 <NAME> <<EMAIL>> // Licence: wxWindows licence /////////////////////////////////////////////////////////////////////////////// // ============================================================================ // declarations // ============================================================================ // ---------------------------------------------------------------------------- // headers // ---------------------------------------------------------------------------- // for compilers that support precompilation, includes "wx.h". #include "wx/wxprec.h" #if wxUSE_ACTIVITYINDICATOR && !defined(__WXGTK3__) #include "wx/activityindicator.h" #ifndef WX_PRECOMP #include "wx/dcclient.h" #include "wx/timer.h" #endif // WX_PRECOMP #include "wx/graphics.h" #include "wx/scopedptr.h" // ---------------------------------------------------------------------------- // constants // ---------------------------------------------------------------------------- // For now the appearance is fixed, we could make these constants customizable // later if really needed. namespace { // Total number of "running" dots. static const int NUM_DOTS = 8; // Delay between the consecutive updates in milliseconds. static const int FRAME_DELAY = 150; } // anonymous namespace // ---------------------------------------------------------------------------- // wxActivityIndicatorImpl: class containing the real implementation. // ---------------------------------------------------------------------------- class wxActivityIndicatorImpl { public: explicit wxActivityIndicatorImpl(wxWindow* win) : m_timer(this), m_win(win) { m_frame = 0; win->Bind(wxEVT_PAINT, &wxActivityIndicatorImpl::OnPaint, this); } void Start() { // Avoid restarting the timer if it's already running, this could // result in jumps in appearance of the next frame while calling // Start() is not supposed to have any effect at all in this case. if ( m_timer.IsRunning() ) return; m_timer.Start(FRAME_DELAY); } void Stop() { // Unlike above, it's not a problem to call Stop() even if we're not // running. m_timer.Stop(); } bool IsRunning() const { return m_timer.IsRunning(); } // This one is only called by AdvanceTimer. void Advance() { if ( ++m_frame == NUM_DOTS ) m_frame = 0; m_win->Refresh(); } private: class AdvanceTimer : public wxTimer { public: explicit AdvanceTimer(wxActivityIndicatorImpl* owner) : m_owner(owner) { } virtual void Notify() wxOVERRIDE { m_owner->Advance(); } private: wxActivityIndicatorImpl* const m_owner; wxDECLARE_NO_COPY_CLASS(AdvanceTimer); }; void OnPaint(wxPaintEvent& WXUNUSED(event)) { wxPaintDC pdc(m_win); wxScopedPtr<wxGraphicsContext> const gc(wxGraphicsRenderer::GetDefaultRenderer()->CreateContext(pdc)); const wxSize size = m_win->GetClientSize(); // Centre everything. gc->Translate(size.x/2., size.y/2.); // Radius of 1/10th allows to have reasonably sized dots with a bit of // separation between them and so subjectively looks a bit nicer than // perhaps more natural 1/8th. static const double RADIUS_FACTOR = 10; const double r = wxMin(size.x, size.y) / RADIUS_FACTOR; // The initial dot touches the top border. wxGraphicsPath path = gc->CreatePath(); path.AddCircle(0, -(RADIUS_FACTOR / 2. - 1.)*r, r); // Subsequent dots are rotated by this angle with respect to the // previous one. const double angle = wxDegToRad(360. / NUM_DOTS); // And the animation effect is achieved just by starting to draw from // the next position every time. gc->Rotate(m_frame*angle); const bool isEnabled = m_win->IsThisEnabled(); for ( int n = 0; n < NUM_DOTS; n++ ) { // Draw all dots uniformly grey when the window is disabled, // otherwise each subsequent dot is slightly more opaque. const int opacityIndex = isEnabled ? n + 1 : 2; // wxALPHA_OPAQUE+1 is used just because it is divisible by the // default NUM_DOTS value, and we need -1 because of this to keep // it in 0..wxALPHA_OPAQUE range. const int opacity = opacityIndex*(wxALPHA_OPAQUE + 1)/NUM_DOTS - 1; gc->SetBrush(wxBrush(wxColour(0, 0, 0, opacity))); gc->FillPath(path); gc->Rotate(angle); } } AdvanceTimer m_timer; wxWindow* const m_win; int m_frame; wxDECLARE_NO_COPY_CLASS(wxActivityIndicatorImpl); }; // ============================================================================ // implementation // ============================================================================ #ifndef wxHAS_NATIVE_ACTIVITYINDICATOR wxIMPLEMENT_DYNAMIC_CLASS(wxActivityIndicator, wxControl); #endif bool wxActivityIndicatorGeneric::Create(wxWindow* parent, wxWindowID winid, const wxPoint& pos, const wxSize& size, long style, const wxString& name) { // Notice that we skip wxControl version, we don't need the validator // support that it adds. if ( !wxWindow::Create(parent, winid, pos, size, style, name) ) return false; m_impl = new wxActivityIndicatorImpl(this); return true; } wxActivityIndicatorGeneric::~wxActivityIndicatorGeneric() { delete m_impl; } void wxActivityIndicatorGeneric::Start() { wxCHECK_RET( m_impl, wxS("Must be created first") ); m_impl->Start(); } void wxActivityIndicatorGeneric::Stop() { wxCHECK_RET( m_impl, wxS("Must be created first") ); m_impl->Stop(); } bool wxActivityIndicatorGeneric::IsRunning() const { return m_impl && m_impl->IsRunning(); } wxSize wxActivityIndicatorGeneric::DoGetBestClientSize() const { int size = 0; switch ( GetWindowVariant() ) { case wxWINDOW_VARIANT_MAX: wxFAIL_MSG(wxS("Invalid window variant")); wxFALLTHROUGH; case wxWINDOW_VARIANT_NORMAL: size = 24; break; case wxWINDOW_VARIANT_SMALL: size = 16; break; case wxWINDOW_VARIANT_MINI: size = 12; break; case wxWINDOW_VARIANT_LARGE: size = 32; break; } wxASSERT_MSG( size, wxS("Unknown window variant") ); return FromDIP(wxSize(size, size)); } #endif // wxUSE_ACTIVITYINDICATOR && !__WXGTK3__
<gh_stars>1-10 require 'spec_extensions' require '_utils' require 'pod/command/lib/docstats'
#!/bin/bash set -e ############## # VARIABLES # ############# MON_SECRET_NAME=rook-ceph-mon OPERATOR_CREDS=rook-ceph-operator-creds CSI_RBD_NODE_SECRET_NAME=rook-csi-rbd-node CSI_RBD_PROVISIONER_SECRET_NAME=rook-csi-rbd-provisioner CSI_CEPHFS_NODE_SECRET_NAME=rook-csi-cephfs-node CSI_CEPHFS_PROVISIONER_SECRET_NAME=rook-csi-cephfs-provisioner MON_SECRET_CLUSTER_NAME_KEYNAME=cluster-name MON_SECRET_FSID_KEYNAME=fsid MON_SECRET_ADMIN_KEYRING_KEYNAME=admin-secret MON_SECRET_MON_KEYRING_KEYNAME=mon-secret MON_ENDPOINT_CONFIGMAP_NAME=rook-ceph-mon-endpoints ROOK_EXTERNAL_CLUSTER_NAME=$NAMESPACE ROOK_EXTERNAL_MAX_MON_ID=2 ROOK_EXTERNAL_MAPPING={} ROOK_EXTERNAL_MONITOR_SECRET=mon-secret : "${ROOK_EXTERNAL_ADMIN_SECRET:=admin-secret}" ############# # FUNCTIONS # ############# function checkEnvVars() { if [ -z "$NAMESPACE" ]; then echo "Please populate the environment variable NAMESPACE" exit 1 fi if [ -z "$ROOK_EXTERNAL_FSID" ]; then echo "Please populate the environment variable ROOK_EXTERNAL_FSID" exit 1 fi if [ -z "$ROOK_EXTERNAL_CEPH_MON_DATA" ]; then echo "Please populate the environment variable ROOK_EXTERNAL_CEPH_MON_DATA" exit 1 fi if [[ "$ROOK_EXTERNAL_ADMIN_SECRET" == "admin-secret" ]]; then if [ -z "$ROOK_EXTERNAL_USER_SECRET" ]; then echo "Please populate the environment variable ROOK_EXTERNAL_USER_SECRET" exit 1 fi if [ -z "$ROOK_EXTERNAL_USERNAME" ]; then echo "Please populate the environment variable ROOK_EXTERNAL_USERNAME" exit 1 fi if [ -z "$CSI_RBD_NODE_SECRET_SECRET" ]; then echo "Please populate the environment variable CSI_RBD_NODE_SECRET_SECRET" exit 1 fi if [ -z "$CSI_RBD_PROVISIONER_SECRET" ]; then echo "Please populate the environment variable CSI_RBD_PROVISIONER_SECRET" exit 1 fi if [ -z "$CSI_CEPHFS_NODE_SECRET" ]; then echo "Please populate the environment variable CSI_CEPHFS_NODE_SECRET" exit 1 fi if [ -z "$CSI_CEPHFS_PROVISIONER_SECRET" ]; then echo "Please populate the environment variable CSI_CEPHFS_PROVISIONER_SECRET" exit 1 fi fi } function importSecret() { kubectl -n "$NAMESPACE" \ create \ secret \ generic \ "$MON_SECRET_NAME" \ --from-literal="$MON_SECRET_CLUSTER_NAME_KEYNAME"="$ROOK_EXTERNAL_CLUSTER_NAME" \ --from-literal="$MON_SECRET_FSID_KEYNAME"="$ROOK_EXTERNAL_FSID" \ --from-literal="$MON_SECRET_ADMIN_KEYRING_KEYNAME"="$ROOK_EXTERNAL_ADMIN_SECRET" \ --from-literal="$MON_SECRET_MON_KEYRING_KEYNAME"="$ROOK_EXTERNAL_MONITOR_SECRET" } function importConfigMap() { kubectl -n "$NAMESPACE" \ create \ configmap \ "$MON_ENDPOINT_CONFIGMAP_NAME" \ --from-literal=data="$ROOK_EXTERNAL_CEPH_MON_DATA" \ --from-literal=mapping="$ROOK_EXTERNAL_MAPPING" \ --from-literal=maxMonId="$ROOK_EXTERNAL_MAX_MON_ID" } function importCheckerSecret() { kubectl -n "$NAMESPACE" \ create \ secret \ generic \ "$OPERATOR_CREDS" \ --from-literal=userID="$ROOK_EXTERNAL_USERNAME" \ --from-literal=userKey="$ROOK_EXTERNAL_USER_SECRET" } function importCsiRBDNodeSecret() { kubectl -n "$NAMESPACE" \ create \ secret \ generic \ "$CSI_RBD_NODE_SECRET_NAME" \ --from-literal=userID=csi-rbd-node \ --from-literal=userKey="$CSI_RBD_NODE_SECRET_SECRET" } function importCsiRBDProvisionerSecret() { kubectl -n "$NAMESPACE" \ create \ secret \ generic \ "$CSI_RBD_PROVISIONER_SECRET_NAME" \ --from-literal=userID=csi-rbd-provisioner \ --from-literal=userKey="$CSI_RBD_PROVISIONER_SECRET" } function importCsiCephFSNodeSecret() { kubectl -n "$NAMESPACE" \ create \ secret \ generic \ "$CSI_CEPHFS_NODE_SECRET_NAME" \ --from-literal=adminID=csi-cephfs-node \ --from-literal=adminKey="$CSI_CEPHFS_NODE_SECRET" } function importCsiCephFSProvisionerSecret() { kubectl -n "$NAMESPACE" \ create \ secret \ generic \ "$CSI_CEPHFS_PROVISIONER_SECRET_NAME" \ --from-literal=adminID=csi-cephfs-provisioner \ --from-literal=adminKey="$CSI_CEPHFS_PROVISIONER_SECRET" } ######## # MAIN # ######## checkEnvVars importSecret importConfigMap importCheckerSecret importCsiRBDNodeSecret importCsiRBDProvisionerSecret importCsiCephFSNodeSecret importCsiCephFSProvisionerSecret
#!/usr/bin/env python # -*- coding: utf-8 -*- from bincrafters import build_template_default import platform import copy if __name__ == "__main__": builder = build_template_default.get_builder() items = [] for item in builder.items: # skip mingw cross-builds if not (platform.system() == "Windows" and item.settings["compiler"] == "gcc" and item.settings["arch"] == "x86"): new_build_requires = copy.copy(item.build_requires) if platform.system() == "Windows" and item.settings["compiler"] == "gcc": # add msys2 and mingw as a build requirement for mingw builds new_build_requires["*"] = new_build_requires.get("*", []) + \ ["mingw_installer/1.0@conan/stable", "msys2_installer/latest@bincrafters/stable"] items.append([item.settings, item.options, item.env_vars, new_build_requires, item.reference]) elif platform.system() == "Windows" and item.settings["compiler"] != "gcc": # add cygwin build requirement new_build_requires["*"] = new_build_requires.get("*", []) + \ ["cygwin_installer/2.9.0@bincrafters/stable"] items.append([item.settings, item.options, item.env_vars, new_build_requires, item.reference]) else: # or just add build items.append(item) builder.items = items builder.run()
// Copyright 2017 <NAME>. All rights reserved. // Use of this source code is governed by a MIT license. package main import ( "flag" "log" "os" "path" "regexp" ) var cmdGet = &Command{ UsageLine: "get [--exclude REGEXP] <gover.yaml>", Short: "download packages", Long: `Get downloads packages specified in configuration file.`, Run: runGet, Flag: cmdGetFlags(), } var exclude string func cmdGetFlags() flag.FlagSet { f := flag.NewFlagSet("get", flag.ContinueOnError) f.StringVar(&exclude, "exclude", "", "regexp for excluding some deps") return *f } func runGet(cmd *Command, configs *configsHierarchy, args []string) { if len(args) == 0 { log.Fatal("missing config file") } localCfg := new(config) if err := localCfg.Load(args[0]); err != nil { log.Fatalf("cannot load configuration file '%s': %v", args[0], err) } missing := []*dependency{} for _, dep := range localCfg.Deps { if !configs.Contains(dep) { missing = append(missing, dep) } } if exclude != "" { reg, err := regexp.Compile(exclude) if err != nil { log.Fatal("incorrect 'exclude' parameter") } deps := []*dependency{} for _, dep := range missing { if !reg.MatchString(dep.Package) { deps = append(deps, dep) } } missing = deps } if len(missing) == 0 { log.Println("everithing is up to date") return } top := configs.Top() if err := top.Update(localCfg.Name, missing); err != nil { log.Fatal(err) } log.Println(top.file) if err := download(path.Dir(top.file), missing); err != nil { log.Fatalf("cannot download packages: %v", err) } if err := top.Save(); err != nil { log.Fatalf("cannot save config: %v", err) } } func download(root string, deps []*dependency) error { var err error for _, dep := range deps { dst := path.Join(root, "src", dep.Package) vcs := getVcsByUrl(dep.Url) if vcs.exists(dst) { log.Printf("warning: unmanaged repository '%s'. reset version\n", dst) err = vcs.checkout(dst, dep.Version) } else { log.Printf("create new repository '%s'\n", dst) if err = os.MkdirAll(path.Dir(dst), 0755); err == nil { err = vcs.create(dst, dep.Url, dep.Version) } } if err != nil { return err } } return nil }
<gh_stars>0 #pragma once #include <functional> #include <string> #include <vector> #include <typed-geometry/tg-lean.hh> #include <glow/common/log.hh> #include <glow/common/property.hh> #include <glow/common/shared.hh> #include <glow/fwd.hh> #include <glow-extras/camera/SmoothedCamera.hh> #include <glow-extras/camera/controllers/LookAroundController.hh> #include <glow-extras/camera/controllers/TargetOrbitController.hh> #include <glow-extras/camera/controllers/WASDController.hh> #include <glow-extras/input/InputState.hh> #include <glow-extras/pipeline/RenderCallback.hh> #include <glow-extras/pipeline/fwd.hh> #include <glow-extras/timing/CpuTimer.hh> #include <glow-extras/timing/GpuTimer.hh> struct GLFWwindow; struct CTwBar; typedef struct CTwBar TwBar; // structure CTwBar is not exposed. namespace glow { namespace debugging { GLOW_SHARED(class, DebugRenderer); GLOW_SHARED(class, ProfilingOverlay); } namespace glfw { class GlfwContext; enum class CursorMode { /// normal behavior Normal, /// normal behavior but hardware cursor is hidden Hidden, /// virtual unrestricted cursor, real cursor is hidden and locked to center Disabled, }; /** * @brief The GlfwApp can be used to efficiently build small sample applications based on glfw * * Derive your own class from GlfwApp and override the functions you need: * - init(...): initialize and allocate all your resources and objects * - update(...): called with a constant rate (default 60 Hz, configurable) before rendering * - render(...): called as fast as possible (affected by vsync) * - onResize(...): called when window is resized * - onClose(...): called when app is closed * - input: see onKey/onChar/onMouseXYZ/onFileDrop (return true if you handled the event, if base returned true, you * should probably return as well) * be sure to call base function unless you know what you do! * * Additional important functions: * - setUpdateRate(...): set the update rate * - window(): get the GLFW window * - tweakbar(): get the AntTweakBar instance * - setWindowWidth/Height(...): set initial window size before run(...) * * Render Pipeline: * - setUsePipeline(true): Enable the default pipeline * - Override all of the RenderCallback methods you need * For a reference implementation of a GlfwApp using the Pipeline, see glow-samples/wip/rendering-pipeline * * Notes: * - if you use primitive/occlusion queries, use setQueryStats(false); * - overwrite onResetView if you want a different default view * * Defaults: * - A GenericCamera with input handling on LMB/RMB/WASD/... (setUseDefaultXYZ to configure) * * Usage: * int main(int argc, char *argv[]) * { * MyGlfwApp app; * return app.run(argc, argv); // automatically sets up GLOW and GLFW and everything * } */ class GlfwApp : virtual public pipeline::RenderCallback { public: enum class Gui { None, AntTweakBar, ImGui }; GlfwApp(Gui gui = Gui::None) : mGui(gui) {} private: std::string mTitle = "GLFW/GLOW Application"; ///< window title double mUpdateRate = 60; ///< rate at which update(...) is called int mMaxFrameSkip = 4; ///< maximum number of update(...) steps that are performed without rendering double mScheduledUpdateInterval = 0; ///< number of seconds between calls to scheduledUpdate(...). 0 means never GLFWwindow* mWindow = nullptr; ///< current GLFW window input::InputState mInputState; ///< Input state int mWindowWidth = 1280; ///< window width, only set before run! int mWindowHeight = 720; ///< window height, only set before run! bool mDumpTimingsOnShutdown = true; ///< if true, dumps AION timings on shutdown CursorMode mCursorMode = CursorMode::Normal; ///< cursor mode bool mVSync = true; ///< if true, enables vsync int mSwapInterval = 1; ///< divisor of monitor frequency double mOutputStatsInterval = 5.0; ///< number of seconds between stats output (0.0 for never) bool mPrimitiveQueryStats = false; ///< if true, queries stats (vertices, fragments, ...) bool mWarnOnFrameskip = true; ///< if true, outputs a warning on frameskips bool mUseDefaultCamera = true; ///< if true, uses default camera bool mUseDefaultCameraHandling = true; ///< if true, implements default cam handling bool mUseDefaultCameraHandlingLeft = true; ///< if true, activates left mouse button handling bool mUseDefaultCameraHandlingRight = true; ///< if true, activates right mouse button handling bool mUsePipeline = false; ///< if true, uses rendering pipeline (requires default cam) bool mUsePipelineConfigGui = false; ///< if true, enables the pipeline scen configuration gui (only if pipeline is used, requires ImGui) bool mCacheWindowSize = false; ///< if true, saves window size and position on close, and restores on next launch double mCurrentTime = 0.0; ///< current frame time (starts with 0) double mCurrentRenderDeltaTime = 0.0; ///< current delta time for the render(dt) call float mLastGpuTimeMs = 0.f; ///< The last measured GPU time, in ms float mLastCpuTimeMs = 0.f; ///< The last measured CPU (render dispatch) time, in ms double mDoubleClickTime = 0.35; ///< max number of seconds for multi clicks int mClickCount = 0; ///< current click count int mClickButton = -1; ///< last clicked button tg::pos2 mClickPos; ///< last clicked position timing::CpuTimer mClickTimer; ///< click timing bool mMinimized = false; ///< is true while the application is minimized bool mStartInvisible = false; GLFWwindow* mSecondaryContext = nullptr; ///< shared OpenGL context for multithreaded loading / OpenGL object creation bool mCreateSecondaryContext = false; ///< if true, creates a secondary, shared OpenGL context bool mIsCleaned = false; // extra features private: Gui mGui = Gui::None; bool mDrawGui = true; bool mGuiAfterRender = false; // Default graphics private: /// Default Camera camera::SharedSmoothedCamera mCamera; /// Default Camera handling controllers camera::WASDController mWASDController; camera::LookAroundController mLookAroundController; camera::TargetOrbitController mTargetOrbitController; /// Default pipeline pipeline::SharedRenderPipeline mPipeline; pipeline::SharedRenderScene mPipelineScene; pipeline::SharedStageCamera mPipelineCamera; SharedPrimitiveQuery mPrimitiveQuery; ///< nr of primitives per frame SharedOcclusionQuery mOcclusionQuery; ///< nr of pixels per frame timing::SharedGpuTimer mGpuTimer; debugging::SharedProfilingOverlay mProfilingOverlay; bool mProfilingOverlayVisible = false; public: GLOW_PROPERTY(StartInvisible); GLOW_PROPERTY(UpdateRate); GLOW_PROPERTY(MaxFrameSkip); GLOW_PROPERTY(ScheduledUpdateInterval); GLOW_GETTER(Title); GLOW_PROPERTY(WindowWidth); GLOW_PROPERTY(WindowHeight); tg::isize2 getWindowSize() const { return {mWindowWidth, mWindowHeight}; } GLOW_PROPERTY(DumpTimingsOnShutdown); GLOW_PROPERTY(VSync); GLOW_PROPERTY(SwapInterval); GLOW_PROPERTY(OutputStatsInterval); GLOW_PROPERTY(PrimitiveQueryStats); GLOW_PROPERTY(WarnOnFrameskip); GLOW_PROPERTY(CreateSecondaryContext); GLOW_PROPERTY(DoubleClickTime); void setCursorMode(CursorMode newMode); CursorMode getCursorMode() const { return mCursorMode; } float getCurrentTime() const { return float(mCurrentTime); } double getCurrentTimeD() const { return mCurrentTime; } float getCurrentDeltaTime() const { return float(mCurrentRenderDeltaTime); } double getCurrentDeltaTimeD() const { return mCurrentRenderDeltaTime; } float getLastGpuTimeMs() const { return mLastGpuTimeMs; } float getLastCpuTimeMs() const { return mLastCpuTimeMs; } GLOW_GETTER(Camera); GLOW_PROPERTY(UsePipeline); GLOW_PROPERTY(UsePipelineConfigGui); GLOW_GETTER(Pipeline); GLOW_GETTER(PipelineScene); GLOW_GETTER(PipelineCamera); GLOW_PROPERTY(Gui); GLOW_PROPERTY(DrawGui); GLOW_PROPERTY(UseDefaultCamera); GLOW_PROPERTY(UseDefaultCameraHandling); GLOW_PROPERTY(UseDefaultCameraHandlingLeft); GLOW_PROPERTY(UseDefaultCameraHandlingRight); GLOW_PROPERTY(CacheWindowSize); void setTitle(std::string const& title); GLFWwindow* window() const { return mWindow; } GLFWwindow* secondaryContext() const { return mSecondaryContext; } input::InputState const& input() const { return mInputState; } camera::WASDController& getWASDController() { return mWASDController; } camera::LookAroundController& getLookAroundController() { return mLookAroundController; } camera::TargetOrbitController& getTargetOrbitController() { return mTargetOrbitController; } public: /// sets the current clipboard content void setClipboardString(std::string const& s) const; /// gets the current clipboard content std::string getClipboardString() const; // NOTE: the naming has changed, pressed means "down this frame, but not down last frame" // the deprecated isXPressed forwardings here just remain for backwards compatibility [[deprecated("use isMouseButtonDown instead")]] bool isMouseButtonPressed(int button) const { return mInputState.isMouseButtonDown(button); } bool isMouseButtonDown(int button) const { return mInputState.isMouseButtonDown(button); } [[deprecated("use isKeyDown instead")]] bool isKeyPressed(int key) const { return mInputState.isKeyDown(key); } bool isKeyDown(int key) const { return mInputState.isKeyDown(key); } tg::pos2 getMousePosition() const { return tg::pos2(mInputState.getMousePosition()); } /// Returns true iff the app should be closed /// Defaults to glfw window closed bool shouldClose() const; /// Returns true iff the app is in fullscren mode bool isFullscreen() const; /// Returns true iff the app is minimized bool isMinimized() const; /// Requests glfw to close the window void requestClose(); // Tweakbar helper #ifdef GLOW_EXTRAS_HAS_ANTTWEAKBAR private: TwBar* mTweakbar = nullptr; ///< main tweakbar window public: TwBar* tweakbar() const { if (mGui != Gui::AntTweakBar) { glow::error() << "AntTweakBar is not active. Did you forget to call GlfwApp(Gui::AntTweakBar) in the ctor?"; TG_ASSERT(0 && "AntTweakBar not active"); return nullptr; } return mTweakbar; } /// create read-write tweakbar entries void tweak(int& value, std::string const& name, std::string const& options = ""); void tweak(bool& value, std::string const& name, std::string const& options = ""); void tweak(float& value, std::string const& name, std::string const& options = ""); void tweak(double& value, std::string const& name, std::string const& options = ""); void tweak(glm::quat& value, std::string const& name, std::string const& options = ""); void tweak(std::string& value, std::string const& name, std::string const& options = ""); void tweak_dir(glm::vec3& value, std::string const& name, std::string const& options = ""); void tweak_color(glm::vec3& value, std::string const& name, std::string const& options = ""); void tweak_color(glm::vec4& value, std::string const& name, std::string const& options = ""); void tweak_color(uint32_t& value, std::string const& name, std::string const& options = ""); // NOTE: function will currently be leaked! void tweak_button(std::string const& name, std::function<void()> const& fun, std::string const& options = ""); #endif #ifdef GLOW_EXTRAS_HAS_IMGUI // imgui support private: bool mEnableDebugOverlay = true; ///< if true, enables debugging::DebugOverlay (requires ImGui) public: GLOW_PROPERTY(EnableDebugOverlay); #endif /// if called, performs onGui after render() void performGuiAfterRender() { mGuiAfterRender = true; } /// if called, performs onGui before render() void performGuiBeforeRender() { mGuiAfterRender = false; } protected: /// Called once GLOW is initialized. Allocated your resources and init your logic here. virtual void init(); /// Called at the start of a frame virtual void onFrameStart() {} /// Called with at 1 / getUpdateRate() Hz (timestep) virtual void update(float elapsedSeconds); /// Called as fast as possible for rendering (elapsedSeconds is not fixed here) virtual void render(float elapsedSeconds); /// Called once every getScheduledUpdateInterval() seconds (0 means never), for tasks that only have to happen rarely virtual void scheduledUpdate(); /// Called once in the beginning after (init) and whenever the window size changed virtual void onResize(int w, int h); /// Called at the end, when application is closed virtual void onClose(); /// Called when the gui is handled (currently only for imgui) virtual void onGui(); /// Called whenever a key is pressed virtual bool onKey(int key, int scancode, int action, int mods); /// Called whenever a character is entered (unicode) virtual bool onChar(unsigned int codepoint, int mods); /// Called whenever the mouse position changes virtual bool onMousePosition(double x, double y); /// Called whenever a mouse button is pressed (clickCount is 1 for single clicks, 2 for double, 3+ for multi) virtual bool onMouseButton(double x, double y, int button, int action, int mods, int clickCount); /// Called whenever the mouse is scrolled virtual bool onMouseScroll(double sx, double sy); /// Called whenever the mouse enters the window virtual bool onMouseEnter(); /// Called whenever the mouse leaves the window virtual bool onMouseExit(); /// Called whenever the window gets focus virtual bool onFocusGain(); /// Called whenever the window loses focus virtual bool onFocusLost(); /// Called whenever files are dropped (drag'n'drop), parameters is file paths virtual bool onFileDrop(std::vector<std::string> const& files); /// Called when view should be reset virtual void onResetView(); /// Blocking call that executes the complete main loop virtual void mainLoop(); private: glfw::GlfwContext* mInternalContext = nullptr; bool mInternalContextOwner = false; private: void internalInit(); void internalCleanUp(); void internalOnMouseButton(double x, double y, int button, int action, int mods); void internalOnGui(); void internalPerformGui(); protected: /// performs glfw polling void updateInput(); /// should be called before rendering void beginRender(); /// should be called after rendering /// calls swapBuffers void endRender(); /// Blocks the thread for a given number of seconds void sleepSeconds(double seconds) const; public: /// Initializes GLFW and GLOW, and runs until window is closed void run(); /// Initializes GLFW and GLOW but does not create a window void startHeadless(); /// Toggle fullscreen mode void toggleFullscreen(); /// Toggle profiling overlay void toggleProfilingOverlay(); #ifdef GLOW_EXTRAS_HAS_IMGUI // imgui support /// Toggle OpenGL debug overlay void toggleDebugOverlay(); #endif public: virtual ~GlfwApp(); // virtual dtor }; } }
function searchItem($arr, $item) { if (in_array($item, $arr)) { return true; } return false; }
// -- API REQ -- const url = "https://labs.inforcedata.com.br/desafio-frontend/banners.json" async function BannerReq(url) { const response = await fetch(url); const photos = await response.json(); console.log(photos) async function CreateImg() { console.log("entrou") const imgTag = document.createElement('img') const container = document.getElementById('carousel-content') container.appendChild(imgTag) imgTag.setAttribute("src", `${photos[0].imagem}`) imgTag.setAttribute("class", "slide") const imgTag2 = document.createElement('img') container.appendChild(imgTag2) imgTag2.setAttribute("src", `${photos[1].imagem}`) imgTag2.setAttribute("class", "slide slide-2") } CreateImg() } BannerReq(url) // -- CARROUSEL -- var carousel = document.querySelector('.carousel'); var carouselContent = document.querySelector('.carousel-content'); var slides = document.querySelectorAll('.slide'); var arrayOfSlides = Array.prototype.slice.call(slides); var carouselDisplaying; var screenSize; setScreenSize(); var lengthOfSlide; function addClone() { var lastSlide = carouselContent.lastElementChild.cloneNode(true); lastSlide.style.left = (-lengthOfSlide) + "px"; carouselContent.insertBefore(lastSlide, carouselContent.firstChild); } // addClone(); function removeClone() { var firstSlide = carouselContent.firstElementChild; firstSlide.parentNode.removeChild(firstSlide); } function moveSlidesRight() { var slides = document.querySelectorAll('.slide'); var slidesArray = Array.prototype.slice.call(slides); var width = 0; slidesArray.forEach(function(el, i){ el.style.left = width + "px"; width += lengthOfSlide; }); addClone(); } moveSlidesRight(); function moveSlidesLeft() { var slides = document.querySelectorAll('.slide'); var slidesArray = Array.prototype.slice.call(slides); slidesArray = slidesArray.reverse(); var maxWidth = (slidesArray.length - 1) * lengthOfSlide; slidesArray.forEach(function(el, i){ maxWidth -= lengthOfSlide; el.style.left = maxWidth + "px"; }); } window.addEventListener('resize', setScreenSize); function setScreenSize() { if ( window.innerWidth >= 500 ) { carouselDisplaying = 3; } else if ( window.innerWidth >= 300 ) { carouselDisplaying = 2; } else { carouselDisplaying = 1; } getScreenSize(); } function getScreenSize() { var slides = document.querySelectorAll('.slide'); var slidesArray = Array.prototype.slice.call(slides); lengthOfSlide = ( carousel.offsetWidth / carouselDisplaying ); var initialWidth = -lengthOfSlide; slidesArray.forEach(function(el) { el.style.width = lengthOfSlide + "px"; el.style.left = initialWidth + "px"; initialWidth += lengthOfSlide; }); } var rightNav = document.querySelector('.nav-right'); rightNav.addEventListener('click', moveLeft); var moving = true; function moveRight() { if ( moving ) { moving = false; var lastSlide = carouselContent.lastElementChild; lastSlide.parentNode.removeChild(lastSlide); carouselContent.insertBefore(lastSlide, carouselContent.firstChild); removeClone(); var firstSlide = carouselContent.firstElementChild; firstSlide.addEventListener('transitionend', activateAgain); moveSlidesRight(); } } function activateAgain() { var firstSlide = carouselContent.firstElementChild; moving = true; firstSlide.removeEventListener('transitionend', activateAgain); } var leftNav = document.querySelector('.nav-left'); leftNav.addEventListener('click', moveRight); // var moveLeftAgain = true; function moveLeft() { if ( moving ) { moving = false; removeClone(); var firstSlide = carouselContent.firstElementChild; firstSlide.addEventListener('transitionend', replaceToEnd); moveSlidesLeft(); } } function replaceToEnd() { var firstSlide = carouselContent.firstElementChild; firstSlide.parentNode.removeChild(firstSlide); carouselContent.appendChild(firstSlide); firstSlide.style.left = ( (arrayOfSlides.length -1) * lengthOfSlide) + "px"; addClone(); moving = true; firstSlide.removeEventListener('transitionend', replaceToEnd); } carouselContent.addEventListener('mousedown', seeMovement); var initialX; var initialPos; function seeMovement(e) { initialX = e.clientX; getInitialPos(); carouselContent.addEventListener('mousemove', slightMove); document.addEventListener('mouseup', moveBasedOnMouse); } function slightMove(e) { if ( moving ) { var movingX = e.clientX; var difference = initialX - movingX; if ( Math.abs(difference) < (lengthOfSlide/4) ) { slightMoveSlides(difference); } } } function getInitialPos() { var slides = document.querySelectorAll('.slide'); var slidesArray = Array.prototype.slice.call(slides); initialPos = []; slidesArray.forEach(function(el){ var left = Math.floor( parseInt( el.style.left.slice(0, -2 ) ) ); initialPos.push( left ); }); } function slightMoveSlides(newX) { var slides = document.querySelectorAll('.slide'); var slidesArray = Array.prototype.slice.call(slides); slidesArray.forEach(function(el, i){ var oldLeft = initialPos[i]; el.style.left = (oldLeft + newX) + "px"; }); } function moveBasedOnMouse(e) { var finalX = e.clientX; if ( initialX - finalX > 0) { moveRight(); } else if ( initialX - finalX < 0 ) { moveLeft(); } document.removeEventListener('mouseup', moveBasedOnMouse); carouselContent.removeEventListener('mousemove', slightMove); }
#!/usr/bin/env bash # ========================================================================== # Setup script for installing project dependencies. # NOTE: Run this script while in the project root directory. # It will not run correctly when run from another directory. # ========================================================================== # Set script to exit on any errors. set -e # Build project dependencies. build(){ if hash gem 2>/dev/null; then echo 'Installing project dependencies...' gem install jekyll gem install pygments.rb else echo 'Ruby Gems is not installed...' echo 'Go here to install: https://rubygems.org/pages/download' fi } build
class myDialogBox { public: // Other class members and methods // Override the OnClose method to handle the close event bool OnClose(void) { if (unsavedChangesExist()) { // Prompt the user with a confirmation dialog if (showConfirmationDialog()) { // User confirmed the close action return true; } else { // User canceled the close action return false; } } else { // No unsaved changes, allow the dialog box to close return true; } } private: bool unsavedChangesExist() { // Check if there are unsaved changes in the dialog box // Return true if unsaved changes exist, false otherwise } bool showConfirmationDialog() { // Display a confirmation dialog to the user // Return true if the user confirms, false if the user cancels } };
export const SET_USER = 'SET_USER' export const SET_ERROR = 'SET_ERROR'
<filename>Application/src/br/com/matheuslino/pacman/LabyrinthMap.java<gh_stars>1-10 package br.com.matheuslino.pacman; import java.util.ArrayList; import java.util.List; import java.util.Random; import br.com.matheuslino.pacman.game.LabyrinthObjectVisitor; public class LabyrinthMap { // Attributes private PacMan pacman; private Level level; // Difficulty level private List<Checkpoint> checkpoints = new ArrayList<>(); private List<Wall> walls = new ArrayList<>(); private List<Ghost> ghosts = new ArrayList<>(); private int width; // Map width private int height; // Map height private int[][] grafo; // Adjacency matrix containing graph's elements private int timerCheckSpecial; // "Timer" - Special checkpoint duration private int pos[] = new int[3]; // Stores the graph's vertices corresponding to evasive, // pursuer and PacMan, respectively // Construtor (protected visibility) protected LabyrinthMap(PacMan pacman, List<Checkpoint> checkpoints, List<Wall> walls, List<Ghost> ghosts, int width, int height, Level level) { // Local variable, just to generate a random number Random r = new Random(); // Project decision: 10% of special checkpoints for(int i=0; i<Math.ceil(checkpoints.size()*0.1); i++) { int n = r.nextInt(checkpoints.size()); // Ensures positive random numbers if(n<0) n = n*(-1); // Set special checkpoints if(!checkpoints.get(n).isSpecial()) { checkpoints.get(n).setSpecial(true); }else { if(i>0) { i--; } } } this.pacman = pacman; this.checkpoints = checkpoints; this.walls = walls; this.ghosts = ghosts; this.width = width; this.height = height; this.level = level; this.grafo = new int[checkpoints.size()+2][checkpoints.size()+2]; // free positions for movement: checkpoints + // PacMan and Ghost start positions } // Return Difficulty level public Level getLevel() { return level; } // Call the accept method for each map element, passing a visitor as argument public void accept(LabyrinthObjectVisitor visitor) { for(Wall wall : walls) { wall.accept(visitor); } for(Checkpoint checkpoint : checkpoints) { checkpoint.accept(visitor); } for(Ghost ghost : ghosts) { ghost.accept(visitor); } pacman.accept(visitor); } public int getWidth() { return width; } public int getHeight() { return height; } // Manage the ghosts movement private void moveGhosts(List<Wall> walls) { // Definitions of local use variables (only) Random1 random = (Random1) ghosts.get(0); // Returns the random ghost Evasive evasive = (Evasive) ghosts.get(1); // Returns the evasive ghost Jumper jumper = (Jumper) ghosts.get(2); // Returns the jumper ghost Pursuer pursuer = (Pursuer) ghosts.get(3); // Returns the pursuer ghost Direction dir_evasive = null; // Evasive ghost direction Direction dir_pursuer = null; // Pursuer ghost direction int[] coord_evasive = null; // coord[x][y] - evasive ghost coordinates int[] next_evasive = null; // next [x][y] - coordinates of the next vertex int[] coord_pursuer = null; // coord[x][y] - pursuer ghost coordinates int[] next_pursuer = null; // next [x][y] - coordinates of the next vertex int nextElement_e = -1; // Vertex of the next element to be visited (evasive) int nextElement_p = -1; // Vertex of the next element to be visited (pursuer) // evasive ghost direction - Dijkstra Algorithm nextElement_e = Dijkstra.shortWay(grafo,pos[0],pointToVertex(midpoint().getX(), midpoint().getY())); next_evasive = (nextElement_e >= 0) ? vertexToPoint(nextElement_e) : null; coord_evasive = vertexToPoint(pos[0]); if(next_evasive != null && coord_evasive != null) { if(coord_evasive[1] == next_evasive[1] && next_evasive[0] > coord_evasive[0]) { // Checks if it should move right dir_evasive = Direction.RIGHT; } else if(coord_evasive[1] == next_evasive[1] && next_evasive[0] < coord_evasive[0]) { // Checks if it should move left dir_evasive = Direction.LEFT; } else if(coord_evasive[0] == next_evasive[0] && next_evasive[1] < coord_evasive[1]) { // Checks if it should move up dir_evasive = Direction.UP; } else if(coord_evasive[0] == next_evasive[0] && next_evasive[1] > coord_evasive[1]) { // Checks if it should move down dir_evasive = Direction.DOWN; } } // Pursuer ghost direction - Dijkstra Algorithm nextElement_p = Dijkstra.shortWay(grafo,pos[1],pos[2]); next_pursuer = (nextElement_p >=0) ? vertexToPoint(nextElement_p) : null; coord_pursuer = vertexToPoint(pos[1]); if(next_pursuer != null && coord_pursuer != null) { if(coord_pursuer[1] == next_pursuer[1] && next_pursuer[0] > coord_pursuer[0]) { // Checks if it should move right dir_pursuer = Direction.RIGHT; } else if(coord_pursuer[1] == next_pursuer[1] && next_pursuer[0] < coord_pursuer[0]) { // Checks if it should move left dir_pursuer = Direction.LEFT; } else if(coord_pursuer[0] == next_pursuer[0] && next_pursuer[1] < coord_pursuer[1]) { // Checks if it should move up dir_pursuer = Direction.UP; } else if(coord_pursuer[0] == next_pursuer[0] && next_pursuer[1] > coord_pursuer[1]) { // Checks if it should move down dir_pursuer = Direction.DOWN; } } // Move ghosts random.moveRandom(walls); jumper.moveJumper(walls, checkpoints); if(dir_evasive != null) evasive.move(dir_evasive, walls); if(dir_pursuer != null) pursuer.move(dir_pursuer, walls); } // Checks collision between ghosts and PacMan private void ghostCollision(){ for(Ghost ghost : ghosts) { if(pacman.isSameCoordinates(ghost)) { // Checks collision between a ghost and PacMan if(timerCheckSpecial>0) { // Ensures PacMan ate a special checkpoint pacman.setScore(pacman.getScore()+100); // Increases 100 points by killing a ghost ghost.changeCoordinates(ghost.getInitialCoordinate().getX(), // Moves dead ghost to origin ghost.getInitialCoordinate().getY()); }else { pacman.setLife(pacman.getLife()-1); // Decreases the PacMan life pacman.changeCoordinates(pacman.getInitialCoordinate().getX(), // Moves PacMan to origin pacman.getInitialCoordinate().getY()); for(Ghost g : ghosts) { g.changeCoordinates(g.getInitialCoordinate().getX(), // Moves ghosts to origin g.getInitialCoordinate().getY()); } } break; } } } private void checkpointUpdate() { for(Checkpoint checkpoint : checkpoints) { // visits each list element if(pacman.isSameCoordinates(checkpoint)) { // Checks if PacMan has earned a checkpoint if(!checkpoint.isConquered()) { checkpoint.conquer(); if(checkpoint.isSpecial()) { timerCheckSpecial = 15; pacman.setScore(pacman.getScore()+10); // Increases 10 points per special checkpoint }else { pacman.setScore(pacman.getScore()+1); // Increases 1 point per commom checkpoint } if((pacman.getScore()%10000)==0) { // Increases 1 life by earning 10000 points pacman.setLife(pacman.getLife()+1); } } } } } // Checks if the map is done (all checkpoints earned) public boolean isDone() { for(Checkpoint checkpoint : checkpoints) { if(!checkpoint.isConquered()) { return false; } } return true; } // Adjacency matrix used to create the graph with route map private void adjacenceMatrice(){ char[][] aux = new char[getHeight()][getWidth()]; // temporary map int cont = -1; // local counter for (int i = 0; i < aux.length; i++) { for (int j = 0; j < aux[0].length; j++) { aux[i][j] = ' '; // Fills matrix with 'empty char' } } for(Wall wall : walls) { // Fills positions with wall aux[wall.getY()][wall.getX()] = 'x'; } for (int i = 1; i < aux.length-1; i++) { // Creation algorithm. Walls must be placed at the edges (project decision) for (int j = 1; j < aux[0].length-1; j++) { if(aux[i][j] != 'x') { // Ensures that reading will be performed in positions without a wall cont++; // Increases adjacency table row (vertex) if(ghosts.get(1).isSameCoordinates(j, i)) { // Checks if it's reading the evasive ghost position pos[0] = cont; // Stores the vertex in pos vector } if(ghosts.get(3).isSameCoordinates(j, i)) { // Checks if it's reading the pursuer ghost position pos[1] = cont; // Stores the vertex in pos vector } if(pacman.isSameCoordinates(j, i)) { // Checks if it's reading the PacMan position pos[2] = cont; // Stores the vertex in pos vector } if(aux[i-1][j]!='x') { // Checks if there is a wall above of read position int x = 0; // Calculates the number of walls between the elements I[i-1][j] e I[i][j] int elements = 0; // Calculates the number of positions between the elements I[i-1][j] e I[i][j] for(int k = i-1; k < i; k++) { for(int l = j; l < aux[0].length-1; l++) { elements += 1; if(aux[k][l] == 'x') x += 1; } } if(j > 1) { for(int k = i; k <= i; k++) { for(int l = 1; l < j; l++) { elements += 1; if(aux[k][l] == 'x') x += 1; } } } grafo[cont][cont-(elements-x)] = 1; } if(aux[i+1][j]!='x') { // Checks if there is a wall below of read position int x = 0; // Calculates the number of walls between the elements I[i][j] e I[i+1][j] int elements = 0; // Calculates the number of positions between the elements I[i][j] e I[i+1][j] for(int k = i; k <= i; k++) { for(int l = j; l < aux[0].length-1; l++) { elements += 1; if(aux[k][l] == 'x') x += 1; } } if(j > 1) { for(int k = i+1; k <= i+1; k++) { for(int l = 1; l < j; l++) { elements += 1; if(aux[k][l] == 'x') x += 1; } } } grafo[cont][cont+(elements-x)] = 1; } if(aux[i][j-1]!='x') { // Checks if there is a wall to the left of read position grafo[cont][cont-1] = 1; } if(aux[i][j+1]!='x') { // Checks if there is a wall to the right of read position grafo[cont][cont+1] = 1; } } } } } // Returns the point corresponding to a given adjacency matrix vertex private int[] vertexToPoint(int v){ int cont = -1; // vertices counter char[][] aux = new char[getHeight()][getWidth()]; // auxiliary map (temporary) int[] point = new int[2]; // Stores x and y coordinates to be returned (p[x][y]) // Aux fill for (int i = 0; i < aux.length; i++) { for (int j = 0; j < aux[0].length; j++) { if(pacman.getX()==j && pacman.getY()==i) { aux[i][j] = 'P'; }else { aux[i][j] = ' '; } } } // Aux fill for(Wall wall : walls) { aux[wall.getY()][wall.getX()] = 'X'; } // Verification Logic for (int i = 1; i < aux.length-1; i++) { for (int j = 1; j < aux[0].length-1; j++) { if(aux[i][j]!='X') { cont++; } if(cont == v) { point[0] = j; point[1] = i; return point; } } } return null; } // Returns the vertex corresponding to a given map point (except borders, according to defined business rule) private int pointToVertex(int x, int y) { int cont =- 1; // vertices counter char[][] aux = new char[getHeight()][getWidth()]; // Auxiliary map (temporary) // Aux fill for (int i = 0; i < aux.length; i++) { for (int j = 0; j < aux[0].length; j++) { aux[i][j] = ' '; } } // Aux fill for(Wall wall : walls) { aux[wall.getY()][wall.getX()] = 'X'; } // Verification Logic for (int i = 1; i < aux.length-1; i++) { for (int j = 1; j < aux[0].length-1; j++) { if(aux[i][j]!='X') { cont++; } if(x==j && y==i) { return cont; } } } return -1; } private Coordinate midpoint(){ Coordinate aux = new Coordinate(0, 0); // Baricenter of the triangle (biggest distance between the gosts) // Formula: G[(xa+xb+xc)/3][(ya+yb+yc)/3] Wall aux2 = new Wall(0, 0); aux.changeCoordinates(Math.round((ghosts.get(0).getX()+ghosts.get(2).getX()+ghosts.get(3).getX())/3), Math.round((ghosts.get(0).getY()+ghosts.get(2).getY()+ghosts.get(3).getY())/3)); aux2.changeCoordinates(aux.getX(), aux.getY());; // Checks if there is a wall at that coordinate if(!walls.contains(aux2)) { aux.changeCoordinates(aux2.getX(), aux2.getY()); return aux; } aux2.changeCoordinates(aux.getX()+1,aux.getY()); // Checks if there is a wall to the right if(!walls.contains(aux2)){ aux.changeCoordinates(aux2.getX(), aux2.getY()); return aux; } aux2.changeCoordinates(aux.getX()-1,aux.getY()); // Checks if there is a wall to the left if(!walls.contains(aux2)){ aux.changeCoordinates(aux2.getX(), aux2.getY()); return aux; } aux2.changeCoordinates(aux.getX(),aux.getY()+1); // Checks if there is a wall below if(!walls.contains(aux2)){ aux.changeCoordinates(aux2.getX(), aux2.getY()); return aux; } aux2.changeCoordinates(aux.getX(),aux.getY()-1); // Checks if there is a wall above if(!walls.contains(aux2)){ aux.changeCoordinates(aux2.getX(), aux2.getY()); return aux; } aux2.changeCoordinates(aux.getX()+2,aux.getY()); // Checks if there is a wall to the right (2 units forward) if(!walls.contains(aux2)){ aux.changeCoordinates(aux2.getX(), aux2.getY()); return aux; } aux2.changeCoordinates(aux.getX()-2,aux.getY()); // Checks if there is a wall to the left (2 units backward) if(!walls.contains(aux2)){ aux.changeCoordinates(aux2.getX(), aux2.getY()); return aux; } aux2.changeCoordinates(aux.getX(),aux.getY()+2); // Checks if there is a wall bellow (2 units forward) if(!walls.contains(aux2)){ aux.changeCoordinates(aux2.getX(), aux2.getY()); return aux; } aux2.changeCoordinates(aux.getX(),aux.getY()-2); // Checks if there is a wall above (2 units backward) if(!walls.contains(aux2)){ aux.changeCoordinates(aux2.getX(), aux2.getY()); return aux; } return aux; } // Method responsible by updating and map control public void updateMap(Direction direction) { if(direction != null) { // Assemble adjacency matrix (Graph) adjacenceMatrice(); // Special CheckPoint duration control if(timerCheckSpecial>0) { timerCheckSpecial--; } pacman.move(direction, walls, ghosts); // Moves the PacMan moveGhosts(walls); // Moves the ghosts ghostCollision(); // Checks collision between ghosts and PacMan checkpointUpdate(); // Achieve checkpoints } } }
function factorial(n) { if (n <= 1) { return 1; } return n * factorial(n - 1); }
<reponame>v55448330/cattle<filename>code/iaas/model/src/main/java/io/cattle/platform/core/dao/impl/LoadBalancerDaoImpl.java package io.cattle.platform.core.dao.impl; import static io.cattle.platform.core.model.tables.CertificateTable.CERTIFICATE; import static io.cattle.platform.core.model.tables.LoadBalancerCertificateMapTable.LOAD_BALANCER_CERTIFICATE_MAP; import static io.cattle.platform.core.model.tables.LoadBalancerConfigListenerMapTable.LOAD_BALANCER_CONFIG_LISTENER_MAP; import static io.cattle.platform.core.model.tables.LoadBalancerListenerTable.LOAD_BALANCER_LISTENER; import static io.cattle.platform.core.model.tables.LoadBalancerTable.LOAD_BALANCER; import io.cattle.platform.core.constants.CommonStatesConstants; import io.cattle.platform.core.dao.GenericMapDao; import io.cattle.platform.core.dao.GenericResourceDao; import io.cattle.platform.core.dao.LoadBalancerDao; import io.cattle.platform.core.model.Certificate; import io.cattle.platform.core.model.LoadBalancer; import io.cattle.platform.core.model.LoadBalancerConfig; import io.cattle.platform.core.model.LoadBalancerConfigListenerMap; import io.cattle.platform.core.model.LoadBalancerListener; import io.cattle.platform.core.model.tables.records.LoadBalancerListenerRecord; import io.cattle.platform.core.model.tables.records.LoadBalancerRecord; import io.cattle.platform.db.jooq.dao.impl.AbstractJooqDao; import java.util.List; import javax.inject.Inject; public class LoadBalancerDaoImpl extends AbstractJooqDao implements LoadBalancerDao { @Inject GenericMapDao mapDao; @Inject GenericResourceDao resourceDao; @Override public boolean updateLoadBalancer(long lbId, Long glbId, Long weight) { int i = create() .update(LOAD_BALANCER) .set(LOAD_BALANCER.GLOBAL_LOAD_BALANCER_ID, glbId) .set(LOAD_BALANCER.WEIGHT, weight) .where(LOAD_BALANCER.ID.eq(lbId)) .execute(); return i == 1; } @Override public List<? extends LoadBalancer> listByConfigId(long configId) { return create() .selectFrom(LOAD_BALANCER) .where( LOAD_BALANCER.LOAD_BALANCER_CONFIG_ID.eq(configId) .and(LOAD_BALANCER.REMOVED.isNull())).fetchInto(LoadBalancerRecord.class); } @Override public List<? extends LoadBalancerListener> listActiveListenersForConfig(long configId) { return create() .select(LOAD_BALANCER_LISTENER.fields()) .from(LOAD_BALANCER_LISTENER) .join(LOAD_BALANCER_CONFIG_LISTENER_MAP) .on(LOAD_BALANCER_CONFIG_LISTENER_MAP.LOAD_BALANCER_LISTENER_ID.eq(LOAD_BALANCER_LISTENER.ID) .and(LOAD_BALANCER_CONFIG_LISTENER_MAP.LOAD_BALANCER_CONFIG_ID.eq(configId)) .and(LOAD_BALANCER_CONFIG_LISTENER_MAP.STATE.in(CommonStatesConstants.ACTIVATING, CommonStatesConstants.ACTIVE))) .where(LOAD_BALANCER_LISTENER.REMOVED.isNull()) .fetchInto(LoadBalancerListenerRecord.class); } @Override public LoadBalancer getActiveLoadBalancerById(long lbId) { List<? extends LoadBalancer> lbs = create() .select(LOAD_BALANCER.fields()) .from(LOAD_BALANCER) .where(LOAD_BALANCER.REMOVED.isNull() .and(LOAD_BALANCER.ID.eq(lbId)) .and( LOAD_BALANCER.STATE.in(CommonStatesConstants.ACTIVATING, CommonStatesConstants.ACTIVE))) .fetchInto(LoadBalancerRecord.class); if (lbs.isEmpty()) { return null; } return lbs.get(0); } @Override public void addListenerToConfig(LoadBalancerConfig config, long listenerId) { LoadBalancerConfigListenerMap lbConfigListenerMap = mapDao.findNonRemoved(LoadBalancerConfigListenerMap.class, LoadBalancerConfig.class, config.getId(), LoadBalancerListener.class, listenerId); if (lbConfigListenerMap == null) { resourceDao.createAndSchedule(LoadBalancerConfigListenerMap.class, LOAD_BALANCER_CONFIG_LISTENER_MAP.LOAD_BALANCER_CONFIG_ID, config.getId(), LOAD_BALANCER_CONFIG_LISTENER_MAP.LOAD_BALANCER_LISTENER_ID, listenerId, LOAD_BALANCER_CONFIG_LISTENER_MAP.ACCOUNT_ID, config.getAccountId()); } } @Override public List<Certificate> getLoadBalancerCertificates(LoadBalancer lb) { return create() .select(CERTIFICATE.fields()) .from(CERTIFICATE) .join(LOAD_BALANCER_CERTIFICATE_MAP) .on(CERTIFICATE.ID.eq(LOAD_BALANCER_CERTIFICATE_MAP.CERTIFICATE_ID) .and(LOAD_BALANCER_CERTIFICATE_MAP.LOAD_BALANCER_ID.eq(lb.getId())) .and(LOAD_BALANCER_CERTIFICATE_MAP.STATE.in(CommonStatesConstants.ACTIVATING, CommonStatesConstants.ACTIVE, CommonStatesConstants.REQUESTED))) .where(CERTIFICATE.REMOVED.isNull()) .fetchInto(Certificate.class); } @Override public Certificate getLoadBalancerDefaultCertificate(LoadBalancer lb) { List<? extends Certificate> certs = create() .select(CERTIFICATE.fields()) .from(CERTIFICATE) .join(LOAD_BALANCER_CERTIFICATE_MAP) .on(CERTIFICATE.ID.eq(LOAD_BALANCER_CERTIFICATE_MAP.CERTIFICATE_ID) .and(LOAD_BALANCER_CERTIFICATE_MAP.LOAD_BALANCER_ID.eq(lb.getId())) .and(LOAD_BALANCER_CERTIFICATE_MAP.IS_DEFAULT.eq(true)) .and(LOAD_BALANCER_CERTIFICATE_MAP.STATE.in(CommonStatesConstants.ACTIVATING, CommonStatesConstants.ACTIVE, CommonStatesConstants.REQUESTED))) .where(CERTIFICATE.REMOVED.isNull()) .fetchInto(Certificate.class); if (certs.isEmpty()) { return null; } return certs.get(0); } }
<filename>test/programs/java/Statements/SubClass.java public class SubClass extends SuperClass { @Override public void method() { int startSubMethod; int endSubMethod; } }
def generate_primes(n): primes = [] is_prime = [True] * n for i in range(2, n+1): if is_prime[i]: primes.append(i) for j in range(i*i, n+1, i): is_prime[j] = False return primes n = 10 prime_list = generate_primes(n) print(prime_list) # Output: [2,3,5,7]
<gh_stars>10-100 /** * Implementation in progress. */ export class Buffer{ constructor(gamma = 0.99){ this.gamma = gamma; this.obs = []; this.act = []; this.ret = []; this.rtg = []; } store(temp_traj, last_sv){ if(temp_traj.length > 0){ let nulls = temp_traj.map((el)=>{ return el[0]; }); let firsts = temp_traj.map((el)=>{ return el[1]; }); let seconds = temp_traj.map((el)=>{ return el[2]; }); let thirds = temp_traj.map((el)=>{ return el[3]; }); this.obs = this.obs.concat(nulls); let rtg = this.discounted_rewards(firsts, last_sv, self.gamma); let temp = rtg.map((value, index) => { value - thirds[i]; }); this.ret = this.ret.concat(temp); this.rtg.concat(rtg); this.act.concat(seconds); } } getBatch(){ return tf.tensor(this.obs), tf.tensor(this.act), tf.tensor(this.ret), tf.tensor(this.rtg); } discounted_rewards(rews, last_sv, gamma){ let rtg = tf.zerosLike(rews).buffer(); rtg.set(rews[rews.length-1] + gamma * last_sv, rews.length-1); for(let i = rews.length-1;i >= 0; i--){ rtg.set(rews[i] + gamma * rtg[i+1], i); } return rtg.toTensor().dataSync(); } get length(){ return this.obs.length; } } export class AC{ constructor(hidden_sizes=[64], ac_lr=0.004, cr_lr=0.015, gamma=0.99, steps_per_epoch=100, ){ } log_summary(writer, step, p_loss, entropy, p_log, ret_batch){ } mlp(x, hidden_layers, output_size, activation= tf.layers.reLU, last_activation=null){ //multilayer perceptron let inputt = tf.input({shape: [null, x[0]]}); x = inputt; for (let l in hidden_layers){ x = tf.layers.dense({units: l, activation: activation}).apply(x); } let output = tf.layers.dense({units: output_size, activation: last_activation}).apply(x); return tf.model({inputs: inputt, outputs: output}) } softmax_entropy(values){ return tf.sum(values.softmax() * values.logSoftmax(), axis=-1); } }
<filename>src/de/erichseifert/gral/graphics/DrawingContext.java /* * GRAL: GRAphing Library for Java(R) * * (C) Copyright 2009-2012 <NAME> <dev[at]erichseifert.de>, * <NAME> <michael[at]erichseifert.de> * * This file is part of GRAL. * * GRAL is free software: you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * * GRAL is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with GRAL. If not, see <http://www.gnu.org/licenses/>. */ package de.erichseifert.gral.graphics; import java.awt.Graphics2D; /** * Class that stores an object for drawing and additional context information * that may be necessary to determine how to draw the object. This includes * information on drawing quality and the target media (screen, paper, etc.). */ public class DrawingContext { /** * Data type that describes the quality mode of drawing operations. */ public static enum Quality { /** Fast drawing mode. */ DRAFT, /** Standard drawing mode. */ NORMAL, /** High quality drawing mode. */ QUALITY } /** * Data type that describes the type of the drawing target. */ public static enum Target { /** Bitmap drawing target consisting of pixels. */ BITMAP, /** Vector drawing target consisting of lines and curves. */ VECTOR } /** Graphics instance used for drawing. */ private final Graphics2D graphics; /** Quality level used for drawing. */ private final Quality quality; /** Target media. */ private final Target target; /** * Initializes a new context with a {@code Graphics2D} object. * @param graphics Object for drawing geometry. */ public DrawingContext(Graphics2D graphics) { this(graphics, Quality.NORMAL, Target.BITMAP); } /** * Initializes a new context with a {@code Graphics2D} object. * @param graphics Object for drawing geometry. * @param quality Drawing quality. * @param target Target media. */ public DrawingContext(Graphics2D graphics, Quality quality, Target target) { this.graphics = graphics; this.quality = quality; this.target = target; } /** * Returns the object for drawing geometry. * @return Graphics object. */ public Graphics2D getGraphics() { return graphics; } /** * Returns the desired display quality. * @return Display quality mode. */ public Quality getQuality() { return quality; } /** * Returns the drawing target. * @return Drawing target. */ public Target getTarget() { return target; } }
# frozen_string_literal: true require "spec_helper" RSpec.describe Dry::ElasticModel::Base do class Foo < described_class field :text_field, :text field :keyword_field, :keyword, index: false field :date_field, :date field :long_field, :long field :double_field, :double field :boolean_field, :boolean field :ip_field, :ip list :list_text_field, :text range :range_long_field, :long end describe "mapping" do let(:expected_mapping) do { foo: { properties: { text_field: { type: "text", index: "not_analyzed" }, keyword_field: { type: "keyword", index: false }, date_field: { type: "date", format: "strict_date_optional_time||epoch_millis" }, long_field: { type: "long" }, double_field: { type: "double" }, boolean_field: { type: "boolean" }, ip_field: { type: "ip" }, list_text_field: { type: "text" }, range_long_field: { type: "long_range" } } } } end it "is valid" do expect(Foo.mapping).to eq(expected_mapping) end end describe "as_json" do it "returns instance of model" do model = Foo.new( text_field: "foo", keyword_field: :test, date_field: Date.today, long_field: 10, double_field: 1.0, boolean_field: true, ip_field: "127.0.0.1", list_text_field: %w(a b c), range_long_field: { gt: 0, lt: 10 } ) expect(model.as_json).to( eq( text_field: "foo", keyword_field: :test, date_field: Date.today, long_field: 10, double_field: 1.0, boolean_field: true, ip_field: "127.0.0.1", list_text_field: %w(a b c), range_long_field: { gt: 0, gte: nil, lt: 10, lte: nil } ) ) end end end
<reponame>isabella232/aurora from base_rest_helper import * class SecurityGroupHelper(BaseRESTHelper): def create_security_group(self, parameters=None): """ Arguments: - parameters: dict, parameters of sec. group (see Wiki for details). Return: - dict, parameters of just created group. """ params = { 'name': '', 'description': 'REST auto-test', # optional } # apply non-empty user-defined parameters if parameters is not None: for k in parameters: if parameters[k] != "": params[k] = parameters[k] if params['name'] == "": groups = self.utils.get_list('securitygroups') params['name'] = self.utils.generate_string(4, *[i['name'] for i in groups]) # launch group creation and verify result (inside of send_request) res = self.utils.send_request("POST", 'create_security_group', data=params) return json.loads(res.content)['resp'] def delete_security_group(self, gid): """ Arguments: - gid: string - group id. Return: - bool: True if success. """ params = {'id': gid} res = self.utils.send_request('POST', 'delete_security_group', data=params) remaining = [i for i in self.utils.get_list('securitygroups') if i['id'] == gid] return len(remaining) == 0 def show_security_group(self, id): """ Arguments: - id: string Return: - JSON dict with group parameters """ params = {'id': id} res = self.utils.send_request('GET', 'show_security_group', data=params) return json.loads(res.content)['securityGroup'] def add_rule(self, group_id): params = { 'id': group_id, 'ipProtocol': 'TCP', 'fromPort': 1, # int 'toPort': 2, # int 'sourceGroup': group_id, # one of sec. groups # 'cidr': '' # optional. format: 'ip/mask' where ip - from 0.0.0.0 to 255.255.255.255, mask 0 to 32 } res = self.utils.send_request('GET', 'add_rule', data=params) return json.loads(res.content)['resp']['security_group_rule'] def delete_rule(self, selected_rules): params = {'selectedRules': selected_rules} # selected_rules can be str or list of str. res = self.utils.send_request('POST', 'delete_rule', data=params) return json.loads(res.content) class KeypairHelper(BaseRESTHelper): def create_keypair(self, parameters=None): params = {'name': ''} # apply non-empty user-defined parameters if parameters is not None: for k in parameters: if parameters[k] != "": params[k] = parameters[k] if params['name'] == "": pairs = self.utils.get_list('keypairs') params['name'] = self.utils.generate_string(3, *[p['name'] for p in pairs]) res = self.utils.send_request('POST', 'create_keypair', data=params) return json.loads(res.content)['keypair'] def delete_keypair(self, pairname): params = {'keypairName': pairname} res = self.utils.send_request('POST', 'delete_keypair', data=params) # res usually contains not very useful [None] so return True/False result. remaining = [p for p in self.utils.get_list('keypairs') if p['name'] == pairname] return len(remaining) == 0 def import_keypair(self, params): """ Arguments: - params: dict {'name' '<value>', 'publicKey': '<value>'} """ res = self.utils.send_request('POST', 'import_keypair', data=params) return json.loads(res.content)
def transform_string(input_string): modified_string = input_string.replace("django", "Django", -1) modified_string = modified_string.replace("http", "HTTPS", -1) return modified_string
#!/bin/bash set -euox pipefail source ci/openstack/vars.sh if [ "${RUN_OPENSTACK_CI:-}" != "true" ]; then echo RUN_OPENSTACK_CI is set to false, skipping the openstack end to end test. exit fi echo SET UP DNS cp /etc/resolv.conf resolv.conf.orig DNS_IP=$(openstack server show dns-0.$ENV_ID.example.com --format value --column addresses | awk '{print $2}') grep -v '^nameserver' resolv.conf.orig > resolv.conf.openshift echo nameserver "$DNS_IP" >> resolv.conf.openshift sudo cp resolv.conf.openshift /etc/resolv.conf function restore_dns { echo RESTORING DNS sudo cp resolv.conf.orig /etc/resolv.conf } trap restore_dns EXIT mkdir -p bin scp -o "StrictHostKeyChecking no" -o "UserKnownHostsFile /dev/null" openshift@console.$ENV_ID.example.com:/usr/bin/oc bin/ ls -alh bin export PATH="$PWD/bin:$PATH" ENV_ID="openshift-$TRAVIS_BUILD_NUMBER" oc login --insecure-skip-tls-verify=true https://console.$ENV_ID.example.com:8443 -u test -p password oc new-project test oc new-app --template=cakephp-mysql-example set +x echo Waiting for the pods to come up STATUS=timeout for i in $(seq 600); do if [ "$(oc status -v | grep 'deployment.*deployed' | wc -l)" -eq 2 ]; then STATUS=success echo Both pods were deployed break elif [ "$(oc status -v | grep -i 'error\|fail' | wc -l)" -gt 0 ]; then STATUS=error echo ERROR: The deployment failed break else printf . sleep 15 fi done if [ "$STATUS" = timeout ]; then echo ERROR: Timed out waiting for the pods fi echo 'Output of `oc status -v`:' oc status -v echo echo 'Output of `oc logs bc/cakephp-mysql-example`:' oc logs bc/cakephp-mysql-example if [ "$STATUS" != success ]; then echo "ERROR: The deployment didn't succeed" exit 1 fi set -o pipefail curl "http://cakephp-mysql-example-test.apps.$ENV_ID.example.com" | grep 'Welcome to your CakePHP application on OpenShift' echo "SUCCESS \o/"
<filename>lang/py/pyadmin/13/hello_optparse.py #! /usr/bin/env python3 # -*-coding:utf-8 -*- # @Time : 2019/06/19 22:44:36 # @Author : che # @Email : <EMAIL> import optparse def main(): p = optparse.OptionParser() p.add_option("--sysadmin", "-s", dest="sysadmin", default="BOFH") options, arguments = p.parse_args() print("Hello, %s" % options.sysadmin) if __name__ == "__main__": main()
<gh_stars>0 const DrawCard = require('../../../drawcard.js'); class ObaraSand extends DrawCard { setupCardAbilities(ability) { this.persistentEffect({ condition: () => ( this.game.currentChallenge && this.game.currentChallenge.challengeType === 'power' && this.game.currentChallenge.defendingPlayer === this.controller ), match: this, effect: [ // Add the icon as a UI hint, but Obara can be declared even if // the opponent removes that icon somehow. ability.effects.addIcon('power'), ability.effects.canBeDeclaredWithoutIcon(), ability.effects.canBeDeclaredWhileKneeling() ] }); } } ObaraSand.code = '01108'; module.exports = ObaraSand;
#!/usr/bin/env sh timestampfile=$USER-$HOSTNAME-lastrun.timestamp euler2 align cases/$1.txt -e $3 -r $2 >& $1.out folder=$(head -n 1 $timestampfile) if [[ -n "$(diff $folder/3-MIR/$1_mir.csv expected/$1_mir.expected)" ]]; then diff $folder/3-MIR/$1_mir.csv expected/$1_mir.expected > $1.dif; echo "There is new dif in $1.dif!" echo "$1 $2 Failed!" else rm $1.out; echo "$1 $2 Passed!" rm -rf $USER-$HOSTNAME rm $timestampfile rm report.csv fi
#!/bin/bash -x # This script installes gitblit on a system running under systemd. # The script assumes the server is running as user giblit # First create a file with the default settings cat > /tmp/gitblit.defaults << EOF GITBLIT_PATH=/opt/gitblit GITBLIT_BASE_FOLDER=/opt/gitblit/data GITBLIT_HTTP_PORT=0 GITBLIT_HTTPS_PORT=8443 GITBLIT_LOG=/var/log/gitblit.log EOF # Create a systemd service file cat > /tmp/gitblit.service << EOF [Unit] Description=Gitblit managing, viewing, and serving Git repositories. After=network.target [Service] User=gitblit Group=gitblit Environment="ARGS=-server -Xmx1024M -Djava.awt.headless=true -jar" EnvironmentFile=-/etc/sysconfig/gitblit WorkingDirectory=/opt/gitblit ExecStart=/usr/bin/java \$ARGS gitblit.jar --httpsPort \$GITBLIT_HTTPS_PORT --httpPort \$GITBLIT_HTTP_PORT --baseFolder \$GITBLIT_BASE_FOLDER --dailyLogFile ExecStop=/usr/bin/java \$ARGS gitblit.jar --baseFolder \$GITBLIT_BASE_FOLDER --stop [Install] WantedBy=multi-user.target EOF # Finally copy the files to the destination and register the systemd unit. sudo su -c "cp /tmp/gitblit.defaults /etc/sysconfig/gitblit && cp /tmp/gitblit.service /usr/lib/systemd/system/" sudo su -c "systemctl daemon-reload && systemctl enable gitblit.service && systemctl start gitblit.service" # Prepare the logfile sudo su -c "touch /var/log/gitblit.log && chown gitblit:gitblit /var/log/gitblit.log"
<gh_stars>1-10 # -*- coding: utf-8 -*- import subprocess import shlex, subprocess def run(): while True: command = str(input(''' ██▓ ▄▄▄ ▄▄▄█████▓▄▄▄█████▓ ██▓ ▄████▄ ▓█████ ▓█████▄ ▓██▒ ▒████▄ ▓ ██▒ ▓▒▓ ██▒ ▓▒▓██▒▒██▀ ▀█ ▓█ ▀ ▒██▀ ██▌ ▒██░ ▒██ ▀█▄ ▒ ▓██░ ▒░▒ ▓██░ ▒░▒██▒▒▓█ ▄ ▒███ ░██ █▌ ▒██░ ░██▄▄▄▄██░ ▓██▓ ░ ░ ▓██▓ ░ ░██░▒▓▓▄ ▄██▒▒▓█ ▄ ░▓█▄ ▌ ░██████▒▓█ ▓██▒ ▒██▒ ░ ▒██▒ ░ ░██░▒ ▓███▀ ░░▒████▒░▒████▓ ░ ▒░▓ ░▒▒ ▓▒█░ ▒ ░░ ▒ ░░ ░▓ ░ ░▒ ▒ ░░░ ▒░ ░ ▒▒▓ ▒ ░ ░ ▒ ░ ▒ ▒▒ ░ ░ ░ ▒ ░ ░ ▒ ░ ░ ░ ░ ▒ ▒ ░ ░ ░ ▒ ░ ░ ▒ ░░ ░ ░ ░ ░ ░ ░ ░ ░ ░ ░ ░ ░ ░ ░ ░ ░ Herramienta para hacer visualizaciones y animaciones con retículas en 2D, 3D y 4D. CIC - IPN - ESFM - Made with manim, python and LaTex. ¿Cuál es la dimensión del Espacio donde vas a trabajar? [D] Dimensión Dos |R^2 [T] Dimensión Tres |R^3 [C] Dimensión Cuatro |R^4 [s] salir ''')) #################################################################################################################################################### # This is already! :D if command == 'D': dim1 = int(input('¿Cuál es la dimensión de la retícula?: ')) if dim1 == 1 : command_line = 'python3.7 -m manim Laticed.py SpanLattice1D -pl' args = shlex.split(command_line) subprocess.call(args) if dim1 == 2 : do1 = str(input(''' ¿Qué deseas hacer? [a] Animar la retícula por el conjunto generador. [b] Dibujar la retícula directamente. [c] Diujar la reítcula y su Dominio Fundamental. [d] Reducir la retícula por algoritmo de Gauss. ''')) if do1 == 'a': command_line = 'python3.7 -m manim Laticed.py SpanLattice2D -pl' args = shlex.split(command_line) subprocess.call(args) if do1 == 'b': command_line = 'python3.7 -m manim Laticed.py DrawLattice2D -pl' args = shlex.split(command_line) subprocess.call(args) if do1 == 'c': command_line = 'python3.7 -m manim Laticed.py DrawDomFundLattice2D -pl' args = shlex.split(command_line) subprocess.call(args) if do1 == 'd': command_line = 'python3.7 -m manim Laticed.py GaussLatticeReduction -pl' args = shlex.split(command_line) subprocess.call(args) else: print("¡Selecione una opción!") if dim1 >= 3: print('¡La dimensión de la retícula no debe ser mayor a la del espacio!') ######################################################################################################################## if command == 'T': dim2 = int(input('¿Cuál es la dimensión de la retícula?: ')) if dim2 == 1 : command_line = 'python3.7 -m manim Laticed.py DrawLattice1Din3D -pl' args = shlex.split(command_line) subprocess.call(args) if dim2 == 2 : do2 = str(input(''' ¿Qué deseas hacer? [a] Dibujar la retícula directamente. [b] Diujar la reítcula y su Dominio Fundamental. ''')) if do2 == 'a': command_line = 'python3.7 -m manim Laticed.py DrawLattice2Din3D -pl' args = shlex.split(command_line) subprocess.call(args) if do2 == 'b': command_line = 'python3.7 -m manim Laticed.py DrawLatticeDomFund2Din3D -pl' args = shlex.split(command_line) subprocess.call(args) else: break if dim2 == 3: do3 = str(input(''' ¿Qué deseas hacer? [a] Dibujar la retícula directamente. [b] Diujar la reítcula y su Dominio Fundamental. [c] Reducir la retícula por algoritmo LLL. ''')) # This is already! :D if do3 == 'a': command_line = 'python3.7 -m manim Laticed.py DrawLattice3D -pl' args = shlex.split(command_line) subprocess.call(args) if do3 == 'b': command_line = 'python3.7 -m manim Laticed.py DrawDomFund3D -pl' args = shlex.split(command_line) subprocess.call(args) if do3 == 'c': command_line = 'python3.7 -m manim Laticed.py LLLReduceLattice -pl' args = shlex.split(command_line) subprocess.call(args) else: break if dim2 >= 4: print('¡La dimensión de la retícula no debe ser mayor a la del espacio!') ############################################################################################################################################# if command == 'C': print("Se va a dibujar la represenación de una retícula de cuatro dimensiones.") command_line = 'python3.7 -m manim Laticed.py DrawLattice4D -pl' args = shlex.split(command_line) subprocess.call(args) ############################################################################################################################################# if command == 's': break else: print("¡Seleccione una de las opciones!") if __name__ == '__main__': run()
const db = require("../models"); const Comment = db.comments; //Create and save a new comment exports.create = async (req, res) => { if (!req.body.comment) { res.status(400).send({ message: "Cannot post an empty comment" }) } try { const comment = { comment: req.body.comment }; const response = await Comment.create(comment) res.send(response); } catch {err => { res.status(500).send({ message: err.message || "Something went wrong while creating your comment" }); }}; }; //Retrieve all Comments from the DB exports.findAll = async (req, res) => { try { const comments = await Comment.findAll() res.send(comments); } catch { (err) => { res.status(500).send({ message: err.message || "Some error occurred while retrieving comments." }); }; }; }
<reponame>dqian/node-boilerplate<filename>src/index.ts import * as http from 'http' import config from '~/config' import './packages/api/auth' import { getConnection } from './packages/database' import "reflect-metadata" import server from './server' const PORT = config.SERVER_PORT || '3000' async function onStart(): Promise<void> { try { // initialize database connection await getConnection() console.log(`Database successfully connected.`) } catch (err) { // tslint:disable-next-line:no-console console.log(err) throw err } console.log(`Server up and running on port ${PORT}.`) } const currentServer = http.createServer({}, server) currentServer.listen(PORT, onStart)
<reponame>SDurand7/AVLIT-Engine<gh_stars>0 #pragma once #include <Core/Base/include/SceneObject.hpp> #include <Core/Renderer/include/RenderTarget.hpp> namespace AVLIT { class Light : public SceneObject { public: Light(const Light &light) = delete; // transform should be a composition of a rotation and a translation, debug models should be scaled on load Light(const std::string &name, const Transform &transform, uint shadowMapWidth, uint shadowMapHeight, const Color3 &color); virtual ~Light() = default; virtual void setParameters(const std::string &name, Shader *shader, int textureUnit) const = 0; virtual const Mat4 &projection() const = 0; inline Mat4 view() const; inline const RenderTarget *shadowMap() const; inline uint shadowMapWidth() const; inline uint shadowMapHeight() const; AVLIT_API inline Color3 color() const; AVLIT_API inline void setColor(const Color3 &color); AVLIT_API inline bool isLit() const; AVLIT_API inline void switchState(); protected: RenderTargetUptr m_shadowMap; uint m_shadowMapWidth; uint m_shadowMapHeight; Color3 m_color; bool m_lit = true; }; class PointLight : public Light { public: PointLight(const std::string &name, const Transform &transform, uint shadowMapWidth, uint shadowMapHeight, const Color3 &color); void setParameters(const std::string &name, Shader *shader, int textureUnit) const override; const Mat4 &projection() const override; private: static const float maxRange; static const Mat4 m_projection; }; class DirectionalLight : public Light { public: DirectionalLight(const std::string &name, const Transform &transform, uint shadowMapWidth, uint shadowMapHeight, const Color3 &color); void setParameters(const std::string &name, Shader *shader, int textureUnit) const override; const Mat4 &projection() const override; private: static const Mat4 m_projection; }; class SpotLight : public Light { public: SpotLight(const std::string &name, const Transform &transform, uint shadowMapWidth, uint shadowMapHeight, const Color3 &color, float innerAngle, float outerAngle); void setParameters(const std::string &name, Shader *shader, int textureUnit) const override; const Mat4 &projection() const override; AVLIT_API float innerAngle() const; AVLIT_API void setInnerAngle(float angle); AVLIT_API float outerAngle() const; AVLIT_API void setOuterAngle(float angle); private: static const float maxRange; static const Mat4 m_projection; float m_cosInnerAngle; float m_cosOuterAngle; }; class AmbientLight : public Light { public: AmbientLight(const std::string &name, const Transform &transform, const Color3 &color); void setParameters(const std::string &name, Shader *shader, int textureUnit) const override; const Mat4 &projection() const override; private: static const Mat4 m_projection; }; } // namespace AVLIT #include <Core/Base/inline/Light.inl>
#!/bin/bash PYTHON="coverage run -p" URL=http://127.0.0.1/file mkdir -p tmp $PYTHON shadowsocks/local.py -c tests/aes.json & LOCAL=$! $PYTHON shadowsocks/server.py -c tests/aes.json --forbidden-ip "" & SERVER=$! sleep 3 time curl -o tmp/expected $URL time curl -o tmp/result --socks5-hostname 127.0.0.1:1081 $URL kill -s SIGINT $LOCAL kill -s SIGINT $SERVER sleep 2 diff tmp/expected tmp/result || exit 1
public static String extractPackageName(String packageDeclaration) { int startIndex = packageDeclaration.indexOf("package") + "package".length(); int endIndex = packageDeclaration.indexOf(";"); return packageDeclaration.substring(startIndex, endIndex).trim(); }
#!/bin/bash set -e # import common functions src_dir="$(dirname "$0")" source ${src_dir}/_common.sh # define input arguments fn="${1}" # remove raw miriad files fn_xx=${fn} fn_yy=$(replace_pol $fn "yy") fn_xy=$(replace_pol $fn "xy") fn_yx=$(replace_pol $fn "yx") echo rm -rf "${fn_xx}" rm -rf "${fn_xx}" echo rm -rf "${fn_yy}" rm -rf "${fn_yy}" echo rm -rf "${fn_xy}" rm -rf "${fn_xy}" echo rm -rf "${fn_yx}" rm -rf "${fn_yx}"
<filename>Modulo 6 - NodeJS/myapp/moduloDNS.js var dns = require("dns"); var w3 = dns.lookup("www.google.es", function(err, address, family) { console.log(address); });
<reponame>edjannoo/api-documentation-frontend<gh_stars>0 /* * Copyright 2020 HM Revenue & Customs * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package uk.gov.hmrc.apidocumentation import org.raml.v2.api.model.v10.api.{Api, DocumentationItem} import uk.gov.hmrc.apidocumentation.models.{DocsVisibility, ExtendedAPIVersion} import uk.gov.hmrc.apidocumentation.views.helpers.VersionDocsVisible import scala.collection.JavaConverters._ package object services { type RAML = Api implicit class RicherRAML(val x: Api) { def documentationForVersion(version: Option[ExtendedAPIVersion]): Seq[DocumentationItem] = versionVisibility(version) match { case DocsVisibility.VISIBLE => x.documentation.asScala.toSeq case DocsVisibility.OVERVIEW_ONLY => x.documentation.asScala.filter(_.title.value == "Overview") case _ => Seq.empty } private def versionVisibility(version: Option[ExtendedAPIVersion]): DocsVisibility.Value = version match { case Some(v) => VersionDocsVisible(v.visibility) case _ => DocsVisibility.VISIBLE } } }
#include <boost/test/unit_test.hpp> #include "eosio/chain/name.hpp" BOOST_AUTO_TEST_SUITE(name_test) BOOST_AUTO_TEST_CASE(default_to_string) { eosio::chain::name name; std::string result = name.to_string(); BOOST_CHECK_EQUAL("", result); } BOOST_AUTO_TEST_SUITE_END()
#!/bin/sh PRIVATE_IP=`ip a | grep 172 | awk '{print $2}' | sed 's#/.*$##'` echo -e "Running a command\n /bin/thanos $@ --cluster.address="${PRIVATE_IP}:10900"" exec /bin/thanos $@ --cluster.address="${PRIVATE_IP}:10900"
<reponame>segfaultxavi/nem.core package org.nem.core.test; import org.nem.core.crypto.KeyPair; import org.nem.core.node.*; import org.nem.core.time.NetworkTimeStamp; import org.nem.core.time.synchronization.*; import java.security.SecureRandom; import java.util.*; public class TimeSyncUtils { private static final long MINUTE = 60L * 1000L; private static final long TOLERATED_DEVIATION_START = 120 * MINUTE; private static final KeyPair KEY_PAIR = new KeyPair(); /** * Creates count sorted synchronization samples with a time offset that is tolerable. * * @param startValue The time offset to start with. * @param count The number of samples needed. * @return the sorted list of samples */ public static List<TimeSynchronizationSample> createTolerableSortedSamples(final long startValue, final int count) { final List<TimeSynchronizationSample> samples = createTolerableSamples(startValue, count); Collections.sort(samples); return samples; } /** * Creates count unsorted synchronization samples with a time offset that is tolerable. * * @param startValue The time offset to start with. * @param count The number of samples needed. * @return the unsorted list of samples */ public static List<TimeSynchronizationSample> createTolerableUnsortedSamples(final long startValue, final int count) { final List<TimeSynchronizationSample> samples = createTolerableSamples(startValue, count); Collections.shuffle(samples); return samples; } private static List<TimeSynchronizationSample> createTolerableSamples(final long startValue, final int count) { final List<TimeSynchronizationSample> samples = new ArrayList<>(); for (int i = 1; i <= count; i++) { samples.add(createTimeSynchronizationSample(startValue + i)); } return samples; } /** * Creates count synchronization samples with a time offset that is not tolerable. * * @param count The number of samples needed. * @return the list of samples */ public static List<TimeSynchronizationSample> createIntolerableSamples(final int count) { final List<TimeSynchronizationSample> samples = new ArrayList<>(); for (int i = 1; i <= count; i++) { samples.add(createTimeSynchronizationSample(TOLERATED_DEVIATION_START + i)); } return samples; } /** * Creates a synchronization sample with a given time offset. * * @param timeOffset The time offset in ms. * @return The time synchronization sample */ private static TimeSynchronizationSample createTimeSynchronizationSample(final long timeOffset) { return new TimeSynchronizationSample( new Node(new NodeIdentity(KEY_PAIR, "node"), new NodeEndpoint("http", "10.10.10.12", 13), null), new CommunicationTimeStamps(new NetworkTimeStamp(0), new NetworkTimeStamp(10)), new CommunicationTimeStamps(new NetworkTimeStamp(5 + timeOffset), new NetworkTimeStamp(5 + timeOffset))); } /** * Creates a synchronization sample with a given time offset. * * @param startValue The time offset to start with. * @param count The number of samples needed. * @return The time synchronization sample */ public static List<TimeSynchronizationSample> createTimeSynchronizationSamplesWithDifferentKeyPairs(final int startValue, final int count) { final List<TimeSynchronizationSample> samples = new ArrayList<>(); for (int i = 0; i < count; i++) { samples.add(createTimeSynchronizationSampleWithKeyPair(new KeyPair(), startValue + i)); } return samples; } /** * Creates a synchronization sample with a given time offset. * * @param count The number of samples needed. * @param mean The mean time offset the samples should have. * @return The time synchronization sample */ public static List<TimeSynchronizationSample> createRandomTolerableSamplesWithDifferentKeyPairsAroundMean(final int count, final long mean) { final SecureRandom random = new SecureRandom(); final List<TimeSynchronizationSample> samples = new ArrayList<>(); if (count % 2 == 1) { samples.add(createTimeSynchronizationSampleWithKeyPair(new KeyPair(), mean)); } for (int i = 0; i < count / 2; i++) { final int value = random.nextInt(1000); samples.add(createTimeSynchronizationSampleWithKeyPair(new KeyPair(), mean + value)); samples.add(createTimeSynchronizationSampleWithKeyPair(new KeyPair(), mean - value)); } return samples; } /** * Creates a synchronization sample with a given time offset. * * @param keyPair The key pair to tie the node to. * @param timeOffset The time offset in ms. * @return The time synchronization sample */ private static TimeSynchronizationSample createTimeSynchronizationSampleWithKeyPair(final KeyPair keyPair, final long timeOffset) { return new TimeSynchronizationSample(new Node(new NodeIdentity(keyPair, "node"), new NodeEndpoint("http", "10.10.10.12", 13), null), new CommunicationTimeStamps(new NetworkTimeStamp(0), new NetworkTimeStamp(10)), new CommunicationTimeStamps(new NetworkTimeStamp(5 + timeOffset), new NetworkTimeStamp(5 + timeOffset))); } /** * Creates a synchronization sample with a given duration. * * @param duration The duration in ms. * @return The time synchronization sample */ public static TimeSynchronizationSample createTimeSynchronizationSampleWithDuration(final long duration) { return new TimeSynchronizationSample( new Node(new NodeIdentity(new KeyPair(), "node"), new NodeEndpoint("http", "10.10.10.12", 13), null), new CommunicationTimeStamps(new NetworkTimeStamp(0), new NetworkTimeStamp(duration)), new CommunicationTimeStamps(new NetworkTimeStamp(duration / 2), new NetworkTimeStamp(duration / 2))); } /** * Creates a synchronization sample. * * @param keyPair The remote node's key pair. * @param localSendTimeStamp The local send time stamp. * @param localReceiveTimeStamp The local receive time stamp. * @param remoteSendTimeStamp The remote send time stamp. * @param remoteReceiveTimeStamp The remote receive time stamp. * @return The time synchronization sample */ public static TimeSynchronizationSample createTimeSynchronizationSample(final KeyPair keyPair, final long localSendTimeStamp, final long localReceiveTimeStamp, final long remoteSendTimeStamp, final long remoteReceiveTimeStamp) { return new TimeSynchronizationSample(new Node(new NodeIdentity(keyPair, "node"), new NodeEndpoint("http", "10.10.10.12", 13), null), new CommunicationTimeStamps(new NetworkTimeStamp(localSendTimeStamp), new NetworkTimeStamp(localReceiveTimeStamp)), new CommunicationTimeStamps(new NetworkTimeStamp(remoteSendTimeStamp), new NetworkTimeStamp(remoteReceiveTimeStamp))); } }
<reponame>pulsar-chem/BPModule #!/usr/bin/env python3 import os import sys import argparse import traceback # Add the pulsar path thispath = os.path.dirname(os.path.realpath(__file__)) psrpath = os.path.join(os.path.dirname(thispath), "modules") sys.path.insert(0, psrpath) import pulsar as psr from pulsar.system import System, CreateAtom def Run(): try: out = psr.output.GetGlobalOut() tester = psr.testing.Tester("Testing System class") tester.PrintHeader() atoms = [ CreateAtom(0, [ 0.000000000000, 0.000000000000, 0.000000000000], 6), CreateAtom(1, [ 0.000000000000, 0.000000000000, 2.845112131228], 6), CreateAtom(2, [ 1.899115961744, 0.000000000000, 4.139062527233], 8), CreateAtom(3, [-1.894048308506, 0.000000000000, 3.747688672216], 1), CreateAtom(4, [ 1.942500819960, 0.000000000000, -0.701145981971], 1), CreateAtom(5, [-1.007295466862, -1.669971842687, -0.705916966833], 1), CreateAtom(6, [-1.007295466862, 1.669971842687, -0.705916966833], 1), # same as above, shifted 2,2,2 CreateAtom(7, [ 2.000000000000, 2.000000000000, 2.000000000000 ], 6), CreateAtom(8, [ 2.000000000000, 2.000000000000, 4.845112131228 ], 6), CreateAtom(9, [ 3.899115961744, 2.000000000000, 6.139062527233 ], 8), CreateAtom(10, [ 0.105951691494, 2.000000000000, 5.747688672216 ], 1), CreateAtom(11, [ 3.942500819960, 2.000000000000, 1.298854018029 ], 1), CreateAtom(12, [ 0.992704533138, 0.330028157313, 1.294083033167 ], 1), CreateAtom(13, [ 0.992704533138, 3.669971842687, 1.294083033167 ], 1) ] molu = psr.system.AtomSetUniverse() for a in atoms: molu.Insert(a) tester.TestValue("System universe size", molu.size(), 14) mol = psr.system.System(molu, True) tester.TestValue("System size", mol.size(), 14) tester.TestValue("System size", len(mol), 14) # Does the system contain all the atoms? idx = 0 for a in atoms: tester.Test("System has atom {}".format(idx), True, mol.HasAtom, a) tester.Test("System has atom {} - via 'in'".format(idx), True, lambda m, el: el in m, mol, a) idx += 1 noatom = CreateAtom(14, [ 0.0, 0.0, 0.0 ], 7) tester.Test("System doesn't have atom", False, mol.HasAtom, noatom) tester.Test("System doesn't have atom - via 'in'", False, lambda m, el: el in m, mol, noatom) # Starting with empty system mol = psr.system.System(molu, False) tester.TestValue("System size", mol.size(), 0) tester.TestValue("System size", len(mol), 0) idx = 0 for a in atoms: tester.Test("System has atom {}".format(idx), False, mol.HasAtom, a) tester.Test("Inserting atom {}".format(idx), True, InsertAtom, mol, a) tester.Test("System has atom {}".format(idx), True, mol.HasAtom, a) idx += 1 tester.Test("Inserting atom not in universe", False, InsertAtom, mol, noatom) #PrintMol(mol, out) #mol2 = mol.Translate( [ 2.0, 3.0, 4.0 ] ) #PrintMol(mol2, out) #mol2 = mol.Rotate( [ 0.0, 1.0, 0.0, # 0.0, 0.0, 1.0, # 1.0, 0.0, 0.0 ] ) #PrintMol(mol2, out) tester.PrintResults() except Exception as e: psr.output.GlobalOutput("Caught exception in main handler. Contact the developers\n") traceback.print_exc() psr.output.GlobalError("\n") psr.output.GlobalError(str(e)) psr.output.GlobalError("\n") psr.Init(sys.argv, out = "stdout", color = True, debug = True) Run() psr.Finalize()
import numpy as np from keras.models import Sequential from keras.layers.core import Dense, Activation # Create the model model = Sequential() # Add a hidden layer with 30 neurons model.add(Dense(30, input_dim=2)) model.add(Activation('relu')) # Add the output layer model.add(Dense(1)) model.add(Activation('linear')) # Compile the model with MSE as the loss function and SGD as the optimizer model.compile(loss='mse', optimizer='sgd', metrics=['accuracy']) # Create dummy data X_train = np.random.random((100, 2)) y_train = np.array([ [ x1 + x2 ] for x1,x2 in X_train]) # Fit the model model.fit(X_train, y_train, epochs=10)
<reponame>yunsean/yoga<gh_stars>10-100 package com.yoga.admin.tenant.controller; import com.github.pagehelper.PageInfo; import com.yoga.admin.tenant.dto.*; import com.yoga.admin.tenant.vo.TenantMenuVo; import com.yoga.admin.tenant.vo.TenantVo; import com.yoga.core.base.BaseController; import com.yoga.core.base.BaseDto; import com.yoga.core.base.BaseEnum; import com.yoga.core.data.ApiResult; import com.yoga.core.data.ApiResults; import com.yoga.core.data.CommonPage; import com.yoga.core.exception.BusinessException; import com.yoga.core.exception.IllegalArgumentException; import com.yoga.core.property.PropertiesService; import com.yoga.core.utils.StringUtil; import com.yoga.setting.annotation.Settable; import com.yoga.setting.customize.CustomPage; import com.yoga.setting.model.SettableItem; import com.yoga.setting.model.Setting; import com.yoga.setting.service.SettingService; import com.yoga.tenant.menu.MenuItem; import com.yoga.tenant.menu.MenuLoader; import com.yoga.tenant.tenant.model.Tenant; import com.yoga.tenant.tenant.model.TenantCustomize; import com.yoga.tenant.tenant.model.TenantMenu; import com.yoga.tenant.tenant.model.TenantSetting; import com.yoga.tenant.tenant.service.TemplateService; import com.yoga.tenant.tenant.service.TenantService; import com.yoga.utility.alidns.service.AliDnsService; import io.swagger.annotations.Api; import io.swagger.annotations.ApiOperation; import org.apache.shiro.authz.annotation.RequiresAuthentication; import org.apache.shiro.authz.annotation.RequiresPermissions; import org.springframework.beans.factory.annotation.Autowired; import org.springframework.beans.factory.annotation.Value; import org.springframework.stereotype.Controller; import org.springframework.ui.ModelMap; import org.springframework.validation.BindingResult; import org.springframework.web.bind.annotation.*; import springfox.documentation.annotations.ApiIgnore; import javax.validation.Valid; import java.util.*; @Controller @Settable @Api(tags = "租户管理") @RequestMapping("/admin/tenant/tenant") public class TenantController extends BaseController { @Value("${app.system.public-ip:}") private String publicIp; @Autowired private TenantService tenantService; @Autowired private SettingService settingService; @Autowired private TemplateService templateService; @Autowired private PropertiesService propertiesService; @Autowired private AliDnsService dnsService; @ApiIgnore @GetMapping("/list") @RequiresPermissions("gbl_tenant") public String allTenants(ModelMap model, CustomPage page, @Valid TenantListDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); PageInfo<Tenant> tenants = tenantService.list(dto.getName(), dto.getCode(), dto.getTemplateId(), null, page.getPageIndex(), page.getPageSize()); model.put("param", dto.wrapAsMap()); model.put("tenants", tenants.getList()); model.put("page", new CommonPage(tenants)); model.put("templates", templateService.list(null, 0, 1000).getList()); model.put("tenantAlias", propertiesService.getTenantAlias()); return "/admin/tenant/tenants"; } @ApiIgnore @GetMapping("/modules") @RequiresPermissions("gbl_tenant") public String allModules(ModelMap model, @Valid TenantModuleDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); List<MenuItem> menuItems = MenuLoader.getInstance().getAllMenus(false); List<String> modules = null; String[] moduleArray = tenantService.getModules(dto.getTenantId()); if (moduleArray != null) modules = Arrays.asList(moduleArray); else modules = new ArrayList<>(); for (MenuItem item : menuItems) { if (item.getChildren() == null) continue; for (MenuItem child : item.getChildren()) { if (modules.contains(child.getCode())) { child.setChecked(true); } else { child.setChecked(false); } } } model.put("tenantId", dto.getTenantId()); model.put("modules", menuItems); model.put("tenantAlias", propertiesService.getTenantAlias()); return "/admin/tenant/modules"; } @ApiIgnore @GetMapping("/menus") @RequiresPermissions("gbl_tenant") public String allMenus(ModelMap model, @Valid TenantMenuDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); List<MenuItem> customMenus = tenantService.getMenus(dto.getTenantId()); List<MenuItem> systemMenus = MenuLoader.getInstance().getAllMenus(); Set<String> groups = new HashSet<>(); if (customMenus != null) { for (MenuItem item : customMenus) { groups.add(item.getName()); if (item.getChildren() != null) { Collections.sort(item.getChildren(), new Comparator<MenuItem>() { @Override public int compare(MenuItem o1, MenuItem o2) { return o1.getSort() - o2.getSort(); } }); } } } if (systemMenus != null) { for (MenuItem item : systemMenus) { groups.add(item.getName()); } } model.put("tenantId", dto.getTenantId()); model.put("menus", customMenus); model.put("groups", groups); model.put("tenantAlias", propertiesService.getTenantAlias()); return "/admin/tenant/menus"; } @ApiIgnore @GetMapping("/settings") @RequiresPermissions("gbl_tenant") public String setting(ModelMap model, CustomPage page, @Valid TenantListSettingsDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); String[] modules = tenantService.getModules(dto.getTenantId()); String[] modeles1 = new String[modules.length + 1]; System.arraycopy(modules, 0, modeles1, 0, modules.length); modeles1[modules.length] = "gbl_tenant"; PageInfo<SettableItem> items = SettingService.allSettable(dto.getName(), modeles1, page.getPageIndex(), page.getPageSize(), true); List<Map<String, Object>> settings = new ArrayList<>(); for (SettableItem item : items.getList()) { Setting setting = settingService.get(dto.getTenantId(), item.getModule(), item.getKey()); if (setting != null) { item.setValue(setting.getValue()); item.setShowValue(setting.getShowValue()); } else { item.setValue(StringUtil.isNotBlank(item.getDefValue()) ? item.getDefValue() : null); } String url = item.getUrl(); if (url == null) url = ""; if (StringUtil.isNotBlank(url)) { if (url.indexOf('?') > 0) url += "&tenantId=" + dto.getTenantId(); else url += "?tenantId=" + dto.getTenantId(); } item.setUrl(url); Map<String, Object> map = new HashMap<>(); if (item.getType() != null && BaseEnum.class.isAssignableFrom(item.getType())) { map.put("enums", item.getType().getEnumConstants()); } map.put("setting", item); settings.add(map); } model.put("param", dto.wrapAsMap()); model.put("tenantId", dto.getTenantId()); model.put("settings", settings); model.put("page", new CommonPage(items)); model.put("tenantAlias", propertiesService.getTenantAlias()); return "/admin/tenant/settings"; } @ApiIgnore @GetMapping("/setting") @RequiresPermissions("gbl_tenant") @Settable(module = TenantService.ModuleName, key = TenantService.Key_Setting, name = "租户设置-全局设置", systemOnly = true) public String tenantSetting(ModelMap model, @Valid TenantSettingDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); TenantSetting setting = tenantService.readSetting(dto.getTenantId()); model.put("setting", setting); model.put("tenantId", dto.getTenantId()); model.put("tenantAlias", propertiesService.getTenantAlias()); return "/admin/tenant/setting"; } @ApiIgnore @GetMapping("/customize") @RequiresPermissions("gbl_tenant") @Settable(module = TenantService.ModuleName, key = TenantService.Key_Customize, name = "租户设置-框架自定义", systemOnly = true) public String tenantCustomize(ModelMap model, @Valid TenantSettingDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); TenantCustomize customize = tenantService.readCustomize(dto.getTenantId()); model.put("customize", customize); model.put("tenantId", dto.getTenantId()); model.put("tenantAlias", propertiesService.getTenantAlias()); return "/admin/tenant/customize"; } @ResponseBody @GetMapping("/list.json") @RequiresAuthentication @ApiOperation(value = "租户列表") public ApiResults<TenantVo> list(@ModelAttribute TenantListDto dto) { PageInfo<Tenant> tenants = tenantService.list(dto.getName(), dto.getCode(), dto.getTemplateId(), false, 0, 1000); return new ApiResults<>(tenants, TenantVo.class); } @ResponseBody @GetMapping("/get.json") @ApiOperation(value = "租户详情") public ApiResult<TenantVo> get(@ModelAttribute @Valid TenantGetDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); Tenant tenant = tenantService.get(dto.getId()); return new ApiResult<>(tenant, TenantVo.class); } @ResponseBody @GetMapping("/info.json") @ApiOperation(value = "当前租户详情") public ApiResult<TenantVo> info(@ModelAttribute @Valid BaseDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); Tenant tenant = tenantService.get(dto.getTid()); return new ApiResult<>(tenant, TenantVo.class); } @ResponseBody @PostMapping("/add.json") @RequiresPermissions("gbl_tenant.add") @ApiOperation(value = "增加新租户") public ApiResult add(@Valid @ModelAttribute TenantAddDto dto, BindingResult bindingResult) throws Exception { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); if (dto.getTid() != 0) throw new BusinessException("非法操作"); if (dto.getPassword().length() < 6) throw new IllegalArgumentException("管理员密码至少6个字符!"); tenantService.add(dto.getName(), dto.getCode(), dto.getRemark(), dto.getTemplateId(), dto.getUsername(), dto.getPassword(), dto.getNickname(), dto.getMobile()); if (StringUtil.isNotBlank(publicIp)) { try { dnsService.addARecord(dto.getCode(), publicIp, null); } catch (Exception ex) { return new ApiResult(1, "创建租户成功,但添加域名解析失败,请手动管理域名解析!"); } } return new ApiResult(); } @ResponseBody @PostMapping("/update.json") @RequiresPermissions("gbl_tenant.update") @ApiOperation(value = "修改租户信息") public ApiResult update(@Valid @ModelAttribute TenantUpdateDto dto, BindingResult bindingResult) throws Exception { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); if (dto.getTid() != 0) throw new BusinessException("非法操作"); tenantService.update(dto.getId(), dto.getName(), dto.getRemark()); return new ApiResult(); } @ResponseBody @DeleteMapping("/delete.json") @RequiresPermissions("gbl_tenant.del") @ApiOperation(value = "删除现有租户") public ApiResult delete(@Valid @ModelAttribute TenantDeleteDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); if (dto.getTid() != 0) throw new BusinessException("非法操作"); Tenant tenant = tenantService.get(dto.getId()); tenantService.delete(dto.getId()); if (StringUtil.isNotBlank(publicIp) && StringUtil.isNotBlank(tenant.getCode())) { try { dnsService.deleteARecord(tenant.getCode(), null); } catch (Exception ex) { return new ApiResult(1, "删除租户成功,但删除域名解析失败,请手动管理域名解析!"); } } return new ApiResult(); } @ResponseBody @PostMapping("/renew.json") @RequiresPermissions("gbl_tenant.del") @ApiOperation(value = "恢复删除的租户") public ApiResult renew(@Valid @ModelAttribute TenantRenewDto dto, BindingResult bindingResult) throws Exception { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); if (dto.getTid() != 0) throw new BusinessException("非法操作"); tenantService.renew(dto.getId(), dto.getCode()); if (StringUtil.isNotBlank(publicIp)) { try { dnsService.addARecord(dto.getCode(), publicIp, null); } catch (Exception ex) { return new ApiResult(1, "恢复租户成功,但添加域名解析失败,请手动管理域名解析!"); } } return new ApiResult(); } @ResponseBody @PostMapping("/repair.json") @RequiresPermissions("gbl_tenant.update") @ApiOperation(value = "修复租户权限") public ApiResult repair(@Valid @ModelAttribute TenantRepairDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); if (dto.getTid() != 0) throw new BusinessException("非法操作"); return new ApiResult<>(tenantService.repair(dto.getId())); } @ResponseBody @PostMapping("/module/set.json") @RequiresPermissions("gbl_tenant.update") @ApiOperation(value = "设置租户可用的模块") public ApiResult saveModules(@Valid @ModelAttribute TenantSetModuleDto dto, BindingResult bindingResult) throws Exception { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); tenantService.setModules(dto.getTenantId(), dto.getModules()); return new ApiResult(); } @ResponseBody @PostMapping("/menu/add.json") @RequiresPermissions("gbl_tenant.update") @ApiOperation(value = "增加租户新自定义菜单") public ApiResult addMenu(@Valid @ModelAttribute TenantAddMenuDto dto, BindingResult bindingResult) throws Exception { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); if (dto.getTid() != 0) throw new BusinessException("非法操作"); tenantService.addMenu(dto.getTenantId(), dto.getCode(), dto.getGroup(), dto.getName(), dto.getUrl(), dto.getRemark(), dto.getSort()); return new ApiResult(); } @ResponseBody @DeleteMapping("/menu/delete.json") @RequiresPermissions("gbl_tenant.update") @ApiOperation(value = "删除租户现有自定义菜单") public ApiResult deleteMenu(@Valid @ModelAttribute TenantDeleteMenuDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); if (dto.getTid() != 0) throw new BusinessException("非法操作"); tenantService.deleteMenu(dto.getTenantId(), dto.getMenuId()); return new ApiResult(); } @ResponseBody @PostMapping("/menu/update.json") @RequiresPermissions("gbl_tenant.update") @ApiOperation(value = "修改租户自定义菜单") public ApiResult updateMenu(@Valid @ModelAttribute TenantUpdateMenuDto dto, BindingResult bindingResult) throws Exception { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); if (dto.getTid() != 0) throw new BusinessException("非法操作"); tenantService.updateMenu(dto.getTenantId(), dto.getMenuId(), dto.getCode(), dto.getGroup(), dto.getName(), dto.getUrl(), dto.getRemark(), dto.getSort()); return new ApiResult(); } @ApiOperation(value = "获取租户自定义菜单详情") @ResponseBody @GetMapping("/menu/get.json") @RequiresPermissions("gbl_tenant.update") public ApiResult<TenantMenuVo> getMenu(@Valid @ModelAttribute TenantGetMenuDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); TenantMenu menu = tenantService.getMenu(dto.getTenantId(), dto.getMenuId()); return new ApiResult<>(menu, TenantMenuVo.class); } @ApiIgnore @ResponseBody @RequiresPermissions("gbl_tenant.update") @PostMapping("/setting/save.json") public ApiResult saveSetting(@Valid TenantSaveSettingDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); TenantSetting setting = new TenantSetting(); setting.setPlatformName(dto.getPlatform()); setting.setFooterRemark(dto.getFooter()); setting.setResourcePrefix(dto.getResource()); setting.setLoginBackUrl(dto.getLoginbg()); setting.setLoginLogoUrl(dto.getLoginlogo()); setting.setAdminIcon(dto.getAdminIcon()); setting.setTopImageUrl(dto.getTopimage()); setting.setMenuColor(dto.getMenuColor()); tenantService.saveSetting(dto.getTenantId(), setting); return new ApiResult(); } @ApiIgnore @ResponseBody @RequiresPermissions("gbl_tenant.update") @PostMapping("/customize/save.json") public ApiResult saveCustomize(@Valid TenantSaveCustomizeDto dto, BindingResult bindingResult) { if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); TenantCustomize customize = new TenantCustomize(); customize.setAdminIndex(dto.getAdminIndex()); customize.setAdminLeft(dto.getAdminLeft()); customize.setAdminLogin(dto.getAdminLogin()); customize.setAdminTop(dto.getAdminTop()); customize.setAdminWelcome(dto.getAdminWelcome()); customize.setFrontIndex(dto.getFrontIndex()); customize.setFrontLogin(dto.getFrontLogin()); tenantService.saveCustomize(dto.getTenantId(), customize); return new ApiResult(); } @ApiIgnore @RequiresPermissions("sys_config.update") @PostMapping("/settings/save.json") public ApiResult save(@RequestBody @Valid TenantSaveSettingsDto bean, BindingResult bindingResult){ if (bindingResult.hasErrors()) throw new IllegalArgumentException(bindingResult); settingService.save(bean.getTenantId(), bean.getSettings()); return new ApiResult(); } }
#! /bin/sh topdir=$( cd "$( dirname "$0" )/../" && pwd ) NAME=mars-censere . ${topdir}/scripts/standard-args.sh ParseArgs $* if [ -z "$REGISTRY" ] then echo "push.sh: Ignoring request to push image, --registry not set" exit 0 fi set -x docker push ${REGISTRY}/${TAG} st=$? docker image ls "${REGISTRY}/${TAG}" set +x exit $st
<button type="button" onclick="loadText()">Load Text</button>
""" Write a code that can check if a given word is a palindrome """ # Function to check if a given word is a palindrome def is_palindrome(word): # Reverse the word rev_word = ''.join(reversed(word)) # Check if the reversed word is the same as the original if rev_word == word: # If same, return True return True else: # If not, return False return False # Test word = "radar" print(is_palindrome(word))
#!/bin/bash # # Oracle Linux DTrace. # Copyright (c) 2006, Oracle and/or its affiliates. All rights reserved. # Licensed under the Universal Permissive License v 1.0 as shown at # http://oss.oracle.com/licenses/upl. # ## # # ASSERTION: # Testing -f option with an invalid function name. # # SECTION: dtrace Utility/-f Option # ## if [ $# != 1 ]; then echo expected one argument: '<'dtrace-path'>' exit 2 fi dtrace=$1 $dtrace $dt_flags -f read: if [ $? -ne 1 ]; then echo $tst: dtrace failed exit 1 fi exit 0
import { createIframe, isObject, objectToUrlQuery, isInQuickApp, createQuickAppScript } from './utils'; export default class QuickApp { constructor(config = { packageName: 'com.linksure.tt.quickapp', sourceName: '' }) { this.config = config; createQuickAppScript(); } showError (message) { console.warn('QuickApp error: ', message); } showInfo (message, name) { name = name || ''; console.log('QuickApp debug: ' + name, message); } open (options) { if (!isObject(options)) { this.showError('options must be a object!'); return; } if (!options.path) { this.showError('options.path is required fields!'); return; } if (!/^\//.test(options.path) ) { this.showError('options.path must start with /!'); return; } if (options.params && !isObject(options.params)) { this.showError('options.params must be a object!'); return; } if (!isInQuickApp) { this.showError('请在快应用外的网页中使用!'); return; } if (!options.packageName) { options.packageName = this.config.packageName; } if (options.openType && options.openType === 'url') { this.openAppRouter(options); } else if (options.openType && options.openType === 'deeplink') { this.openDeepLink(options); } else { this.openAppRouter(options); this.openDeepLink(options); } return true; } openAppRouter (options) { // https://doc.quickapp.cn/tutorial/platform/url-jump-configuration.html const isRun = this.openAppRouterOnce(options); let stopIntervalId; function loopInterval(optionsLoop) { stopIntervalId = setTimeout( () => { if ( typeof window.appRouter !== 'undefined' ) { clearTimeout(stopIntervalId); this.openAppRouterOnce(optionsLoop); } else { loopInterval(optionsLoop); } }, 600); } if (!isRun) { loopInterval(options); } } openAppRouterOnce(options) { if ( typeof window.appRouter !== 'undefined' ) { this.showInfo(options, 'URL appRouter 方式跳转: '); if (options.confirm) { window.appRouter(options.packageName, options.path, options.params, options.confirm); } else { window.appRouter(options.packageName, options.path, options.params); } return true; } return false; } openDeepLink (options) { // https://doc.quickapp.cn/tutorial/platform/deeplink.html let deepLinkUrl = 'hap://app/' + options.packageName + options.path + '?' + objectToUrlQuery(options.params); this.showInfo(deepLinkUrl, 'Deeplink hap 方式跳转: '); createIframe(deepLinkUrl); } }
<filename>testdirectory/options.go package testdirectory import ( "github.com/hashicorp/go-hclog" "github.com/jimlambrt/gldap" ) // Option defines a common functional options type which can be used in a // variadic parameter pattern. type Option func(interface{}) // getOpts gets the defaults and applies the opt overrides passed in func getOpts(t TestingT, opt ...Option) options { if v, ok := interface{}(t).(HelperT); ok { v.Helper() } opts := defaults(t) applyOpts(&opts, opt...) return opts } // applyOpts takes a pointer to the options struct as a set of default options // and applies the slice of opts as overrides. func applyOpts(opts interface{}, opt ...Option) { for _, o := range opt { if o == nil { // ignore any nil Options continue } o(opts) } } // options are the set of available options for test functions type options struct { withPort int withLogger hclog.Logger withNoTLS bool withMTLS bool withDisablePanicRecovery bool withDefaults *Defaults withMembersOf []string withTokenGroupSIDs [][]byte withFirst bool } func defaults(t TestingT) options { if v, ok := interface{}(t).(HelperT); ok { v.Helper() } debugLogger := hclog.New(&hclog.LoggerOptions{ Name: "testdirectory-default-logger", Level: hclog.Error, }) return options{ withLogger: debugLogger, withDefaults: &Defaults{ UserAttr: DefaultUserAttr, GroupAttr: DefaultGroupAttr, UserDN: DefaultUserDN, GroupDN: DefaultGroupDN, }, } } // Defaults define a type for composing all the defaults for Directory.Start(...) type Defaults struct { UserAttr string GroupAttr string // Users configures the user entries which are empty by default Users []*gldap.Entry // Groups configures the group entries which are empty by default Groups []*gldap.Entry // TokenGroups configures the tokenGroup entries which are empty be default TokenGroups map[string][]*gldap.Entry // UserDN is the base distinguished name to use when searching for users // which is "ou=people,dc=example,dc=org" by default UserDN string // GroupDN is the base distinguished name to use when searching for groups // which is "ou=groups,dc=example,dc=org" by default GroupDN string // AllowAnonymousBind determines if anon binds are allowed AllowAnonymousBind bool // UPNDomain is the userPrincipalName domain, which enables a // userPrincipalDomain login with [username]@UPNDomain (optional) UPNDomain string } // WithDefaults provides an option to provide a set of defaults to // Directory.Start(...) which make it much more composable. func WithDefaults(t TestingT, defaults *Defaults) Option { return func(o interface{}) { if o, ok := o.(*options); ok { if defaults != nil { if defaults.AllowAnonymousBind { o.withDefaults.AllowAnonymousBind = true } if defaults.Users != nil { o.withDefaults.Users = defaults.Users } if defaults.Groups != nil { o.withDefaults.Groups = defaults.Groups } if defaults.UserDN != "" { o.withDefaults.UserDN = defaults.UserDN } if defaults.GroupDN != "" { o.withDefaults.GroupDN = defaults.GroupDN } if len(defaults.TokenGroups) > 0 { o.withDefaults.TokenGroups = defaults.TokenGroups } if defaults.UserAttr != "" { o.withDefaults.UserAttr = defaults.UserAttr } if defaults.GroupAttr != "" { o.withDefaults.GroupAttr = defaults.GroupAttr } if defaults.UPNDomain != "" { o.withDefaults.UPNDomain = defaults.UPNDomain } } } } } // WithMTLS provides the option to use mTLS for the directory. func WithMTLS(t TestingT) Option { return func(o interface{}) { if o, ok := o.(*options); ok { o.withMTLS = true } } } // WithNoTLS provides the option to not use TLS for the directory. func WithNoTLS(t TestingT) Option { return func(o interface{}) { if o, ok := o.(*options); ok { o.withNoTLS = true } } } // WithLogger provides the optional logger for the directory. func WithLogger(t TestingT, l hclog.Logger) Option { return func(o interface{}) { if o, ok := o.(*options); ok { o.withLogger = l } } } // WithPort provides an optional port for the directory. 0 causes a // started server with a random port. Any other value returns a started server // on that port. func WithPort(t TestingT, port int) Option { return func(o interface{}) { if o, ok := o.(*options); ok { o.withPort = port } } } // withFirst provides the option to only find the first match. func withFirst(t TestingT) Option { return func(o interface{}) { if o, ok := o.(*options); ok { o.withFirst = true } } } // WithMembersOf specifies optional memberOf attributes for user // entries func WithMembersOf(t TestingT, membersOf ...string) Option { return func(o interface{}) { if o, ok := o.(*options); ok { o.withMembersOf = membersOf } } } // WithTokenGroups specifies optional test tokenGroups SID attributes for user // entries func WithTokenGroups(t TestingT, tokenGroupSID ...[]byte) Option { return func(o interface{}) { if o, ok := o.(*options); ok { o.withTokenGroupSIDs = tokenGroupSID } } } func WithDisablePanicRecovery(t TestingT, disable bool) Option { return func(o interface{}) { if o, ok := o.(*options); ok { o.withDisablePanicRecovery = disable } } }
#!/usr/bin/env bash set -e npm run dist npm run pack TMPDIR="/tmp/npm-pack-testing.$$" mkdir "$TMPDIR" mv *-*.*.*.tgz "$TMPDIR" cp tests/fixtures/smoke-testing.ts "$TMPDIR" cd $TMPDIR npm init -y npm install *-*.*.*.tgz \ @types/quick-lru \ @types/node \ @types/normalize-package-data \ file-box \ memory-card \ typescript \ ./node_modules/.bin/tsc \ --esModuleInterop \ --lib esnext \ --noEmitOnError \ --noImplicitAny \ --target es6 \ --module commonjs \ smoke-testing.ts node smoke-testing.js
<filename>arrows/core/triangle_scan_iterator.h /*ckwg +29 * Copyright 2018 by Kitware, SAS. * All rights reserved. * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions are met: * * * Redistributions of source code must retain the above copyright notice, * this list of conditions and the following disclaimer. * * * Redistributions in binary form must reproduce the above copyright notice, * this list of conditions and the following disclaimer in the documentation * and/or other materials provided with the distribution. * * * Neither name of Kitware, Inc. nor the names of any contributors may be used * to endorse or promote products derived from this software without specific * prior written permission. * * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE * ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHORS OR CONTRIBUTORS BE LIABLE FOR * ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR * SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER * CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, * OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. */ /** * \file * \brief Header for kwiver::arrows::triangle_scan_iterator */ #ifndef KWIVER_ARROWS_CORE_TRIANGLE_SCAN_ITERATOR_H #define KWIVER_ARROWS_CORE_TRIANGLE_SCAN_ITERATOR_H #include <arrows/core/kwiver_algo_core_export.h> #include <vital/types/vector.h> namespace kwiver { namespace arrows { namespace core { /// Provides access to the pixels of a triangle using scanlines class KWIVER_ALGO_CORE_EXPORT triangle_scan_iterator { public: triangle_scan_iterator(vital::vector_2d const & pt1, vital::vector_2d const & pt2, vital::vector_2d const & pt3) : a(pt1), b(pt2), c(pt3) { reset(); } /// Reset the iterator state void reset(); /// Update the iterator to the next scanline bool next(); /// Current scanline index int scan_y() const { return scan_y_; } /// Index of the first pixel of the current scanline int start_x() const { return start_x_; } /// Index of the last pixel of the current scanline int end_x() const { return end_x_; } private: vital::vector_2d const &a, &b, &c; vital::vector_2d g; int scan_y_; int start_x_, end_x_; int x0, y0, x1, y1; double data[3][3]; }; } } } #endif // KWIVER_ARROWS_CORE_TRIANGLE_SCAN_ITERATOR_H
#!/usr/bin/env bash set -e echo "--- yarn" yarn --frozen-lockfile --network-timeout 60000 for cmd in "$@" do echo "--- $cmd" yarn -s run $cmd done
<reponame>maps90/hanu<filename>conversation_test.go package hanu import ( "testing" "golang.org/x/net/websocket" "github.com/sbstjn/allot" ) type ConnectionMock struct{} func (c ConnectionMock) Send(ws *websocket.Conn, v interface{}) (err error) { return nil } func TestConversation(t *testing.T) { command := allot.New("cmd test <param>") msg := Message{ ID: 0, } msg.SetText("cmd test value") match, _ := command.Match(msg.Text()) conv := NewConversation(match, msg, nil) str, err := conv.String("param") if err != nil { t.Errorf("Failed to get correct value for param \"param\"") } if str != "value" { t.Errorf("Failed to get correct value for param \"param\": %s != %s", str, "value") } conv.Reply("example") } func TestConnect(t *testing.T) { cmd := allot.New("cmd test <param>") msg := Message{ ID: 0, } msg.SetText("cmd test value") match, _ := cmd.Match(msg.Text()) conv := NewConversation(match, msg, &websocket.Conn{}) conv.SetConnection(ConnectionMock{}) conv.Reply("example") }
import React, {Component} from "react" import PropTypes from "prop-types" import {GridList, GridTile} from "material-ui/GridList" import RaisedButton from "material-ui/RaisedButton" import FloatingActionButton from "material-ui/FloatingActionButton" import ContentAdd from "material-ui/svg-icons/content/add" import DialogLanguageCreate from "../containers/dialogLanguageCreate" import TileLanguage from "../containers/tileLanguage" const styles = { root: { display: "flex", flexWrap: "wrap", justifyContext: "space-around" }, gridList: { margin: 0 }, raisedButton: { marginLeft: 12 }, floatingActionButton: { position: "fixed", bottom: 32, right: 48 } } class Languages extends Component { constructor(props) { super(props) this.state = { dialogShow: false } this.dialogToggle = this.dialogToggle.bind(this) this.handleDelete = this.handleDelete.bind(this) } componentWillMount() { const { languagesGet } = this.props languagesGet() } dialogToggle() { const { dialogShow } = this.state this.setState({dialogShow: !dialogShow}) } handleDelete() { const { languageIDsSelected, languagesDelete } = this.props let URL = new URL(window.location.href) languageIDsSelected.forEach(([i, v]) => { if (i === 0) URL.searchParams.set("IDs", v) URL.searchParams.append("IDs", v) }) languagesDelete({ URL, data: { value: languageIDsSelected } }) } tilesLanguage(languages) { const { contexts, languageIDsSelected } = this.props return Object.values(languages).map(v => <TileLanguage key={v.ID} language={v} title={contexts[v.contextID].value || v.ID} isChecked={languageIDsSelected.indexOf(v.ID) !== -1} />) } render() { const { root, gridList, raisedButton, floatingActionButton } = styles const { dialogShow } = this.state const { contexts, languages, languageIDsSelected } = this.props return ( <div style={root}> <GridList cols={4} cellHeight="auto" style={gridList} > <GridTile cols={1} /> <GridTile cols={2}> { Object.keys(languages).length ? <GridList style={gridList} cols={4} padding={10} cellHeight={333} > {this.tilesLanguage(languages)} </GridList> : <h3>{contexts["<KEY>"].value || "No Content"}</h3> } { languageIDsSelected.length > 0 && <RaisedButton label={contexts["aghkZXZ-Tm9uZXIT<KEY>IG<KEY>"].value || "Delete"} style={raisedButton} secondary={true} onTouchTap={this.handleDelete} /> } </GridTile> <GridTile cols={1} /> </GridList> { !dialogShow && <FloatingActionButton secondary={true} style={floatingActionButton} onTouchTap={this.dialogToggle} > <ContentAdd /> </FloatingActionButton> } <DialogLanguageCreate contexts={contexts} title={contexts["aghkZXZ-Tm9uZXIfCxIHQ29udGVudCISQWRkIEEgTmV3IExhbmd1YWdlDA"].value || "Add A New Language"} dialogShow={dialogShow} dialogToggle={this.dialogToggle} /> </div> ) } } Languages.defaultProps = { contexts: {} } Languages.propTypes = { contexts: PropTypes.object.isRequired, languages: PropTypes.object, languageIDsSelected: PropTypes.array, languagesGet: PropTypes.func.isRequired, languagesDelete: PropTypes.func.isRequired } Languages.muiName = "GridList" export default Languages
<reponame>ghsecuritylab/bk7231_rtt_sdk<filename>test/test_pm.c #include <rthw.h> #include <rtthread.h> #include <stdint.h> #include <stdlib.h> extern int beken_pm_level; extern int bk_wlan_dtim_rf_ps_mode_enable(void ); extern int bk_wlan_dtim_rf_ps_mode_need_disable(void); extern int bk_wlan_mcu_ps_mode_enable(void); extern int bk_wlan_mcu_ps_mode_disable(void); extern int bk_wlan_dtim_with_normal_open(void); extern int bk_wlan_dtim_with_normal_close(void); extern void power_save_set_linger_time(uint32_t data_wakeup_time); static int pm_level(int argc, char **argv) { uint32_t level; if(argc != 2) { rt_kprintf("input argc is err!\n"); return -1; } level = atoi(argv[1]); if(level > 99) { level = 99; } rt_kprintf("power_save_level: %d\n", level); //power_save_set_linger_time(level); //beken_pm_level = level; { struct rt_wlan_device *sta_device = (struct rt_wlan_device *)rt_device_find(WIFI_DEVICE_STA_NAME); if (NULL != sta_device) { rt_wlan_enter_powersave(sta_device, level); rt_kprintf("rt_wlan_enter_powersave switch to %d\n", level); } } return 0; } #ifdef RT_USING_FINSH #include <finsh.h> MSH_CMD_EXPORT(pm_level, pm_level 1); #if CFG_USE_STA_PS FINSH_FUNCTION_EXPORT_ALIAS(bk_wlan_dtim_rf_ps_mode_enable, __cmd_rf_ps, bk_wlan_dtim_rf_ps_mode_enable); #endif //FINSH_FUNCTION_EXPORT_ALIAS(bk_wlan_dtim_rf_ps_mode_need_disable, __cmd_rf_ps_disable, bk_wlan_dtim_rf_ps_mode_need_disable); #if CFG_USE_MCU_PS FINSH_FUNCTION_EXPORT_ALIAS(bk_wlan_mcu_ps_mode_enable, __cmd_mcu_ps, bk_wlan_mcu_ps_mode_enable); FINSH_FUNCTION_EXPORT_ALIAS(bk_wlan_mcu_ps_mode_disable, __cmd_mcu_ps_disable, bk_wlan_mcu_ps_mode_disable); #endif //FINSH_FUNCTION_EXPORT_ALIAS(bk_wlan_dtim_with_normal_open, __cmd_dtim_normal_open, bk_wlan_dtim_with_normal_open); //FINSH_FUNCTION_EXPORT_ALIAS(bk_wlan_dtim_with_normal_close, __cmd_dtim_normal_close, bk_wlan_dtim_with_normal_close); #endif /* RT_USING_FINSH */
#!/bin/bash echo "Executing ${BASH_SOURCE[0]}..." DIR=$1 if [ -z "${DIR}" ]; then echo "No directory provided!"; exit 1; fi if [ ! -d "${DIR}" ]; then DIR=$(realpath ${DIR}); fi if [ -z "${DIR}" ]; then echo "No directory provided!"; exit 1; fi set -e echo "Directory: ${DIR}..." cd ${DIR} echo "Generating coverage..." lcov --directory . --capture --output-file coverage.info echo "Removing coverage..." lcov --remove coverage.info '/usr/*' "${HOME}"'/.cache/*' '*/external/*' --output-file coverage.info echo "Listing coverage..." lcov --list coverage.info echo "Submitting coverage..." bash <(curl -s https://codecov.io/bash) -f coverage.info || echo "Codecov did not collect coverage reports"
<reponame>dblabuofi/Mindreader angular.module("myApp").controller('editerController', function ($scope, $timeout, url) { $scope.submit = function() { console.log($scope.userCode); } });
<gh_stars>10-100 import { DEFAULT_LIST_PAGE_INDEX, DEFAULT_LIST_PAGE_SIZE, LOGOUT, getMatchOtherDriverListTypes, matchesOtherDriverListDownloadLinkShowHideTypes, matchesOtherDriverGetHideListTypes, matchesOtherDriverListSetInfoType, matchesOtherDriverListHideExpiredType, matchesOtherDriverListHideConfirmedType } from '../actions/types'; const matchesOtherDriverInfo = ( state = { showMatchList: false, matches: [], listPageIndex: DEFAULT_LIST_PAGE_INDEX, listPageSize: DEFAULT_LIST_PAGE_SIZE, hideExpiredCanceled: false, hideConfirmed: false, showCurrentMatchDetails: false, currentMatch: {}, showDownloadLink: false, urlDownloadBlob: '' }, action ) => { switch (action.type) { case LOGOUT: return { ...state, showMatchList: false, matches: [], listPageIndex: DEFAULT_LIST_PAGE_INDEX, showCurrentMatchDetails: false, currentMatch: {} }; case getMatchOtherDriverListTypes.success: { const { data: matches } = action.payload; return { ...state, showMatchList: true, matches }; } case matchesOtherDriverGetHideListTypes.hide: return { ...state, showMatchList: false, matches: [] }; case matchesOtherDriverListDownloadLinkShowHideTypes.show: { const { urlDownloadBlob } = action.payload; return { ...state, showDownloadLink: true, urlDownloadBlob }; } case matchesOtherDriverListDownloadLinkShowHideTypes.hide: return { ...state, showDownloadLink: false, urlDownloadBlob: '' }; case matchesOtherDriverListSetInfoType: return { ...state, listPageIndex: action.payload.listPageIndex, listPageSize: action.payload.listPageSize }; case matchesOtherDriverListHideExpiredType: return { ...state, hideExpiredCanceled: !state.hideExpiredCanceled }; case matchesOtherDriverListHideConfirmedType: return { ...state, hideConfirmed: !state.hideConfirmed }; default: return state; } }; export default matchesOtherDriverInfo;
// Code generated by csi-proxy-api-gen. DO NOT EDIT. package v1beta1 import ( unsafe "unsafe" v1beta1 "github.com/kubernetes-csi/csi-proxy/client/api/volume/v1beta1" impl "github.com/kubernetes-csi/csi-proxy/pkg/server/volume/impl" ) func autoConvert_v1beta1_DismountVolumeRequest_To_impl_DismountVolumeRequest(in *v1beta1.DismountVolumeRequest, out *impl.DismountVolumeRequest) error { out.VolumeId = in.VolumeId out.Path = in.Path return nil } // Convert_v1beta1_DismountVolumeRequest_To_impl_DismountVolumeRequest is an autogenerated conversion function. func Convert_v1beta1_DismountVolumeRequest_To_impl_DismountVolumeRequest(in *v1beta1.DismountVolumeRequest, out *impl.DismountVolumeRequest) error { return autoConvert_v1beta1_DismountVolumeRequest_To_impl_DismountVolumeRequest(in, out) } func autoConvert_impl_DismountVolumeRequest_To_v1beta1_DismountVolumeRequest(in *impl.DismountVolumeRequest, out *v1beta1.DismountVolumeRequest) error { out.VolumeId = in.VolumeId out.Path = in.Path return nil } // Convert_impl_DismountVolumeRequest_To_v1beta1_DismountVolumeRequest is an autogenerated conversion function. func Convert_impl_DismountVolumeRequest_To_v1beta1_DismountVolumeRequest(in *impl.DismountVolumeRequest, out *v1beta1.DismountVolumeRequest) error { return autoConvert_impl_DismountVolumeRequest_To_v1beta1_DismountVolumeRequest(in, out) } func autoConvert_v1beta1_DismountVolumeResponse_To_impl_DismountVolumeResponse(in *v1beta1.DismountVolumeResponse, out *impl.DismountVolumeResponse) error { return nil } // Convert_v1beta1_DismountVolumeResponse_To_impl_DismountVolumeResponse is an autogenerated conversion function. func Convert_v1beta1_DismountVolumeResponse_To_impl_DismountVolumeResponse(in *v1beta1.DismountVolumeResponse, out *impl.DismountVolumeResponse) error { return autoConvert_v1beta1_DismountVolumeResponse_To_impl_DismountVolumeResponse(in, out) } func autoConvert_impl_DismountVolumeResponse_To_v1beta1_DismountVolumeResponse(in *impl.DismountVolumeResponse, out *v1beta1.DismountVolumeResponse) error { return nil } // Convert_impl_DismountVolumeResponse_To_v1beta1_DismountVolumeResponse is an autogenerated conversion function. func Convert_impl_DismountVolumeResponse_To_v1beta1_DismountVolumeResponse(in *impl.DismountVolumeResponse, out *v1beta1.DismountVolumeResponse) error { return autoConvert_impl_DismountVolumeResponse_To_v1beta1_DismountVolumeResponse(in, out) } func autoConvert_v1beta1_FormatVolumeRequest_To_impl_FormatVolumeRequest(in *v1beta1.FormatVolumeRequest, out *impl.FormatVolumeRequest) error { out.VolumeId = in.VolumeId return nil } // Convert_v1beta1_FormatVolumeRequest_To_impl_FormatVolumeRequest is an autogenerated conversion function. func Convert_v1beta1_FormatVolumeRequest_To_impl_FormatVolumeRequest(in *v1beta1.FormatVolumeRequest, out *impl.FormatVolumeRequest) error { return autoConvert_v1beta1_FormatVolumeRequest_To_impl_FormatVolumeRequest(in, out) } func autoConvert_impl_FormatVolumeRequest_To_v1beta1_FormatVolumeRequest(in *impl.FormatVolumeRequest, out *v1beta1.FormatVolumeRequest) error { out.VolumeId = in.VolumeId return nil } // Convert_impl_FormatVolumeRequest_To_v1beta1_FormatVolumeRequest is an autogenerated conversion function. func Convert_impl_FormatVolumeRequest_To_v1beta1_FormatVolumeRequest(in *impl.FormatVolumeRequest, out *v1beta1.FormatVolumeRequest) error { return autoConvert_impl_FormatVolumeRequest_To_v1beta1_FormatVolumeRequest(in, out) } func autoConvert_v1beta1_FormatVolumeResponse_To_impl_FormatVolumeResponse(in *v1beta1.FormatVolumeResponse, out *impl.FormatVolumeResponse) error { return nil } // Convert_v1beta1_FormatVolumeResponse_To_impl_FormatVolumeResponse is an autogenerated conversion function. func Convert_v1beta1_FormatVolumeResponse_To_impl_FormatVolumeResponse(in *v1beta1.FormatVolumeResponse, out *impl.FormatVolumeResponse) error { return autoConvert_v1beta1_FormatVolumeResponse_To_impl_FormatVolumeResponse(in, out) } func autoConvert_impl_FormatVolumeResponse_To_v1beta1_FormatVolumeResponse(in *impl.FormatVolumeResponse, out *v1beta1.FormatVolumeResponse) error { return nil } // Convert_impl_FormatVolumeResponse_To_v1beta1_FormatVolumeResponse is an autogenerated conversion function. func Convert_impl_FormatVolumeResponse_To_v1beta1_FormatVolumeResponse(in *impl.FormatVolumeResponse, out *v1beta1.FormatVolumeResponse) error { return autoConvert_impl_FormatVolumeResponse_To_v1beta1_FormatVolumeResponse(in, out) } func autoConvert_v1beta1_IsVolumeFormattedRequest_To_impl_IsVolumeFormattedRequest(in *v1beta1.IsVolumeFormattedRequest, out *impl.IsVolumeFormattedRequest) error { out.VolumeId = in.VolumeId return nil } // Convert_v1beta1_IsVolumeFormattedRequest_To_impl_IsVolumeFormattedRequest is an autogenerated conversion function. func Convert_v1beta1_IsVolumeFormattedRequest_To_impl_IsVolumeFormattedRequest(in *v1beta1.IsVolumeFormattedRequest, out *impl.IsVolumeFormattedRequest) error { return autoConvert_v1beta1_IsVolumeFormattedRequest_To_impl_IsVolumeFormattedRequest(in, out) } func autoConvert_impl_IsVolumeFormattedRequest_To_v1beta1_IsVolumeFormattedRequest(in *impl.IsVolumeFormattedRequest, out *v1beta1.IsVolumeFormattedRequest) error { out.VolumeId = in.VolumeId return nil } // Convert_impl_IsVolumeFormattedRequest_To_v1beta1_IsVolumeFormattedRequest is an autogenerated conversion function. func Convert_impl_IsVolumeFormattedRequest_To_v1beta1_IsVolumeFormattedRequest(in *impl.IsVolumeFormattedRequest, out *v1beta1.IsVolumeFormattedRequest) error { return autoConvert_impl_IsVolumeFormattedRequest_To_v1beta1_IsVolumeFormattedRequest(in, out) } func autoConvert_v1beta1_IsVolumeFormattedResponse_To_impl_IsVolumeFormattedResponse(in *v1beta1.IsVolumeFormattedResponse, out *impl.IsVolumeFormattedResponse) error { out.Formatted = in.Formatted return nil } // Convert_v1beta1_IsVolumeFormattedResponse_To_impl_IsVolumeFormattedResponse is an autogenerated conversion function. func Convert_v1beta1_IsVolumeFormattedResponse_To_impl_IsVolumeFormattedResponse(in *v1beta1.IsVolumeFormattedResponse, out *impl.IsVolumeFormattedResponse) error { return autoConvert_v1beta1_IsVolumeFormattedResponse_To_impl_IsVolumeFormattedResponse(in, out) } func autoConvert_impl_IsVolumeFormattedResponse_To_v1beta1_IsVolumeFormattedResponse(in *impl.IsVolumeFormattedResponse, out *v1beta1.IsVolumeFormattedResponse) error { out.Formatted = in.Formatted return nil } // Convert_impl_IsVolumeFormattedResponse_To_v1beta1_IsVolumeFormattedResponse is an autogenerated conversion function. func Convert_impl_IsVolumeFormattedResponse_To_v1beta1_IsVolumeFormattedResponse(in *impl.IsVolumeFormattedResponse, out *v1beta1.IsVolumeFormattedResponse) error { return autoConvert_impl_IsVolumeFormattedResponse_To_v1beta1_IsVolumeFormattedResponse(in, out) } // detected external conversion function // Convert_v1beta1_ListVolumesOnDiskRequest_To_impl_ListVolumesOnDiskRequest(in *v1beta1.ListVolumesOnDiskRequest, out *impl.ListVolumesOnDiskRequest) error // skipping generation of the auto function // detected external conversion function // Convert_impl_ListVolumesOnDiskRequest_To_v1beta1_ListVolumesOnDiskRequest(in *impl.ListVolumesOnDiskRequest, out *v1beta1.ListVolumesOnDiskRequest) error // skipping generation of the auto function func autoConvert_v1beta1_ListVolumesOnDiskResponse_To_impl_ListVolumesOnDiskResponse(in *v1beta1.ListVolumesOnDiskResponse, out *impl.ListVolumesOnDiskResponse) error { out.VolumeIds = *(*[]string)(unsafe.Pointer(&in.VolumeIds)) return nil } // Convert_v1beta1_ListVolumesOnDiskResponse_To_impl_ListVolumesOnDiskResponse is an autogenerated conversion function. func Convert_v1beta1_ListVolumesOnDiskResponse_To_impl_ListVolumesOnDiskResponse(in *v1beta1.ListVolumesOnDiskResponse, out *impl.ListVolumesOnDiskResponse) error { return autoConvert_v1beta1_ListVolumesOnDiskResponse_To_impl_ListVolumesOnDiskResponse(in, out) } func autoConvert_impl_ListVolumesOnDiskResponse_To_v1beta1_ListVolumesOnDiskResponse(in *impl.ListVolumesOnDiskResponse, out *v1beta1.ListVolumesOnDiskResponse) error { out.VolumeIds = *(*[]string)(unsafe.Pointer(&in.VolumeIds)) return nil } // Convert_impl_ListVolumesOnDiskResponse_To_v1beta1_ListVolumesOnDiskResponse is an autogenerated conversion function. func Convert_impl_ListVolumesOnDiskResponse_To_v1beta1_ListVolumesOnDiskResponse(in *impl.ListVolumesOnDiskResponse, out *v1beta1.ListVolumesOnDiskResponse) error { return autoConvert_impl_ListVolumesOnDiskResponse_To_v1beta1_ListVolumesOnDiskResponse(in, out) } // detected external conversion function // Convert_v1beta1_MountVolumeRequest_To_impl_MountVolumeRequest(in *v1beta1.MountVolumeRequest, out *impl.MountVolumeRequest) error // skipping generation of the auto function // detected external conversion function // Convert_impl_MountVolumeRequest_To_v1beta1_MountVolumeRequest(in *impl.MountVolumeRequest, out *v1beta1.MountVolumeRequest) error // skipping generation of the auto function func autoConvert_v1beta1_MountVolumeResponse_To_impl_MountVolumeResponse(in *v1beta1.MountVolumeResponse, out *impl.MountVolumeResponse) error { return nil } // Convert_v1beta1_MountVolumeResponse_To_impl_MountVolumeResponse is an autogenerated conversion function. func Convert_v1beta1_MountVolumeResponse_To_impl_MountVolumeResponse(in *v1beta1.MountVolumeResponse, out *impl.MountVolumeResponse) error { return autoConvert_v1beta1_MountVolumeResponse_To_impl_MountVolumeResponse(in, out) } func autoConvert_impl_MountVolumeResponse_To_v1beta1_MountVolumeResponse(in *impl.MountVolumeResponse, out *v1beta1.MountVolumeResponse) error { return nil } // Convert_impl_MountVolumeResponse_To_v1beta1_MountVolumeResponse is an autogenerated conversion function. func Convert_impl_MountVolumeResponse_To_v1beta1_MountVolumeResponse(in *impl.MountVolumeResponse, out *v1beta1.MountVolumeResponse) error { return autoConvert_impl_MountVolumeResponse_To_v1beta1_MountVolumeResponse(in, out) } // detected external conversion function // Convert_v1beta1_ResizeVolumeRequest_To_impl_ResizeVolumeRequest(in *v1beta1.ResizeVolumeRequest, out *impl.ResizeVolumeRequest) error // skipping generation of the auto function // detected external conversion function // Convert_impl_ResizeVolumeRequest_To_v1beta1_ResizeVolumeRequest(in *impl.ResizeVolumeRequest, out *v1beta1.ResizeVolumeRequest) error // skipping generation of the auto function func autoConvert_v1beta1_ResizeVolumeResponse_To_impl_ResizeVolumeResponse(in *v1beta1.ResizeVolumeResponse, out *impl.ResizeVolumeResponse) error { return nil } // Convert_v1beta1_ResizeVolumeResponse_To_impl_ResizeVolumeResponse is an autogenerated conversion function. func Convert_v1beta1_ResizeVolumeResponse_To_impl_ResizeVolumeResponse(in *v1beta1.ResizeVolumeResponse, out *impl.ResizeVolumeResponse) error { return autoConvert_v1beta1_ResizeVolumeResponse_To_impl_ResizeVolumeResponse(in, out) } func autoConvert_impl_ResizeVolumeResponse_To_v1beta1_ResizeVolumeResponse(in *impl.ResizeVolumeResponse, out *v1beta1.ResizeVolumeResponse) error { return nil } // Convert_impl_ResizeVolumeResponse_To_v1beta1_ResizeVolumeResponse is an autogenerated conversion function. func Convert_impl_ResizeVolumeResponse_To_v1beta1_ResizeVolumeResponse(in *impl.ResizeVolumeResponse, out *v1beta1.ResizeVolumeResponse) error { return autoConvert_impl_ResizeVolumeResponse_To_v1beta1_ResizeVolumeResponse(in, out) } func autoConvert_v1beta1_VolumeDiskNumberRequest_To_impl_VolumeDiskNumberRequest(in *v1beta1.VolumeDiskNumberRequest, out *impl.VolumeDiskNumberRequest) error { out.VolumeId = in.VolumeId return nil } // Convert_v1beta1_VolumeDiskNumberRequest_To_impl_VolumeDiskNumberRequest is an autogenerated conversion function. func Convert_v1beta1_VolumeDiskNumberRequest_To_impl_VolumeDiskNumberRequest(in *v1beta1.VolumeDiskNumberRequest, out *impl.VolumeDiskNumberRequest) error { return autoConvert_v1beta1_VolumeDiskNumberRequest_To_impl_VolumeDiskNumberRequest(in, out) } func autoConvert_impl_VolumeDiskNumberRequest_To_v1beta1_VolumeDiskNumberRequest(in *impl.VolumeDiskNumberRequest, out *v1beta1.VolumeDiskNumberRequest) error { out.VolumeId = in.VolumeId return nil } // Convert_impl_VolumeDiskNumberRequest_To_v1beta1_VolumeDiskNumberRequest is an autogenerated conversion function. func Convert_impl_VolumeDiskNumberRequest_To_v1beta1_VolumeDiskNumberRequest(in *impl.VolumeDiskNumberRequest, out *v1beta1.VolumeDiskNumberRequest) error { return autoConvert_impl_VolumeDiskNumberRequest_To_v1beta1_VolumeDiskNumberRequest(in, out) } func autoConvert_v1beta1_VolumeDiskNumberResponse_To_impl_VolumeDiskNumberResponse(in *v1beta1.VolumeDiskNumberResponse, out *impl.VolumeDiskNumberResponse) error { out.DiskNumber = in.DiskNumber return nil } // Convert_v1beta1_VolumeDiskNumberResponse_To_impl_VolumeDiskNumberResponse is an autogenerated conversion function. func Convert_v1beta1_VolumeDiskNumberResponse_To_impl_VolumeDiskNumberResponse(in *v1beta1.VolumeDiskNumberResponse, out *impl.VolumeDiskNumberResponse) error { return autoConvert_v1beta1_VolumeDiskNumberResponse_To_impl_VolumeDiskNumberResponse(in, out) } func autoConvert_impl_VolumeDiskNumberResponse_To_v1beta1_VolumeDiskNumberResponse(in *impl.VolumeDiskNumberResponse, out *v1beta1.VolumeDiskNumberResponse) error { out.DiskNumber = in.DiskNumber return nil } // Convert_impl_VolumeDiskNumberResponse_To_v1beta1_VolumeDiskNumberResponse is an autogenerated conversion function. func Convert_impl_VolumeDiskNumberResponse_To_v1beta1_VolumeDiskNumberResponse(in *impl.VolumeDiskNumberResponse, out *v1beta1.VolumeDiskNumberResponse) error { return autoConvert_impl_VolumeDiskNumberResponse_To_v1beta1_VolumeDiskNumberResponse(in, out) } func autoConvert_v1beta1_VolumeIDFromMountRequest_To_impl_VolumeIDFromMountRequest(in *v1beta1.VolumeIDFromMountRequest, out *impl.VolumeIDFromMountRequest) error { out.Mount = in.Mount return nil } // Convert_v1beta1_VolumeIDFromMountRequest_To_impl_VolumeIDFromMountRequest is an autogenerated conversion function. func Convert_v1beta1_VolumeIDFromMountRequest_To_impl_VolumeIDFromMountRequest(in *v1beta1.VolumeIDFromMountRequest, out *impl.VolumeIDFromMountRequest) error { return autoConvert_v1beta1_VolumeIDFromMountRequest_To_impl_VolumeIDFromMountRequest(in, out) } func autoConvert_impl_VolumeIDFromMountRequest_To_v1beta1_VolumeIDFromMountRequest(in *impl.VolumeIDFromMountRequest, out *v1beta1.VolumeIDFromMountRequest) error { out.Mount = in.Mount return nil } // Convert_impl_VolumeIDFromMountRequest_To_v1beta1_VolumeIDFromMountRequest is an autogenerated conversion function. func Convert_impl_VolumeIDFromMountRequest_To_v1beta1_VolumeIDFromMountRequest(in *impl.VolumeIDFromMountRequest, out *v1beta1.VolumeIDFromMountRequest) error { return autoConvert_impl_VolumeIDFromMountRequest_To_v1beta1_VolumeIDFromMountRequest(in, out) } func autoConvert_v1beta1_VolumeIDFromMountResponse_To_impl_VolumeIDFromMountResponse(in *v1beta1.VolumeIDFromMountResponse, out *impl.VolumeIDFromMountResponse) error { out.VolumeId = in.VolumeId return nil } // Convert_v1beta1_VolumeIDFromMountResponse_To_impl_VolumeIDFromMountResponse is an autogenerated conversion function. func Convert_v1beta1_VolumeIDFromMountResponse_To_impl_VolumeIDFromMountResponse(in *v1beta1.VolumeIDFromMountResponse, out *impl.VolumeIDFromMountResponse) error { return autoConvert_v1beta1_VolumeIDFromMountResponse_To_impl_VolumeIDFromMountResponse(in, out) } func autoConvert_impl_VolumeIDFromMountResponse_To_v1beta1_VolumeIDFromMountResponse(in *impl.VolumeIDFromMountResponse, out *v1beta1.VolumeIDFromMountResponse) error { out.VolumeId = in.VolumeId return nil } // Convert_impl_VolumeIDFromMountResponse_To_v1beta1_VolumeIDFromMountResponse is an autogenerated conversion function. func Convert_impl_VolumeIDFromMountResponse_To_v1beta1_VolumeIDFromMountResponse(in *impl.VolumeIDFromMountResponse, out *v1beta1.VolumeIDFromMountResponse) error { return autoConvert_impl_VolumeIDFromMountResponse_To_v1beta1_VolumeIDFromMountResponse(in, out) } func autoConvert_v1beta1_VolumeStatsRequest_To_impl_VolumeStatsRequest(in *v1beta1.VolumeStatsRequest, out *impl.VolumeStatsRequest) error { out.VolumeId = in.VolumeId return nil } // Convert_v1beta1_VolumeStatsRequest_To_impl_VolumeStatsRequest is an autogenerated conversion function. func Convert_v1beta1_VolumeStatsRequest_To_impl_VolumeStatsRequest(in *v1beta1.VolumeStatsRequest, out *impl.VolumeStatsRequest) error { return autoConvert_v1beta1_VolumeStatsRequest_To_impl_VolumeStatsRequest(in, out) } func autoConvert_impl_VolumeStatsRequest_To_v1beta1_VolumeStatsRequest(in *impl.VolumeStatsRequest, out *v1beta1.VolumeStatsRequest) error { out.VolumeId = in.VolumeId return nil } // Convert_impl_VolumeStatsRequest_To_v1beta1_VolumeStatsRequest is an autogenerated conversion function. func Convert_impl_VolumeStatsRequest_To_v1beta1_VolumeStatsRequest(in *impl.VolumeStatsRequest, out *v1beta1.VolumeStatsRequest) error { return autoConvert_impl_VolumeStatsRequest_To_v1beta1_VolumeStatsRequest(in, out) } func autoConvert_v1beta1_VolumeStatsResponse_To_impl_VolumeStatsResponse(in *v1beta1.VolumeStatsResponse, out *impl.VolumeStatsResponse) error { out.VolumeSize = in.VolumeSize out.VolumeUsedSize = in.VolumeUsedSize return nil } // Convert_v1beta1_VolumeStatsResponse_To_impl_VolumeStatsResponse is an autogenerated conversion function. func Convert_v1beta1_VolumeStatsResponse_To_impl_VolumeStatsResponse(in *v1beta1.VolumeStatsResponse, out *impl.VolumeStatsResponse) error { return autoConvert_v1beta1_VolumeStatsResponse_To_impl_VolumeStatsResponse(in, out) } func autoConvert_impl_VolumeStatsResponse_To_v1beta1_VolumeStatsResponse(in *impl.VolumeStatsResponse, out *v1beta1.VolumeStatsResponse) error { out.VolumeSize = in.VolumeSize out.VolumeUsedSize = in.VolumeUsedSize return nil } // Convert_impl_VolumeStatsResponse_To_v1beta1_VolumeStatsResponse is an autogenerated conversion function. func Convert_impl_VolumeStatsResponse_To_v1beta1_VolumeStatsResponse(in *impl.VolumeStatsResponse, out *v1beta1.VolumeStatsResponse) error { return autoConvert_impl_VolumeStatsResponse_To_v1beta1_VolumeStatsResponse(in, out) }
<reponame>zmb3/om package renderers const ( ShellTypePowershell = "powershell" ShellTypePosix = "posix" )
#!/bin/bash # sudo chmod +x wordpress.sh # NGIRIM file zip ke scp lalu menjalankan script di server setelah kirim 1 file termasuk sampai create db dan bikin subdomain echo "START:" IP='127.0.0.1' domain=YOURDOMAIN targetDirectory='/var/www' targetNginx='/etc/nginx' DBHOST=YOURDBHOST DBUSER=YOURDBUSER DBPASS=YOURDBPASS while IFS= read -r line; do array=(`echo $line | sed 's/|/\n/g'`) file=${array[0]} dbName=${array[1]} domainName=${array[2]} location="${targetDirectory}/${domainName}.${domain}" # unzip file to target echo "${file} START:------- unzipping" tar -zxf ${file} --overwrite cp -R ${dbName}.com ${targetDirectory}/${domainName}.${domain} rm -rf ${targetDirectory}/${dbName}.com mv ${targetDirectory}/${domainName}.${domain}/.user.ini ${targetDirectory}/${domainName}.${domain}/.user.ini.backup rm -rf ${dbName}.com echo "${file} DONE:-------- unzipping" echo "${file} START:------- copy wp-config.php -> wp-config.php.backup" `echo cp ${location}/wp-config.php ${location}/wp-config.php.backup` echo "${file} DONE:-------- copy wp-config.php -> wp-config.php.backup" # set config file echo "${file} START:------- copy to target path and replace wp-config parameter" `echo cp -rf wp-config.php.master ${location}/wp-config.php` `echo sed -i "s/{DB_HOST}/$DBHOST/g" ${location}/wp-config.php` `echo sed -i "s/{DB_USER}/$DBUSER/g" ${location}/wp-config.php` `echo sed -i "s/{DB_PASSWORD}/$DBPASS/g" ${location}/wp-config.php` `echo sed -i "s/{DB_NAME}/$dbName/g" ${location}/wp-config.php` echo "${file} DONE:-------- copy to target path and replace wp-config parameter" # insert to database echo "${file} START:------- search sql file and execute" sqlFile=`find ${location} -maxdepth 1 -name "*.sql"` echo "DROP DATABASE IF EXISTS ${dbName};" | mysql -h "${DBHOST}" -u "${DBUSER}" "-p${DBPASS}" echo "CREATE DATABASE ${dbName}" | mysql -h "${DBHOST}" -u "${DBUSER}" "-p${DBPASS}" if [ -f "$sqlFile" ] then echo $sqlFile echo `mysql -h "${DBHOST}" -u "${DBUSER}" "${dbName}" "-p${DBPASS}" < "$sqlFile"` echo "UPDATE ${dbName}.wp_options SET option_value = REPLACE(option_value, 'http://${dbName}.com', 'http://${domainName}.${domain}') WHERE option_name = 'home' OR option_name = 'siteurl';" | mysql -h "${DBHOST}" -u "${DBUSER}" "-p${DBPASS}" echo "UPDATE ${dbName}.wp_posts SET guid = REPLACE(guid, 'http://${dbName}.com','http://${domainName}.${domain}');" | mysql -h "${DBHOST}" -u "${DBUSER}" "-p${DBPASS}" echo "UPDATE ${dbName}.wp_posts SET post_content = REPLACE(post_content, 'http://${dbName}.com', 'http://${domainName}.${domain}');" | mysql -h "${DBHOST}" -u "${DBUSER}" "-p${DBPASS}" echo "UPDATE ${dbName}.wp_postmeta SET meta_value = REPLACE(meta_value,'http://${dbName}.com','http://${domainName}.${domain}');" | mysql -h "${DBHOST}" -u "${DBUSER}" "-p${DBPASS}" fi echo "${file} DONE:-------- search sql file and execute" # set up nginx sites echo "${file} START:------- setup nginx " `echo sudo cp -rf sites-available ${targetNginx}/sites-available/${domainName}.${domain}` `echo sudo sed -i "s/{TARGET_PATH}/${domainName}.${domain}/g" ${targetNginx}/sites-available/${domainName}.${domain}` `echo sudo sed -i "s/{DOMAIN}/${domainName}.${domain}/g" ${targetNginx}/sites-available/${domainName}.${domain}` `echo sudo ln -sf ${targetNginx}/sites-available/${domainName}.${domain} ${targetNginx}/sites-enabled/` echo "${file} DONE:------- setup nginx " echo "${file} START:------- insert to /etc/hosts " if grep -Fxq "${IP} ${domainName}.${domain}" /etc/hosts then echo "${file} /etc/hosts:------- found -> NOT INSERTING AGAIN" else echo `sudo -- sh -c -e "echo '${IP} ${domainName}.${domain}' >> /etc/hosts"`; fi echo "${file} DONE:------- insert to /etc/hosts " done < lamtim.txt
<filename>pkg/anonymize/anonymize_doOnJSON_test.go package anonymize import ( "os" "testing" "github.com/stretchr/testify/assert" "github.com/stretchr/testify/require" ) func Test_doOnJSON(t *testing.T) { baseConfiguration, err := os.ReadFile("./testdata/example.json") require.NoError(t, err) anomConfiguration := doOnJSON(string(baseConfiguration)) expectedConfiguration, err := os.ReadFile("./testdata/expected.json") require.NoError(t, err) assert.JSONEq(t, string(expectedConfiguration), anomConfiguration) } func Test_doOnJSON_simple(t *testing.T) { testCases := []struct { name string input string expectedOutput string }{ { name: "email", input: `{ "email1": "<EMAIL>", "email2": "<EMAIL>", "email3": "<EMAIL>" }`, expectedOutput: `{ "email1": "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx", "email2": "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx", "email3": "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx" }`, }, { name: "url", input: `{ "URL": "foo domain.com foo", "URL": "foo sub.domain.com foo", "URL": "foo sub.sub.domain.com foo", "URL": "foo sub.sub.sub.domain.com.us foo" }`, expectedOutput: `{ "URL": "foo xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx foo", "URL": "foo xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx foo", "URL": "foo xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx foo", "URL": "foo xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx foo" }`, }, } for _, test := range testCases { t.Run(test.name, func(t *testing.T) { output := doOnJSON(test.input) assert.Equal(t, test.expectedOutput, output) }) } }
package evilcraft.items; import net.minecraft.block.Block; import net.minecraft.entity.player.EntityPlayer; import net.minecraft.item.ItemBlock; import net.minecraft.item.ItemDye; import net.minecraft.item.ItemStack; import net.minecraft.world.World; import evilcraft.blocks.ExcrementPile; import evilcraft.blocks.ExcrementPileConfig; /** * {@link ItemBlock} for the {@link ExcrementPile}. * @author rubensworks * */ public class ExcrementPileItemBlock extends ItemBlock { /** * Make a new instance. * @param block The block. */ public ExcrementPileItemBlock(Block block) { super(block); } @Override public boolean onItemUse(ItemStack itemStack, EntityPlayer player, World world, int x, int y, int z, int side, float coordX, float coordY, float coordZ) { Block block = world.getBlock(x, y, z); if(player.isSneaking()) { boolean done = false; int attempts = 0; while(attempts < ExcrementPileConfig.effectiveness) { done = ItemDye.applyBonemeal(itemStack.copy(), world, x, y, z, player) | done; attempts++; } if(done) { itemStack.stackSize--; if (!world.isRemote) { world.playAuxSFX(2005, x, y, z, 0); } return true; } } else { if (block == ExcrementPile.getInstance() && itemStack != null) { if(ExcrementPile.canHeightenPileAt(world, x, y, z)) { ExcrementPile.heightenPileAt(world, x, y, z); itemStack.stackSize--; return true; } return false; } } return super.onItemUse(itemStack, player, world, x, y, z, side, coordX, coordY, coordZ); } }
import numpy as np from sklearn.model_selection import train_test_split from sklearn.tree import DecisionTreeClassifier from sklearn.datasets import load_iris # load data iris = load_iris() X = iris.data y = iris.target # split data into train and test sets X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=0.25, random_state=0) # Training dtree_model = DecisionTreeClassifier(max_depth=2).fit(X_train, y_train) # Testing dtree_predictions = dtree_model.predict(X_test) # Checking accuracy print("Accuracy:",np.mean(dtree_predictions==y_test))
./qjsc_macos -c -m -M GPIO -N jslib_gpio -o bytecode/jslib_gpio.c src/gpio.js ./qjsc_macos -c -m -N jslib_events -o bytecode/jslib_events.c src/events.js ./qjsc_macos -c -m -M events -M CRYPTO -N jslib_crypto -o bytecode/jslib_crypto.c src/crypto.js ./qjsc_macos -c -m -M events -M CHECKSUM -N jslib_checksum -o bytecode/jslib_checksum.c src/checksum.js ./qjsc_macos -c -m -M events -M APPOTA -N jslib_appota -o bytecode/jslib_appota.c src/appota.js ./qjsc_macos -c -m -M events -M AIOT_DEVICE -M AIOT_GATEWAY -N jslib_iot -o bytecode/jslib_iot.c src/iot.js ./qjsc_macos -c -m -M events -M BT_HOST -N jslib_bt_host -o bytecode/jslib_bt_host.c src/bt_host.js ./qjsc_macos -c -m -M REPL -M os -M std -N jslib_repl -o bytecode/jslib_repl.c src/repl.js ./qjsc_macos -c -m -M events -M UART -N jslib_uart -o bytecode/jslib_uart.c src/uart.js ./qjsc_macos -c -m -M events -M FS -N jslib_fs -o bytecode/jslib_fs.c src/fs.js ./qjsc_macos -c -m -M events -M AUDIOPLAYER -N jslib_audioplayer -o bytecode/jslib_audioplayer.c src/audioplayer.js ./qjsc_macos -c -m -M kv -N jslib_device -o bytecode/jslib_device.c src/device.js ./qjsc_macos -c -m -M events -M NETMGR -N jslib_netmgr -o bytecode/jslib_netmgr.c src/netmgr.js ./qjsc_macos -c -m -M events -M NETWORK -M NETMGR -M CELLULAR -N jslib_network -o bytecode/jslib_network.c src/network.js ./qjsc_macos -c -m -M MQTT -M events -N jslib_mqtt -o bytecode/jslib_mqtt.c src/mqtt.js ./qjsc_macos -c -m -M events -M TCP -N jslib_tcp -o bytecode/jslib_tcp.c src/tcp.js ./qjsc_macos -c -m -M events -M UDP -N jslib_udp -o bytecode/jslib_udp.c src/udp.js ./qjsc_macos -c -m -M NETWORK -M NETMGR -M CELLULAR -N jslib_location -o bytecode/jslib_location.c src/location.js ./qjsc_macos -c -m -M events -M SPI -N jslib_spi -o bytecode/jslib_spi.c src/spi.js