text
stringlengths
1
1.05M
<reponame>chylex/Hardcore-Ender-Expansion package chylex.hee.test; import java.util.Collection; import chylex.hee.system.util.MathUtil; import com.google.common.base.Objects; public final class Assert{ @FunctionalInterface public static interface AssertionSuccess{ void call(); } @FunctionalInterface public static interface AssertionFailure{ void call(IllegalStateException ex); } private static AssertionSuccess onSuccess = () -> {}; private static AssertionFailure onFail = (ex) -> { throw ex; }; public static void setSuccessCallback(AssertionSuccess callback){ Assert.onSuccess = callback; } public static void setFailCallback(AssertionFailure callback){ Assert.onFail = callback; } /** * Always fails. */ public static void fail(){ fail("Triggered failure."); } /** * Always fails. */ public static void fail(String message){ onFail.call(new IllegalStateException(message)); } /** * Fails if the provided value is not true. */ public static void isTrue(boolean value){ isTrue(value, "Expected value to be true."); } /** * Fails if the provided value is not true. */ public static void isTrue(boolean value, String message){ if (value)onSuccess.call(); else onFail.call(new IllegalStateException(message)); } /** * Fails if the provided value is not false. */ public static void isFalse(boolean value){ isFalse(value, "Expected value to be false."); } /** * Fails if the provided value is not false. */ public static void isFalse(boolean value, String message){ if (!value)onSuccess.call(); else onFail.call(new IllegalStateException(message)); } /** * Fails if the provided value is not null. */ public static void isNull(Object value){ isNull(value, "Expected value to be null, got $ instead."); } /** * Fails if the provided value is not null. * Use $ to put the string value of the object into the message. */ public static void isNull(Object value, String message){ if (value == null)onSuccess.call(); else onFail.call(new IllegalStateException(message.replace("$", value.toString()))); } /** * Fails if the provided value is null. */ public static void notNull(Object value){ notNull(value, "Expected value to not be null."); } /** * Fails if the provided value is null. */ public static void notNull(Object value, String message){ if (value != null)onSuccess.call(); else onFail.call(new IllegalStateException(message)); } /** * Fails if the value is not an instance of targetClass. */ public static void instanceOf(Object value, Class<?> targetClass){ instanceOf(value, targetClass, "Expected value to be instance of $2, instead the class is $1."); } /** * Fails if the value is not an instance of targetClass. * Use $1 to put the current object class into the message, and $2 for the target class. */ public static void instanceOf(Object value, Class<?> targetClass, String message){ if (value != null && targetClass.isAssignableFrom(value.getClass()))onSuccess.call(); else onFail.call(new IllegalStateException(message.replace("$1", value == null ? "<null>" : value.getClass().getName()).replace("$2", targetClass.getName()))); } /** * Fails if the value is not present in the collection. */ public static void contains(Collection<?> collection, Object value){ contains(collection, value, "Expected object $1 to be present in the collection. Collection contents: $2"); } /** * Fails if the value is not present in the collection. * Use $1 to substitute the value and $2 to substitute the collection contents in the message. */ public static void contains(Collection<?> collection, Object value, String message){ if (collection != null && collection.contains(value))onSuccess.call(); else onFail.call(new IllegalStateException(message.replace("$1", value == null ? "<null>" : value.toString()).replace("$2", collection == null ? "<null>" : collection.toString()))); } /** * Fails if the value is present in the collection, or if the collection is null. */ public static void notContains(Collection<?> collection, Object value){ notContains(collection, value, "Expected object $1 to not be present in the collection. Collection contents: $2"); } /** * Fails if the value is not present in the collection, or if the collection is null. * Use $1 to substitute the value and $2 to substitute the collection contents in the message. */ public static void notContains(Collection<?> collection, Object value, String message){ if (collection == null || !collection.contains(value))onSuccess.call(); else onFail.call(new IllegalStateException(message.replace("$1", value == null ? "<null>" : value.toString()).replace("$2", collection.toString()))); } /** * Fails if the value is not equal to target (supports wrapped primitives). */ public static void equal(Object value, Object target){ equal(value, target, "Expected value to be equal to $2, got $1 instead."); } /** * Fails if the value is not equal to target (supports wrapped primitives). * Use $1 to substitute the value and $2 to substitute the target in the message. */ public static void equal(Object value, Object target, String message){ if (Objects.equal(value, target) || arePrimitivesEqual(value, target))onSuccess.call(); else onFail.call(new IllegalStateException(message.replace("$1", value == null ? "null" : value.toString()).replace("$2", target == null ? "null" : target.toString()))); } /** * Compares two objects using their primitive values. */ private static boolean arePrimitivesEqual(Object value1, Object value2){ if (value1 instanceof Number && value2 instanceof Number){ if (value1 instanceof Double || value1 instanceof Float)return MathUtil.floatEquals(((Number)value1).floatValue(), ((Number)value2).floatValue()); else return ((Number)value1).longValue() == ((Number)value2).longValue(); } else if (value1 instanceof Boolean && value2 instanceof Boolean){ return ((Boolean)value1).booleanValue() == ((Boolean)value2).booleanValue(); } else if (value1 instanceof Character && value2 instanceof Character){ return ((Character)value1).charValue() == ((Character)value2).charValue(); } else return false; } private Assert(){} }
#!/bin/bash mkdir ./mpi_batch cd ./mpi_batch echo "Writing mpi_hello_world.c file" cat << 'EOF' > mpi_hello_world.c #include <mpi.h> #include <stdio.h> int main(int argc, char** argv) { // Initialize the MPI environment MPI_Init(NULL, NULL); // Get the number of processes int world_size; MPI_Comm_size(MPI_COMM_WORLD, &world_size); // Get the rank of the process int world_rank; MPI_Comm_rank(MPI_COMM_WORLD, &world_rank); // Get the name of the processor char processor_name[MPI_MAX_PROCESSOR_NAME]; int name_len; MPI_Get_processor_name(processor_name, &name_len); // Print off a hello world message printf("Hello world from processor %s, rank %d out of %d processors\n", processor_name, world_rank, world_size); // Finalize the MPI environment. MPI_Finalize(); } EOF echo "Writing run_mpi.sh file" cat << 'EOF' > run_mpi.sh #!/bin/bash if [ -f /etc/bashrc ]; then . /etc/bashrc fi module load gcc-9.2.0 module load mpi/hpcx # Create host file batch_hosts=hosts.batch rm -rf $batch_hosts IFS=';' read -ra ADDR <<< "$AZ_BATCH_NODE_LIST" for i in "${ADDR[@]}"; do echo $i >> $batch_hosts;done # Determine hosts to run on src=$(tail -n1 $batch_hosts) dst=$(head -n1 $batch_hosts) echo "Src: $src" echo "Dst: $dst" NP=$(($NODES*$PPN)) #Runnning the following command echo "mpirun -np $NP -oversubscripe --host ${src}:${PPN},${dst}:${PPN} --map-by ppr:${PPN}:node --mca btl tcp,vader,self --mca coll_hcoll_enable 0 --mca btl_tcp_if_include lo,eth0 --mca pml ^ucx ${AZ_BATCH_APP_PACKAGE_mpi_batch_1_0_0}/mpi_batch/mpi_hello_world" # Run two node MPI tests mpirun -np $NP --oversubscribe --host ${src}:${PPN},${dst}:${PPN} --map-by ppr:${PPN}:node --mca btl tcp,vader,self --mca coll_hcoll_enable 0 --mca btl_tcp_if_include lo,eth0 --mca pml ^ucx ${AZ_BATCH_APP_PACKAGE_mpi_batch_1_0_0}/mpi_batch/mpi_hello_world EOF if [ -f /etc/bashrc ]; then . /etc/bashrc fi module load gcc-9.2.0 module load mpi/hpcx echo "Compiling mpi_hello_world.c file" mpicc -o mpi_hello_world mpi_hello_world.c echo "Deleting source file" rm mpi_hello_world.c cd .. echo "Creating zip file" zip -r mpi_batch.zip mpi_batch
"""Rare words in company purposes. This script requires the `dasem` module """ from __future__ import print_function from os import write import signal from six import b from nltk import WordPunctTokenizer from dasem.fullmonty import Word2Vec from dasem.text import Decompounder from cvrminer.cvrmongo import CvrMongo from cvrminer.text import PurposeProcessor from cvrminer.virksomhed import Virksomhed # Ignore broken pipe errors signal.signal(signal.SIGPIPE, signal.SIG_DFL) decompounder = Decompounder() purpose_processor = PurposeProcessor() w2v = Word2Vec() word_tokenizer = WordPunctTokenizer() n = 1 cvr_mongo = CvrMongo() for company in cvr_mongo.iter_companies(): virksomhed = Virksomhed(company) purposes = virksomhed.formaal for purpose in purposes: cleaned_purpose = purpose_processor.clean(purpose) words = word_tokenizer.tokenize(cleaned_purpose) for word in words: word = word.lower() if word not in w2v.model: phrase = decompounder.decompound_word(word) for subphrase in phrase.split(' '): if subphrase not in w2v.model: write(1, subphrase.encode('utf-8') + b('\n'))
const generateRandomNumbers = (length) => { let result = []; for (let i = 0; i < length; i++) { result.push(Math.floor(Math.random() * 100)); } return result; }; console.log(generateRandomNumbers(10));
<reponame>KyllianGautier/treasure-map import { TreasureMap } from './treasure-map'; import { Player } from './player'; import { Mountain } from './mountain'; import { Treasure } from './treasure'; describe('Player', () => { let treasureMap: TreasureMap; beforeEach(() => { treasureMap = new TreasureMap(5, 6); }); describe('Player orientation', () => { it('Change direction right', async () => { const player = new Player('Alphonse', 2, 3, 'South', [], treasureMap); treasureMap.addPlayer(player); player['turnRound']('D'); expect(player.direction).toBe('West'); player['turnRound']('D'); expect(player.direction).toBe('North'); player['turnRound']('D'); expect(player.direction).toBe('East'); player['turnRound']('D'); expect(player.direction).toBe('South'); }); it('Change direction left', async () => { const player = new Player('Alphonse', 2, 3, 'South', [], treasureMap); treasureMap.addPlayer(player); player['turnRound']('G'); expect(player.direction).toBe('East'); player['turnRound']('G'); expect(player.direction).toBe('North'); player['turnRound']('G'); expect(player.direction).toBe('West'); player['turnRound']('G'); expect(player.direction).toBe('South'); }); }); describe('Player movement', () => { it('Move forward', async () => { const player = new Player('Alphonse', 3, 3, 'South', [], treasureMap); treasureMap.addPlayer(player); player['goForward'](); expect(player.column).toBe(3); expect(player.row).toBe(4); }); it('Move on a wall north', async () => { const player = new Player('Alphonse', 3, 0, 'North', [], treasureMap); treasureMap.addPlayer(player); player['goForward'](); expect(player.column).toBe(3); expect(player.row).toBe(0); }); it('Move on a wall east', async () => { const player = new Player('Alphonse', 4, 3, 'East', [], treasureMap); treasureMap.addPlayer(player); player['goForward'](); expect(player.column).toBe(4); expect(player.row).toBe(3); }); it('Move on a wall south', async () => { const player = new Player('Alphonse', 2, 5, 'South', [], treasureMap); treasureMap.addPlayer(player); player['goForward'](); expect(player.column).toBe(2); expect(player.row).toBe(5); }); it('Move on a wall west', async () => { const player = new Player('Alphonse', 0, 3, 'West', [], treasureMap); treasureMap.addPlayer(player); player['goForward'](); expect(player.column).toBe(0); expect(player.row).toBe(3); }); it('Move on a mountain', async () => { const player = new Player('Alphonse', 2, 2, 'South', [], treasureMap); const mountain = new Mountain(2, 3); treasureMap.addPlayer(player); treasureMap.addMountain(mountain); player['goForward'](); expect(player.column).toBe(2); expect(player.row).toBe(2); }); it('Move on a player', async () => { const player = new Player('Alphonse', 2, 2, 'North', [], treasureMap); const opponent = new Player('Germaine', 2, 1, 'South', [], treasureMap); treasureMap.addPlayer(player); treasureMap.addPlayer(opponent); player['goForward'](); expect(player.column).toBe(2); expect(player.row).toBe(2); }); }); describe('Player gets treasure', () => { it('Get simple treasure', async () => { const player = new Player('Alphonse', 2, 3, 'South', [], treasureMap); const treasure = new Treasure(2, 4, 1); treasureMap.addPlayer(player); treasureMap.addTreasure(treasure); player['goForward'](); expect(player.treasureCount).toBe(1); expect(treasure.quantity).toBe(0); }); it('Get empty treasure', async () => { const player = new Player('Alphonse', 2, 3, 'South', [], treasureMap); const treasure = new Treasure(2, 4, 0); treasureMap.addPlayer(player); treasureMap.addTreasure(treasure); player['goForward'](); expect(player.treasureCount).toBe(0); expect(treasure.quantity).toBe(0); }); }); describe('Player action', () => { it('Player does an action', async () => { const player = new Player('Alphonse', 2, 3, 'South', ['A'], treasureMap); treasureMap.addPlayer(player); player.doAction(); expect(player.actions.length).toBe(0); }); it('Player has no more action to do', async () => { const player = new Player('Alphonse', 2, 3, 'South', [], treasureMap); treasureMap.addPlayer(player); player.doAction(); expect(player.actions.length).toBe(0); }); }); });
#!/bin/bash # # Auto-Install Apps and Tools for Manjaro/ArchLinux # # Resources: # https://wiki.archlinux.org/index.php/Secure_Shell#Protection # # @author Dumitru Uzun (DUzun.me) # if ! pacman -Qi fakeroot > /dev/null; then sudo pacman -Sq base-devel fi if ! command -v yay > /dev/null; then sudo pacman -Sq yay fi _i_='yay -S --noconfirm' _d_=$(dirname "$0"); # NumLock On at boot sudo "$_d_/numlock_on_boot.sh"; # Setup ~/.bin sudo "$_d_/set_home_bin_path.sh"; # Set some values in sysctl sudo "$_d_/sysctl.sh"; # Enable BBR tcp_congestion_control sudo "$_d_/enable_bbr.sh"; # The file /usr/bin/x-terminal-emulator is usually nonexistent on ArchLinux Systems, you have to link it manually. [ -x /usr/bin/x-terminal-emulator ] || sudo ln -sT xterm /usr/bin/x-terminal-emulator [ -x ./.bin/pacman-refresh-keys ] && ./.bin/pacman-refresh-keys # Dropdown console $_i_ guake guake & if ! ps -C rngd > /dev/null; then $_i_ rng-tools # echo RNGD_OPTS="-r /dev/urandom" | sudo tee /etc/conf.d/rngd sudo systemctl enable rngd sudo systemctl start rngd fi $_i_ dialog $_i_ git curl -L https://raw.github.com/git/git/master/contrib/completion/git-prompt.sh > ~/.bash_git grep "/.bash_git" ~/.bashrc || { echo >> ~/.bashrc; echo '[ -f ~/.bash_git ] && . ~/.bash_git' >> ~/.bashrc; } # Unlock id_rsa key with KWallet f=~/.config/autostart-scripts/ssh-add.sh if [ ! -s "$f" ] && [ -s "$_d_/autostart-scripts/ssh-add.sh" ]; then cat "$_d_/autostart-scripts/ssh-add.sh" > "$f" chmod +x "$f" fi # $_i_ redshift # not required any more, see "Night Mode" in settings $_i_ synergy1-bin # $_i_ dropbox # $_i_ kde-servicemenus-dropbox # Create an account at https://e.pcloud.com/#page=register&invite=BOUkZ4oWYRy $_i_ pcloud-drive # pCloud drive client on Electron $_i_ speedcrunch # advanced calculator # $_i_ odrive-bin # Google Drive client on Electron # $_i_ yandex-disk # $_i_ yandex-disk-indicator $_i_ brave-browser # $_i_ google-chrome # https://chrome.google.com/webstore/detail/plasma-integration/cimiefiiaegbelhefglklhhakcgmhkai # https://addons.mozilla.org/en-US/firefox/addon/plasma-integration/ $_i_ plasma-browser-integration $_i_ sshfs $_i_ fuseiso $_i_ ifuse $_i_ cdemu-daemon $_i_ cdemu-client $_i_ autofs sudo cp -R "$_d_"/autofs/* /etc/autofs/ sudo systemctl enable autofs sudo systemctl start autofs $_i_ etcher # write ISO to USB-Storage $_i_ open-fuse-iso $_i_ gparted # alternative to KDE Partition Manager $_i_ kdiskmark # Measure storage read/write performance $_i_ diffuse $_i_ meld $_i_ kdiff3 $_i_ terminator $_i_ xorg-xkill # xkill any window app $_i_ plasma5-applets-caffeine-plus # Prevents the desktop becoming idle in full-screen mode $_i_ wmctrl # Window control utility # $_i_ pamac-gtk # this is now the default GUI package manager # $_i_ pamac-tray-appindicator # Tray icon using appindicator which feets better in KDE $_i_ krita # photo editor $_i_ blender # video editor # $_i_ xnviewmp # photo viewer $_i_ kodi # video player $_i_ celluloid # video player # $_i_ kodi-addon-stream $_i_ clementine # audio player $_i_ kdegraphics-thumbnailers $_i_ raw-thumbnailer $_i_ raw-thumbnailer-entry $_i_ webp-thumbnailer # $_i_ ffmpegthumbnailer-mp3 $_i_ exe-thumbnailer $_i_ appimage-thumbnailer-git # $_i_ jar-thumbnailer-git # Install a hook for minidlna _sed_=$(command -v sed) cat << EOS | sudo tee /etc/pacman.d/hooks/minidlna-unjail-home.hook > /dev/null [Trigger] Type = Package Target = minidlna Operation = Install Operation = Upgrade [Action] Description = Unjail home for MiniDLNA service When = PostTransaction Exec = $_sed_ -i 's/ProtectHome=on/ProtectHome=off/' /lib/systemd/system/minidlna.service EOS $_i_ minidlna # Media Server # sed -i 's/ProtectHome=on/ProtectHome=off/' /lib/systemd/system/minidlna.service # Security $_i_ rkhunter $_i_ fail2ban $_i_ unhide $_i_ clamav # antivirus $_i_ clamtk # GUI for clamav # Fast reboot $_i_ dash $_i_ kexec-tools f=~/.bin/krbt if [ ! -s "$f" ] && [ -s "$_d_/.bin/krbt" ]; then cat "$_d_/.bin/krbt" > "$f" chmod +x "$f" fi # # https://wiki.archlinux.org/index.php/PPTP_Client # $_i_ pptpclient # # Create MikroTel VPN connection and daemonize it # [ -x "$_d_/setup_mikrotel_pptp.sh" ] && sudo "$_d_/setup_mikrotel_pptp.sh"; # Install Cronie (if missing) and setup /etc/cron.minutely folder [ -d /etc/cron.minutely ] || sudo mkdir /etc/cron.minutely cat << EOF | sudo tee /etc/cron.d/0minutely > /dev/null SHELL=/bin/bash PATH=/sbin:/bin:/usr/sbin:/usr/bin MAILTO=root */1 * * * * root run-parts /etc/cron.minutely #Runs a cron job script every minute EOF if ! ps -C crond > /dev/null; then $_i_ cronie sudo systemctl enable cronie sudo systemctl start cronie fi $_i_ notepadqq # like notepad++ $_i_ vscodium-bin # [ -d ~/.config/VSCodium/User ] if [ -d ~/Dropbox/config/VSCodium/User/ ]; then ln -sf ~/Dropbox/config/VSCodium/User ~/.config/VSCodium/ fi # $_i_ sublime-text-dev # sudo ln -sf /opt/sublime_text_3/sublime_text /usr/bin/subl # [ -d ~/.config/sublime-text-3/Packages/User ] if [ -d ~/Dropbox/config/Sublime/User/ ]; then ln -sf ~/Dropbox/config/Sublime/User ~/.config/sublime-text-3/Packages/ fi # File & Sync $_i_ syncthing-gtk-python3 # Start syncthing delayed f=~/.config/autostart-scripts/syncthing-delayed.sh if [ ! -s "$f" ] && [ -s "$_d_/autostart-scripts/syncthing-delayed.sh" ]; then cat "$_d_/autostart-scripts/syncthing-delayed.sh" > "$f" chmod +x "$f" fi # systemctl enable --user syncthing systemctl start --user syncthing $_i_ freefilesync $_i_ fslint # $_i_ btsync-1.4 # sudo systemctl enable btsync # sudo systemctl start btsync # $_i_ btsync-gui # google-chrome-stable http://localhost:8888 & $_i_ qbittorrent $_i_ gufw # GUI for ufw # Like krunner $_i_ rofi # KDE VNC $_i_ krfb $_i_ krdc # VNC $_i_ tigervnc # $_i_ tigervnc-viewer $_i_ remmina # Other Remote Desktop $_i_ teamviewer sudo systemctl enable teamviewerd $_i_ telegram-desktop $_i_ viber # Start Viber and send it to the system tray f=~/.config/autostart-scripts/viber-to-tray.sh if [ ! -f "$f" ]; then cat > "$f" << EOF #!/bin/bash viber StartMinimized & sleep 3; wid=\$(wmctrl -p -l | grep Viber | grep " \$! " | awk '{print \$1}') && \ wmctrl -i -c "\$wid" # pidof /opt/viber/Viber EOF chmod +x "$f" # Disable Viber autostart f=~/.config/autostart/Viber.desktop if [ -f "$f" ]; then if ! grep -q 'Hidden=true' -- "$f"; then echo 'Hidden=true' >> "$f" fi fi fi # $_i_ skypeforlinux-stable-bin # cat > ~/.config/autostart/skypeforlinux.desktop << EOF # [Desktop Entry] # Name=Skype for Linux # GenericName=Skype # Exec=skypeforlinux # Icon=skypeforlinux # Terminal=false # Type=Application # Categories=Network; # StartupNotify=false # EOF # SkypeForLinux doesn't use kwallet (yet?), but uses gnome-keyring instead if $_i_ gnome-keyring; then if command -v sddm > /dev/null; then if ! grep -lq pam_gnome_keyring.so -- /etc/pam.d/sddm; then # Add these lines to /etc/pam.d/sddm # -auth optional pam_gnome_keyring.so # -session optional pam_gnome_keyring.so auto_start t=-1; while read -r ln; do echo "$ln" | grep -q '^auth\s\+'; s="$?" if [ "$s" -ne 0 ] && [ "$t" -eq 0 ]; then echo -e '-auth\t\toptional\tpam_gnome_keyring.so'; fi; t=$s; echo "$ln"; done < /etc/pam.d/sddm > /tmp/etc_pam_sddm && \ echo -e '-session\toptional\tpam_gnome_keyring.so\tauto_start' >> /tmp/etc_pam_sddm && \ sudo mv -f /tmp/etc_pam_sddm /etc/pam.d/sddm fi fi git config --global credential.helper gnome-keyring # git config --global credential.modalprompt true $_i_ seahorse fi # Replace Yakuake with Guake # You have to enable autostart in prefferences cat > ~/.config/autostart/guake.desktop << EOF [Desktop Entry] Name=Guake Terminal GenericName=Terminal Comment=Use the command line in a Quake-like terminal Exec=guake Icon=guake Terminal=false Type=Application Categories=GNOME;GTK;System;Utility;TerminalEmulator; Encoding=UTF-8 StartupNotify=false TryExec=guake EOF # Disable Yakuake autostart f=~/.config/autostart/org.kde.yakuake.desktop if [ -f "$f" ]; then if ! grep -q 'Hidden=true' -- "$f"; then echo 'Hidden=true' >> "$f" fi fi # Ctrl+` opens Guake (global shortcut) f=~/.config/kglobalshortcutsrc if [ -f "$f" ]; then if ! grep -q '[guake.desktop]' -- "$f"; then cat >> "$f" << EOF [guake.desktop] _k_friendly_name=Launch Guake Terminal _launch=\\tMeta+\`,none,Launch Guake Terminal EOF fi fi # Login screen on two displays f=/usr/share/sddm/scripts/Xsetup x=$(grep "xrandr --output" $f) if [ -z "$x" ]; then x=$(xrandr --listmonitors | awk '{print $4}' | grep -v '^$') x1=$(echo "$x" | head -1) x2=$(echo "$x" | tail -1) cat << EOF xrandr --output $x1 --primary --left-of $x2 EOF fi | sudo tee -a $f > /dev/null $_i_ doublecmd-gtk2 $_i_ sddm-config-editor-git $_i_ kazam $_i_ flameshot $_i_ obs-studio # screen recording/streaming $_i_ screenkey # show keystrokes on the screen $_i_ kcolorchooser #$_i_ winscp $_i_ playonlinux # if $_i_ crossover ; # then # $_i_ nss-mdns # # On x64 # $_i_ lib32-nss-mdns # $_i_ lib32-sdl2 # $_i_ lib32-vkd3d # fi $_i_ ttf-ms-fonts # On x64 $_i_ lib32-libwbclient lib32-libxslt $_i_ virtualbox virtualbox-host-dkms $_i_ virt-manager virt-viewer qemu vde2 ebtables dnsmasq sudo systemctl enable libvirtd # sudo systemctl start libvirtd echo "options kvm-intel nested=1" | tee /etc/modprobe.d/kvm-intel.conf qemu-kvm # If VMs doesn't start, try: # yay --noconfirm linux-headers # sudo modprobe vboxdrv # depmod -a # Failed to start Load Kernel Modules # Update virs signatures sudo freshclam
def generate_documentation_list(doc_requires): output = "## Required Documentation Tools\n" for tool in doc_requires: output += f"- {tool}\n" return output
try: from dotenv import load_dotenv print("Found .env file, loading environment variables from it.") load_dotenv(override=True) except ModuleNotFoundError: pass import asyncio import logging import os from functools import partial, partialmethod import arrow import sentry_sdk from discord.ext import commands from sentry_sdk.integrations.logging import LoggingIntegration from sentry_sdk.integrations.redis import RedisIntegration from bot import log, monkey_patches sentry_logging = LoggingIntegration( level=logging.DEBUG, event_level=logging.WARNING ) sentry_sdk.init( dsn=os.environ.get("BOT_SENTRY_DSN"), integrations=[ sentry_logging, RedisIntegration() ], release=f"sir-lancebot@{os.environ.get('GIT_SHA', 'foobar')}" ) log.setup() # Set timestamp of when execution started (approximately) start_time = arrow.utcnow() # On Windows, the selector event loop is required for aiodns. if os.name == "nt": asyncio.set_event_loop_policy(asyncio.WindowsSelectorEventLoopPolicy()) monkey_patches.patch_typing() # This patches any convertors that use PartialMessage, but not the PartialMessageConverter itself # as library objects are made by this mapping. # https://github.com/Rapptz/discord.py/blob/1a4e73d59932cdbe7bf2c281f25e32529fc7ae1f/discord/ext/commands/converter.py#L984-L1004 commands.converter.PartialMessageConverter = monkey_patches.FixedPartialMessageConverter # Monkey-patch discord.py decorators to use the both the Command and Group subclasses which supports root aliases. # Must be patched before any cogs are added. commands.command = partial(commands.command, cls=monkey_patches.Command) commands.GroupMixin.command = partialmethod(commands.GroupMixin.command, cls=monkey_patches.Command) commands.group = partial(commands.group, cls=monkey_patches.Group) commands.GroupMixin.group = partialmethod(commands.GroupMixin.group, cls=monkey_patches.Group)
<gh_stars>0 import * as t from '../constants/ActionTypes'; import _ from 'lodash'; const initialState = { ecode: 0, collection: [], collection2JSON: '', options: {}, indexLoading: false, saveLoading: false }; export default function wfconfig(state = initialState, action) { const { collection } = state; switch (action.type) { case t.WFCONFIG_INDEX: return { ...state, indexLoading: true, collection: [] }; case t.WFCONFIG_INDEX_SUCCESS: if (action.result.ecode === 0) { state.collection = action.result.data.contents && action.result.data.contents.steps ? action.result.data.contents.steps : []; state.collection2JSON = JSON.stringify(state.collection); state.workflowId = action.result.data.id; state.workflowName = action.result.data.name; state.options = action.result.options; } return { ...state, indexLoading: false, ecode: action.result.ecode }; case t.WFCONFIG_INDEX_FAIL: return { ...state, indexLoading: false, error: action.error }; case t.WFCONFIG_SAVE: return { ...state, saveLoading: true }; case t.WFCONFIG_SAVE_SUCCESS: return action.result.ecode === 0 ? { ...state, saveLoading: false, ecode: action.result.ecode, collection2JSON: JSON.stringify(state.collection) } : { ...state, saveLoading: false, ecode: action.result.ecode }; case t.WFCONFIG_SAVE_FAIL: return { ...state, saveLoading: false, error: action.error }; case t.WFCONFIG_STEP_CREATE: const maxStep = _.max(collection, step => step.id).id || 0; collection.push({ id: maxStep+1, name: action.values.name, state: action.values.state, actions: [] }); return { ...state, collection }; case t.WFCONFIG_STEP_EDIT: const index = _.findIndex(collection, { id: action.values.id }); collection[index]['name'] = action.values.name; collection[index]['state'] = action.values.state; return { ...state, collection }; case t.WFCONFIG_STEP_DELETE: const inx = _.findIndex(collection, { id: action.id }); collection.splice(inx, 1); return { ...state, collection: collection }; case t.WFCONFIG_ACTION_ADD: const stepIndex = _.findIndex(collection, { id: action.stepId }); if (!collection[stepIndex].actions) { collection[stepIndex].actions = []; } const maxAction = _.max(collection[stepIndex].actions, value => value.id).id || 0; action.values.id = action.stepId * 1000 + maxAction % 1000 + 1; collection[stepIndex].actions.push(action.values); return { ...state, collection }; case t.WFCONFIG_ACTION_EDIT: const stepInd = _.findIndex(collection, { id: action.stepId }); const actionInd = _.findIndex(collection[stepInd].actions, { id: action.values.id }) collection[stepInd].actions[actionInd] = action.values; return { ...state, collection }; case t.WFCONFIG_ACTION_DELETE: const sInd = _.findIndex(collection, { id: action.stepId }); collection[sInd].actions = _.filter(collection[sInd].actions, function(v) { return _.indexOf(action.values, v.id) === -1 }); return { ...state, collection }; case t.WFCONFIG_CANCEL: state.collection = JSON.parse(state.collection2JSON); return { ...state }; default: return state; } }
#!/bin/bash # try running like '.scripts/tidy.sh --fix' find ./src -type f -iname *.h -o -iname *.c -o -iname *.cpp -o -iname *.hpp | xargs -I {} clang-tidy --quiet $@ {}
#!/bin/bash go run cmd/server/main.go
import requests class HttpException(Exception): pass def delete_resource(api_url: str, resource_id: int) -> dict: try: response = requests.delete(f"{api_url}/{resource_id}") response.raise_for_status() # Raise an HTTPError for 4xx or 5xx status codes return {'status': 'deleted', 'resource_id': resource_id} except requests.exceptions.HTTPError as e: raise HttpException(f"A HTTP error response was received: {e}") except requests.exceptions.RequestException as e: raise HttpException(f"An error occurred while executing the API: {e}") # Test the function try: result = delete_resource('https://api.example.com/resources', 123) print(result) # Output: {'status': 'deleted', 'resource_id': 123} except HttpException as e: print(e)
<filename>allrichstore/UI/Home/Message/C/MessageVC.h // // MessageVC.h // allrichstore // // Created by 任强宾 on 16/11/15. // Copyright © 2016年 allrich88. All rights reserved. // #import "BaseVC.h" @interface MessageVC : BaseVC @end
#!/usr/bin/env bash DIR="$( cd "$( dirname "${BASH_SOURCE[0]}" )" && pwd )" rail-rna prep elastic -m $DIR/sra_batch_82.manifest --skip-bad-records --ignore-missing-sra-samples --core-instance-type m3.xlarge --master-instance-type m3.xlarge -o s3://rail-sra-hg38/sra_prep_batch_82 -c 20 --core-instance-bid-price 0.25 --master-instance-bid-price 0.25 -f --max-task-attempts 6 --region us-east-1 --ec2-key-name useast1
def maxOverlapSum(intervals): res = [] intervals = sorted(intervals, key=lambda x: x[0]) while len(intervals) > 0: curr = intervals.pop(0) temp = [] for interval in intervals: if (interval[0] >= curr[0] and interval[1] <= curr[1]): temp.append(interval) elif (interval[0] <= curr[1] and interval[1] >= curr[1]): curr[1] = interval[1] temp.append(interval) res.append(curr) intervals = [x for x in intervals if x not in temp] return sum(map(lambda x: x[1] - x[0], res)) intervals = [[1, 10], [2, 5], [8, 12], [15, 20]] result = maxOverlapSum(intervals) print(result)
<gh_stars>1-10 import React from 'react'; import { StylePosterRandom } from './style'; const PosterRandom: React.FC =()=>{ return( <StylePosterRandom> <div className="wrraper"> <div className="cabecalho"> <img src="/assets/kiba.jfif" alt="userPhoto" className="userPhoto" /> <div className="text-cab"> <h1><NAME></h1> <p>4 h. <i className="fas fa-globe-americas"></i></p> </div> <i className="fas fa-ellipsis-h"></i> </div> <img src="/assets/kibaPoster.jpg" alt="fotoPostada" className="fotoPostada" /> <span className="separator"></span> <div className="infoCurt"> <div className="esq"> <i className="fas fa-thumbs-up"></i> <i className="fas fa-heart"></i> <span>1 mil</span> </div> <div className="dir"> <span>300 Comentários</span> <span>500 Compartilhamentos</span> </div> </div> <span className="separator"></span> <div className="curti"> <button> <i className="fas fa-thumbs-up"></i> Curtir </button> <button> <i className="far fa-comment-alt"></i> Comentar </button> <button> <i className="far fa-share-square"></i> Compartilhar </button> </div> </div> </StylePosterRandom> ); } export default PosterRandom;
function handleMessage(data, channel) { if (data.error) { console.log('# Something went wrong', data.error); return; } if (data.message === 'ping') { console.log('# Sending pong'); channel.send('pong'); } if (data.message === 'pong') { console.log('# Received ping'); channel.send('ping'); } }
package com.alchemyapi.api; public class AlchemyAPI_TextParams extends AlchemyAPI_Params{ private Boolean useMetaData; private Boolean extractLinks; public boolean isUseMetaData() { return useMetaData; } public void setUseMetaData(boolean useMetaData) { this.useMetaData = useMetaData; } public boolean isExtractLinks() { return extractLinks; } public void setExtractLinks(boolean extractLinks) { this.extractLinks = extractLinks; } public String getParameterString(){ String retString = super.getParameterString(); if(useMetaData!=null) retString+="&useMetaData="+(useMetaData?"1":"0"); if(extractLinks!=null) retString+="&extractLinks="+(extractLinks?"1":"0"); return retString; } }
<filename>src/main/java/com/netcracker/ncstore/dto/ReviewCreateDTO.java<gh_stars>0 package com.netcracker.ncstore.dto; import com.netcracker.ncstore.model.Product; import com.netcracker.ncstore.model.User; import lombok.AllArgsConstructor; import lombok.Getter; @AllArgsConstructor @Getter public class ReviewCreateDTO { private final User author; private final Product product; private final int rating; private final String text; }
import locales from '../i18n/locales.json'; import anime from 'animejs'; import React, {useState, useRef} from 'react'; import * as Icon from 'react-feather'; import {useTranslation} from 'react-i18next'; import {Link} from 'react-router-dom'; import {useSpring, animated} from 'react-spring'; import {useEffectOnce, useLockBodyScroll, useWindowSize} from 'react-use'; function Navbar({ pages, darkMode, showLanguageSwitcher, setShowLanguageSwitcher, }) { const {i18n, t} = useTranslation(); const currentLanguage = Object.keys(locales).includes(i18n?.language) ? i18n?.language : i18n?.options?.fallbackLng[0]; const [expand, setExpand] = useState(false); useLockBodyScroll(expand); const windowSize = useWindowSize(); const [spring, set, stop] = useSpring(() => ({opacity: 0})); set({opacity: 1}); stop(); return ( <animated.div className="Navbar" style={spring}> <div className="navbar-left" onClick={() => { setShowLanguageSwitcher((prevState) => !prevState); }} > {locales[currentLanguage]} </div> <div className="navbar-middle"> <Link to="/" onClick={() => { setExpand(false); }} > Covid19<span>India</span> </Link> </div> <div className="navbar-right" onClick={() => { setExpand(!expand); }} onMouseEnter={() => { if (window.innerWidth > 769) { setExpand(true); } }} > {windowSize.width < 769 && ( <span>{expand ? t('Close') : t('Menu')}</span> )} {windowSize.width > 769 && ( <React.Fragment> <span> <Link to="/"> <Icon.Home {...activeNavIcon('/')} /> </Link> </span> <span> <Link to="/demographics"> <Icon.Users {...activeNavIcon('/demographics')} /> </Link> </span> <span> <Link to="/essentials"> <Icon.Package {...activeNavIcon('/essentials')} /> </Link> </span> <span> <Link to="/about"> <Icon.HelpCircle {...activeNavIcon('/about')} /> </Link> </span> <span> {window.innerWidth > 768 && <SunMoon {...{darkMode}} />} </span> </React.Fragment> )} </div> {expand && ( <Expand {...{expand, pages, setExpand, darkMode, windowSize}} /> )} </animated.div> ); } function Expand({expand, pages, setExpand, darkMode, windowSize}) { const expandElement = useRef(null); const {t} = useTranslation(); useEffectOnce(() => { anime({ targets: expandElement.current, translateX: '10.5rem', easing: 'easeOutExpo', duration: 250, }); }); return ( <div className="expand" ref={expandElement} onMouseLeave={() => { if (windowSize.width > 769) setExpand(false); }} > {pages.map((page, i) => { if (page.showInNavbar === true) { return ( <Link to={page.pageLink} key={i} onClick={() => { setExpand(false); }} > <span {...navLinkProps(page.pageLink, page.animationDelayForNavbar)} > {t(page.displayName)} </span> </Link> ); } return null; })} {window.innerWidth < 768 && <SunMoon {...{darkMode}} />} <div className="expand-bottom fadeInUp" style={{animationDelay: '1s'}}> <h5>{t('A crowdsourced initiative.')}</h5> </div> </div> ); } export default Navbar; const navLinkProps = (path, animationDelay) => ({ className: `fadeInUp ${window.location.pathname === path ? 'focused' : ''}`, style: { animationDelay: `${animationDelay}s`, }, }); const activeNavIcon = (path) => ({ style: { stroke: window.location.pathname === path ? '#4c75f2' : '', }, }); const SunMoon = ({darkMode}) => { return ( <div className="SunMoon" onClick={() => { darkMode.toggle(); }} > <div> {darkMode.value ? <Icon.Sun color={'#ffc107'} /> : <Icon.Moon />} </div> </div> ); };
<reponame>madhusha2020/inventory-frontend-ngx import {Component, OnInit} from '@angular/core'; import {ActivatedRoute, Router} from '@angular/router'; import { Customer, CustomerControllerService, CustomerUser, Role, RoleControllerService, User, UserControllerService } from '../../../service/rest'; import Swal from 'sweetalert2'; import {FormBuilder, FormGroup, Validators} from '@angular/forms'; import {ServiceUtil} from '../../../service/util/service-util'; import {TokenService} from '../../../service/auth/token.service'; @Component({ selector: 'ngx-customer-view', templateUrl: './customer-view.component.html', styleUrls: ['./customer-view.component.scss'] }) export class CustomerViewComponent implements OnInit { editMode: boolean; disabledProperty = 'disabled'; title: string; customerForm: FormGroup; customerPasswordForm: FormGroup; customerUser: CustomerUser = {}; user: User = {}; customer: Customer = {}; customerTypes: Array<string> = ServiceUtil.getCustomerTypes(); roles: Array<Role> = []; roleNameList: Array<string> = []; assignedRoles: Map<string, Role> = new Map<string, Role>(); constructor(private formBuilder: FormBuilder, private roleControllerService: RoleControllerService, private userControllerService: UserControllerService, private customerControllerService: CustomerControllerService, private tokenService: TokenService, private route: ActivatedRoute, private router: Router) { } get name() { return this.customerForm.get('name'); } get userName() { return this.customerForm.get('userName'); } get oldPassword() { return this.customerPasswordForm.get('oldPassword'); } get password() { return this.customerPasswordForm.get('password'); } get confirmPassword() { return this.customerPasswordForm.get('confirmPassword'); } get type() { return this.customerForm.get('type'); } get address() { return this.customerForm.get('address'); } get contact1() { return this.customerForm.get('contact1'); } get contact2() { return this.customerForm.get('contact2'); } get fax() { return this.customerForm.get('fax'); } ngOnInit(): void { this.editMode = false; this.route.queryParams.subscribe(params => { if (params.id) { this.fetchCustomer(params.id); } else { Swal.fire('Error', 'Customer not found', 'error'); } } ); this.fetchRoles(); this.customerForm = this.formBuilder.group({ name: [null, [Validators.required]], userName: [null, [Validators.required, Validators.pattern('^[a-z0-9._%+-]+@[a-z0-9.-]+\\.[a-z]{2,4}$')]], type: [ServiceUtil.getExternalCustomerType(), [Validators.required]], address: [null, [Validators.required]], contact1: [null, [Validators.required, Validators.minLength(10), Validators.maxLength(13), Validators.pattern('^((\\+91?)|(\\+94?)|0)?[0-9]{10}$')]], contact2: [null, [Validators.minLength(10), Validators.maxLength(13), Validators.pattern('^((\\+91?)|(\\+94?)|0)?[0-9]{10}$')]], fax: [null, [Validators.minLength(10), Validators.maxLength(13), Validators.pattern('^((\\+91?)|(\\+94?)|0)?[0-9]{10}$')]], }); this.customerPasswordForm = this.formBuilder.group({ password: [null, [Validators.required, Validators.minLength(8)]], confirmPassword: [null, [Validators.required, Validators.minLength(8)]], oldPassword: [null, [Validators.required, Validators.minLength(8)]], }); } fetchCustomer(id: string) { this.userControllerService.getCustomerByIdUsingGET(id).subscribe(response => { console.log('CustomerUser Data :', response); this.customer = response.customer; this.user = response.user; this.roleNameList = response.roleNameList; console.log('Customer Data :', this.customer); console.log('User Data :', this.user); console.log('Role Name List Data :', this.roleNameList); this.setData(); }); } setData() { this.userName.setValue(this.user.userName); this.name.setValue(this.customer.name); this.address.setValue(this.customer.address); this.contact1.setValue(this.customer.contact1); this.contact2.setValue(this.customer.contact2); this.fax.setValue(this.customer.fax); this.type.setValue(this.customer.type); this.roleNameList.forEach(role => { this.assignedRoles.set(role, {name: role}); }); } fetchRoles() { this.roleControllerService.getAllRolesUsingGET().subscribe(response => { console.log('Roles :', response); this.roles = response.roles; }); } typeStateChange(event) { console.log('Customer Type : ', event); this.type.setValue(event); } roleStateChange(event, role: Role) { if (event.target.checked) { this.assignedRoles.set(role.name, role); } else { this.assignedRoles.delete(role.name); } console.log('Assigned Roles :', this.assignedRoles); } enableEditMode() { this.editMode = true; this.disabledProperty = null; this.title = 'Edit'; } disabledEditMode() { this.editMode = false; this.disabledProperty = 'disabled'; this.title = null; this.setData(); } updateCustomerDetails() { this.updateCustomer(); } updateCustomerPassword() { this.user.password = <PASSWORD>; this.user.oldPassword = <PASSWORD>; this.updateCustomer(); } suspend() { console.log('Suspend customer'); if (this.customer.email != this.tokenService.getUserName()) { Swal.fire({ title: 'Are you sure?', text: 'Suspend customer : {0}'.replace('{0}', this.customer.name), icon: 'warning', showCancelButton: true, confirmButtonText: 'Yes', cancelButtonText: 'No' }).then((result) => { if (result.value) { this.customerControllerService.suspendCustomerUsingPUT({id: this.customer.id, userId: this.tokenService.getUserName()}).subscribe(response => { console.log('Suspend customer :', response); Swal.fire('Success', 'Customer suspend successfully', 'success').then(ok => { this.router.navigate(['/pages/customer/main']); }); }); } else if (result.dismiss === Swal.DismissReason.cancel) { // Canceled } }); } else { Swal.fire('Error', 'You cannot suspend your own customer record', 'error'); } } activate() { console.log('Activate customer'); if (this.customer.email != this.tokenService.getUserName()) { Swal.fire({ title: 'Are you sure?', text: 'Activate customer : {0}'.replace('{0}', this.customer.name), icon: 'warning', showCancelButton: true, confirmButtonText: 'Yes', cancelButtonText: 'No' }).then((result) => { if (result.value) { this.customerControllerService.activateCustomerUsingPUT({id: this.customer.id, userId: this.tokenService.getUserName()}).subscribe(response => { console.log('Activate customer :', response); Swal.fire('Success', 'Customer activate successfully', 'success').then(ok => { this.router.navigate(['/pages/customer/main']); }); }); } else if (result.dismiss === Swal.DismissReason.cancel) { // Canceled } }); } else { Swal.fire('Error', 'You cannot activate your own customer record', 'error'); } } private updateCustomer() { this.user.userId = this.tokenService.getUserName(); this.customer.name = this.name.value; this.customer.email = this.userName.value; this.customer.address = this.address.value; this.customer.contact1 = this.contact1.value; this.customer.contact2 = this.contact2.value; this.customer.fax = this.fax.value; this.customer.description = ServiceUtil.getUpdateCustomerDescription(); this.customer.type = this.type.value; this.customer.userId = this.tokenService.getUserName(); this.customerUser.roleNameList = new Array<string>(); this.assignedRoles.forEach((value, key) => { this.customerUser.roleNameList.push(key); }); this.customerUser.user = this.user; this.customerUser.customer = this.customer; console.log('Customer User : ', this.customerUser); Swal.fire({ title: 'Are you sure?', text: 'Update customer : {0}'.replace('{0}', this.customer.name), icon: 'warning', showCancelButton: true, confirmButtonText: 'Yes', cancelButtonText: 'No' }).then((result) => { if (result.value) { this.userControllerService.updateCustomerUsingPUT(this.customerUser).subscribe(response => { console.log('Updated Customer :', response); Swal.fire('Success', 'Customer successfully updated', 'success').then(value => { this.router.navigate(['/pages/customer/main']); }); }); } else if (result.dismiss === Swal.DismissReason.cancel) { // Canceled } }); } }
/* ************************************************************************** */ /* */ /* ::: :::::::: */ /* get_value.c :+: :+: :+: */ /* +:+ +:+ +:+ */ /* By: rle <<EMAIL>> +#+ +:+ +#+ */ /* +#+#+#+#+#+ +#+ */ /* Created: 2017/05/05 22:03:03 by rle #+# #+# */ /* Updated: 2017/05/05 22:15:52 by rle ### ########.fr */ /* */ /* ************************************************************************** */ #include <ft_db.h> int get_value(char *line, struct s_command *command, struct s_header *header) { int i; int j; j = 0; i = 0; command->value = (char *)malloc(sizeof(char) * \ header->fields[command->field].value_size); ft_bzero(command->value, header->fields[command->field].value_size); while (line[i] && line[i] != ':') i++; if (!line[i++]) return (0); while (line[i]) { ((char *)command->value)[j] = line[i]; i++; j++; } return (1); } uint64_t value_size(char *line) { int i; int j; i = 0; j = 0; while (line[i] && line[i] != ':') i++; if (!line[i++]) return (-1); while (line[i]) { i++; j++; } return (j); }
<html> <head> <title>Toggle between List and Card View</title> </head> <body> <h3> Toggle between List and Card View </h3> <div class="container"> <input type="radio" name="view" value="list" id="list-view"> <label for="list-view">List View</label> <input type="radio" name="view" value="card" id="card-view"> <label for="card-view">Card View</label> <ul class="items"> <li>Item 1</li> <li>Item 2</li> <li>Item 3</li> <li>Item 4</li> </ul> </div> <script> const container = document.querySelector('.container'); const cards = document.querySelectorAll('.items li'); function showListView() { container.classList.remove('card-view'); container.classList.add('list-view'); } function showCardView() { container.classList.remove('list-view'); container.classList.add('card-view'); } document.querySelector('#list-view').addEventListener('change', showListView); document.querySelector('#card-view').addEventListener('change', showCardView); </script> </body> </html>
#!/bin/bash # Copyright 2021 Huawei Technologies Co., Ltd # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================ echo "==============================================================================================================" echo "Please run the script as: " echo "bash run.sh RANK_TABLE_FILE RANK_SIZE RANK_START /path/weight_file /path/OTB" echo "For example: bash run_distributed_test.sh /path/rank_table.json 16 0 weight_file /data/OTB" echo "It is better to use the absolute path." echo "==============================================================================================================" execute_path=$(pwd) echo ${execute_path} script_self=$(readlink -f "$0") self_path=$(dirname "${script_self}") echo ${self_path} export RANK_TABLE_FILE=$1 export RANK_SIZE=$2 DEVICE_START=$3 WEIGHT_FILE=$4 for((i=0;i<$RANK_SIZE;i++)); do export RANK_ID=$i export DEVICE_ID=$((DEVICE_START + i)) echo "Start test for rank $RANK_ID, device $DEVICE_ID." if [ -d ${execute_path}/eval_device${DEVICE_ID} ]; then rm -rf ${execute_path}/eval_device${DEVICE_ID} fi mkdir ${execute_path}/eval_device${DEVICE_ID} cp -f eval.py ${execute_path}/eval_device${DEVICE_ID} cp -rf src ${execute_path}/eval_device${DEVICE_ID} cd ${execute_path}/eval_device${DEVICE_ID} || exit python3.7 -u eval.py --distributed 'True' --weight_file ${WEIGHT_FILE} --dataset_path $5> eval_log$i 2>&1 & cd .. done wait filename=`echo ${WEIGHT_FILE##*/} |awk -F. '{print $1}'` bboxes_folder="results_on_test_images_part2/${filename}.-0.5" python3 create_plots.py --bboxes_folder ${execute_path}/${bboxes_folder} > eval_result.txt
#!/bin/bash CROMWELL_JAR=$(which cromwell-30.1.jar) WDL=$CODE/atac-seq-pipeline/atac.wdl INPUT=$CODE/atac-seq-pipeline-test-data/scripts/ENCSR356KRQ_no_dup_removal.json WF_OPT=$CODE/atac-seq-pipeline/workflow_opts/docker.json BACKEND_CONF=$CODE/atac-seq-pipeline/backends/backend.conf BACKEND=Local mkdir -p ENCSR356KRQ_no_dup_removal && cd ENCSR356KRQ_no_dup_removal java -Dconfig.file=${BACKEND_CONF} -Dbackend.default=${BACKEND} -jar ${CROMWELL_JAR} run ${WDL} -i ${INPUT} -o ${WF_OPT} find $PWD -name '*.filt.bam' | grep -v glob | grep shard-0 cd ..
set :markdown_engine, :redcarpet set :markdown, fenced_code_blocks: true, smartypants: true, tables: true, no_intra_emphasis: true set :css_dir, 'stylesheets' set :js_dir, 'javascripts' set :images_dir, 'images' helpers do def version @version ||= File.read('source/_changelog.md').match(/(v\d+\.[\w\.]*)/).try(:[], 1) end end configure :build do activate :minify_css activate :minify_javascript end
SELECT * FROM customers WHERE payment_method = 'Credit Card' AND purchase_date BETWEEN CURDATE() - INTERVAL 3 MONTH AND CURDATE();
<reponame>amygdaloideum/browser-env-vars<filename>test/main.js<gh_stars>1-10 const expect = require('chai').expect; const sinon = require('sinon'); const fs = require('fs'); const service = require('../index'); let s; describe('Generate()', function () { var readFileSyncStub, unlinkSyncStub, existsSyncStub; let output; const mockEnvFile = content => s.stub(fs, 'readFileSync').returns(content); const setFileExists = (file, exists) => existsSyncStub.withArgs(file).returns(exists); beforeEach(function() { output = ''; process.env = {}; s = sinon.sandbox.create(); s.stub(fs, 'appendFileSync').callsFake(function fakeFn(path, data) { output += data; }); unlinkSyncStub = s.stub(fs, 'unlinkSync'); existsSyncStub = s.stub(fs, 'existsSync'); }); afterEach(function() { s.restore(); }); it('should take values from .env', function () { setFileExists('.env', true); mockEnvFile('test=val\ntest2=val2'); service.generate(); expect(output).to.equal(`module.exports = {\n "test": "val",\n "test2": "val2"\n}`); }); it('should use the whitelisted values from process.env', function () { setFileExists('.env', false); mockEnvFile(''); process.env.test='value'; process.env.test2='value2'; process.env.notWhitelistedKey='notWhitelistedValue'; const options = { whitelist: ['test', 'test2'], }; service.generate(options); expect(output).to.equal('module.exports = {\n "test": "value",\n "test2": "value2"\n}'); }); it('should ignore whitelisted values that does not exist in the enviroment', function () { setFileExists('.env', false); mockEnvFile(''); process.env.TEST='value'; const options = { whitelist: ['TEST', 'VALUE_THAT_DOES_NOT_EXIST_IN_THE_ENV'], }; service.generate(options); expect(output).to.equal('module.exports = {\n "TEST": "value"\n}'); }); it('should prioritize values from env over values read from the .env file', function () { setFileExists('.env', true); mockEnvFile('DUPE=valueFromFile\nVALUE_FILE=fileValue'); process.env.DUPE='valueFromProcessEnv'; process.env.ENV_VALUE='envValue'; process.env.notWhitelistedKey='notWhitelistedValue'; const options = { whitelist: ['DUPE', 'ENV_VALUE'], }; service.generate(options); expect(output).to.equal('module.exports = {\n "DUPE": "valueFromProcessEnv",\n "VALUE_FILE": "fileValue",\n "ENV_VALUE": "envValue"\n}'); }); it('should delete the previous output file if it exists', function () { setFileExists('.env', false); setFileExists('config.js', true); service.generate(); expect(unlinkSyncStub.called).to.be.true; }); it('should not attempt to delete the previous output file if it does not exists', function () { setFileExists('.env', false); setFileExists('config.js', false); service.generate(); expect(unlinkSyncStub.called).to.be.false; }); it('should export a json file if the outFile option has a json file extension', function () { setFileExists('.env', false); setFileExists('config.js', false); process.env.TEST='value'; const options = { whitelist: ['TEST'], outFile: 'config.json', }; service.generate(options); expect(output).to.equal('{\n "TEST": "value"\n}'); }); it('should export a json file if the outFile option has a json file extension', function () { setFileExists('.env', false); setFileExists('config.js', false); process.env.TEST='value'; const options = { whitelist: ['TEST'], outFile: 'config.json', }; service.generate(options); expect(output).to.equal('{\n "TEST": "value"\n}'); }); it('should read from the specified readFile path if provided', function () { setFileExists('.mycustomfile', true); setFileExists('config.js', false); mockEnvFile('TEST=value'); const options = { whitelist: ['TEST'], readFile: '.mycustomfile' }; service.generate(options); expect(output).to.equal('module.exports = {\n "TEST": "value"\n}'); }); it('should output a ES6 module if the esm flag is set', function () { setFileExists('.env', false); setFileExists('config.js', false); process.env.TEST = 'value'; const options = { whitelist: ['TEST'], esm: true, }; service.generate(options); expect(output).to.equal('export default {\n "TEST": "value"\n}'); }); });
#!/usr/bin/env bash source ./docker/.env COMMAND="${1:-build}" IMAGE="${2:-slim}" EDITION="${3:-rtm}" VERSION="${4:-latest}" if [[ $IMAGE != "alpine" && $IMAGE != "slim" ]]; then echo "Unsupported image $IMAGE" exit 5 fi if [[ $EDITION != "src" && $EDITION != "rtm" ]]; then echo "Unsupported image $EDITION" exit 5 fi if [[ -z "$VERSION" ]]; then VERSION=$([[ "$EDITION" == "rtm" ]] && echo "v4.34-9745-beta" || echo "5.01.9674") fi dockerfile="docker/dockerfile/sevpn.$EDITION.$IMAGE.Dockerfile" tag="softethervpn:$IMAGE-$EDITION-$VERSION" if [[ $COMMAND == "build" ]]; then docker build -f "$dockerfile" --build-arg VPN_VERSION="$VERSION" -t "$tag" ./docker elif [[ $COMMAND == "up" ]]; then cat <<EOT >docker/dev-vpnserver.env IMAGE=$IMAGE EDITION=$EDITION VERSION=$VERSION EOT docker-compose -f docker/vpnserver-dkc.yml --env-file docker/dev-vpnserver.env up fi
<filename>ruby/URI_1070.rb x = gets.to_i y = 0 while y < 6 do x += 1 if x % 2 == 1 then puts x y += 1 end end
#!/bin/bash # Use nc to create a bidirection link between one IP address/port ${1}:${2} and another ${3}:${4} IP_LEFT=$1 PORT_LEFT=$2 IP_RIGHT=$3 PORT_RIGHT=$4 ESPEC=$5 ISPEC=$6 rm -f fifo* mkfifo fifo-left mkfifo fifo-right nc -4 -k -l ${IP_LEFT} ${PORT_LEFT} < fifo-left | cat > fifo-right & sleep 2 nc -4 ${IP_RIGHT} ${PORT_RIGHT} < fifo-right | cat > fifo-left & sleep 2 N= `ps -ef | grep "nc -4 | grep -v grep | wc -l` if [ $N -ne 2 ] then echo "ERROR: 2 netcat processes should be started, only $N found" else echo "SUCCESS" fi
<gh_stars>1-10 class UpdateEmployer def initialize(repository, address_factory, phone_factory, email_factory, plan_year_factory) @repository = repository @address_factory = address_factory @phone_factory = phone_factory @email_factory = email_factory @plan_year_factory = plan_year_factory end def execute(request) @employer = @repository.find_for_fein(request[:fein]) @request = request @requested_contact = request[:contact] @employer.name = request[:name] unless (request[:name].nil? || request[:name].empty?) @employer.hbx_id = request[:hbx_id] unless (request[:hbx_id].nil? || request[:hbx_id].empty?) @employer.fein = request[:fein] unless (request[:fein].nil? || request[:fein].empty?) @employer.sic_code = request[:sic_code] unless (request[:sic_code].nil? || request[:sic_code].empty?) @employer.notes = request[:notes] unless (request[:notes].nil? || request[:notes].empty?) update_address update_phone update_email update_plan_year update_contact @employer.save! end private def update_address return unless @requested_contact[:address] address = @address_factory.make(@requested_contact[:address]) @employer.merge_address(address) end def update_phone return unless @requested_contact[:phone] phone = @phone_factory.make(@requested_contact[:phone]) @employer.merge_phone(phone) end def update_email return unless @requested_contact[:email] email = @email_factory.make(@requested_contact[:email]) @employer.merge_email(email) end def update_plan_year plan_year = @plan_year_factory.make({ open_enrollment_start: @request[:open_enrollment_start], open_enrollment_end: @request[:open_enrollment_end], start_date: @request[:plan_year_start], end_date: @request[:plan_year_end], plans: @request[:plans], broker_npn: @request[:broker_npn], fte_count: @request[:fte_count], pte_count: @request[:pte_count]}) @employer.merge_plan_year(plan_year) end def update_contact return unless @requested_contact[:name] @employer.update_contact(@request[:contact][:name]) end end
//============================================================================ // Copyright 2009-2018 ECMWF. // This software is licensed under the terms of the Apache Licence version 2.0 // which can be obtained at http://www.apache.org/licenses/LICENSE-2.0. // In applying this licence, ECMWF does not waive the privileges and immunities // granted to it by virtue of its status as an intergovernmental organisation // nor does it submit to any jurisdiction. //============================================================================ #include "ModelColumn.hpp" #include <map> #include <QDebug> #include "DiagData.hpp" #include "VConfig.hpp" #include "VConfigLoader.hpp" #include "VProperty.hpp" #include "VSettingsLoader.hpp" static std::map<std::string,ModelColumn*> defs; ModelColumn::ModelColumn(const std::string& id) : id_(id), diagStart_(-1), diagEnd_(-1) { defs[id_]=this; } ModelColumn* ModelColumn::def(const std::string& id) { std::map<std::string,ModelColumn*>::const_iterator it=defs.find(id); if(it != defs.end()) return it->second; return nullptr; } ModelColumn* ModelColumn::tableModelColumn() { return ModelColumn::def("table_columns"); } //int ModelColumn::indexOf(const std::string& id) const //{ // return indexOf(QString::fromStdString(id)); //} int ModelColumn::indexOf(QString id) const { for(int i=0; i< items_.count(); i++) { if(items_.at(i)->id_ == id) return i; } return -1; } void ModelColumn::loadItem(VProperty *p) { auto* obj=new ModelColumnItem(p->strName()); obj->label_=p->param("label"); obj->tooltip_=p->param("tooltip"); obj->icon_=p->param("icon"); obj->index_=items_.count(); items_ << obj; } void ModelColumn::loadExtraItem(QString name,QString label) { auto* obj=new ModelColumnItem(name.toStdString(),true); obj->label_=label; obj->tooltip_=obj->label_; //obj->icon_=p->param("icon"); obj->index_=items_.count(); obj->editable_=true; if(hasDiag()) { items_.insert(diagStart_,obj); diagStart_++; diagEnd_++; } else { items_ << obj; } } void ModelColumn::loadDiagItem(QString name,QString label) { auto* obj=new ModelColumnItem(name.toStdString(),true); obj->label_=label; obj->tooltip_=obj->label_; //obj->icon_=p->param("icon"); obj->index_=items_.count(); obj->editable_=false; items_ << obj; } void ModelColumn::addExtraItem(QString name,QString label) { if(indexOf(name) != -1) return; //Editable extra items are always inserted in front of the diag items int pos=items_.count(); if(hasDiag()) { pos=diagStart_; Q_ASSERT(pos >=0); } Q_EMIT addItemsBegin(pos,pos); //Q_EMIT appendItemBegin(); loadExtraItem(name,label); //Q_EMIT appendItemEnd(); Q_EMIT addItemsEnd(pos,pos); save(); } void ModelColumn::changeExtraItem(int idx, QString name,QString label) { if(indexOf(name) != -1) return; if(!isExtra(idx) || !isEditable(idx)) return; Q_EMIT changeItemBegin(idx); items_[idx]->id_=name; items_[idx]->label_=label; Q_EMIT changeItemEnd(idx); save(); } void ModelColumn::removeExtraItem(QString name) { int idx=indexOf(name); if(idx != -1 && items_[idx]->isExtra() && items_[idx]->isEditable()) { Q_EMIT removeItemsBegin(idx,idx); ModelColumnItem* obj=items_[idx]; items_.removeAt(idx); delete obj; if(hasDiag()) { diagStart_--; diagEnd_--; Q_ASSERT(diagStart_ >= 0); } Q_EMIT removeItemsEnd(idx,idx); save(); } } bool ModelColumn::isSameDiag(DiagData *diag) const { if(diagStart_ >=0 && diagEnd_ >=0 && diag->count() == diagEnd_-diagStart_+1) { for(int i=diagStart_; i <= diagEnd_; i++) { if(items_[i]->id_ != QString::fromStdString(diag->columnName(i-diagStart_))) { return false; } } return true; } return false; } void ModelColumn::setDiagData(DiagData *diag) { if(isSameDiag(diag)) return; //Remove the current diag items if(diagStart_ >=0 && diagEnd_ >=0) { Q_EMIT removeItemsBegin(diagStart_,diagEnd_); for(int i=diagStart_; i <= diagEnd_; i++) { ModelColumnItem* obj=items_[diagStart_]; items_.removeAt(diagStart_); delete obj; } Q_EMIT removeItemsEnd(diagStart_,diagEnd_); diagStart_=-1; diagEnd_=-1; } //Add the current diag items to the back of the items if(diag->count() <=0) return; diagStart_=items_.count(); diagEnd_=items_.count()+diag->count()-1; Q_ASSERT(diagStart_ >= 0); Q_ASSERT(diagStart_ <= diagEnd_); Q_EMIT addItemsBegin(diagStart_,diagEnd_); for(int i=0; i < diag->count(); i++) { QString n=QString::fromStdString(diag->columnName(i)); loadDiagItem(n,n);// these are not editable items!!! } Q_EMIT addItemsEnd(diagStart_,diagEnd_); } void ModelColumn::save() { if(!configPath_.empty()) { if(VProperty* prop=VConfig::instance()->find(configPath_)) { QStringList lst; for(int i=0; i < items_.count(); i++) { if(items_[i]->isExtra() && items_[i]->isEditable()) lst << items_[i]->id_; } if(lst.isEmpty()) prop->setValue(prop->defaultValue()); else prop->setValue(lst.join("/")); } } } void ModelColumn::load(VProperty* group) { Q_ASSERT(group); auto* m=new ModelColumn(group->strName()); for(int i=0; i < group->children().size(); i++) { VProperty *p=group->children().at(i); m->loadItem(p); } //Define extra config property m->configPath_=group->param("__config__").toStdString(); } //Called via VSettingsLoader after the users settings are read void ModelColumn::loadSettings() { for(auto it=defs.begin(); it != defs.end(); ++it) { it->second->loadUserSettings(); } } //Load user defined settings void ModelColumn::loadUserSettings() { //Load extra config if(!configPath_.empty()) { if(VProperty* p=VConfig::instance()->find(configPath_)) { QString pval=p->valueAsString(); if(!pval.isEmpty() && pval != "__none__") { Q_FOREACH(QString s,pval.split("/")) { loadExtraItem(s,s); } } } } } ModelColumnItem::ModelColumnItem(const std::string& id, bool extra) : id_(QString::fromStdString(id)),index_(-1), extra_(extra), editable_(extra) { } static SimpleLoader<ModelColumn> loaderQuery("query_columns"); static SimpleLoader<ModelColumn> loaderTable("table_columns"); static SimpleLoader<ModelColumn> loaderZombie("zombie_columns"); static SimpleLoader<ModelColumn> loaderTriggerGraph("trigger_graph_columns"); static SimpleLoader<ModelColumn> loaderOutput("output_columns"); static SimpleSettingsLoader<ModelColumn> settingsLoader;
#!/bin/bash # # @file wp_search_replace.sh # # Do a search and replace on a WP database using WP-CLI, including any # serialized data (IMPORTANT!!!). Run from within anywhere in the site itself. # This is most useful for fixing any hardcoded domains that WP creates during # uploads, etc. # # USAGE: wp_search_replace.sh [-n] old_domain.com new_domain.com # # For **Multisite** pass the -n argument, its necessary # # @author @dbsinteractive 2014-11-31 # ####################################################### ####################################################### wp=wp # sometimes root is a good thing #wp="wp --allow-root" [ "$1" == "-n" ] && network=" --network" && shift clear ! which wp > /dev/null && echo wp-cli not installed, aborting. FIXME! && exit 1 ! [ $1 ] && echo 'USAGE: wp_search_replace.sh [-n] old_domain.com new_domain.tld' && exit 1 ! [ $2 ] && echo 'USAGE: wp_search_replace.sh [-n] old_domain.com new_domain.tld' && exit 1 echo Your are about to update a WP database, please have a current backup handy. echo -n Selected database is:\ $wp db query "select database()" |grep -v "database(\|*" || exit 1 echo echo If this is not the correct database, cancel now ctrl-c, and use defined\(\'WP_CLI\'\) echo to select the correct database in wp-config.php. echo Press any key when ready, sir, or ctrl-c to cancel read clear echo Let\'s do a dry run first, OK? Press any key. read $wp search-replace $network $1 $2 --dry-run echo Look OK? If not, ctrl-c to cancel, anything else to give it a go for real this time. read echo running for real now ... sleep 1 $wp search-replace $network $1 $2 echo Done.
<gh_stars>10-100 package chylex.hee.gui.helpers; import gnu.trove.map.hash.TIntObjectHashMap; import org.apache.commons.lang3.BooleanUtils; import cpw.mods.fml.relauncher.Side; import cpw.mods.fml.relauncher.SideOnly; @SideOnly(Side.CLIENT) public final class KeyState{ private static final TIntObjectHashMap<Boolean> keyMap = new TIntObjectHashMap<>(8); public static void startTracking(int keyCode){ keyMap.putIfAbsent(keyCode, Boolean.FALSE); } public static void stopTracking(int keyCode){ keyMap.remove(keyCode); } public static void setState(int keyCode, boolean isHeld){ if (keyMap.contains(keyCode))keyMap.put(keyCode, Boolean.valueOf(isHeld)); } public static boolean isHeld(int keyCode){ return BooleanUtils.isTrue(keyMap.get(keyCode)); } }
# Copyright (c) 2017 Sony Corporation. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import argparse import random import numpy as np import os import sys import nnabla as nn import nnabla.functions as F import nnabla.parametric_functions as PF import nnabla.solvers as S from nnabla.ext_utils import get_extension_context import nnabla.communicators as C from nnabla.monitor import Monitor, MonitorSeries, MonitorTimeElapsed import glob import cv2 from utils import * from models import rrdb_net from utils.lr_scheduler import get_repeated_cosine_annealing_learning_rate, get_multistep_learning_rate from datetime import datetime from utils.util import array_to_image, calculate_psnr from args import get_config # Calculate PSNR and save validation image def val_save(val_gt, val_lq, val_lq_path, idx, epoch, avg_psnr): conf = get_config() sr_img = rrdb_net(val_lq, 64, 23) real_image = array_to_image(val_gt.data) sr_image = array_to_image(sr_img.data) img_name = os.path.splitext( os.path.basename(val_lq_path[idx]))[0] img_dir = os.path.join( conf.val.save_results + "/results", img_name) if not os.path.exists(img_dir): os.makedirs(img_dir) save_img_path = os.path.join( img_dir, '{:s}_{:d}.png'.format(img_name, epoch)) cv2.imwrite(save_img_path, sr_image) crop_size = conf.train.scale cropped_sr_image = sr_image[crop_size:- crop_size, crop_size:-crop_size, :] cropped_real_image = real_image[crop_size:- crop_size, crop_size:-crop_size, :] avg_psnr += calculate_psnr(cropped_sr_image, cropped_real_image) print("validating", img_name) return avg_psnr def main(): conf = get_config() train_gt_path = sorted(glob.glob(conf.DIV2K.gt_train + "/*.png")) train_lq_path = sorted(glob.glob(conf.DIV2K.lq_train + "/*.png")) val_gt_path = sorted(glob.glob(conf.SET14.gt_val + "/*.png")) val_lq_path = sorted(glob.glob(conf.SET14.lq_val + "/*.png")) train_samples = len(train_gt_path) val_samples = len(val_gt_path) lr_g = conf.hyperparameters.lr_g lr_d = conf.hyperparameters.lr_d lr_steps = conf.train.lr_steps random.seed(conf.train.seed) np.random.seed(conf.train.seed) extension_module = conf.nnabla_context.context ctx = get_extension_context( extension_module, device_id=conf.nnabla_context.device_id) comm = CommunicatorWrapper(ctx) nn.set_default_context(comm.ctx) # data iterators for train and val data from data_loader import data_iterator_sr data_iterator_train = data_iterator_sr( train_samples, conf.train.batch_size, train_gt_path, train_lq_path, train=True, shuffle=True) data_iterator_val = data_iterator_sr( val_samples, conf.val.batch_size, val_gt_path, val_lq_path, train=False, shuffle=False) if comm.n_procs > 1: data_iterator_train = data_iterator_train.slice( rng=None, num_of_slices=comm.n_procs, slice_pos=comm.rank) train_gt = nn.Variable( (conf.train.batch_size, 3, conf.train.gt_size, conf.train.gt_size)) train_lq = nn.Variable( (conf.train.batch_size, 3, conf.train.gt_size // conf.train.scale, conf.train.gt_size // conf.train.scale)) # setting up monitors for logging monitor_path = './nnmonitor' + str(datetime.now().strftime("%Y%m%d%H%M%S")) monitor = Monitor(monitor_path) monitor_pixel_g = MonitorSeries( 'l_g_pix per iteration', monitor, interval=100) monitor_val = MonitorSeries( 'Validation loss per epoch', monitor, interval=1) monitor_time = MonitorTimeElapsed( "Training time per epoch", monitor, interval=1) with nn.parameter_scope("gen"): nn.load_parameters(conf.train.gen_pretrained) fake_h = rrdb_net(train_lq, 64, 23) fake_h.persistent = True pixel_loss = F.mean(F.absolute_error(fake_h, train_gt)) pixel_loss.persistent = True gen_loss = pixel_loss if conf.model.esrgan: from esrgan_model import get_esrgan_gen, get_esrgan_dis, get_esrgan_monitors gen_model = get_esrgan_gen(conf, train_gt, train_lq, fake_h) gen_loss = conf.hyperparameters.eta_pixel_loss * pixel_loss + conf.hyperparameters.feature_loss_weight * gen_model.feature_loss + \ conf.hyperparameters.lambda_gan_loss * gen_model.loss_gan_gen dis_model = get_esrgan_dis(fake_h, gen_model.pred_d_real) # Set Discriminator parameters solver_dis = S.Adam(lr_d, beta1=0.9, beta2=0.99) with nn.parameter_scope("dis"): solver_dis.set_parameters(nn.get_parameters()) esr_mon = get_esrgan_monitors() # Set generator Parameters solver_gen = S.Adam(alpha=lr_g, beta1=0.9, beta2=0.99) with nn.parameter_scope("gen"): solver_gen.set_parameters(nn.get_parameters()) train_size = int( train_samples / conf.train.batch_size / comm.n_procs) total_epochs = conf.train.n_epochs start_epoch = 0 current_iter = 0 if comm.rank == 0: print("total_epochs", total_epochs) print("train_samples", train_samples) print("val_samples", val_samples) print("train_size", train_size) for epoch in range(start_epoch + 1, total_epochs + 1): index = 0 # Training loop for psnr rrdb model while index < train_size: if comm.rank == 0: current_iter += comm.n_procs train_gt.d, train_lq.d = data_iterator_train.next() if not conf.model.esrgan: lr_g = get_repeated_cosine_annealing_learning_rate( current_iter, conf.hyperparameters.eta_max, conf.hyperparameters.eta_min, conf.train.cosine_period, conf.train.cosine_num_period) if conf.model.esrgan: lr_g = get_multistep_learning_rate( current_iter, lr_steps, lr_g) gen_model.var_ref.d = train_gt.d gen_model.pred_d_real.grad.zero() gen_model.pred_d_real.forward(clear_no_need_grad=True) gen_model.pred_d_real.need_grad = False # Generator update gen_loss.forward(clear_no_need_grad=True) solver_gen.zero_grad() # All-reduce gradients every 2MiB parameters during backward computation if comm.n_procs > 1: with nn.parameter_scope('gen'): all_reduce_callback = comm.get_all_reduce_callback() gen_loss.backward(clear_buffer=True, communicator_callbacks=all_reduce_callback) else: gen_loss.backward(clear_buffer=True) solver_gen.set_learning_rate(lr_g) solver_gen.update() # Discriminator Upate if conf.model.esrgan: gen_model.pred_d_real.need_grad = True lr_d = get_multistep_learning_rate( current_iter, lr_steps, lr_d) solver_dis.zero_grad() dis_model.l_d_total.forward(clear_no_need_grad=True) if comm.n_procs > 1: with nn.parameter_scope('dis'): all_reduce_callback = comm.get_all_reduce_callback() dis_model.l_d_total.backward( clear_buffer=True, communicator_callbacks=all_reduce_callback) else: dis_model.l_d_total.backward(clear_buffer=True) solver_dis.set_learning_rate(lr_d) solver_dis.update() index += 1 if comm.rank == 0: monitor_pixel_g.add( current_iter, pixel_loss.d.copy()) monitor_time.add(epoch * comm.n_procs) if comm.rank == 0 and conf.model.esrgan: esr_mon.monitor_feature_g.add( current_iter, gen_model.feature_loss.d.copy()) esr_mon.monitor_gan_g.add( current_iter, gen_model.loss_gan_gen.d.copy()) esr_mon.monitor_gan_d.add( current_iter, dis_model.l_d_total.d.copy()) esr_mon.monitor_d_real.add(current_iter, F.mean( gen_model.pred_d_real.data).data) esr_mon.monitor_d_fake.add(current_iter, F.mean( gen_model.pred_g_fake.data).data) # Validation Loop if comm.rank == 0: avg_psnr = 0.0 for idx in range(val_samples): val_gt_im, val_lq_im = data_iterator_val.next() val_gt = nn.NdArray.from_numpy_array(val_gt_im) val_lq = nn.NdArray.from_numpy_array(val_lq_im) with nn.parameter_scope("gen"): avg_psnr = val_save( val_gt, val_lq, val_lq_path, idx, epoch, avg_psnr) avg_psnr = avg_psnr / val_samples monitor_val.add(epoch, avg_psnr) # Save generator weights if comm.rank == 0: if not os.path.exists(conf.train.savemodel): os.makedirs(conf.train.savemodel) with nn.parameter_scope("gen"): nn.save_parameters(os.path.join( conf.train.savemodel, "generator_param_%06d.h5" % epoch)) # Save discriminator weights if comm.rank == 0 and conf.model.esrgan: with nn.parameter_scope("dis"): nn.save_parameters(os.path.join( conf.train.savemodel, "discriminator_param_%06d.h5" % epoch)) if __name__ == "__main__": main()
require_relative 'temp_dir' module Inferno module Terminology module Tasks class CreateValueSetValidators include TempDir attr_reader :minimum_binding_strength, :version, :delete_existing, :type def initialize(minimum_binding_strength:, version:, delete_existing:, type:) @minimum_binding_strength = minimum_binding_strength @version = version @delete_existing = delete_existing != 'false' @type = type.to_sym end def run Loader.register_umls_db db_for_version Loader.load_value_sets_from_directory(Inferno::Terminology::PACKAGE_DIR, true) Loader.create_validators( type: type, minimum_binding_strength: minimum_binding_strength, delete_existing: delete_existing ) end def db_for_version File.join(versioned_temp_dir, 'umls.db') end end end end end
/** * SPDX-License-Identifier: Apache-2.0 */ import PeerGraph from './PeerGraph'; const setup = () => { const props = { peerList: [ { requests: "grpcs://127.0.0.1:7051", server_hostname: "peer0.org1.example.com" }, { requests: "grpcs://127.0.0.1:8051", server_hostname: "peer1.org1.example.com" }, { requests: "grpcs://127.0.0.1:9051", server_hostname: "peer0.org2.example.com" }, { requests: "grpcs://127.0.0.1:10051", server_hostname: "peer1.org2.example.com" } ] } const wrapper = shallow(<PeerGraph {...props} />); return{ props, wrapper } } describe('PeerGraph', () => { test("PeerGraph component should render", () => { const { wrapper } = setup(); expect(wrapper.exists()).toBe(true); }); });
source global.sh download_compile https://ftp.gnu.org/gnu/gdb/gdb-$GDB_VERSION.tar.gz gdb-$GDB_VERSION "--target=i386-elf"
#!/usr/bin/env bash ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --adv_eval --epoch_delay 5 \ --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt g1 ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_input dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --adv_eval --epoch_delay 5 \ --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt g2 ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_both dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --adv_eval --epoch_delay 5 \ --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 169018 cc@sat:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-04-14-04-57-058607111.txt # no adversarial training ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_input dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 71214 cc@icml-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-04-14-11-03-294585424.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_both dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_no_adv_train #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 119881 cc@icml-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-04-14-19-45-778648234.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_no_adv_train #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 113589 cc@wifi:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-04-14-21-24-566295267.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_input dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_no_adv_train_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --adv_eval --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 74651 cc@g-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-02-53-25-778977624.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_both dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_no_adv_train_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --adv_eval --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 66643 cc@g-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-03-00-16-357489616.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_weight dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_no_adv_train_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 75452 cc@sat:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-03-21-57-962498895.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_both dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_no_adv_train_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 73745 cc@f:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-03-25-28-247734754.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_input dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_no_adv_train_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 121227 cc@z:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-03-27-16-250630896.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_both dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_adv_train_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 102368 cc@wifi:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-04-08-31-621040073.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 58848 cc@sat:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-05-37-23-891561239.txt ############### Configurations ######################## PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 6965 cc@z:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-05-36-01-105993017.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 13099 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-10-33-49-546921320.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_both dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_no_adv_train_robust_net_both #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \m --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 100998 -end 29 cc@icml-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-16-40-40-277973375.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_adv_train_vanilla_resnet20 #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \m --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 71337 cc@f:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-16-51-32-572125767.txt cc@f:~/code/bandlimited-cnns/cnns/nnlib/pytorch_architecture$ [1] Done PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} --data_path ${data_path} --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} --epochs ${epochs} --learning_rate 0.1 --optimizer ${optimizer} --schedule 80 120 --gammas 0.1 0.1 --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 --print_freq 100 --decay 0.0003 --momentum 0.9 --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 (wd: ~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code) (wd now: ~/code/bandlimited-cnns/cnns/nnlib/pytorch_architecture) ==>>[2020-02-05 21:58:12] [Epoch=159/160] [Need: 00:01:55] [LR=0.0010][M=0.90] [Best : Accuracy=84.15, Error=15.85] Epoch: [159][000/391] Time 0.492 (0.492) Data 0.199 (0.199) Loss 0.7769 (0.7769) Prec@1 93.750 (93.750) Prec@5 99.219 (99.219) [2020-02-05 21:58:12] Epoch: [159][100/391] Time 0.304 (0.312) Data 0.000 (0.002) Loss 0.7494 (0.7410) Prec@1 88.281 (88.877) Prec@5 100.000 (99.613) [2020-02-05 21:58:43] Epoch: [159][200/391] Time 0.344 (0.300) Data 0.000 (0.001) Loss 0.8205 (0.7450) Prec@1 87.500 (89.043) Prec@5 98.438 (99.677) [2020-02-05 21:59:12] Epoch: [159][300/391] Time 0.327 (0.299) Data 0.000 (0.001) Loss 0.6536 (0.7461) Prec@1 80.469 (88.741) Prec@5 100.000 (99.676) [2020-02-05 21:59:42] **Train** Prec@1 88.730 Prec@5 99.684 Error@1 11.270 **Adversarial Train** Prec@1 53.920 Prec@5 97.768 Error@1 46.080 **Test** Prec@1 83.760 Prec@5 99.270 Error@1 16.240 ---- save figure the accuracy/loss curve of train/val into ./save//cifar10_vanilla_resnet20_160_SGD_train_layerwise_3e-4decay_robust_net/curve.png PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_input dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_no_adv_train_robust_net_input #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 130484 cc@icml-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-18-52-11-960855088.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_robust_net #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 2 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 70468 cc@g-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-19-41-09-712288797.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust # init 0.1 inner 0.1 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_robust_net_adv_train #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 79546 cc@g-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-20-00-18-937669813.txt timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../ nohup /home/${USER}/anaconda3/bin/python3.6 vgg_train.py --paramNoise 0.0 --noiseInit 0.0 --noiseInner 0.0 --net 'vgg16-fft' --compress_rate 85.0 --initializeNoise 0.02 >> ${timestamp}.txt 2>&1 & echo ${timestamp}.txt [1] 4844 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/pytorch_architecture$ echo ${timestamp}.txt 2020-02-05-14-52-24-658630568.txt timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../ nohup /home/${USER}/anaconda3/bin/python3.6 vgg_train.py --paramNoise 0.0 --noiseInit 0.0 --noiseInner 0.0 --net 'vgg16-fft' --compress_rate 80.0 --initializeNoise 0.02 >> ${timestamp}.txt 2>&1 & echo ${timestamp}.txt f 100995 2020-02-05-21-14-46-235774981.txt timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../ nohup /home/${USER}/anaconda3/bin/python3.6 vgg_train.py --paramNoise 0.0 --noiseInit 0.0 --noiseInner 0.0 --net 'vgg16-fft' --compress_rate 70.0 --initializeNoise 0.02 >> ${timestamp}.txt 2>&1 & echo ${timestamp}.txt [3] 101291 cc@f:~/code/bandlimited-cnns/cnns/nnlib/pytorch_architecture$ echo ${timestamp}.txt 2020-02-05-21-15-47-337316762.txt timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../ nohup /home/${USER}/anaconda3/bin/python3.6 vgg_train.py --paramNoise 0.0 --noiseInit 0.0 --noiseInner 0.0 --net 'vgg16-fft' --compress_rate 70.0 --initializeNoise 0.02 >> ${timestamp}.txt 2>&1 & echo ${timestamp}.txt [4] 101366 cc@f:~/code/bandlimited-cnns/cnns/nnlib/pytorch_architecture$ echo ${timestamp}.txt 2020-02-05-21-16-27-074140847.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_robust_net_init_noise_0.15 #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) PYTHONPATH=../../../../../ $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 77816 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-05-21-26-54-710179415.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_adv_train_vanilla_resnet20_plain #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 56312 cc@icml-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-06-05-30-25-346400537.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_adv_train_vanilla_resnet20_plain_no_adv #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 111266 cc@g-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-06-07-47-05-931286438.txt [1] 23458 cc@g-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-06-16-33-52-502708202.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay_adv_train_vanilla_resnet20_plain #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 112258 cc@g-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-06-07-49-34-905649455.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 62743 cc@g-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-06-07-53-56-198637208.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_02 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 62419 cc@g-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-06-07-53-08-232294426.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 120954 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-06-07-56-07-651468314.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_input dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/data/pytorch/cifar10" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 121461 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-06-07-58-23-439637304.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets/tiny-224/" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 137953 cc@g-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-03-38-56-802012326.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets/tiny-224/" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt g2 [2] 138292 cc@g-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-03-39-59-518614900.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=imagenet epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets/tiny-224/" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_02 dataset=imagenet epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets/tiny-224/" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=imagenet epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets/tiny-224/" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=imagenet epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets/tiny-224/" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=imagenet epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets/tiny-64/" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 90458 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-10-11-635161494.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 90645 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-14-39-557431445.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 90825 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-15-13-385413955.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 91994 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-16-37-444371274.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_02 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [4] 92817 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-17-21-435364545.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 78569 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-27-54-835694871.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters=40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 79151 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-29-13-558159540.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 80315 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-30-08-183339905.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_02 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [4] 80658 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-30-27-956193475.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 81609 cc@g-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-36-24-783102383.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 6244 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-08-23-32-29-696181815.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters=40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 82117 cc@g-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-37-38-391999029.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_02 dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 48591 cc@g-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-39-46-508918889.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters=40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 48916 cc@g-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-40-19-667773368.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=stl10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters=40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 52832 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-43-24-525493119.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=stl10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters=40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 52920 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-44-27-931238848.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 78569 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-27-54-835694871.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-100-iters #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters=100 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 53312 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-49-47-737908358.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-100-iters #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters=100 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 54479 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-09-05-52-24-203653053.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-attack-iters-40 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 123446 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-17-24-21-783253335.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_01 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-attack-iters-7 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 7 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 123591 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-17-24-38-313852566.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_013 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-attack-iters-7 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 7 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 34326 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-19-50-26-595321624.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_013 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-attack-iters-7 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 171687 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-19-51-12-835446430.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_013 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-attack-iters-7-adv-train #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 7 --adv_train \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 172810 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-19-53-04-872641562.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_013 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-attack-iters-7-adv-train #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 40 --adv_train \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 173360 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-19-53-40-329671271.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_014 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-roubst-014-no-adv-train #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 63686 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-21-09-46-773395157.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_014 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-roubst-014-no-adv-train #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 40 \ --adv_train \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 20073 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-21-20-08-929333746.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_014 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-roubst-014-no-adv-train #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 100 \ --adv_train \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 20619 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-21-20-44-493891179.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_robust_0-9_0-7 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.09 \ --inner_noise 0.07 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 31204 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-16-11-56-427824622.txt [1] 50935 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-22-13-32-685014413.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_robust_0-08_0-08 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.08 \ --inner_noise 0.08 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 52296 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-22-16-04-193327018.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_robust_0-1_0-09 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.1 \ --inner_noise 0.09 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 53931 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-22-18-15-051988181.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_robust_0-1_0-09 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.08 \ --inner_noise 0.07 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [4] 54476 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-22-18-35-303368930.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_014 dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-roubst-014-no-adv-train #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 40 \ --adv_train \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 183636 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-11-04-25-44-048463992.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_014 dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-roubst-014-no-adv-train-true #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 184099 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-11-04-26-39-189445535.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_robust_0-9_0-7 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 185585 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-11-04-28-01-641968720.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_only #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [4] 186864 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-11-04-29-13-520212968.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_013 dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-roubst-013-adv-train #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 40 \ --adv_train \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 96554 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-11-04-31-58-108970222.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_013 dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-roubst-013-no-adv-train-true #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --attack_iters 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 96706 cc@p:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-11-04-32-19-562397893.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_robust_0-1_0-09 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.1 \ --inner_noise 0.09 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 71933 cc@nips:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-11-04-34-17-796533109.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar100 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train_robust_0-1_0-09 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.1 \ --inner_noise 0.09 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 22472 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-10-22-37-30-279744125.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train_robust-0.07-0.06 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.07 \ --inner_noise 0.06 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 114431 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-12-02-14-58-101825118.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_robust-0.07-0.06 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.07 \ --inner_noise 0.06 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 114820 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-12-02-15-51-126110622.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train_robust-0.05-0.04 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.05 \ --inner_noise 0.04 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 125712 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-12-02-38-49-734586301.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_robust-0.05-0.04 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.05 \ --inner_noise 0.04 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [4] 125856 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-12-02-39-14-445383221.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train_only #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train \ --attack_iters 100 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 88151 cc@i-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-25-15-57-04-273719851.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [4] 88512 cc@i-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-25-15-57-39-228843915.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train_robust_0-14_0-10 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.14 \ --inner_noise 0.10 --adv_train \ --attack_iters 100 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [5] 90499 cc@i-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-25-16-01-22-359838561.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-without-adv-train_plain_robust_0-14_0-10 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.14 \ --inner_noise 0.10 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [6] 91406 cc@i-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-25-16-03-10-170347657.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-train_only #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 86138 cc@i-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-25-17-09-52-069740438.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 86237 cc@i-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-25-17-10-11-386067412.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train_robust-0.07-0.06 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.07 \ --inner_noise 0.06 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 87471 cc@i-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-25-17-11-51-338507251.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-without-adv-train_robust-0.07-0.06 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.07 \ --inner_noise 0.06 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [4] 88092 cc@i-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-25-17-12-25-568371784.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-without-adv-train_robust-0.05-0.04 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.05 \ --inner_noise 0.04 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 27527 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-26-21-31-01-483688075.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-without-adv-train_robust-0.04-0.03 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.04 \ --inner_noise 0.03 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 27661 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-26-21-31-58-096840788.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-without-adv-train_robust-0.03-0.02 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.03 \ --inner_noise 0.02 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 27777 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-26-21-32-38-278049122.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train_robust_0-14_0-10 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.14 \ --inner_noise 0.10 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 8884 cc@rtx:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-02-29-18-53-34-770940567.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train --attack_iters 40 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-without-adv-train_robust-0.04-0.03 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.04 \ --inner_noise 0.03 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 9462 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-01-21-31-27-485749832.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-without-adv-train_robust-0.04-0.03 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.04 \ --inner_noise 0.04 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 158873 cc@i-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-02-03-32-16-704481602.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-without-adv-train_robust-0.03-0.03 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.03 \ --inner_noise 0.03 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 159247 cc@i-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-02-03-33-06-302830089.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train_robust-0.07-0.06 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.07 \ --inner_noise 0.06 --adv_train \ --attack_iters 7 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 160607 cc@i-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-02-03-34-55-754752844.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train_robust-0.08-0.07 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.08 \ --inner_noise 0.07 --adv_train \ --attack_iters 7 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [4] 161556 cc@i-2:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-02-03-35-47-804009354.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=adv-train-0.09-0.08 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.09 \ --inner_noise 0.08 --adv_train \ --attack_iters 7 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 2952 cc@rtx:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-02-03-37-37-294899008.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=adv-train-0.09-0.08 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.09 \ --inner_noise 0.08 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 192870 cc@i-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-02-03-39-10-341006193.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=adv-train-0.08-0.07 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.08 \ --inner_noise 0.07 --adv_train \ --attack_iters 40 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 193327 cc@i-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-02-03-40-29-748117820.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train-0.25-0.21 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.25 \ --inner_noise 0.21 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 195243 cc@i-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-02-03-43-45-118528090.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train-0.3-0.2 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.3 \ --inner_noise 0.2 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [4] 195598 cc@i-1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-02-03-44-38-792221701.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=adv-train-0.08-0.07 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.08\ --inner_noise 0.07 --adv_train \ --attack_iters 7 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 17097 cc@rtx:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-03-17-52-43-686410941.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.03-0.02 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.03 \ --inner_noise 0.02 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 22511 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-03-11-59-03-207700069.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.02-0.01 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.02 \ --inner_noise 0.01 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 14028 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-04-11-23-31-285120306.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=adv-train-0.07-0.06 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.07 \ --inner_noise 0.06 --adv_train \ --attack_iters 7 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 34523 cc@rtx:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-04-17-28-15-091439370.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.08-0.07 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.08 \ --inner_noise 0.07 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 10730 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-04-14-42-18-135400803.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.09-0.08 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.09 \ --inner_noise 0.08 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 18056 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-05-19-53-35-772051178.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.09-0.08 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.09 \ --inner_noise 0.08 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 99000 cc@m-3:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-06-03-20-54-406689261.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.1-0.09 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.1 \ --inner_noise 0.09 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 101138 cc@m-3:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-06-03-29-25-885235788.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 19729 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-18-22-11-23-453104281.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 13460 cc@rtx:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-19-03-12-50-034552005.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.08-0.07 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.08 \ --inner_noise 0.07 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 19729 ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-18-22-11-23-453104281.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.08-0.07 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.08 \ --inner_noise 0.07 \ --attack_strengths 0.0 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 159439 cc@i:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-19-04-18-38-012564140.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=adv-train_robust-0.08-0.07 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.08 \ --inner_noise 0.07 \ --attack_strengths 0.031 \ --adv_train \ --attack_iters 7 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 160024 cc@i:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-19-04-20-12-960935239.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [3] 161680 cc@i:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-19-04-22-24-078882321.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_weight dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=3 PYTHONPATH=../../../../../ nohup $PYTHON main.py --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.09-0.08 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.09 \ --inner_noise 0.08 \ --attack_strengths 0.0 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 6776 cc@rtx:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-19-16-04-22-388666599.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.1-0.09 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --init_noise 0.1 \ --inner_noise 0.09 \ --attack_strengths 0.0 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 31104 cc@rtx:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-19-22-42-15-543433057.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no-adv-train_robust-0.2-0.1 #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --init_noise 0.2 \ --inner_noise 0.1 \ --attack_strengths 0.0 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 43363 cc@rtx:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-03-20-01-24-37-190837110.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=no_adv_train_vanilla_pure #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --init_noise 0.0 \ --inner_noise 0.0 \ --attack_strengths 0.0 \ --attack_iters 0 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 95043 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-04-01-19-30-34-938456390.txt PYTHON="/home/${USER}/anaconda3/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=vanilla_resnet20 dataset=svhn epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=2 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment PYTHON='python' enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.2-0.1-laplace #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'laplace' \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 19042 (abs) ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-04-30-21-58-55-598796642.txt PYTHON='python' PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.2-0.1-laplace #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'laplace' \ --init_noise 0.2 \ --inner_noise 0.1 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 20372 (abs) ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-04-30-22-27-42-215337499.txt PYTHON='python' # PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.2-0.1-laplace #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'laplace' \ --init_noise 0.2 \ --inner_noise 0.1 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 48714 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-01-03-34-27-764514292.txt mosh cc@129.114.109.80 PYTHON='python' # PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.2-0.1-gauss #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'gauss' \ --init_noise 0.2 \ --inner_noise 0.1 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 6176 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-01-03-46-30-811341935.txt mosh cc@129.114.109.80 PYTHON='python' # PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train-0.2-0.1-laplace #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --noise_type 'laplace' \ --init_noise 0.2 \ --inner_noise 0.1 \ --limit_batch_number 0 \ --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt cat train_2020-05-01-03-33-04-837271633.txt cc@129.114.108.196 8809 cat train_2020-05-01-03-56-22-104907395.txt PYTHON='python' # PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train-0.2-0.1-gauss #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --noise_type 'gauss' \ --init_noise 0.2 \ --inner_noise 0.1 \ --limit_batch_number 0 \ --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt cc@129.114.108.196 [1] 9346 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-01-03-57-40-173017453.txt PYTHON='python' # PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train-0.2-0.1-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --noise_type 'uniform' \ --init_noise 0.2 \ --inner_noise 0.1 \ --limit_batch_number 0 \ --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 32490 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-01-04-00-11-980826924.txt 129.114.109.205 PYTHON='python' # PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.2-0.1-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.2 \ --inner_noise 0.1 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 32601 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-01-04-00-31-640335413.txt 129.114.109.205 # PYTHON='python' PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train-0.2-0.1-laplace #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --noise_type 'laplace' \ --init_noise 0.2 \ --inner_noise 0.1 \ --limit_batch_number 0 \ --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 4936 (abs) ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-04-30-23-06-56-149173140.txt PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-adv-train-0.15-0.1-laplace #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --noise_type 'laplace' \ --init_noise 0.15 \ --inner_noise 0.1 \ --limit_batch_number 0 \ --adv_train \ --attack_strengths 0.031 \ --attack_iters 7 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt PYTHON='python' # PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.15-0.1-laplace #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'laplace' \ --init_noise 0.15 \ --inner_noise 0.1 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 21470 cc@iclr:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-01-15-58-25-282431600.txt # PYTHON='python' PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.17-0.09-laplace #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'laplace' \ --init_noise 0.17 \ --inner_noise 0.09 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 6357 (abs) ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-01-11-00-45-221321170.txt PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.25-0.15-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.25 \ --inner_noise 0.15 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 32210 (abs) ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-03-10-43-46-487040710.txt PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment PYTHON='python' enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.20-0.16-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.20 \ --inner_noise 0.16 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 41438 cc@iclr:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-03-15-53-50-609959192.txt # PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment PYTHON='python' enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.3-0.15-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.3 \ --inner_noise 0.15 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 32583 cc@iclr:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-05-00-53-13-784249285.txt 129.114.108.241 PYTHON='python' enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.3-0.2-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.3 \ --inner_noise 0.2 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 33184 cc@iclr:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-05-00-55-03-592820804.txt 129.114.108.241 PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.25-0.20-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.25 \ --inner_noise 0.20 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 3808 (base) ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-04-19-57-27-883190580.txt PYTHON='python' enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.3-0.25-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.3 \ --inner_noise 0.25 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 9549 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-05-01-04-40-695554020.txt 129.114.109.80 PYTHON='python' enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.3-0.3-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.3 \ --inner_noise 0.3 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [2] 9906 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-05-01-05-37-887306655.txt cc@129.114.109.80 PYTHON='python' enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.35-0.3-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.35 \ --inner_noise 0.3 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt cc@129.114.109.80 [1] 47295 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-05-03-04-47-774546927.txt PYTHON='python' enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.4-0.3-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=1 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.4 \ --inner_noise 0.3 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt cc@129.114.109.80 [2] 2863 cc@icml:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-05-03-17-37-095230986.txt PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.4-0.4-uniform #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'uniform' \ --init_noise 0.4 \ --inner_noise 0.4 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 26048 (base) ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-04-22-19-57-526786769.txt # PYTHON='python' PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-0.22-0.0-gauss #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'gauss' \ --init_noise 0.22 \ --inner_noise 0.0 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 16860 (abs) ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-10-15-33-59-432930458.txt PYTHON="/home/${USER}/anaconda3/envs/abs/bin/python" # python environment enable_tb_display=false # enable tensorboard display model=noise_resnet20_robust_no_grad dataset=cifar10 epochs=160 batch_size=128 optimizer=SGD # add more labels as additional info into the saving path label_info=train_layerwise_3e-4decay-no-adv-0.2-0.1-gauss-no-grad #dataset path data_path="/home/${USER}/code/bandlimited-cnns/cnns/nnlib/datasets" timestamp=$(date +%Y-%m-%d-%H-%M-%S-%N) CUDA_VISIBLE_DEVICES=0 PYTHONPATH=../../../../../ nohup $PYTHON main.py \ --dataset ${dataset} \ --data_path ${data_path} \ --arch ${model} \ --save_path ./save/${DATE}/${dataset}_${model}_${epochs}_${optimizer}_${label_info} \ --epochs ${epochs} \ --learning_rate 0.1 \ --optimizer ${optimizer} \ --schedule 80 120 \ --gammas 0.1 0.1 \ --batch_size ${batch_size} --workers 4 --ngpu 1 --gpu_id 0 \ --print_freq 100 --decay 0.0003 --momentum 0.9 \ --epoch_delay 5 \ --attack_strengths 0.0 \ --attack_iters 0 \ --noise_type 'gauss' \ --init_noise 0.2 \ --inner_noise 0.1 \ --limit_batch_number 0 \ >> train_${timestamp}.txt 2>&1 & echo train_${timestamp}.txt [1] 14739 (abs) ady@skr-compute1:~/code/bandlimited-cnns/cnns/nnlib/robustness/pni/code$ echo train_${timestamp}.txt train_2020-05-20-22-09-40-446365138.txt
public boolean search(Node root, int x) { if (root==null) return false; if (root.val == x) return true; // Then recur on left sutree boolean res1 = search(root.left, x); // Now recur on right subtree boolean res2 = search(root.right, x); return res1 || res2; }
<filename>src/PGTA/include/PGTA/akPGTAContext.inl #ifndef AK_PGTA_CPP_H #error "donut include pls" #endif namespace PGTA { PGTAContext::PGTAContext(HPGTAContext context): m_pgtaContext(context) { } PGTAContext::PGTAContext(const PGTAContext& other): m_pgtaContext(other.m_pgtaContext) { } PGTAContext::~PGTAContext() { } PGTABuffer PGTAContext::Update(const float deltaSeconds) { return pgtaUpdate(m_pgtaContext, deltaSeconds); } PGTABuffer PGTAContext::GetOutputBuffer() { return pgtaGetOutputBuffer(m_pgtaContext); } void PGTAContext::BindTrack(HPGTATrack track) { pgtaBindTrack(m_pgtaContext, track); } void PGTAContext::Transition(HPGTATrack track, const float percentAmount, const float durationSeconds) { pgtaTransition(m_pgtaContext, track, percentAmount, durationSeconds); } }
#!/bin/bash projectId=$1 reportId=$2 authToken=$3 reportOptions=$4 ############################################################################### # Call the script to collect the data and generate the report # This script will create a zip file containing the viewable file # combined with another zip file that contains all report artifacts for # download. Since this is executed from the tomcat/bin directory we need to # use REPORTDIR to get the location of this shell script since the script is # relative to that. ############################################################################### REPORTDIR="$( cd "$( dirname "${BASH_SOURCE[0]}" )" >/dev/null 2>&1 && pwd )" python3 ${REPORTDIR}/create_report.py -pid $projectId -rid $reportId -authToken $authToken -reportOpts "$reportOptions"
<reponame>n-paukov/swengine<filename>sources/Game/Core/GameApplication.cpp #include "GameApplication.h" #include <spdlog/spdlog.h> #include <glm/gtx/string_cast.hpp> #include <Engine/Exceptions/EngineRuntimeException.h> #include <Engine/Modules/Graphics/Resources/SkeletonResourceManager.h> #include <Engine/Utility/files.h> #include "Game/Screens/GameScreen.h" #include "Game/Screens/MainMenuScreen.h" #include "Game/Screens/MainMenuSettingsScreen.h" #include "Game/Inventory/InventoryUI.h" #include "Game/Dynamic/DialoguesUI.h" #include "Game/Saving/SavingSystem.h" #include "Game/Game.h" GameApplication::GameApplication(int argc, char* argv[]) : BaseGameApplication(argc, argv, "Game") { } GameApplication::~GameApplication() { } void GameApplication::render() { } void GameApplication::load() { auto resourceMgr = m_resourceManagementModule->getResourceManager(); resourceMgr->loadResourcesMapFile("../resources/resources.xml"); resourceMgr->loadResourcesMapFile("../resources/game/resources.xml"); m_gameWorld->registerComponentBinderFactory<ActorComponent>( std::make_shared<GameObjectsComponentsGenericBindersFactory<ActorComponent, ActorComponentBinder>>()); m_gameWorld->registerComponentBinderFactory<InventoryComponent>( std::make_shared<GameObjectsComponentsGenericBindersFactory<InventoryComponent, InventoryComponentBinder, GameObjectsComponentsBinderInjectParameters::GameWorld>>(m_gameWorld)); m_gameWorld->registerComponentBinderFactory<InventoryItemComponent>( std::make_shared<GameObjectsComponentsGenericBindersFactory<InventoryItemComponent, InventoryItemComponentBinder, GameObjectsComponentsBinderInjectParameters::ResourcesManager>>(resourceMgr)); m_gameWorld->registerComponentBinderFactory<PlayerComponent>( std::make_shared<GameObjectsComponentsGenericBindersFactory<PlayerComponent, PlayerComponentBinder>>()); m_componentsLoader = std::make_unique<GameComponentsLoader>(m_gameWorld, resourceMgr); m_levelsManager->getObjectsLoader().registerGenericComponentLoader("player", [this](const pugi::xml_node& data) { return m_componentsLoader->loadPlayerData(data); }); m_levelsManager->getObjectsLoader().registerGenericComponentLoader("inventory_item", [this](const pugi::xml_node& data) { return m_componentsLoader->loadInventoryItemData(data); }); m_levelsManager->getObjectsLoader().registerGenericComponentLoader("inventory", [this](const pugi::xml_node& data) { return m_componentsLoader->loadInventoryData(data); }); m_levelsManager->getObjectsLoader().registerGenericComponentLoader("interactive", [this](const pugi::xml_node& data) { return m_componentsLoader->loadInteractiveData(data); }); m_levelsManager->getObjectsLoader().registerGenericComponentLoader("actor", [this](const pugi::xml_node& data) { return m_componentsLoader->loadActorData(data); }); auto gameScreen = std::make_shared<GameScreen>(m_inputModule, getGameApplicationSystemsGroup(), m_levelsManager, m_graphicsScene, m_guiSystem); m_screenManager->registerScreen(gameScreen); auto mainMenuGUILayout = m_guiSystem->loadScheme( FileUtils::getGUISchemePath("screen_main_menu")); m_screenManager->registerScreen(std::make_shared<MainMenuScreen>( m_inputModule, mainMenuGUILayout, m_gameConsole)); auto mainMenuSettingsGUILayout = m_guiSystem->loadScheme( FileUtils::getGUISchemePath("screen_main_menu_settings")); m_screenManager->registerScreen(std::make_shared<MainMenuSettingsScreen>(mainMenuSettingsGUILayout)); GUIWidgetStylesheet commonStylesheet = m_guiSystem->loadStylesheet( FileUtils::getGUISchemePath("common.stylesheet")); m_screenManager->getCommonGUILayout()->applyStylesheet(commonStylesheet); std::shared_ptr deferredAccumulationPipeline = std::make_shared<GLShadersPipeline>( resourceMgr->getResource<GLShader>("deferred_accum_pass_vertex_shader"), resourceMgr->getResource<GLShader>("deferred_accum_pass_fragment_shader"), std::optional<ResourceHandle<GLShader>>()); m_graphicsModule->getGraphicsContext()->setupDeferredAccumulationMaterial(deferredAccumulationPipeline); m_engineGameSystems->addGameSystem(std::make_shared<SavingSystem>(m_levelsManager, gameScreen->getGame())); m_gameWorld->subscribeEventsListener<ScreenSwitchEvent>(this); m_screenManager->changeScreen(BaseGameScreen::getScreenName(GameScreenType::MainMenu)); } void GameApplication::unload() { m_componentsLoader.reset(); m_gameWorld->unsubscribeEventsListener<ScreenSwitchEvent>(this); } EventProcessStatus GameApplication::receiveEvent(const ScreenSwitchEvent& event) { if (event.newScreen->getName() == "Game") { m_engineGameSystems->getGameSystem<SkeletalAnimationSystem>()->setActive(true); m_engineGameSystems->getGameSystem<PhysicsSystem>()->setActive(true); m_renderingSystemsPipeline->setActive(true); m_gameApplicationSystems->setActive(true); } else { if (m_renderingSystemsPipeline->isActive()) { m_engineGameSystems->getGameSystem<SkeletalAnimationSystem>()->setActive(false); m_engineGameSystems->getGameSystem<PhysicsSystem>()->setActive(false); m_renderingSystemsPipeline->setActive(false); m_gameApplicationSystems->setActive(false); } } return EventProcessStatus::Processed; }
<gh_stars>1-10 var mtg = {}; mtg.search = function (name, cb, fail) { $.ajax({ "url": "https://api.magicthegathering.io/v1/cards", "data": { name: name } }).done(function (data) { console.log(data.cards); cb(data.cards); }).fail(function (err) { fail(err); }); }; mtg.get_counter_class = function (counter) { switch (Math.abs(counter.val)) { case 1: return "fi-die-one"; case 2: return "fi-die-two"; case 3: return "fi-die-three"; case 4: return "fi-die-four"; case 5: return "fi-die-five"; case 6: return "fi-die-six"; default: console.error('Dont know which class for ', counter.val); break; } }; mtg.get_counters = function (a_card) { var counters = []; if (a_card.counters) { for (var i = 0; i < a_card.counters.length; i++) { var curr = a_card.counters[i]; var c_class = mtg.get_counter_class(curr); if (curr.is_pos) { counters.push("<li><i class='counter pos " + c_class + "'></i></li>"); } else { counters.push("<li><i class='counter neg " + c_class + "'></i></li>"); } } } return counters.join(""); }; mtg.get_card = function (a_card) { var the_card = $("<a class='card'>" + "<ul class='counters'>" + mtg.get_counters(a_card) + "</ul>" + "<img src='" + a_card.imageUrl + "'/>" + "</a>"); if (a_card.is_tapped) { the_card.addClass("card-tapped"); } return $("<li></li>").append(the_card); }; mtg.make_hand = function (cards) { var hand = $("<ul class='hand'>"); for (var i = 0; i < cards.length; i++) { var curr = cards[i]; hand.append(mtg.get_card(curr)); } return hand.wrap("<div class='playingCards'>"); };
const icons_disabled = { "16": "/assets/icons-disabled/16.png", "19": "/assets/icons-disabled/19.png", "32": "/assets/icons-disabled/32.png", "64": "/assets/icons-disabled/64.png", "128": "/assets/icons-disabled/128.png" } const icons_enabled = { "16": "/assets/icons/16.png", "19": "/assets/icons/19.png", "32": "/assets/icons/32.png", "64": "/assets/icons/64.png", "128": "/assets/icons/128.png" } chrome.runtime.onMessage.addListener((request, sender, sendResponse) => { if(request=="isDev") { chrome.management.getSelf(self => { sendResponse(self.installType=="development"); }); } return true; // VERY IMPORTANT TO RETURN TRUE HERE. Because of asynchronous sendResponse. }); /** * Fires when the active tab in a window changes. * Note that the tab's URL may not be set at the time this event fired, * but you can listen to onUpdated events so as to be notified when a URL is * https://developer.chrome.com/docs/extensions/reference/tabs/#event-onActivated */ chrome.tabs.onActivated.addListener(function(activeInfo) { chrome.tabs.query({active: true}, function(tab) { updateIcon(tab.url); }); }); /** * Fired when a tab is updated. * https://developer.chrome.com/docs/extensions/reference/tabs/#event-onUpdated * We need to tell the tab that the URL has changed because the content script doesn't always automatically reload. */ chrome.tabs.onUpdated.addListener(function(tabId, changeInfo, tab) { if (changeInfo.url) { chrome.tabs.sendMessage(tabId, "url_changed"); updateIcon(changeInfo.url); } }); /** * Change the popup icon based on the current URL * @param {string} url */ function updateIcon(url) { if(!url) return; const icons = url.match(/amazon.*\/s/) ? icons_enabled : icons_disabled; chrome.browserAction.setIcon({ path : icons }); }
<reponame>huangjianqin/bigdata package org.kin.distributelock; import io.lettuce.core.RedisClient; import io.lettuce.core.RedisURI; import io.lettuce.core.api.StatefulRedisConnection; import io.lettuce.core.api.sync.RedisCommands; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import java.time.Duration; import java.time.temporal.ChronoUnit; import java.util.concurrent.TimeUnit; import java.util.concurrent.locks.Condition; /** * 支持阻塞锁和超时锁+进程故障会自动释放锁(利用超时实现) * Created by 健勤 on 2017/5/23. */ public class RedisDistributeLock implements DistributeLock { private static final Logger log = LoggerFactory.getLogger(RedisDistributeLock.class); //每轮锁请求的间隔 private static final long LOCK_REQUEST_DURATION = 50; //阻塞锁的最大超时时间 private static final long MAX_TIMEOUT = Integer.MAX_VALUE; //请求的锁名字 private final String lockName; //redis服务器的host和port private final String host; private final int port; //redis客户端连接 private RedisClient redisClient; private StatefulRedisConnection<String, String> connection; //表示该锁是否被锁上 private volatile long lockedThreadId; public RedisDistributeLock(String host, String lockName) { this(host, 6379, lockName); } public RedisDistributeLock(String host, int port, String lockName) { this.host = host; this.port = port; this.lockName = lockName; } /** * 初始化锁 * 初始化redis客户端 */ @Override public void init() { RedisURI redisUri = RedisURI.builder() .withHost(host) .withPort(port) .withTimeout(Duration.of(10, ChronoUnit.SECONDS)) .build(); redisClient = RedisClient.create(redisUri); connection = redisClient.connect(); } /** * 销毁锁 * 关闭redis客户端 */ @Override public void destroy() { connection.close(); redisClient.shutdown(); } /** * 获得锁的封装方法 * 阻塞式和超时锁都基于该方法获得锁 */ private Boolean requestLock(boolean isBlock, Long time, TimeUnit unit) { long start = System.currentTimeMillis(); //阻塞时一直尝试获得锁 //超时锁时判断获得锁的过程是否超时 while ((isBlock || System.currentTimeMillis() - start < unit.toMillis(time))) { Thread currentThread = Thread.currentThread(); RedisCommands<String, String> redisCommands = connection.sync(); long now = System.currentTimeMillis(); //如果没有进程获得锁,redis上并没有这个key,setnx就会返回1,当前进程就可以获得锁 if (redisCommands.setnx(lockName, now + "," + (isBlock ? MAX_TIMEOUT : unit.toMillis(time)))) { log.debug(currentThread.getName() + "命中锁"); lockedThreadId = currentThread.getId(); return true; } //否则,判断持有锁的进程是否超时,若是超时,则抢占锁 else { String v = redisCommands.get(lockName); if (v != null) { long expireTime = Long.parseLong(v.split(",")[1]); long lockedTime = Long.parseLong(v.split(",")[0]); /** * 该锁超时,尝试抢占 * 对于阻塞式锁,超时时间 = MAX_TIMEOUT,一般值比较大,很难会超时 * * 这里会存在一个问题,假设两个进程同时判断锁超时 * 一个进程先获得锁,那么另外一个进程就会通过下面逻辑尝试获得锁 * 但是该进程执行了getset命令,该锁的值已经不是获得锁的进程设置的值 * 如果获得锁的进程正常释放,问题并不大,但是如果该进程挂了 * 那么锁真正的超时时间就长了 */ if (now - lockedTime > expireTime) { //尝试抢占,并校验锁有没被其他进程抢占了,也就是key对应的value改变了 String ov = redisCommands.getset(lockName, now + "," + (isBlock ? MAX_TIMEOUT : unit.toMillis(time))); if (ov != null && ov.equals(v)) { //设置成功, 并返回原来的value, 抢占成功 log.debug(currentThread.getName() + "命中锁"); lockedThreadId = currentThread.getId(); return true; } } } } //睡眠一会再重试 try { Thread.sleep(LOCK_REQUEST_DURATION); } catch (InterruptedException e) { } } return false; } /** * 阻塞式获得锁 */ @Override public void lock() { //阻塞 requestLock(true, null, null); } /** * 可中断阻塞获得锁 */ @Override public void lockInterruptibly() throws InterruptedException { //没经严格测试 if (Thread.interrupted()) { throw new InterruptedException(); } lock(); } /** * 尝试一次去获得锁,并返回结果 */ @Override public boolean tryLock() { long now = System.currentTimeMillis(); RedisCommands<String, String> redisCommands = connection.sync(); return redisCommands.setnx(lockName, now + "," + MAX_TIMEOUT); } /** * 超时尝试获得锁,超时后返回是否获得锁 */ @Override public boolean tryLock(long time, TimeUnit unit) { return requestLock(false, time, unit); } /** * 释放锁 * 也就是删除lockName的key */ @Override public void unlock() { Thread currentThread = Thread.currentThread(); if (currentThread.getId() == lockedThreadId) { log.debug(currentThread.getName() + "释放锁"); /** * 先释放锁, 再删除key, 不然会存在以下情况: * A进程: 删除key, 但仍没有释放锁 * B进程: 获取了分布式锁并设置锁 * A进程: 释放锁状态 * 待B进程要释放锁时, 却无法执行删除key的逻辑, 导致死锁 */ lockedThreadId = 0; RedisCommands<String, String> redisCommands = connection.sync(); redisCommands.del(lockName); } } /** * 不支持 */ @Override public Condition newCondition() { throw new UnsupportedOperationException("DistributedLock Base on Redis don't support now"); } }
#!/bin/bash #------------------------------------------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See https://go.microsoft.com/fwlink/?linkid=2090316 for license information. #------------------------------------------------------------------------------------------------------------- # # Docs: https://github.com/microsoft/vscode-dev-containers/blob/main/script-library/docs/node.md # Maintainer: The VS Code and Codespaces Teams # # Syntax: ./node-debian.sh [directory to install nvm] [node version to install (use "none" to skip)] [non-root user] [Update rc files flag] export NVM_DIR=${1:-"/usr/local/share/nvm"} export NODE_VERSION=${2:-"lts/*"} USERNAME=${3:-"automatic"} UPDATE_RC=${4:-"true"} set -e if [ "$(id -u)" -ne 0 ]; then echo -e 'Script must be run as root. Use sudo, su, or add "USER root" to your Dockerfile before running this script.' exit 1 fi # Ensure that login shells get the correct path if the user updated the PATH using ENV. rm -f /etc/profile.d/00-restore-env.sh echo "export PATH=${PATH//$(sh -lc 'echo $PATH')/\$PATH}" > /etc/profile.d/00-restore-env.sh chmod +x /etc/profile.d/00-restore-env.sh # Determine the appropriate non-root user if [ "${USERNAME}" = "auto" ] || [ "${USERNAME}" = "automatic" ]; then USERNAME="" POSSIBLE_USERS=("vscode" "node" "codespace" "$(awk -v val=1000 -F ":" '$3==val{print $1}' /etc/passwd)") for CURRENT_USER in ${POSSIBLE_USERS[@]}; do if id -u ${CURRENT_USER} > /dev/null 2>&1; then USERNAME=${CURRENT_USER} break fi done if [ "${USERNAME}" = "" ]; then USERNAME=root fi elif [ "${USERNAME}" = "none" ] || ! id -u ${USERNAME} > /dev/null 2>&1; then USERNAME=root fi if [ "${NODE_VERSION}" = "none" ]; then export NODE_VERSION= fi function updaterc() { if [ "${UPDATE_RC}" = "true" ]; then echo "Updating /etc/bash.bashrc and /etc/zsh/zshrc..." echo -e "$1" >> /etc/bash.bashrc if [ -f "/etc/zsh/zshrc" ]; then echo -e "$1" >> /etc/zsh/zshrc fi fi } # Ensure apt is in non-interactive to avoid prompts export DEBIAN_FRONTEND=noninteractive # Install curl, apt-transport-https, tar, or gpg if missing if ! dpkg -s apt-transport-https curl ca-certificates tar > /dev/null 2>&1 || ! type gpg > /dev/null 2>&1; then if [ ! -d "/var/lib/apt/lists" ] || [ "$(ls /var/lib/apt/lists/ | wc -l)" = "0" ]; then apt-get update fi apt-get -y install --no-install-recommends apt-transport-https curl ca-certificates tar gnupg2 fi # Install yarn if type yarn > /dev/null 2>&1; then echo "Yarn already installed." else curl -sS https://dl.yarnpkg.com/debian/pubkey.gpg | (OUT=$(apt-key add - 2>&1) || echo $OUT) echo "deb https://dl.yarnpkg.com/debian/ stable main" | tee /etc/apt/sources.list.d/yarn.list apt-get update apt-get -y install --no-install-recommends yarn fi # Install the specified node version if NVM directory already exists, then exit if [ -d "${NVM_DIR}" ]; then echo "NVM already installed." if [ "${NODE_VERSION}" != "" ]; then su ${USERNAME} -c ". $NVM_DIR/nvm.sh && nvm install ${NODE_VERSION} && nvm clear-cache" fi exit 0 fi # Create nvm group, nvm dir, and set sticky bit if ! cat /etc/group | grep -e "^nvm:" > /dev/null 2>&1; then groupadd -r nvm fi umask 0002 usermod -a -G nvm ${USERNAME} mkdir -p ${NVM_DIR} chown :nvm ${NVM_DIR} chmod g+s ${NVM_DIR} su ${USERNAME} -c "$(cat << EOF set -e umask 0002 # Do not update profile - we'll do this manually export PROFILE=/dev/null curl -so- https://raw.githubusercontent.com/nvm-sh/nvm/v0.35.3/install.sh | bash source ${NVM_DIR}/nvm.sh if [ "${NODE_VERSION}" != "" ]; then nvm alias default ${NODE_VERSION} fi nvm clear-cache EOF )" 2>&1 # Update rc files if [ "${UPDATE_RC}" = "true" ]; then updaterc "$(cat <<EOF export NVM_DIR="${NVM_DIR}" [ -s "\$NVM_DIR/nvm.sh" ] && . "\$NVM_DIR/nvm.sh" [ -s "\$NVM_DIR/bash_completion" ] && . "\$NVM_DIR/bash_completion" EOF )" fi echo "Done!"
#!/bin/bash # LICENSE UPL 1.0 # # Copyright (c) 1982-2019 Oracle and/or its affiliates. All rights reserved. # # Since: January, 2019 # Author: paramdeep.saini@oracle.com # Description: Cleanup the $GRID_HOME and ORACLE_BASE after Grid confguration in the image # # DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS HEADER. # # Image Cleanup Script source /home/grid/.bashrc rm -rf /u01/app/grid/* rm -rf $GRID_HOME/log rm -rf $GRID_HOME/logs rm -rf $GRID_HOME/crs/init rm -rf $GRID_HOME/crs/install/rhpdata rm -rf $GRID_HOME/crs/log rm -rf $GRID_HOME/racg/dump rm -rf $GRID_HOME/srvm/log rm -rf $GRID_HOME/cv/log rm -rf $GRID_HOME/cdata rm -rf $GRID_HOME/bin/core* rm -rf $GRID_HOME/bin/diagsnap.pl rm -rf $GRID_HOME/cfgtoollogs/* rm -rf $GRID_HOME/network/admin/listener.ora rm -rf $GRID_HOME/crf rm -rf $GRID_HOME/ologgerd/init rm -rf $GRID_HOME/osysmond/init rm -rf $GRID_HOME/ohasd/init rm -rf $GRID_HOME/ctss/init rm -rf $GRID_HOME/dbs/.*.dat rm -rf $GRID_HOME/oc4j/j2ee/home/log rm -rf $GRID_HOME/inventory/Scripts/ext/bin/log rm -rf $GRID_HOME/inventory/backup/* rm -rf $GRID_HOME/mdns/init rm -rf $GRID_HOME/gnsd/init rm -rf $GRID_HOME/evm/init rm -rf $GRID_HOME/gipc/init rm -rf $GRID_HOME/gpnp/gpnp_bcp.* rm -rf $GRID_HOME/gpnp/init rm -rf $GRID_HOME/auth rm -rf $GRID_HOME/tfa rm -rf $GRID_HOME/suptools/tfa/release/diag rm -rf $GRID_HOME/rdbms/audit/* rm -rf $GRID_HOME/rdbms/log/* rm -rf $GRID_HOME/network/log/* rm -rf $GRID_HOME/inventory/Scripts/comps.xml.* rm -rf $GRID_HOME/inventory/Scripts/oraclehomeproperties.xml.* rm -rf $GRID_HOME/inventory/Scripts/oraInst.loc.* rm -rf $GRID_HOME/inventory/Scripts/inventory.xml.* rm -rf $GRID_HOME/log_file_client.log
#!/usr/bin/env bash readonly BASEDIR=$(readlink -f $(dirname $0))/../../../ PRIORITY=normal function run_app(){ cd $BASEDIR/src/app/voltdb/voltdb_src/bin ./voltdb init unset LD_PRELOAD CXLMALLOC=$BASEDIR/lib/smdk_allocator/lib/libcxlmalloc.so export LD_PRELOAD=$CXLMALLOC CXLMALLOC_CONF=use_exmem:true,exmem_zone_size:16384,normal_zone_size:16384,maxmemory_policy:remain if [ "$PRIORITY" == 'exmem' ]; then CXLMALLOC_CONF+=,priority:exmem,: elif [ "$PRIORITY" == 'normal' ]; then CXLMALLOC_CONF+=,priority:normal,: fi export CXLMALLOC_CONF echo $CXLMALLOC_CONF ./voltdb start } while getopts ":ena" opt; do case "$opt" in e) PRIORITY='exmem' ;; n) PRIORITY='normal' ;; a) run_app ;; :) echo "Usage: $0 [-e | -n] -a" esac done
#/bin/bash/ # to use particles2grid, it has to be compiled by running python setup.py build_ext # check first that the name of the file particle2grid is well in setup.py.
package bootcamp.mercado.config.exception; import org.springframework.context.MessageSource; import org.springframework.validation.FieldError; import java.util.List; import java.util.stream.Collectors; public class FieldErrorListResponse { List<FieldErrorResponse> errors; public FieldErrorListResponse(List<FieldError> errors, MessageSource messageSource) { this.errors = errors.stream() .map(i -> { return new FieldErrorResponse(i, messageSource); }) .collect(Collectors.toList()); } public List<FieldErrorResponse> getErrors() { return errors; } }
import sys from pyspark import SparkConf from collections import namedtuple from pyspark.sql import SparkSession#, SparkContext from lib.logger import Log4j # create schema. Can also define a class and use it to define the schema. However name tuple is more convenient SurveyRecord = namedtuple("SurveyRecord", ["Age", "Gender", "Country", "State"]) if __name__ == "__main__": conf = SparkConf()\ .setMaster('local[3]')\ .setAppName('MyFirstRDD') #spark context to create the RDD, without SparkSession #context = SparkContext(conf=conf) # better use SparkContext, which is a higher level object, from which we spark = SparkSession.builder.config(conf=conf).getOrCreate() context = spark.sparkContext # set up logger logger = Log4j(spark) # check cmd argument if len(sys.argv) != 2: logger.error("Usage: my_RDD <filename>") sys.exit(-1) #create RDD linesRDD = context.textFile(sys.argv[1]) # RDD basic transformation partitionedRDD = linesRDD.repartition(2) colsRDD = partitionedRDD.map(lambda line: line.replace('"','').split(",")) # separate col from each line and map to a list selectRDD = colsRDD.map(lambda cols: SurveyRecord(int(cols[1]), cols[2], cols[3],cols[4])) filteredRDD = selectRDD.filter(lambda r: r.Age<40) KeyValueRDD = filteredRDD.map(lambda r: (r.Country, 1)) #map countRDD = KeyValueRDD.reduceByKey(lambda v1, v2: v1 +v2) #reduce colsList = countRDD.collect() for x in colsList: logger.info(x)
module.exports = async (d) => { const data = d.util.aoiFunc(d); const [shardId = 0] = data.inside.splits; if (isNaN(shardId)) return d.aoiError.fnError( d, "custom", { inside: data.inside }, "Invalid ShardId Provided In", ); data.result = await d.client.shard.broadcastEval((c) => c.ws.ping, { shard: Number(shardId), }); return { code: d.util.setCode(data), }; };
#!/bin/sh ############################################################################### # Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ############################################################################### # If unspecified, the hostname of the container is taken as the JobManager address JOB_MANAGER_RPC_ADDRESS=${JOB_MANAGER_RPC_ADDRESS:-$(hostname -f)} CONF_FILE="${FLINK_HOME}/conf/flink-conf.yaml" drop_privs_cmd() { if [ $(id -u) != 0 ]; then # Don't need to drop privs if EUID != 0 return elif [ -x /sbin/su-exec ]; then # Alpine echo su-exec flink else # Others echo gosu flink fi } if [ "$1" = "help" ]; then echo "Usage: $(basename "$0") (jobmanager|taskmanager|help)" exit 0 elif [ "$1" = "jobmanager" ]; then shift 1 echo "Starting Job Manager" if grep -E "^jobmanager\.rpc\.address:.*" "${CONF_FILE}" > /dev/null; then sed -i -e "s/jobmanager\.rpc\.address:.*/jobmanager.rpc.address: ${JOB_MANAGER_RPC_ADDRESS}/g" "${CONF_FILE}" else echo "jobmanager.rpc.address: ${JOB_MANAGER_RPC_ADDRESS}" >> "${CONF_FILE}" fi if grep -E "^blob\.server\.port:.*" "${CONF_FILE}" > /dev/null; then sed -i -e "s/blob\.server\.port:.*/blob.server.port: 6124/g" "${CONF_FILE}" else echo "blob.server.port: 6124" >> "${CONF_FILE}" fi if grep -E "^query\.server\.port:.*" "${CONF_FILE}" > /dev/null; then sed -i -e "s/query\.server\.port:.*/query.server.port: 6125/g" "${CONF_FILE}" else echo "query.server.port: 6125" >> "${CONF_FILE}" fi if [ -n "${FLINK_PROPERTIES}" ]; then echo "${FLINK_PROPERTIES}" >> "${CONF_FILE}" fi envsubst < "${CONF_FILE}" > "${CONF_FILE}.tmp" && mv "${CONF_FILE}.tmp" "${CONF_FILE}" echo "config file: " && grep '^[^\n#]' "${CONF_FILE}" exec $(drop_privs_cmd) "$FLINK_HOME/bin/jobmanager.sh" start-foreground "$@" elif [ "$1" = "taskmanager" ]; then shift 1 echo "Starting Task Manager" TASK_MANAGER_NUMBER_OF_TASK_SLOTS=${TASK_MANAGER_NUMBER_OF_TASK_SLOTS:-$(grep -c ^processor /proc/cpuinfo)} if grep -E "^jobmanager\.rpc\.address:.*" "${CONF_FILE}" > /dev/null; then sed -i -e "s/jobmanager\.rpc\.address:.*/jobmanager.rpc.address: ${JOB_MANAGER_RPC_ADDRESS}/g" "${CONF_FILE}" else echo "jobmanager.rpc.address: ${JOB_MANAGER_RPC_ADDRESS}" >> "${CONF_FILE}" fi if grep -E "^taskmanager\.numberOfTaskSlots:.*" "${CONF_FILE}" > /dev/null; then sed -i -e "s/taskmanager\.numberOfTaskSlots:.*/taskmanager.numberOfTaskSlots: ${TASK_MANAGER_NUMBER_OF_TASK_SLOTS}/g" "${CONF_FILE}" else echo "taskmanager.numberOfTaskSlots: ${TASK_MANAGER_NUMBER_OF_TASK_SLOTS}" >> "${CONF_FILE}" fi if grep -E "^blob\.server\.port:.*" "${CONF_FILE}" > /dev/null; then sed -i -e "s/blob\.server\.port:.*/blob.server.port: 6124/g" "${CONF_FILE}" else echo "blob.server.port: 6124" >> "${CONF_FILE}" fi if grep -E "^query\.server\.port:.*" "${CONF_FILE}" > /dev/null; then sed -i -e "s/query\.server\.port:.*/query.server.port: 6125/g" "${CONF_FILE}" else echo "query.server.port: 6125" >> "${CONF_FILE}" fi if [ -n "${FLINK_PROPERTIES}" ]; then echo "${FLINK_PROPERTIES}" >> "${CONF_FILE}" fi envsubst < "${CONF_FILE}" > "${CONF_FILE}.tmp" && mv "${CONF_FILE}.tmp" "${CONF_FILE}" echo "config file: " && grep '^[^\n#]' "${CONF_FILE}" exec $(drop_privs_cmd) "$FLINK_HOME/bin/taskmanager.sh" start-foreground "$@" fi exec "$@"
<reponame>pertsenga/shards3d require "shards3d/version" require "stl" require "geo3d" class Shards3d attr_reader :stl, :max_x, :max_y, :max_z def initialize(stl_file) @stl_faces = STL.read(stl_file) # gem doesn't work exactly as stated on its doc @max_x, @max_y, @max_z = [800, 800, 800] end def max_dimensions @stl.faces end def slice(increment = 0.1) # milimeters slicer = Slicer.new(max_x, max_y, max_z, increment) # slice here end end
def get_divisors(n): divisors_list = [] for i in range(2, n): if n % i == 0: divisors_list.append(i) return divisors_list if __name__ == '__main__': print (get_divisors(6)) # Output [2, 3]
<reponame>yiminghe/babel-loose-runtime var slice = Array.prototype.slice; module.exports = function _extends(to) { var from = slice.call(arguments, 1); from.forEach(function t(f) { if (f && typeof (f) === 'object') { Object.keys(f).forEach(function tt(k) { to[k] = f[k]; }); } }); return to; };
<reponame>vadi2/codeql class ElemIterator implements Iterator<MyElem>, Iterable<MyElem> { private MyElem[] data; private idx = 0; public boolean hasNext() { return idx < data.length; } public MyElem next() { return data[idx++]; } public Iterator<MyElem> iterator() { return this; } // ... } void useMySequence(Iterable<MyElem> s) { // do some work by traversing the sequence for (MyElem e : s) { // ... } // do some more work by traversing it again for (MyElem e : s) { // ... } }
<filename>example/pages/setOptions.tsx import type { NextPage } from 'next' import { Box } from '@fower/react' import { Form, useForm } from 'fomir-react' import { request } from '@peajs/request' const Home: NextPage = () => { const form = useForm({ onSubmit(values) { console.log('values', values) }, children: [ { component: 'Select', label: 'Todos', name: 'todo', value: '', async onFieldInit() { const todos = await request('https://jsonplaceholder.typicode.com/todos') form.setFieldState('todo', { options: todos.map((i) => ({ label: i.title, value: i.id, })), }) }, }, { component: 'Submit', text: 'submit', }, ], }) return ( <Box p-100> <Form form={form} /> </Box> ) } export default Home
mv /etc/resolv.conf /etc/resolv.conf.backup echo "search ${vcnFQDN} ${privateBSubnetsFQDN} ${privateSubnetsFQDN} ${privateProtocolSubnetFQDN}" > /etc/resolv.conf echo "nameserver 169.254.169.254" >> /etc/resolv.conf if [ -z /etc/oci-hostname.conf ]; then echo "PRESERVE_HOSTINFO=2" > /etc/oci-hostname.conf else # https://docs.cloud.oracle.com/iaas/Content/Network/Tasks/managingDHCP.htm#notes sed -i "s/^PRESERVE_HOSTINFO/#PRESERVE_HOSTINFO/g" /etc/oci-hostname.conf echo "PRESERVE_HOSTINFO=2" >> /etc/oci-hostname.conf fi # not be overwritten by dhclient chattr +i /etc/resolv.conf
import * as yup from 'yup'; import HelpOrder from '../models/HelpOrder'; import Student from '../models/Student'; class HelpOrderController { async index(req, res) { const { page } = req.query; const { student_id } = req.params; const student = await Student.findByPk(student_id); if (!student) { return res.status(401).json({ error: 'Aluno não encontrado!' }); } const helpOrders = await HelpOrder.findAll({ where: { student_id }, attributes: ['id', 'question', 'answer', 'answer_at', 'created_at'], order: [['created_at', 'desc']], limit: 10, offset: ((page && page > 0 ? page : 1) - 1) * 10 }); return res.json(helpOrders); } async store(req, res) { const { student_id } = req.params; const student = await Student.findByPk(student_id); if (!student) { return res.status(401).json({ error: 'Aluno não encontrado!' }); } const schema = yup.object().shape({ question: yup.string().required('Informe sua dúvida') }); try { await schema.validate(req.body); } catch (err) { return res.status(400).json({ error: err.message }); } req.body.student_id = +student_id; const { id, question, created_at } = await HelpOrder.create(req.body); return res.json({ id, question, created_at }); } } export default new HelpOrderController();
#!/bin/sh api_base="https://api.github.com/repos" # Function to take 2 git tags/commits and get any lines from commit messages # that contain something that looks like a PR reference: e.g., (#1234) sanitised_git_logs(){ git --no-pager log --pretty=format:"%s" "$1...$2" | # Only find messages referencing a PR grep -E '\(#[0-9]+\)' | # Strip any asterisks sed 's/^* //g' | # And add them all back sed 's/^/* /g' } # Returns the last published release on github # Note: we can't just use /latest because that ignores prereleases # repo: 'organization/repo' # Usage: last_github_release "$repo" last_github_release(){ i=0 # Iterate over releases until we find the last release that's not just a draft while [ $i -lt 29 ]; do out=$(curl -H "Authorization: token $GITHUB_RELEASE_TOKEN" -s "$api_base/$1/releases" | jq ".[$i]") echo "$out" # Ugh when echoing to jq, we need to translate newlines into spaces :/ if [ "$(echo "$out" | tr '\r\n' ' ' | jq '.draft')" = "false" ]; then echo "$out" | tr '\r\n' ' ' | jq '.tag_name' return else i=$((i + 1)) fi done } # Checks whether a tag on github has been verified # repo: 'organization/repo' # tagver: 'v1.2.3' # Usage: check_tag $repo $tagver check_tag () { repo=$1 tagver=$2 tag_out=$(curl -H "Authorization: token $GITHUB_RELEASE_TOKEN" -s "$api_base/$repo/git/refs/tags/$tagver") tag_sha=$(echo "$tag_out" | jq -r .object.sha) object_url=$(echo "$tag_out" | jq -r .object.url) if [ "$tag_sha" = "null" ]; then return 2 fi verified_str=$(curl -H "Authorization: token $GITHUB_RELEASE_TOKEN" -s "$object_url" | jq -r .verification.verified) if [ "$verified_str" = "true" ]; then # Verified, everything is good return 0 else # Not verified. Bad juju. return 1 fi } # Checks whether a given PR has a given label. # repo: 'organization/repo' # pr_id: 12345 # label: B1-silent # Usage: has_label $repo $pr_id $label has_label(){ repo="$1" pr_id="$2" label="$3" # These will exist if the function is called in Gitlab. # If the function's called in Github, we should have GITHUB_ACCESS_TOKEN set # already. if [ -n "$GITHUB_RELEASE_TOKEN" ]; then GITHUB_TOKEN="$GITHUB_RELEASE_TOKEN" elif [ -n "$GITHUB_PR_TOKEN" ]; then GITHUB_TOKEN="$GITHUB_PR_TOKEN" fi out=$(curl -H "Authorization: token $GITHUB_TOKEN" -s "$api_base/$repo/pulls/$pr_id") [ -n "$(echo "$out" | tr -d '\r\n' | jq ".labels | .[] | select(.name==\"$label\")")" ] } # Formats a message into a JSON string for posting to Matrix # message: 'any plaintext message' # formatted_message: '<strong>optional message formatted in <em>html</em></strong>' # Usage: structure_message $content $formatted_content (optional) structure_message() { if [ -z "$2" ]; then body=$(jq -Rs --arg body "$1" '{"msgtype": "m.text", $body}' < /dev/null) else body=$(jq -Rs --arg body "$1" --arg formatted_body "$2" '{"msgtype": "m.text", $body, "format": "org.matrix.custom.html", $formatted_body}' < /dev/null) fi echo "$body" } # Post a message to a matrix room # body: '{body: "JSON string produced by structure_message"}' # room_id: !fsfSRjgjBWEWffws:matrix.parity.io # access_token: see https://matrix.org/docs/guides/client-server-api/ # Usage: send_message $body (json formatted) $room_id $access_token send_message() { curl -XPOST -d "$1" "https://matrix.parity.io/_matrix/client/r0/rooms/$2/send/m.room.message?access_token=$3" }
class AddProducts < ActiveRecord::Migration def change Product.create!( title: "Margarita", description: "This is Margarit's pizza", price: 120, size: 30, is_spicy: false, is_veg: false, is_best_offer: true, path_to_image: "/images/margarita.jpeg" ) Product.create!( title: "Assorti", description: "This is Assorti pizza", price: 420, size: 30, is_spicy: true, is_veg: false, is_best_offer: false, path_to_image: "/images/assorti.jpg" ) Product.create!( title: "Vegetarian", description: "Amazing Vegetarian pizza", price: 320, size: 30, is_spicy: true, is_veg: true, is_best_offer: false, path_to_image: "/images/veg.jpeg" ) end end
#!/bin/bash # Test Pip install/uninstall works okay sudo pip install -i https://testpypi.python.org/pypi pyresttest # Test installed if [ -f '/usr/local/bin/resttest.py' ]; then echo "Runnable script installed okay" else echo "ERROR: Runnable script DID NOT install okay" fi if [ -d '/usr/local/lib/python2.7/dist-packages/pyresttest/' ]; then echo "Library install okay" else echo "ERROR: Library install DID NOT install okay" fi # Test script runs resttest.py https://github.com ../simple_test.yaml if [$? -ne 0]; then echo 'ERROR: Runnable script failed to execute okay testing GitHub query' fi # Test uninstall is clean sudo pip uninstall -y pyresttest if [ -f '/usr/local/bin/resttest.py' ]; then echo "ERROR: Runnable script for resttest.py did non uninstall" else echo "Runnable script uninstalled okay" fi if [ -d '/usr/local/lib/python2.7/dist-packages/pyresttest/' ]; then echo "ERROR: Library install DID NOT uninstall okay" else echo "Library uninstall okay" fi
import java.util.HashSet; public class UniqueGUIComponentsCounter { public static int countUniqueGUIComponents(String guiCode) { String[] components = guiCode.split(";"); HashSet<String> uniqueComponents = new HashSet<>(); for (String component : components) { String[] parts = component.trim().split("\\s+"); if (parts.length > 2 && parts[1].equals("javax.swing")) { uniqueComponents.add(parts[2]); } } return uniqueComponents.size(); } public static void main(String[] args) { String guiCode = "private javax.swing.JPanel jPanel1; private javax.swing.JButton jButton1; private javax.swing.JTextField jTextField1; private javax.swing.JLabel jLabel1;"; System.out.println(countUniqueGUIComponents(guiCode)); // Output: 4 } }
<reponame>pomali/priznanie-digital<gh_stars>1-10 import { validate } from '../src/pages/hypoteka' import { testValidation } from './utils/testValidation' describe('hypoteka', () => { describe('#validate', () => { testValidation(validate, [ { input: { r037_uplatnuje_uroky: undefined }, expected: ['r037_uplatnuje_uroky'], }, { input: { r037_uplatnuje_uroky: false }, expected: [] }, { input: { r037_uplatnuje_uroky: true }, expected: ['r037_zaplatene_uroky', 'r037_pocetMesiacov'], }, { input: { r037_uplatnuje_uroky: true, r037_zaplatene_uroky: 'a', r037_pocetMesiacov: 'b', }, expected: ['r037_zaplatene_uroky', 'r037_pocetMesiacov'], }, { input: { r037_uplatnuje_uroky: true, r037_zaplatene_uroky: '10', r037_pocetMesiacov: '20', }, expected: ['r037_pocetMesiacov'], }, { input: { r037_uplatnuje_uroky: true, r037_zaplatene_uroky: '10', r037_pocetMesiacov: '12', }, expected: [], }, ]) }) })
#!/bin/bash #SBATCH -J Act_sigmoid_1 #SBATCH --mail-user=eger@ukp.informatik.tu-darmstadt.de #SBATCH --mail-type=FAIL #SBATCH -e /work/scratch/se55gyhe/log/output.err.%j #SBATCH -o /work/scratch/se55gyhe/log/output.out.%j #SBATCH -n 1 # Number of cores #SBATCH --mem-per-cpu=2000 #SBATCH -t 23:59:00 # Hours, minutes and seconds, or '#SBATCH -t 10' -only mins #module load intel python/3.5 python3 /home/se55gyhe/Act_func/progs/meta.py sigmoid 1 RMSprop 2 0.5394407940012951 293 0.0005872644578229275 varscaling PE-infersent
# Given a file name, this program creates 5 figures using xmgrace: # 1. A plot of the NRIXS and resolution raw data # 2. A plot of the peak subtraction # 3. A plot of the phonon density of states (PDOS) # 4. A plot of the PDOS integrated over energy # 5. A zoomed-in plot of the PDOS integral # INPUT parameter FILE_NAME="Fe_Murphy_P10" # PLOT 1: NRIXS # ------------- INPUTFILE_DAT="../../$FILE_NAME.dat" INPUTFILE_RES="../../$FILE_NAME.res" OUTPUTFILE_NRIXS="../NRIXS_$FILE_NAME.ps" PDFFILE_NRIXS="../NRIXS_$FILE_NAME.pdf" BATCHFILE_NRIXS="NRIXS.bfile" # Change NRIXS batchfile # awk (use the awk program) # -v VAR1=$INPUTFILE_DAT (allows shell variable VAR1 to be passed to awk) # '/READ XYDY/ {$3 = VAR1} {print $0}' (Find the line containing READ XYDY and replace # the third word on the line with VAR1) # Then do a funny dance to properly save the new file awk -v VAR1=\"$INPUTFILE_RES\" '/READ XY/ {$3 = VAR1} {print $0}' $BATCHFILE_NRIXS > input_file.tmp && mv input_file.tmp $BATCHFILE_NRIXS awk -v VAR1=\"$INPUTFILE_DAT\" '/READ XYDY/ {$3 = VAR1} {print $0}' $BATCHFILE_NRIXS > input_file.tmp && mv input_file.tmp $BATCHFILE_NRIXS awk -v VAR1=\"$OUTPUTFILE_NRIXS\" '/PRINT TO/ {$3 = VAR1} {print $0}' $BATCHFILE_NRIXS > input_file.tmp && mv input_file.tmp $BATCHFILE_NRIXS # Create the postscript file xmgrace -batch NRIXS.bfile -nosafe -hardcopy # Convert postscript file to pdf pstopdf $OUTPUTFILE_NRIXS # Eliminate whitespace around pdf (pdfcrop input.pdf output.pdf, overrides file) pdfcrop $PDFFILE_NRIXS $PDFFILE_NRIXS # Delete postscript file to keep clutter down rm $OUTPUTFILE_NRIXS # PLOT 2: Resolution Peak Subtraction # ----------------------------------- INPUTFILE_PSN="../../Output/$FILE_NAME\_psn.dat" OUTPUTFILE_PSN="../PeakSub_$FILE_NAME.ps" PDFFILE_PSN="../PeakSub_$FILE_NAME.pdf" BATCHFILE_PSN="PeakSub.bfile" # Change PeakSub batchfile awk -v VAR1=\"$INPUTFILE_PSN\" '/READ XYDY/ {$3 = VAR1} {print $0}' $BATCHFILE_PSN > input_file.tmp && mv input_file.tmp $BATCHFILE_PSN awk -v VAR1=\"$OUTPUTFILE_PSN\" '/PRINT TO/ {$3 = VAR1} {print $0}' $BATCHFILE_PSN > input_file.tmp && mv input_file.tmp $BATCHFILE_PSN # Create the postscript file xmgrace -batch PeakSub.bfile -nosafe -hardcopy # Convert postscript file to pdf pstopdf $OUTPUTFILE_PSN # Eliminate whitespace around pdf (pdfcrop input.pdf output.pdf, overrides file) pdfcrop $PDFFILE_PSN $PDFFILE_PSN # Delete postscript file to keep clutter down rm $OUTPUTFILE_PSN # PLOT 3: Phonon Density of States # ----------------------------------- INPUTFILE_PDOS="../../Output/$FILE_NAME\_dos.dat" OUTPUTFILE_PDOS="../PDOS_$FILE_NAME.ps" PDFFILE_PDOS="../PDOS_$FILE_NAME.pdf" BATCHFILE_PDOS="PDOS.bfile" # Change PeakSub batchfile awk -v VAR1=\"$INPUTFILE_PDOS\" '/READ XYDY/ {$3 = VAR1} {print $0}' $BATCHFILE_PDOS > input_file.tmp && mv input_file.tmp $BATCHFILE_PDOS awk -v VAR1=\"$OUTPUTFILE_PDOS\" '/PRINT TO/ {$3 = VAR1} {print $0}' $BATCHFILE_PDOS > input_file.tmp && mv input_file.tmp $BATCHFILE_PDOS # Create the postscript file xmgrace -batch PDOS.bfile -nosafe -hardcopy # Convert postscript file to pdf pstopdf $OUTPUTFILE_PDOS # Eliminate whitespace around pdf (pdfcrop input.pdf output.pdf, overrides file) pdfcrop $PDFFILE_PDOS $PDFFILE_PDOS # Delete postscript file to keep clutter down rm $OUTPUTFILE_PDOS # PLOT 4: Integrated PDOS wrt Energy # ---------------------------------- INPUTFILE_INTPDOS="../../Output/$FILE_NAME\_dos.dat" OUTPUTFILE_INTPDOS="../IntPDOS_$FILE_NAME.ps" PDFFILE_INTPDOS="../IntPDOS_$FILE_NAME.pdf" BATCHFILE_INTPDOS="IntPDOS.bfile" # Change PeakSub batchfile awk -v VAR1=\"$INPUTFILE_INTPDOS\" '/READ XY/ {$3 = VAR1} {print $0}' $BATCHFILE_INTPDOS > input_file.tmp && mv input_file.tmp $BATCHFILE_INTPDOS awk -v VAR1=\"$OUTPUTFILE_INTPDOS\" '/PRINT TO/ {$3 = VAR1} {print $0}' $BATCHFILE_INTPDOS > input_file.tmp && mv input_file.tmp $BATCHFILE_INTPDOS # Create the postscript file xmgrace -batch IntPDOS.bfile -nosafe -hardcopy # Convert postscript file to pdf pstopdf $OUTPUTFILE_INTPDOS # Eliminate whitespace around pdf (pdfcrop input.pdf output.pdf, overrides file) pdfcrop $PDFFILE_INTPDOS $PDFFILE_INTPDOS # Delete postscript file to keep clutter down rm $OUTPUTFILE_INTPDOS # PLOT 5: Zoomed integrated PDOS wrt Energy # ----------------------------------------- INPUTFILE_INTPDOSZOOM="../../Output/$FILE_NAME\_dos.dat" OUTPUTFILE_INTPDOSZOOM="../IntPDOSZoom_$FILE_NAME.ps" PDFFILE_INTPDOSZOOM="../IntPDOSZoom_$FILE_NAME.pdf" BATCHFILE_INTPDOSZOOM="IntPDOSZoom.bfile" # Change PeakSub batchfile awk -v VAR1=\"$INPUTFILE_INTPDOSZOOM\" '/READ XY/ {$3 = VAR1} {print $0}' $BATCHFILE_INTPDOSZOOM > input_file.tmp && mv input_file.tmp $BATCHFILE_INTPDOSZOOM awk -v VAR1=\"$OUTPUTFILE_INTPDOSZOOM\" '/PRINT TO/ {$3 = VAR1} {print $0}' $BATCHFILE_INTPDOSZOOM > input_file.tmp && mv input_file.tmp $BATCHFILE_INTPDOSZOOM # Create the postscript file xmgrace -batch IntPDOSZoom.bfile -nosafe -hardcopy # Convert postscript file to pdf pstopdf $OUTPUTFILE_INTPDOSZOOM # Eliminate whitespace around pdf (pdfcrop input.pdf output.pdf, overrides file) pdfcrop $PDFFILE_INTPDOSZOOM $PDFFILE_INTPDOSZOOM # Delete postscript file to keep clutter down rm $OUTPUTFILE_INTPDOSZOOM
#!/bin/bash -ev # # Installation Script # Written by: Tommy Lincoln <pajamapants3000@gmail.com> # Github: https://github.com/pajamapants3000 # Legal: See LICENSE in parent directory # # # Dependencies #************** # Begin Required #gtk+-3.16.6 # End Required # Begin Recommended #gobject_introspection-1.44.0 # End Recommended # Begin Optional #vala-0.28.1 #glade #gtk_doc-1.24 # End Optional # Begin Kernel # End Kernel # # Installation #************** # Check for previous installation: PROCEED="yes" REINSTALL=0 grep gtksourceview-3.16.1 /list-$CHRISTENED"-"$SURNAME > /dev/null && ((\!$?)) &&\ REINSTALL=1 && echo "Previous installation detected, proceed?" && read PROCEED [ $PROCEED = "yes" ] || [ $PROCEED = "y" ] || exit 0 # Download: wget http://ftp.gnome.org/pub/gnome/sources/gtksourceview/3.16/gtksourceview-3.16.1.tar.xz # FTP/alt Download: #wget ftp://ftp.gnome.org/pub/gnome/sources/gtksourceview/3.16/gtksourceview-3.16.1.tar.xz # # md5sum: echo "e727db8202d23a54b54b69ebc66f5331 gtksourceview-3.16.1.tar.xz" | md5sum -c ;\ ( exit ${PIPESTATUS[0]} ) # tar -xvf gtksourceview-3.16.1.tar.xz cd gtksourceview-3.16.1 ./configure --prefix=/usr make # Test (must be in graphical environment): make check # as_root make install cd .. as_root rm -rf gtksourceview-3.16.1 # # Add to installed list for this computer: echo "gtksourceview-3.16.1" >> /list-$CHRISTENED"-"$SURNAME # ###################################################
package zdebug import ( "fmt" "testing" ) func TestPrintStack(t *testing.T) { func() { PrintStack() }() } func TestLoc(t *testing.T) { func() { fmt.Println(Loc(0)) fmt.Println(Loc(1)) fmt.Println(Loc(2)) }() }
<reponame>JasonLiu798/javautil package com.atjl.dbservice.util; import com.atjl.common.constant.CommonConstant; import com.atjl.dbservice.api.domain.DataCpConfig; import com.atjl.util.character.StringCheckUtil; import com.atjl.util.character.StringUtil; import com.atjl.util.collection.CollectionUtil; import java.util.ArrayList; import java.util.HashMap; import java.util.List; import java.util.Map; public class DataFilterUtil { /** * 内存过滤重复数据 */ public static List<Map> filterDuplicate(DataCpConfig config, List<Map> l) { if (CollectionUtil.isEmpty(l)) { return l; } List<Map> res = new ArrayList<>(); Map<String, Map> noDuplicateMap = new HashMap<>(); for (Map item : l) { String pk = DataFieldUtil.getPkValues(item, config); Map existItem = noDuplicateMap.get(pk); if (existItem != null) { if (config.getRawDataDuplicateCheck().keepWhich(existItem, item)) { item = existItem; } } noDuplicateMap.put(pk, item); } for (Map.Entry<String, Map> entry : noDuplicateMap.entrySet()) { res.add(entry.getValue()); } return res; } public static boolean loadTmDftChecker(Map raw, Map tgt) { String rawStr = StringUtil.getEmptyString(raw.get("load_tm")); String tgtStr = StringUtil.getEmptyString(tgt.get("LOAD_TM")); if (rawStr.compareTo(tgtStr) <= 0) {//原始表值 小于 目标表值,不更新 return false; } return true; } public static boolean isModifyChecker(Map tgt) { String modify = StringUtil.getEmptyString(tgt.get("IS_MODIFY")); if (StringCheckUtil.equal(modify, CommonConstant.YES)) { return false; } return true; } public static boolean isAllEqual(Map<String, String> pkMapping, Map raw, Map tgt) { List<Boolean> result = new ArrayList<>(); for (Map.Entry<String, String> entry : pkMapping.entrySet()) { boolean find = false; if (StringCheckUtil.equal(String.valueOf(raw.get(entry.getKey())), String.valueOf(tgt.get(entry.getValue())))) { find = true; } result.add(find); } boolean existNotEqual = false; for (Boolean r : result) { if (!r) { existNotEqual = true; } } return !existNotEqual; } /** * 过滤 load_tm 小于等于的 * public static boolean canUpdate(Map rawData, Map tgtData, DbTableTransferConfig config) { Map<String, String> cols = config.getNoUpdateCheckMapping(); if (CollectionUtil.isEmpty(cols)) { return true; } for (Map.Entry<String, String> fc : cols.entrySet()) { String rawCol = fc.getKey(); String tgtCol = fc.getValue(); String rawStr = StringUtil.getEmptyString(rawData.get(rawCol)); String tgtStr = StringUtil.getEmptyString(tgtData.get(tgtCol)); if (rawStr.compareTo(tgtStr) <= 0) {//原始表值 小于 目标表值,不更新 return false; } } return true; }*/ }
#!/bin/bash failed_any=0 diff_output_and_report() { diff $1 $2 >/dev/null if [ $? != 0 ]; then printf "\t\x1b[31m%s\x1b[0m\n" "FAILED test $3!" failed_any=1 else printf "\tPASSED test $3!\n" fi } diff_output_and_report2() { diff $1 $3 >/dev/null if [ $? != 0 ]; then printf "\t\x1b[31m%s\x1b[0m\n" "FAILED test $5!" else diff $2 $4 >/dev/null if [ $? != 0 ]; then printf "\t\x1b[31m%s\x1b[0m\n" "FAILED test $5!" failed_any=1 else printf "\tPASSED test $5!\n" fi fi } print_test_header() { echo "Testing..." $1 } print_test_header "search for sequences using the different regex engines" ../fxtract CAAAGGGATTGAGACGCCACTT 1.fa > 1.output.fa diff_output_and_report 1.output.fa 1.expected.fa 1a ../fxtract -G CAAAGGGATTGAGACGCCACTT 1.fa > 1.output.fa diff_output_and_report 1.output.fa 1.expected.fa 1b ../fxtract -E CAAAGGGATTGAGACGCCACTT 1.fa > 1.output.fa diff_output_and_report 1.output.fa 1.expected.fa 1c ../fxtract -P CAAAGGGATTGAGACGCCACTT 1.fa > 1.output.fa diff_output_and_report 1.output.fa 1.expected.fa 1d print_test_header "search for headers" ../fxtract -H "HISEQ2000:55:C0JRTACXX:2:1101:11128:12710_1:N:0:CTTGTAAT" 1.fa > 2.output.fa diff_output_and_report 2.output.fa 2.expected.fa 2a ../fxtract -HG "HISEQ2000:55:C0JRTACXX:2:1101:11128:12710_1:N:0:CTTGTAAT" 1.fa > 2.output.fa diff_output_and_report 2.output.fa 2.expected.fa 2b ../fxtract -HE "HISEQ2000:55:C0JRTACXX:2:1101:11128:12710_1:N:0:CTTGTAAT" 1.fa > 2.output.fa diff_output_and_report 2.output.fa 2.expected.fa 2c ../fxtract -HP "HISEQ2000:55:C0JRTACXX:2:1101:11128:12710_1:N:0:CTTGTAAT" 1.fa > 2.output.fa diff_output_and_report 2.output.fa 2.expected.fa 2d ../fxtract -HX "HISEQ2000:55:C0JRTACXX:2:1101:11128:12710_1:N:0:CTTGTAAT" 1.fa > 2.output.fa diff_output_and_report 2.output.fa 2.expected.fa 2e ../fxtract -HX 1660334 12.fa >2f.output.fa diff_output_and_report 2f.output.fa 12.expected.fa 2f ../fxtract -rHX 1660334 12.fa >2g.output.fa diff_output_and_report 2g.output.fa 2g.expected.fa 2g print_test_header "multipattern search" ../fxtract -Hf headers.txt 1.fa > 3.output.fa diff_output_and_report 3.output.fa 3.expected.fa 3 print_test_header "paired reads" ../fxtract -H "HSQ868392H08B7ADXX:2:1112:8977:35114" 4_1.fa 4_2.fa > 4.output.fa diff_output_and_report 4.output.fa 4.expected.fa 4 print_test_header "search in comment strings" ../fxtract -C "Accumulibacter" 5.fa > 5.output.fa diff_output_and_report 5.output.fa 5.expected.fa 5 print_test_header "inverted match" ../fxtract -Hv 647449011 11.fa > 11.output.fa diff_output_and_report 11.output.fa 11.expected.fa 6a ../fxtract -HvX 647449011 11.fa > 11.output.fa diff_output_and_report 11.output.fa 11.expected.fa 6b ../fxtract -HvP 647449011 11.fa > 11.output.fa diff_output_and_report 11.output.fa 11.expected.fa 6c ../fxtract -HvG 647449011 11.fa > 11.output.fa diff_output_and_report 11.output.fa 11.expected.fa 6d ../fxtract -HvE 647449011 11.fa > 11.output.fa diff_output_and_report 11.output.fa 11.expected.fa 6e ../fxtract -Hvf <(echo 647449011) 11.fa > 11.output.fa diff_output_and_report 11.output.fa 11.expected.fa 6f print_test_header "count the matches" ../fxtract -Hc HISEQ2000 1.fa > 7.output.fa diff_output_and_report 7.output.fa 7.expected.fa 7 print_test_header "test out different fasta file styles" ../fxtract -H 1101:11128:12710 8.fa >8.output.fa diff_output_and_report 8.output.fa 8.expected.fa 8 ../fxtract -H 1101:11128:12710 9.fa >9.output.fa diff_output_and_report 9.output.fa 8.expected.fa 9 print_test_header "compressed files" gzip 8.fa ../fxtract -zH 1101:11128:12710 8.fa.gz >8.output.fa diff_output_and_report 8.output.fa 8.expected.fa 10a gunzip 8.fa.gz gzip 4_1.fa 4_2.fa ../fxtract -Hz "HSQ868392H08B7ADXX:2:1112:8977:35114" 4_1.fa.gz 4_2.fa.gz > 4.output.fa diff_output_and_report 4.output.fa 4.expected.fa 10c gunzip 4_1.fa.gz 4_2.fa.gz print_test_header "multiple files" ../fxtract -CS Accumulibacter 1.fa 11.fa 5.fa > 12.output.fa diff_output_and_report 12.output.fa 5.expected.fa 11 print_test_header "multiple outputs" ../fxtract -HXf headers2.txt 1.fa diff_output_and_report2 14_out_1.fasta 14_out_2.fasta 14_1.expected 14_2.expected 12a ../fxtract -Hf headers2.txt 1.fa diff_output_and_report2 14_out_1.fasta 14_out_2.fasta 14_1.expected 14_2.expected 12b print_test_header "proper comment printing" ../fxtract CAAAGGGATTGAGACGCCACTT 13.fa > 13.output.fa diff_output_and_report 1.output.fa 1.expected.fa 13a ../fxtract -G CAAAGGGATTGAGACGCCACTT 13.fa > 13.output.fa diff_output_and_report 13.output.fa 13.expected.fa 13b ../fxtract -E CAAAGGGATTGAGACGCCACTT 13.fa > 13.output.fa diff_output_and_report 13.output.fa 13.expected.fa 13c ../fxtract -P CAAAGGGATTGAGACGCCACTT 13.fa > 13.output.fa diff_output_and_report 13.output.fa 13.expected.fa 13d ../fxtract -HX HWI-ST1243:175:C29BRACXX:4:1101:15034:30425 15.fq > 15.output.fq diff_output_and_report 15.output.fq 15.expected.fq 13e print_test_header "search for sequences using the reverse complement with different regex engines" ../fxtract -r AAGTGGCGTCTCAATCCCTTTG 1.fa > 1.output.fa diff_output_and_report 1.output.fa 1.expected.fa 14a ../fxtract -rX TCGAACGTCGCAAAGACTCGCACCCTCGCTGCGAACGACACGTCTCAATCCCTTTGAATTCAGGGCATCAGTTCGAACTGGAGCAGTACGACCACGTTGATCTGAAGTGGCGTCTCAATCCCTTTGAATTCAGGGCATCAGTTCGAACGG 1.fa > 13b.output.fa diff_output_and_report 13b.output.fa 13b.expected.fa 14b ../fxtract -rf <(echo AAGTGGCGTCTCAATCCCTTTG) 1.fa > 1.output.fa diff_output_and_report 1.output.fa 1.expected.fa 14c ../fxtract -X TCGAACGTCGCAAAGACTCGCACCCTCGCTGCGAACGACACGTCTCAATCCCTTTGAATTCAGGGCATCAGTTCGAACTGGAGCAGTACGACCACGTTGATCTGAAGTGGCGTCTCAATCCCTTTGAATTCAGGGCATCAGTTCGAACGG 1.fa > 13b.output.fa diff_output_and_report 13b.output.fa empty.fa 14d ../fxtract -f <(echo AAGTGGCGTCTCAATCCCTTTG) 1.fa > 13e.output.fa diff_output_and_report 13e.output.fa empty.fa 14e exit $failed_any
FUNCTION multiplyBy2 (LIST aList) FOR every element in aList aList[element] *= 2 END FOR END FUNCTION
import React from 'react' import { FilePond, File, registerPlugin } from 'react-filepond' import FilePondPluginFileValidateType from 'filepond-plugin-file-validate-type' import FilePondPluginImageExifOrientation from 'filepond-plugin-image-exif-orientation' import FilePondPluginImagePreview from 'filepond-plugin-image-preview' import 'filepond-plugin-image-preview/dist/filepond-plugin-image-preview.css' import 'filepond/dist/filepond.css' registerPlugin( FilePondPluginImageExifOrientation, FilePondPluginImagePreview, FilePondPluginFileValidateType ) class FileUploader extends React.Component { constructor (props) { super(props) this.state = { files: [], media: [], id: '' } this.handleRevert = this.handleRevert.bind(this) } handleRevert () { fetch('https://video.laaksonen.me/api/videos/' + this.state.id, { method: 'delete' }).then(() => { this.setState(prevState => ({ media: prevState.media.filter(value => value._id !== this.state.id) })) }) } componentDidMount () { fetch('https://video.laaksonen.me/api/videos') .then(response => response.json()) .then(json => { this.setState({ media: json }) }) } render () { return ( <div style={{ width: '50%', margin: 'auto', marginTop: '2em' }}> <FilePond ref={ref => { this.pond = ref }} allowMultiple={true} acceptedFileTypes={['video/mp4', 'video/webm']} server={{ url: 'https://video.laaksonen.me/api/videos/' }} onupdatefiles={fileItems => { this.setState({ files: fileItems.map(fileItem => fileItem.file) }) }} > {this.state.files.map(file => ( <File key={file} src={file} origin="local" /> ))} </FilePond> </div> ) } } export default FileUploader
<reponame>Ciip1996/OsxJugueteria // // AdministradorVC.h // Jugueteria_OSX // // Created by <NAME> on 14/06/17. // Copyright © 2017 <NAME>. All rights reserved. // #import <Cocoa/Cocoa.h> #import "ManejadorSQLite.h" @interface AdministradorVC : NSViewController{ ManejadorSQLite *msqlite; AppDelegate *appdelegate; } @property (weak) IBOutlet NSDatePicker *FechaNacimiento; @property (weak) IBOutlet NSTextField *txtNombre; @property (weak) IBOutlet NSTextField *txtPaterno; @property (weak) IBOutlet NSTextField *txtMaterno; @property (weak) IBOutlet NSTextField *txtCurp; @property (weak) IBOutlet NSTextField *txtRFC; @property (weak) IBOutlet NSPopUpButton *popUpBtnGenero; @property (weak) IBOutlet NSTextField *txtClave; @property (weak) IBOutlet NSTextField *txtConfirmarClave; @property (weak) IBOutlet NSTextField *txtSalario; @property (weak) IBOutlet NSPopUpButton *popUpBtnRol; - (IBAction)OnCrearUsuarioNuevo:(id)sender; - (IBAction)CerrarVC:(id)sender; @end
<filename>ajax/endpoints.py<gh_stars>1-10 from django.core import serializers from django.core.exceptions import ValidationError from django.db import models from django.utils import simplejson as json from django.utils.encoding import smart_str from django.utils.translation import ugettext_lazy as _ from django.db.models.fields import FieldDoesNotExist from ajax.decorators import require_pk from ajax.exceptions import AJAXError, AlreadyRegistered, NotRegistered, \ PrimaryKeyMissing from ajax.encoders import encoder from taggit.utils import parse_tags class ModelEndpoint(object): _value_map = { 'false': False, 'true': True, 'null': None } immutable_fields = [] # List of model fields that are not writable. def __init__(self, application, model, method, **kwargs): self.application = application self.model = model self.fields = [f.name for f in self.model._meta.fields] self.method = method self.pk = kwargs.get('pk', None) self.options = kwargs def create(self, request): record = self.model(**self._extract_data(request)) if self.can_create(request.user, record): record = self._save(record) try: tags = self._extract_tags(request) record.tags.set(*tags) except KeyError: pass return encoder.encode(record) else: raise AJAXError(403, _("Access to endpoint is forbidden")) def tags(self, request): cmd = self.options.get('taggit_command', None) if not cmd: raise AJAXError(400, _("Invalid or missing taggit command.")) record = self._get_record() if cmd == 'similar': result = record.tags.similar_objects() else: try: tags = self._extract_tags(request) getattr(record.tags, cmd)(*tags) except KeyError: pass # No tags to set/manipulate in this request. result = record.tags.all() return encoder.encode(result) def _save(self, record): try: record.full_clean() record.save() return record except ValidationError, e: raise AJAXError(400, _("Could not save model."), errors=e.message_dict) @require_pk def update(self, request): record = self._get_record() if self.can_update(request.user, record): for key, val in self._extract_data(request).iteritems(): setattr(record, key, val) self._save(record) try: tags = self._extract_tags(request) if tags: record.tags.set(*tags) else: # If tags were in the request and set to nothing, we will # clear them all out. record.tags.clear() except KeyError: pass return encoder.encode(record) else: raise AJAXError(403, _("Access to endpoint is forbidden")) @require_pk def delete(self, request): record = self._get_record() if self.can_delete(request.user, record): record.delete() return {'pk': int(self.pk)} else: raise AJAXError(403, _("Access to endpoint is forbidden")) @require_pk def get(self, request): record = self._get_record() if self.can_get(request.user, record): return encoder.encode(record) else: raise AJAXError(403, _("Access to endpoint is forbidden")) def _extract_tags(self, request): # We let this throw a KeyError so that calling functions will know if # there were NO tags in the request or if there were, but that the # call had an empty tags list in it. raw_tags = request.POST['tags'] tags = [] if raw_tags: try: tags = [t for t in parse_tags(raw_tags) if len(t)] except Exception, e: pass return tags def _extract_data(self, request): """Extract data from POST. Handles extracting a vanilla Python dict of values that are present in the given model. This also handles instances of ``ForeignKey`` and will convert those to the appropriate object instances from the database. In other words, it will see that user is a ``ForeignKey`` to Django's ``User`` class, assume the value is an appropriate pk, and load up that record. """ data = {} for field, val in request.POST.iteritems(): if field in self.immutable_fields: continue # Ignore immutable fields silently. if field in self.fields: f = self.model._meta.get_field(field) val = self._extract_value(val) if val and isinstance(f, models.ForeignKey): data[smart_str(field)] = f.rel.to.objects.get(pk=val) else: data[smart_str(field)] = val return data def _extract_value(self, value): """If the value is true/false/null replace with Python equivalent.""" return ModelEndpoint._value_map.get(smart_str(value).lower(), value) def _get_record(self): """Fetch a given record. Handles fetching a record from the database along with throwing an appropriate instance of ``AJAXError`. """ if not self.pk: raise AJAXError(400, _('Invalid request for record.')) try: return self.model.objects.get(pk=self.pk) except self.model.DoesNotExist: raise AJAXError(404, _('%s with id of "%s" not found.') % ( self.model.__name__, self.pk)) def can_get(self, user, record): return True def _user_is_active_or_staff(self, user, record): return ((user.is_authenticated() and user.is_active) or user.is_staff) can_create = _user_is_active_or_staff can_update = _user_is_active_or_staff can_delete = _user_is_active_or_staff def authenticate(self, request, application, method): """Authenticate the AJAX request. By default any request to fetch a model is allowed for any user, including anonymous users. All other methods minimally require that the user is already logged in. Most likely you will want to lock down who can edit and delete various models. To do this, just override this method in your child class. """ if request.user.is_authenticated(): return True return False class FormEndpoint(object): """AJAX endpoint for processing Django forms. The models and forms are processed in pretty much the same manner, only a form class is used rather than a model class. """ def create(self, request): form = self.model(request.POST) if form.is_valid(): model = form.save() if hasattr(model, 'save'): # This is a model form so we save it and return the model. model.save() return encoder.encode(model) else: return model # Assume this is a dict to encode. else: return encoder.encode(form.errors) def update(self, request): raise AJAXError(404, _("Endpoint does not exist.")) delete = update get = update class Endpoints(object): def __init__(self): self._registry = {} def register(self, model, endpoint): if model in self._registry: raise AlreadyRegistered() self._registry[model] = endpoint def unregister(self, model): if model not in self._registry: raise NotRegistered() del self._registry[model] def load(self, model_name, application, method, **kwargs): for model in self._registry: if model.__name__.lower() == model_name: return self._registry[model](application, model, method, **kwargs) raise NotRegistered()
import numpy as np A = np.array([1, 2, 3, 4, 5, 6, 7, 8]) B = A.reshape((2, -1)) print(B)
let Stack = function() { // Hey! Rewrite in the new style. Your code will wind up looking very similar, // but try not not reference your old code in writing the new style. let someInstance = { length: 0, storage: {} }; _.extend(someInstance, stackMethods); return someInstance; }; let stackMethods = { push: function(value) { this.storage[this.length] = value; this.length++; }, pop: function() { this.length && this.length--; return this.storage[this.length]; }, size: function() { return this.length; } };
#!/bin/sh # Copyright (c) 2017-2019 The Bitcoin Core developers # Distributed under the MIT software license, see the accompanying # file COPYING or http://www.opensource.org/licenses/mit-license.php. # This simple script checks for commits beginning with: scripted-diff: # If found, looks for a script between the lines -BEGIN VERIFY SCRIPT- and # -END VERIFY SCRIPT-. If no ending is found, it reads until the end of the # commit message. # The resulting script should exactly transform the previous commit into the current # one. Any remaining diff signals an error. export LC_ALL=C if test "x$1" = "x"; then echo "Usage: $0 <commit>..." exit 1 fi RET=0 PREV_BRANCH=$(git name-rev --name-only HEAD) PREV_HEAD=$(git rev-parse HEAD) for commit in $(git rev-list --reverse $1); do if git rev-list -n 1 --pretty="%s" $commit | grep -q "^scripted-diff:"; then git checkout --quiet $commit^ || exit SCRIPT="$(git rev-list --format=%b -n1 $commit | sed '/^-BEGIN VERIFY SCRIPT-$/,/^-END VERIFY SCRIPT-$/{//!b};d')" if test "x$SCRIPT" = "x"; then echo "Error: missing script for: $commit" echo "Failed" RET=1 else echo "Running script for: $commit" echo "$SCRIPT" (eval "$SCRIPT") git --no-pager diff --exit-code $commit && echo "OK" || (echo "Failed"; false) || RET=1 fi git reset --quiet --hard HEAD else if git rev-list "--format=%b" -n1 $commit | grep -q '^-\(BEGIN\|END\)[ a-zA-Z]*-$'; then echo "Error: script block marker but no scripted-diff in title" echo "Failed" RET=1 fi fi done git checkout --quiet $PREV_BRANCH 2>/dev/null || git checkout --quiet $PREV_HEAD exit $RET
import kivy from kivy.app import App from kivy.uix.boxlayout import BoxLayout from kivy.uix.screenmanager import ScreenManager class Calculator(ScreenManager): def do_calculation(self, instance): x = self.ids.input1.text y = self.ids.input2.text value = 0 if instance.text == "+": value = float(x) + float(y) elif instance.text == "-": value = float(x) - float(y) elif instance.text == "*": value = float(x) * float(y) elif instance.text == "/": value = float(x) / float(y) self.ids.result.text = str(value) class CalculatorApp(App): def build(self): return Calculator() if __name__ == '__main__': CalculatorApp().run()
<reponame>jrfaller/maracas<gh_stars>1-10 package main.test.classRemoved; public class ClassRemoved { public int field; public int method() { return 90; } }
import '@babel/polyfill'; import dotenv from 'dotenv'; import 'isomorphic-fetch'; import createShopifyAuth, { verifyRequest } from '@shopify/koa-shopify-auth'; import graphQLProxy, { ApiVersion } from '@shopify/koa-shopify-graphql-proxy'; import Koa from 'koa'; import next from 'next'; import Router from 'koa-router'; import session from 'koa-session'; import { DeliveryMethod, Options, receiveWebhook } from '@shopify/koa-shopify-webhooks'; import addWebhook from 'src/server/utils/addWebhook'; dotenv.config(); const port = parseInt(process.env.PORT, 10) || 8081; const dev = process.env.NODE_ENV !== 'production'; const app = next({ dev, }); const handle = app.getRequestHandler(); const { SHOPIFY_API_SECRET, SHOPIFY_API_KEY, SCOPES, HOST, } = process.env; app.prepare().then(() => { const server = new Koa(); const router = new Router(); server.use( session( { sameSite: 'none', secure: true, }, server ) ); server.keys = [SHOPIFY_API_SECRET]; server.use( createShopifyAuth({ apiKey: SHOPIFY_API_KEY, secret: SHOPIFY_API_SECRET, scopes: [SCOPES], async afterAuth(ctx) { let { shop, accessToken, scopes } = ctx.session; // Access token and shop available in ctx.state.shopify also?? if (!shop) { shop = ctx.state.shopify.shop || new URLSearchParams(ctx.request.url).get('shop'); } ctx.cookies.set('shopOrigin', shop, { httpOnly: false, secure: true, sameSite: 'none' }); console.log('accessToken', accessToken); console.log('scopes', scopes); const productsCreateWebhookOptions: Options = { address: `${HOST}/webhooks/products/create`, topic: 'PRODUCTS_CREATE', accessToken, shop, apiVersion: ApiVersion.July20, deliveryMethod: DeliveryMethod.Http, } await addWebhook(productsCreateWebhookOptions); // Redirect to app with shop parameter upon auth ctx.redirect(`/?shop=${shop}`); }, }) ); const webhook = receiveWebhook({ secret: SHOPIFY_API_SECRET }); router.post('/webhooks/products/create', webhook, (ctx) => { console.log('received webhook: ', ctx.state.webhook); }); router.post('/webhooks/carrier_services', webhook, (ctx) => { console.log('received webhook: ', ctx.state.webhook); }); server.use( graphQLProxy({ version: ApiVersion.October19, }) ); router.get('(.*)', verifyRequest(), async (ctx) => { await handle(ctx.req, ctx.res); ctx.respond = false; ctx.res.statusCode = 200; }); server.use(router.allowedMethods()); server.use(router.routes()); server.listen(port, () => { console.log(`> Ready on http://localhost:${port}`); }); });
<gh_stars>0 import React from "react"; import { useFormContext } from "react-hook-form"; import { ErrorMessage } from "@hookform/error-message"; import { StyledContainer, StyledFlex, StyledLabel, StyledAsterisk, StyledAlertText } from "./styles"; const withInputWrapper = WrappedComponent => props => { const { id, name, readOnly, required, alertText, errorName, fullWidth, alertStyle, label = "", containerStyle = {} } = props; const { errors } = useFormContext(); return ( <StyledContainer fullWidth={fullWidth} style={containerStyle}> <StyledFlex> <StyledLabel htmlFor={id}> {label} {!readOnly && required && ( <StyledAsterisk aria-label="required">*</StyledAsterisk> )} </StyledLabel> <ErrorMessage errors={errors} name={errorName || name} render={({ message }) => ( <StyledAlertText style={alertStyle}> {alertText || message} </StyledAlertText> )} /> </StyledFlex> <WrappedComponent {...props} /> </StyledContainer> ); }; export default withInputWrapper;
'use strict'; const {app, clipboard, dialog, shell} = require('electron'); const os = require('os'); const {activate} = require('./win'); const {release} = require('./url'); const file = require('./file'); const settings = require('./settings'); class Dialog { get _systemInfo() { return [ `版本: ${app.getVersion()}`, `系統: ${os.type()} ${os.arch()} ${os.release()}` ].join('\n'); } _about() { return this._create({ buttons: ['好嘞!', '复制'], detail: `Developed by <NAME>.\n由Kevin Wang维护.\n联系方式:<EMAIL>.\n本软件永久免费\n\n${this._systemInfo}`, message: `Ao ${app.getVersion()} (${os.arch()})`, title: '关于 Ao' }); } _create(options) { return dialog.showMessageBox( Object.assign({ cancelId: 1, defaultId: 0, icon: file.icon }, options) ); } _exit() { return this._create({ buttons: ['退出', '取消'], detail: '你确定你想要退出码?', message: '退出', title: 'Ao - 退出确认' }); } _signOut() { return this._create({ buttons: ['注销', '取消'], detail: '你确定要登出你的微软账户登录吗?', message: '登出', title: 'Ao - 登出确认' }); } _restart() { return this._create({ buttons: ['重新启动', '取消'], detail: '你确定你想要重启软件以更新设置码?', message: '重启以更新选定的设置', title: 'Ao - 需要登出' }); } _update(version) { return this._create({ buttons: ['下载', '忽略'], detail: `发现新版本!!!!`, message: `${version} 可以更新啦`, title: `Ao - 发现新版本:${version}` }); } confirmAbout() { if (this._about() === 1) { clipboard.writeText(this._systemInfo); } } confirmExit() { if (settings.get('requestExitConfirmation')) { if (this._exit() === 0) { app.quit(); } } else { app.quit(); } } confirmActivationRestart(option, state) { if (this._restart() === 0) { settings.set(option, state); app.quit(); app.relaunch(); } } confirmSignOut() { if (this._signOut() === 0) { activate('sign-out'); } } updateError(content) { return dialog.showErrorBox('获取最新版本失败!', content); } noUpdate() { return this._create({ buttons: ['好嘞!'], detail: `软件暂无新版本`, message: '软件暂无新版本', title: 'Ao - 无更新可用' }); } getUpdate(version) { if (this._update(version) === 0) { shell.openExternal(release); } } } module.exports = new Dialog();
<gh_stars>1-10 import { CommandArgs, SuiteStats, TestStats } from '@wdio/reporter' import AllureReporter from '../src' import { linkPlaceholder } from '../src/constants' let processOn: any beforeAll(() => { processOn = process.on.bind(process) process.on = jest.fn() }) afterAll(() => { process.on = processOn }) describe('reporter runtime implementation', () => { it('should correct add custom label', () => { const reporter = new AllureReporter() const addLabel = jest.fn() const mock = jest.fn(() => { return { addLabel } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addLabel({ name: 'customLabel', value: 'Label' }) expect(addLabel).toHaveBeenCalledTimes(1) expect(addLabel).toHaveBeenCalledWith('customLabel', 'Label') }) it('should correct add story label', () => { const reporter = new AllureReporter() const addLabel = jest.fn() const mock = jest.fn(() => { return { addLabel } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addStory({ storyName: 'foo' }) expect(addLabel).toHaveBeenCalledTimes(1) expect(addLabel).toHaveBeenCalledWith('story', 'foo') }) it('should correct add feature label', () => { const reporter = new AllureReporter() const addLabel = jest.fn() const mock = jest.fn(() => { return { addLabel } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addFeature({ featureName: 'foo' }) expect(addLabel).toHaveBeenCalledTimes(1) expect(addLabel).toHaveBeenCalledWith('feature', 'foo') }) it('should correct add severity label', () => { const reporter = new AllureReporter() const addLabel = jest.fn() const mock = jest.fn(() => { return { addLabel } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addSeverity({ severity: 'foo' }) expect(addLabel).toHaveBeenCalledTimes(1) expect(addLabel).toHaveBeenCalledWith('severity', 'foo') }) it('should correctly add issue label', () => { const reporter = new AllureReporter() const addLabel = jest.fn() const mock = jest.fn(() => { return { addLabel } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addIssue({ issue: '1' }) expect(addLabel).toHaveBeenCalledTimes(1) expect(addLabel).toHaveBeenCalledWith('issue', '1') }) it('should correctly add issue label with link', () => { const reporter = new AllureReporter({ issueLinkTemplate: `http://example.com/${linkPlaceholder}` }) const addLabel = jest.fn() const mock = jest.fn(() => { return { addLabel } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addIssue({ issue: '1' }) expect(addLabel).toHaveBeenCalledTimes(1) expect(addLabel).toHaveBeenCalledWith('issue', 'http://example.com/1') }) it('should correctly add test id label', () => { const reporter = new AllureReporter() const addLabel = jest.fn() const mock = jest.fn(() => { return { addLabel } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addTestId({ testId: '2' }) expect(addLabel).toHaveBeenCalledTimes(1) expect(addLabel).toHaveBeenCalledWith('testId', '2') }) it('should correctly add test id label with link', () => { const reporter = new AllureReporter({ tmsLinkTemplate: `https://webdriver.io/${linkPlaceholder}` }) const addLabel = jest.fn() const mock = jest.fn(() => { return { addLabel } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addTestId({ testId: '2' }) expect(addLabel).toHaveBeenCalledTimes(1) expect(addLabel).toHaveBeenCalledWith('testId', 'https://webdriver.io/2') }) it('should correct add environment', () => { const reporter = new AllureReporter() const addParameter = jest.fn() const mock = jest.fn(() => { return { addParameter } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addEnvironment({ name: 'foo', value: 'bar' }) expect(addParameter).toHaveBeenCalledTimes(1) expect(addParameter).toHaveBeenCalledWith('environment-variable', 'foo', 'bar') }) it('should correct add description', () => { const reporter = new AllureReporter() const setDescription = jest.fn() const mock = jest.fn(() => { return { setDescription } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addDescription({ description: 'foo', descriptionType: 'bar' }) expect(setDescription).toHaveBeenCalledTimes(1) expect(setDescription).toHaveBeenCalledWith('foo', 'bar') }) it('should correct add attachment', () => { const reporter = new AllureReporter() const addAttachment = jest.fn() reporter['_allure'] = { getCurrentSuite: jest.fn(() => true), getCurrentTest: jest.fn(() => true), addAttachment } as any reporter.addAttachment({ name: 'foo', content: 'bar', type: 'baz' }) expect(addAttachment).toHaveBeenCalledTimes(1) expect(addAttachment).toHaveBeenCalledWith('foo', Buffer.from('bar'), 'baz') }) it('should correct add "application/json" attachment', () => { const reporter = new AllureReporter() const dumpJSON = jest.fn() reporter.dumpJSON = dumpJSON reporter['_allure'] = { getCurrentSuite: jest.fn(() => true), getCurrentTest: jest.fn(() => true), } as any reporter.addAttachment({ name: 'foo', content: 'bar', type: 'application/json' }) expect(dumpJSON).toHaveBeenCalledWith('foo', 'bar') }) it('should allow to start end step', () => { const reporter = new AllureReporter() const startStep = jest.fn() const endStep = jest.fn() reporter['_allure'] = { getCurrentSuite: jest.fn(() => true), getCurrentTest: jest.fn(() => true), startStep, endStep } as any reporter.startStep('bar') reporter.endStep('failed') expect(startStep).toHaveBeenCalledTimes(1) expect(endStep).toHaveBeenCalledTimes(1) expect(startStep).toHaveBeenCalledWith('bar') expect(endStep).toHaveBeenCalledWith('failed') }) it('should correct add step with attachment', () => { const reporter = new AllureReporter() const startStep = jest.fn() const endStep = jest.fn() const addAttachment = jest.fn() reporter.addAttachment = addAttachment reporter['_allure'] = { getCurrentSuite: jest.fn(() => true), getCurrentTest: jest.fn(() => true), startStep, endStep } as any const step = { 'step': { 'attachment': { 'content': 'baz', 'name': 'attachment' }, 'status': 'passed', 'title': 'foo' } } reporter.addStep(step) expect(startStep).toHaveBeenCalledTimes(1) expect(endStep).toHaveBeenCalledTimes(1) expect(addAttachment).toHaveBeenCalledTimes(1) expect(startStep).toHaveBeenCalledWith(step.step.title) expect(addAttachment).toHaveBeenCalledWith(step.step.attachment) expect(endStep).toHaveBeenCalledWith(step.step.status) }) it('should correct add step without attachment', () => { const reporter = new AllureReporter() const startStep = jest.fn() const endStep = jest.fn() const addAttachment = jest.fn() reporter.addAttachment = addAttachment reporter['_allure'] = { getCurrentSuite: jest.fn(() => true), getCurrentTest: jest.fn(() => true), startStep, endStep } as any const step = { 'step': { 'status': 'passed', 'title': 'foo' } } reporter.addStep(step) expect(startStep).toHaveBeenCalledTimes(1) expect(endStep).toHaveBeenCalledTimes(1) expect(addAttachment).toHaveBeenCalledTimes(0) expect(startStep).toHaveBeenCalledWith(step.step.title) expect(endStep).toHaveBeenCalledWith(step.step.status) }) it('should correctly add argument', () => { const reporter = new AllureReporter() const addParameter = jest.fn() const mock = jest.fn(() => { return { addParameter } }) reporter['_allure'] = { getCurrentSuite: mock, getCurrentTest: mock, } as any reporter.addArgument({ name: 'os', value: 'osx' }) expect(addParameter).toHaveBeenCalledTimes(1) expect(addParameter).toHaveBeenCalledWith('argument', 'os', 'osx') }) it('should do nothing if no tests run', () => { const reporter = new AllureReporter() expect(reporter.addLabel({})).toEqual(false) expect(reporter.addStory({})).toEqual(false) expect(reporter.addFeature({})).toEqual(false) expect(reporter.addSeverity({})).toEqual(false) expect(reporter.addIssue({})).toEqual(false) expect(reporter.addTestId({})).toEqual(false) expect(reporter.addEnvironment({})).toEqual(false) expect(reporter.addDescription({})).toEqual(false) expect(reporter.addAttachment({})).toEqual(false) expect(reporter.startStep('test')).toEqual(false) expect(reporter.endStep('passed')).toEqual(false) expect(reporter.addStep({})).toEqual(false) expect(reporter.addArgument({})).toEqual(false) }) describe('add argument', () => { let reporter: any, addParameter: any, addLabel: any, mock beforeEach(() => { reporter = new AllureReporter() addParameter = jest.fn() addLabel = jest.fn() mock = jest.fn(() => { return { addParameter, addLabel } }) reporter['_allure'] = { startCase: mock, getCurrentSuite: mock, getCurrentTest: mock, } }) it('should correctly add argument for selenium', () => { reporter.onRunnerStart({ config: {}, capabilities: { browserName: 'firefox', version: '1.2.3' } }) reporter.onTestStart({ cid: '0-0', title: 'SomeTest' }) expect(addParameter).toHaveBeenCalledTimes(1) expect(addParameter).toHaveBeenCalledWith('argument', 'browser', 'firefox-1.2.3') }) it('should correctly set proper browser version for chrome headless in devtools', () => { reporter.onRunnerStart({ config: {}, capabilities: { browserName: 'Chrome Headless', browserVersion: '85.0.4183.84' } }) reporter.onTestStart({ cid: '0-0', title: 'SomeTest' }) expect(addParameter).toHaveBeenCalledTimes(1) expect(addParameter).toHaveBeenCalledWith('argument', 'browser', 'Chrome Headless-85.0.4183.84') }) it('should correctly add argument for appium', () => { reporter.onRunnerStart({ config: {}, capabilities: { deviceName: 'Android Emulator', platformVersion: '8.0' } }) reporter.onTestStart({ cid: '0-0', title: 'SomeTest' }) expect(addParameter).toHaveBeenCalledTimes(1) expect(addParameter).toHaveBeenCalledWith('argument', 'device', 'Android Emulator-8.0') }) it('should correctly add device name when run on BrowserStack', () => { reporter.onRunnerStart({ config: {}, capabilities: { device: 'Google Pixel 3', platformVersion: '9.0' } }) reporter.onTestStart({ cid: '0-0', title: 'SomeTest' }) expect(addParameter).toHaveBeenCalledTimes(1) expect(addParameter).toHaveBeenCalledWith('argument', 'device', 'Google Pixel 3-9.0') }) it('should correctly add argument for multiremote', () => { reporter.onRunnerStart({ isMultiremote: true, config: { capabilities: { myBrowser: { browserName: 'chrome' } } } }) reporter.onTestStart({ cid: '0-0', title: 'SomeTest' }) expect(addParameter).toHaveBeenCalledTimes(1) expect(addParameter).toHaveBeenCalledWith('argument', 'isMultiremote', 'true') }) }) }) describe('auxiliary methods', () => { it('isScreenshotCommand', () => { const reporter = new AllureReporter() expect(reporter.isScreenshotCommand({ endpoint: '/session/id/screenshot' } as CommandArgs)).toEqual(true) expect(reporter.isScreenshotCommand({ endpoint: '/wdu/hub/session/id/screenshot' } as CommandArgs)).toEqual(true) expect(reporter.isScreenshotCommand({ endpoint: '/session/id/click' } as CommandArgs)).toEqual(false) expect(reporter.isScreenshotCommand({ command: 'takeScreenshot' } as CommandArgs)).toEqual(true) expect(reporter.isScreenshotCommand({ command: 'elementClick' } as CommandArgs)).toEqual(false) expect(reporter.isScreenshotCommand({ endpoint: '/session/id/element/id/screenshot' } as CommandArgs)).toEqual(true) }) it('dumpJSON', () => { const reporter = new AllureReporter() const addAttachment = jest.fn() reporter['_allure'] = { addAttachment } as any const json = { bar: 'baz' } reporter.dumpJSON('foo', json) expect(addAttachment).toHaveBeenCalledTimes(1) expect(addAttachment).toHaveBeenCalledWith('foo', JSON.stringify(json, null, 2), 'application/json') }) it('should populate the correct deviceName', () => { const capabilities = { deviceName: 'emulator', desired: { platformName: 'Android', automationName: 'UiAutomator2', deviceName: 'Android GoogleAPI Emulator', platformVersion: '6.0', noReset: true, } } const reporter = new AllureReporter() const currentTestMock = { addParameter: jest.fn(), addLabel: jest.fn() } reporter['_allure'].getCurrentTest = jest.fn().mockReturnValue(currentTestMock) reporter['_allure'].startCase = jest.fn() reporter['_isMultiremote'] = false reporter['_capabilities'] = capabilities reporter.onTestStart({ cid: '0-0', title: 'SomeTest' } as TestStats) expect(reporter['_allure'].getCurrentTest).toBeCalledTimes(1) expect(currentTestMock.addParameter).toHaveBeenCalledWith('argument', 'device', 'Android GoogleAPI Emulator 6.0') }) }) describe('hooks handling disabled Mocha Hooks', () => { let reporter: any, startCase: any, endCase: any, startStep: any, endStep: any const allureInstance = ({ suite = {}, test = { steps: [1] } }: any = {}) => ({ getCurrentSuite: jest.fn(() => suite), getCurrentTest: jest.fn(() => { return test }), startCase, endCase, startStep, endStep }) beforeEach(() => { reporter = new AllureReporter({ disableMochaHooks: true }) reporter.onTestStart = jest.fn(test => startCase(test.title)) startCase = jest.fn() endCase = jest.fn(result => result) startStep = jest.fn() endStep = jest.fn(result => result) }) it('should add test on custom hook', () => { reporter['_allure'] = allureInstance() reporter.onHookStart({ title: 'foo', parent: 'bar' }) expect(startCase).toHaveBeenCalledTimes(1) expect(startCase).toHaveBeenCalledWith('foo') expect(startStep).toHaveBeenCalledTimes(0) }) it('should not add test if no suite', () => { reporter['_allure'] = allureInstance({ suite: false }) reporter.onHookStart({ title: 'foo', parent: 'bar' }) expect(startStep).toHaveBeenCalledTimes(0) expect(startCase).toHaveBeenCalledTimes(0) }) it('should ignore global mocha hooks', () => { reporter['_allure'] = allureInstance() reporter.onHookStart({ title: '"after all" hook', parent: '' }) expect(startStep).toHaveBeenCalledTimes(0) expect(startCase).toHaveBeenCalledTimes(0) }) it('should capture mocha each hooks', () => { reporter['_allure'] = allureInstance() reporter.onHookStart({ title: '"before each" hook', parent: 'foo' }) expect(startStep).toHaveBeenCalledTimes(1) expect(startCase).toHaveBeenCalledTimes(0) }) it('should ignore mocha each hooks if no test', () => { reporter['_allure'] = allureInstance({ test: null }) reporter.onHookStart({ title: '"after each" hook', parent: 'foo' }) expect(startStep).toHaveBeenCalledTimes(0) expect(startCase).toHaveBeenCalledTimes(0) }) it('should not end test onHookEnd if no suite', () => { reporter['_allure'] = allureInstance({ suite: false }) reporter.onHookEnd({ title: 'foo', parent: 'bar' }) expect(endCase).toHaveBeenCalledTimes(0) }) it('should ignore mocha hook end if no test', () => { reporter['_allure'] = allureInstance({ test: null }) reporter.onHookEnd({ title: 'foo', parent: 'bar' }) expect(endCase).toHaveBeenCalledTimes(0) expect(endStep).toHaveBeenCalledTimes(0) }) it('should ignore global mocha end hooks', () => { reporter['_allure'] = allureInstance() reporter.onHookEnd({ title: 'foo' }) expect(startStep).toHaveBeenCalledTimes(0) expect(startCase).toHaveBeenCalledTimes(0) }) it('should not pop test case if no steps and before hook', () => { const testcases = [1] reporter['_allure'] = allureInstance({ suite: { testcases }, test: { steps: [] } }) reporter.onHookEnd({ title: '"before all" hook', parent: 'foo' }) expect(endCase).toHaveBeenCalledTimes(0) expect(testcases).toHaveLength(1) }) it('should pop test case if no steps and custom hook', () => { const testcases = [1] reporter['_allure'] = allureInstance({ suite: { testcases }, test: { steps: [] } }) reporter.onHookEnd({ title: 'bar', parent: 'foo' }) expect(endCase).toHaveBeenCalledTimes(1) expect(testcases).toHaveLength(0) }) it('should keep passed hooks if there are some steps', () => { const testcases = [1] reporter['_allure'] = allureInstance({ suite: { testcases }, test: { steps: [1] } }) reporter.onHookEnd({ title: 'foo', parent: 'bar' }) expect(endCase).toHaveBeenCalledTimes(1) expect(endCase.mock.results[0].value).toBe('passed') expect(testcases).toHaveLength(1) }) it('should keep failed hooks if there no some steps', () => { const testcases = [1] reporter['_allure'] = allureInstance({ suite: { testcases }, test: { steps: [1] } }) reporter.onHookEnd({ title: '"after all" hook', parent: 'foo', error: { message: '', stack: '' } }) expect(endCase).toHaveBeenCalledTimes(1) expect(endCase.mock.results[0].value).toBe('broken') expect(testcases).toHaveLength(1) }) it('should keep failed hooks if there are some steps', () => { const testcases = [1] reporter['_allure'] = allureInstance({ suite: { testcases }, test: { steps: [1] } }) reporter.onHookEnd({ title: '"after all" hook', parent: 'foo', error: { message: '', stack: '' } }) expect(endCase).toHaveBeenCalledTimes(1) expect(endCase.mock.results[0].value).toBe('broken') expect(testcases).toHaveLength(1) }) it('should capture mocha each hooks end - passed', () => { reporter['_allure'] = allureInstance() reporter.onHookEnd({ title: '"after each" hook', parent: 'foo' }) expect(endCase).toHaveBeenCalledTimes(0) expect(endStep).toHaveBeenCalledTimes(1) expect(endStep.mock.results[0].value).toBe('passed') }) it('should capture mocha each hooks end - failed', () => { reporter['_allure'] = allureInstance() reporter.onHookEnd({ title: '"before each" hook', parent: 'foo', error: { message: '', stack: '' } }) expect(endCase).toHaveBeenCalledTimes(0) expect(endStep).toHaveBeenCalledTimes(1) expect(endStep.mock.results[0].value).toBe('failed') }) it('should ignore mocha all hooks if hook passes', () => { reporter['_allure'] = allureInstance() reporter.onHookStart({ title: '"after all" hook', parent: 'foo' }) expect(startCase).toHaveBeenCalledTimes(0) expect(endCase).toHaveBeenCalledTimes(0) }) it('should treat mocha all hooks as tests if hook throws', () => { reporter['_allure'] = allureInstance() reporter.onHookEnd({ title: '"before all" hook', parent: 'foo', error: { message: '', stack: '' } }) expect(startCase).toHaveBeenCalledTimes(1) expect(endCase).toHaveBeenCalledTimes(1) expect(endCase.mock.results[0].value).toBe('broken') }) }) describe('hooks handling default', () => { let reporter: any, startCase: any, endCase: any, startStep: any, endStep: any const allureInstance = ({ suite = {}, test = { steps: [1] } }: any = {}) => ({ getCurrentSuite: jest.fn(() => suite), getCurrentTest: jest.fn(() => { return test }), startCase, endCase, startStep, endStep }) beforeEach(() => { reporter = new AllureReporter({ disableMochaHooks: false }) reporter.onTestStart = jest.fn(test => startCase(test.title)) startCase = jest.fn() endCase = jest.fn(result => result) startStep = jest.fn() endStep = jest.fn(result => result) }) it('should capture mocha each hooks', () => { reporter['_allure'] = allureInstance() reporter.onHookStart({ title: '"before each" hook', parent: 'foo' }) expect(startStep).toHaveBeenCalledTimes(0) expect(startCase).toHaveBeenCalledTimes(1) }) it('should not ignore mocha each hooks if no test', () => { reporter['_allure'] = allureInstance({ test: null }) reporter.onHookStart({ title: '"after each" hook', parent: 'foo' }) expect(startStep).toHaveBeenCalledTimes(0) expect(startCase).toHaveBeenCalledTimes(1) }) it('should keep passed hooks if there are no steps (before/after)', () => { const testcases = [1] reporter['_allure'] = allureInstance({ suite: { testcases }, test: { steps: [] } }) reporter.onHookEnd({ title: '"before all" hook', parent: 'foo' }) expect(endCase).toHaveBeenCalledTimes(1) expect(testcases).toHaveLength(1) }) it('should keep passed hooks if there are some steps', () => { const testcases = [1] reporter['_allure'] = allureInstance({ suite: { testcases }, test: { steps: [1] } }) reporter.onHookEnd({ title: 'foo', parent: 'bar' }) expect(endCase).toHaveBeenCalledTimes(1) expect(testcases).toHaveLength(1) }) }) describe('nested suite naming', () => { it('should not end test if no hook ignored', () => { const reporter = new AllureReporter() const startSuite = jest.fn() reporter['_allure'] = { getCurrentSuite: jest.fn(() => { return { name: 'foo' } }), startSuite } as any reporter.onSuiteStart({ title: 'bar' } as SuiteStats) expect(startSuite).toHaveBeenCalledTimes(1) expect(startSuite).toHaveBeenCalledWith('foo: bar') }) })
package javafx.scene.transform; import com.sun.javafx.geom.Point2D; import javafx.beans.property.*; import javafx.geometry.GeometryUtil; import javafx.geometry.Point3D; import dev.webfx.kit.mapper.peers.javafxgraphics.markers.HasAngleProperty; /** * @author <NAME> */ public class Rotate extends PivotTransform implements HasAngleProperty { /** * Specifies the X-axis as the axis of rotation. */ public static final Point3D X_AXIS = new Point3D(1,0,0); /** * Specifies the Y-axis as the axis of rotation. */ public static final Point3D Y_AXIS = new Point3D(0,1,0); /** * Specifies the Z-axis as the axis of rotation. */ public static final Point3D Z_AXIS = new Point3D(0,0,1); /** * Creates a default Rotate transform (identity). */ public Rotate() { } /** * Creates a two-dimensional Rotate transform. * The pivot point is set to (0,0) * @param angle the angle of rotation measured in degrees */ public Rotate(double angle) { setAngle(angle); } /** * Creates a three-dimensional Rotate transform. * The pivot point is set to (0,0,0) * @param angle the angle of rotation measured in degrees * @param axis the axis of rotation */ public Rotate(double angle, Point3D axis) { setAngle(angle); setAxis(axis); } /** * Creates a two-dimensional Rotate transform with pivot. * @param angle the angle of rotation measured in degrees * @param pivotX the X coordinate of the rotation pivot point * @param pivotY the Y coordinate of the rotation pivot point */ public Rotate(double angle, double pivotX, double pivotY) { setAngle(angle); setPivotX(pivotX); setPivotY(pivotY); } private final DoubleProperty angleProperty = new SimpleDoubleProperty(0d); @Override public DoubleProperty angleProperty() { return angleProperty; } /** * Defines the axis of rotation at the pivot point. */ private ObjectProperty<Point3D> axis; public final void setAxis(Point3D value) { axisProperty().set(value); } public final Point3D getAxis() { return axis == null ? Z_AXIS : axis.get(); } public final ObjectProperty<Point3D> axisProperty() { if (axis == null) { axis = new ObjectPropertyBase<Point3D>(Z_AXIS) { /* @Override public void invalidated() { transformChanged(); } */ @Override public Object getBean() { return Rotate.this; } @Override public String getName() { return "axis"; } }; } return axis; } @Override public Point2D transform(double x, double y) { if (Z_AXIS.equals(getAxis())) // Ignoring 3D transforms for now return GeometryUtil.rotate(getPivotX(), getPivotY(), x, y, getAngle()); return new Point2D((float) x, (float) y); } @Override public Transform createInverse() { return new Rotate(-getAngle(), getPivotX(), getPivotY()); } @Override public Property[] propertiesInvalidatingCache() { return new Property[]{angleProperty, pivotXProperty, pivotYProperty}; } @Override public Affine toAffine() { double rads = Math.toRadians(getAngle()); double px = getPivotX(); double py = getPivotY(); double sin = Math.sin(rads); double cos = Math.cos(rads); double mxx = cos; double mxy = -sin; double tx = px * (1 - cos) + py * sin; double myx = sin; double myy = cos; double ty = py * (1 - cos) - px * sin; return new Affine(mxx, mxy, myx, myy, tx, ty); } }
export { default as useEditAchievementSelector } from './useEditAchievementSelector';
<gh_stars>0 package com.example.googleplay.ui.holder; import android.view.View; import android.widget.ImageView; import android.widget.TextView; import com.example.googleplay.R; import com.example.googleplay.domain.SubjectInfo; import com.example.googleplay.http.HttpHelper; import com.example.googleplay.utils.BitmapHelper; import com.example.googleplay.utils.UIUtils; import com.lidroid.xutils.BitmapUtils; public class SubjectHolder extends BaseHolder<SubjectInfo> { private ImageView ivPic; private TextView tvTitle; private BitmapUtils mBitmapUtils; @Override public View initView() { View view = UIUtils.inflate(R.layout.list_item_subject); ivPic = (ImageView) view.findViewById(R.id.iv_pic); tvTitle = (TextView) view.findViewById(R.id.tv_title); mBitmapUtils = BitmapHelper.getBitmapUtils(); return view; } @Override public void refreshView(SubjectInfo data) { tvTitle.setText(data.des); mBitmapUtils.display(ivPic, HttpHelper.URL + "image?name=" + data.url); } }
from typing import List def process_array(arr: List[int]) -> List[int]: modified_arr = [] if not arr: # Check if the input array is empty return modified_arr # Return an empty array if input is empty else: for num in arr: if num % 2 == 0: # If the number is even modified_arr.append(num ** 2) # Square the number and add to modified array else: modified_arr.append(num ** 3) # Cube the number and add to modified array return modified_arr
class ASCIIFormatter: def __init__(self, param_names, result, formats): self.param_names = param_names self.result = result self.formats = formats def get_ascii(self, names=None, params=None): if names is None: names = self.param_names if params is None: params = self.result[1] idx = [self.param_names.index(f) for f in names] text = [self.formats.get(n, '%11.4e') % params[i] for n, i in zip(names, idx)] return ' '.join(text) # Example usage param_names = ['x', 'y', 'z'] result_values = [3.14159, 2.71828, 1.41421] formats_dict = {'x': '%.2f', 'y': '%.3e'} formatter = ASCIIFormatter(param_names, (None, result_values), formats_dict) formatted_text = formatter.get_ascii(['x', 'y']) # Output: '3.14 2.718e+00'
<filename>utils/index.ts import * as util from "util"; import { wasm_modules_amount } from "../index"; import { log } from "../utils/log"; import { event } from "../rpc/parser"; import { getContract, runContract } from "../contract"; import { getWasmExport } from "../storage"; export const setValue = (moduleName: string, value: string) => { const wasm_exports = getWasmExport(moduleName); const textEncoder = new util.TextEncoder(); const typedArray = textEncoder.encode(value); const ptr = wasm_exports._wasm_malloc(typedArray.length); const Uint8Memory = new Uint8Array(wasm_exports.memory.buffer); Uint8Memory.subarray(ptr, ptr + typedArray.length).set(typedArray); return {ptr, length: typedArray.length}; }; export const getValue = (moduleName: string, ptr: number, length: number) => { const wasm_exports = getWasmExport(moduleName); const value = wasm_exports.memory.buffer.slice(ptr, ptr + length); const utf8decoder = new util.TextDecoder(); return utf8decoder.decode(value); }; export const setValueByBytes = (moduleName: string, bytes: any) => { const wasm_exports = getWasmExport(moduleName); const typedArray = new Uint8Array(bytes); const ptr = wasm_exports._wasm_malloc(typedArray.length); const Uint8Memory = new Uint8Array(wasm_exports.memory.buffer); Uint8Memory.subarray(ptr, ptr + typedArray.length).set(typedArray); return {ptr, length: typedArray.length }; }; export const getValueByBytes = (moduleName: string, ptr: number, length: number) => { const wasm_exports = getWasmExport(moduleName); const buffer = wasm_exports.memory.buffer.slice(ptr, ptr + length); return buffer; }; export const _get_timestamp = () => { return Date.now(); }; export const _gen_rand32_callback = (fn: number, addr: number) => {}; export const _load_callback = (moduleName: string) => { return async function _load_callback (ptr: number, size: number, cb: number, user_data: number) { const wasm_exports = getWasmExport(moduleName); log().info(ptr, size, cb, user_data, "from load callback"); const index = await getContract(moduleName, ptr, size); wasm_exports.call_loader_callback_fn(index, cb, user_data); }; }; export const _load_run = () => { return function _load_run (index: number, ptr: number, size: number) { const result = runContract(index, ptr, size); return result; }; }; let wasm_init_next = 1; // When the previous wasm init is completed, this method will // be notified to call the next wasm init export const _callback_number = (index: number, num: number) => { if (wasm_init_next >= wasm_modules_amount) { log().info("wasm modules init complate"); return; } else { log().info(`wasm entry callback, begin init module ${wasm_init_next}`); event.emit("next_wasm_init", wasm_init_next); wasm_init_next++; } };
// Dependencies // ============================================================= const express = require("express"); const router = express.Router(); // Import the model to use its database functions. const blogs = require("../models/blogs"); // Routes // ============================================================= module.exports = function (app) { // Create all our routes and set up logic within those routes where required. router.get("/", function (req, res) { blogs.all(function (data) { const hbsObject = { blogs: data }; console.log(hbsObject); res.render("index", hbsObject); }); }); router.post("/api/blogs", function (req, res) { blogs.create([ "title", "link", "summary" ], [ req.body.title, req.body.link ], function (result) { // Send back the ID of the new article res.json({ id: result.insertId }); }); }); router.put("/api/blogs/:id", function (req, res) { const condition = "id = " + req.params.id; console.log("condition", condition); blogs.update({ link: req.body.link }, condition, function (result) { if (result.changedRows == 0) { // If no rows were changed, then the ID must not exist, so 404 return res.status(404).end(); } else { res.status(200).end(); } }); }); router.delete("/api/blogs/:id", function (req, res) { const condition = "id = " + req.params.id; blogs.delete(condition, function (result) { if (result.affectedRows == 0) { // If no rows were changed, then the ID must not exist, so 404 return res.status(404).end(); } else { res.status(200).end(); } }); }); }
SELECT city, COUNT(*) AS 'NumOfCustomers' FROM Customers GROUP BY city;
""" Created on Feb 5, 2010 @author: barthelemy """ from __future__ import unicode_literals, absolute_import import unittest from py4j.java_gateway import JavaGateway, GatewayParameters from py4j.tests.java_gateway_test import ( start_example_app_process, safe_shutdown, sleep) def get_map(): return {"a": 1, "b": 2.0, "c": "z"} class AutoConvertTest(unittest.TestCase): def setUp(self): self.p = start_example_app_process() self.gateway = JavaGateway( gateway_parameters=GatewayParameters(auto_convert=True)) def tearDown(self): safe_shutdown(self) self.p.join() sleep() def testAutoConvert(self): dj = self.gateway.jvm.java.util.HashMap() dj["b"] = 2 dj["a"] = 1 dp = {"a": 1, "b": 2} self.assertTrue(dj.equals(dp)) class MapTest(unittest.TestCase): def setUp(self): self.p = start_example_app_process() self.gateway = JavaGateway() def tearDown(self): safe_shutdown(self) self.p.join() sleep() def equal_maps(self, m1, m2): if len(m1) == len(m2): equal = True for k in m1: equal = m1[k] == m2[k] if not equal: break return equal else: return False def testMap(self): dp0 = {} dp = get_map() dj = self.gateway.jvm.java.util.HashMap() self.equal_maps(dj, dp0) dj["a"] = 1 dj["b"] = 2.0 dj["c"] = "z" self.equal_maps(dj, dp) del(dj["a"]) del(dp["a"]) dj2 = self.gateway.jvm.java.util.HashMap() dj2["b"] = 2.0 dj2["c"] = "z" dj3 = self.gateway.jvm.java.util.HashMap() dj3["a"] = 1 dj3["b"] = 2.0 dj3["c"] = "z" self.equal_maps(dj, dp) self.assertEqual(dj, dj) self.assertEqual(dj, dj2) # Does not always work for some reason... # Probably not worth supporting for now... # self.assertLess(dj, dj3) self.assertNotEqual(dj, dp) dps = {1: 1, 2: 2} djs = self.gateway.jvm.java.util.HashMap() djs[1] = 1 djs[2] = 2 self.assertEqual(str(djs), str(dps)) if __name__ == "__main__": unittest.main()
#!/usr/bin/env bash # try find nginx conf conf=resume.conf if [[ ! -f ${ZEUS_NGINX_CONF}/${conf} ]];then echo "服务配置文件不存在" exit 1 else mv ${ZEUS_NGINX_CONF}/${conf} ${ZEUS_NGINX_CONF}/${conf}.stop nginx -s reload exit 0 fi
(function() { 'use strict'; angular .module('bubbleApp') .config(bubbleAppRoutes); bubbleAppRoutes.$inject = [ '$stateProvider', '$urlRouterProvider' ]; function bubbleAppRoutes($stateProvider, $urlRouterProvider) { $urlRouterProvider.otherwise('/'); $stateProvider .state('home', { url: '/', controller: 'TweetListCtrl as vm', templateUrl: 'app/tweetlist/tweetlist.html' }); } })();
//@ts-check const func = require('../solves/9'); const { testVal } = require('./helpers'); describe('#9', () => { it("1", () => { testVal(func, '1', true); }) it("-1", () => { testVal(func, '-1', false); }) it("132333231", () => { testVal(func, '132333231', true) }) it("1323332310", () => { testVal(func, '1323332310', false) }) })
#!/bin/sh # Build the .wasm Module first # Since we're compiling a side module here, so that we can load it without the # runtime cruft, we have to explicitly compile in support for malloc and # friends. # Note memcpy, memmove and memset are explicitly exported, otherwise they will # be eliminated by the SIDE_MODULE=2 setting - not sure why that happens. emcc \ src/wasm/mpeg1.c \ src/wasm/mp2.c \ src/wasm/buffer.c \ $EMSCRIPTEN/system/lib/emmalloc.cpp \ $EMSCRIPTEN/system/lib/libc/musl/src/string/memcpy.c \ $EMSCRIPTEN/system/lib/libc/musl/src/string/memmove.c \ $EMSCRIPTEN/system/lib/libc/musl/src/string/memset.c \ -s WASM=1 \ -s SIDE_MODULE=2 \ -s TOTAL_STACK=5242880\ -s USE_PTHREADS=0 \ -s LEGALIZE_JS_FFI=0\ -s NO_FILESYSTEM=1 \ -s DEFAULT_LIBRARY_FUNCS_TO_INCLUDE="[]" \ -s "EXPORTED_FUNCTIONS=[ '_memcpy', '_memmove', '_memset', '_mpeg1_decoder_create', '_mpeg1_decoder_destroy', '_mpeg1_decoder_get_write_ptr', '_mpeg1_decoder_get_index', '_mpeg1_decoder_set_index', '_mpeg1_decoder_did_write', '_mpeg1_decoder_has_sequence_header', '_mpeg1_decoder_get_frame_rate', '_mpeg1_decoder_get_coded_size', '_mpeg1_decoder_get_width', '_mpeg1_decoder_get_height', '_mpeg1_decoder_get_y_ptr', '_mpeg1_decoder_get_cr_ptr', '_mpeg1_decoder_get_cb_ptr', '_mpeg1_decoder_decode', '_mp2_decoder_create', '_mp2_decoder_destroy', '_mp2_decoder_get_write_ptr', '_mp2_decoder_get_index', '_mp2_decoder_set_index', '_mp2_decoder_did_write', '_mp2_decoder_get_left_channel_ptr', '_mp2_decoder_get_right_channel_ptr', '_mp2_decoder_get_sample_rate', '_mp2_decoder_decode']" \ -O3 \ -o jsmpeg.wasm # Concat all .js sources cat \ src/jsmpeg.js \ src/video-element.js \ src/player.js \ src/buffer.js \ src/ajax.js \ src/ajax-progressive.js \ src/websocket.js \ src/stream.js \ src/ts.js \ src/decoder.js \ src/mpeg1.js \ src/mpeg1-wasm.js \ src/mp2.js \ src/mp2-wasm.js \ src/webgl.js \ src/canvas2d.js \ src/webaudio.js \ src/wasm-module.js \ > jsmpeg.js # Append the .wasm module to the .js source as base64 string echo "JSMpeg.WASM_BINARY_INLINED='$(base64 -w 0 jsmpeg.wasm)';" \ >> jsmpeg.js # Minify uglifyjs jsmpeg.js -o jsmpeg.min.js # Cleanup rm jsmpeg.js rm jsmpeg.wasm
/****************************************************************************** Course videos: https://www.red-gate.com/hub/university/courses/t-sql/tsql-for-beginners Course scripts: https://litknd.github.io/TSQLBeginners Introducing SELECTs and Aliasing This is your HOMEWORK file For best results, work through this homework and test running the queries (learn by "doing" when you can) Need some help? Join the SQL Community Slack group for discussion: https://t.co/w5LWUuDrqG Click the + next to 'Channels' and join #tsqlbeginners *****************************************************************************/ /* ✋🏻 Doorstop ✋🏻 */ RAISERROR(N'Did you mean to run the whole thing?', 20, 1) WITH LOG; GO /* 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 Homework documentation: 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌 🚌*/ USE WideWorldImporters; GO --Not sure how to start? Get stuck? These pages will un-stick you! --WHERE: https://docs.microsoft.com/en-us/sql/t-sql/queries/where-transact-sql --LIKE: https://docs.microsoft.com/en-us/sql/t-sql/language-elements/like-transact-sql --ORDER BY: https://docs.microsoft.com/en-us/sql/t-sql/queries/select-order-by-clause-transact-sql /* 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 Homework 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 🌮 */ USE WideWorldImporters; GO /* Q1 Write a query that SELECTS all the rows from Application.People Return all columns in the table Use a "worst practice" to SELECT every column in the table GO */ /* Q2 Write a query that SELECTS all the rows from Application.People Return rows for ONLY three columns: FullName PreferredName EmailAddress - alias as: Email GO */ /* Q3 Write a query that SELECTS all the rows from Application.People Return rows for ONLY three columns: FullName PreferredName EmailAddress - alias as: Email Return ONLY rows where Email has not been entered (NULL) GO */ /* Q4 Write a query that SELECTS all the rows from Application.People Return rows for ONLY three columns: FullName PreferredName EmailAddress - alias as: Email Return ONLY rows where PreferredName is Agrita GO */ /* Q5 Write a query that SELECTS all the rows from Application.People Return rows for ONLY three columns: FullName PreferredName EmailAddress - alias as: Email Return ONLY rows where PreferredName starts with the letter A GO */ /* Q6 Write a query that SELECTS all the rows from Application.People Return rows for ONLY three columns: FullName PreferredName EmailAddress - alias as: Email Return ONLY rows where PreferredName starts with the LOWERCASE letter 'a' GO */ /* Q7 Write a query that SELECTS all the rows from Application.People Return rows for ONLY three columns: FullName PreferredName EmailAddress - alias as: Email Return ONLY rows where PreferredName contains 'y' or 'Y' anywhere in the string AND the email address contains a space Order the results by EmailAddress Ascending GO */ /* Q8 Write a query that SELECTS all the rows from Application.People Return rows for ONLY two columns: FullName The length (number of characters in) the FullName column, as calculated by the LEN() SQL Server function https://docs.microsoft.com/en-us/sql/t-sql/functions/len-transact-sql?view=sql-server-2017 alias as: Len Full Name Order the results by the length of FullName, Descending Return only 10 rows Do NOT use SET ROWCOUNT -- instead do everything in a single TSQL statement GO */ /* Q9 Write a query that SELECTS all the rows from Application.People Just like Q8... Return rows for ONLY two columns: FullName The length (number of characters in) the FullName column, as calculated by the LEN() SQL Server function https://docs.microsoft.com/en-us/sql/t-sql/functions/len-transact-sql?view=sql-server-2017 alias as: Len Full Name Order the results by the length of FullName, Descending Return only 10 rows EXCEPT this time... Return rows ONLY #11 - 20 (as ordered by description above) Do NOT use the TOP keyword, do not use ROW_NUMBER(), and do not use SET ROWCOUNT GO */