input
stringlengths
2.65k
237k
output
stringclasses
1 value
the name of the fight winner, and the method of winning. Returns a cleaned pandas table. Set round_by_round=True to use the round-by-round data. Otherwise, uses full fight stats.''' def create_aggregated_fight_table(raw_fight_tables): # Aggregate data from multiple tables fight_table = process_fight(raw_fight_tables["Totals"]) fight_table2 = process_fight(raw_fight_tables["Significant Strikes"]) # Rename column names with identical data to match fight_table2 = fight_table2.rename(columns={"Fighter 0 Sig. str": "Fighter 0 Sig. str.", "Fighter 1 Sig. str": "Fighter 1 Sig. str."}) # Bring tables together, then remove duplicates fight_table = pd.concat([fight_table, fight_table2], axis=1) fight_table = fight_table.loc[:,~fight_table.columns.duplicated()] return fight_table def create_aggregated_round_by_round_fight_table(raw_fight_tables): ##### Aggregate data totals table tables = [] for i, row in raw_fight_tables["Per Round Totals"].iterrows(): # Get df of one round df = pd.DataFrame(row) values = list(df[i].to_dict().values()) cols = list(raw_fight_tables["Totals"].columns) df = pd.DataFrame([values], columns=cols) # Update columns with round number new_cols = [f"Round {i+1} {c}" if c != "Fighter" else c for c in cols] df.columns = new_cols tables.append(process_fight(df)) # Concatenate round-by-round horizontally, so each row is for 1 fight. # Then remove duplicates totals_df = pd.concat(tables, axis=1) totals_df = totals_df.loc[:,~totals_df.columns.duplicated()] ##### Aggregate data significant strikes table tables = [] for i, row in raw_fight_tables["Per Round Significant Strikes"].iterrows(): # Get df of one round df = pd.DataFrame(row) values = list(df[i].to_dict().values()) cols = list(raw_fight_tables["Significant Strikes"].columns) if len(values) != len(cols): values = values[:-1] # Remove last column values, as shown above, has extra column for no reason df = pd.DataFrame([values], columns=cols) # Update columns with round number new_cols = [f"Round {i+1} {c}" if c != "Fighter" else c for c in cols] df.columns = new_cols tables.append(process_fight(df)) # Concatenate round-by-round horizontally, so each row is for 1 fight # Then remove duplicates sig_strikes_df = pd.concat(tables, axis=1) sig_strikes_df = sig_strikes_df.loc[:,~sig_strikes_df.columns.duplicated()] ##### Bring tables together, then remove duplicates fight_table = pd.concat([totals_df, sig_strikes_df], axis=1) fight_table = fight_table.loc[:,~fight_table.columns.duplicated()] return fight_table if round_by_round: fight_table = create_aggregated_round_by_round_fight_table(raw_fight_tables) else: fight_table = create_aggregated_fight_table(raw_fight_tables) if fight_table["Fighter 0 Name"][0] == winner: label = 0 elif fight_table["Fighter 1 Name"][0] == winner: label = 1 else: print(f'ERROR: fight_table["Fighter 0 Name"]={fight_table["Fighter 0 Name"]}, fight_table["Fighter 1 Name"]={fight_table["Fighter 1 Name"]}, winner={winner}') label = -1 fight_table['Winner'] = label fight_table['Method'] = method return fight_table # + id="BUyy5MUhNTkJ" FIGHT_TABLE = [] for i in tqdm(range(len(RAW_FIGHT_TABLES_LIST))): FIGHT_TABLE.append(process_raw_fight_tables(RAW_FIGHT_TABLES_LIST[i], WINNERS[i], METHODS[i], round_by_round=ROUND_BY_ROUND)) FIGHT_TABLE = pd.concat(FIGHT_TABLE, ignore_index=True) FIGHT_TABLE = FIGHT_TABLE.replace("^-+", np.nan, regex=True) # Replace -- and --- with nan # + id="G9EhqLLcAWs-" FIGHT_TABLE.head() # + id="7hQjO9B2RDoZ" FIGHT_TABLE.tail() # + [markdown] id="pCMOvzM0efI4" # ## Augment dataset by flipping around columns # # The system should work the same no matter what order we pass in the fighters. Let fighters be A and B. We want # # winner(fighter0=A, fighter1=B) = winner(fighter0=B, fighter1=A) # + id="kM2b_cAif7rM" def create_flipped_table(table): '''Rearranges columns of table so that each fight has two rows. Let fighters be A and B. One row has (Fighter 0 = A, Fighter 1 = B). One row has (Fighter 0 = B, Fighter 1 = A) Ensure same column order, as column names not looked at when passed to ML model''' # Get columns in flipped order, which moves the columns around, but changes column name order too flipped_columns = [] for column in table.columns: if "Fighter 0" in column: flipped_columns.append(column.replace("Fighter 0", "Fighter 1")) elif "Fighter 1" in column: flipped_columns.append(column.replace("Fighter 1", "Fighter 0")) else: flipped_columns.append(column) flipped_table = table[flipped_columns] # Flips winners around if 'Winner' in flipped_table.columns: flipped_table['Winner'] = flipped_table['Winner'].replace([0, 1], [1, 0]) # Change column names back to normal flipped_table.columns = table.columns return flipped_table # + id="KQcGgKW6k-ba" def add_rows_of_flipped_columns(table): flipped_table = create_flipped_table(table) new_table = pd.concat([table, flipped_table]) return new_table # + id="HnwZdNiplLF3" FULL_FIGHT_TABLE = add_rows_of_flipped_columns(FIGHT_TABLE) # + id="PlnOp-fbjknE" FULL_FIGHT_TABLE.head() # + [markdown] id="gu7-RmZOkP68" # ## Example of augmented data # + id="PHsGqr0_joHn" FULL_FIGHT_TABLE[(FULL_FIGHT_TABLE['Fighter 0 Name'] == "<NAME>") & (FULL_FIGHT_TABLE['Fighter 1 Name'] == "<NAME>")] # + id="samSx7Olj3vQ" FULL_FIGHT_TABLE[(FULL_FIGHT_TABLE['Fighter 1 Name'] == "<NAME>") & (FULL_FIGHT_TABLE['Fighter 0 Name'] == "<NAME>")] # + [markdown] id="3OOgguk84RJl" # ## Additional data cleaning # # TODO: See if something better than replacing nan with 0. See if something better for labels than 0 and 1. Could remove fights with no winner, or handle them differently. Could remove fights that don't go to decision by removing based on Method. # + id="RIS0yarnbTmj" X = FIGHT_TABLE.drop(['Winner', 'Fighter 0 Name', 'Fighter 1 Name', 'Method'], axis=1).fillna(0) y = FIGHT_TABLE[['Winner']] # + id="QxOiDLXHfgDx" X.head() # + id="N5qqnw6Efh8K" y.head() # + [markdown] id="JwvrHfOCf1mh" # ## Setup train/validate/test split # Can't blindly use full fight table train/validate/test split, because the augmented data must stay together. If in train we know winner(A, B) = A, then we don't want to have winner(B, A) in the validation/test set. # + id="CwlwAWNRcwJ1" from sklearn.model_selection import train_test_split X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=0.33, random_state=0) X_train, X_valid, y_train, y_valid = train_test_split(X_train, y_train, test_size=0.33, random_state=0) X_train, y_train = add_rows_of_flipped_columns(X_train), add_rows_of_flipped_columns(y_train) X_valid, y_valid = add_rows_of_flipped_columns(X_valid), add_rows_of_flipped_columns(y_valid) X_test, y_test = add_rows_of_flipped_columns(X_test), add_rows_of_flipped_columns(y_test) # + id="aFmWIOydoJXd" # Expect equal number of examples in Fighter 0 as Fighter 1 assert(len(y_train[y_train['Winner'] == 0]) == len(y_train[y_train['Winner'] == 1])) assert(len(y_valid[y_valid['Winner'] == 0]) == len(y_valid[y_valid['Winner'] == 1])) assert(len(y_test[y_test['Winner'] == 0]) == len(y_test[y_test['Winner'] == 1])) # + id="jekwTdNAk3rE" X_train.head() # + id="BUeeqFtHpZQw" y_train.head() # + id="75PnIBkYpabr" print(f"X_train.shape = {X_train.shape}") print(f"X_valid.shape = {X_valid.shape}") print(f"X_test.shape = {X_test.shape}") print(f"y_train.shape = {y_train.shape}") print(f"y_valid.shape = {y_valid.shape}") print(f"y_test.shape = {y_test.shape}") # + [markdown] id="ARUH8kxCbJpG" # ## ML Models # + id="0_v4cnEFbKp3" from sklearn.ensemble import RandomForestClassifier # + id="6gOrDS8AbPqM" # Train clf = RandomForestClassifier(max_depth=5, random_state=0) clf.fit(X_train, y_train) # Validate accuracy_train = clf.score(X_train, y_train) accuracy_valid = clf.score(X_valid, y_valid) print(f"accuracy_train = {accuracy_train}") print(f"accuracy_valid = {accuracy_valid}") # + id="dn1Njq7ecfAT" import matplotlib.pyplot as plt # Visualize importances plt.rcParams.update({'font.size': 8}) plt.barh(X_train.columns, clf.feature_importances_) # + id="GifEEZiTq2yL" # MLP from sklearn.neural_network import MLPClassifier clf = MLPClassifier(random_state=1, max_iter=300).fit(X_train, y_train) accuracy_train = clf.score(X_train, y_train) accuracy_valid = clf.score(X_valid, y_valid) print(f"accuracy_train = {accuracy_train}") print(f"accuracy_valid = {accuracy_valid}") # + id="r6tiCNo3rEE0" # SVM from sklearn.svm import SVC clf = SVC(random_state=1).fit(X_train, y_train) accuracy_train = clf.score(X_train, y_train) accuracy_valid = clf.score(X_valid, y_valid) print(f"accuracy_train = {accuracy_train}") print(f"accuracy_valid = {accuracy_valid}") # + id="KNxPPw2DrbpW" # FFN import tensorflow as tf model = tf.keras.models.Sequential() model.add(tf.keras.Input(shape=X_train.shape[1:])) model.add(tf.keras.layers.Dense(32, activation='relu')) model.add(tf.keras.layers.Dense(32, activation='relu')) model.add(tf.keras.layers.Dense(1, activation='sigmoid')) model.compile(optimizer='adam', loss='binary_crossentropy', metrics=['accuracy']) tf.keras.utils.plot_model(model, show_shapes=True, rankdir="LR") # + id="agRwGSv2IEKa" model.summary() # + id="Wo9gE7_HtQhl" model.fit(X_train, y_train, epochs=100, validation_data=(X_valid, y_valid)) # + id="RWTGwJUVtalk" model.evaluate(X_train, y_train) model.evaluate(X_valid, y_valid) # + [markdown] id="ZOwm0hZTxZyr" # ## Test out model manually # + id="OWIypYX-uryi" idx = 6 # + id="ofKgNtPPuC0V" X_test.iloc[idx] # + id="4tEAEW59ulsz" # 0 means fighter 0 won. 1 means fighter 1 won. y_test.iloc[idx] # + id="67EbW0E1uXGi" X_test.shape # + id="3FWZP5LfuYYJ" X_test.iloc[idx].shape # + id="W19rlXXouGfs" model.predict(np.expand_dims(X_test.iloc[idx], 0)) # + [markdown] id="ZOwm0hZTxZyr" # ## Save data # # Store beginning file parameters. # Use current date and time to save files uniquely. # + from datetime import datetime now = datetime.now() dt_string = now.strftime("%d-%m-%Y_%H:%M:%S") print("dt_string =", dt_string) # - parameters_string = f"NUM_EVENTS_{NUM_EVENTS_INPUT}_DATA_MODE_{DATA_MODE_INPUT}" print("parameters_string =", parameters_string) import pickle filename1 = f"FULL_FIGHT_TABLE_{parameters_string}_{dt_string}.csv" filename2 = f"FIGHT_TABLE_{parameters_string}_{dt_string}.csv" filename3 = f"ALL_FIGHTERS_{parameters_string}_{dt_string}.csv" filename4 = f"RAW_FIGHT_TABLES_LIST_{parameters_string}_{dt_string}.pkl" print(f"Saving to {filename1} and {filename2} and {filename3} and {filename4}") FULL_FIGHT_TABLE.to_csv(filename1, index=False) FIGHT_TABLE.to_csv(filename2, index=False) ALL_FIGHTERS.to_csv(filename3, index=False) with open(filename4, 'wb') as handle: pickle.dump(RAW_FIGHT_TABLES_LIST, handle, protocol=pickle.HIGHEST_PROTOCOL) new = pd.read_csv(filename1) new with open(filename4, 'rb') as pickle_file: new2 = pickle.load(pickle_file) len(new2[0]) # ## Experimental: Get detailed fighter information # # TODO: Get more detailed information about fighters, so we can change the task to fight prediction using fighter stats only. http://ufcstats.com/statistics/fighters?char=a&page=all has little information compared to http://ufcstats.com/fighter-details/33a331684283900f. Still lots to improve. Better features like strikes per minute. Handling nans better. Handling non win/losses better. def get_all_fighters_detailed(): '''Get pandas table with detailed information about all UFC fighters (KO's, strikes, etc.)''' fighter_detailed_tables = [] # For each letter of the alphabet, get the fighters for c in tqdm(ascii_lowercase): # Each page has a list of fighter detail urls all_fighters_url = f"http://ufcstats.com/statistics/fighters?char={c}&page=all" all_fighters_html = urlopen(all_fighters_url).read().decode("utf-8") # Regex for "http://ufcstats.com/fighter-details/<alphanumeric>" # Eg. "http://ufcstats.com/fighter-details/27541033b97c076d" pattern = "\"http://ufcstats.com/fighter-details/[a-zA-Z0-9_]+\"" urls = re.findall(pattern, all_fighters_html) # Remove quotes and duplicates urls = [url.strip("\"") for url in urls] urls = remove_duplicates_keep_order(urls) # For each fighter detail url, merge together their record information # Initially in form "<NAME>", "0 0", "1:10, 0:00" # Want just "<NAME>", "0", "1:10", then convert to numbers # Just need to get the first value of each one, then average/sum/aggregate this together for url in urls: fighter_table = pd.read_html(url)[0].dropna(subset=["Time"], how='all') # Drop initial row of nans # If no fight information, add empty dataframe if fighter_table.shape[0] == 0: df = pd.DataFrame() fighter_detailed_tables.append(df) continue # Preprocess certain values for consistency # TODO: Handle this better, perhaps keep more information fighter_table = fighter_table.drop(columns=["Method", "Event"]) fighter_table.loc[~fighter_table['W/L'].isin(['win', 'loss']), 'W/L'] = "-1 -1" fighter_table.loc[fighter_table['W/L'] == 'win', 'W/L'] = "1 1" fighter_table.loc[fighter_table['W/L'] == 'loss', 'W/L'] = "0 0" times = [int(min_) * 60 + int(sec) for min_, sec in fighter_table['Time'].str.split(':')] fighter_table['Time'] = [f"{t} {t}" for t in times] # Parse each row to remove the other fighter's information new_rows = [] for i, row in fighter_table.iterrows(): # Get df
<reponame>omikabir/omEngin<filename>TBOT/mssql.py import pandas as pd import pyodbc from datetime import * soc = "Driver={SQL Server};SERVER=192.168.88.121;DATABASE=SOC_Roster;UID=sa;PWD=<PASSWORD>&" #soc = "Driver={SQL Server};SERVER=localhost;DATABASE=SOC_Roster;UID=sa;PWD=<PASSWORD>$" def chk_exist(qry): conn = pyodbc.connect(soc) df = pd.read_sql(qry, con=conn) return df.shape[0] def exqry(qr): conn = pyodbc.connect(soc) cr = conn.cursor() print(qr) st = 'does not exist' if 'select' in qr: cr.execute(qr) rs = cr.fetchone() try: for i in rs: if st == 'does not exist': st = i else: st = st + ' | ' + i return st except: return st else: if isinstance(qr, str): try: cr.execute(qr) conn.commit() return 'successfully' except: print(qr, 'failed') return '' elif isinstance(qr, list): cnt = 0 for i in range(len(qr)): try: cr.execute(qr) cnt = cnt + 1 except: pass else: st = cnt + ' rows modified successfully' return st def execute_qry(qq, colname=[]): conn = pyodbc.connect(soc) print('query execute- ', qq) if "select" in qq: df = pd.read_sql(qq, con=conn) heap = '' ls = [] if len(colname) != 0: dfx = df[colname] df = dfx print(df) if df.shape[0] > 1: for i in range(len(df)): hp = '' for j in df: if hp == '': hp = df.loc[i, j] else: hp = hp + ',' + df.loc[i, j] if heap == '': heap = hp elif len(heap) < 3500: heap = heap + chr(10) + hp else: ls.append(heap) heap = '' else: ls.append(heap) return ls elif df.shape[0] == 1: hp = '' for i in df: if hp == '': hp = df.loc[0, i] else: hp = hp + chr(10) + df.loc[0, i] return hp else: return 'not exist' elif "update" in qq or "delete" in qq: cr = conn.cursor() try: cr.execute(qq) conn.commit() return "successful" except: return "failed" else: cr = conn.cursor() cr.execute(qq) def qry_code_name(code, cols = []): qry = "select Site_Name from sitebase where Site_Code LIKE '%" + code + "%'" conn = pyodbc.connect(soc) cr = conn.cursor() st = '' try: cr.execute(qry) rs = cr.fetchone() for i in rs: if st == '': st = i else: st = st + ", " + i return st except: return "" def qry_select(tx2, omv): qry = '' qy = '' tbl = '' if 'CONTACT' in tx2 or 'CONTACTS' in tx2: qry = "select Number from PeriCon where Number LIKE '%" + omv + "%'" qy = exqry(qry) tbl = ' periodic contacts' elif "ABH" in tx2 or 'ABHIGHTECH' in tx2: qry = "select Code from ABHI where Code LIKE '%" + omv + "%'" qy = exqry(qry) tbl = ' AB hi-tech' elif "RMT" in tx2 or 'ROBIMT' in tx2: qry = "select Code,Name from RMT where Code LIKE '%" + omv + "%'" qy = exqry(qry) tbl = ' robi mt' elif "VIP" in tx2: qry = "select Code,Name from VIP where Code LIKE '%" + omv + "%'" qy = exqry(qry) tbl = ' vip' elif "TOP5" in tx2: qry = "select Code,Name from TOP5 where Code LIKE '%" + omv + "%'" qy = exqry(qry) tbl = ' vip top5' elif "EXCEPTION" in tx2: qry = "select code from EXCEPTION where Code LIKE '%" + omv + "%'" qy = exqry(qry) tbl = 'EXCEPTION ' else: txx = tx2.split(',') qry = "select * from " + txx[1] + "where Code LIKE '%" + omv + "%'" qy = exqry(qry) if str(omv) in str(qy): return omv + ' already exist in' + tbl else: return omv + ' does not exist in' + tbl def qry_add(tx2, omv): qry = '' sitename = '' result = qry_select(tx2, omv) if 'does not exist' in result: if 'CONTACT' in tx2: qry = "insert into PeriCon (Number) values ('" + omv + "')" tbl = " in periodic contacts " elif "ABH" in tx2: qry = "insert into ABHI (Code) values ('" + omv + "')" tbl = " in ab-hitech " elif "RMT" in tx2: sitename = qry_code_name(omv) qry = "insert into RMT (Code,Name) values ('" + omv + "','" + sitename + "')" tbl = " in RMT " elif "VIP" in tx2: sitename = qry_code_name(omv) qry = "insert into VIP (Code,Name) values ('" + omv + "','" + sitename + "')" tbl = " in VIP " elif "VIPTOP5" in tx2: sitename = qry_code_name(omv) qry = "insert into TOP5 (Code,Name) values ('" + omv + "','" + sitename + "')" tbl = " in VIPTO5 " elif "EXCEPTION" in tx2: qry = "insert into EXCEPTION (code,reason) values ('" + omv + "','" + "" + "')" tbl = " in EXCEPTION " if qry != '': rs = exqry(qry) if 'failed' not in rs: return 'added ' + omv + tbl + rs else: return 'adding failed - ' + omv + tbl + rs else: return result def qry_delete(tx2, omv): qry = '' result = qry_select(tx2, omv) print('chk result', result) if 'does not exist' not in result: if 'CONTACT' in tx2: qry = "DELETE FROM PeriCon WHERE Number Like '" + omv + "'" tbl = " from periodic contacts " elif "ABH" in tx2: qry = "DELETE FROM ABHI WHERE Code Like '" + omv + "'" tbl = " from ABHI-TECH " elif "RMT" in tx2: qry = "DELETE FROM RMT WHERE Code Like '" + omv + "'" tbl = " from Robi top MGT " elif "VIP" in tx2: qry = "DELETE FROM VIP WHERE Code Like '" + omv + "'" tbl = " from VIP " elif "VIPTOP5" in tx2: qry = "DELETE FROM TOP5 WHERE Code Like '" + omv + "'" tbl = " from VIP-TOP5 " elif "EXCEPTION" in tx2: qry = "DELETE FROM EXCEPTION WHERE code Like '" + omv + "'" tbl = " from EXCEPTION " if qry != '': rs = exqry(qry) return 'removed ' + omv + tbl + rs else: return 'failed' else: return result def auth_check_db(uid): conn = pyodbc.connect(soc) qry = "select * from om_socbot_access" df1 = pd.read_sql(qry, con=conn) df = df1[df1['UID'].str.contains(uid)] x = df.shape[0] conn.close() if x == 0: return 0 else: return 1 def query_code_or_ms(tx): try: if ',' in tx: txx = tx.split(',') xx = str(txx[2]) xxy = xx.strip(' ') print('xx - ', xxy) return xxy else: txx = tx.split(' ') xx = str(txx[2]) if len(xx) == 10 or len(xx) == 11: return xx else: return "" except: return "" def private_add_rmv_upd(txt, ty='text'): print('private_add_rmv_upd') if ty == 'text': tx1 = txt.upper() rs = query_code_or_ms(tx1) print(rs) qx = '' qy = '' if rs != '': if 'CHK' in tx1: qx = qry_select(tx1, rs) return qx elif 'RMV' in tx1: qx = qry_delete(tx1, rs) return qx elif 'ADD' in tx1: qx = qry_add(tx1, rs) return qx else: return "NA" else: print('x') def rpa_help(): rpachk = ["chk, VIP, PBSDR01", "chk, ABHITECH, KHSDR56", "chk, TOP5, DHGUL19", "chk, contact, 01817183680", "chk, RMT, DHGULF2", "chk, exception, DHGULF2"] rpaadd = ["add, VIP, PBSDR01", "add, ABHITECH, PBSDR01", "add, TOP5, PBSDR01", "add, contact, 01717015682", "add, RMT, DHGULF0", "add, exception, DHGULF2"] rparmv = ["rmv, VIP, PBSDR01", "rmv, ABHITECH, PBSDR01", "rmv, TOP5, PBSDR01", "rmv, contact, 01717015682", "rmv, RMT, DHGULF0", "rmv, exception, DHGULF2"] st = '' for i in range(len(rpachk)): st1 = rpachk[i] st2 = rpaadd[i] st3 = rparmv[i] if st =='': st = st1 + chr(10) + st2 + chr(10) + st3 else: st = st + chr(10) + st1 + chr(10) + st2 + chr(10) + st3 else: return st def priority(txt): tx2 = txt.upper() qq = '' if tx2 == "RWS": qq = "select TOP 1 msgtext from rpa_msg where msghead ='update s' ORDER BY SL DESC" elif tx2 == "P1": qq = "select TOP 1 msgtext from rpa_msg where msghead ='update p1' ORDER BY SL DESC" elif tx2 == "P2": qq = "select TOP 1 msgtext from rpa_msg where msghead ='update p2' ORDER BY SL DESC" if qq != '': rs = exqry(qq) if rs != '': return rs else: return "database update on going, please try
# -*- coding: utf-8 -*- """ Created on Thu Dec 5 16:16:35 2019 @author: Meghana """ # import os # os.environ['JOBLIB_START_METHOD'] = "forkserver" # export JOBLIB_START_METHOD="forkserver" from numpy import exp as np_exp from numpy.random import uniform as rand_uniform from tqdm import tqdm from joblib import Parallel, delayed from pickle import load as pickle_load, dump as pickle_dump from logging import info as logging_info, debug as logging_debug from os import mkdir as os_mkdir, path as os_path,remove as os_remove from distutils.dir_util import copy_tree from shutil import copyfile,rmtree from networkx import Graph as nx_Graph from multiprocessing import cpu_count as mul_cpu_count from sample_helpers import * def search_max_neig(seed_node, scaler, par_inputs_fn): with open(par_inputs_fn, 'rb') as f: inputs = pickle_load(f) with open(inputs['modelfname'], 'rb') as f: model = pickle_load(f) # Seed node logging_debug("Seed node is", seed_node) folNm = inputs['folNm'] folNm_out = inputs['folNm_out'] max_nodes = inputs["max_size"] score_curr = 0 cd, g1 = starting_edge(folNm, seed_node) if cd == 0: return while len(g1) < max_nodes: # print(len(g1)) logging_debug("Adding next node") neig_list = read_neigs(g1.nodes(), folNm) if not neig_list: # Checking if empty logging_debug("No more neighbors to add") break node_to_add = max(neig_list.items(), key=lambda elem: elem[1]['weight'])[0] g1 = add_newnode(g1, node_to_add, neig_list[node_to_add]['graph_neigs']) score_prev = score_curr (score_curr, comp_bool) = get_score(g1, model, scaler, inputs['model_type']) if score_curr < inputs["classi_thresh"]: logging_debug("Complex found") # Remove the node last added g1.remove_node(node_to_add) score_curr = score_prev break with open(folNm_out + "/" + seed_node, 'wb') as f: pickle_dump((frozenset(g1.nodes()), score_curr), f) def search_top_neigs(seed_node, scaler, par_inputs_fn): # Picks out of a subset of its neighbors and adds the best node # logging_debug("No. of nodes in g = ",len(G)) # Assigning original graph to temporary variable with open(par_inputs_fn, 'rb') as f: inputs = pickle_load(f) with open(inputs['modelfname'], 'rb') as f: model = pickle_load(f) folNm = inputs['folNm'] folNm_out = inputs['folNm_out'] cd, g1 = starting_edge(folNm, seed_node) if cd == 0: return score_curr = 0 max_nodes = inputs["max_size"] thres_neig = inputs["thres_neig"] # Threshold on number of neighbors to consider while len(g1) < max_nodes: score_prev = score_curr logging_debug("Adding next node") g1, cc, node_to_add, score_curr, comp_bool, rand_flag = add_top_neig(g1, thres_neig, folNm, inputs, model, scaler) if (score_curr is None) or (comp_bool is None): score_curr, comp_bool = get_score(g1, model, scaler, inputs['model_type']) if cc == 0: break if score_curr < inputs["classi_thresh"]: logging_debug("Complex found") # Remove the node last added g1.remove_node(node_to_add) score_curr = score_prev break with open(folNm_out + "/" + seed_node, 'wb') as f: pickle_dump((frozenset(g1.nodes()), score_curr), f) def met(g1, model, scaler, inputs, score_prev): max_nodes = inputs["max_size"] - len(g1) num_iter = 1 last_iter_imp = 0 thres_neig = inputs["thres_neig"] prob_metropolis = inputs["prob_metropolis"] folNm = inputs['folNm'] met_low_prob_acc = 0 while num_iter < max_nodes: # Limiting number of iteration rounds logging_debug("Adding next node") # neig_list_old = neig_list # g1, cc, node_to_add, score_curr, comp_bool, rand_flag, neig_list = add_top_neig(g1, thres_neig, folNm, inputs, model, scaler, neig_list) g1, cc, node_to_add, score_curr, comp_bool, rand_flag = add_top_neig(g1, thres_neig, folNm, inputs, model, scaler) if (score_curr is None) or (comp_bool is None): score_curr, comp_bool = get_score(g1, model, scaler, inputs['model_type']) if cc == 0: break if score_curr < inputs["classi_thresh"]: logging_debug("Complex found") # Remove the node last added g1.remove_node(node_to_add) break cur_trial = rand_uniform(low=0.0, high=1.0) if score_curr < score_prev: if cur_trial > prob_metropolis: # Remove the node last added g1.remove_node(node_to_add) # neig_list = neig_list_old else: logging_debug("Accepting with low probability") met_low_prob_acc += 1 rand_flag = 1 elif score_curr > score_prev: last_iter_imp = num_iter if (num_iter - last_iter_imp) > 10: # Has been a long time since a score improvement logging_debug("Long time since score improvement") break score_prev = score_curr num_iter += 1 logging_debug("No. of low probability acceptances = ") logging_debug(str(met_low_prob_acc)) # print(g1.nodes()) # print(g1.edges()) return frozenset(g1.nodes()), score_prev def search_metropolis_clique_start(scaler, par_inputs_fn, G_clique): # Picks out of a subset of its neighbors and adds the best node # print(seed_clique) with open(par_inputs_fn, 'rb') as f: inputs = pickle_load(f) with open(inputs['modelfname'], 'rb') as f: model = pickle_load(f) g1 = nx_Graph(G_clique) # Finding score score_prev, comp_bool = get_score(g1, model, scaler, inputs['model_type']) # Removing starting points which are not complexes if score_prev < inputs["classi_thresh"]: return a, b = met(g1, model, scaler, inputs, score_prev) name = " ".join([str(n) for n in g1.nodes()]) with open(folNm_out + "/" + name, 'wb') as f: pickle_dump((a, b), f) def search_metropolis(seed_node, scaler, par_inputs_fn): # Picks out of a subset of its neighbors and adds the best node with open(par_inputs_fn, 'rb') as f: inputs = pickle_load(f) with open(inputs['modelfname'], 'rb') as f: model = pickle_load(f) folNm = inputs['folNm'] folNm_out = inputs['folNm_out'] cd, g1 = starting_edge(folNm, seed_node) if cd == 0: return a, b = met(g1, model, scaler, inputs, 0) with open(folNm_out + "/" + seed_node, 'wb') as f: pickle_dump((a, b), f) def search_isa(seed_node, scaler, par_inputs_fn): # Picks out of a subset of its neighbors and adds the best node with open(par_inputs_fn, 'rb') as f: inputs = pickle_load(f) with open(inputs['modelfname'], 'rb') as f: model = pickle_load(f) folNm = inputs['folNm'] folNm_out = inputs['folNm_out'] score_prev = 0 cd, g1 = starting_edge(folNm, seed_node) if cd == 0: return max_nodes = inputs["max_size"] - len(g1) num_iter = 1 last_iter_imp = 0 thres_neig = inputs["thres_neig"] T = inputs["T0"] # T0 value alpha = inputs["alpha"] while num_iter < max_nodes: # Limiting number of iteration rounds logging_debug("Adding next node") # neig_list_old = neig_list # g1, cc, node_to_add, score_curr, comp_bool, rand_flag, neig_list = add_top_neig(g1, thres_neig, folNm, inputs, model, scaler, neig_list) g1, cc, node_to_add, score_curr, comp_bool, rand_flag = add_top_neig(g1, thres_neig, folNm, inputs, model, scaler) if (score_curr is None) or (comp_bool is None): score_curr, comp_bool = get_score(g1, model, scaler, inputs['model_type']) if cc == 0: break if score_curr < inputs["classi_thresh"]: logging_debug("Complex found") # Remove the node last added g1.remove_node(node_to_add) break cur_trial = rand_uniform(low=0.0, high=1.0) if score_curr < score_prev: prob_isa = np_exp((score_curr - score_prev) / T) if cur_trial > prob_isa: # Remove the node last added g1.remove_node(node_to_add) # neig_list = neig_list_old else: logging_debug("Accepting with low probability") rand_flag = 1 elif score_curr > score_prev: last_iter_imp = num_iter if (num_iter - last_iter_imp) > 10: # Has been a long time since a score improvement logging_debug("Long time since score improvement") break score_prev = score_curr num_iter += 1 T = float(T) / alpha # If number of nodes is less than 2, don't write. with open(folNm_out + "/" + seed_node, 'wb') as f: pickle_dump((frozenset(g1.nodes()), score_prev), f) def sample(inputs, G, modelfname, scaler, seed_nodes, max_size,transfer2tmp): seed_mode = inputs['seed_mode'] out_comp_nm = inputs['dir_nm'] + inputs['out_comp_nm'] logging_info("Sampling complexes...") num_cores = mul_cpu_count() if 'num_cores' in inputs: num_cores = inputs['num_cores'] # num_comp = 10 num_comp = len(seed_nodes) with open(out_comp_nm + '_metrics.out', "a") as fid: print("No. of cores = ", num_cores, file=fid) print("No. of seeds for complex search = ", num_comp, file=fid) search_method = inputs["search_method"] folNm_out = "/tmp/" + out_comp_nm + "_orig_comps" folNm = inputs['dir_nm'] + inputs['graph_files_dir'] + "/neig_dicts" if not os_path.exists("/tmp/"): os_mkdir("/tmp/") if not os_path.exists("/tmp/" + inputs['dir_nm']): os_mkdir("/tmp/" + inputs['dir_nm']) if not os_path.exists("/tmp/" + inputs['dir_nm'] + inputs['graph_files_dir'] ): os_mkdir("/tmp/" + inputs['dir_nm'] + inputs['graph_files_dir'] ) if not os_path.exists("/tmp/" + out_comp_nm[:-3]): os_mkdir("/tmp/" + out_comp_nm[:-3]) out_comp_nm_model = inputs['dir_nm'] + inputs['model_dir'] if not os_path.exists("/tmp/" + out_comp_nm_model[:-3]): os_mkdir("/tmp/" + out_comp_nm_model[:-3]) if not os_path.exists(folNm_out): os_mkdir(folNm_out) tmp_prefix_read = "" if transfer2tmp: tmp_prefix_read = "/tmp/" if "classi_thresh" not in inputs: inputs["classi_thresh"] = 0.5 par_inputs = {"classi_thresh": inputs["classi_thresh"],"use_all_neigs": inputs["use_all_neigs"], "min_thres_neig_sorted": inputs["min_thres_neig_sorted"], "modelfname": tmp_prefix_read + modelfname, "folNm_out": folNm_out, "folNm": tmp_prefix_read + folNm, "model_type": inputs["model_type"], "max_size": max_size, "perc": inputs["perc"], "thres_neig": inputs["thres_neig"], "T0": inputs["T0"], "alpha": inputs["alpha"], "prob_metropolis": inputs["prob_metropolis"], "explore_prob": inputs["explore_prob"], "feats": inputs["feats"]} par_inputs_fn = tmp_prefix_read + inputs['dir_nm'] + "/res_par_inputs" if transfer2tmp: if not os_path.exists("/tmp/" + modelfname): copyfile(modelfname, "/tmp/" + modelfname) if not os_path.exists("/tmp/" + folNm): os_mkdir("/tmp/" + folNm) copy_tree(folNm, "/tmp/" + folNm) with open(par_inputs_fn, 'wb') as f: pickle_dump(par_inputs, f) if inputs["run_mode"] == "parallel": # method = "threads" method = "processes" # better since we are not releasing the GIL ? prefer not required # when backend is specified. (prefer = method in parallel args) back = 'loky' # loky and multiprocessing for processes and threading for threads if "backend" in inputs: back = inputs['backend'] if seed_mode == "cliques": Parallel(n_jobs=num_cores, backend=back)( delayed(search_metropolis_clique_start)(scaler, par_inputs_fn, G.subgraph(clique)) for clique in tqdm(seed_nodes)) elif search_method == "isa": Parallel(n_jobs=num_cores, backend=back)( delayed(search_isa)(node, scaler, par_inputs_fn) for node in tqdm(seed_nodes)) elif search_method ==
everything. :param str field_selector: A selector to restrict the list of returned objects by their fields. Defaults to everything. :param bool watch: Watch for changes to the described resources and return them as a stream of add, update, and remove notifications. Specify resourceVersion. :param str resource_version: When specified with a watch call, shows changes that occur after that particular version of a resource. Defaults to changes from the beginning of history. :param int timeout_seconds: Timeout for the list/watch call. :return: V1PersistentVolumeClaimList If the method is called asynchronously, returns the request thread. """ all_params = ['namespace', 'pretty', 'label_selector', 'field_selector', 'watch', 'resource_version', 'timeout_seconds'] all_params.append('callback') params = locals() for key, val in iteritems(params['kwargs']): if key not in all_params: raise TypeError( "Got an unexpected keyword argument '%s'" " to method list_namespaced_persistent_volume_claim" % key ) params[key] = val del params['kwargs'] # verify the required parameter 'namespace' is set if ('namespace' not in params) or (params['namespace'] is None): raise ValueError("Missing the required parameter `namespace` when calling `list_namespaced_persistent_volume_claim`") resource_path = '/api/v1/namespaces/{namespace}/persistentvolumeclaims'.replace('{format}', 'json') method = 'GET' path_params = {} if 'namespace' in params: path_params['namespace'] = params['namespace'] query_params = {} if 'pretty' in params: query_params['pretty'] = params['pretty'] if 'label_selector' in params: query_params['labelSelector'] = params['label_selector'] if 'field_selector' in params: query_params['fieldSelector'] = params['field_selector'] if 'watch' in params: query_params['watch'] = params['watch'] if 'resource_version' in params: query_params['resourceVersion'] = params['resource_version'] if 'timeout_seconds' in params: query_params['timeoutSeconds'] = params['timeout_seconds'] header_params = {} form_params = {} files = {} body_params = None # HTTP header `Accept` header_params['Accept'] = self.api_client.\ select_header_accept(['application/json', 'application/yaml']) if not header_params['Accept']: del header_params['Accept'] # HTTP header `Content-Type` header_params['Content-Type'] = self.api_client.\ select_header_content_type(['*/*']) # Authentication setting auth_settings = [] response = self.api_client.call_api(resource_path, method, path_params, query_params, header_params, body=body_params, post_params=form_params, files=files, response_type='V1PersistentVolumeClaimList', auth_settings=auth_settings, callback=params.get('callback')) return response def create_namespaced_persistent_volume_claim(self, body, namespace, **kwargs): """ create a PersistentVolumeClaim This method makes a synchronous HTTP request by default. To make an asynchronous HTTP request, please define a `callback` function to be invoked when receiving the response. >>> def callback_function(response): >>> pprint(response) >>> >>> thread = api.create_namespaced_persistent_volume_claim(body, namespace, callback=callback_function) :param callback function: The callback function for asynchronous request. (optional) :param V1PersistentVolumeClaim body: (required) :param str namespace: object name and auth scope, such as for teams and projects (required) :param str pretty: If 'true', then the output is pretty printed. :return: V1PersistentVolumeClaim If the method is called asynchronously, returns the request thread. """ all_params = ['body', 'namespace', 'pretty'] all_params.append('callback') params = locals() for key, val in iteritems(params['kwargs']): if key not in all_params: raise TypeError( "Got an unexpected keyword argument '%s'" " to method create_namespaced_persistent_volume_claim" % key ) params[key] = val del params['kwargs'] # verify the required parameter 'body' is set if ('body' not in params) or (params['body'] is None): raise ValueError("Missing the required parameter `body` when calling `create_namespaced_persistent_volume_claim`") # verify the required parameter 'namespace' is set if ('namespace' not in params) or (params['namespace'] is None): raise ValueError("Missing the required parameter `namespace` when calling `create_namespaced_persistent_volume_claim`") resource_path = '/api/v1/namespaces/{namespace}/persistentvolumeclaims'.replace('{format}', 'json') method = 'POST' path_params = {} if 'namespace' in params: path_params['namespace'] = params['namespace'] query_params = {} if 'pretty' in params: query_params['pretty'] = params['pretty'] header_params = {} form_params = {} files = {} body_params = None if 'body' in params: body_params = params['body'] # HTTP header `Accept` header_params['Accept'] = self.api_client.\ select_header_accept(['application/json', 'application/yaml']) if not header_params['Accept']: del header_params['Accept'] # HTTP header `Content-Type` header_params['Content-Type'] = self.api_client.\ select_header_content_type(['*/*']) # Authentication setting auth_settings = [] response = self.api_client.call_api(resource_path, method, path_params, query_params, header_params, body=body_params, post_params=form_params, files=files, response_type='V1PersistentVolumeClaim', auth_settings=auth_settings, callback=params.get('callback')) return response def deletecollection_namespaced_persistent_volume_claim(self, namespace, **kwargs): """ delete collection of PersistentVolumeClaim This method makes a synchronous HTTP request by default. To make an asynchronous HTTP request, please define a `callback` function to be invoked when receiving the response. >>> def callback_function(response): >>> pprint(response) >>> >>> thread = api.deletecollection_namespaced_persistent_volume_claim(namespace, callback=callback_function) :param callback function: The callback function for asynchronous request. (optional) :param str namespace: object name and auth scope, such as for teams and projects (required) :param str pretty: If 'true', then the output is pretty printed. :param str label_selector: A selector to restrict the list of returned objects by their labels. Defaults to everything. :param str field_selector: A selector to restrict the list of returned objects by their fields. Defaults to everything. :param bool watch: Watch for changes to the described resources and return them as a stream of add, update, and remove notifications. Specify resourceVersion. :param str resource_version: When specified with a watch call, shows changes that occur after that particular version of a resource. Defaults to changes from the beginning of history. :param int timeout_seconds: Timeout for the list/watch call. :return: UnversionedStatus If the method is called asynchronously, returns the request thread. """ all_params = ['namespace', 'pretty', 'label_selector', 'field_selector', 'watch', 'resource_version', 'timeout_seconds'] all_params.append('callback') params = locals() for key, val in iteritems(params['kwargs']): if key not in all_params: raise TypeError( "Got an unexpected keyword argument '%s'" " to method deletecollection_namespaced_persistent_volume_claim" % key ) params[key] = val del params['kwargs'] # verify the required parameter 'namespace' is set if ('namespace' not in params) or (params['namespace'] is None): raise ValueError("Missing the required parameter `namespace` when calling `deletecollection_namespaced_persistent_volume_claim`") resource_path = '/api/v1/namespaces/{namespace}/persistentvolumeclaims'.replace('{format}', 'json') method = 'DELETE' path_params = {} if 'namespace' in params: path_params['namespace'] = params['namespace'] query_params = {} if 'pretty' in params: query_params['pretty'] = params['pretty'] if 'label_selector' in params: query_params['labelSelector'] = params['label_selector'] if 'field_selector' in params: query_params['fieldSelector'] = params['field_selector'] if 'watch' in params: query_params['watch'] = params['watch'] if 'resource_version' in params: query_params['resourceVersion'] = params['resource_version'] if 'timeout_seconds' in params: query_params['timeoutSeconds'] = params['timeout_seconds'] header_params = {} form_params = {} files = {} body_params = None # HTTP header `Accept` header_params['Accept'] = self.api_client.\ select_header_accept(['application/json', 'application/yaml']) if not header_params['Accept']: del header_params['Accept'] # HTTP header `Content-Type` header_params['Content-Type'] = self.api_client.\ select_header_content_type(['*/*']) # Authentication setting auth_settings = [] response = self.api_client.call_api(resource_path, method, path_params, query_params, header_params, body=body_params, post_params=form_params, files=files, response_type='UnversionedStatus', auth_settings=auth_settings, callback=params.get('callback')) return response def read_namespaced_persistent_volume_claim(self, namespace, name, **kwargs): """ read the specified PersistentVolumeClaim This method makes a synchronous HTTP request by default. To make an asynchronous HTTP request, please define a `callback` function to be invoked when receiving the response. >>> def callback_function(response): >>> pprint(response) >>> >>> thread = api.read_namespaced_persistent_volume_claim(namespace, name, callback=callback_function) :param callback function: The callback function for asynchronous request. (optional) :param str namespace: object name and auth scope, such as for teams and projects (required) :param str name: name of the PersistentVolumeClaim (required) :param str pretty: If 'true', then the output is pretty printed. :param bool export: Should this value be exported. Export strips fields that a user can not specify. :param bool exact: Should the export be exact. Exact export maintains cluster-specific fields like 'Namespace' :return: V1PersistentVolumeClaim If the method is called asynchronously, returns the request thread. """ all_params = ['namespace', 'name', 'pretty', 'export', 'exact'] all_params.append('callback') params = locals() for key, val in iteritems(params['kwargs']): if key not in all_params: raise TypeError( "Got an unexpected keyword argument '%s'" " to method read_namespaced_persistent_volume_claim" % key ) params[key] = val del params['kwargs'] # verify the required parameter 'namespace' is set if ('namespace' not in params) or (params['namespace'] is None): raise ValueError("Missing the required parameter `namespace` when calling `read_namespaced_persistent_volume_claim`") # verify the required parameter 'name' is set if ('name' not in params) or (params['name'] is None): raise ValueError("Missing the required parameter `name` when calling `read_namespaced_persistent_volume_claim`") resource_path = '/api/v1/namespaces/{namespace}/persistentvolumeclaims/{name}'.replace('{format}', 'json') method = 'GET' path_params = {} if 'namespace' in params: path_params['namespace'] = params['namespace'] if 'name' in params: path_params['name'] = params['name'] query_params = {} if 'pretty' in params: query_params['pretty'] = params['pretty'] if 'export' in params: query_params['export'] = params['export'] if 'exact' in params: query_params['exact'] = params['exact'] header_params = {} form_params = {} files = {} body_params = None # HTTP header `Accept` header_params['Accept'] = self.api_client.\ select_header_accept(['application/json', 'application/yaml']) if not header_params['Accept']: del header_params['Accept'] # HTTP header `Content-Type` header_params['Content-Type'] = self.api_client.\ select_header_content_type(['*/*']) # Authentication setting auth_settings = [] response = self.api_client.call_api(resource_path, method, path_params, query_params, header_params, body=body_params, post_params=form_params, files=files, response_type='V1PersistentVolumeClaim', auth_settings=auth_settings, callback=params.get('callback')) return response def replace_namespaced_persistent_volume_claim(self, body, namespace, name, **kwargs):
<reponame>toastisme/cctbx_project<filename>mmtbx/command_line/geometry_minimization.py # LIBTBX_SET_DISPATCHER_NAME phenix.geometry_minimization from __future__ import absolute_import, division, print_function import mmtbx.refinement.geometry_minimization import mmtbx.utils from iotbx.pdb import combine_unique_pdb_files import iotbx.phil from cctbx.array_family import flex from libtbx.utils import user_plus_sys_time, Sorry from libtbx import runtime_utils import os import sys from six.moves import cStringIO as StringIO from mmtbx.monomer_library import pdb_interpretation from mmtbx.hydrogens import riding import mmtbx.model from cctbx import uctbx base_params_str = """\ silent = False .type = bool write_geo_file = True .type = bool file_name = None .type = path .short_caption = Model file .style = file_type:pdb bold input_file show_states = False .type = bool restraints = None .type = path .multiple = True .short_caption = Restraints .style = file_type:cif bold input_file restraints_directory = None .type = path .style = directory output_file_name_prefix = None .type = str .input_size = 400 .style = bold directory = None .type = path .short_caption = Output directory .style = output_dir include scope libtbx.phil.interface.tracking_params fix_rotamer_outliers = True .type = bool .help = Remove outliers allow_allowed_rotamers = True .type = bool .help = More strict fixing outliers stop_for_unknowns = True .type = bool .short_caption = Stop for unknown residues .style = noauto include scope mmtbx.monomer_library.pdb_interpretation.grand_master_phil_str include scope \ mmtbx.geometry_restraints.torsion_restraints.reference_model.reference_model_params """ master_params_str = """ %s selection = all .type = str .help = Atom selection string: selected atoms are subject to move .short_caption = Atom selection .input_size = 400 minimization .help = Geometry minimization parameters .short_caption = Minimization parameters .expert_level=1 { max_iterations = 500 .type = int .help = Maximun number of minimization iterations .short_caption = Max. iterations .style = noauto macro_cycles = 5 .type = int .help = Number of minimization macro-cycles alternate_nonbonded_off_on = False .type = bool .short_caption = Macro cycles .style = noauto rmsd_bonds_termination_cutoff = 0 .type = float .help = stop after reaching specified cutoff value rmsd_angles_termination_cutoff = 0 .type = float .help = stop after reaching specified cutoff value grms_termination_cutoff = 0 .type = float .help = stop after reaching specified cutoff value correct_special_position_tolerance = 1.0 .type = float riding_h = True .type = bool .help = Use riding model for H move .help = Define what to include into refinement target .short_caption = Geometry terms .style = box auto_align columns:4 noauto { bond = True .type = bool .short_caption = Bond lengths nonbonded = True .type = bool .short_caption = Nonbonded distances angle = True .type = bool .short_caption = Bond angle dihedral = True .type = bool .short_caption = Dihedral angle chirality = True .type = bool .short_caption = Chirality planarity = True .type = bool .short_caption = Planarity parallelity = True .type = bool .short_caption = Parallelity } } include scope mmtbx.geometry_restraints.external.external_energy_params_str """ % base_params_str def master_params(): return iotbx.phil.parse(master_params_str, process_includes=True) def broadcast(m, log): print("-"*79, file=log) print(m, file=log) print("*"*len(m), file=log) def format_usage_message(log): print("-"*79, file=log) msg = """\ phenix.geometry_minimization: regularize model geometry Usage examples: phenix.geometry_minimization model.pdb phenix.geometry_minimization model.pdb ligands.cif """ print(msg, file=log) print("-"*79, file=log) def run_minimization( selection, restraints_manager, riding_h_manager, pdb_hierarchy, params, cdl, rdl, correct_hydrogens, states_collector, fix_rotamer_outliers, allow_allowed_rotamers, log, ncs_restraints_group_list = [], mon_lib_srv = None): o = mmtbx.refinement.geometry_minimization.run2( restraints_manager = restraints_manager, riding_h_manager = riding_h_manager, pdb_hierarchy = pdb_hierarchy, ncs_restraints_group_list = ncs_restraints_group_list, max_number_of_iterations = params.max_iterations, number_of_macro_cycles = params.macro_cycles, selection = selection, correct_special_position_tolerance = params.correct_special_position_tolerance, bond = params.move.bond, nonbonded = params.move.nonbonded, angle = params.move.angle, dihedral = params.move.dihedral, chirality = params.move.chirality, planarity = params.move.planarity, parallelity = params.move.parallelity, rmsd_bonds_termination_cutoff = params.rmsd_bonds_termination_cutoff, rmsd_angles_termination_cutoff = params.rmsd_angles_termination_cutoff, alternate_nonbonded_off_on = params.alternate_nonbonded_off_on, cdl = cdl, rdl = rdl, states_collector = states_collector, correct_hydrogens = correct_hydrogens, fix_rotamer_outliers = fix_rotamer_outliers, allow_allowed_rotamers = allow_allowed_rotamers, log = log, mon_lib_srv = mon_lib_srv) def run_minimization_amber( selection, restraints_manager, pdb_hierarchy, params, log, prmtop, ambcrd, ): import amber_adaptbx.amber_geometry_minimization o = amber_adaptbx.amber_geometry_minimization.run( restraints_manager = restraints_manager, pdb_hierarchy = pdb_hierarchy, max_number_of_iterations = params.max_iterations, number_of_macro_cycles = params.macro_cycles, selection = selection, bond = params.move.bond, nonbonded = params.move.nonbonded, angle = params.move.angle, dihedral = params.move.dihedral, chirality = params.move.chirality, planarity = params.move.planarity, parallelity = params.move.parallelity, grms_termination_cutoff = params.grms_termination_cutoff, alternate_nonbonded_off_on = params.alternate_nonbonded_off_on, log = log, prmtop = prmtop, ambcrd = ambcrd, ) class run(object): _pdb_suffix = "minimized" def __init__(self, args, log, use_directory_prefix=True): # You are not supposed to put here (in __init__) any time-consuming stuff, # otherwise self.total_time would be unaccurate. It's not clear # why it is important. self.model = None self.log = log self.params = None self.inputs = None self.args = args self.selection = None self.restrain_selection = None self.time_strings = [] self.total_time = 0 self.pdb_file_names = [] self.use_directory_prefix = use_directory_prefix self.sites_cart_start = None self.states_collector = None self.__execute() def __execute(self): # self.caller(self.initialize, "Initialization, inputs") self.caller(self.process_inputs, "Processing inputs") self.caller(self.atom_selection, "Atom selection") self.caller(self.get_restraints, "Geometry Restraints") self.caller(self.setup_riding_h, "Setup riding H") self.caller(self.minimization, "Minimization") self.caller(self.write_pdb_file, "Write PDB file") self.caller(self.write_geo_file, "Write GEO file") self.caller(self.show_model_statistics, "Model statistics") # self.show_times() def master_params(self): return master_params() def caller(self, func, prefix): timer = user_plus_sys_time() func(prefix = prefix) t = timer.elapsed() self.total_time += t self.time_strings.append(" %s: %s"%(prefix, str("%8.3f"%t).strip())) def show_times(self): broadcast(m="Detailed timing", log = self.log) max_len = 0 for ts in self.time_strings: lts = len(ts) if(lts > max_len): max_len = lts fmt = " %-"+str(lts)+"s" for ts in self.time_strings: sts = ts.split() l = " ".join(sts[:len(sts)-1]) print(fmt%l, sts[len(sts)-1], file=self.log) print(" Sum of individual times: %s"%\ str("%8.3f"%self.total_time).strip(), file=self.log) def format_usage_message(self): format_usage_message(log=self.log) def setup_output_file_names(self): # for pdb ofn = self.params.output_file_name_prefix directory = self.params.directory base_name = "" if self.use_directory_prefix and directory is not None: base_name = directory suffix = "_" + self._pdb_suffix + ".pdb" if self.params.output_file_name_prefix is None: in_fn = os.path.basename(self.pdb_file_names[0]) ind = max(0, in_fn.rfind(".")) ofn = in_fn + suffix if ind > 0: ofn = in_fn[:ind]+suffix else: ofn = self.params.output_file_name_prefix+".pdb" self.result_model_fname = os.path.join(base_name, ofn) self.result_states_fname = self.result_model_fname[:].replace(".pdb","_all_states.pdb") self.final_geo_fname = self.result_model_fname[:].replace(".pdb",".geo") def initialize(self, prefix): if (self.log is None) : self.log = sys.stdout if(len(self.args)==0): self.format_usage_message() parsed = self.master_params() self.inputs = mmtbx.utils.process_command_line_args(args = self.args, master_params = parsed) self.params = self.inputs.params.extract() if(self.params.silent): self.log = StringIO() broadcast(m=prefix, log = self.log) self.inputs.params.show(prefix=" ", out=self.log) if(len(self.args)==0): sys.exit(0) def process_inputs(self, prefix): broadcast(m=prefix, log = self.log) self.pdb_file_names = list(self.inputs.pdb_file_names) if(self.params.file_name is not None): self.pdb_file_names.append(self.params.file_name) #================================================= cs = self.inputs.crystal_symmetry is_non_crystallographic_unit_cell = False import iotbx.pdb pdb_combined = combine_unique_pdb_files(file_names = self.pdb_file_names) pdb_inp = iotbx.pdb.input(lines=pdb_combined.raw_records, source_info=None) if(cs is None): cs=pdb_inp.crystal_symmetry() if(cs is None): is_non_crystallographic_unit_cell = True box = uctbx.non_crystallographic_unit_cell_with_the_sites_in_its_center( sites_cart = pdb_inp.atoms().extract_xyz(), buffer_layer = 10) cs = box.crystal_symmetry() cif_objects = list(self.inputs.cif_objects) if (len(self.params.restraints) > 0): import iotbx.cif for file_name in self.params.restraints : cif_object = iotbx.cif.reader(file_path=file_name, strict=False).model() cif_objects.append((file_name, cif_object)) if (self.params.restraints_directory is not None): restraint_files = os.listdir(self.params.restraints_directory) for file_name in restraint_files : if (file_name.endswith(".cif")): full_path = os.path.join(self.params.restraints_directory, file_name) cif_object = iotbx.cif.reader(file_path=full_path, strict=False).model() cif_objects.append((full_path, cif_object)) self.model = mmtbx.model.manager( model_input = pdb_inp, crystal_symmetry = cs, restraint_objects = cif_objects, pdb_interpretation_params = self.params, stop_for_unknowns = self.params.stop_for_unknowns, build_grm = True, log = self.log) self.ncs_obj = self.model.get_ncs_obj() self.output_crystal_symmetry = not is_non_crystallographic_unit_cell self.sites_cart_start = self.model.get_xray_structure().sites_cart().deep_copy() if(self.params.show_states): self.states_collector = mmtbx.utils.states( xray_structure = self.model.get_xray_structure(), pdb_hierarchy = self.model.get_hierarchy()) self.setup_output_file_names() def atom_selection(self, prefix): broadcast(m=prefix, log = self.log) self.selection = self.model.selection(string = self.params.selection) print(" selected %s atoms out of total %s"%( str(self.selection.count(True)),str(self.selection.size())), file=self.log) def get_restraints(self, prefix): broadcast(m=prefix, log = self.log) self.model.get_restraints_manager() def setup_riding_h(self, prefix): if not self.params.minimization.riding_h: return broadcast(m=prefix, log = self.log) self.model.setup_riding_h_manager(idealize=True) def minimization(self, prefix): # XXX USE alternate_nonbonded_off_on etc broadcast(m=prefix, log = self.log) use_amber = False if self.ncs_obj is not None: print("Using NCS constraints:", file=self.log) self.ncs_obj.show(format='phil', log=self.log) ncs_restraints_group_list = [] if self.ncs_obj is not None: ncs_restraints_group_list = self.ncs_obj.get_ncs_restraints_group_list() run_minimization( selection = self.selection, restraints_manager = self.model.get_restraints_manager(), riding_h_manager = self.model.get_riding_h_manager(), params = self.params.minimization, pdb_hierarchy = self.model.get_hierarchy(), cdl = self.params.pdb_interpretation.restraints_library.cdl, rdl = self.params.pdb_interpretation.restraints_library.rdl, correct_hydrogens = self.params.pdb_interpretation.correct_hydrogens, fix_rotamer_outliers = self.params.fix_rotamer_outliers, allow_allowed_rotamers = self.params.allow_allowed_rotamers, states_collector = self.states_collector, log = self.log, ncs_restraints_group_list = ncs_restraints_group_list, mon_lib_srv = self.model.get_mon_lib_srv()) self.model.set_sites_cart_from_hierarchy() def write_pdb_file(self, prefix): broadcast(m=prefix, log = self.log) # self.pdb_hierarchy.adopt_xray_structure(self.xray_structure) print(" output file name:", self.result_model_fname, file=self.log) print(self.min_max_mean_shift(), file=self.log) print(self.min_max_mean_shift(), file=self.log) r = self.model.model_as_pdb(output_cs=self.output_crystal_symmetry) f = open(self.result_model_fname, 'w') f.write(r) f.close() if(self.states_collector): self.states_collector.write( file_name=self.result_states_fname) def min_max_mean_shift(self): return "min,max,mean shift from start: %6.3f %6.3f %6.3f"%flex.sqrt(( self.sites_cart_start - self.model.get_xray_structure().sites_cart()).dot() ).min_max_mean().as_tuple() def write_geo_file(self, prefix): if self.params.write_geo_file: broadcast(m=prefix, log = self.log) # no output of NCS stuff here restr_txt = self.model.restraints_as_geo() f = open(self.final_geo_fname, "w") f.write("# Geometry restraints after refinement\n") f.write(restr_txt) f.close() def show_model_statistics(self, prefix): if self.params.write_geo_file: broadcast(m=prefix, log = self.log) s = self.model.geometry_statistics() s.show(log = self.log, uppercase=False) class launcher(runtime_utils.target_with_save_result): def run(self): os.mkdir(self.output_dir) os.chdir(self.output_dir) filename = run(args=self.args, log=sys.stdout, use_directory_prefix=False).result_model_fname return os.path.join(self.output_dir, filename) def validate_params(params): if (params.file_name is None): raise Sorry("Please specify a model file to minimize.") if (params.restraints_directory is not None): if (not os.path.isdir(params.restraints_directory)): raise
# @endcode class Sum (Operation2) : """Summation operation >>> op = Sum ( math.sin , math.cos ) """ def __init__ ( self , a , b ) : super(Sum,self).__init__ ( a , b , operator.add , '+' ) # ============================================================================= ## @class Sub # Subtraction operation # @code # op = Sub ( math.sin , math.cos ) # @endcode class Sub (Operation2) : """Subtraction operation >>> op = Sub ( math.sin , math.cos ) """ def __init__ ( self , a , b ) : super(Sub,self).__init__ ( a , b , operator.sub , '-' ) # ============================================================================= ## @class Mul # Multiplication operation # @code # op = Mul ( math.sin , math.cos ) # @endcode class Mul (Operation2) : """Multiplication operation >>> op = Mul ( math.sin , math.cos ) """ def __init__ ( self , a , b ) : super(Mul,self).__init__ ( a , b , operator.mul , '*' ) # ============================================================================= ## @class Div # Division operation # @code # op = Div ( math.sin , math.cos ) # @endcode class Div (Operation2) : """Division operation >>> op = Div ( math.sin , math.cos ) """ def __init__ ( self , a , b ) : super(Div,self).__init__ ( a , b , operator.truediv , '/') # ============================================================================= ## @class Pow # Pow-operation # @code # op = Pow ( lambda x : x , lambda x : x**2 ) # @endcode class Pow (Operation2) : """Pow-operation >>> op = Pow ( lambda x : x , lambda x : x**2 ) """ def __init__ ( self , a , b ) : super(Pow,self).__init__ ( a , b , operator.pow , '**') # ============================================================================= ## @class Square # square-operation class Square(Pow) : """square-operation """ def __init__ ( self , a ) : super(Square,self).__init__ ( a , 2 ) # ============================================================================= ## @class Cube # cube-operation class Cube(Pow) : """Cube-operation """ def __init__ ( self , a ) : super(Cube,self).__init__ ( a , 3 ) # ============================================================================= ## @class Mod # modulo operation # @code # op = Mod ( math.sin , math.cos ) # @endcode class Mod (Operation2) : """Modulo operation >>> op = Mod ( math.sin , math.cos ) """ def __init__ ( self , a , b ) : super(Mod ,self).__init__ ( a , b , operator.mod , '%') # ============================================================================= ## @class Max # Max-operation # @code # op = Max ( math.sin , math.cos ) # @endcode class Max (Operation2) : """Max-operation >>> op = Max ( math.sin , math.cos ) """ def __init__ ( self , a , b ) : super(Max,self).__init__ ( a , b , _Fmax() , ',' , 'max') # ============================================================================= ## @class Min # Min-operation # @code # op = Min ( math.sin , math.cos ) # @endcode class Min (Operation2) : """Min-operation >>> op = Min ( math.sin , math.cos ) """ def __init__ ( self , a , b ) : super(Min,self).__init__ ( a , b , _Fmin() , '' , 'min') # ============================================================================= ## @class Or_l # OR (logical) - operation # @code # op = LOr ( fun1 , fun2 ) # @endcode class Or_l (Operation2) : """OR (logical) -operation >>> op = Or_l ( fun1 , fun2 ) """ def __init__ ( self , a , b ) : super(Or_l,self).__init__ ( a , b , _For () , ' or ' ) # ============================================================================= ## @class And_l # AND (logical) -operation # @code # op = And_l ( fun1 , fun2 ) # @endcode class And_l (Operation2) : """AND (logical) -operation >>> op = And_l ( fun1 , fun2 ) """ def __init__ ( self , a , b ) : super(And_l,self).__init__ ( a , b , _Fand() , ' and ' ) # ============================================================================= ## @class Or_b # OR (bitwise) - operation # @code # op = Or_b ( fun1 , fun2 ) # @endcode class Or_b (Operation2) : """OR (bitwise) -operation >>> op = Or_b ( fun1 , fun2 ) """ def __init__ ( self , a , b ) : super(Or_b,self).__init__ ( a , b , operator.or_ , '|' ) # ============================================================================= ## @class And_b # AND (bitwise) -operation # @code # op = And_b ( fun1 , fun2 ) # @endcode class And_b (Operation2) : """AND (bitwise) -operation >>> op = And_b ( fun1 , fun2 ) """ def __init__ ( self , a , b ) : super(And_b,self).__init__ ( a , b , operator.and_ , '&' ) # ============================================================================= ## @class Xor_b # XOR (bitwise) - operation # @code # op = Xor_b ( fun1 , fun2 ) # @endcode class Xor_b (Operation2) : """XOR (bitwise) -operation >>> op = Xor_b ( fun1 , fun2 ) """ def __init__ ( self , a , b ) : super(Xor_b,self).__init__ ( a , b , operator.xor , '^' ) # ============================================================================= ## @class Abs # absolute value class Abs(Compose) : """absolute value""" def __init__ ( self , func ) : super(Abs,self).__init__ ( abs , func , 'exp') # ============================================================================= ## @class Exp # simple 'exponent' class Exp(Compose) : """Exponent for the function""" def __init__ ( self , func ) : super(Exp,self).__init__ ( math.exp , func , 'exp') # ============================================================================= ## @class Log # simple 'log' class Log(Compose) : """Log for the function""" def __init__ ( self , func ) : super(Log,self).__init__ ( math.log , func , 'log') # ============================================================================= ## @class Log10 # simple 'log10' class Log10(Compose) : """Log10 for the function""" def __init__ ( self , func ) : super(Log10,self).__init__ ( math.log10 , func , 'log10' ) # ============================================================================= ## @class Sin # simple 'sin' class Sin(Compose) : """Sin for the function""" def __init__ ( self , func ) : super(Sin,self).__init__ ( math.sin , func , 'sin') # ============================================================================= ## @class Cos # simple 'cos' class Cos(Compose) : """Cos for the function""" def __init__ ( self , func ) : super(Cos,self).__init__ ( math.cos , func , 'cos' ) # ============================================================================= ## @class Tan # simple 'tan' class Tan(Compose) : """Tan for the function""" def __init__ ( self , func ) : super(Tan,self).__init__ ( math.tan , func , 'tan' ) # ============================================================================= ## @class Sinh # simple 'sinh' class Sinh(Compose) : """Sinh for the function""" def __init__ ( self , func ) : super(Sinh,self).__init__ ( math.sinh , func , 'sinh' ) # ============================================================================= ## @class Cosh # simple 'cosh' class Cosh(Compose) : """Cos for the function""" def __init__ ( self , func ) : super(Cosh,self).__init__ ( math.cosh , func , 'cosh' ) # ============================================================================= ## @class Tanh # simple 'tan' class Tanh(Compose) : """Tanh for the function""" def __init__ ( self , func ) : super(Tanh,self).__init__ ( math.tanh , func , 'tanh' ) # ============================================================================= ## @class ASin # simple 'asin' class ASin(Compose) : """ASin for the function""" def __init__ ( self , func ) : super(ASin,self).__init__ ( math.asin , func , 'asinh' ) # ============================================================================= ## @class ACos # simple 'acos' class ACos(Compose) : """ACos for the function""" def __init__ ( self , func ) : super(ACos,self).__init__ ( math.acos , func , 'acos' ) # ============================================================================= ## @class ATan # simple 'atan' class ATan(Compose) : """ATan for the function""" def __init__ ( self , func ) : super(ATan,self).__init__ ( math.atan , func , 'atan' ) # ============================================================================= ## @class ASinh # simple 'asinh' class ASinh(Compose) : """ASinh for the function""" def __init__ ( self , func ) : super(ASinh,self).__init__ ( math.asinh , func , 'asinh' ) # ============================================================================= ## @class ACosh # simple 'acosh' class ACosh(Compose) : """ACosh for the function""" def __init__ ( self , func ) : super(ACosh,self).__init__ ( math.acosh , func , 'acosh' ) # ============================================================================= ## @class ATanh # simple 'atanh' class ATanh(Compose) : """ATanh for the function""" def __init__ ( self , func ) : super(ATanh,self).__init__ ( math.atanh , func , 'atanh' ) # ============================================================================= ## @class Erf # simple 'erf' class Erf(Compose) : """Erf for the function""" def __init__ ( self , func ) : super(Erf,self).__init__ ( math.erf , func , 'erf' ) # ============================================================================= ## @class Erfc # simple 'erfc' class Erfc(Compose) : """Erfc for the function""" def __init__ ( self , func ) : super(Erfc,self).__init__ ( math.erfc , func , 'erfc' ) # ============================================================================= ## @class Gamma # simple 'Gamma' class Gamma(Compose) : """Gamma for the function""" def __init__ ( self , func ) : super(Gamma,self).__init__ ( math.gamma , func , 'G' ) # ============================================================================= ## @class LogGamma # simple 'LogGamma' class LogGamma(Compose) : """LogGamma for the function""" def
nest1 and schedule1 with a smaller iteration space size nest1 = Nest(shape=(16, 10)) i1, j1 = nest1.get_indices() @nest1.iteration_logic def _(): C[i1, j1] *= B[i1, j1] schedule1 = nest1.create_schedule() # Create a fused schedule: the smaller iteration space (nest1) should # be automatically end-padded with no-ops schedule = fuse(schedule0, schedule1) f, i, j = schedule.get_indices() schedule.reorder(i, j, f) # Emitted fused loop should look like: # for i in range(0, 16): # for j in range(0, 10): # for f in range(2): # if f == 0: # C[i, j] += A[i, j] # if f == 1: # C[i, j] *= B[i, j] # for j in range(10, 16): # for f in range(2): # if f == 0: # C[i, j] += A[i, j] A_test = np.random.random(A.shape).astype(np.float32) B_test = np.random.random(B.shape).astype(np.float32) C_test = np.random.random(C.shape).astype(np.float32) C_ref = C_test + A_test # nest0 C_ref[:, :B.shape[1]] = C_ref[:, :B.shape[1]] * B_test # nest1 correctness_check_values = { "pre": [A_test, B_test, C_test], "post": [A_test, B_test, C_ref] } self._verify_schedule(schedule, (A, B, C), "test_unequal_iteration_space_fusing_1", correctness_check_values) def test_unequal_iteration_space_fusing_2(self) -> None: from accera import fuse, Nest A = Array(role=Array.Role.INPUT, shape=(16, 10)) B = Array(role=Array.Role.INPUT, shape=(16, 16)) C = Array(role=Array.Role.INPUT_OUTPUT, shape=(16, 16)) # Create nest0 and schedule nest0 = Nest(shape=(16, 10)) i0, j0 = nest0.get_indices() @nest0.iteration_logic def _(): C[i0, j0] += A[i0, j0] schedule0 = nest0.create_schedule() # Create nest1 and schedule1 with a larger iteration space size nest1 = Nest(shape=(16, 16)) i1, j1 = nest1.get_indices() @nest1.iteration_logic def _(): C[i1, j1] *= B[i1, j1] schedule1 = nest1.create_schedule() # Create a fused schedule: the smaller iteration space (nest0) should # be automatically end-padded with no-ops schedule = fuse(schedule0, schedule1) f, i, j = schedule.get_indices() schedule.reorder(i, j, f) # Emitted fused loop should look like: # for i in range(0, 16): # for j in range(0, 10): # for f in range(2): # if f == 0: # C[i, j] += A[i, j] # if f == 1: # C[i, j] *= B[i, j] # for j in range(10, 16): # for f in range(2): # if f == 1: # C[i, j] *= B[i, j] A_test = np.random.random(A.shape).astype(np.float32) B_test = np.random.random(B.shape).astype(np.float32) C_test = np.random.random(C.shape).astype(np.float32) C_ref = np.copy(C_test) C_ref[:, :A.shape[1]] = C_test[:, :A.shape[1]] + A_test # nest0 C_ref *= B_test # nest1 correctness_check_values = { "pre": [A_test, B_test, C_test], "post": [A_test, B_test, C_ref] } self._verify_schedule(schedule, (A, B, C), "test_unequal_iteration_space_fusing_2", correctness_check_values) def test_unequal_iteration_space_fusing_3(self) -> None: from accera import fuse, Nest A = Array(role=Array.Role.INPUT, shape=(16, 16)) B = Array(role=Array.Role.INPUT, shape=(16, 10)) C = Array(role=Array.Role.INPUT_OUTPUT, shape=(16, 16)) # Create nest0 and schedule nest0 = Nest(shape=(16, 16)) i0, j0 = nest0.get_indices() @nest0.iteration_logic def _(): C[i0, j0] += A[i0, j0] schedule0 = nest0.create_schedule() # Create nest1 and schedule1 with a smaller iteration space size nest1 = Nest(shape=(16, 10)) i1, j1 = nest1.get_indices() @nest1.iteration_logic def _(): C[i1, j1] *= B[i1, j1] schedule1 = nest1.create_schedule() # Create a fused schedule: the smaller iteration space (nest1) should # be automatically end-padded with no-ops schedule = fuse(schedule0, schedule1) f, i, j = schedule.get_indices() # computing the output block-by-block: # first computing C[0:4, 0:4] += A[0:4, 0:4] # then computing C[0:4, 0:4] *= B[0:4, 0:4] ii, jj = schedule.tile({ i: 4, j: 4 }) schedule.reorder(i, j, f, ii, jj) # Emitted fused loop should look like: # for i in range(0, 16, 4): # # run both kernels in the smaller iteration spaces # # (tiled block) # for j in range(0, 8, 4): # for f in range(2): # if f == 0: # for ii in range(0, 4): # for jj in range(0, 4): # C[i+ii, j+jj] += A[i+ii, j+jj] # if f == 1: # for ii in range(0, 4): # for jj in range(0, 4): # C[i+ii, j+jj] *= B[i+ii, j+jj] # # # run both kernels in the smaller iteration space # # (boundary block for split) # for j in range(8, 10): # range < split size # for f in range(2): # if f == 0: # for ii in range(0, 4): # C[i+ii, j] += A[i+ii, j] # if f == 1: # for ii in range(0, 4): # C[i+ii, j] *= B[i+ii, j] # # # run kernel with the larger iteration space # # (boundary block for split) # for j in range(10, 16): # range < split size # for f in range(2): # if f == 0: # for ii in range(0, 4): # C[i+ii, j] += A[i+ii, j] A_test = np.random.random(A.shape).astype(np.float32) B_test = np.random.random(B.shape).astype(np.float32) C_test = np.random.random(C.shape).astype(np.float32) C_ref = C_test + A_test # nest0 C_ref[:, :B.shape[1]] = C_ref[:, :B.shape[1]] * B_test # nest1 correctness_check_values = { "pre": [A_test, B_test, C_test], "post": [A_test, B_test, C_ref] } self._verify_schedule(schedule, (A, B, C), "test_unequal_iteration_space_fusing_3", correctness_check_values) def test_concat_fusing_1(self) -> None: from accera import fuse, Nest A = Array(role=Array.Role.INPUT_OUTPUT, shape=(3, )) B = Array(role=Array.Role.INPUT_OUTPUT, shape=(7, )) n1 = Nest(A.shape) n2 = Nest(B.shape) n1_i = n1.get_indices() @n1.iteration_logic def _(): A[n1_i] /= A[n1_i] n2_i = n2.get_indices() @n2.iteration_logic def _(): B[n2_i] *= B[n2_i] fused = fuse([n.create_schedule() for n in [n1, n2]], partial=0) # Emitted fused loop should look like: # for f in range(3): # if f == 0: # for i in range(3): # A[i] /= A[i] # if f == 1: # for i in range(7): # B[i] *= B[i] A_test = np.random.random(A.shape).astype(np.float32) B_test = np.random.random(B.shape).astype(np.float32) A_ref = A_test / A_test B_ref = B_test * B_test correctness_check_values = { "pre": [A_test, B_test], "post": [A_ref, B_ref] } self._verify_schedule(fused, (A, B), "test_concat_fusing_1", correctness_check_values) @expectedFailure(FailedReason.BUG, "Concat fusing is broken") def test_concat_fusing_2(self) -> None: from accera import fuse, Nest A = Array(role=Array.Role.INPUT_OUTPUT, shape=(11, )) B = Array(role=Array.Role.INPUT_OUTPUT, shape=(7, )) C = Array(role=Array.Role.INPUT_OUTPUT, shape=(5, )) n1 = Nest(A.shape) n2 = Nest(B.shape) n3 = Nest(C.shape) n1_i = n1.get_indices() @n1.iteration_logic def _(): A[n1_i] += A[n1_i] n2_i = n2.get_indices() @n2.iteration_logic def _(): B[n2_i] *= B[n2_i] n3_i = n3.get_indices() @n3.iteration_logic def _(): C[n3_i] /= C[n3_i] fused = fuse([n.create_schedule() for n in [n1, n2, n3]], partial=0) # Emitted fused loop should look like: # for f in range(3): # if f == 0: # for i in range(11): # A[i}] += A[i}] # if f == 1: # for i in range(7): # B[i}] *= B[i}] # if f == 2: # for i in range(5): # C[i}] /= C[i}] A_test = np.random.random(A.shape).astype(np.float32) B_test = np.random.random(B.shape).astype(np.float32) C_test = np.random.random(C.shape).astype(np.float32) A_ref = A_test + A_test B_ref = B_test * B_test C_ref = C_test / C_test correctness_check_values = { "pre": [A_test, B_test, C_test], "post": [A_ref, B_ref, C_ref] } self._verify_schedule(fused, (A, B, C), "test_concat_fusing_2", correctness_check_values) def test_concat_fusing_3(self) -> None: from accera import fuse, Nest A = Array(role=Array.Role.INPUT_OUTPUT, shape=(3, 16)) B = Array(role=Array.Role.INPUT_OUTPUT, shape=(7, 16)) n1 = Nest(A.shape) n2 = Nest(B.shape) n1_i, n1_j = n1.get_indices() @n1.iteration_logic def _(): A[n1_i, n1_j] /= A[n1_i, n1_j] n2_i, n2_j = n2.get_indices() @n2.iteration_logic def _(): B[n2_i, n2_j] *= B[n2_i, n2_j] fused = fuse([n.create_schedule() for n in [n1, n2]], partial=0) # Emitted fused loop should look like: # for f in range(3): # if f == 0: # for i in range(3): # for j in range(16): # A[i,j] /= A[i,j] # if f == 1: # for i in range(7): # for j in range(16): # B[i,j] *= B[i,j] A_test = np.random.random(A.shape).astype(np.float32) B_test = np.random.random(B.shape).astype(np.float32) A_ref = A_test / A_test B_ref = B_test * B_test correctness_check_values = { "pre": [A_test, B_test], "post": [A_ref, B_ref] } self._verify_schedule(fused, (A, B), "test_concat_fusing_3", correctness_check_values) @expectedFailure(FailedReason.BUG, "Concat fusing is broken") def test_concat_fusing_4(self) -> None: from accera import fuse, Nest A = Array(role=Array.Role.INPUT_OUTPUT, shape=(11, 16)) B = Array(role=Array.Role.INPUT_OUTPUT, shape=(7, 16)) C = Array(role=Array.Role.INPUT_OUTPUT, shape=(5, 16)) n1 = Nest(A.shape) n2 = Nest(B.shape) n3 = Nest(C.shape) n1_i, n1_j = n1.get_indices() @n1.iteration_logic def _(): A[n1_i, n1_j] += A[n1_i, n1_j] n2_i, n2_j = n2.get_indices() @n2.iteration_logic def _(): B[n2_i, n2_j] *= B[n2_i, n2_j] n3_i, n3_j = n3.get_indices() @n3.iteration_logic def _(): C[n3_i, n3_j] /= C[n3_i, n3_j] fused =
m, None) self._scan_code(m, co, co_ast) m.code = co if self.replace_paths: m.code = self._replace_paths_in_code(m.code) return m #FIXME: For safety, the "source_module" parameter should default to the #root node of the current graph if unpassed. This parameter currently #defaults to None, thus disconnected modules imported in this manner (e.g., #hidden imports imported by depend.analysis.initialize_modgraph()). def import_hook( self, target_module_partname, source_module=None, target_attr_names=None, level=DEFAULT_IMPORT_LEVEL, edge_attr=None, ): """ Import the module with the passed name, all parent packages of this module, _and_ all submodules and attributes in this module with the passed names from the previously imported caller module signified by the passed graph node. Unlike most import methods (e.g., `_safe_import_hook()`), this method is designed to be publicly called by both external and internal callers and hence is public. Parameters ---------- target_module_partname : str Partially-qualified name of the target module to be imported. See `_safe_import_hook()` for further details. source_module : Node Graph node for the previously imported **source module** (i.e., module containing the `import` statement triggering the call to this method) _or_ `None` if this module is to be imported in a "disconnected" manner. **Passing `None` is _not_ recommended.** Doing so produces a disconnected graph in which the graph node created for the module to be imported will be disconnected and hence unreachable from all other nodes -- which frequently causes subtle issues in external callers (namely PyInstaller, which silently ignores unreachable nodes). target_attr_names : list List of the unqualified names of all submodules and attributes to be imported from the module to be imported if this is a "from"- style import (e.g., `[encode_base64, encode_noop]` for the import `from email.encoders import encode_base64, encode_noop`) _or_ `None` otherwise. level : int Whether to perform an absolute or relative import. See `_safe_import_hook()` for further details. Returns ---------- list List of the graph nodes created for all modules explicitly imported by this call, including the passed module and all submodules listed in `target_attr_names` _but_ excluding all parent packages implicitly imported by this call. If `target_attr_names` is `None` or the empty list, this is guaranteed to be a list of one element: the graph node created for the passed module. Raises ---------- ImportError If the target module to be imported is unimportable. """ self.msg(3, "_import_hook", target_module_partname, source_module, source_module, level) source_package = self._determine_parent(source_module) target_package, target_module_partname = self._find_head_package( source_package, target_module_partname, level) target_module = self._load_tail(target_package, target_module_partname) target_modules = [target_module] # If this is a "from"-style import *AND* this target module is # actually a package, import all submodules of this package specified # by the "import" half of this import (e.g., the submodules "bar" and # "car" of the target package "foo" in "from foo import bar, car"). # # If this target module is a non-package, it could still contain # importable submodules (e.g., the non-package `os` module containing # the `os.path` submodule). In this case, these submodules are already # imported by this target module's pure-Python code. Since our import # scanner already detects such imports, these submodules need *NOT* be # reimported here. if target_attr_names and isinstance(target_module, Package): for target_submodule in self._import_importable_package_submodules( target_module, target_attr_names): if target_submodule not in target_modules: target_modules.append(target_submodule) # Add an edge from this source module to each target module. for target_module in target_modules: self._updateReference( source_module, target_module, edge_data=edge_attr) return target_modules def _determine_parent(self, caller): """ Determine the package containing a node. """ self.msgin(4, "determine_parent", caller) parent = None if caller: pname = caller.identifier if isinstance(caller, Package): parent = caller elif '.' in pname: pname = pname[:pname.rfind('.')] parent = self.findNode(pname) elif caller.packagepath: # XXX: I have no idea why this line # is necessary. parent = self.findNode(pname) self.msgout(4, "determine_parent ->", parent) return parent def _find_head_package( self, source_package, target_module_partname, level=DEFAULT_IMPORT_LEVEL): """ Import the target package providing the target module with the passed name to be subsequently imported from the previously imported source package corresponding to the passed graph node. Parameters ---------- source_package : Package Graph node for the previously imported **source package** (i.e., package containing the module containing the `import` statement triggering the call to this method) _or_ `None` if this module is to be imported in a "disconnected" manner. **Passing `None` is _not_ recommended.** See the `_import_hook()` method for further details. target_module_partname : str Partially-qualified name of the target module to be imported. See `_safe_import_hook()` for further details. level : int Whether to perform absolute or relative imports. See the `_safe_import_hook()` method for further details. Returns ---------- (target_package, target_module_tailname) 2-tuple describing the imported target package, where: * `target_package` is the graph node created for this package. * `target_module_tailname` is the unqualified name of the target module to be subsequently imported (e.g., `text` when passed a `target_module_partname` of `email.mime.text`). Raises ---------- ImportError If the package to be imported is unimportable. """ self.msgin(4, "find_head_package", source_package, target_module_partname, level) #FIXME: Rename all local variable names to something sensible. No, #"p_fqdn" is not a sensible name. # If this target module is a submodule... if '.' in target_module_partname: target_module_headname, target_module_tailname = ( target_module_partname.split('.', 1)) # Else, this target module is a top-level module. else: target_module_headname = target_module_partname target_module_tailname = '' # If attempting both absolute and relative imports... if level == ABSOLUTE_OR_RELATIVE_IMPORT_LEVEL: if source_package: target_package_name = source_package.identifier + '.' + target_module_headname else: target_package_name = target_module_headname # Else if attempting only absolute imports... elif level == ABSOLUTE_IMPORT_LEVEL: target_package_name = target_module_headname # Absolute import, ignore the parent source_package = None # Else if attempting only relative imports... else: if source_package is None: self.msg(2, "Relative import outside of package") raise InvalidRelativeImportError( "Relative import outside of package (name=%r, parent=%r, level=%r)" % ( target_module_partname, source_package, level)) for i in range(level - 1): if '.' not in source_package.identifier: self.msg(2, "Relative import outside of package") raise InvalidRelativeImportError( "Relative import outside of package (name=%r, parent=%r, level=%r)" % ( target_module_partname, source_package, level)) p_fqdn = source_package.identifier.rsplit('.', 1)[0] new_parent = self.findNode(p_fqdn) if new_parent is None: #FIXME: Repetition detected. Exterminate. Exterminate. self.msg(2, "Relative import outside of package") raise InvalidRelativeImportError( "Relative import outside of package (name=%r, parent=%r, level=%r)" % ( target_module_partname, source_package, level)) assert new_parent is not source_package, ( new_parent, source_package) source_package = new_parent if target_module_headname: target_package_name = ( source_package.identifier + '.' + target_module_headname) else: target_package_name = source_package.identifier # Graph node of this target package. target_package = self._safe_import_module( target_module_headname, target_package_name, source_package) #FIXME: Why exactly is this necessary again? This doesn't quite seem #right but maybe it is. Shouldn't absolute imports only be performed if #the passed "level" is either "ABSOLUTE_IMPORT_LEVEL" or #"ABSOLUTE_OR_RELATIVE_IMPORT_LEVEL" -- or, more succinctly: # # if level < 1: # If this target package is *NOT* importable and a source package was # passed, attempt to import this target package as an absolute import. if target_package is None and source_package is not None: target_package_name = target_module_headname source_package = None # Graph node for the target package, again. target_package = self._safe_import_module( target_module_headname, target_package_name, source_package) # If this target package is importable, return this package. if target_package is not None: self.msgout(4, "find_head_package ->", (target_package, target_module_tailname)) return target_package, target_module_tailname # Else, raise an exception. self.msgout(4, "raise ImportError: No module named", target_package_name) raise ImportError("No module named " + target_package_name) def _load_tail(self, package, submodule_name): """ Import the submodule with the passed name and all parent packages of this module from the previously imported parent package corresponding to the passed graph node. Parameters ---------- package : Package Graph node of the previously imported package containing this submodule. submodule_name : str Name of the submodule to be imported in either qualified (e.g., `email.mime.base`) or unqualified (e.g., `base`) form. Returns ---------- Node Graph node created for this submodule. Raises ---------- ImportError If this submodule is unimportable. """ self.msgin(4, "load_tail", package, submodule_name) submodule = package while submodule_name: i = submodule_name.find('.') if i < 0: i = len(submodule_name) head, submodule_name = submodule_name[:i], submodule_name[i+1:] mname = "%s.%s" % (submodule.identifier, head) submodule = self._safe_import_module(head, mname, submodule) if submodule is None: # FIXME: Why do we no longer return
_dataflow_plus_data_3; reg _dataflow_plus_valid_3; wire _dataflow_plus_ready_3; assign _dataflow_lut_ready_2 = (_dataflow_plus_ready_3 || !_dataflow_plus_valid_3) && (_dataflow_lut_valid_2 && _dataflow__delay_valid_4); assign _dataflow__delay_ready_4 = (_dataflow_plus_ready_3 || !_dataflow_plus_valid_3) && (_dataflow_lut_valid_2 && _dataflow__delay_valid_4); assign zdata = _dataflow_plus_data_3; assign zvalid = _dataflow_plus_valid_3; assign _dataflow_plus_ready_3 = zready; always @(posedge CLK) begin if(RST) begin _dataflow_lut_valid_2 <= 0; _dataflow__delay_data_4 <= 0; _dataflow__delay_valid_4 <= 0; _dataflow_plus_data_3 <= 0; _dataflow_plus_valid_3 <= 0; end else begin if(_dataflow_lut_valid_2 && _dataflow_lut_ready_2) begin _dataflow_lut_valid_2 <= 0; end if((_dataflow_lut_ready_2 || !_dataflow_lut_valid_2) && xready) begin _dataflow_lut_valid_2 <= xvalid; end if((_dataflow__delay_ready_4 || !_dataflow__delay_valid_4) && yready && yvalid) begin _dataflow__delay_data_4 <= ydata; end if(_dataflow__delay_valid_4 && _dataflow__delay_ready_4) begin _dataflow__delay_valid_4 <= 0; end if((_dataflow__delay_ready_4 || !_dataflow__delay_valid_4) && yready) begin _dataflow__delay_valid_4 <= yvalid; end if((_dataflow_plus_ready_3 || !_dataflow_plus_valid_3) && (_dataflow_lut_ready_2 && _dataflow__delay_ready_4) && (_dataflow_lut_valid_2 && _dataflow__delay_valid_4)) begin _dataflow_plus_data_3 <= _dataflow_lut_data_2 + _dataflow__delay_data_4; end if(_dataflow_plus_valid_3 && _dataflow_plus_ready_3) begin _dataflow_plus_valid_3 <= 0; end if((_dataflow_plus_ready_3 || !_dataflow_plus_valid_3) && (_dataflow_lut_ready_2 && _dataflow__delay_ready_4)) begin _dataflow_plus_valid_3 <= _dataflow_lut_valid_2 && _dataflow__delay_valid_4; end end end endmodule module _dataflow_lut_LUT_ROM_2 ( input CLK, input [8-1:0] addr, input enable, output reg [32-1:0] val ); always @(posedge CLK) begin if(enable) begin case(addr) 0: begin val <= 0; end 1: begin val <= 1; end 2: begin val <= 4; end 3: begin val <= 9; end 4: begin val <= 16; end 5: begin val <= 25; end 6: begin val <= 36; end 7: begin val <= 49; end 8: begin val <= 64; end 9: begin val <= 81; end 10: begin val <= 100; end 11: begin val <= 121; end 12: begin val <= 144; end 13: begin val <= 169; end 14: begin val <= 196; end 15: begin val <= 225; end 16: begin val <= 256; end 17: begin val <= 289; end 18: begin val <= 324; end 19: begin val <= 361; end 20: begin val <= 400; end 21: begin val <= 441; end 22: begin val <= 484; end 23: begin val <= 529; end 24: begin val <= 576; end 25: begin val <= 625; end 26: begin val <= 676; end 27: begin val <= 729; end 28: begin val <= 784; end 29: begin val <= 841; end 30: begin val <= 900; end 31: begin val <= 961; end 32: begin val <= 1024; end 33: begin val <= 1089; end 34: begin val <= 1156; end 35: begin val <= 1225; end 36: begin val <= 1296; end 37: begin val <= 1369; end 38: begin val <= 1444; end 39: begin val <= 1521; end 40: begin val <= 1600; end 41: begin val <= 1681; end 42: begin val <= 1764; end 43: begin val <= 1849; end 44: begin val <= 1936; end 45: begin val <= 2025; end 46: begin val <= 2116; end 47: begin val <= 2209; end 48: begin val <= 2304; end 49: begin val <= 2401; end 50: begin val <= 2500; end 51: begin val <= 2601; end 52: begin val <= 2704; end 53: begin val <= 2809; end 54: begin val <= 2916; end 55: begin val <= 3025; end 56: begin val <= 3136; end 57: begin val <= 3249; end 58: begin val <= 3364; end 59: begin val <= 3481; end 60: begin val <= 3600; end 61: begin val <= 3721; end 62: begin val <= 3844; end 63: begin val <= 3969; end 64: begin val <= 4096; end 65: begin val <= 4225; end 66: begin val <= 4356; end 67: begin val <= 4489; end 68: begin val <= 4624; end 69: begin val <= 4761; end 70: begin val <= 4900; end 71: begin val <= 5041; end 72: begin val <= 5184; end 73: begin val <= 5329; end 74: begin val <= 5476; end 75: begin val <= 5625; end 76: begin val <= 5776; end 77: begin val <= 5929; end 78: begin val <= 6084; end 79: begin val <= 6241; end 80: begin val <= 6400; end 81: begin val <= 6561; end 82: begin val <= 6724; end 83: begin val <= 6889; end 84: begin val <= 7056; end 85: begin val <= 7225; end 86: begin val <= 7396; end 87: begin val <= 7569; end 88: begin val <= 7744; end 89: begin val <= 7921; end 90: begin val <= 8100; end 91: begin val <= 8281; end 92: begin val <= 8464; end 93: begin val <= 8649; end 94: begin val <= 8836; end 95: begin val <= 9025; end 96: begin val <= 9216; end 97: begin val <= 9409; end 98: begin val <= 9604; end 99: begin val <= 9801; end 100: begin val <= 10000; end 101: begin val <= 10201; end 102: begin val <= 10404; end 103: begin val <= 10609; end 104: begin val <= 10816; end 105: begin val <= 11025; end 106: begin val <= 11236; end 107: begin val <= 11449; end 108: begin val <= 11664; end 109: begin val <= 11881; end 110: begin val <= 12100; end 111: begin val <= 12321; end 112: begin val <= 12544; end 113: begin val <= 12769; end 114: begin val <= 12996; end 115: begin val <= 13225; end 116: begin val <= 13456; end 117: begin val <= 13689; end 118: begin val <= 13924; end 119: begin val <= 14161; end 120: begin val <= 14400; end 121: begin val <= 14641; end 122: begin val <= 14884; end 123: begin val <= 15129; end 124: begin val <= 15376; end 125: begin val <= 15625; end 126: begin val <= 15876; end 127: begin val <= 16129; end 128: begin val <= 16384; end 129: begin val <= 16641; end 130: begin val <= 16900; end 131: begin val <= 17161; end 132: begin val <= 17424; end 133: begin val <= 17689; end 134: begin val <= 17956; end 135: begin val <= 18225; end 136: begin val <= 18496; end 137: begin val <= 18769; end 138: begin val <= 19044; end 139: begin val <= 19321; end 140: begin val <= 19600; end 141: begin val <= 19881; end 142: begin val <= 20164; end 143: begin val <= 20449; end 144: begin val <= 20736; end 145: begin val <= 21025; end 146: begin val <= 21316; end 147: begin val <= 21609; end 148: begin val <= 21904; end 149: begin val <= 22201; end 150: begin val <= 22500; end 151: begin val <= 22801; end 152: begin val <= 23104; end 153: begin val <= 23409; end 154: begin val <= 23716; end 155: begin val <= 24025; end 156: begin val <= 24336; end 157: begin val <= 24649; end 158: begin val <= 24964; end 159: begin val <= 25281; end 160: begin val <= 25600; end 161: begin val <= 25921; end 162: begin val <= 26244; end 163: begin val <= 26569; end 164: begin val <= 26896; end 165: begin val <= 27225; end 166: begin val <= 27556; end 167: begin val <= 27889; end 168: begin val <= 28224; end 169: begin val <= 28561; end 170: begin val <= 28900; end 171: begin val <= 29241; end 172: begin val <= 29584; end 173: begin val <= 29929; end 174: begin val <= 30276; end 175: begin val <= 30625; end 176: begin val <= 30976; end 177: begin val <= 31329; end 178: begin val <= 31684; end 179: begin val <= 32041; end 180: begin val <= 32400; end 181: begin val <= 32761; end 182: begin val <= 33124; end 183: begin val <=
# -*- coding:utf-8 -*- # Licensed to the Apache Software Foundation (ASF) under one or more # contributor license agreements. See the NOTICE file distributed with # this work for additional information regarding copyright ownership. # The ASF licenses this file to You under the Apache License, Version 2.0 # (the "License"); you may not use this file except in compliance with # the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import urllib from networkapiclient.ApiGenericClient import ApiGenericClient class Pool(ApiGenericClient): def __init__(self, networkapi_url, user, password, user_ldap=None): """Class constructor receives parameters to connect to the networkAPI. :param networkapi_url: URL to access the network API. :param user: User for authentication. :param password: Password for authentication. """ super(Pool, self).__init__( networkapi_url, user, password, user_ldap ) def set_poolmember_state(self, id_pools, pools): """ Enable/Disable pool member by list """ data = dict() uri = "api/v3/pool/real/%s/member/status/" % ';'.join(id_pools) data["server_pools"] = pools return self.put(uri, data=data) def get_poolmember_state(self, id_pools, checkstatus=0): """ Enable/Disable pool member by list """ uri = "api/v3/pool/real/%s/member/status/?checkstatus=%s" % (';'.join(id_pools), checkstatus) return self.get(uri) def list_all(self, environment_id, pagination): """ List All Pools To Populate Datatable :param pagination: Object Pagination :return: Following dictionary:{ "total" : < total >, "pools" :[{ "id": < id > "default_port": < default_port >, "identifier": < identifier >, "healthcheck": < healthcheck >, }, ... too ... ]} :raise NetworkAPIException: Falha ao acessar fonte de dados """ uri = "api/pools/" data = dict() data["start_record"] = pagination.start_record data["end_record"] = pagination.end_record data["asorting_cols"] = pagination.asorting_cols data["searchable_columns"] = pagination.searchable_columns data["custom_search"] = pagination.custom_search or None data["environment_id"] = environment_id or None return self.post(uri, data=data) def list_all_by_reqvip(self, id_vip, pagination): """ List All Pools To Populate Datatable :param pagination: Object Pagination :return: Following dictionary:{ "total" : < total >, "pools" :[{ "id": < id > "default_port": < default_port >, "identifier": < identifier >, "healthcheck": < healthcheck >, }, ... too ... ]} :raise NetworkAPIException: Falha ao acessar fonte de dados """ uri = "api/pools/pool_list_by_reqvip/" data = dict() data["start_record"] = pagination.start_record data["end_record"] = pagination.end_record data["asorting_cols"] = pagination.asorting_cols data["searchable_columns"] = pagination.searchable_columns data["custom_search"] = pagination.custom_search or None data["id_vip"] = id_vip or None return self.post(uri, data=data) def inserir(self, identifier, default_port, environment, balancing, healthcheck_type, healthcheck_expect, healthcheck_request, old_healthcheck_id, maxcon, ip_list_full, nome_equips, id_equips, priorities, weight, ports_reals, servicedownaction=None): uri = "api/pools/insert/" data = dict() data['identifier'] = identifier data['default_port'] = default_port data['environment'] = environment data['balancing'] = balancing data['servicedownaction'] = servicedownaction data['healthcheck_type'] = healthcheck_type data['healthcheck_expect'] = healthcheck_expect data['healthcheck_request'] = healthcheck_request if old_healthcheck_id == '': old_healthcheck_id = None data['old_healthcheck_id'] = old_healthcheck_id data['maxcon'] = maxcon data['ip_list_full'] = ip_list_full data['id_equips'] = id_equips data['priorities'] = priorities data['ports_reals'] = ports_reals data['nome_equips'] = nome_equips data['weight'] = weight return self.post(uri, data=data) def save(self, id, identifier, default_port, environment, balancing, healthcheck_type, healthcheck_expect, healthcheck_request, maxcon, ip_list_full, nome_equips, id_equips, priorities, weight, ports_reals, id_pool_member, servicedownaction=None): uri = "api/pools/save/" data = dict() data['id'] = id data['identifier'] = identifier data['default_port'] = default_port data['environment'] = environment data['balancing'] = balancing data['servicedownaction'] = servicedownaction data['healthcheck_type'] = healthcheck_type data['healthcheck_expect'] = healthcheck_expect data['healthcheck_request'] = healthcheck_request data['maxcon'] = maxcon data['id_pool_member'] = id_pool_member data['ip_list_full'] = ip_list_full data['id_equips'] = id_equips data['priorities'] = priorities data['ports_reals'] = ports_reals data['nome_equips'] = nome_equips data['weight'] = weight return self.post(uri, data=data) def save_reals(self, id_server_pool, ip_list_full, nome_equips, id_equips, priorities, weight, ports_reals, id_pool_member): uri = "api/pools/save_reals/" data = dict() data['id_server_pool'] = id_server_pool data['id_pool_member'] = id_pool_member data['ip_list_full'] = ip_list_full data['id_equips'] = id_equips data['priorities'] = priorities data['ports_reals'] = ports_reals data['nome_equips'] = nome_equips data['weight'] = weight return self.post(uri, data=data) def update(self, id_server_pool, default_port, balancing, healthcheck_type, healthcheck_expect, healthcheck_request, old_healthcheck_id, maxcon, ip_list_full, nome_equips, id_equips, priorities, weight, ports_reals, servicedownaction=None): uri = "api/pools/edit/" data = dict() # data['identifier'] = identifier data['default_port'] = default_port # data['environment'] = environment data['balancing'] = balancing data['servicedownaction'] = servicedownaction data['healthcheck_type'] = healthcheck_type data['healthcheck_expect'] = healthcheck_expect data['healthcheck_request'] = healthcheck_request if old_healthcheck_id == '': old_healthcheck_id = None data['old_healthcheck_id'] = old_healthcheck_id data['maxcon'] = maxcon data['ip_list_full'] = ip_list_full data['id_equips'] = id_equips data['priorities'] = priorities data['ports_reals'] = ports_reals data['id_server_pool'] = id_server_pool data['nome_equips'] = nome_equips data['weight'] = weight return self.post(uri, data=data) def list_all_members_by_poolll_members(self, id_pools): uri = "api/pools/get_all_members/%s/" % id_pools return self.get(uri) def list_all_members_by_pool(self, id_server_pool, checkstatus=False, pagination=None): data = dict() uri = "api/pools/get_all_members/%s/?checkstatus=%s" % (id_server_pool, checkstatus) if pagination: data["start_record"] = pagination.start_record data["end_record"] = pagination.end_record data["asorting_cols"] = pagination.asorting_cols data["searchable_columns"] = pagination.searchable_columns data["custom_search"] = pagination.custom_search or None return self.post(uri, data=data) else: return self.get(uri) def get_equip_by_ip(self, id_ip): """ Get equipment by IP id :param id_ip: IP id :return: Following dictionary:{ "equipamento" :[{ "id": < id > "tipo_equipamento": < tipo_equipamento >, "modelo": < modelo >, "nome": < nome >, "grupos": < grupos > }] :raise NetworkAPIException: Falha ao acessar fonte de dados """ uri = "api/pools/get_equip_by_ip/%s/" % id_ip return self.get(uri) def list_healthchecks(self): """ List all healthchecks :return: Following dictionary: :: {'ambiente': [{ 'id': <id_environment>, 'grupo_l3': <id_group_l3>, 'grupo_l3_name': <name_group_l3>, 'ambiente_logico': <id_logical_environment>, 'ambiente_logico_name': <name_ambiente_logico>, 'divisao_dc': <id_dc_division>, 'divisao_dc_name': <name_divisao_dc>, 'filter': <id_filter>, 'filter_name': <filter_name>, 'link': <link> }, ... ]} :raise DataBaseError: Falha na networkapi ao acessar o banco de dados. """ uri = "api/pools/list_healthchecks/" return self.get(uri) # def delete_pool(self, ids): # """ # Delete Pools # :param ids: List of ids # :return: None on success # :raise PoolConstraintVipException # :raise ScriptDeletePoolException # :raise InvalidIdPoolException # :raise NetworkAPIException # """ # data = dict() # data["ids"] = ids # uri = "api/pools/delete/" # return self.post(uri, data) def get_by_pk(self, pk): uri = "api/pools/getbypk/%s/" % pk return self.get(uri) def remove(self, pools): """ Remove Pools Running Script And Update to Not Created :param ids: List of ids :return: None on success :raise ScriptRemovePoolException :raise InvalidIdPoolException :raise NetworkAPIException """ data = dict() data["pools"] = pools uri = "api/pools/v2/" return self.delete(uri, data) def create(self, pools): """ Create Pools Running Script And Update to Created :param pools: List of pools :return: None on success :raise PoolDoesNotExistException :raise ScriptCreatePoolException :raise InvalidIdPoolException :raise NetworkAPIException """ data = dict() data["pools"] = pools uri = "api/pools/v2/" return self.put(uri, data) def enable(self, ids): """ Enable Pool Members Running Script :param ids: List of ids :return: None on success :raise PoolMemberDoesNotExistException :raise InvalidIdPoolMemberException :raise ScriptEnablePoolException :raise NetworkAPIException """ data = dict() data["ids"] = ids uri = "api/pools/enable/" return self.post(uri, data) def disable(self, ids): """ Disable Pool Members Running Script :param ids: List of ids :return: None on success :raise PoolMemberDoesNotExistException :raise InvalidIdPoolMemberException :raise ScriptDisablePoolException :raise NetworkAPIException """ data = dict() data["ids"] = ids uri = "api/pools/disable/" return self.post(uri, data) def get_opcoes_pool_by_ambiente(self, id_ambiente): data = dict() data["id_environment"] = id_ambiente uri = "api/pools/get_opcoes_pool_by_ambiente/" return self.post(uri, data=data) def get_requisicoes_vip_by_pool(self, id_server_pool, pagination): data = dict() data["start_record"] = pagination.start_record data["end_record"] = pagination.end_record data["asorting_cols"] = pagination.asorting_cols data["searchable_columns"] = pagination.searchable_columns data["custom_search"] = pagination.custom_search or None uri = "api/pools/get_requisicoes_vip_by_pool/%s/" % id_server_pool return self.post(uri, data=data) def list_by_environment(self, environment_id): """ Disable Pool Members Running Script :param ids: List of ids :return: Following dictionary:{ "pools" :[{ "id": < id > "default_port": < default_port >, "identifier": < identifier >, "healthcheck": < healthcheck >, }, ... too ... ]} :raise ObjectDoesNotExistException :raise ValidationException :raise NetworkAPIException """ uri = "api/pools/list/by/environment/%s/" % (environment_id) return self.get(uri) def list_pool_members(self, pool_id): """ Disable Pool Members Running Script :param ids: List of ids :return: :raise ObjectDoesNotExistException :raise ValidationException :raise NetworkAPIException """ uri = "api/pools/list/members/%s/" % (pool_id) return self.get(uri) def list_by_environmet_vip(self, environment_vip_id): """ """ uri = "api/pools/list/by/environment/vip/%s/" % (environment_vip_id) return self.get(uri) def list_environments_with_pools(self): """ """ uri = "api/pools/list/environment/with/pools/" return self.get(uri) def list_all_environment_related_environment_vip(self): """ """ uri = "api/pools/list/environments/environmentvip/" return self.get(uri) def get_available_ips_to_add_server_pool(self, equip_name, id_ambiente): """ """ uri = "api/pools/getipsbyambiente/{}/{}/".format(equip_name, id_ambiente) return self.get(uri) ####################### # API V3 ####################### def get_pool(self, pool_id): uri = "api/v3/pool/%s/" % pool_id return self.get(uri) def list_pool(self, search): uri = "api/v3/pool/?%s" % urllib.urlencode({"search": search}) return self.get(uri) def save_pool(self, pool): uri = "api/v3/pool/" data = dict() data['server_pools'] = list() data['server_pools'].append(pool) return self.post(uri, data) def update_pool(self, pool, pool_id): uri = "api/v3/pool/%s/" % pool_id data = dict() data['server_pools'] = list() data['server_pools'].append(pool) return self.put(uri, data) def delete_pool(self,
py_attrs: name = "p->%s" % entry.cname code.putln("tmp = ((PyObject*)%s);" % name) if entry.is_declared_generic: code.put_init_to_py_none(name, py_object_type, nanny=False) else: code.put_init_to_py_none(name, entry.type, nanny=False) code.putln("Py_XDECREF(tmp);") else: for entry in py_attrs: code.putln("Py_CLEAR(p->%s);" % entry.cname) for entry in py_buffers: # Note: shouldn't this call __Pyx_ReleaseBuffer ?? code.putln("Py_CLEAR(p->%s.obj);" % entry.cname) if cclass_entry.cname == '__pyx_memoryviewslice': code.putln("__PYX_XDEC_MEMVIEW(&p->from_slice, 1);") code.putln("return 0;") code.putln("}") def generate_getitem_int_function(self, scope, code): # This function is put into the sq_item slot when # a __getitem__ method is present. It converts its # argument to a Python integer and calls mp_subscript. code.putln( "static PyObject *%s(PyObject *o, Py_ssize_t i) {" % ( scope.mangle_internal("sq_item"))) code.putln( "PyObject *r;") code.putln( "PyObject *x = PyInt_FromSsize_t(i); if(!x) return 0;") code.putln( "r = Py_TYPE(o)->tp_as_mapping->mp_subscript(o, x);") code.putln( "Py_DECREF(x);") code.putln( "return r;") code.putln( "}") def generate_ass_subscript_function(self, scope, code): # Setting and deleting an item are both done through # the ass_subscript method, so we dispatch to user's __setitem__ # or __delitem__, or raise an exception. base_type = scope.parent_type.base_type set_entry = scope.lookup_here("__setitem__") del_entry = scope.lookup_here("__delitem__") code.putln("") code.putln( "static int %s(PyObject *o, PyObject *i, PyObject *v) {" % ( scope.mangle_internal("mp_ass_subscript"))) code.putln( "if (v) {") if set_entry: code.putln("return %s(o, i, v);" % set_entry.func_cname) else: self.generate_guarded_basetype_call( base_type, "tp_as_mapping", "mp_ass_subscript", "o, i, v", code) code.putln( "PyErr_Format(PyExc_NotImplementedError,") code.putln( ' "Subscript assignment not supported by %.200s", Py_TYPE(o)->tp_name);') code.putln( "return -1;") code.putln( "}") code.putln( "else {") if del_entry: code.putln( "return %s(o, i);" % ( del_entry.func_cname)) else: self.generate_guarded_basetype_call( base_type, "tp_as_mapping", "mp_ass_subscript", "o, i, v", code) code.putln( "PyErr_Format(PyExc_NotImplementedError,") code.putln( ' "Subscript deletion not supported by %.200s", Py_TYPE(o)->tp_name);') code.putln( "return -1;") code.putln( "}") code.putln( "}") def generate_guarded_basetype_call( self, base_type, substructure, slot, args, code): if base_type: base_tpname = base_type.typeptr_cname if substructure: code.putln( "if (%s->%s && %s->%s->%s)" % ( base_tpname, substructure, base_tpname, substructure, slot)) code.putln( " return %s->%s->%s(%s);" % ( base_tpname, substructure, slot, args)) else: code.putln( "if (%s->%s)" % ( base_tpname, slot)) code.putln( " return %s->%s(%s);" % ( base_tpname, slot, args)) def generate_ass_slice_function(self, scope, code): # Setting and deleting a slice are both done through # the ass_slice method, so we dispatch to user's __setslice__ # or __delslice__, or raise an exception. base_type = scope.parent_type.base_type set_entry = scope.lookup_here("__setslice__") del_entry = scope.lookup_here("__delslice__") code.putln("") code.putln( "static int %s(PyObject *o, Py_ssize_t i, Py_ssize_t j, PyObject *v) {" % ( scope.mangle_internal("sq_ass_slice"))) code.putln( "if (v) {") if set_entry: code.putln( "return %s(o, i, j, v);" % ( set_entry.func_cname)) else: self.generate_guarded_basetype_call( base_type, "tp_as_sequence", "sq_ass_slice", "o, i, j, v", code) code.putln( "PyErr_Format(PyExc_NotImplementedError,") code.putln( ' "2-element slice assignment not supported by %.200s", Py_TYPE(o)->tp_name);') code.putln( "return -1;") code.putln( "}") code.putln( "else {") if del_entry: code.putln( "return %s(o, i, j);" % ( del_entry.func_cname)) else: self.generate_guarded_basetype_call( base_type, "tp_as_sequence", "sq_ass_slice", "o, i, j, v", code) code.putln( "PyErr_Format(PyExc_NotImplementedError,") code.putln( ' "2-element slice deletion not supported by %.200s", Py_TYPE(o)->tp_name);') code.putln( "return -1;") code.putln( "}") code.putln( "}") def generate_richcmp_function(self, scope, code): if scope.lookup_here("__richcmp__"): # user implemented, nothing to do return # otherwise, we have to generate it from the Python special methods richcmp_cfunc = scope.mangle_internal("tp_richcompare") code.putln("") code.putln("static PyObject *%s(PyObject *o1, PyObject *o2, int op) {" % richcmp_cfunc) code.putln("switch (op) {") class_scopes = [] cls = scope.parent_type while cls is not None and not cls.entry.visibility == 'extern': class_scopes.append(cls.scope) cls = cls.scope.parent_type.base_type assert scope in class_scopes extern_parent = None if cls and cls.entry.visibility == 'extern': # need to call up into base classes as we may not know all implemented comparison methods extern_parent = cls if cls.typeptr_cname else scope.parent_type.base_type eq_entry = None has_ne = False for cmp_method in TypeSlots.richcmp_special_methods: for class_scope in class_scopes: entry = class_scope.lookup_here(cmp_method) if entry is not None: break else: continue cmp_type = cmp_method.strip('_').upper() # e.g. "__eq__" -> EQ code.putln("case Py_%s: {" % cmp_type) if cmp_method == '__eq__': eq_entry = entry # Python itself does not do this optimisation, it seems... #code.putln("if (o1 == o2) return __Pyx_NewRef(Py_True);") elif cmp_method == '__ne__': has_ne = True # Python itself does not do this optimisation, it seems... #code.putln("if (o1 == o2) return __Pyx_NewRef(Py_False);") code.putln("return %s(o1, o2);" % entry.func_cname) code.putln("}") if eq_entry and not has_ne and not extern_parent: code.putln("case Py_NE: {") code.putln("PyObject *ret;") # Python itself does not do this optimisation, it seems... #code.putln("if (o1 == o2) return __Pyx_NewRef(Py_False);") code.putln("ret = %s(o1, o2);" % eq_entry.func_cname) code.putln("if (likely(ret && ret != Py_NotImplemented)) {") code.putln("int b = __Pyx_PyObject_IsTrue(ret); Py_DECREF(ret);") code.putln("if (unlikely(b < 0)) return NULL;") code.putln("ret = (b) ? Py_False : Py_True;") code.putln("Py_INCREF(ret);") code.putln("}") code.putln("return ret;") code.putln("}") code.putln("default: {") if extern_parent and extern_parent.typeptr_cname: code.putln("if (likely(%s->tp_richcompare)) return %s->tp_richcompare(o1, o2, op);" % ( extern_parent.typeptr_cname, extern_parent.typeptr_cname)) code.putln("return __Pyx_NewRef(Py_NotImplemented);") code.putln("}") code.putln("}") # switch code.putln("}") def generate_getattro_function(self, scope, code): # First try to get the attribute using __getattribute__, if defined, or # PyObject_GenericGetAttr. # # If that raises an AttributeError, call the __getattr__ if defined. # # In both cases, defined can be in this class, or any base class. def lookup_here_or_base(n, tp=None, extern_return=None): # Recursive lookup if tp is None: tp = scope.parent_type r = tp.scope.lookup_here(n) if r is None: if tp.is_external and extern_return is not None: return extern_return if tp.base_type is not None: return lookup_here_or_base(n, tp.base_type) return r has_instance_dict = lookup_here_or_base("__dict__", extern_return="extern") getattr_entry = lookup_here_or_base("__getattr__") getattribute_entry = lookup_here_or_base("__getattribute__") code.putln("") code.putln( "static PyObject *%s(PyObject *o, PyObject *n) {" % ( scope.mangle_internal("tp_getattro"))) if getattribute_entry is not None: code.putln( "PyObject *v = %s(o, n);" % ( getattribute_entry.func_cname)) else: if not has_instance_dict and scope.parent_type.is_final_type: # Final with no dict => use faster type attribute lookup. code.globalstate.use_utility_code( UtilityCode.load_cached("PyObject_GenericGetAttrNoDict", "ObjectHandling.c")) generic_getattr_cfunc = "__Pyx_PyObject_GenericGetAttrNoDict" elif not has_instance_dict or has_instance_dict == "extern": # No dict in the known ancestors, but don't know about extern ancestors or subtypes. code.globalstate.use_utility_code( UtilityCode.load_cached("PyObject_GenericGetAttr", "ObjectHandling.c")) generic_getattr_cfunc = "__Pyx_PyObject_GenericGetAttr" else: generic_getattr_cfunc = "PyObject_GenericGetAttr" code.putln( "PyObject *v = %s(o, n);" % generic_getattr_cfunc) if getattr_entry is not None: code.putln( "if (!v && PyErr_ExceptionMatches(PyExc_AttributeError)) {") code.putln( "PyErr_Clear();") code.putln( "v = %s(o, n);" % ( getattr_entry.func_cname)) code.putln( "}") code.putln( "return v;") code.putln( "}") def generate_setattro_function(self, scope, code): # Setting and deleting an attribute are both done through # the setattro method, so we dispatch to user's __setattr__ # or __delattr__ or fall back on PyObject_GenericSetAttr. base_type = scope.parent_type.base_type set_entry = scope.lookup_here("__setattr__") del_entry = scope.lookup_here("__delattr__") code.putln("") code.putln( "static int %s(PyObject *o, PyObject *n, PyObject *v) {" % ( scope.mangle_internal("tp_setattro"))) code.putln( "if (v) {") if set_entry: code.putln( "return %s(o, n, v);" % ( set_entry.func_cname)) else: self.generate_guarded_basetype_call( base_type, None, "tp_setattro", "o, n, v", code) code.putln( "return PyObject_GenericSetAttr(o, n, v);") code.putln( "}") code.putln( "else {") if del_entry: code.putln( "return %s(o, n);" % ( del_entry.func_cname)) else: self.generate_guarded_basetype_call( base_type, None, "tp_setattro", "o, n, v", code) code.putln( "return PyObject_GenericSetAttr(o, n, 0);") code.putln( "}") code.putln( "}") def generate_descr_get_function(self, scope, code): # The __get__ function of a descriptor object can be # called with NULL for the second or third arguments # under some circumstances, so we replace them with # None in that case. user_get_entry = scope.lookup_here("__get__") code.putln("") code.putln( "static PyObject *%s(PyObject *o, PyObject *i, PyObject *c) {" % ( scope.mangle_internal("tp_descr_get"))) code.putln( "PyObject *r = 0;") code.putln( "if (!i) i = Py_None;") code.putln( "if (!c) c = Py_None;") #code.put_incref("i", py_object_type) #code.put_incref("c", py_object_type) code.putln( "r = %s(o, i, c);" % ( user_get_entry.func_cname)) #code.put_decref("i", py_object_type) #code.put_decref("c", py_object_type) code.putln( "return r;") code.putln( "}") def generate_descr_set_function(self, scope, code): # Setting and deleting are both done through the __set__ # method of a descriptor, so we dispatch to user's __set__ # or __delete__ or raise an exception. base_type = scope.parent_type.base_type user_set_entry = scope.lookup_here("__set__") user_del_entry = scope.lookup_here("__delete__") code.putln("") code.putln( "static int %s(PyObject *o, PyObject *i, PyObject *v) {" % ( scope.mangle_internal("tp_descr_set"))) code.putln( "if (v) {") if user_set_entry: code.putln( "return %s(o, i, v);" % ( user_set_entry.func_cname)) else: self.generate_guarded_basetype_call( base_type, None, "tp_descr_set", "o, i, v", code) code.putln( 'PyErr_SetString(PyExc_NotImplementedError, "__set__");') code.putln( "return -1;") code.putln( "}") code.putln( "else {") if user_del_entry: code.putln( "return %s(o, i);" % ( user_del_entry.func_cname)) else: self.generate_guarded_basetype_call( base_type, None, "tp_descr_set", "o, i, v", code) code.putln( 'PyErr_SetString(PyExc_NotImplementedError, "__delete__");') code.putln( "return -1;") code.putln( "}") code.putln( "}") def generate_property_accessors(self, cclass_scope, code): for entry in cclass_scope.property_entries: property_scope = entry.scope if property_scope.defines_any(["__get__"]): self.generate_property_get_function(entry, code) if property_scope.defines_any(["__set__", "__del__"]): self.generate_property_set_function(entry, code) def generate_property_get_function(self,
#!/usr/bin/env python # -*- coding: utf-8 -*- import pytest from pytest import mark from translate.tools import pomerge from translate.storage import factory from translate.storage import po from translate.storage import xliff from translate.misc import wStringIO def test_str2bool(): """test the str2bool function""" assert pomerge.str2bool("yes") assert pomerge.str2bool("true") assert pomerge.str2bool("1") assert not pomerge.str2bool("no") assert not pomerge.str2bool("false") assert not pomerge.str2bool("0") pytest.raises(ValueError, pomerge.str2bool, "2") class TestPOMerge: xliffskeleton = '''<?xml version="1.0" ?> <xliff version="1.1" xmlns="urn:oasis:names:tc:xliff:document:1.1"> <file original="filename.po" source-language="en-US" datatype="po"> <body> %s </body> </file> </xliff>''' def mergestore(self, templatesource, inputsource, mergeblanks="yes", mergefuzzy="yes", mergecomments="yes"): """merges the sources of the given files and returns a new pofile object""" templatefile = wStringIO.StringIO(templatesource) inputfile = wStringIO.StringIO(inputsource) outputfile = wStringIO.StringIO() assert pomerge.mergestore(inputfile, outputfile, templatefile, mergeblanks=mergeblanks, mergefuzzy=mergefuzzy, mergecomments=mergecomments, ) outputpostring = outputfile.getvalue() outputpofile = po.pofile(outputpostring) return outputpofile def mergexliff(self, templatesource, inputsource, mergeblanks="yes", mergefuzzy="yes", mergecomments="yes"): """merges the sources of the given files and returns a new xlifffile object""" templatefile = wStringIO.StringIO(templatesource) inputfile = wStringIO.StringIO(inputsource) outputfile = wStringIO.StringIO() assert pomerge.mergestore(inputfile, outputfile, templatefile, mergeblanks=mergeblanks, mergefuzzy=mergefuzzy, mergecomments=mergecomments) outputxliffstring = outputfile.getvalue() print "Generated XML:" print outputxliffstring outputxlifffile = xliff.xlifffile(outputxliffstring) return outputxlifffile def countunits(self, pofile): """returns the number of non-header items""" if pofile.units[0].isheader(): return len(pofile.units) - 1 else: return len(pofile.units) def singleunit(self, pofile): """checks that the pofile contains a single non-header unit, and returns it""" assert self.countunits(pofile) == 1 return pofile.units[-1] def test_mergesore_bad_data(self): """Test that we catch bad options sent to mergestore""" templatefile = wStringIO.StringIO("") inputfile = wStringIO.StringIO("") outputfile = wStringIO.StringIO() pytest.raises(ValueError, pomerge.mergestore, inputfile, outputfile, templatefile, mergeblanks="yay") pytest.raises(ValueError, pomerge.mergestore, inputfile, outputfile, templatefile, mergecomments="yay") def test_simplemerge(self): """checks that a simple po entry merges OK""" templatepo = '''#: simple.test\nmsgid "Simple String"\nmsgstr ""\n''' inputpo = '''#: simple.test\nmsgid "Simple String"\nmsgstr "Dimpled Ring"\n''' pofile = self.mergestore(templatepo, inputpo) pounit = self.singleunit(pofile) assert pounit.source == "Simple String" assert pounit.target == "Dimpled Ring" def test_simplemerge_no_locations(self): """checks that a simple po entry merges OK""" templatepo = '''msgid "Simple String" msgstr ""''' inputpo = '''msgid "Simple String" msgstr "Dimpled Ring"''' pofile = self.mergestore(templatepo, inputpo) pounit = self.singleunit(pofile) assert pounit.source == "Simple String" assert pounit.target == "Dimpled Ring" def test_replacemerge(self): """checks that a simple po entry merges OK""" templatepo = '''#: simple.test\nmsgid "Simple String"\nmsgstr "Dimpled Ring"\n''' inputpo = '''#: simple.test\nmsgid "Simple String"\nmsgstr "Dimpled King"\n''' pofile = self.mergestore(templatepo, inputpo) pounit = self.singleunit(pofile) assert pounit.source == "Simple String" assert pounit.target == "Dimpled King" def test_merging_blanks(self): """By default we will merge blanks, but we can also override that""" templatepo = '''#: simple.test\nmsgid "Simple String"\nmsgstr "Dimpled Ring"\n''' inputpo = '''#: simple.test\nmsgid "Simple String"\nmsgstr ""\n''' pofile = self.mergestore(templatepo, inputpo) pounit = self.singleunit(pofile) assert pounit.source == "Simple String" assert pounit.target == "" pofile = self.mergestore(templatepo, inputpo, mergeblanks="no") pounit = self.singleunit(pofile) assert pounit.source == "Simple String" assert pounit.target == "Dimpled Ring" def test_merging_fuzzies(self): """By default we will merge fuzzies, but can can also override that.""" templatepo = '''#: simple.test\nmsgid "Simple String"\nmsgstr "Dimpled Ring"\n''' inputpo = '''#: simple.test\n#, fuzzy\nmsgid "Simple String"\nmsgstr "changed fish"\n''' pofile = self.mergestore(templatepo, inputpo) pounit = self.singleunit(pofile) assert pounit.source == "Simple String" assert pounit.target == "changed fish" assert pounit.isfuzzy() pofile = self.mergestore(templatepo, inputpo, mergefuzzy="no") pounit = self.singleunit(pofile) assert pounit.source == "Simple String" assert pounit.target == "Dimpled Ring" assert pounit.isfuzzy() == False def test_merging_locations(self): """check that locations on separate lines are output in Gettext form of all on one line""" templatepo = '''#: location.c:1\n#: location.c:2\nmsgid "Simple String"\nmsgstr ""\n''' inputpo = '''#: location.c:1\n#: location.c:2\nmsgid "Simple String"\nmsgstr "Dimpled Ring"\n''' expectedpo = '''#: location.c:1%slocation.c:2\nmsgid "Simple String"\nmsgstr "Dimpled Ring"\n''' % po.lsep pofile = self.mergestore(templatepo, inputpo) print pofile assert str(pofile) == expectedpo def test_unit_missing_in_template_with_locations(self): """If the unit is missing in the template we should raise an error""" templatepo = '''#: location.c:1 msgid "Simple String" msgstr ""''' inputpo = '''#: location.c:1 msgid "Simple String" msgstr "Dimpled Ring" #: location.c:1 msgid "Extra string" msgstr "Perplexa ring"''' expectedpo = '''#: location.c:1 msgid "Simple String" msgstr "Dimpled Ring" ''' pofile = self.mergestore(templatepo, inputpo) print pofile assert str(pofile) == expectedpo def test_unit_missing_in_template_no_locations(self): """If the unit is missing in the template we should raise an error""" templatepo = '''msgid "Simple String" msgstr ""''' inputpo = '''msgid "Simple String" msgstr "Dimpled Ring" msgid "Extra string" msgstr "Perplexa ring"''' expectedpo = '''msgid "Simple String" msgstr "Dimpled Ring" ''' pofile = self.mergestore(templatepo, inputpo) print pofile assert str(pofile) == expectedpo def test_reflowed_source_comments(self): """ensure that we don't duplicate source comments (locations) if they have been reflowed""" templatepo = '''#: newMenu.label\n#: newMenu.accesskey\nmsgid "&New"\nmsgstr ""\n''' newpo = '''#: newMenu.label newMenu.accesskey\nmsgid "&New"\nmsgstr "&Nuwe"\n''' expectedpo = '''#: newMenu.label%snewMenu.accesskey\nmsgid "&New"\nmsgstr "&Nuwe"\n''' % po.lsep pofile = self.mergestore(templatepo, newpo) pounit = self.singleunit(pofile) print pofile assert str(pofile) == expectedpo def test_comments_with_blank_lines(self): """ensure that we don't loose empty newlines in comments""" templatepo = '''# # ***** BEGIN LICENSE BLOCK ***** # Version: MPL 1.1/GPL 2.0/LGPL 2.1 # # bla bla msgid "bla" msgstr "blabla" ''' newpo = templatepo expectedpo = templatepo pofile = self.mergestore(templatepo, newpo) pounit = self.singleunit(pofile) print pofile assert str(pofile) == expectedpo def test_merge_dont_delete_unassociated_comments(self): """ensure that we do not delete comments in the PO file that are not assocaited with a message block""" templatepo = '''# Lonely comment\n\n# Translation comment\nmsgid "Bob"\nmsgstr "Toolmaker"\n''' mergepo = '''# Translation comment\nmsgid "Bob"\nmsgstr "Builder"\n''' expectedpo = '''# Lonely comment\n# Translation comment\nmsgid "Bob"\nmsgstr "Builder"\n''' pofile = self.mergestore(templatepo, mergepo) # pounit = self.singleunit(pofile) print pofile assert str(pofile) == expectedpo def test_preserve_format_trailing_newlines(self): """Test that we can merge messages correctly that end with a newline""" templatepo = '''msgid "Simple string\\n"\nmsgstr ""\n''' mergepo = '''msgid "Simple string\\n"\nmsgstr "Dimpled ring\\n"\n''' expectedpo = '''msgid "Simple string\\n"\nmsgstr "Dimpled ring\\n"\n''' pofile = self.mergestore(templatepo, mergepo) print "Expected:\n%s\n\nMerged:\n%s" % (expectedpo, str(pofile)) assert str(pofile) == expectedpo templatepo = '''msgid ""\n"Simple string\\n"\nmsgstr ""\n''' mergepo = '''msgid ""\n"Simple string\\n"\nmsgstr ""\n"Dimpled ring\\n"\n''' expectedpo = '''msgid ""\n"Simple string\\n"\nmsgstr "Dimpled ring\\n"\n''' expectedpo2 = '''msgid "Simple string\\n"\nmsgstr "Dimpled ring\\n"\n''' pofile = self.mergestore(templatepo, mergepo) print "Expected:\n%s\n\nMerged:\n%s" % (expectedpo, str(pofile)) assert str(pofile) == expectedpo or str(pofile) == expectedpo2 def test_preserve_format_minor_start_and_end_of_sentence_changes(self): """Test that we are not too fussy about large diffs for simple changes at the start or end of a sentence""" templatepo = '''msgid "Target type:"\nmsgstr "Doelsoort"\n\n''' mergepo = '''msgid "Target type:"\nmsgstr "Doelsoort:"\n''' expectedpo = mergepo pofile = self.mergestore(templatepo, mergepo) print "Expected:\n%s\n\nMerged:\n%s" % (expectedpo, str(pofile)) assert str(pofile) == expectedpo templatepo = '''msgid "&Select"\nmsgstr "Kies"\n\n''' mergepo = '''msgid "&Select"\nmsgstr "&Kies"\n''' expectedpo = mergepo pofile = self.mergestore(templatepo, mergepo) print "Expected:\n%s\n\nMerged:\n%s" % (expectedpo, str(pofile)) assert str(pofile) == expectedpo templatepo = '''msgid "en-us, en"\nmsgstr "en-us, en"\n''' mergepo = '''msgid "en-us, en"\nmsgstr "af-za, af, en-za, en-gb, en-us, en"\n''' expectedpo = mergepo pofile = self.mergestore(templatepo, mergepo) print "Expected:\n%s\n\nMerged:\n%s" % (expectedpo, str(pofile)) assert str(pofile) == expectedpo def test_preserve_format_last_entry_in_a_file(self): """The last entry in a PO file is usualy not followed by an empty line. Test that we preserve this""" templatepo = '''msgid "First"\nmsgstr ""\n\nmsgid "Second"\nmsgstr ""\n''' mergepo = '''msgid "First"\nmsgstr "Eerste"\n\nmsgid "Second"\nmsgstr "Tweede"\n''' expectedpo = '''msgid "First"\nmsgstr "Eerste"\n\nmsgid "Second"\nmsgstr "Tweede"\n''' pofile = self.mergestore(templatepo, mergepo) print "Expected:\n%s\n\nMerged:\n%s" % (expectedpo, str(pofile)) assert str(pofile) == expectedpo templatepo = '''msgid "First"\nmsgstr ""\n\nmsgid "Second"\nmsgstr ""\n\n''' mergepo = '''msgid "First"\nmsgstr "Eerste"\n\nmsgid "Second"\nmsgstr "Tweede"\n''' expectedpo = '''msgid "First"\nmsgstr "Eerste"\n\nmsgid "Second"\nmsgstr "Tweede"\n''' pofile = self.mergestore(templatepo, mergepo) print "Expected:\n%s\n\nMerged:\n%s" % (expectedpo, str(pofile)) assert str(pofile) == expectedpo @mark.xfail(reason="Not Implemented") def test_escape_tabs(self): """Ensure that input tabs are escaped in the output, like gettext does.""" # The strings below contains the tab character, not spaces. templatepo = '''msgid "First Second"\nmsgstr ""\n\n''' mergepo = '''msgid "First Second"\nmsgstr "Eerste Tweede"\n''' expectedpo = r'''msgid "First\tSecond" msgstr "Eerste\tTweede" ''' pofile = self.mergestore(templatepo, mergepo) print "Expected:\n%s\n\nMerged:\n%s" % (expectedpo, str(pofile)) assert str(pofile) == expectedpo def test_preserve_comments_layout(self): """Ensure that when we merge with new '# (poconflict)' or other comments that we don't mess formating""" templatepo = '''#: filename\nmsgid "Desktop Background.bmp"\nmsgstr "Desktop Background.bmp"\n\n''' mergepo = '''# (pofilter) unchanged: please translate\n#: filename\nmsgid "Desktop Background.bmp"\nmsgstr "Desktop Background.bmp"\n''' expectedpo = mergepo pofile = self.mergestore(templatepo, mergepo) print "Expected:\n%s\n\nMerged:\n%s" % (expectedpo, str(pofile)) assert str(pofile) == expectedpo def test_merge_dos2unix(self): """Test that merging a comment line with dos newlines doesn't add a new line""" templatepo = '''# User comment\n# (pofilter) Translate Toolkit comment\n#. Automatic comment\n#: location_comment.c:110\nmsgid "File"\nmsgstr "File"\n\n''' mergepo = '''# User comment\r\n# (pofilter) Translate Toolkit comment\r\n#. Automatic comment\r\n#: location_comment.c:110\r\nmsgid "File"\r\nmsgstr "Ifayile"\r\n\r\n''' expectedpo = '''# User comment\n# (pofilter) Translate Toolkit comment\n#. Automatic comment\n#: location_comment.c:110\nmsgid "File"\nmsgstr "Ifayile"\n''' pofile = self.mergestore(templatepo, mergepo) assert str(pofile) == expectedpo # Unassociated comment templatepo = '''# Lonely comment\n\n#: location_comment.c:110\nmsgid "Bob"\nmsgstr
&= ~triangle(0.6, 0.95, 0.6, 0.05, 0.18, 0.5) _widths['K'] = 0.6 _glyphs['K'] = shape shape = rectangle(0, 0.5, 0, 1) shape &= ~triangle(0.1, 1, 0.5, 1, 0.1, 0.45) shape &= ~triangle(0.36, 0, 0.1, 0, 0.1, 0.25) shape &= ~triangle(0.6, 1, 0.5, 0.0, 0.18, 0.35) shape &= ~triangle(0.1, 1, 0.6, 1, 0.6, 0.5) _widths['k'] = 0.5 _glyphs['k'] = shape shape = rectangle(0, 0.6, 0, 0.1) shape |= rectangle(0, 0.1, 0, 1) _widths['L'] = 0.6 _glyphs['L'] = shape shape = rectangle(0.025, 0.125, 0, 1) _widths['l'] = 0.15 _glyphs['l'] = shape shape = rectangle(0, 0.1, 0, 1) shape |= rectangle(0.7, 0.8, 0, 1) shape |= triangle(0, 1, 0.1, 1, 0.45, 0) shape |= triangle(0.45, 0, 0.35, 0, 0, 1) shape |= triangle(0.7, 1, 0.8, 1, 0.35, 0) shape |= triangle(0.35, 0, 0.8, 1, 0.45, 0) _widths['M'] = 0.8 _glyphs['M'] = shape shape = circle(0.175, 0.35, 0.175) & ~circle(0.175, 0.35, 0.075) shape |= circle(0.425, 0.35, 0.175) & ~circle(0.425, 0.35, 0.075) shape &= rectangle(0, 0.65, 0.35, 0.65) shape |= rectangle(0, 0.1, 0, 0.525) shape |= rectangle(0.25, 0.35, 0, 0.35) shape |= rectangle(0.5, 0.6, 0, 0.35) _widths['m'] = 0.6 _glyphs['m'] = shape shape = rectangle(0, 0.1, 0, 1) shape |= rectangle(0.5, 0.6, 0, 1) shape |= triangle(0, 1, 0.1, 1, 0.6, 0) shape |= triangle(0.6, 0, 0.5, 0, 0, 1) _widths['N'] = 0.6 _glyphs['N'] = shape shape = circle(0.275, 0.275, 0.275) shape &= ~circle(0.275, 0.275, 0.175) shape &= rectangle(0, 0.55, 0.325, 0.55) shape |= rectangle(0, 0.1, 0, 0.55) shape |= rectangle(0.45, 0.55, 0, 0.325) _widths['n'] = 0.55 _glyphs['n'] = shape shape = circle(0.3, 0.7, 0.3) & ~circle(0.3, 0.7, 0.2) shape |= circle(0.3, 0.3, 0.3) & ~circle(0.3, 0.3, 0.2) shape &= ~rectangle(0, 0.6, 0.3, 0.7) shape |= rectangle(0, 0.1, 0.3, 0.7) shape |= rectangle(0.5, 0.6, 0.3, 0.7) _widths['O'] = 0.6 _glyphs['O'] = shape shape = circle(0.275, 0.275, 0.275) shape &= ~circle(0.275, 0.275, 0.175) _widths['o'] = 0.55 _glyphs['o'] = shape shape = circle(0.3, 0.725, 0.275) shape &= ~circle(0.3, 0.725, 0.175) shape &= rectangle(0.3, 1, 0, 1) shape |= rectangle(0, 0.1, 0, 1) shape |= rectangle(0.1, 0.3, 0.45, 0.55) shape |= rectangle(0.1, 0.3, 0.9, 1) _widths['P'] = 0.575 _glyphs['P'] = shape shape = circle(0.275, 0.275, 0.275) shape &= ~circle(0.275, 0.275, 0.175) shape |= rectangle(0, 0.1, -0.375, 0.55) _widths['p'] = 0.55 _glyphs['p'] = shape shape = circle(0.3, 0.7, 0.3) & ~circle(0.3, 0.7, 0.2) shape |= circle(0.3, 0.3, 0.3) & ~circle(0.3, 0.3, 0.2) shape &= ~rectangle(0, 0.6, 0.3, 0.7) shape |= rectangle(0, 0.1, 0.3, 0.7) shape |= rectangle(0.5, 0.6, 0.3, 0.7) shape |= triangle(0.5, 0.1, 0.6, 0.1, 0.6, 0) shape |= triangle(0.5, 0.1, 0.5, 0.3, 0.6, 0.1) _widths['Q'] = 0.6 _glyphs['Q'] = shape shape = circle(0.275, 0.275, 0.275) & ~circle(0.275, 0.275, 0.175) shape |= rectangle(0.45, 0.55, -0.375, 0.55) _widths['q'] = 0.55 _glyphs['q'] = shape shape = circle(0.3, 0.725, 0.275) shape &= ~circle(0.3, 0.725, 0.175) shape &= rectangle(0.3, 1, 0, 1) shape |= rectangle(0, 0.1, 0, 1) shape |= rectangle(0.1, 0.3, 0.45, 0.55) shape |= rectangle(0.1, 0.3, 0.9, 1) shape |= triangle(0.3, 0.5, 0.4, 0.5, 0.575, 0) shape |= triangle(0.475, 0.0, 0.3, 0.5, 0.575, 0) _widths['R'] = 0.575 _glyphs['R'] = shape shape = circle(0.55, 0, 0.55) & ~scale_x(circle(0.55, 0, 0.45), 0.55, 0.8) shape &= rectangle(0, 0.55, 0, 0.55) shape = scale_x(shape, 0, 0.7) shape |= rectangle(0, 0.1, 0, 0.55) _widths['r'] = 0.385 _glyphs['r'] = shape shape = circle(0.275, 0.725, 0.275) shape &= ~circle(0.275, 0.725, 0.175) shape &= ~rectangle(0.275, 0.55, 0.45, 0.725) shape |= reflect_x(reflect_y(shape, 0.5), .275) _widths['S'] = 0.55 _glyphs['S'] = shape shape = circle(0.1625, 0.1625, 0.1625) shape &= ~scale_x(circle(0.165, 0.165, 0.0625), 0.165, 1.5) shape &= ~rectangle(0, 0.1625, 0.1625, 0.325) shape |= reflect_x(reflect_y(shape, 0.275), 0.1625) shape = scale_x(shape, 0, 1.5) _widths['s'] = 0.4875 _glyphs['s'] = shape shape = rectangle(0, 0.6, 0.9, 1) | rectangle(0.25, 0.35, 0, 0.9) _widths['T'] = 0.6 _glyphs['T'] = shape shape = circle(0.4, 0.25, 0.25) & ~circle(0.4, 0.25, 0.15) shape &= rectangle(0, 0.4, 0, 0.25) shape |= rectangle(0, 0.4, 0.55, 0.65) shape |= rectangle(0.15, 0.25, 0.25, 1) _widths['t'] = 0.4 _glyphs['t'] = shape shape = circle(0.3, 0.3, 0.3) & ~circle(0.3, 0.3, 0.2) shape &= rectangle(0, 0.6, 0, 0.3) shape |= rectangle(0, 0.1, 0.3, 1) shape |= rectangle(0.5, 0.6, 0.3, 1) _widths['U'] = 0.6 _glyphs['U'] = shape shape = circle(0.275, 0.275, 0.275) & ~circle(0.275, 0.275, 0.175) shape &= rectangle(0, 0.55, 0, 0.275) shape |= rectangle(0, 0.1, 0.275, 0.55) shape |= rectangle(0.45, 0.55, 0, 0.55) _widths['u'] = 0.55 _glyphs['u'] = shape shape = triangle(0, 1, 0.1, 1, 0.35, 0) shape |= triangle(0.35, 0, 0.25, 0, 0, 1) shape |= reflect_x(shape, 0.3) _widths['V'] = 0.6 _glyphs['V'] = shape shape = triangle(0, 0.55, 0.1, 0.55, 0.35, 0) shape |= triangle(0.35, 0, 0.25, 0, 0, 0.55) shape |= reflect_x(shape, 0.3) _widths['v'] = 0.6 _glyphs['v'] = shape shape = triangle(0, 1, 0.1, 1, 0.25, 0) shape |= triangle(0.25, 0, 0.15, 0, 0, 1) shape |= triangle(0.15, 0, 0.35, 1, 0.45, 1) shape |= triangle(0.45, 1, 0.25, 0, 0.15, 0) shape |= reflect_x(shape, 0.4) _widths['W'] = 0.8 _glyphs['W'] = shape shape = triangle(0, 0.55, 0.1, 0.55, 0.25, 0) shape |= triangle(0.25, 0, 0.15, 0, 0, 0.55) shape |= triangle(0.15, 0, 0.35, 0.5, 0.45, 0.5) shape |= triangle(0.45, 0.5, 0.25, 0, 0.15, 0) shape |= reflect_x(shape, 0.4) _widths['w'] = 0.8 _glyphs['w'] = shape shape = triangle(0, 1, 0.125, 1, 0.8, 0) shape |= triangle(0.8, 0, 0.675, 0, 0, 1) shape |= reflect_x(shape, 0.4) _widths['X'] = 0.8 _glyphs['X'] = shape shape = triangle(0, 0.55, 0.125, 0.55, 0.55, 0) shape |= triangle(0.55, 0, 0.425, 0, 0, 0.55) shape |= reflect_x(shape, 0.275) _widths['x'] = 0.55 _glyphs['x'] = shape shape = triangle(0, 1, 0.1, 1, 0.45, 0.5) shape |= triangle(0.45, 0.5, 0.35, 0.5, 0, 1) shape |= reflect_x(shape, 0.4) shape |= rectangle(0.35, 0.45, 0, 0.5) _widths['Y'] = 0.8 _glyphs['Y'] = shape shape = triangle(0, 0.55, 0.1, 0.55, 0.325, 0) shape |= triangle(0.325, 0, 0.225, 0, 0, 0.55) shape |= reflect_x(shape, 0.275) | move(reflect_x(shape, 0.275), -0.225, -0.55) shape &= rectangle(0, 0.55, -0.375, 0.55) _widths['y'] = 0.55 _glyphs['y'] = shape shape = rectangle(0, 0.6, 0, 1) shape &= ~triangle(0, 0.1, 0, 0.9, 0.45, 0.9) shape &= ~triangle(0.6, 0.1, 0.15, 0.1, 0.6, 0.9) _widths['Z'] = 0.6 _glyphs['Z'] = shape shape = rectangle(0, 0.6, 0, 0.55) shape &= ~triangle(0, 0.1, 0, 0.45, 0.45, 0.45) shape &= ~triangle(0.6, 0.1, 0.15, 0.1, 0.6, 0.45) _widths['z'] = 0.6 _glyphs['z'] = shape shape = Shape("f1.0", 0, 0.55, 0, 1) _widths[' '] = 0.55 _glyphs[' '] = shape shape = circle(0.075, 0.075, 0.075) shape = scale_y(shape, 0.075, 3) shape &= rectangle(0.0, 0.15, -0.15, 0.075) shape &= ~triangle(0.075, 0.075, 0.0, -0.15, -0.5, 0.075) shape |= circle(0.1, 0.075, 0.075) _widths[','] = 0.175 _glyphs[','] = shape shape = circle(0.075, 0.075, 0.075) _widths['.'] = 0.15 _glyphs['.'] = shape shape = rectangle(0, 0.1, 0.55, 0.8) _widths["'"] = 0.1 _glyphs["'"] = shape shape = rectangle(0, 0.1, 0.55, 0.8) | rectangle(0.2, 0.3, 0.55, 0.8) _widths['"'] = 0.3 _glyphs['"'] = shape shape = circle(0.075, 0.15, 0.075) | circle(0.075, 0.45, 0.075) _widths[':'] = 0.15 _glyphs[':'] = shape shape = circle(0.075, 0.15, 0.075) shape = scale_y(shape, 0.15, 3) shape &= rectangle(0.0, 0.15, -0.075, 0.15) shape &= ~triangle(0.075, 0.15, 0.0, -0.075, -0.5, 0.15) shape |= circle(0.075, 0.45, 0.075) shape |= circle(0.1, 0.15, 0.075) _widths[';'] = 0.15 _glyphs[';'] = shape shape = rectangle(0.025, 0.125, 0.3, 1) shape |= circle(0.075, 0.075, 0.075) _widths['!'] = 0.1 _glyphs['!'] = shape shape = rectangle(0.05, 0.4, 0.35, 0.45) _widths['-'] = 0.45 _glyphs['-'] = shape shape = circle(0, 0.4, 0.6) & ~scale_x(circle(0, 0.4, 0.5), 0, 0.7) shape &= rectangle(0, 0.6, -0.2, 1) shape = scale_x(shape, 0, 1/2.) _widths[')'] = 0.3 _glyphs[')'] = shape shape = circle(0.6, 0.4, 0.6) & ~scale_x(circle(0.6, 0.4, 0.5), 0.6, 0.7) shape &= rectangle(0, 0.6, -0.2, 1) shape = scale_x(shape, 0, 1/2.) _widths['('] = 0.3 _glyphs['('] = shape shape = rectangle(0, 0.3, 0, 1) shape &= ~circle(0, 1, 0.2) shape &= ~rectangle(0, 0.2, 0, 0.7) _widths['1'] = 0.3 _glyphs['1'] = shape shape = circle(0.275, .725, .275) shape &= ~circle(0.275, 0.725, 0.175) shape &= ~rectangle(0, 0.55, 0, 0.725) shape |= rectangle(0, 0.55, 0, 0.1) shape |= triangle(0, 0.1, 0.45, 0.775, 0.55, 0.725) shape |= triangle(0, 0.1, 0.55, 0.725, 0.125, 0.1) _widths['2'] = 0.55 _glyphs['2'] = shape shape = circle(0.3, 0.725, 0.275) shape &= ~circle(0.3, 0.725, 0.175) shape |= circle(0.3, 0.275, 0.275) shape &= ~circle(0.3, 0.275, 0.175) shape &= ~rectangle(0, 0.275, 0.275, 0.725) _widths['3'] = 0.55 _glyphs['3'] = shape shape = triangle(-0.10, 0.45, 0.4, 1, 0.4, 0.45) shape |= rectangle(0.4, 0.5, 0, 1) shape &= ~triangle(0.4, 0.85, 0.4, 0.55, 0.1, 0.55) shape &= rectangle(0, 0.5, 0, 1) _widths['4'] = 0.5 _glyphs['4'] = shape shape = circle(0.325, 0.325, 0.325) & ~circle(0.325, 0.325, 0.225) shape &= ~rectangle(0, 0.325, 0.325, 0.65) shape |= rectangle(0, 0.325, 0.55, 0.65) shape |= rectangle(0, 0.1, 0.55, 1) shape |= rectangle(0.1, 0.65, 0.9, 1) _widths['5'] = 0.65 _glyphs['5'] = shape shape = circle(0.275, 0.725, 0.275) & ~scale_y(circle(0.275, 0.725, 0.175), .725, 1.2) shape &= rectangle(0, 0.55, 0.725, 1) shape &= ~triangle(0.275, 0.925, 0.55, 0.9, 0.55, 0.725) shape = scale_y(shape, 1, 2) shape = scale_x(shape, 0, 1.1) shape &= ~rectangle(0.275, 0.65, 0., 0.7) shape |= rectangle(0, 0.1, 0.275, 0.45) shape |= circle(0.275, 0.275, 0.275) & ~circle(0.275, 0.275, 0.175) _widths['6'] = 0.55 _glyphs['6'] = shape shape = rectangle(0, 0.6, 0.9, 1) shape |= triangle(0, 0, 0.475, 0.9, 0.6, 0.9) shape |= triangle(0, 0, 0.6, 0.9, 0.125, 0) _widths['7'] = 0.6 _glyphs['7'] = shape shape = circle(0.3, 0.725, 0.275) shape &= ~circle(0.3, 0.725, 0.175) shape |= circle(0.3, 0.275, 0.275) shape &= ~circle(0.3, 0.275, 0.175) _widths['8'] = 0.55 _glyphs['8'] = shape shape = reflect_x(reflect_y(_glyphs['6'], 0.5), _widths['6']/2) _widths['9'] = _widths['6'] _glyphs['9'] = shape shape = circle(0.5, 0.5, 0.5) & ~scale_x(circle(0.5, 0.5, 0.4), 0.5, 0.7**0.5) shape =
Client, domain: str, base_score: int) -> int: """Analyzing premium subscription. Args: client: a client with relationship commands. domain: the domain to check base_score: the base score from basic analysis Returns: score calculated by relationship. """ return self.analyze_premium_scores( domain, base_score, [ client.get_domain_communicating_files, client.get_url_downloaded_files, client.get_url_referrer_files ] ) def analyze_premium_ip_score(self, client: Client, ip: str, base_score: int) -> int: """Analyzing premium subscription. Args: client: a client with relationship commands. ip: the ip to check base_score: the base score from basic analysis Returns: score calculated by relationship. """ return self.analyze_premium_scores( ip, base_score, [ client.get_ip_communicating_files, client.get_ip_downloaded_files, client.get_ip_referrer_files ] ) # endregion # region Helper functions def create_relationships(entity_a: str, entity_a_type: str, relationships_response: dict, reliability): """ Create a list of entityRelationship object from the api result entity_a: (str) - source of the relationship entity_a_type: (str) - type of the source of the relationship relationships_response: (dict) - the relationship response from the api reliability: The reliability of the source. Returns a list of EntityRelationship objects. """ relationships_list: List[EntityRelationship] = [] for relationship_type, relationship_type_raw in relationships_response.items(): relationships_data = relationship_type_raw.get('data', []) if relationships_data: if isinstance(relationships_data, dict): relationships_data = [relationships_data] for relation in relationships_data: name = RELATIONSHIP_TYPE.get(entity_a_type.lower(), {}).get(relationship_type) entity_b = relation.get('id', '') entity_b_type = INDICATOR_TYPE.get(relation.get('type', '').lower()) if entity_b and entity_b_type and name: if entity_b_type == FeedIndicatorType.URL: entity_b = dict_safe_get(relation, ['context_attributes', 'url']) relationships_list.append( EntityRelationship(entity_a=entity_a, entity_a_type=entity_a_type, name=name, entity_b=entity_b, entity_b_type=entity_b_type, source_reliability=reliability, brand=INTEGRATION_NAME)) else: demisto.info( f"WARNING: Relationships will not be created to entity A {entity_a} with relationship name {name}") return relationships_list def arg_to_number_must_int(arg: Any, arg_name: Optional[str] = None, required: bool = False): """Wrapper of arg_to_number that must return int For mypy fixes. """ arg_num = arg_to_number(arg, arg_name, required) assert isinstance(arg_num, int) return arg_num def epoch_to_timestamp(epoch: Union[int, str]) -> Optional[str]: """Converts epoch timestamp to a string. Args: epoch: Time to convert Returns: A formatted string if succeeded. if not, returns None. """ try: return datetime.utcfromtimestamp(int(epoch)).strftime("%Y-%m-%d %H:%M:%SZ") except (TypeError, OSError, ValueError): return None def decrease_data_size(data: Union[dict, list]) -> Union[dict, list]: """ Minifying data size. Args: data: the data object from raw response Returns: the same data without: data['attributes']['last_analysis_results'] data['attributes']['pe_info'] data['attributes']['crowdsourced_ids_results'] data['attributes']['autostart_locations'] data['attributes']['sandbox_verdicts'] data['attributes']['sigma_analysis_summary'] """ attributes_to_remove = [ 'last_analysis_results', 'pe_info', 'crowdsourced_ids_results', 'autostart_locations', 'sandbox_verdicts', 'sigma_analysis_summary' ] if isinstance(data, list): data = [decrease_data_size(item) for item in data] else: for attribute in attributes_to_remove: try: del data['attributes'][attribute] except KeyError: pass return data def build_domain_output( client: Client, score_calculator: ScoreCalculator, domain: str, raw_response: dict, extended_data: bool): data = raw_response.get('data', {}) attributes = data.get('attributes', {}) relationships_response = data.get('relationships', {}) whois: defaultdict = get_whois(attributes.get('whois', '')) score = score_calculator.domain_score(domain, raw_response) if score != Common.DBotScore.BAD and client.is_premium: score = score_calculator.analyze_premium_domain_score(client, domain, score) logs = score_calculator.get_logs() demisto.debug(logs) relationships_list = create_relationships(entity_a=domain, entity_a_type=FeedIndicatorType.Domain, relationships_response=relationships_response, reliability=client.reliability) domain_indicator = Common.Domain( domain=domain, name_servers=whois['Name Server'], creation_date=whois['Creation Date'], updated_date=whois['Updated Date'], expiration_date=whois['Registry Expiry Date'], admin_name=whois['Admin Organization'], admin_email=whois['Admin Email'], admin_country=whois['Admin Country'], registrant_email=whois['Registrant Email'], registrant_country=whois['Registrant Country'], registrar_name=whois['Registrar'], registrar_abuse_email=whois['Registrar Abuse Contact Email'], registrar_abuse_phone=whois['Registrar Abuse Contact Phone'], dbot_score=Common.DBotScore( domain, DBotScoreType.DOMAIN, INTEGRATION_NAME, score=score, malicious_description=logs, reliability=client.reliability ), relationships=relationships_list ) if not extended_data: data = decrease_data_size(data) attributes = data.get('attributes', {}) return CommandResults( outputs_prefix=f'{INTEGRATION_ENTRY_CONTEXT}.Domain', outputs_key_field='id', indicator=domain_indicator, readable_output=tableToMarkdown( f'Domain data of {domain}', { 'last_modified': epoch_to_timestamp(attributes.get('last_modification_date')), **data, **whois, **attributes }, headers=[ 'id', 'Registrant Country', 'last_modified', 'last_analysis_stats' ], removeNull=True, headerTransform=underscoreToCamelCase ), outputs=data, raw_response=raw_response, relationships=relationships_list ) def build_url_output( client: Client, score_calculator: ScoreCalculator, url: str, raw_response: dict, extended_data: bool ) -> CommandResults: data = raw_response.get('data', {}) score = score_calculator.url_score(url, raw_response) if score != Common.DBotScore.BAD and client.is_premium: score = score_calculator.analyze_premium_url_score(client, url, score) logs = score_calculator.get_logs() demisto.debug(logs) # creating readable output attributes = data.get('attributes', {}) last_analysis_stats = attributes.get('last_analysis_stats', {}) relationships_response = data.get('relationships', {}) positive_detections = last_analysis_stats.get('malicious', 0) detection_engines = sum(last_analysis_stats.values()) relationships_list = create_relationships(entity_a=url, entity_a_type=FeedIndicatorType.URL, relationships_response=relationships_response, reliability=client.reliability) url_indicator = Common.URL( url, category=attributes.get('categories'), detection_engines=detection_engines, positive_detections=positive_detections, relationships=relationships_list, dbot_score=Common.DBotScore( url, DBotScoreType.URL, INTEGRATION_NAME, score=score, reliability=client.reliability, malicious_description=logs ) ) if not extended_data: data = decrease_data_size(data) return CommandResults( outputs_prefix=f'{INTEGRATION_ENTRY_CONTEXT}.URL', outputs_key_field='id', indicator=url_indicator, readable_output=tableToMarkdown( f'URL data of "{url}"', { **data, **data.get('attributes', {}), 'url': url, 'positives': f'{positive_detections}/{detection_engines}', 'last_modified': epoch_to_timestamp(attributes.get('last_modification_date')) }, headers=[ 'url', 'title', 'last_modified', 'has_content', 'last_http_response_content_sha256', 'positives', 'reputation' ], removeNull=True, headerTransform=underscoreToCamelCase ), outputs=data, raw_response=raw_response, relationships=relationships_list ) def build_ip_output(client: Client, score_calculator: ScoreCalculator, ip: str, raw_response: dict, extended_data: bool) -> CommandResults: score = score_calculator.ip_score(ip, raw_response) if score != Common.DBotScore.BAD and client.is_premium: score = score_calculator.analyze_premium_ip_score(client, ip, score) logs = score_calculator.get_logs() demisto.debug(logs) data = raw_response.get('data', {}) attributes = data.get('attributes', {}) relationships_response = data.get('relationships', {}) last_analysis_stats = attributes.get('last_analysis_stats') positive_engines = last_analysis_stats.get('malicious', 0) detection_engines = sum(last_analysis_stats.values()) relationships_list = create_relationships(entity_a=ip, entity_a_type=FeedIndicatorType.IP, relationships_response=relationships_response, reliability=client.reliability) ip_indicator = Common.IP( ip, asn=attributes.get('asn'), geo_country=attributes.get('country'), detection_engines=detection_engines, positive_engines=positive_engines, relationships=relationships_list, dbot_score=Common.DBotScore( ip, DBotScoreType.IP, INTEGRATION_NAME, score=score, malicious_description=logs, reliability=client.reliability ) ) if not extended_data: data = decrease_data_size(data) return CommandResults( outputs_prefix=f'{INTEGRATION_ENTRY_CONTEXT}.IP', outputs_key_field='id', indicator=ip_indicator, readable_output=tableToMarkdown( f'IP reputation of {ip}:', { **data, **attributes, 'last_modified': epoch_to_timestamp(attributes.get('last_modification_date')), 'positives': f'{positive_engines}/{detection_engines}' }, headers=['id', 'network', 'country', 'last_modified', 'reputation', 'positives'], headerTransform=underscoreToCamelCase ), outputs=data, raw_response=raw_response, relationships=relationships_list ) def build_file_output( client: Client, score_calculator: ScoreCalculator, file_hash: str, raw_response: dict, extended_data: bool ) -> CommandResults: data = raw_response.get('data', {}) attributes = data.get('attributes') relationships_response = data.get('relationships', {}) score = score_calculator.file_score(file_hash, raw_response) logs = score_calculator.get_logs() demisto.debug(logs) signature_info = attributes.get('signature_info', {}) exiftool = attributes.get('exiftool', {}) relationships_list = create_relationships(entity_a=file_hash, entity_a_type=FeedIndicatorType.File, relationships_response=relationships_response, reliability=client.reliability) file_indicator = Common.File( dbot_score=Common.DBotScore( file_hash, DBotScoreType.FILE, integration_name=INTEGRATION_NAME, score=score, malicious_description=logs, reliability=client.reliability ), name=exiftool.get('OriginalFileName'), size=attributes.get('size'), sha1=attributes.get('sha1'), sha256=attributes.get('sha256'), file_type=exiftool.get('MIMEType'), md5=attributes.get('md5'), ssdeep=attributes.get('ssdeep'), extension=exiftool.get('FileTypeExtension'), company=exiftool.get('CompanyName'), product_name=exiftool.get('ProductName'), tags=attributes.get('tags'), signature=Common.FileSignature( authentihash=attributes.get('authentihash'), copyright=signature_info.get('copyright'), file_version=signature_info.get('file version'), description=signature_info.get('description'), internal_name=signature_info.get('internal name'), original_name=signature_info.get('original name') ), relationships=relationships_list ) if not extended_data: data = decrease_data_size(data) last_analysis_stats = attributes.get("last_analysis_stats", {}) malicious = last_analysis_stats.get('malicious', 0) total = sum(last_analysis_stats.values()) return CommandResults( outputs_prefix=f'{INTEGRATION_ENTRY_CONTEXT}.File', outputs_key_field='id', indicator=file_indicator, readable_output=tableToMarkdown( f'Results of file hash {file_hash}', { **data, **attributes, 'positives': f'{malicious}/{total}', 'creation date': epoch_to_timestamp(attributes.get('creation_date')), 'last modified': epoch_to_timestamp(attributes.get('last_modification_date', 0)) }, headers=[ 'sha1', 'sha256', 'md5', 'meaningful_name', 'type_extension', 'creation date', 'last modified', 'reputation', 'positives' ], removeNull=True, headerTransform=underscoreToCamelCase ), outputs=data, raw_response=raw_response, relationships=relationships_list ) def get_whois(whois_string: str) -> defaultdict: """Gets a WHOIS string and returns a parsed dict of the WHOIS String. Args: whois_string: whois from domain api call Returns: A parsed whois Examples: >>> get_whois('key1:value\\nkey2:value2') defaultdict({'key1': 'value', 'key2': 'value2'}) """ whois: defaultdict = defaultdict(lambda: None) for line in whois_string.splitlines(): key: str value: str try: key, value = line.split(sep=':', maxsplit=1) except ValueError: demisto.debug(f'Could not unpack Whois string: {line}. Skipping') continue key = key.strip() value = value.strip() if key in whois: if not isinstance(whois[key], list): whois[key] = [whois[key]] whois[key].append(value) else: whois[key] = value return whois def get_file_context(entry_id: str) -> dict: """Gets a File object from context. Args: entry_id: The entry ID of the file Returns: File object contains Name, Hashes and more information """ context = demisto.dt(demisto.context(), f'File(val.EntryID === "{entry_id}")') if not context: return {} if isinstance(context, list): return context[0] return context def raise_if_ip_not_valid(ip: str): """Raises an error if ip is not valid Args: ip: ip address Raises: ValueError: If IP is not valid Examples: >>> raise_if_ip_not_valid('not ip at all') Traceback (most recent call last): ... ValueError: IP "not ip at all" is not valid >>> raise_if_ip_not_valid('8.8.8.8') """ if not is_ip_valid(ip, accept_v6_ips=True): raise ValueError(f'IP "{ip}" is not valid') def raise_if_hash_not_valid(file_hash: str): """Raises an error if file_hash is not valid Args: file_hash: file hash Raises: ValueError: if hash is not of type SHA-256, SHA-1 or MD5 Examples: >>> raise_if_hash_not_valid('not a hash') Traceback (most recent call last): ... ValueError: Hash "not a hash" is not of type SHA-256, SHA-1 or MD5 >>> raise_if_hash_not_valid('7e641f6b9706d860baf09fe418b6cc87') """ if get_hash_type(file_hash) not in ('sha256', 'sha1', 'md5'): raise ValueError(f'Hash "{file_hash}" is not of type SHA-256, SHA-1 or MD5') def encode_url_to_base64(url: str) -> str: """Gets a string (in this case, url but it can not be) and return it as base64 without padding ('=') Args: url: A string to encode Returns: Base64 encoded string with no padding Examples: >>> encode_url_to_base64('https://example.com') 'aHR0cHM6Ly9leGFtcGxlLmNvbQ' """ return base64.urlsafe_b64encode(url.encode()).decode().strip('=') def merge_two_dicts(dict_a, dict_b): merged_dict = dict_a.copy() merged_dict.update(dict_b) return merged_dict # endregion # region Reputation commands def ip_command(client: Client, score_calculator: ScoreCalculator, args: dict, relationships: str) -> List[CommandResults]: """ 1 API Call for regular 1-4 API Calls for premium subscriptions """ ips = argToList(args['ip']) results: List[CommandResults] = list() for ip in ips: raise_if_ip_not_valid(ip) try: raw_response = client.ip(ip, relationships) except Exception as exception: # If anything happens, just keep going demisto.debug(f'Could not process IP: "{ip}"\n {str(exception)}') continue results.append( build_ip_output(client, score_calculator, ip, raw_response, argToBoolean(args.get('extended_data'))) ) return results def file_command(client: Client, score_calculator: ScoreCalculator, args: dict, relationships: str) -> List[CommandResults]: """ 1 API Call """ files
tilts when calculating wavefront RMS orig_modestart = self.modestart if self.modestart < 4: self.modestart = 4 norm_coeffs = self.norm_array # once coeffs are normalized, the RMS is simply the sqrt of the sum of the squares of the coefficients rms = np.sqrt(np.sum(norm_coeffs**2)) self.modestart = orig_modestart return rms def pretty_print(self, last=22): """ Overload __repr__ to print out coefficients in a nice way including units and descriptive labels. """ s = "" if self.normalized: s += "Normalized (Noll) Coefficients\n" else: s += "Fringe Coefficients\n" keys = sorted(self.coeffs.keys()) if len(keys) > 0: for k in keys: if self._key_to_l(k) <= last: if k in self.__zernikelabels: label = self.label(k) else: label = "" if k in self.errorbars: s += "{0:>4s}: {1:>24s} \t {2:s}".format( k, "{0:8.4g} ± {1:5.3g}".format(self.coeffs[k].value, self.errorbars[k]), label ) else: s += "{0:>4s}: {1:>24s} \t {2:s}".format(k, "{0:0.4g}".format(self.coeffs[k]), label) s += "\n" s += "\n" if self._key_to_l(keys[-1]) > last: hi_orders = ZernikeVector(modestart=last+1, normalized=self.normalized, units=self.units, **self.coeffs) s += "High Orders RMS: \t {0:0.3g} {1:>3s} ➞ {2:>3s}\n".format( hi_orders.rms, self._l_to_key(last+1), keys[-1] ) s += "Total RMS: \t {0:0.4g}\n".format(self.rms) return s def copy(self): """ Make a new ZernikeVector with the same configuration and coefficients """ new = ZernikeVector(modestart=self.modestart, normalized=self.normalized, errorbars=copy.deepcopy(self.errorbars), units=self.units, **self.coeffs) return new def save(self, filename="zernike.json"): """ Save Zernike vector to JSON format to retain units and normalization info. """ outdict = {} outdict['units'] = self.units.to_string() outdict['normalized'] = self.normalized outdict['modestart'] = self.modestart outdict['errorbars'] = {} outdict['coeffs'] = {} for k, c in self.coeffs.items(): outdict['coeffs'][k] = c.value for k, v in self.errorbars.items(): outdict['errorbars'][k] = v.value with open(filename, 'w') as f: json.dump(outdict, f, indent=4, separators=(',', ': '), sort_keys=True) def load(self, filename="zernike.json"): """ Load ZernikeVector data from JSON format. """ try: with open(filename, 'r') as f: json_data = json.load(f) except IOError as e: msg = f"Missing JSON file, {filename}: {e}" raise ZernikeException(value=msg) if 'units' in json_data: self.units = u.Unit(json_data['units']) if 'normalized' in json_data: self.normalized = json_data['normalized'] if 'modestart' in json_data: self.modestart = json_data['modestart'] self.coeffs = {} if 'coeffs' in json_data: for k, v in json_data['coeffs'].items(): self.__setitem__(k, v) self.errorbars = {} if 'errorbars' in json_data: for k, v in json_data['coeffs'].items(): self.errorbars[k] = u.Quantity(v, self.units) def load_lmfit(self, fit_report): """ Load information from a lmfit.minimizer.MinimizerResult that is output from a wavefront fit. If there are reported errorbars, populate those, too. """ has_errors = fit_report.errorbars for k, v in fit_report.params.items(): self.__setitem__(k, v) if has_errors: self.errorbars[k] = u.Quantity(v.stderr, self.units) def label(self, key): """ If defined, return the descriptive label for mode, 'key' """ if key in self.__zernikelabels: return self.__zernikelabels[key] else: return key def shortlabel(self, key): """ If defined, return the short label for mode, 'key' """ if key in self.__shortlabels: return self.__shortlabels[key] else: return key def from_array(self, coeffs, zmap=None, modestart=None, errorbars=None, normalized=False): """ Load coefficients from a provided list/array starting from modestart. Array is assumed to start from self.modestart if modestart is not provided. """ self.normalized = normalized if errorbars is None or not isinstance(errorbars, dict): self.errorbars = dict() else: self.errorbars = errorbars if len(coeffs) > 0: if modestart is None: modestart = self.modestart if zmap: for k in zmap: mode = self._key_to_l(k) if mode >= modestart: self.__setitem__(k, coeffs[zmap[k]]) else: for i, c in enumerate(coeffs): key = self._l_to_key(i + modestart) if c != 0.0: self.__setitem__(key, c) def frac_error(self, key=None): """ Calculate fractional size of the error bar for mode, key. """ err = 0.0 if key is not None and key in self.coeffs and self.coeffs[key].value != 0.0: err = np.abs(self.errorbars.get(key, 0.0 * self.units).value / self.coeffs[key].value) return err def normalize(self): """ Normalize coefficients to unit variance for each mode. """ if not self.normalized: self.normalized = True for k in self.coeffs: mode = self._key_to_l(k) noll = noll_coefficient(mode) self.coeffs[k] /= noll if k in self.errorbars: self.errorbars[k] /= noll def denormalize(self): """ Restore normalized coefficients to fringe coefficients. """ if self.normalized: self.normalized = False for k in self.coeffs: mode = self._key_to_l(k) noll = noll_coefficient(mode) self.coeffs[k] *= noll if k in self.errorbars: self.errorbars[k] *= noll def ignore(self, key): """ Set coefficient, key, aside for later recall if needed. """ if self._valid_key(key) and key in self.coeffs: self.ignored[key] = self.coeffs[key] self.coeffs[key] = 0.0 * self.units def restore(self, key): """ Restore coefficient, key, back into set of coefficients. """ if self._valid_key(key) and key in self.ignored: self.coeffs[key] = self.ignored[key] del self.ignored[key] def rotate(self, angle=0.0 * u.deg): """ Rotate the ZernikeVector by an angle. Rotation matrix algorithm taken from https://arxiv.org/pdf/1302.7106.pdf. """ # this is a hack to extend the vector to the largest supported term to make sure we include everything affected # by the rotation self.coeffs['Z99'] = 0.0 a = self.array ang = u.Quantity(angle, u.rad) # convert angle to radians # there must be a more concise way to do this, but this makes it clear what's going on rotm = np.zeros((len(a), len(a))) for r in np.arange(len(a)): n_i, m_i = noll_to_zernike(r + self.modestart) for c in np.arange(len(a)): n_j, m_j = noll_to_zernike(c + self.modestart) if n_i != n_j: rotm[r, c] = 0.0 elif m_i == m_j: rotm[r, c] = np.cos(m_j * ang) elif m_i == -m_j and m_i != 0.0: rotm[r, c] = np.sin(m_j * ang) elif np.abs(m_i) != np.abs(m_j): rotm[r, c] = 0.0 else: rotm[r, c] = 1.0 rot_arr = np.dot(rotm, a) # this will take back out the zero terms del self.coeffs['Z99'] # i think it's correct to just pass on the uncertainties unchanged since measurements are done in unrotated space. # might want to consider handling rotations in the pupil coordinates before doing a fit. self.from_array(rot_arr, errorbars=self.errorbars) def total_phase(self, rho, phi): """ Calculate total phase displacement at polar coordinates (rho, phi). """ phase = 0.0 for k, z in self.coeffs.items(): mode = self._key_to_l(k) if self.normalized: norm = noll_coefficient(mode) else: norm = 1.0 ph = z * norm * zernike_noll(mode, rho, phi) phase += ph return phase def phase_map(self, n=400): """ Calculate a 2D polar map of total phase displacements with sampling of n points along rho and phi vectors. """ rho = np.linspace(0.0, 1.0, n) phi = np.linspace(0, 2*np.pi, n) [p, r] = np.meshgrid(phi, rho) x = r * np.cos(p) y = r * np.sin(p) ph = self.total_phase(r, p) return x, y, r, p, ph def fringe_bar_chart(self, total=True, max_c=2000*u.nm, title=None, last_mode=None): """ Plot a bar chart of the fringe amplitudes of the coefficients """ # we want to plot bars for each of the modes we usually use and thus label. label_keys = sorted(self.__zernikelabels.keys()) if last_mode is None: last_label = self._key_to_l(label_keys[-1]) else: last_label = last_mode last_coeff = self._key_to_l(sorted(self.coeffs.keys())[-1]) if last_coeff < 22: modes = label_keys[3:last_coeff] # ignore piston and tilts in bar plot else: modes = label_keys[3:22] labels = [self.shortlabel(m) for m in modes] if self.normalized: coeffs = [self.__getitem__(m).value * noll_coefficient(self._key_to_l(m)) for m in modes] errorbars = [self.errorbars.get(m, 0.0 * self.units).value * noll_coefficient(self._key_to_l(m)) for m in modes] else: coeffs = [self.__getitem__(m).value for m in modes] errorbars = [self.errorbars.get(m, 0.0 * self.units).value for m in modes] # lump higher order terms into one RMS bin. if last_coeff > last_label: hi_orders = ZernikeVector(modestart=last_label+1, normalized=self.normalized, units=self.units, **self.coeffs) labels.append("Hi Ord RMS") coeffs.append(hi_orders.rms.value) errorbars.append(0.0) # add total RMS if total: labels.append("Total RMS") coeffs.append(self.rms.value) errorbars.append(0.0) max_c = u.Quantity(max_c, self.units).value cmap = cm.ScalarMappable(col.Normalize(-max_c, max_c), cm.coolwarm_r) cmap._A = [] # stupid matplotlib ind = np.arange(len(labels)) fig, ax = plt.subplots(figsize=(11, 5)) fig.set_label("Fringe Wavefront Amplitude per Zernike Mode") ax.bar(ind, coeffs, color=cmap.to_rgba(coeffs), yerr=errorbars) ax.spines['top'].set_visible(False) ax.spines['right'].set_visible(False) ax.yaxis.grid(color='gray', linestyle='dotted') ax.xaxis.grid(color='gray', linestyle='dotted', lw=1) ax.set_axisbelow(True) ax.set_xticks(ind) ax.set_xticklabels(labels, rotation=45, ha='right', size='x-small') ax.set_ylim(-max_c, max_c) ax.set_ylabel(f"Wavefront Amplitude ({self.units})") if title is not None: ax.set_title(title) cb = fig.colorbar(cmap) cb.set_label(f"{self.units}") return fig def bar_chart(self, residual=None, total=True, max_c=500*u.nm, title=None, last_mode=None): """ Plot a bar chart of the coefficients and, optionally, a residual amount not included in the coefficients. """ # we want to plot bars for each of the modes we usually use and thus label. label_keys = sorted(self.__zernikelabels.keys()) if last_mode is None: last_label = self._key_to_l(label_keys[-1]) else: last_label = last_mode last_coeff = self._key_to_l(sorted(self.coeffs.keys())[-1]) if last_coeff < 22: modes = label_keys[3:last_coeff] # ignore piston and tilts
also considering provided entry # return a (l, ll, e, ee) tuple # break entries into two groups # 'node' is a full node that we wish to add 'entry' to # assume 'entry' is well-formed, i.e. it has an mbr and a node pointer def splitNode(self, node, entry): """ if entry.getChild().getParent() != None: print entry.getChild() in entry.getChild().getParent().getChildren() """ # print "child:", entry.getChild() # print "full node:", node """ if node.getParent() != None: print "children:", node.getParent().getChildren() """ # print "node:", node.toString() # print "splitting a node" # prev_leaf_status = node.isLeafNode() prev_leaf_status = None # associated with this operation is one for condenseTree # this line may be unnecessary # node.setIsLeafNode(False) curr_node = node # pick seeds E_overall = curr_node.getEntries() + [entry] # print "E_overall:", E_overall # result = RTree.linearPickSeeds(E_overall) result = RTree.quadraticPickSeeds(E_overall) seed_entry1, seed_entry2 = result parent = curr_node.getParent() """ if parent != None: parent.setIsLeafNode(True) """ # if parent != None: # print "parent has a child:", node in parent.getChildren() # print "children and entries:", parent.getChildren(), parent.getEntries() # if parent != None: # entries = parent.getEntries() # if parent != None and (node in parent.getChildren()): """ if parent != None: # print node, parent.getChildren() # print node in parent.getChildren() parent.removeEntry(parent.retrieveEntryForChild(node)) """ # possibly questionable # entry.getChild().setParent(parent) # print "parent:", parent # print curr_node == self.getRoot() # propagating prev_leaf_status may be unnecessary node1 = RTreeNode(parent, [seed_entry1], prev_leaf_status) node2 = RTreeNode(parent, [seed_entry2], prev_leaf_status) # also possibly questionable # have seed entries in parent seed_entry1.getChild().setParent(node1) seed_entry2.getChild().setParent(node2) # print node remaining_entries = [x for x in E_overall if x != seed_entry1 and x != seed_entry2] # print entry in remaining_entries or entry == seed_entry1 or entry == seed_entry2 # error here regarding mbr list; provided entries curr_overall_mbr1 = CompositeMBR(seed_entry1.getMBR().getUpperLeft(), seed_entry1.getMBR().getLowerRight(), [seed_entry1]) curr_overall_mbr2 = CompositeMBR(seed_entry2.getMBR().getUpperLeft(), seed_entry2.getMBR().getLowerRight(), [seed_entry2]) for i in range(len(remaining_entries)): curr_entry = remaining_entries[i] next_curr_node = curr_entry.getChild() # print curr_entry.getMBR().toString() # have an error here - num. of remaining entries is not properly decreasing num_remaining_entries = len(remaining_entries) curr_mbr = curr_entry.getMBR() # print curr_mbr.toString() enlargement1 = MBR.getAreaEnlargement(curr_overall_mbr1, curr_mbr) enlargement2 = MBR.getAreaEnlargement(curr_overall_mbr2, curr_mbr) # print enlargement1, enlargement2 m = next_curr_node.getMinimumNumEntriesPerNode() size1 = len(curr_overall_mbr1.getMBRList()) size2 = len(curr_overall_mbr2.getMBRList()) lambda_entries = num_remaining_entries # if parent != None: # parent.removeEntry(curr_entry) # print "curr. node entries, curr. entry, entry:", curr_node.getEntries(), curr_entry, entry if curr_entry != entry: curr_node.removeEntry(curr_entry) # print "entries for node #1:", [x.getMBR().toString() for x in node1.getEntries()] # print "entries for node #2:", [x.getMBR().toString() for x in node2.getEntries()] if size1 == (m - lambda_entries): curr_overall_mbr1 = MBR.getEnlargedMBR(curr_overall_mbr1, curr_mbr) node1.addEntry(curr_entry) next_curr_node.setParent(node1) continue if size2 == (m - lambda_entries): curr_overall_mbr2 = MBR.getEnlargedMBR(curr_overall_mbr2, curr_mbr) node2.addEntry(curr_entry) next_curr_node.setParent(node2) continue if enlargement1 > enlargement2: curr_overall_mbr1 = MBR.getEnlargedMBR(curr_overall_mbr1, curr_mbr) node1.addEntry(curr_entry) next_curr_node.setParent(node1) elif enlargement2 > enlargement1: curr_overall_mbr2 = MBR.getEnlargedMBR(curr_overall_mbr2, curr_mbr) node2.addEntry(curr_entry) next_curr_node.setParent(node2) elif enlargement2 == enlargement1: if size1 <= size2: curr_overall_mbr1 = MBR.getEnlargedMBR(curr_overall_mbr1, curr_mbr) node1.addEntry(curr_entry) next_curr_node.setParent(node1) elif size1 > size2: # print curr_entry.getMBR().toString() curr_overall_mbr2 = MBR.getEnlargedMBR(curr_overall_mbr2, curr_mbr) node2.addEntry(curr_entry) next_curr_node.setParent(node2) # next_parent = node.getParent() # print parent, next_parent if parent != None: # print node, parent.getChildren() # print node in parent.getChildren() parent.removeEntry(parent.retrieveEntryForChild(node)) # print "parent children and node:", parent.getChildren(), node # print "removed" # nodes with composite mbr's entry1 = RTreeEntry(curr_overall_mbr1, node1) entry2 = RTreeEntry(curr_overall_mbr2, node2) if node != self.getRootEntry().getChild(): # entry.getChild().setParent(parent) # print parent.getChildren(), node # entry_for_removal = parent.retrieveEntryForChild(node) # parent.removeEntry(entry_for_removal) parent.addEntry(entry1) parent.addEntry(entry2) # parent.addEntry(e) # parent.addEntry(ee) node1.setParent(parent) node2.setParent(parent) # node1.setParent(parent) # print "node #1:", node1.toString() # print "node #2:", node2.toString() # node2.setParent(parent) # print "parent again:", parent else: next_root = RTreeNode(None, [entry1, entry2], False) self.getRootEntry().setChild(next_root) # this causes problems # entry.getChild().setParent(next_root) node1.setParent(next_root) node2.setParent(next_root) """ if node.getParent() != None: print node in node.getParent().getChildren() """ return (node1, node2, entry1, entry2) # adjustTree modifies parents so that their mbr's # are enlarged and the nodes are possibly split # with the two resulting pieces being added # to parent's entry list # consider whether mbr's for a group have changed # returns an (ended_with_split, [resulting_first_entry_from_split, resulting_second_entry_from_split?]) tuple # ended_with_split tells us whether adjustTree ended by splitting a node that is root of a subtree """ # also, when taken w.r.t. an operation that ends with root, ended_with_split is pre-emptive """ # resulting_entries_from_split give us two entries that are to be children of current node # resulting_second_entry_from_split can be omitted @staticmethod def adjustTree(tree, node, resulting_entries_from_split, have_resulting_second_entry_from_split, is_first_call_after_first_pass): # if node == tree.getRootEntry().getChild(): if node.getParent() == None: # no parent to speak of # print "reach root case" # return (False, []) entry = tree.getRootEntry() curr_entries = entry.getChild().getEntries() children = [x.getChild() for x in curr_entries] mbr_list = [x.getMBR() for x in curr_entries] tight_overall_mbr = CompositeMBR.makeMBR(mbr_list) entry.setMBR(tight_overall_mbr) return (have_resulting_second_entry_from_split, resulting_entries_from_split) else: parent = node.getParent() curr_entries = node.getEntries() entry = None # print "parent:", parent """ if node.getParent() == None: entry = tree.getRootEntry() else: entry = node.getParent().retrieveEntryForChild(node) """ entry = parent.retrieveEntryForChild(node) children = [x.getChild() for x in curr_entries] mbr_list = [x.getMBR() for x in curr_entries] tight_overall_mbr = CompositeMBR.makeMBR(mbr_list) entry.setMBR(tight_overall_mbr) # set N, NN # if N is root, stop # let P be parent of N # let E_N be N's entry in P # adjust E_N.I so that it tightly encloses all entry rectangles in N # if N has partner NN resulting from an earlier split, # create a new entry E_NN with E_NN.p pointing to NN # and E_NN.I enclosing all rectangles in NN partner_entry = None if have_resulting_second_entry_from_split == True: first_entry, second_entry = resulting_entries_from_split partner_entry = second_entry # if have_resulting_second_entry_from_split == True and is_first_call_after_first_pass != True: if have_resulting_second_entry_from_split == True: partner_node = partner_entry.getChild() partner_entries = partner_node.getEntries() partner_children = [x.getChild() for x in partner_entries] partner_mbr_list = [x.getMBR() for x in partner_entries] partner_tight_overall_mbr = CompositeMBR.makeMBR(partner_mbr_list) partner_entry.setMBR(partner_tight_overall_mbr) # add E_NN to P if there is room # otherwise, invoke SplitNode to produce P and PP # containing E_NN and all P's old entries # set N to P and set NN to PP if a split occurred, repeat from AT2 if node.isLeafNode() == False: if have_resulting_second_entry_from_split == True: # parent.removeEntry(entry) """ index = parent.getIndexForEntry(entry) parent.removeIthEntry(index) """ # if parent.isFull() == False: if (parent.getNumChildren() + 1) <= parent.getMaximumNumEntriesPerNode(): # parent.addEntry(entry) parent.addEntry(partner_entry) # entry.getChild().setParent(parent) partner_entry.getChild().setParent(parent) return RTree.adjustTree(tree, node.getParent(), [entry], False, False) else: # ought to split parent.addEntry(entry) entry.getChild().setParent(parent) # following is a risky choice split_result = tree.splitNode(parent, partner_entry) l, ll, e, ee = split_result return RTree.adjustTree(tree, node.getParent(), [e, ee], True, False) else: return RTree.adjustTree(tree, node.getParent(), [entry], False, False) else: return RTree.adjustTree(tree, node.getParent(), resulting_entries_from_split, have_resulting_second_entry_from_split, False) # note that we do not have to update mbr for parent anymore # given that a split changes how mbrs are organized, # but the elements are not changed # don't care about parent overall mbr # until we recursively call adjustTree on parent # update all MBRs in the path from the root to L, # so that all of them cover E.mbr # update the MBRs of nodes that are in the path from root to L, so as to cover L1 and accommodate L2 # perform splits at the upper levels if necessary # assume item is in tree # returns a node, which can be None if no match is found # finds one match if such a node exists # def delete(self, E, RN): def findLeaf(self, entry): return self.findLeafHelper(entry, self.getRootEntry()) def findLeafHelper(self, entry, curr_entry): """ if node.isLeafNode() == False: curr_mbr = entry.getMBR() entries = self.getEntries() tagged_mbr_list = [(x.getMBR(), x) for x in entries] tagged_overlapped_mbr_list = [x for x in tagged_mbr_list if MBR.doOverlap(curr_mbr, x[0]) == True] for tagged_overlapped_mbr in tagged_overlapped_mbr_list: curr_mbr, curr_entry = tagged_overlapped_mbr curr_node = curr_entry.getChild() result = self.findLeafHelper(entry, curr_node) if result == None: continue else: return curr_node return None """ # a little stilted since we don't need a O(log(n)) time operation # to find the entry containing node; just look at parent of entry child if curr_entry.getMBR().isRaw() == True: if entry ==
import sys import os import shutil import gzip import json import requests import uuid import subprocess import argparse import time from concurrent.futures import ThreadPoolExecutor from random import randint, choices from tqdm import tqdm from zipfile import ZipFile # support for S3 import S3 # support for SWIFT object storage import swift #from google.cloud import storage import urllib3 # logging import logging import logging.handlers urllib3.disable_warnings(urllib3.exceptions.InsecureRequestWarning) logging.getLogger("urllib3").setLevel(logging.ERROR) logging.getLogger("keystoneclient").setLevel(logging.ERROR) logging.getLogger("swiftclient").setLevel(logging.ERROR) # public access base for google cloud storage gcs_base = "https://storage.googleapis.com/arxiv-dataset/arxiv/" import pickle import lmdb # init LMDB map_size = 200 * 1024 * 1024 * 1024 class ArXivHarvester(object): def __init__(self, config): self.config = config self._init_lmdb() self.s3 = None if "bucket_name" in self.config and len(self.config["bucket_name"].strip()) > 0: self.s3 = S3.S3(self.config) self.swift = None if "swift" in self.config and len(self.config["swift"])>0 and "swift_container" in self.config and len(self.config["swift_container"])>0: self.swift = swift.Swift(self.config) def _init_lmdb(self): # create the data path if it does not exist if not os.path.isdir(self.config["data_path"]): try: os.makedirs(self.config["data_path"]) except OSError: logging.exception("Creation of the directory %s failed" % self.config["data_path"]) else: logging.debug("Successfully created the directory %s" % self.config["data_path"]) # open in write mode envFilePath = os.path.join(self.config["data_path"], 'entries') self.env = lmdb.open(envFilePath, map_size=map_size) def harvest(self, metadata_file): if 'batch_size' in self.config: batch_size_pdf = self.config['batch_size'] else: batch_size_pdf = 10 if metadata_file is None or not os.path.isfile(metadata_file): raise("the provided metadata file is not valid") if not metadata_file.endswith(".zip") and not metadata_file.endswith(".json.gz") and not metadata_file.endswith(".json"): raise("the metadata file must be a jsonl file, or a zipped or gziped jsonl file") file_in = _get_json_file_reader(metadata_file, 'rb') # check the overall number of entries based on the line number print("\ncalculating number of entries...") count = 0 while 1: buffer = file_in.read(8192*1024) if not buffer: break count += buffer.count(b'\n') print("total entries found: " + str(count) + "\n") logging.info("total entries found: " + str(count)) file_in.close() # iterate through the jsonl file file_in = _get_json_file_reader(metadata_file, 'r') i = 0 entries = [] for line in tqdm(file_in, total=count): if i == batch_size_pdf: result = self.processBatch(entries) entries = [] i = 0 entry = json.loads(line) if 'id' not in entry: logging.info("entry without arxiv id, skipping...") continue arxiv_id = entry['id'] versions = _get_versions(entry) # google cloud public access: gs://arxiv-dataset/arxiv/arxiv/pdf/0906/0906.5594v2.pdf # public web access, preferred: http://storage.googleapis.com/arxiv-dataset/arxiv/ found = False for version in versions: # check if document and version are already processed with self.env.begin() as txn: local_object = txn.get(arxiv_id.encode(encoding='UTF-8')) if local_object != None: local_entry = _deserialize_pickle(local_object) if local_entry != None: if "version" in local_entry and local_entry["version"] == version: found = True break if found: continue entries.append(entry) i += 1 # we need to process the latest incomplete batch (if not empty) if len(entries) >0: result = self.processBatch(entries) dump_destination = os.path.join(self.config["data_path"], "arxiv_list.json") self.dump_map(dump_destination) def processBatch(self, entries): with ThreadPoolExecutor(max_workers=12) as executor: results = executor.map(self.process_entry, entries, timeout=60) return "success" def process_entry(self, entry): arxiv_id = entry['id'] versions = _get_versions(entry) # google cloud public access: gs://arxiv-dataset/arxiv/arxiv/pdf/0906/0906.5594v2.pdf # public web access, preferred: http://storage.googleapis.com/arxiv-dataset/arxiv/ collection, prefix, number = _generate_storage_components(arxiv_id) if collection == 'arxiv': full_number = prefix+"."+number else: full_number = prefix+number # temporary place to download the file destination_pdf = os.path.join(self.config["data_path"], full_number + ".pdf") latest_version = None for version in versions: pdf_location = gcs_base + collection + '/pdf/' + prefix + "/" + full_number + version + ".pdf" destination_pdf = os.path.join(self.config["data_path"], full_number + ".pdf") # note: destination file nanme can change if compression is true in config #print(pdf_location) destination_pdf = self.download_file(pdf_location, destination_pdf, compression=self.config["compression"]) if destination_pdf is not None: latest_version = version break if destination_pdf is None: # if PDF not found, look for a ps file version = versions[0] ps_location = gcs_base + collection + '/ps/' + prefix + "/" + full_number + version + ".ps.gz" destination_ps = os.path.join(self.config["data_path"], full_number + ".ps.gz") destination_ps = self.download_file(ps_location, destination_ps, compression=False) if destination_ps is None: # if still not found, they are 44 articles in html only logging.info("Full text article not found for " + arxiv_id + " - it might be available in html only") destination_pdf = None else: latest_version = version # for convenience, convert .ps.gz into PDF destination_pdf = os.path.join(self.config["data_path"], arxiv_id + ".pdf") # first gunzip the ps file subprocess.check_call(['gunzip', '-f', destination_ps]) destination_ps = destination_ps.replace(".ps.gz", ".ps") subprocess.check_call(['ps2pdf', destination_ps, destination_pdf]) # clean ps file try: if os.path.isfile(destination_ps): os.remove(destination_ps) except IOError: logging.exception("temporary ps file cleaning failed") if destination_pdf is not None: if self.config["compression"]: compression_suffix = ".gz" try: if os.path.isfile(destination_pdf): subprocess.check_call(['gzip', '-f', destination_pdf]) destination_pdf += compression_suffix except: logging.error("Error compressing resource files for " + destination_pdf) if destination_pdf is not None: # store the pdf file in the selected storage self.store_file(destination_pdf, arxiv_id) # update advancement status map profile = {} profile['id'] = arxiv_id profile['version'] = latest_version if 'doi' in entry and entry['doi'] != None: profile['doi'] = entry['doi'] with self.env.begin(write=True) as txn: txn.put(arxiv_id.encode(encoding='UTF-8'), _serialize_pickle(profile)) # store the metadata file destination_json = os.path.join(self.config["data_path"], arxiv_id+".json") with open(destination_json, 'w', encoding='utf-8') as outfile: json.dump(entry, outfile, ensure_ascii=False) if self.config["compression"]: compression_suffix = ".gz" try: if os.path.isfile(destination_json): subprocess.check_call(['gzip', '-f', destination_json]) destination_json += compression_suffix except: logging.error("Error compressing resource files for " + destination_json) self.store_file(destination_json, arxiv_id) return "success" def download_file(self, source_url, destination, compression=False, rolling_user_agent=True): result = "fail" try: if rolling_user_agent: HEADERS = {"""User-Agent""": _get_random_user_agent()} file_data = requests.get(source_url, allow_redirects=True, headers=HEADERS, verify=False, timeout=30) else: file_data = requests.get(source_url, allow_redirects=True, verify=False, timeout=30) if file_data.status_code == 200: with open(destination, 'wb') as f_out: f_out.write(file_data.content) result = "success" except Exception: logging.exception("Download failed for {0} with requests".format(source_url)) if result != "success": return None if compression: compression_suffix = ".gz" try: if os.path.isfile(destination): subprocess.check_call(['gzip', '-f', destination]) destination += compression_suffix except: logging.error("Error compressing resource files for " + destination) return destination def store_file(self, source, identifier, clean=True): file_name = os.path.basename(source) collection, prefix, number = _generate_storage_components(identifier) if collection == 'arxiv': full_number = prefix+"."+number else: full_number = prefix+number if self.s3 is not None: try: if os.path.isfile(source): dest_path = os.path.join(collection, prefix, full_number, file_name) self.s3.upload_file_to_s3(source, dest_path, storage_class='ONEZONE_IA') except: logging.error("Error writing on S3 bucket") elif self.swift is not None: # to SWIFT object storage, we can do a bulk upload for all the resources associated to the entry try: if os.path.isfile(source): dest_path = os.path.join(collection, prefix, full_number) self.swift.upload_file_to_swift(source, dest_path) except: logging.error("Error writing on SWIFT object storage") else: # save under local storate indicated by data_path in the config json try: local_dest_path = os.path.join(self.config["data_path"], collection, prefix, full_number) os.makedirs(local_dest_path, exist_ok=True) if os.path.isfile(source): shutil.copyfile(source, os.path.join(local_dest_path, file_name)) except IOError: logging.exception("invalid path") # clean stored files if clean: try: if os.path.isfile(source): os.remove(source) except IOError: logging.exception("temporary file cleaning failed") def dump_map(self, destination): # init lmdb transactions with open(destination,'w') as file_out: with self.env.begin(write=True) as txn: cursor = txn.cursor() for key, value in cursor: if txn.get(key) is None: continue map_entry = _deserialize_pickle(txn.get(key)) json_local_entry = json.dumps(map_entry) file_out.write(json_local_entry) file_out.write("\n") if self.config["compression"]: subprocess.check_call(['gzip', '-f', destination]) destination += ".gz" # store dump file_name = os.path.basename(destination) if self.s3 is not None: try: if os.path.isfile(destination): self.s3.upload_file_to_s3(destination, file_name, storage_class='ONEZONE_IA') except: logging.error("Error writing on S3 bucket") elif self.swift is not None: # to SWIFT object storage, we can do a bulk upload for all the resources associated to the entry try: if os.path.isfile(destination): self.swift.upload_file_to_swift(destination, file_name) except: logging.error("Error writing on SWIFT object storage") return destination def diagnostic(self): with self.env.begin(write=True) as txn: nb_total = txn.stat()['entries'] print("\nnumber of successfully harvested entries:", nb_total) def reset(self): """ Remove the local lmdb keeping track of the state of advancement of the harvesting and of the failed entries """ # close environments self.env.close() envFilePath = os.path.join(self.config["data_path"], 'entries') shutil.rmtree(envFilePath) # re-init the environments self._init_lmdb() def _get_json_file_reader(filename, mode): file_in = None if filename.endswith(".zip"): with ZipFile(filename, 'r') as zipObj: list_filenames = zipObj.namelist() for local_filename in list_filenames: if local_filename.endswith('.json'): file_in = zipObj.open(local_filename, mode='r') break elif filename.endswith(".gz"): file_in = gzip.open(filename, mode) else: # uncompressed file file_in = open(filename, mode) return file_in def _get_versions(json_entry): """ Return version labels ranked from the most recent to the earliest one """ versions = [] if "versions" in json_entry: for version in json_entry["versions"]: # time indicated by "created" attribute versions.insert(0, version["version"]) if len(versions) == 0: # default value versions.append("v1") return versions def _generate_storage_components(identifier): ''' Convert an arxiv identifier into components for storage path purposes post-2007 identifier: arXiv:YYMM.numbervV -> arxiv YYMM number arXiv:1501.00001v1 -> arXiv 1501 00001 pre-2007 identifiers: archive.subject_call/YYMMnumber -> archive YYMM number
<reponame>sieniven/spot-it-3d import cv2 import math import numpy as np import time import queue from camera_stabilizer import stabilize_frame from camera_stabilizer import Camera from filterpy.kalman import KalmanFilter from filterpy.common import Q_discrete_white_noise from scipy.spatial import distance from scipy.optimize import linear_sum_assignment from automatic_brightness import average_brightness from object_tracker import imopen class Track: def __init__(self, track_id, size): self.id = track_id self.size = size # Constant Velocity Model self.kalmanFilter = KalmanFilter(dim_x=4, dim_z=2) # # Constant Acceleration Model # self.kalmanFilter = KalmanFilter(dim_x=6, dim_z=2) self.age = 1 self.totalVisibleCount = 1 self.consecutiveInvisibleCount = 0 # Dilates the image multiple times to get of noise in order to get a single large contour for each background object # Identify background objects by their shape (non-circular) # Creates a copy of the input image which has the background contour filled in # Returns the filled image which has the background elements filled in def remove_ground(im_in, dilation_iterations, background_contour_circularity, frame): kernel_dilation = np.ones((5, 5), np.uint8) # Number of iterations determines how close objects need to be to be considered background dilated = cv2.dilate(im_in, kernel_dilation, iterations=dilation_iterations) imshow_resized('dilated', dilated) contours, hierarchy = cv2.findContours(dilated, cv2.RETR_EXTERNAL, cv2.CHAIN_APPROX_SIMPLE) background_contours = [] for contour in contours: # Identify background from foreground by the circularity of their dilated contours circularity = 4 * math.pi * cv2.contourArea(contour) / (cv2.arcLength(contour, True) ** 2) if circularity <= background_contour_circularity: background_contours.append(contour) # This bit is used to find a suitable level of dilation to remove background objects # while keeping objects to be detected # im_debug = cv2.cvtColor(im_in.copy(), cv2.COLOR_GRAY2BGR) im_debug = frame.copy() cv2.drawContours(im_debug, background_contours, -1, (0, 255, 0), 3) imshow_resized('to_be_removed', im_debug) im_out = im_in.copy() cv2.drawContours(im_out, background_contours, -1, 0, -1) return im_out def imshow_resized(window_name, img): aspect_ratio = img.shape[1] / img.shape[0] window_size = (int(600), int(600 / aspect_ratio)) img = cv2.resize(img, window_size, interpolation=cv2.INTER_CUBIC) cv2.imshow(window_name, img) def downsample_image(img): aspect_ratio = img.shape[1] / img.shape[0] img_size = (int(1920), int(1920 / aspect_ratio)) img = cv2.resize(img, img_size, interpolation=cv2.INTER_CUBIC) return img def track_objects_realtime(filename): if filename == 0: realtime = True print('Start Video Capture') else: realtime = False cap = cv2.VideoCapture(filename) global FPS, FRAME_WIDTH, FRAME_HEIGHT, SCALE_FACTOR FPS = int(cap.get(cv2.CAP_PROP_FPS)) FRAME_WIDTH = int(cap.get(cv2.CAP_PROP_FRAME_WIDTH)) FRAME_HEIGHT = int(cap.get(cv2.CAP_PROP_FRAME_HEIGHT)) SCALE_FACTOR = math.sqrt(FRAME_WIDTH ** 2 + FRAME_HEIGHT ** 2) / math.sqrt(848 ** 2 + 480 ** 2) aspect_ratio = FRAME_WIDTH / FRAME_HEIGHT downsample = False if FRAME_WIDTH * FRAME_HEIGHT > 1920 * 1080: downsample = True FRAME_WIDTH = 1920 FRAME_HEIGHT = int(1920 / aspect_ratio) SCALE_FACTOR = math.sqrt(FRAME_WIDTH ** 2 + FRAME_HEIGHT ** 2) / math.sqrt(848 ** 2 + 480 ** 2) # recording = cv2.VideoWriter('recording.mp4', cv2.VideoWriter_fourcc(*'h264'), # FPS, (FRAME_WIDTH, FRAME_HEIGHT)) out_combined = cv2.VideoWriter('out_real-time.mp4', cv2.VideoWriter_fourcc(*'h264'), FPS, (FRAME_WIDTH, FRAME_HEIGHT * 2)) camera = Camera((FRAME_WIDTH, FRAME_HEIGHT)) fgbg, detector = setup_system_objects() next_id = 0 tracks = [] frame = None frame_before = None frame_count = 0 fps_log = [] frame_start = time.time() origin = np.array([0, 0]) consecutive_dropped_frames = 0 max_tolerated_consecutive_dropped_frames = 5 while cap.isOpened(): if realtime: frame_end = time.time() frame_time = frame_end - frame_start if frame_time > 0.001: fps_log.append(frame_time) if len(fps_log) > 5: FPS = 1 / (sum(fps_log) / len(fps_log)) fps_log.pop(0) ret, frame = cap.read() frame_start = time.time() if ret: print(frame_count) if downsample: frame = downsample_image(frame) # frame, mask = camera.undistort(frame) mask = np.ones((FRAME_HEIGHT, FRAME_WIDTH), dtype=np.uint8) * 255 if frame_count == 0: frame_before = frame elif frame_count >= 1: # Frame stabilization stabilized_frame, dx, dy = stabilize_frame(frame_before, frame) origin[0] -= int(dx) origin[1] -= int(dy) frame_before = frame frame = stabilized_frame calibration_time = time.time() # centroids_f, sizes_f, masked = detect_objects(frame, mask, fgbg, detector, origin) # Detect the far & small objects # centroids = centroids_f # sizes = sizes_f centroids_n, sizes_n, masked = detect_objects_large(frame, mask, fgbg, detector, origin) # Detect the near & big objects # centroids = np.append(centroids, centroids_n) # sizes = np.append(sizes, sizes_n) centroids = centroids_n sizes = sizes_n detection_time = time.time() else: # Failed to read file if consecutive_dropped_frames >= max_tolerated_consecutive_dropped_frames: break else: consecutive_dropped_frames += 1 # There is no frame, so we make do with the previous frame for visualization # We still want it as a 3 channel image but in gray frame = cv2.cvtColor(cv2.cvtColor(frame_before, cv2.COLOR_BGR2GRAY), cv2.COLOR_GRAY2BGR) # Empty array as the masked image masked = np.zeros((FRAME_HEIGHT, FRAME_WIDTH), dtype=np.uint8) # Empty data for detections centroids = np.zeros((0, 2)) sizes = np.zeros(0) predict_new_locations_of_tracks(tracks) prediction_time = time.time() assignments, unassigned_tracks, unassigned_detections \ = detection_to_track_assignment(tracks, centroids, 10 * SCALE_FACTOR) assignment_time = time.time() update_assigned_tracks(assignments, tracks, centroids, sizes) update_unassigned_tracks(unassigned_tracks, tracks) tracks = delete_lost_tracks(tracks) next_id = create_new_tracks(unassigned_detections, next_id, tracks, centroids, sizes) return_frame = frame.copy() masked = cv2.cvtColor(masked, cv2.COLOR_GRAY2BGR) good_tracks = filter_tracks(frame, masked, tracks, frame_count, origin) other_track_stuff = time.time() # recording.write(return_frame) frame_out = np.zeros((FRAME_HEIGHT * 2, FRAME_WIDTH, 3), dtype=np.uint8) frame_out[0:FRAME_HEIGHT, 0:FRAME_WIDTH] = frame frame_out[FRAME_HEIGHT:FRAME_HEIGHT * 2, 0:FRAME_WIDTH] = masked out_combined.write(frame_out) imshow_resized('frame', frame) imshow_resized('masked', masked) display_time = time.time() print(f"The frame took {(display_time - frame_start) * 1000}ms in total.\n" f"Camera stabilization took {(calibration_time - frame_start) * 1000}ms.\n" f"Object detection took {(detection_time - calibration_time) * 1000}ms.\n" f"Prediction took {(prediction_time - detection_time) * 1000}ms.\n" f"Assignment took {(assignment_time - prediction_time) * 1000}ms.\n" f"Other track stuff took {(other_track_stuff - assignment_time) * 1000}ms.\n" f"Writing to file took {(display_time - other_track_stuff) * 1000}ms.\n\n") frame_count += 1 if not realtime: frame_start = False yield good_tracks, origin, frame_count, return_frame, frame_start if cv2.waitKey(1) & 0xFF == ord('q'): break cap.release() # recording.release() out_combined.release() cv2.destroyAllWindows() # Create VideoCapture object to extract frames from, # background subtractor object and blob detector objects for object detection # and VideoWriters for output videos def setup_system_objects(): # Background subtractor works by subtracting the history from the current frame. # Further more this model already incldues guassian blur and morphological transformations # varThreshold affects the spottiness of the image. The lower it is, the more smaller spots. # The larger it is, these spots will combine into large foreground areas # fgbg = cv2.createBackgroundSubtractorMOG2(history=int(10*FPS), varThreshold=64*SCALE_FACTOR, # detectShadows=False) # A lower varThreshold results in more noise which is beneficial to ground subtraction (but detrimental if you want # detections closer to the ground as there is more noise fgbg = cv2.createBackgroundSubtractorMOG2(history=int(5 * FPS), varThreshold=16 / SCALE_FACTOR, detectShadows=False) # Background ratio represents the fraction of the history a frame must be present # to be considered part of the background # eg. history is 5s, background ratio is 0.1, frames present for 0.5s will be considered background fgbg.setBackgroundRatio(0.05) fgbg.setNMixtures(5) # fgbg = cv2.createBackgroundSubtractorMOG2(detectShadows=False) params = cv2.SimpleBlobDetector_Params() # params.filterByArea = True # params.minArea = 1 # params.maxArea = 1000 params.filterByConvexity = False params.filterByCircularity = False detector = cv2.SimpleBlobDetector_create(params) return fgbg, detector # Apply image masks to prepare frame for blob detection # Masks: 1) Increased contrast and brightness to fade out the sky and make objects stand out # 2) Background subtractor to remove the stationary background (Converts frame to a binary image) # 3) Further background subtraction by means of contouring around non-circular objects # 4) Dilation to fill holes in detected drones # 5) Inversion to make the foreground black for the blob detector to identify foreground objects # Perform the blob detection on the masked image # Return detected blob centroids as well as size def detect_objects(frame, mask, fgbg, detector, origin): # Adjust contrast and brightness of image to make foreground stand out more # alpha used to adjust contrast, where alpha < 1 reduces contrast and alpha > 1 increases it # beta used to increase brightness, scale of (-255 to 255) ? Needs confirmation # formula is im_out = alpha * im_in + beta # Therefore to change brightness before contrast, we need to do alpha = 1 first masked = cv2.convertScaleAbs(frame, alpha=1, beta=0) gain = 15 masked = cv2.convertScaleAbs(masked, alpha=1, beta=256 - average_brightness(16, frame, mask) + gain) # masked = cv2.convertScaleAbs(masked, alpha=2, beta=128) # masked = cv2.cvtColor(masked, cv2.COLOR_BGR2GRAY) # masked = threshold_rgb(frame) imshow_resized("pre-background subtraction", masked) # Subtract Background # Learning rate affects how often the model is updated # High values > 0.5 tend to lead to patchy output # Found that 0.1 - 0.3 is a good range masked = fgbg.apply(masked, learningRate=-1) imshow_resized("background subtracted", masked) masked = remove_ground(masked, int(13 / (2.26 / SCALE_FACTOR)), 0.6, frame) # Morphological Transforms # Close to remove black spots # masked = imclose(masked,
<filename>flaskbb/management/views.py # -*- coding: utf-8 -*- """ flaskbb.management.views ~~~~~~~~~~~~~~~~~~~~~~~~ This module handles the management views. :copyright: (c) 2014 by the FlaskBB Team. :license: BSD, see LICENSE for more details. """ import logging import sys from celery import __version__ as celery_version from flask import __version__ as flask_version from flask import (Blueprint, current_app, flash, jsonify, redirect, request, url_for) from flask.views import MethodView from flask_allows import Not, Permission from flask_babelplus import gettext as _ from flask_login import current_user, login_fresh from pluggy import HookimplMarker from flaskbb import __version__ as flaskbb_version from flaskbb.extensions import allows, celery, db from flaskbb.forum.forms import UserSearchForm from flaskbb.forum.models import Category, Forum, Post, Report, Topic from flaskbb.management.forms import (AddForumForm, AddGroupForm, AddUserForm, CategoryForm, EditForumForm, EditGroupForm, EditUserForm) from flaskbb.management.models import Setting, SettingsGroup from flaskbb.plugins.models import PluginRegistry, PluginStore from flaskbb.plugins.utils import validate_plugin from flaskbb.user.models import Group, Guest, User from flaskbb.utils.forms import populate_settings_dict, populate_settings_form from flaskbb.utils.helpers import (get_online_users, register_view, render_template, time_diff, time_utcnow, FlashAndRedirect) from flaskbb.utils.requirements import (CanBanUser, CanEditUser, IsAdmin, IsAtleastModerator, IsAtleastSuperModerator) from flaskbb.utils.settings import flaskbb_config impl = HookimplMarker('flaskbb') logger = logging.getLogger(__name__) class ManagementSettings(MethodView): decorators = [ allows.requires( IsAdmin, on_fail=FlashAndRedirect( message=_("You are not allowed to access the management settings"), # noqa level="danger", endpoint="management.overview" ) ) ] def _determine_active_settings(self, slug, plugin): """Determines which settings are active. Returns a tuple in following order: ``form``, ``old_settings``, ``plugin_obj``, ``active_nav`` """ # Any ideas how to do this better? slug = slug if slug else 'general' active_nav = {} # used to build the navigation plugin_obj = None if plugin is not None: plugin_obj = PluginRegistry.query.filter_by(name=plugin ).first_or_404() active_nav.update( { 'key': plugin_obj.name, 'title': plugin_obj.name.title() } ) form = plugin_obj.get_settings_form() old_settings = plugin_obj.settings elif slug is not None: group_obj = SettingsGroup.query.filter_by(key=slug).first_or_404() active_nav.update({'key': group_obj.key, 'title': group_obj.name}) form = Setting.get_form(group_obj)() old_settings = Setting.get_settings(group_obj) return form, old_settings, plugin_obj, active_nav def get(self, slug=None, plugin=None): form, old_settings, plugin_obj, active_nav = \ self._determine_active_settings(slug, plugin) # get all groups and plugins - used to build the navigation all_groups = SettingsGroup.query.all() all_plugins = PluginRegistry.query.filter(db.and_( PluginRegistry.values != None, PluginRegistry.enabled == True )).all() form = populate_settings_form(form, old_settings) return render_template( "management/settings.html", form=form, all_groups=all_groups, all_plugins=all_plugins, active_nav=active_nav ) def post(self, slug=None, plugin=None): form, old_settings, plugin_obj, active_nav = \ self._determine_active_settings(slug, plugin) all_groups = SettingsGroup.query.all() all_plugins = PluginRegistry.query.filter(db.and_( PluginRegistry.values != None, PluginRegistry.enabled == True )).all() if form.validate_on_submit(): new_settings = populate_settings_dict(form, old_settings) if plugin_obj is not None: plugin_obj.update_settings(new_settings) else: Setting.update(settings=new_settings) flash(_("Settings saved."), "success") return render_template( "management/settings.html", form=form, all_groups=all_groups, all_plugins=all_plugins, active_nav=active_nav ) class ManageUsers(MethodView): decorators = [ allows.requires( IsAtleastModerator, on_fail=FlashAndRedirect( message=_("You are not allowed to manage users"), level="danger", endpoint="management.overview" ) ) ] form = UserSearchForm def get(self): page = request.args.get('page', 1, type=int) form = self.form() users = User.query.order_by(User.id.asc()).paginate( page, flaskbb_config['USERS_PER_PAGE'], False ) return render_template( 'management/users.html', users=users, search_form=form ) def post(self): page = request.args.get('page', 1, type=int) form = self.form() if form.validate(): users = form.get_results().\ paginate(page, flaskbb_config['USERS_PER_PAGE'], False) return render_template( 'management/users.html', users=users, search_form=form ) users = User.query.order_by(User.id.asc()).paginate( page, flaskbb_config['USERS_PER_PAGE'], False ) return render_template( 'management/users.html', users=users, search_form=form ) class EditUser(MethodView): decorators = [ allows.requires( IsAtleastModerator, CanEditUser, on_fail=FlashAndRedirect( message=_("You are not allowed to manage users"), level="danger", endpoint="management.overview" ) ) ] form = EditUserForm def get(self, user_id): user = User.query.filter_by(id=user_id).first_or_404() form = self.form(user) member_group = db.and_( * [ db.not_(getattr(Group, p)) for p in ['admin', 'mod', 'super_mod', 'banned', 'guest'] ] ) filt = db.or_( Group.id.in_(g.id for g in current_user.groups), member_group ) if Permission(IsAtleastSuperModerator, identity=current_user): filt = db.or_(filt, Group.mod) if Permission(IsAdmin, identity=current_user): filt = db.or_(filt, Group.admin, Group.super_mod) if Permission(CanBanUser, identity=current_user): filt = db.or_(filt, Group.banned) group_query = Group.query.filter(filt) form.primary_group.query = group_query form.secondary_groups.query = group_query return render_template( 'management/user_form.html', form=form, title=_('Edit User') ) def post(self, user_id): user = User.query.filter_by(id=user_id).first_or_404() member_group = db.and_( * [ db.not_(getattr(Group, p)) for p in ['admin', 'mod', 'super_mod', 'banned', 'guest'] ] ) filt = db.or_( Group.id.in_(g.id for g in current_user.groups), member_group ) if Permission(IsAtleastSuperModerator, identity=current_user): filt = db.or_(filt, Group.mod) if Permission(IsAdmin, identity=current_user): filt = db.or_(filt, Group.admin, Group.super_mod) if Permission(CanBanUser, identity=current_user): filt = db.or_(filt, Group.banned) group_query = Group.query.filter(filt) form = EditUserForm(user) form.primary_group.query = group_query form.secondary_groups.query = group_query if form.validate_on_submit(): form.populate_obj(user) user.primary_group_id = form.primary_group.data.id # Don't override the password if form.password.data: user.password = form.password.data user.save(groups=form.secondary_groups.data) flash(_('User updated.'), 'success') return redirect(url_for('management.edit_user', user_id=user.id)) return render_template( 'management/user_form.html', form=form, title=_('Edit User') ) class DeleteUser(MethodView): decorators = [ allows.requires( IsAdmin, on_fail=FlashAndRedirect( message=_("You are not allowed to manage users"), level="danger", endpoint="management.overview" ) ) ] def post(self, user_id=None): # ajax request if request.is_xhr: ids = request.get_json()["ids"] data = [] for user in User.query.filter(User.id.in_(ids)).all(): # do not delete current user if current_user.id == user.id: continue if user.delete(): data.append( { "id": user.id, "type": "delete", "reverse": False, "reverse_name": None, "reverse_url": None } ) return jsonify( message="{} users deleted.".format(len(data)), category="success", data=data, status=200 ) user = User.query.filter_by(id=user_id).first_or_404() if current_user.id == user.id: flash(_("You cannot delete yourself.", "danger")) return redirect(url_for("management.users")) user.delete() flash(_("User deleted."), "success") return redirect(url_for("management.users")) class AddUser(MethodView): decorators = [ allows.requires( IsAdmin, on_fail=FlashAndRedirect( message=_("You are not allowed to manage users"), level="danger", endpoint="management.overview" ) ) ] form = AddUserForm def get(self): return render_template( 'management/user_form.html', form=self.form(), title=_('Add User') ) def post(self): form = self.form() if form.validate_on_submit(): form.save() flash(_('User added.'), 'success') return redirect(url_for('management.users')) return render_template( 'management/user_form.html', form=form, title=_('Add User') ) class BannedUsers(MethodView): decorators = [ allows.requires( IsAtleastModerator, on_fail=FlashAndRedirect( message=_("You are not allowed to manage users"), level="danger", endpoint="management.overview" ) ) ] form = UserSearchForm def get(self): page = request.args.get('page', 1, type=int) search_form = self.form() users = User.query.filter( Group.banned == True, Group.id == User.primary_group_id ).paginate(page, flaskbb_config['USERS_PER_PAGE'], False) return render_template( 'management/banned_users.html', users=users, search_form=search_form ) def post(self): page = request.args.get('page', 1, type=int) search_form = self.form() users = User.query.filter( Group.banned == True, Group.id == User.primary_group_id ).paginate(page, flaskbb_config['USERS_PER_PAGE'], False) if search_form.validate(): users = search_form.get_results().\ paginate(page, flaskbb_config['USERS_PER_PAGE'], False) return render_template( 'management/banned_users.html', users=users, search_form=search_form ) return render_template( 'management/banned_users.html', users=users, search_form=search_form ) class BanUser(MethodView): decorators = [ allows.requires( IsAtleastModerator, on_fail=FlashAndRedirect( message=_("You are not allowed to manage users"), level="danger", endpoint="management.overview" ) ) ] def post(self, user_id=None): if not Permission(CanBanUser, identity=current_user): flash( _("You do not have the permissions to ban this user."), "danger" ) return redirect(url_for("management.overview")) # ajax request if request.is_xhr: ids = request.get_json()["ids"] data = [] users = User.query.filter(User.id.in_(ids)).all() for user in users: # don't let a user ban himself and do not allow a moderator # to ban a admin user if (current_user.id == user.id or Permission(IsAdmin, identity=user) and Permission(Not(IsAdmin), current_user)): continue elif user.ban(): data.append( { "id": user.id, "type": "ban", "reverse": "unban", "reverse_name": _("Unban"), "reverse_url": url_for("management.unban_user", user_id=user.id) } ) return jsonify( message="{} users banned.".format(len(data)), category="success", data=data, status=200 ) user = User.query.filter_by(id=user_id).first_or_404() # Do not allow moderators to ban admins if Permission(IsAdmin, identity=user) and Permission( Not(IsAdmin), identity=current_user): flash(_("A moderator cannot ban an admin user."), "danger") return redirect(url_for("management.overview")) if not current_user.id == user.id and user.ban(): flash(_("User is now banned."), "success") else: flash(_("Could not ban user."), "danger") return redirect(url_for("management.banned_users")) class UnbanUser(MethodView): decorators = [ allows.requires( IsAtleastModerator, on_fail=FlashAndRedirect( message=_("You are not allowed to manage users"), level="danger", endpoint="management.overview" ) ) ] def post(self, user_id=None): if not Permission(CanBanUser, identity=current_user): flash( _("You do not have the permissions to unban this user."), "danger" ) return redirect(url_for("management.overview")) # ajax request if request.is_xhr: ids = request.get_json()["ids"] data = [] for user in User.query.filter(User.id.in_(ids)).all(): if user.unban(): data.append( { "id": user.id, "type": "unban", "reverse": "ban", "reverse_name": _("Ban"), "reverse_url": url_for("management.ban_user", user_id=user.id) } ) return jsonify( message="{} users unbanned.".format(len(data)), category="success", data=data, status=200 ) user = User.query.filter_by(id=user_id).first_or_404() if user.unban(): flash(_("User is now unbanned."), "success") else: flash(_("Could not unban user."), "danger") return redirect(url_for("management.banned_users")) class Groups(MethodView): decorators = [ allows.requires( IsAdmin, on_fail=FlashAndRedirect( message=_("You are not allowed to modify groups."), level="danger", endpoint="management.overview" ) ) ] def get(self): page = request.args.get("page", 1, type=int) groups = Group.query.\ order_by(Group.id.asc()).\ paginate(page, flaskbb_config['USERS_PER_PAGE'], False) return render_template("management/groups.html", groups=groups) class AddGroup(MethodView): decorators = [ allows.requires( IsAdmin, on_fail=FlashAndRedirect( message=_("You are not allowed to modify groups."), level="danger", endpoint="management.overview" ) ) ] form = AddGroupForm def get(self): return render_template( 'management/group_form.html', form=self.form(), title=_('Add Group') ) def post(self): form = AddGroupForm() if form.validate_on_submit(): form.save() flash(_('Group added.'), 'success') return redirect(url_for('management.groups')) return render_template( 'management/group_form.html', form=form, title=_('Add Group') ) class EditGroup(MethodView): decorators = [ allows.requires( IsAdmin, on_fail=FlashAndRedirect( message=_("You are not allowed to modify groups."), level="danger", endpoint="management.overview" ) ) ] form = EditGroupForm def get(self, group_id): group = Group.query.filter_by(id=group_id).first_or_404() form = self.form(group) return render_template( 'management/group_form.html', form=form, title=_('Edit Group') ) def post(self, group_id): group = Group.query.filter_by(id=group_id).first_or_404() form = EditGroupForm(group) if form.validate_on_submit(): form.populate_obj(group) group.save() if group.guest: Guest.invalidate_cache() flash(_('Group updated.'), 'success') return redirect(url_for('management.groups', group_id=group.id)) return render_template( 'management/group_form.html', form=form, title=_('Edit
in Alexa global 'http://www.casadellibro.com/', # Why: #8495 in Alexa global 'http://www.ixwebhosting.com/', # Why: #8496 in Alexa global 'http://www.buyorbury.com/', # Why: #8497 in Alexa global 'http://www.getglue.com/', # Why: #8498 in Alexa global 'http://www.864321.com/', # Why: #8499 in Alexa global 'http://www.alivv.com/', # Why: #8500 in Alexa global 'http://www.4.cn/', # Why: #8501 in Alexa global 'http://www.competitor.com/', # Why: #8502 in Alexa global 'http://www.iheima.com/', # Why: #8503 in Alexa global 'http://www.submarinoviagens.com.br/', # Why: #8504 in Alexa global 'http://emailsrvr.com/', # Why: #8505 in Alexa global 'http://www.udacity.com/', # Why: #8506 in Alexa global 'http://www.mcafeesecure.com/', # Why: #8507 in Alexa global 'http://www.laposte.fr/', # Why: #8508 in Alexa global 'http://olhardigital.uol.com.br/', # Why: #8509 in Alexa global 'http://ppy.sh/', # Why: #8510 in Alexa global 'http://www.rumah.com/', # Why: #8511 in Alexa global 'http://www.pullbear.com/', # Why: #8512 in Alexa global 'http://www.pkt.pl/', # Why: #8513 in Alexa global 'http://www.jayde.com/', # Why: #8514 in Alexa global 'http://www.myjoyonline.com/', # Why: #8515 in Alexa global 'http://www.locopengu.com/', # Why: #8516 in Alexa global 'http://www.vsnl.net.in/', # Why: #8517 in Alexa global 'http://www.hornbunny.com/', # Why: #8518 in Alexa global 'http://www.royalcaribbean.com/', # Why: #8520 in Alexa global 'http://www.football.ua/', # Why: #8521 in Alexa global 'http://www.thaifriendly.com/', # Why: #8522 in Alexa global 'http://www.bankofthewest.com/', # Why: #8523 in Alexa global 'http://www.indianprice.com/', # Why: #8524 in Alexa global 'http://www.chodientu.vn/', # Why: #8525 in Alexa global 'http://www.alison.com/', # Why: #8526 in Alexa global 'http://www.eveonline.com/', # Why: #8527 in Alexa global 'http://www.blogg.se/', # Why: #8528 in Alexa global 'http://www.jetairways.com/', # Why: #8529 in Alexa global 'http://www.larousse.fr/', # Why: #8530 in Alexa global 'http://www.noticierodigital.com/', # Why: #8531 in Alexa global 'http://mkfst.com/', # Why: #8532 in Alexa global 'http://www.anyfiledownloader.com/', # Why: #8533 in Alexa global 'http://www.tiramillas.net/', # Why: #8534 in Alexa global 'http://www.telus.com/', # Why: #8535 in Alexa global 'http://www.paperblog.com/', # Why: #8536 in Alexa global 'http://www.songsterr.com/', # Why: #8537 in Alexa global 'http://www.entremujeres.com/', # Why: #8538 in Alexa global 'http://www.startsiden.no/', # Why: #8539 in Alexa global 'http://www.hotspotshield.com/', # Why: #8540 in Alexa global 'http://www.hosteurope.de/', # Why: #8541 in Alexa global 'http://www.ebags.com/', # Why: #8542 in Alexa global 'http://www.eenadupratibha.net/', # Why: #8543 in Alexa global 'http://www.uppit.com/', # Why: #8544 in Alexa global 'http://www.piaohua.com/', # Why: #8545 in Alexa global 'http://www.xxxymovies.com/', # Why: #8546 in Alexa global 'http://www.netbarg.com/', # Why: #8547 in Alexa global 'http://www.chip.com.tr/', # Why: #8548 in Alexa global 'http://xl.co.id/', # Why: #8549 in Alexa global 'http://www.kowalskypage.com/', # Why: #8550 in Alexa global 'http://www.afterdawn.com/', # Why: #8551 in Alexa global 'http://www.locanto.com/', # Why: #8552 in Alexa global 'http://www.liilas.com/', # Why: #8553 in Alexa global 'http://www.superboy.com/', # Why: #8554 in Alexa global 'http://www.indiavisiontv.com/', # Why: #8555 in Alexa global 'http://www.ixquick.com/', # Why: #8556 in Alexa global 'http://www.hotelium.com/', # Why: #8557 in Alexa global 'http://www.twsela.com/', # Why: #8558 in Alexa global 'http://www.newsmeback.com/', # Why: #8559 in Alexa global 'http://www.perfectliving.com/', # Why: #8560 in Alexa global 'http://www.laughingsquid.com/', # Why: #8561 in Alexa global 'http://www.designboom.com/', # Why: #8562 in Alexa global 'http://www.zigil.ir/', # Why: #8563 in Alexa global 'http://www.coachfactory.com/', # Why: #8564 in Alexa global 'http://www.wst.cn/', # Why: #8565 in Alexa global 'http://www.kaboodle.com/', # Why: #8566 in Alexa global 'http://www.fastmail.fm/', # Why: #8567 in Alexa global 'http://www.threadless.com/', # Why: #8568 in Alexa global 'http://www.wiseconvert.com/', # Why: #8569 in Alexa global 'http://www.br.de/', # Why: #8570 in Alexa global 'http://www.promovacances.com/', # Why: #8572 in Alexa global 'http://www.wrzuta.pl/', # Why: #8573 in Alexa global 'http://www.fromdoctopdf.com/', # Why: #8574 in Alexa global 'http://www.ono.es/', # Why: #8575 in Alexa global 'http://www.zinio.com/', # Why: #8576 in Alexa global 'http://netcoc.com/', # Why: #8577 in Alexa global 'http://www.eanswers.com/', # Why: #8578 in Alexa global 'http://www.wallst.com/', # Why: #8579 in Alexa global 'http://www.ipiccy.com/', # Why: #8580 in Alexa global 'http://www.fastweb.it/', # Why: #8581 in Alexa global 'http://www.kaufmich.com/', # Why: #8582 in Alexa global 'http://www.groupon.co.za/', # Why: #8583 in Alexa global 'http://www.cyzo.com/', # Why: #8584 in Alexa global 'http://www.addic7ed.com/', # Why: #8585 in Alexa global 'http://www.liuliangbao.cn/', # Why: #8586 in Alexa global 'http://www.alintibaha.net/', # Why: #8587 in Alexa global 'http://www.indiewire.com/', # Why: #8588 in Alexa global 'http://www.needforspeed.com/', # Why: #8590 in Alexa global 'http://www.e24.no/', # Why: #8591 in Alexa global 'http://www.hupso.com/', # Why: #8592 in Alexa global 'http://www.kathimerini.gr/', # Why: #8593 in Alexa global 'http://www.worldoffiles.net/', # Why: #8594 in Alexa global 'http://www.express.pk/', # Why: #8595 in Alexa global 'http://www.wieszjak.pl/', # Why: #8597 in Alexa global 'http://www.mobile.bg/', # Why: #8598 in Alexa global 'http://www.subway.com/', # Why: #8599 in Alexa global 'http://www.akhbarelyom.com/', # Why: #8600 in Alexa global 'http://www.thisoldhouse.com/', # Why: #8601 in Alexa global 'http://www.autoevolution.com/', # Why: #8602 in Alexa global 'http://www.public-api.wordpress.com/', # Why: #8603 in Alexa global 'http://www.airarabia.com/', # Why: #8604 in Alexa global 'http://www.powerball.com/', # Why: #8605 in Alexa global 'http://www.mais.uol.com.br/', # Why: #8606 in Alexa global 'http://www.visa.com/', # Why: #8607 in Alexa global 'http://www.gendai.net/', # Why: #8608 in Alexa global 'http://www.gymboree.com/', # Why: #8609 in Alexa global 'http://www.tvp.pl/', # Why: #8610 in Alexa global 'http://www.sinhayasocialreader.com/', # Why: #8611 in Alexa global 'http://a963.com/', # Why: #8612 in Alexa global 'http://www.gamgos.ae/', # Why: #8613 in Alexa global 'http://www.fx678.com/', # Why: #8614 in Alexa global 'http://www.mp3round.com/', # Why: #8615 in Alexa global 'http://www.komonews.com/', # Why: #8616 in Alexa global 'http://www.contactcars.com/', # Why: #8617 in Alexa global 'http://www.pdftoword.com/', # Why: #8618 in Alexa global 'http://www.songtaste.com/', # Why: #8620 in Alexa global 'http://www.squareup.com/', # Why: #8621 in Alexa global 'http://www.newsevent24.com/', # Why: #8622 in Alexa global 'http://www.dti.ne.jp/', # Why: #8623 in Alexa global 'http://www.livestation.com/', # Why: #8624 in Alexa global 'http://www.oldertube.com/', # Why: #8625 in Alexa global 'http://www.rtl.fr/', # Why: #8626 in Alexa global 'http://www.gather.com/', # Why: #8627 in Alexa global 'http://www.liderendeportes.com/', # Why: #8628 in Alexa global 'http://www.thewrap.com/', # Why: #8629 in Alexa global 'http://www.viber.com/', # Why: #8630 in Alexa global 'http://www.reklama5.mk/', # Why: #8631 in Alexa global 'http://www.fonts.com/', # Why: #8632 in Alexa global 'http://www.hrsaccount.com/', # Why: #8633 in Alexa global 'http://www.bizcommunity.com/', # Why: #8634 in Alexa global 'http://www.favicon.cc/', # Why: #8635 in Alexa global 'http://www.totalping.com/', # Why: #8636 in Alexa global 'http://www.live365.com/', # Why: #8637 in Alexa global 'http://www.tlife.gr/', # Why: #8638 in Alexa global 'http://www.imasters.com.br/', # Why: #8639 in Alexa global 'http://www.n11.com/', # Why: #8640 in Alexa global 'http://www.iam.ma/', # Why: #8641 in Alexa global 'http://www.qq5.com/', # Why: #8642 in Alexa global 'http://www.tvboxnow.com/', # Why: #8643 in Alexa global 'http://www.limetorrents.com/', # Why: #8644 in Alexa global 'http://www.bancopopular.es/', # Why: #8645 in Alexa global 'http://www.ray-ban.com/', # Why: #8646 in Alexa global 'http://www.drweb.com/', # Why: #8647 in Alexa global 'http://www.hushmail.com/', # Why: #8648 in Alexa global 'http://www.resuelvetudeuda.com/', # Why: #8649 in Alexa global 'http://www.sharpnews.ru/', # Why: #8650 in Alexa global 'http://www.hellocoton.fr/', # Why: #8651 in Alexa global 'http://buysub.com/', # Why: #8652 in Alexa global 'http://www.homemoviestube.com/', # Why: #8653 in Alexa global 'http://www.utsandiego.com/', # Why: #8654 in Alexa global 'http://www.learn4good.com/', # Why: #8655 in Alexa global 'http://www.nii.ac.jp/', # Why: #8656 in Alexa global 'http://www.girlsgogames.ru/', # Why: #8657 in Alexa global 'http://www.talksport.co.uk/', # Why: #8658 in Alexa global 'http://fap.to/', # Why: #8659 in Alexa global 'http://www.teennick.com/', # Why: #8660 in Alexa global 'http://www.seitwert.de/', # Why: #8661 in Alexa global 'http://www.celebritymoviearchive.com/', # Why: #8662 in Alexa global 'http://www.sukar.com/', # Why: #8663 in Alexa global 'http://www.astromeridian.ru/', # Why: #8664 in Alexa global 'http://www.zen-cart.com/', # Why: #8665 in Alexa global 'http://www.1phads.com/', # Why: #8666 in Alexa global 'http://www.plaisio.gr/', # Why: #8667 in Alexa global 'http://www.photozou.jp/', # Why: #8668 in Alexa global 'http://www.cplusplus.com/', # Why: #8669 in Alexa global 'http://www.ewebse.com/', # Why: #8670 in Alexa global 'http://6eat.com/', # Why: #8672 in Alexa global 'http://www.payless.com/', # Why: #8673 in Alexa global 'http://www.subaonet.com/', # Why: #8674 in Alexa global 'http://www.dlisted.com/', # Why: #8675 in Alexa global 'http://www.kia.com/', # Why: #8676 in Alexa global 'http://www.lankahotnews.net/', # Why: #8677 in Alexa global 'http://www.vg247.com/', # Why: #8678 in Alexa global 'http://www.formstack.com/', # Why: #8679 in Alexa global 'http://www.jobs.net/', # Why: #8680 in Alexa global 'http://www.coolchaser.com/', # Why: #8681 in Alexa global 'http://www.blackplanet.com/', # Why: #8682 in Alexa global 'http://www.unionbank.com/', # Why:
""" Synthetic Generators for labeled random graphs for SSL-H Inspiration: http://networkx.github.io/documentation/latest/_modules/networkx/generators/random_graphs.html Author: <NAME> License: Apache Software License """ import random import warnings from random import randint from numpy.random import random_sample, shuffle import numpy as np from scipy.sparse import csr_matrix from scipy import optimize from math import ceil, pi import collections # collections.Counter from utils import (row_normalize_matrix, check_normalized_beliefs, from_dictionary_beliefs, calculate_potential_from_row_normalized) import networkx as nx RANDOMSEED = None # TODO: remove after removing graph generator at the end. Better initialized in experimental loop outside this file with following two lines: # random.seed(RANDOMSEED) # seeds some other python random generator # np.random.seed(seed=RANDOMSEED) # seeds the actually used numpy random generator; both are used and thus needed def planted_distribution_model_H(n, alpha, H, d_out, distribution='powerlaw', exponent=-0.5, directed=True, backEdgesAllowed=False, sameInAsOutDegreeRanking=False, debug=0): """Variation on planted_distribution_model_H that uses (P, m) instead of (H, d_out) Notice that for undirected graphs, the actual average degree distribution will be double of d_out """ k = len(alpha) if not isinstance(d_out, (collections.Sequence, np.ndarray)): # allow single number as input d_out = [d_out] * k P = calculate_potential_from_row_normalized(H, alpha, d_out) m = np.rint(n * np.array(alpha).dot(np.array(d_out))) # print("P:", P) return planted_distribution_model(n=n, alpha=alpha, P=P, m=m, distribution=distribution, exponent=exponent, directed=directed, backEdgesAllowed=backEdgesAllowed, sameInAsOutDegreeRanking=sameInAsOutDegreeRanking, debug=debug) def planted_distribution_model(n, alpha, P, m, distribution='powerlaw', exponent=-0.5, directed=True, backEdgesAllowed=False, # deprecated sameInAsOutDegreeRanking=False, # deprecated debug=0): """Creates a directed random graph with planted compatibility matrix 'P'. Accepts (n, alpha_vec, P, m). The alternative version accepts: (n, alpha_vec, H, d_out_vec). If directed==False: creates an undirected graph. Requires: 1) P to be symmetric, with identical row and column sum 2) ignores: backEdgesAllowed, sameInAsOutDegreeRanking Notice: m = |W| for directed, but 2m = |W| for undirected. Notice: Average outdegree d_out = m/n for directed, but average total degree d = 2m/n for directed and undirected Parameters ---------- n : int number of nodes alpha : k-dimensional ndarray or list node label distribution P : [k,k] ndarray Compatibility matrix (no need for column-normalized or symmetric) m : int total number of edges distribution : string, optional (Default = 'powerlaw') 'uniform', 'triangle', 'powerlaw': used with "create_distribution_vector(n, m, distribution, exponent)" exponent : float, optional (Default = None) only for 'powerlaw', by default = -1 directed : Boolean, optional (Default = True) False: then constructs an undirected graph. Requires symmetric doubly stochastic potential backEdgesAllowed : Boolean, optional (Default = False) False: then two nodes cannot be connected by two edges back and forth Overwritten for undirected to be False sameInAsOutDegreeRanking : Boolean, optional (Default = False) True: then node with highest indegree also has highest outdegree among its peers Overwritten for undirected to be False debug : int (Default = 0) 0: print nothing 1: prints some statistics 2: prints even node degree distributions Returns ------- W : sparse.csr_matrix sparse weighted adjacency matrix Xd : dictionary Explicit beliefs """ # -- Jump out from inner loop if graph cannot be found # Define an exception that allows to jump out from inner loop to a certain outer loop class GraphNotFound(Exception): pass # -- Initialization alpha = np.asarray(alpha) k = len(alpha) k1, k2 = P.shape assert k == k1 and k == k2 # # DEL # n_vec = np.array(alpha*n, int) # number of nodes in each class # P_sum = P.sum() # P_tot = m * P / P_sum # !!! # P_row_sum = P.sum(1, keepdims=True) # sums along horizontal axis # H = 1. * P / P_row_sum # m_out_vec = P_tot.sum(1, keepdims=False) # sums along vertical axis # d_out_vec = m_out_vec / n_vec # if not directed: # # for i in range(k): # symmetric matrix [not important either, P + P^T (back edges) becomes symmetric # # for j in range(k): # # assert P[i,j] == P[j,i] # # s_vec = P.sum(1, keepdims=False) # same col and row sum [actually not important, only symmetry] # # for i in range(k): # # assert s_vec[0] == s_vec[i] # # d_out_vec = 1. * d_out_vec / 2 # use half of the desired degree since symmetric back edges are created # # d_out_vec = 1. * d_out_vec * np.power(alpha, -1) / k # calculate the d_out vector (given doubly stoch constraint) # if backEdgesAllowed: # warnings.warn("'backEdgesAllowed' set to False") # backEdgesAllowed = False # Otherwise, same edge could be created twice, redundant # if sameInAsOutDegreeRanking: # warnings.warn("'sameInAsOutDegreeRanking' set to False") # sameInAsOutDegreeRanking = False # Otherwise in uniform distribution not correct # # d_out_vec = np.asarray(d_out_vec) # --- Big loop that attempts to create a graph for 20 times (sometimes the parameters don't allow a graph) attempt = 0 finished = False while attempt < 20 and not finished: # -- (1) n_vec: np.array: number of nodes for each class n_vec = np.array(alpha*n, int) # number of nodes in each class delta = np.sum(n_vec) - n n_vec[k-1] = n_vec[k-1] - delta # make sure sum(N)=n, in case there are rounding errors, correct the last entry # -- Xd: dictionary: class of each node Xl = [ [i]*n_vec[i] for i in range(k) ] Xl = np.hstack(Xl) # flatten nested array shuffle(Xl) # random order of those classes. Array that maps i -> k Xd = {i : Xl[i] for i in range(n)} # Xd: dictionary that maps i -> k # -- P / P_tot: nested np.array: total number of edges between each node type # P = calculate_potential_from_row_normalized(H, alpha, d_out_vec) P_tot = m * P / P.sum() # !!! P_tot = np.rint(P_tot).astype(int) # P_row_sum = P_tot.sum(1, keepdims=False) # sums along horizontal axis delta = m - P_tot.sum() P_tot[0][0] = P_tot[0][0] + delta # for i in range(k): # P_tot[i][i] = P_tot[i][i] + delta[i] # add any delta to diagonal: that guarantees a symmetric matrix for undirected case assert np.all(P_tot >= 0), "Negative values in P_tot due to rounding errors. Change graph parameters" # Can happen for H with 0 entries due to necessary rounding to closest integers # -- (2) m_out_vec: np.array: number outgoing edges in each class / m: total number of edges # m_out_vec = np.rint(n_vec * d_out_vec).astype(int) # round to nearest integer m_out_vec = P_tot.sum(1, keepdims=False) # delta = np.rint(np.sum(alpha * n * d_out_vec) - np.sum(m_out_vec)).astype(int) # m_out_vec[k-1] = m_out_vec[k-1] + delta # make sure sum(m_out_vec)=expected(m), in case there are rounding errors, correct the last entry m = np.sum(m_out_vec) # -- m_in_vec: number of incoming edges per class / d_in_vec: np.array: average in-degree per class m_in_vec = P_tot.sum(0, keepdims=False) # sums along vertical axis d_in_vec = 1. * m_in_vec / n_vec # -- (3) list_OutDegree_vecs, list_InDegree_vec: list of np.array: distribution of in/outdegrees for nodes in each class list_OutDegree_vec = [] list_InDegree_vec = [] for i in range(k): # if not directed: # undirected case works differently: create double the degrees # m_out_vec[i] *= 2 # but then deduce 2 outdegrees per edge (ignoring indegrees completely) out_distribution = create_distribution_vector(n_vec[i], m_out_vec[i], distribution=distribution, exponent=exponent) list_OutDegree_vec.append(out_distribution) # if directed: # in_distribution = create_distribution_vector(n_vec[i], m_in_vec[i], distribution=distribution, exponent=exponent) # list_InDegree_vec.append(in_distribution) in_distribution = create_distribution_vector(n_vec[i], m_in_vec[i], distribution=distribution, exponent=exponent) list_InDegree_vec.append(in_distribution) # -- listlistNodes: list of randomly shuffled node ids for each class listlistNodes = [[node for node in range(n) if Xd[node] == i] for i in range(k)] for innerList in listlistNodes: shuffle( innerList ) # -- list_OutDegree_nodes: list of list of node ids: # contains for each outgoing edge in each class the start node id, later used for sampling list_OutDegree_nodes = [] for i in range(k): innerList = [] for j, item in enumerate(listlistNodes[i]): innerList += [item] * list_OutDegree_vec[i][j] list_OutDegree_nodes.append(innerList) if not sameInAsOutDegreeRanking: # shuffle the randomly ordered list again before assigning indegrees for innerList in listlistNodes: np.random.shuffle(innerList) list_InDegree_nodes = [] # list of each node times the outdegree for i in range(k): innerList = [] for j, item in enumerate(listlistNodes[i]): innerList += [item] * list_InDegree_vec[i][j] list_InDegree_nodes.append(innerList) # if directed: # if not sameInAsOutDegreeRanking: # shuffle the randomly ordered list again before assigning indegrees # for innerList in listlistNodes: # np.random.shuffle( innerList ) # list_InDegree_nodes = []
probability that a person is not allowed to move to other districts blocked_not_allowed_target_district_index = self.model.params.BLOCK_ALLOWED_PROBABILITY < np.random.random(len(target_district_ids)) # If a person is not allowed to move and target location is on lockdown blocked_district_index = blocked_target_district_index & blocked_not_allowed_target_district_index # If identified to be restricted, set target district to home district target_district_ids[blocked_district_index] = self.model.district_ids[district_out_mover_ids][blocked_district_index] #### NOTE: SCENARIO SPECIFIC: Execute check for blocking places with outbound other_district_index = np.not_equal(target_district_ids, self.model.district_ids[district_out_mover_ids]) actual_district_out_mover_ids = district_out_mover_ids[other_district_index] src_district_ids = self.model.district_ids[actual_district_out_mover_ids] dst_district_ids = target_district_ids[other_district_index] dow = current_time.weekday() stay_idx = [( dow, self.model.params.DISTRICT_ID_TO_NAME.get(src), self.model.params.DISTRICT_ID_TO_NAME.get(dst) ) for src, dst in zip(src_district_ids, dst_district_ids)] od_stay_matrix = self.model.params.DISTRICT_WEEKDAY_OD_STAY_COUNT_MATRIX.loc[stay_idx] return_district_params = self.model.params.get_gamma_shape_scale( od_stay_matrix['avg_duration'], od_stay_matrix['stddev_duration']) return_district_at_times = current_time + np.array([ timedelta(hours=h) for h in np.random.gamma(*return_district_params) ]) self.model.return_district_at[actual_district_out_mover_ids] = return_district_at_times self.model.current_district_ids[actual_district_out_mover_ids] = target_district_ids[other_district_index] # We don't assign movers to households. They will be actively interacting with people in different districts. # This also suggests that at night, people from other districts will be interacting with each other and not with locals in the district. self.model.current_location_ids[actual_district_out_mover_ids] = target_district_ids[other_district_index] return actual_district_out_mover_ids class Country(Model): def __init__(self, params, model_log_file=None, individual_log_file=None): ''' params: class or dict containing the global parameters for the model. start_datetime: datetime object corresponding to the start date of the simulation. step_timedelta: timedelta corresponding to the timestep in the simulation. ''' self.individual_log_file = individual_log_file self.model_log_file = model_log_file self.params = params self.start_datetime = params.start_datetime self.step_timedelta = params.step_timedelta # Agent Vectors self.person_ids = None self.district_ids = None self.household_ids = None self.age = None self.sex = None self.economic_status_ids = None self.economic_activity_location_ids = None # Set initial location as the household # Current location can be [school, household, outside] # Since we don't have specific location data yet. self.current_location_ids = None self.current_district_ids = None self.left_district_at = None self.return_district_at = None self.economic_status_weekday_movement_probability = None self.economic_status_other_day_movement_probability = None self.mild_symptom_movement_probability = None # Epidemic Vectors ## Epidemic status self.epidemic_state = None # default to 0 -> susceptible, 1 -> infected, 2 -> contagious, 3 -> recovered, 4 -> dead self.infection_rate = None self.infected_symptomatic_status = None # default to -1 -> uninfected, 0 -> asymptomatic, 1 -> symptomatic self.clinical_state = None # default to 0 -> uninfected/not hospitalized, 1 -> hospitalized, 2 -> critical self.date_infected = None # default to np.inf self.date_start_contagious = None # default to np.inf self.date_start_symptomatic = None # default to np.inf self.date_recovered = None # default to np.inf self.infected_at_district_ids = None self.infected_at_location_ids = None ## Clinical care self.date_start_hospitalized = None # default to np.inf self.date_end_hospitalized = None # default to np.inf self.date_start_critical = None # default to np.inf self.date_end_critical = None # default to np.inf ## Note, a person in icu can recover and need to get a hospital bed for recovery. ## Fatality status self.date_died = None # default to np.inf # if (self.economic_status in self.model.params.DISTRICT_MOVING_ECONOMIC_STATUS) and (self.age >= self.model.params.DISTRICT_MOVEMENT_ALLOWED_AGE): self.district_mover = None # 0 -> not allowed to move between districts, 1 -> allowed to move between districts # Trackers self.infected_count = 0 self.asymptomatic_count = 0 self.symptomatic_count = 0 self.hospitalized_count = 0 self.critical_count = 0 self.died_count = 0 self.recovered_count = 0 self.scheduler = EpidemicScheduler(self) self.lockdown = params.lockdown self.blocked = params.blocked # School reopening status self.school_phase = None self.is_school_scenario = False def initialize_epidemic_vectors(self, size): self.STATE_SUSCEPTIBLE = 0 self.STATE_INFECTED = 1 self.STATE_CONTAGIOUS = 2 self.STATE_RECOVERED = 3 self.STATE_DEAD = 4 self.DEAD_LOCATION_ID = -1 self.CLINICAL_NOT_HOSPITALIZED = 0 self.CLINICAL_HOSPITALIZED = 1 self.CLINICAL_CRITICAL = 2 self.CLINICAL_RELEASED_OR_DEAD = 3 self.SYMPTOM_NONE = -1 self.SYMPTOM_ASYMPTOMATIC = 0 self.SYMPTOM_SYMPTOMATIC = 1 ## Epidemic status self.epidemic_state = np.zeros(shape=size) # default to 0 -> susceptible, 1 -> infected, 2 -> contagious, 3 -> recovered, 4 -> dead self.infection_rate = np.zeros(shape=size) self.infected_symptomatic_status = np.full(shape=size, fill_value=self.SYMPTOM_NONE) # default to -1 -> uninfected, 0 -> asymptomatic, 1 -> symptomatic self.clinical_state = np.full(shape=size, fill_value=self.CLINICAL_NOT_HOSPITALIZED) # default to 0 -> uninfected/not hospitalized, 1 -> hospitalized, 2 -> critical self.date_infected = np.full(shape=size, fill_value=datetime.max) # default to np.inf self.date_start_contagious = np.full(shape=size, fill_value=datetime.max) # default to np.inf self.date_start_symptomatic = np.full(shape=size, fill_value=datetime.max) # default to np.inf self.date_recovered = np.full(shape=size, fill_value=datetime.max) # default to np.inf self.infected_at_district_ids = np.full(shape=size, fill_value=-1) self.infected_at_location_ids = np.full(shape=size, fill_value=-1) self.severe_disease_risk = np.ones(shape=size) def initialize_clinical_vectors(self, size): ## Clinical care self.date_start_hospitalized = np.full(shape=size, fill_value=datetime.max) # default to np.inf self.date_end_hospitalized = np.full(shape=size, fill_value=datetime.max) # default to np.inf self.date_start_critical = np.full(shape=size, fill_value=datetime.max) # default to np.inf self.date_end_critical = np.full(shape=size, fill_value=datetime.max) # default to np.inf ## Note, a person in icu can recover and need to get a hospital bed for recovery. ## Fatality status self.date_died = np.full(shape=size, fill_value=datetime.max) # default to np.inf def initialize_agent_vectors(self, df): # Agent Vectors size = df.shape[0] # Define household id relative to district id so that we can unify location. self.params.HOUSEHOLD_ID_TO_NAME = dict(enumerate( sorted(df['household_id'].unique()), max(self.params.DISTRICT_ID_TO_NAME) + 1) ) self.params.HOUSEHOLD_NAME_TO_ID = {j: i for i, j in self.params.HOUSEHOLD_ID_TO_NAME.items()} if self.is_school_scenario: # Define school id relative to district id and household id so that we can unify location. self.params.SCHOOL_ID_TO_NAME = dict(enumerate( sorted(df.loc[df['school_id'] != '', 'school_id'].unique()), max(self.params.HOUSEHOLD_ID_TO_NAME) + 1) ) self.params.SCHOOL_NAME_TO_ID = {j: i for i, j in self.params.SCHOOL_ID_TO_NAME.items()} self.params.SEX_ID_TO_NAME = dict(enumerate(sorted(df['sex'].unique()))) self.params.SEX_NAME_TO_ID = {j: i for i, j in self.params.SEX_ID_TO_NAME.items()} self.params.LOCATION_ID_TO_NAME = dict(self.params.DISTRICT_ID_TO_NAME) self.params.LOCATION_ID_TO_NAME.update(self.params.HOUSEHOLD_ID_TO_NAME) if self.is_school_scenario: self.params.LOCATION_ID_TO_NAME.update(self.params.SCHOOL_ID_TO_NAME) self.params.LOCATION_NAME_TO_ID = {j: i for i, j in self.params.LOCATION_ID_TO_NAME.items()} self.person_ids = np.array(range(size), dtype=int) self.district_ids = np.array(df['district_id'].map(self.params.DISTRICT_NAME_TO_ID)) self.household_ids = np.array(df['household_id'].map(self.params.HOUSEHOLD_NAME_TO_ID)) self.age = np.array(df['age']) self.sex = np.array(df['sex'].map(self.params.SEX_NAME_TO_ID)) self.economic_status_ids = np.array(df['economic_status'].map(self.params.ECON_STAT_NAME_TO_ID)) self.economic_activity_location_ids = np.array(df['economic_activity_location_id'].map( self.params.LOCATION_NAME_TO_ID)) self.economic_status_ids_person_ids = {i: set(np.where(self.economic_status_ids == i)[0]) for i in self.params.ECON_STAT_ID_TO_NAME} self.economic_status_weekday_movement_probability = np.array(df['economic_status'].map(self.params.ECONOMIC_STATUS_WEEKDAY_MOVEMENT_PROBABILITY)) self.economic_status_other_day_movement_probability = np.array(df['economic_status'].map(self.params.ECONOMIC_STATUS_OTHER_DAY_MOVEMENT_PROBABILITY)) self.mild_symptom_movement_probability = np.ones(shape=size) # Set initial location as the household # Current location can be [school, household, outside] # Since we don't have specific location data yet. self.current_location_ids = np.array(self.household_ids) self.current_district_ids = np.array(self.district_ids) self.left_district_at = np.full(shape=size, fill_value=datetime.max) self.return_district_at = np.full(shape=size, fill_value=datetime.max) district_moving_economic_status_ids = [self.params.ECON_STAT_NAME_TO_ID[es] for es in self.params.DISTRICT_MOVING_ECONOMIC_STATUS] self.DISTRICT_MOVER_FALSE = 0 self.DISTRICT_MOVER_TRUE = 1 self.district_mover = self.DISTRICT_MOVER_TRUE * ( np.in1d(self.economic_status_ids, district_moving_economic_status_ids) & (self.age >= self.params.DISTRICT_MOVEMENT_ALLOWED_AGE) ) def scenario_data_preprocessing(self, df): pass def scenario_data_postprocessing(self, df): pass def set_blocked_movers_and_movement_probabilities(self): blocked_ids = self.person_ids[np.in1d(self.district_ids, self.params.BLOCK_DISTRICTS_IDS)] district_blocked_movers = blocked_ids[self.district_mover[blocked_ids] == self.DISTRICT_MOVER_TRUE] district_blocked_allowed_movers = district_blocked_movers[np.random.random(len(district_blocked_movers)) < self.params.BLOCK_ALLOWED_PROBABILITY] self.district_mover[district_blocked_movers] = self.DISTRICT_MOVER_FALSE self.district_mover[district_blocked_allowed_movers] = self.DISTRICT_MOVER_TRUE def set_lockdown_movers_and_movement_probabilities(self, unrestricted_ids=None): lockdown_ids = self.person_ids[np.in1d(self.district_ids, self.params.LOCKDOWN_DISTRICTS_IDS)] if unrestricted_ids is not None and len(unrestricted_ids) > 0: lockdown_ids = np.array(list(set(lockdown_ids).difference(unrestricted_ids))) district_lockdown_movers = lockdown_ids[self.district_mover[lockdown_ids] == self.DISTRICT_MOVER_TRUE] district_lockdown_allowed_movers = district_lockdown_movers[ np.less( np.random.random(len(district_lockdown_movers)), np.array([ self.params.LOCKDOWN_ALLOWED_PROBABILITY[i] for i in self.district_ids[district_lockdown_movers]]))] self.district_mover[district_lockdown_movers] = self.DISTRICT_MOVER_FALSE self.district_mover[district_lockdown_allowed_movers] = self.DISTRICT_MOVER_TRUE decreased_mobility_rate = np.array([self.params.LOCKDOWN_DECREASED_MOBILITY_RATE[i] for i in self.district_ids[lockdown_ids]]) self.economic_status_weekday_movement_probability[lockdown_ids] *= decreased_mobility_rate self.economic_status_other_day_movement_probability[lockdown_ids] *= decreased_mobility_rate def setup_selective_movement_restriction_scenarios(self, unrestricted_ids, set_lockdown): if set_lockdown: self.set_lockdown_movers_and_movement_probabilities(unrestricted_ids=unrestricted_ids) # NOTE: Don't allow unrestricted_ids to move between districts self.district_mover[unrestricted_ids] = self.DISTRICT_MOVER_FALSE # NOTE: During weekends apply mobility restrictions to unrestricted_ids? other_decreased_mobility_rate = np.array([self.params.LOCKDOWN_DECREASED_MOBILITY_RATE[i] for i in self.district_ids[unrestricted_ids]]) self.economic_status_other_day_movement_probability[unrestricted_ids] *= other_decreased_mobility_rate def set_school_params(self, df): if self.params.SCENARIO.endswith("GOVERNMENT_OPEN_SCHOOLS"): self.school_phase = np.array(df["phase"]) self.max_school_phase = max(self.school_phase) self.active_school_phases = [1] self.school_ids = np.array(df['school_id'].map(self.params.SCHOOL_NAME_TO_ID)) def lockdown_schools(self, district_ids, active_school_phases): ''' district_ids: list of location that are being locked down due to high symptomatic infection rate. active_school_phases: list of phases of school opening that are currently active. # Assume that people not going to school will be assigned # a school_phase value of 0. # lockdown_ids corresponds to school goers. ''' lockdown_ids = self.person_ids[np.in1d(self.district_ids, district_ids) & np.in1d(self.school_phase, active_school_phases)] district_lockdown_movers = lockdown_ids[self.district_mover[lockdown_ids] == self.DISTRICT_MOVER_TRUE] district_lockdown_allowed_movers = district_lockdown_movers[ np.less(np.random.random(len(district_lockdown_movers)), np.array([self.params.LOCKDOWN_ALLOWED_PROBABILITY[i] for i in self.district_ids[district_lockdown_movers]]))] self.district_mover[district_lockdown_movers] = self.DISTRICT_MOVER_FALSE self.district_mover[district_lockdown_allowed_movers] = self.DISTRICT_MOVER_TRUE decreased_mobility_rate = np.array([self.params.LOCKDOWN_DECREASED_MOBILITY_RATE[i] for i in self.district_ids[lockdown_ids]]) # # Reset values before updating... No need to update other day movement since we only alter # # weekday behaviour. # # NOTE: Strictly, lockdown_ids should be split into In School and Teachers economic status. However, we can operate on the combined # # set since the ECONOMIC_STATUS_WEEKDAY_MOVEMENT_PROBABILITY values for both status are the same. # in_school_lockdown_ids = None # teachers_lockdown_ids = None self.economic_status_weekday_movement_probability[lockdown_ids] = self.params.ECONOMIC_STATUS_WEEKDAY_MOVEMENT_PROBABILITY["In School"] self.economic_status_weekday_movement_probability[lockdown_ids] *= decreased_mobility_rate # If schools are closed, revert to default external interaction location. self.update_school_economic_activity_location(lockdown_ids, is_lockdown=True) def open_schools(self, district_ids, active_school_phases): school_educ_ids = self.person_ids[np.in1d(self.district_ids, district_ids) & np.in1d(self.school_phase, active_school_phases)] # # Reset values before updating... # # NOTE: Strictly, lockdown_ids should be split into In School and Teachers economic status. However, we can operate
Input structure. prev_incar (Incar/string): Incar file from previous run. mode (str): Supported modes are "STATIC" (default), "DIAG", "GW", and "BSE". nbands (int): For subsequent calculations, it is generally recommended to perform NBANDS convergence starting from the NBANDS of the previous run for DIAG, and to use the exact same NBANDS for GW and BSE. This parameter is used by from_previous_calculation to set nband. potcar_functional (str): Defaults to "PBE_54". copy_wavecar: Whether to copy the old WAVECAR, WAVEDER and associated files when starting from a previous calculation. nbands_factor (int): Multiplicative factor for NBANDS when starting from a previous calculation. Only applies if mode=="DIAG". Need to be tested for convergence. ncores (int): Numbers of cores used for the calculation. VASP will alter NBANDS if it was not dividable by ncores. Only applies if mode=="DIAG". **kwargs: All kwargs supported by DictSet. Typically, user_incar_settings is a commonly used option. """ CONFIG = _load_yaml_config("MVLGWSet") SUPPORTED_MODES = ("DIAG", "GW", "STATIC", "BSE") def __init__(self, structure, prev_incar=None, nbands=None, potcar_functional="PBE_54", reciprocal_density=100, mode="STATIC", copy_wavecar=True, nbands_factor=5, ncores=16, **kwargs): super().__init__(structure, MVLGWSet.CONFIG, **kwargs) self.prev_incar = prev_incar self.nbands = nbands self.potcar_functional = potcar_functional self.reciprocal_density = reciprocal_density self.mode = mode.upper() if self.mode not in MVLGWSet.SUPPORTED_MODES: raise ValueError("%s not one of the support modes : %s" % (self.mode, MVLGWSet.SUPPORTED_MODES)) self.kwargs = kwargs self.copy_wavecar = copy_wavecar self.nbands_factor = nbands_factor self.ncores = ncores @property def kpoints(self): """ Generate gamma center k-points mesh grid for GW calc, which is requested by GW calculation. """ return Kpoints.automatic_density_by_vol(self.structure, self.reciprocal_density, force_gamma=True) @property def incar(self): parent_incar = super().incar incar = Incar(self.prev_incar) if self.prev_incar is not None else \ Incar(parent_incar) if self.mode == "DIAG": # Default parameters for diagonalization calculation. incar.update({ "ALGO": "Exact", "NELM": 1, "LOPTICS": True, "LPEAD": True }) elif self.mode == "GW": # Default parameters for GW calculation. incar.update({ "ALGO": "GW0", "NELM": 1, "NOMEGA": 80, "ENCUTGW": 250 }) incar.pop("EDIFF", None) incar.pop("LOPTICS", None) incar.pop("LPEAD", None) elif self.mode == "BSE": # Default parameters for BSE calculation. incar.update({ "ALGO": "BSE", "ANTIRES": 0, "NBANDSO": 20, "NBANDSV": 20 }) if self.nbands: incar["NBANDS"] = self.nbands # Respect user set INCAR. incar.update(self.kwargs.get("user_incar_settings", {})) return incar def override_from_prev_calc(self, prev_calc_dir='.'): """ Update the input set to include settings from a previous calculation. Args: prev_calc_dir (str): The path to the previous calculation directory. Returns: The input set with the settings (structure, k-points, incar, etc) updated using the previous VASP run. """ vasprun, outcar = get_vasprun_outcar(prev_calc_dir) self.prev_incar = vasprun.incar self._structure = vasprun.final_structure if self.standardize: warnings.warn("Use of standardize=True with from_prev_run is not " "recommended as there is no guarantee the copied " "files will be appropriate for the standardized " "structure.") self.nbands = int(vasprun.parameters["NBANDS"]) if self.mode.upper() == "DIAG": self.nbands = int(np.ceil(self.nbands * self.nbands_factor / self.ncores) * self.ncores) # copy WAVECAR, WAVEDER (derivatives) files_to_transfer = {} if self.copy_wavecar: for fname in ("WAVECAR", "WAVEDER", "WFULL"): w = sorted(glob.glob(str(Path(prev_calc_dir) / (fname + "*")))) if w: if fname == "WFULL": for f in w: fname = Path(f).name fname = fname.split(".")[0] files_to_transfer[fname] = f else: files_to_transfer[fname] = str(w[-1]) self.files_to_transfer.update(files_to_transfer) return self @classmethod def from_prev_calc(cls, prev_calc_dir, mode="DIAG", **kwargs): """ Generate a set of Vasp input files for GW or BSE calculations from a directory of previous Exact Diag Vasp run. Args: prev_calc_dir (str): The directory contains the outputs( vasprun.xml of previous vasp run. mode (str): Supported modes are "STATIC", "DIAG" (default), "GW", and "BSE". **kwargs: All kwargs supported by MVLGWSet, other than structure, prev_incar and mode, which are determined from the prev_calc_dir. """ input_set = cls(_dummy_structure, mode=mode, **kwargs) return input_set.override_from_prev_calc(prev_calc_dir=prev_calc_dir) class MVLSlabSet(MPRelaxSet): """ Class for writing a set of slab vasp runs, including both slabs (along the c direction) and orient unit cells (bulk), to ensure the same KPOINTS, POTCAR and INCAR criterion. Args: k_product: default to 50, kpoint number * length for a & b directions, also for c direction in bulk calculations bulk (bool): Set to True for bulk calculation. Defaults to False. **kwargs: Other kwargs supported by :class:`DictSet`. """ def __init__(self, structure, k_product=50, bulk=False, auto_dipole=False, set_mix=True, sort_structure=True, **kwargs): super().__init__(structure, **kwargs) if sort_structure: structure = structure.get_sorted_structure() self.k_product = k_product self.bulk = bulk self.auto_dipole = auto_dipole self.kwargs = kwargs self.set_mix = set_mix self.kpt_calc = None slab_incar = {"EDIFF": 1e-4, "EDIFFG": -0.02, "ENCUT": 400, "ISMEAR": 0, "SIGMA": 0.05, "ISIF": 3} if not self.bulk: slab_incar["ISIF"] = 2 slab_incar["LVTOT"] = True if self.set_mix: slab_incar["AMIN"] = 0.01 slab_incar["AMIX"] = 0.2 slab_incar["BMIX"] = 0.001 slab_incar["NELMIN"] = 8 if self.auto_dipole: weights = [s.species.weight for s in structure] center_of_mass = np.average(structure.frac_coords, weights=weights, axis=0) slab_incar["IDIPOL"] = 3 slab_incar["LDIPOL"] = True slab_incar["DIPOL"] = center_of_mass self._config_dict["INCAR"].update(slab_incar) @property def kpoints(self): """ k_product, default to 50, is kpoint number * length for a & b directions, also for c direction in bulk calculations Automatic mesh & Gamma is the default setting. """ # To get input sets, the input structure has to has the same number # of required parameters as a Structure object (ie. 4). Slab # attributes aren't going to affect the VASP inputs anyways so # converting the slab into a structure should not matter kpt = super().kpoints kpt.comment = "Automatic mesh" kpt.style = 'Gamma' # use k_product to calculate kpoints, k_product = kpts[0][0] * a lattice_abc = self.structure.lattice.abc kpt_calc = [int(self.k_product / lattice_abc[0] + 0.5), int(self.k_product / lattice_abc[1] + 0.5), 1] self.kpt_calc = kpt_calc # calculate kpts (c direction) for bulk. (for slab, set to 1) if self.bulk: kpt_calc[2] = int(self.k_product / lattice_abc[2] + 0.5) kpt.kpts[0] = kpt_calc return kpt def as_dict(self, verbosity=2): d = MSONable.as_dict(self) if verbosity == 1: d.pop("structure", None) return d class MVLGBSet(MPRelaxSet): """ Class for writing a vasp input files for grain boundary calculations, slab or bulk. Args: structure(Structure): provide the structure k_product: Kpoint number * length for a & b directions, also for c direction in bulk calculations. Default to 40. slab_mode (bool): Defaults to False. Use default (False) for a bulk supercell. Use True if you are performing calculations on a slab-like (i.e., surface) of the GB, for example, when you are calculating the work of separation. is_metal (bool): Defaults to True. This determines whether an ISMEAR of 1 is used (for metals) or not (for insulators and semiconductors) by default. Note that it does *not* override user_incar_settings, which can be set by the user to be anything desired. **kwargs: Other kwargs supported by :class:`MPRelaxSet`. """ def __init__(self, structure, k_product=40, slab_mode=False, is_metal=True, **kwargs): super().__init__(structure, **kwargs) self.k_product = k_product self.slab_mode = slab_mode self.is_metal = is_metal @property def kpoints(self): """ k_product, default to 40, is kpoint number * length for a & b directions, also for c direction in bulk calculations Automatic mesh & Gamma is the default setting. """ # To get input sets, the input structure has to has the same number # of required parameters as a Structure object. kpt = super().kpoints kpt.comment = "Generated by pymatgen's MVLGBSet" kpt.style = 'Gamma' # use k_product to calculate kpoints, k_product = kpts[0][0] * a lengths = self.structure.lattice.abc kpt_calc = [int(self.k_product / lengths[0] + 0.5), int(self.k_product / lengths[1] + 0.5), int(self.k_product / lengths[2] + 0.5)] if self.slab_mode: kpt_calc[2] = 1 kpt.kpts[0] = kpt_calc return kpt @property def incar(self): incar = super().incar # The default incar setting is used for metallic system, for # insulator or semiconductor, ISMEAR need to be changed. incar.update({ "LCHARG": False, "NELM": 60, "PREC": "Normal", "EDIFFG": -0.02, "ICHARG": 0, "NSW": 200, "EDIFF": 0.0001 }) if self.is_metal: incar["ISMEAR"] = 1 incar["LDAU"] = False if self.slab_mode: # for clean grain boundary and bulk relaxation, full optimization # relaxation (ISIF=3) is used. For slab relaxation (ISIF=2) is used. incar["ISIF"] = 2 incar["NELMIN"] = 8 incar.update(self.user_incar_settings) return incar class MVLRelax52Set(DictSet): """ Implementation of VaspInputSet utilizing the public Materials Project parameters for INCAR & KPOINTS and VASP's recommended PAW potentials for POTCAR. Keynotes from VASP manual: 1. Recommended potentials for calculations using vasp.5.2+ 2. If dimers with short bonds are present in the compound (O2, CO, N2, F2, P2, S2, Cl2), it is recommended to use the h potentials.
<reponame>qingpeng/khmer # # This file is part of khmer, http://github.com/ged-lab/khmer/, and is # Copyright (C) Michigan State University, 2009-2013. It is licensed under # the three-clause BSD license; see doc/LICENSE.txt. # Contact: <EMAIL> # # pylint: disable=missing-docstring,protected-access import khmer from khmer import ReadParser from screed.fasta import fasta_iter import screed import khmer_tst_utils as utils from nose.plugins.attrib import attr def teardown(): utils.cleanup() def test__get_set_tag_density(): ht = khmer.new_hashbits(32, 1, 1) orig = ht._get_tag_density() assert orig != 2 ht._set_tag_density(2) assert ht._get_tag_density() == 2 def test_n_occupied_1(): filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 1 # number of hashtables # test modified c++ n_occupied code ht1 = khmer.new_hashbits(K, HT_SIZE, N_HT) for n, record in enumerate(fasta_iter(open(filename))): ht1.consume(record['sequence']) # this number calculated independently assert ht1.n_occupied() == 3877 def test_bloom_python_1(): # test python code to count unique kmers using bloom filter filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht2 = khmer.new_hashbits(K, HT_SIZE, N_HT) n_unique = 0 for n, record in enumerate(fasta_iter(open(filename))): sequence = record['sequence'] seq_len = len(sequence) for n in range(0, seq_len + 1 - K): kmer = sequence[n:n + K] if (not ht2.get(kmer)): n_unique += 1 ht2.count(kmer) assert n_unique == 3960 assert ht2.n_occupied() == 3882 assert ht2.n_unique_kmers() == 3960 # this number equals to n_unique def test_bloom_c_1(): # test c++ code to count unique kmers using bloom filter filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 100000 # size of hashtable N_HT = 3 # number of hashtables ht3 = khmer.new_hashbits(K, HT_SIZE, N_HT) for n, record in enumerate(fasta_iter(open(filename))): ht3.consume(record['sequence']) assert ht3.n_occupied() == 3882 assert ht3.n_unique_kmers() == 3960 def test_n_occupied_2(): # simple one K = 4 HT_SIZE = 10 # use 11 N_HT = 1 ht1 = khmer.new_hashbits(K, HT_SIZE, N_HT) ht1.count('AAAA') # 00 00 00 00 = 0 assert ht1.n_occupied() == 1 ht1.count('ACTG') # 00 10 01 11 = assert ht1.n_occupied() == 2 ht1.count('AACG') # 00 00 10 11 = 11 # collision 1 assert ht1.n_occupied() == 2 ht1.count('AGAC') # 00 11 00 10 # collision 2 assert ht1.n_occupied() == 2 def test_bloom_c_2(): # simple one K = 4 HT_SIZE = 10 # use 11 N_HT1 = 1 # hashtable size = 11 N_HT2 = 2 # hashtable size = 11,13 # use only 1 hashtable, no bloom filter ht1 = khmer.new_hashbits(K, HT_SIZE, N_HT1) ht1.count('AAAA') # 00 00 00 00 = 0 ht1.count('ACTG') # 00 10 01 11 = assert ht1.n_unique_kmers() == 2 ht1.count('AACG') # 00 00 10 11 = 11 # collision with 1st kmer assert ht1.n_unique_kmers() == 2 ht1.count('AGAC') # 00 11 00 10 # collision with 2nd kmer assert ht1.n_unique_kmers() == 2 # use two hashtables with 11,13 ht2 = khmer.new_hashbits(K, HT_SIZE, N_HT2) ht2.count('AAAA') # 00 00 00 00 = 0 ht2.count('ACTG') # 00 10 01 11 = 2*16 +4 +3 = 39 assert ht2.n_unique_kmers() == 2 ht2.count('AACG') # 00 00 10 11 = 11 # collision with only 1st kmer assert ht2.n_unique_kmers() == 3 ht2.count('AGAC') # 00 11 00 10 3*16 +2 = 50 # collision with both 2nd and 3rd kmers assert ht2.n_unique_kmers() == 3 def test_filter_if_present(): ht = khmer.new_hashbits(32, 2, 2) maskfile = utils.get_test_data('filter-test-A.fa') inputfile = utils.get_test_data('filter-test-B.fa') outfile = utils.get_temp_filename('filter') ht.consume_fasta(maskfile) ht.filter_if_present(inputfile, outfile) records = list(fasta_iter(open(outfile))) assert len(records) == 1 assert records[0]['name'] == '3' def test_combine_pe(): inpfile = utils.get_test_data('combine_parts_1.fa') ht = khmer.new_hashbits(32, 1, 1) ht.consume_partitioned_fasta(inpfile) assert ht.count_partitions() == (2, 0) s1 = "CATGCAGAAGTTCCGCAACCATACCGTTCAGT" pid1 = ht.get_partition_id(s1) s2 = "CAAATGTACATGCACTTAAAATCATCCAGCCG" pid2 = ht.get_partition_id(s2) assert pid1 == 2 assert pid2 == 80293 ht.join_partitions(pid1, pid2) pid1 = ht.get_partition_id(s1) pid2 = ht.get_partition_id(s2) assert pid1 == pid2 assert ht.count_partitions() == (1, 0) def test_load_partitioned(): inpfile = utils.get_test_data('combine_parts_1.fa') ht = khmer.new_hashbits(32, 1, 1) ht.consume_partitioned_fasta(inpfile) assert ht.count_partitions() == (2, 0) s1 = "CATGCAGAAGTTCCGCAACCATACCGTTCAGT" assert ht.get(s1) s2 = "CAAATGTACATGCACTTAAAATCATCCAGCCG" assert ht.get(s2) s3 = "CATGCAGAAGTTCCGCAACCATACCGTTCAGTTCCTGGTGGCTA"[-32:] assert ht.get(s3) def test_count_within_radius_simple(): inpfile = utils.get_test_data('all-A.fa') ht = khmer.new_hashbits(4, 2, 2) print ht.consume_fasta(inpfile) n = ht.count_kmers_within_radius('AAAA', 1) assert n == 1 n = ht.count_kmers_within_radius('AAAA', 10) assert n == 1 def test_count_within_radius_big(): inpfile = utils.get_test_data('random-20-a.fa') ht = khmer.new_hashbits(20, 1e5, 4) ht.consume_fasta(inpfile) n = ht.count_kmers_within_radius('CGCAGGCTGGATTCTAGAGG', int(1e6)) assert n == 3960 ht = khmer.new_hashbits(21, 1e5, 4) ht.consume_fasta(inpfile) n = ht.count_kmers_within_radius('CGCAGGCTGGATTCTAGAGGC', int(1e6)) assert n == 39 def test_count_kmer_degree(): inpfile = utils.get_test_data('all-A.fa') ht = khmer.new_hashbits(4, 2, 2) ht.consume_fasta(inpfile) assert ht.kmer_degree('AAAA') == 2 assert ht.kmer_degree('AAAT') == 1 assert ht.kmer_degree('AATA') == 0 assert ht.kmer_degree('TAAA') == 1 def test_save_load_tagset(): ht = khmer.new_hashbits(32, 1, 1) outfile = utils.get_temp_filename('tagset') ht.add_tag('A' * 32) ht.save_tagset(outfile) ht.add_tag('G' * 32) ht.load_tagset(outfile) # implicitly => clear_tags=True ht.save_tagset(outfile) # if tags have been cleared, then the new tagfile will be larger (34 bytes) # else smaller (26 bytes). fp = open(outfile, 'rb') data = fp.read() fp.close() assert len(data) == 26, len(data) def test_save_load_tagset_noclear(): ht = khmer.new_hashbits(32, 1, 1) outfile = utils.get_temp_filename('tagset') ht.add_tag('A' * 32) ht.save_tagset(outfile) ht.add_tag('G' * 32) ht.load_tagset(outfile, False) # set clear_tags => False; zero tags ht.save_tagset(outfile) # if tags have been cleared, then the new tagfile will be large (34 bytes); # else small (26 bytes). fp = open(outfile, 'rb') data = fp.read() fp.close() assert len(data) == 34, len(data) def test_stop_traverse(): filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 1e4 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.new_hashbits(K, HT_SIZE, N_HT) # without tagging/joining across consume, this breaks into two partition; # with, it is one partition. ht.add_stop_tag('TTGCATACGTTGAGCCAGCG') ht.consume_fasta_and_tag(filename) # DO NOT join reads across stoptags subset = ht.do_subset_partition(0, 0, True) ht.merge_subset(subset) n, _ = ht.count_partitions() assert n == 2, n def test_tag_across_stoptraverse(): filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 1e4 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.new_hashbits(K, HT_SIZE, N_HT) # without tagging/joining across consume, this breaks into two partition; # with, it is one partition. ht.add_stop_tag('CCGAATATATAACAGCGACG') ht.consume_fasta_and_tag_with_stoptags(filename) # DO join reads across subset = ht.do_subset_partition(0, 0) n, _ = ht.count_partitions() assert n == 99 # reads only connected by traversal... n, _ = ht.subset_count_partitions(subset) assert n == 2 # but need main to cross stoptags. ht.merge_subset(subset) n, _ = ht.count_partitions() # ta-da! assert n == 1, n def test_notag_across_stoptraverse(): filename = utils.get_test_data('random-20-a.fa') K = 20 # size of kmer HT_SIZE = 1e4 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.new_hashbits(K, HT_SIZE, N_HT) # connecting k-mer at the beginning/end of a read: breaks up into two. ht.add_stop_tag('TTGCATACGTTGAGCCAGCG') ht.consume_fasta_and_tag_with_stoptags(filename) subset = ht.do_subset_partition(0, 0) ht.merge_subset(subset) n, _ = ht.count_partitions() assert n == 2, n def test_find_stoptags(): ht = khmer.new_hashbits(5, 1, 1) ht.add_stop_tag("AAAAA") assert ht.identify_stoptags_by_position("AAAAA") == [0] assert ht.identify_stoptags_by_position("AAAAAA") == [0, 1] assert ht.identify_stoptags_by_position("TTTTT") == [0] assert ht.identify_stoptags_by_position("TTTTTT") == [0, 1] def test_find_stoptags2(): ht = khmer.new_hashbits(4, 1, 1) ht.add_stop_tag("ATGC") x = ht.identify_stoptags_by_position("ATGCATGCGCAT") assert x == [0, 2, 4, 8], x def test_get_ksize(): kh = khmer.new_hashbits(22, 1, 1) assert kh.ksize() == 22 def test_get_hashsizes(): kh = khmer.new_hashbits(22, 100, 4) assert kh.hashsizes() == [101, 103, 107, 109], kh.hashsizes() def test_extract_unique_paths_0(): kh = khmer.new_hashbits(10, 4, 4) x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) assert x == ['ATGGAGAGACACAGATAGACAGGAGTGGCGATG'] kh.consume('ATGGAGAGACACAGATAGACAGGAGTGGCGATG') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) assert not x def test_extract_unique_paths_1(): kh = khmer.new_hashbits(10, 4, 4) kh.consume('AGTGGCGATG') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) print x assert x == ['ATGGAGAGACACAGATAGACAGGAGTGGCGAT'] # all but the last k-mer def test_extract_unique_paths_2(): kh = khmer.new_hashbits(10, 4, 4) kh.consume('ATGGAGAGAC') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) print x assert x == ['TGGAGAGACACAGATAGACAGGAGTGGCGATG'] # all but the 1st k-mer def test_extract_unique_paths_3(): kh = khmer.new_hashbits(10, 4, 4) kh.consume('ATGGAGAGAC') kh.consume('AGTGGCGATG') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) print x # all but the 1st/last k-mer assert x == ['TGGAGAGACACAGATAGACAGGAGTGGCGAT'] def test_extract_unique_paths_4(): kh = khmer.new_hashbits(10, 4, 4) kh.consume('ATGGAGAGAC') kh.consume('AGTGGCGATG') kh.consume('ATAGACAGGA') x = kh.extract_unique_paths('ATGGAGAGACACAGATAGACAGGAGTGGCGATG', 10, 1) print x assert x == ['TGGAGAGACACAGATAGACAGG', 'TAGACAGGAGTGGCGAT'] def test_find_unpart(): filename = utils.get_test_data('random-20-a.odd.fa') filename2 = utils.get_test_data('random-20-a.even.fa') K = 20 # size of kmer HT_SIZE = 1e4 # size of hashtable N_HT = 3 # number of hashtables ht = khmer.new_hashbits(K, HT_SIZE, N_HT) ht.consume_fasta_and_tag(filename) subset = ht.do_subset_partition(0, 0) ht.merge_subset(subset) n, _ = ht.count_partitions() assert n == 49 ht.find_unpart(filename2, True, False) n, _ = ht.count_partitions()
<reponame>tupui/rbc """Implement Buffer type as a base class to HeavyDB Array and Column types. HeavyDB Buffer represents the following structure: template<typename T> struct Buffer { T* ptr; size_t sz; ... } that is, a structure that has at least two members where the first is a pointer to some data type and the second is the size of the buffer. This module implements the support for the following Python operators: len __getitem__ __setitem__ to provide a minimal functionality for accessing and manipulating the HeavyDB buffer objects from UDF/UDTFs. """ import operator from .metatype import HeavyDBMetaType from llvmlite import ir import numpy as np from rbc import typesystem, irutils, errors from rbc.targetinfo import TargetInfo from numba.core import datamodel, cgutils, extending, types, imputils int8_t = ir.IntType(8) int32_t = ir.IntType(32) int64_t = ir.IntType(64) void_t = ir.VoidType() fp32 = ir.FloatType() fp64 = ir.DoubleType() class HeavyDBBufferType(typesystem.Type): """Typesystem type class for HeavyDB buffer structures. """ # When True, buffer type arguments are passed by value to # functions [not recommended]. @property def pass_by_value(self): return False @property def numba_pointer_type(self): return BufferPointer @classmethod def preprocess_args(cls, args): assert len(args) == 1, args assert len(args[0]) == 1, args element_type = args[0][0] if not isinstance(element_type, typesystem.Type): element_type = typesystem.Type.fromobject(element_type) return ((element_type,),) @property def element_type(self): return self[0][0] @property def buffer_extra_members(self): return () def tonumba(self, bool_is_int8=None): ptr_t = typesystem.Type(self.element_type, '*', name='ptr') size_t = typesystem.Type.fromstring('size_t sz') extra_members = tuple(map(typesystem.Type.fromobject, self.buffer_extra_members)) buffer_type = typesystem.Type( ptr_t, size_t, *extra_members ) buffer_type._params['NumbaType'] = BufferType buffer_type._params['NumbaPointerType'] = self.numba_pointer_type numba_type = buffer_type.tonumba(bool_is_int8=True) if self.pass_by_value: return numba_type return self.numba_pointer_type(numba_type) class BufferType(types.Type): """Numba type class for HeavyDB buffer structures. """ @property def eltype(self): """ Return buffer element dtype. """ return self.members[0].dtype class BufferPointer(types.IterableType): """Numba type class for pointers to HeavyDB buffer structures. We are not deriving from CPointer because BufferPointer getitem is used to access the data stored in Buffer ptr member. """ mutable = True return_as_first_argument = True def __init__(self, dtype): self.dtype = dtype # struct dtype self.eltype = dtype.eltype # buffer element dtype name = "%s[%s]*" % (type(self).__name__, dtype) super().__init__(name) @property def key(self): return self.dtype @property def iterator_type(self): return BufferPointerIteratorType(self) class BufferPointerIteratorType(types.SimpleIteratorType): def __init__(self, buffer_type): name = f"iter_buffer({buffer_type})" self.buffer_type = buffer_type super().__init__(name, self.buffer_type.eltype) @datamodel.register_default(BufferPointerIteratorType) class BufferPointerIteratorModel(datamodel.StructModel): def __init__(self, dmm, fe_type): members = [('index', types.EphemeralPointer(types.uintp)), ('buffer', fe_type.buffer_type)] super(BufferPointerIteratorModel, self).__init__(dmm, fe_type, members) class BufferMeta(HeavyDBMetaType): pass class Buffer(object, metaclass=BufferMeta): """Represents HeavyDB Buffer that can be constructed within UDF/UDTFs. """ @datamodel.register_default(BufferPointer) class BufferPointerModel(datamodel.models.PointerModel): """Base class for HeavyDB buffer pointer models. Subclasses should register the model for the corresponding BufferPointer subclass, for instance:: @datamodel.register_default(ArrayPointer) class ArrayPointerModel(BufferPointerModel): pass """ def heavydb_buffer_constructor(context, builder, sig, args): """ Usage: extending.lower_builtin(MyBuffer, numba.types.Integer, ...)(heavydb_buffer_constructor) will enable creating MyBuffer instance from a HeavyDB UDF/UDTF definition: b = MyBuffer(<size>, ...) """ ptr_type, sz_type = sig.return_type.dtype.members[:2] if len(sig.return_type.dtype.members) > 2: assert len(sig.return_type.dtype.members) == 3 null_type = sig.return_type.dtype.members[2] else: null_type = None assert isinstance(args[0].type, ir.IntType), (args[0].type) element_count = builder.zext(args[0], int64_t) element_size = int64_t(ptr_type.dtype.bitwidth // 8) alloc_fnty = ir.FunctionType(int8_t.as_pointer(), [int64_t, int64_t]) alloc_fn_name = 'allocate_varlen_buffer' alloc_fn = irutils.get_or_insert_function(builder.module, alloc_fnty, alloc_fn_name) ptr8 = builder.call(alloc_fn, [element_count, element_size]) ptr = builder.bitcast(ptr8, context.get_value_type(ptr_type)) fa = cgutils.create_struct_proxy(sig.return_type.dtype)(context, builder) fa.ptr = ptr # T* fa.sz = element_count # size_t if null_type is not None: is_zero = builder.icmp_signed('==', element_count, int64_t(0)) with builder.if_else(is_zero) as (then, orelse): with then: is_null = context.get_value_type(null_type)(1) with orelse: is_null = context.get_value_type(null_type)(0) fa.is_null = is_null # int8_t return fa._getpointer() @extending.intrinsic def heavydb_buffer_ptr_get_ptr_(typingctx, data): eltype = data.eltype ptrtype = types.CPointer(eltype) sig = ptrtype(data) def codegen(context, builder, signature, args): data, = args rawptr = cgutils.alloca_once_value(builder, value=data) struct = builder.load(builder.gep(rawptr, [int32_t(0)])) return builder.load(builder.gep(struct, [int32_t(0), int32_t(0)])) return sig, codegen @extending.intrinsic def heavydb_buffer_get_ptr_(typingctx, data): eltype = data.eltype ptrtype = types.CPointer(eltype) sig = ptrtype(data) def codegen(context, builder, signature, args): data, = args assert data.opname == 'load' struct = data.operands[0] return builder.load(builder.gep(struct, [int32_t(0), int32_t(0)])) return sig, codegen @extending.intrinsic def heavydb_buffer_ptr_item_get_ptr_(typingctx, data, index): eltype = data.eltype ptrtype = types.CPointer(eltype) sig = ptrtype(data, index) def codegen(context, builder, signature, args): data, index = args rawptr = cgutils.alloca_once_value(builder, value=data) struct = builder.load(builder.gep(rawptr, [int32_t(0)])) ptr = builder.load(builder.gep(struct, [int32_t(0), int32_t(0)])) return builder.gep(ptr, [index]) return sig, codegen @extending.overload_method(BufferPointer, 'ptr') def heavydb_buffer_get_ptr(x, index=None): if isinstance(x, BufferPointer): if cgutils.is_nonelike(index): def impl(x, index=None): return heavydb_buffer_ptr_get_ptr_(x) else: def impl(x, index=None): return heavydb_buffer_ptr_item_get_ptr_(x, index) return impl if isinstance(x, BufferType): if cgutils.is_nonelike(index): def impl(x, index=None): return heavydb_buffer_get_ptr_(x) else: raise NotImplementedError(f'heavydb_buffer_item_get_ptr_({x}, {index})') return impl @extending.intrinsic def heavydb_buffer_ptr_len_(typingctx, data): sig = types.int64(data) def codegen(context, builder, signature, args): data, = args rawptr = cgutils.alloca_once_value(builder, value=data) struct = builder.load(builder.gep(rawptr, [int32_t(0)])) return builder.load(builder.gep( struct, [int32_t(0), int32_t(1)])) return sig, codegen @extending.intrinsic def heavydb_buffer_len_(typingctx, data): sig = types.int64(data) def codegen(context, builder, signature, args): data, = args return irutils.get_member_value(builder, data, 1) return sig, codegen @extending.overload(len) def heavydb_buffer_len(x): if isinstance(x, BufferPointer): return lambda x: heavydb_buffer_ptr_len_(x) if isinstance(x, BufferType): return lambda x: heavydb_buffer_len_(x) @extending.intrinsic def heavydb_buffer_ptr_getitem_(typingctx, data, index): sig = data.eltype(data, index) def codegen(context, builder, signature, args): data, index = args rawptr = cgutils.alloca_once_value(builder, value=data) buf = builder.load(builder.gep(rawptr, [int32_t(0)])) ptr = builder.load(builder.gep( buf, [int32_t(0), int32_t(0)])) res = builder.load(builder.gep(ptr, [index])) return res return sig, codegen @extending.intrinsic def heavydb_buffer_getitem_(typingctx, data, index): eltype = data.eltype sig = eltype(data, index) def codegen(context, builder, signature, args): data, index = args ptr = irutils.get_member_value(builder, data, 0) res = builder.load(builder.gep(ptr, [index])) return res return sig, codegen @extending.overload(operator.getitem) def heavydb_buffer_getitem(x, i): if isinstance(x, BufferPointer): return lambda x, i: heavydb_buffer_ptr_getitem_(x, i) if isinstance(x, BufferType): return lambda x, i: heavydb_buffer_getitem_(x, i) # [rbc issue-197] Numba promotes operations like # int32(a) + int32(b) to int64 def truncate_cast_or_extend(builder, value, typ, signed): def _cast(builder, value, typ, signed): fn = { # unsigned int := float (ir.IntType, ir.FloatType, False): builder.uitofp, (ir.IntType, ir.DoubleType, False): builder.uitofp, # signed int := float (ir.IntType, ir.FloatType, True): builder.sitofp, (ir.IntType, ir.DoubleType, True): builder.sitofp, # float := unsigned int (ir.FloatType, ir.IntType, False): builder.fptoui, (ir.DoubleType, ir.IntType, False): builder.fptoui, # float := signed int (ir.FloatType, ir.IntType, True): builder.fptosi, (ir.DoubleType, ir.IntType, True): builder.fptosi, }[(type(value.type), type(typ), signed)] return fn(value, typ) def _truncate(builder, value, typ, signed): if isinstance(typ, ir.IntType): fn = builder.trunc else: fn = builder.fptrunc return fn(value, typ) def _extend(builder, value, typ, signed): if isinstance(typ, ir.IntType): fn = builder.zext if signed else builder.sext else: fn = builder.fpext return fn(value, typ) if not isinstance(value.type, (ir.IntType, ir.FloatType, ir.DoubleType)): raise errors.NumbaTypeError('Can only truncate, cast or extend int, float or double') if value.type.__class__ != typ.__class__ and \ ir.IntType in (value.type.__class__, typ.__class__): value = _cast(builder, value, typ, signed) if isinstance(value.type, ir.IntType): if value.type.width < typ.width: return _extend(builder, value, typ, signed) elif value.type.width > typ.width: return _truncate(builder, value, typ, signed) elif isinstance(value.type, ir.FloatType): if isinstance(typ, ir.DoubleType): return _extend(builder, value, typ, signed) elif isinstance(value.type, ir.DoubleType): if isinstance(typ, ir.FloatType): return _truncate(builder, value, typ, signed) return value @extending.intrinsic def heavydb_buffer_ptr_setitem_(typingctx, data, index, value): sig = types.none(data, index, value) signed = value.signed if isinstance(value, types.Integer) else True def codegen(context, builder, signature, args): zero = int32_t(0) data, index, value = args rawptr = cgutils.alloca_once_value(builder, value=data) ptr = builder.load(rawptr) buf = builder.load(builder.gep(ptr, [zero, zero])) value = truncate_cast_or_extend(builder, value, buf.type.pointee, signed) builder.store(value, builder.gep(buf, [index])) return sig, codegen @extending.intrinsic def heavydb_buffer_setitem_(typingctx, data, index, value): sig = types.none(data, index, value) signed = value.signed if isinstance(value, types.Integer) else True def codegen(context, builder, signature, args): data, index, value = args ptr = irutils.get_member_value(builder, data, 0) value = truncate_cast_or_extend(builder, value, ptr.type.pointee, signed) builder.store(value, builder.gep(ptr, [index])) return sig, codegen @extending.overload(operator.setitem) def heavydb_buffer_setitem(a, i, v): if isinstance(a, BufferPointer): return lambda a, i, v: heavydb_buffer_ptr_setitem_(a, i, v) if isinstance(a, BufferType): return lambda a, i, v: heavydb_buffer_setitem_(a, i, v) @extending.intrinsic def heavydb_buffer_is_null_(typingctx, data): sig = types.int8(data) def codegen(context, builder, sig, args): rawptr = cgutils.alloca_once_value(builder, value=args[0]) ptr = builder.load(rawptr) return builder.load(builder.gep(ptr, [int32_t(0), int32_t(2)])) return sig, codegen @extending.intrinsic def heavydb_buffer_set_null_(typingctx, data): sig = types.none(data) def codegen(context, builder, sig, args): rawptr = cgutils.alloca_once_value(builder, value=args[0]) ptr = builder.load(rawptr) builder.store(int8_t(1), builder.gep(ptr, [int32_t(0), int32_t(2)])) return sig, codegen @extending.intrinsic def heavydb_buffer_idx_is_null_(typingctx, col_var, row_idx): T = col_var.eltype sig = types.boolean(col_var, row_idx) target_info = TargetInfo() null_value = target_info.null_values[str(T)] # The server sends numbers as unsigned values rather than signed ones. # Thus, 129 should be read as -127 (overflow). See rbc issue #254 nv = ir.Constant(ir.IntType(T.bitwidth), null_value) def codegen(context, builder, signature, args): ptr, index = args data = builder.extract_value(builder.load(ptr), [0]) res = builder.load(builder.gep(data, [index])) if isinstance(T, types.Float): res = builder.bitcast(res, nv.type) return builder.icmp_signed('==', res, nv) return sig, codegen # "BufferPointer.is_null" checks if a given array or column is null # as opposed to "BufferType.is_null" that checks if an index in a # column is null @extending.overload_method(BufferPointer, 'is_null') def heavydb_buffer_is_null(x,
from __future__ import division from . import _breaks import itertools import math class Classifier(object): def __init__(self, items, breaks, classvalues, key=None, **kwargs): self.items = items if isinstance(breaks, bytes): algo = breaks breaks = None else: algo = "custom" breaks = breaks self.algo = algo self.breaks = breaks self.classvalues = classvalues # the raw preinterpolated valuestops of the classvalues self.key = key self.kwargs = kwargs self.classvalues_interp = None # the final interpolated classvalues self.update() def __repr__(self): import pprint metadict = dict(algo=self.algo, breaks=self.breaks, classvalues_interp=self.classvalues_interp) return "Classifier object:\n" + pprint.pformat(metadict, indent=4) def update(self): # force update/calculate breaks and class values # mostly used internally, though can be used to recalculate if self.algo == "unique": self.classvalues_interp = self.classvalues elif self.algo == "proportional": self.classvalues_interp = [self.classvalues[0], self.classvalues[-1]] items,values = zip(*rescale(self.items, newmin=self.classvalues_interp[0], newmax=self.classvalues_interp[-1], key=self.key, **self.kwargs)) itemvals = [self.key(item) for item in items] if self.classvalues_interp[0] < self.classvalues_interp[-1]: minval,maxval = min(itemvals), max(itemvals) else: minval,maxval = max(itemvals), min(itemvals) self.breaks = [minval,maxval] else: if self.algo != "custom": self.breaks = breaks(items=self.items, algorithm=self.algo, key=self.key, **self.kwargs) self.classvalues_interp = class_values(len(self.breaks)-1, # -1 because break values include edgevalues so will be one more in length self.classvalues) def __iter__(self): # loop and yield items along with their classnum and classvalue if self.algo == "unique": if isinstance(self.classvalues_interp, dict): # only return specified uniqueval-classval pairs for uid,subitems in unique(self.items, key=self.key, **self.kwargs): if uid in self.classvalues_interp: classval = self.classvalues_interp[uid] for item in subitems: yield item,classval else: # eternally iterate over classvalues for each unique value def classvalgen (): while True: for classval in self.classvalues_interp: yield classval classvalgen = classvalgen() for uid,subitems in unique(self.items, key=self.key, **self.kwargs): classval = next(classvalgen) for item in subitems: yield item,classval elif self.algo == "proportional": for item,newval in rescale(self.items, newmin=self.classvalues_interp[0], newmax=self.classvalues_interp[-1], key=self.key, **self.kwargs): yield item,newval else: for valrange,subitems in split(self.items, self.breaks, key=self.key, **self.kwargs): midval = (valrange[0] + valrange[1]) / 2.0 classinfo = self.find_class(midval) if classinfo is not None: classnum,_ = classinfo classval = self.classvalues_interp[classnum-1] # index is zero-based while find_class returns 1-based for item in subitems: yield item,classval def find_class(self, value): return find_class(value, self.breaks) ################################ def find_class(value, breaks): """ Given a set of breakpoints, calculate which two breakpoints an input value is located between, returning the class number (1 as the first class) and the two enclosing breakpoint values. A value that is not between any of the breakpoints, ie larger or smaller than the break endpoints, is considered to be a miss and returns None. """ prevbrk = breaks[0] classnum = 1 for nextbrk in breaks[1:]: if eval(bytes(prevbrk)) <= eval(bytes(value)) <= eval(bytes(nextbrk)): return classnum, (prevbrk,nextbrk) prevbrk = nextbrk classnum += 1 else: # Value was not within the range of the break points return None def class_values(classes, valuestops): """ Return x number of class values linearly interpolated between a minimum and maximum value. - classes: Number of classes values to return. - valuestops: can be either a single number or sequences of numbers where a classvalue will be interpolated for each sequence number, and so all sequences must be equally long. Thus, specifying the valuestops as rgb color tuples will create interpolated color gradients. """ # special case if classes <= 1: #raise Exception("Number of classes must be higher than 1") return [valuestops[0]] if len(valuestops) < 2: raise Exception("There must be at least two items in valuestops for interpolating between") def _lerp(val, oldfrom, oldto, newfrom, newto): oldrange = oldto - oldfrom relval = (val - oldfrom) / float(oldrange) newrange = newto - newfrom newval = newfrom + newrange * relval return newval # determine appropriate interp func for either sequenes or single values if all(hasattr(valstop, "__iter__") for valstop in valuestops): _len = len(valuestops[0]) if any(len(valstop) != _len for valstop in valuestops): raise Exception("If valuestops are sequences they must all have the same length") def _interpfunc(val): relindex = _lerp(classnum, 0, classes-1, 0, len(valuestops)-1) fromval = valuestops[int(math.floor(relindex))] toval = valuestops[int(math.ceil(relindex))] classval = [_lerp(relindex, int(relindex), int(relindex+1), ifromval, itoval) for ifromval,itoval in zip(fromval,toval)] return classval else: def _interpfunc(classnum): relindex = _lerp(classnum, 0, classes-1, 0, len(valuestops)-1) fromval = valuestops[int(math.floor(relindex))] toval = valuestops[int(math.ceil(relindex))] classval = _lerp(relindex, int(relindex), int(relindex+1), fromval, toval) return classval # perform classvalues = [] for classnum in range(classes): classval = _interpfunc(classnum) classvalues.append(classval) return classvalues def breaks(items, algorithm, key=None, extrabreaks=None, exclude=None, minval=None, maxval=None, **kwargs): """ Only get the break points, including the start and endpoint. """ # ensure values are numeric def forcenumber(val): try: val = float(val) return val except: return None # sort by key if key: keywrap = lambda x: forcenumber(key(x)) else: keywrap = forcenumber items = (item for item in items if keywrap(item) is not None) if exclude is not None: if not isinstance(exclude, (list,tuple)): exclude = [exclude] items = (item for item in items if keywrap(item) not in exclude) if minval is not None: items = (item for item in items if keywrap(item) >= minval) if maxval is not None: items = (item for item in items if keywrap(item) <= maxval) items = sorted(items, key=keywrap) values = [keywrap(item) for item in items] # get breaks func = _breaks.__dict__[algorithm] breaks = func(values, **kwargs) # insert extra breaks (list of single break values or pairs) if extrabreaks: for val in extrabreaks: oldbreaks = list(breaks) # insert single break value anywhere after first same or greater breakpoint # (remember that duplicate breakpoints will collect only that specific value) prevbrk = oldbreaks[0] i = 0 for nextbrk in oldbreaks[1:]: if prevbrk <= val < nextbrk: breaks.insert(i, val) break else: prevbrk = nextbrk i += 1 return breaks def split(items, breaks, key=None, exclude=None, minval=None, maxval=None, **kwargs): """ Splits a list of items into n non-overlapping classes based on the specified algorithm. Values are either the items themselves or a value extracted from the item using the key function. Arguments: - **items**: The list of items or values to classify. - **breaks**: List of custom break values, or the name of the algorithm to use. Valid names are: - histogram (alias for equal) - equal - quantile - pretty - stdev - natural - headtail - log (base-10, uses offset to handle 0s but not negative numbers) - **key** (optional): Function used to extract value from each item, defaults to None and treats item itself as the value. - **classes** (optional): The number of classes to group the items into. - more... Returns: - All the input items reorganized into the groups/classes that they belong to, as a list of lists of items. """ # ensure values are numeric def forcenumber(val): try: val = float(val) return val except: return None # sort and get key if key: keywrap = lambda x: forcenumber(key(x)) else: keywrap = forcenumber items = (item for item in items if keywrap(item) is not None) if exclude is not None: if not isinstance(exclude, (list,tuple)): exclude = [exclude] items = (item for item in items if keywrap(item) not in exclude) if minval is not None: items = (item for item in items if keywrap(item) >= minval) if maxval is not None: items = (item for item in items if keywrap(item) <= maxval) items = sorted(items, key=keywrap) values = [keywrap(item) for item in items] # if not custom specified, get break values from algorithm name if isinstance(breaks, bytes): func = _breaks.__dict__[breaks] breaks = func(values, **kwargs) else: # custom specified breakpoints breaks = list(breaks) breaks_gen = (brk for brk in breaks) loopdict = dict() loopdict["prevbrk"] = next(breaks_gen) loopdict["nextbrk"] = next(breaks_gen) def find_class(item, loopdict=loopdict): val = keywrap(item) ## while eval(bytes(val)) > eval(bytes(loopdict["nextbrk"])): ## loopdict["prevbrk"] = loopdict["nextbrk"] ## loopdict["nextbrk"] = next(breaks_gen) ## if eval(bytes(loopdict["prevbrk"])) <= eval(bytes(val)) <= eval(bytes(loopdict["nextbrk"])): ## return loopdict["prevbrk"],loopdict["nextbrk"] ## if eval(bytes(val)) < loopdict["prevbrk"]: ## # value lower than first class ## return None ## else: ## while not (eval(bytes(loopdict["prevbrk"])) <= eval(bytes(val)) <= eval(bytes(loopdict["nextbrk"]))): ## print eval(bytes(loopdict["prevbrk"])) , eval(bytes(val)) , eval(bytes(loopdict["nextbrk"])) ## # increment breaks until value is between ## loopdict["prevbrk"] = loopdict["nextbrk"] ## loopdict["nextbrk"] = next(breaks_gen, None) ## if loopdict["nextbrk"] == None: ## return None ## #
<filename>species/analysis/fit_model.py<gh_stars>0 """ Module with functionalities for fitting atmospheric model spectra. """ import os import math import warnings from typing import Optional, Union, List, Tuple, Dict from multiprocessing import Pool, cpu_count import emcee import numpy as np import spectres from scipy import stats try: import ultranest except: warnings.warn( "UltraNest could not be imported. Perhaps " "because cython was not correctly compiled?" ) try: import pymultinest except: warnings.warn( "PyMultiNest could not be imported. " "Perhaps because MultiNest was not build " "and/or found at the LD_LIBRARY_PATH " "(Linux) or DYLD_LIBRARY_PATH (Mac)?" ) from typeguard import typechecked from species.analysis import photometry from species.data import database from species.core import constants from species.read import read_model, read_object, read_planck, read_filter from species.util import read_util, dust_util warnings.filterwarnings("always", category=DeprecationWarning) @typechecked def lnprior( param: np.ndarray, bounds: dict, param_index: Dict[str, int], prior: Optional[Dict[str, Tuple[float, float]]] = None, ): """ Internal function for calculating the log prior. Parameters ---------- param : np.ndarray Parameter values. bounds : dict Dictionary with the parameter boundaries. param_index : dict(str, int) Dictionary with the parameter indices of ``param``. prior : dict(str, tuple(float, float)), None Dictionary with Gaussian priors for one or multiple parameters. The prior can be set for any of the atmosphere or calibration parameters, e.g. ``prior={'teff': (1200., 100.)}``. Additionally, a prior can be set for the mass, e.g. ``prior={'mass': (13., 3.)}`` for an expected mass of 13 Mjup with an uncertainty of 3 Mjup. The parameter is not used if set to ``None``. Returns ------- floats Log prior. """ ln_prior = 0 for key, value in bounds.items(): if value[0] <= param[param_index[key]] <= value[1]: ln_prior += 0.0 else: ln_prior = -np.inf break if prior is not None: for key, value in prior.items(): if key == "mass": mass = read_util.get_mass( param[param_index["logg"]], param[param_index["radius"]] ) ln_prior += -0.5 * (mass - value[0]) ** 2 / value[1] ** 2 else: ln_prior += ( -0.5 * (param[param_index[key]] - value[0]) ** 2 / value[1] ** 2 ) return ln_prior @typechecked def lnlike( param: np.ndarray, bounds: dict, param_index: Dict[str, int], model: str, objphot: List[Optional[np.ndarray]], distance: Tuple[float, float], spectrum: Optional[dict], modelphot: Optional[ Union[List[read_model.ReadModel], List[photometry.SyntheticPhotometry]] ], modelspec: Optional[List[read_model.ReadModel]], n_planck: int, fit_corr: List[str], ): """ Internal function for calculating the log likelihood. Parameters ---------- param : np.ndarray Parameter values. bounds : dict Dictionary with the parameter boundaries. param_index : dict(str, int) Dictionary with the parameter indices of ``param``. model : str Atmosphere model (e.g. 'bt-settl', 'exo-rem', or 'planck). objphot : list(np.ndarray) List with the photometric fluxes and uncertainties of the object. Not photometric data is fitted if an empty list is provided. distance : tuple(float, float) Distance and uncertainty (pc). spectrum : dict(str, tuple(np.ndarray, np.ndarray, np.ndarray, float)), None Dictionary with the spectra stored as wavelength (um), flux (W m-2 um-1), and error (W m-2 um-1). Optionally the covariance matrix, the inverse of the covariance matrix, and the spectral resolution are included. Each of these three elements can be set to ``None``. No spectroscopic data is fitted if ``spectrum=None``. modelphot : list(species.read.read_model.ReadModel), list(species.analysis.photometry.SyntheticPhotometry), None List with the interpolated synthetic fluxes or list with the :class:`~species.analysis.photometry.SyntheticPhotometry` objects for calculation of synthetic photometry for Planck spectra. No photometry is fitted if set to ``None``. modelspec : list(species.read.read_model.ReadModel), None List with the interpolated synthetic spectra. n_planck : int Number of Planck components. The argument is set to zero if ``model`` is not equal to ``'planck'``. fit_corr : list(str) List with spectrum names for which the covariances are modeled with a Gaussian process (see Wang et al. 2020). This option can be used if the actual covariances as determined from the data are not available. The parameters that will be fitted are the correlation length and fractional amplitude. Returns ------- float Log likelihood. """ param_dict = {} spec_scaling = {} err_scaling = {} corr_len = {} corr_amp = {} for item in bounds: if item[:8] == "scaling_" and item[8:] in spectrum: spec_scaling[item[8:]] = param[param_index[item]] elif item[:6] == "error_" and item[6:] in spectrum: err_scaling[item[6:]] = param[param_index[item]] elif item[:9] == "corr_len_" and item[9:] in spectrum: corr_len[item[9:]] = 10.0 ** param[param_index[item]] # (um) elif item[:9] == "corr_amp_" and item[9:] in spectrum: corr_amp[item[9:]] = param[param_index[item]] else: param_dict[item] = param[param_index[item]] if model == "planck": param_dict["distance"] = param[param_index["distance"]] else: flux_scaling = (param_dict["radius"] * constants.R_JUP) ** 2 / ( param_dict["distance"] * constants.PARSEC ) ** 2 # The scaling is applied manually because of the interpolation del param_dict["radius"] for item in spectrum: if item not in spec_scaling: spec_scaling[item] = 1.0 if item not in err_scaling: err_scaling[item] = None ln_like = 0.0 if model == "planck" and n_planck > 1: for i in range(n_planck - 1): if param_dict[f"teff_{i+1}"] > param_dict[f"teff_{i}"]: return -np.inf if param_dict[f"radius_{i}"] > param_dict[f"radius_{i+1}"]: return -np.inf for i, obj_item in enumerate(objphot): if model == "planck": readplanck = read_planck.ReadPlanck(filter_name=modelphot[i].filter_name) phot_flux = readplanck.get_flux(param_dict, synphot=modelphot[i])[0] else: phot_flux = modelphot[i].spectrum_interp(list(param_dict.values())) phot_flux *= flux_scaling if obj_item.ndim == 1: ln_like += -0.5 * (obj_item[0] - phot_flux) ** 2 / obj_item[1] ** 2 else: for j in range(obj_item.shape[1]): ln_like += ( -0.5 * (obj_item[0, j] - phot_flux) ** 2 / obj_item[1, j] ** 2 ) for i, item in enumerate(spectrum.keys()): # Calculate or interpolate the model spectrum if model == "planck": # Calculate a blackbody spectrum readplanck = read_planck.ReadPlanck( (0.9 * spectrum[item][0][0, 0], 1.1 * spectrum[item][0][-1, 0]) ) model_box = readplanck.get_spectrum(param_dict, 1000.0, smooth=True) # Resample the spectrum to the observed wavelengths model_flux = spectres.spectres( spectrum[item][0][:, 0], model_box.wavelength, model_box.flux ) else: # Interpolate the model spectrum model_flux = modelspec[i].spectrum_interp(list(param_dict.values()))[0, :] # Scale the spectrum by the (radius/distance)^2 model_flux *= flux_scaling # Scale the spectrum data data_flux = spec_scaling[item] * spectrum[item][0][:, 1] if err_scaling[item] is None: # Variance without error inflation data_var = spectrum[item][0][:, 2] ** 2 else: # Variance with error inflation (see Piette & Madhusudhan 2020) data_var = ( spectrum[item][0][:, 2] ** 2 + (err_scaling[item] * model_flux) ** 2 ) if spectrum[item][2] is not None: # The inverted covariance matrix is available if err_scaling[item] is None: # Use the inverted covariance matrix directly data_cov_inv = spectrum[item][2] else: # Ratio of the inflated and original uncertainties sigma_ratio = np.sqrt(data_var) / spectrum[item][0][:, 2] sigma_j, sigma_i = np.meshgrid(sigma_ratio, sigma_ratio) # Calculate the inverted matrix of the inflated covariances data_cov_inv = np.linalg.inv(spectrum[item][1] * sigma_i * sigma_j) if spectrum[item][2] is not None: # Calculate the log-likelihood with the covariance matrix dot_tmp = np.dot( data_flux - model_flux, np.dot(data_cov_inv, data_flux - model_flux) ) ln_like += -0.5 * dot_tmp - 0.5 * np.nansum(np.log(2.0 * np.pi * data_var)) else: if item in fit_corr: # Calculate the log-likelihood with the # covariance model (see Wang et al. 2020) wavel = spectrum[item][0][:, 0] # (um) wavel_j, wavel_i = np.meshgrid(wavel, wavel) error = np.sqrt(data_var) # (W m-2 um-1) error_j, error_i = np.meshgrid(error, error) cov_matrix = ( corr_amp[item] ** 2 * error_i * error_j * np.exp(-((wavel_i - wavel_j) ** 2) / (2.0 * corr_len[item] ** 2)) + (1.0 - corr_amp[item] ** 2) * np.eye(wavel.shape[0]) * error_i ** 2 ) dot_tmp = np.dot( data_flux - model_flux, np.dot(np.linalg.inv(cov_matrix), data_flux - model_flux), ) ln_like += -0.5 * dot_tmp - 0.5 * np.nansum( np.log(2.0 * np.pi * data_var) ) else: # Calculate the log-likelihood without the covariance matrix but with the # normalization term in case of the errors are inflated ln_like += np.nansum( -0.5 * (data_flux - model_flux) ** 2 / data_var - 0.5 * np.log(2.0 * np.pi * data_var) ) return ln_like @typechecked def lnprob( param: np.ndarray, bounds: dict, model: str, param_index: Dict[str, int], objphot: List[Optional[np.ndarray]], distance: Tuple[float, float], prior: Optional[Dict[str, Tuple[float, float]]], spectrum: Optional[dict], modelphot: Optional[ Union[List[read_model.ReadModel], List[photometry.SyntheticPhotometry]] ], modelspec: Optional[List[read_model.ReadModel]], n_planck: int, fit_corr: List[str], ) -> np.float64: """ Internal function for calculating the log posterior. Parameters ---------- param : np.ndarray Parameter values. bounds : dict Parameter boundaries. model : str Atmosphere model (e.g. 'bt-settl', 'exo-rem', or 'planck). param_index : dict(str, int) Dictionary with the parameter indices of ``param``. objphot : list(np.ndarray), None List with the photometric fluxes and uncertainties. No photometric data is fitted if the parameter is set to ``None``. distance : tuple(float, float) Distance and uncertainty (pc). prior : dict(str, tuple(float, float)), None Dictionary with Gaussian priors for
#!/usr/bin/env python import matplotlib matplotlib.use('TkAgg') from numpy import arange, sin, pi,log10,max,min,cos,isnan, meshgrid,sqrt,abs from matplotlib.backends.backend_tkagg import FigureCanvasTkAgg,NavigationToolbar2TkAgg from matplotlib.figure import Figure import pyPLUTO as pp import string import time from Tkinter import * import sys import os class App: def __init__(self,master): # create toplevel window frame = Frame(master) frame.grid(ipadx=10,ipady=10) try: sys.argv[1] except: self.datatype = None else: self.datatype = sys.argv[1].split('--')[1] if self.datatype == 'hdf5': print "GUI currently doesnot support pyPLUTO AMR Reader!!" sys.exit() self.I = pp.Image() self.Tool = pp.Tools() self.lb1=Label(frame, text="Nstep").grid(row=0,column=0) self.enstep = Entry(frame,width=8) self.enstep.grid(row=0,column=1) self.enstep.insert(0, "0") self.LoadedNstep = StringVar() self.PresentTime = StringVar() self.myData = self.loaddata() self.varkeys = self.myData.vars self.wdir = self.myData.wdir if self.myData.n3 != 1: self.Geom = '3D' elif self.myData.n3 == 1 and self.myData.n2 != 1: self.Geom = '2D' else: self.Geom = '1D' self.ldatabutton=Button(frame,text="Load data",command=self.loaddata) self.ldatabutton.grid(row=0,column=2) ############### MARK THE CUTS ################################# self.ex1 = Entry(frame,width=5) self.ex1.grid(row=2,column=0) self.ex1.insert(0, "x1") self.ex2 = Entry(frame,width=5) self.ex2.grid(row=2,column=1) self.ex2.insert(0, "x2") self.ex3 = Entry(frame,width=5) self.ex3.grid(row=2,column=2) self.ex3.insert(0, "x3") if self.Geom == '2D': self.ex3.config(state='disabled') if self.Geom == '1D': self.ex3.config(state='disabled') self.ex2.config(state='disabled') self.ex1.config(state='disabled') # place a graph somewhere here self.f = Figure(figsize=(7,7), dpi=100) self.a = self.f.add_subplot(111) self.canvas = FigureCanvasTkAgg(self.f, master=root) self.canvas.show() self.canvas.get_tk_widget().grid(row=0,column=3,columnspan=10,rowspan=10,sticky=E) #self.toolbar = NavigationToolbar2TkAgg(self.canvas,tl) #self.toolbar.update() #self.canvas._tkcanvas.grid(row=60,column=15,sticky=E) self.v = StringVar() self.v.set("None") ################ VARIABLES TO PLOT ################################# for i in ['bx1s', 'bx2s', 'bx3s']: try: self.varkeys.remove(i) except ValueError: pass for j in range(len(self.varkeys)): self.ldata = Radiobutton(frame,text=self.varkeys[j],variable=self.v,value=self.varkeys[j],command=self.getmyvar) self.ldata.grid(row=3+j,column=0,sticky=W) ################ SLICES CHOICE ################################# self.slvar = StringVar() self.slvar.set("Choose Slice") if self.Geom == '3D' : SliceList = ("Along x1","Along x2","Along x3","Along x1-x2","Along x2-x3","Along x3-x1") elif self.Geom == '2D' : SliceList = ("Along x1", "Along x2", "Along x1-x2") else: SliceList = () for j in range(len(SliceList)): self.sldata = Radiobutton(frame,text=SliceList[j],variable=self.slvar,value=SliceList[j],command=self.setslice) self.sldata.grid(row=3+j,column=1,sticky=W) ############### PLOT PROPERTIES ################################# self.logvar = IntVar() self.chkb = Checkbutton(frame,text="Log ",variable=self.logvar,onvalue=1,offvalue=0,command=self.logchkcall) self.chkb.grid(row=3,column=2,sticky=W)#(row=15,column=0,sticky=W) self.polarvar = IntVar() self.polchkb = Checkbutton(frame,text="Polar",variable=self.polarvar,onvalue=1,offvalue=0,command=self.polchkcall) self.polchkb.grid(row=4,column=2,sticky=W)#(row=15,column=1) if self.Geom == '1D': self.polchkb.config(state='disabled') self.polarvar.set(0) self.preaspect = IntVar() self.aspectb = Checkbutton(frame,text="Aspect",variable=self.preaspect,onvalue=1,offvalue=0,command=self.aspchkcall) self.aspectb.grid(row=5,column=2,sticky=W)#(row=15,column=2) if self.Geom == '1D': self.aspectb.config(state='disabled') ################ X and Y LABELS ################################# self.lb2=Label(frame,text="Labels").grid(row=22,column=0) self.xlb = Entry(frame,width=15) self.xlb.grid(row=22,column=1) self.xlb.insert(0, "xlabel") self.ylb = Entry(frame,width=15) self.ylb.grid(row=22,column=2) self.ylb.insert(0, "ylabel") ############### X and Y RANGE####################### self.lb2a=Label(frame,text="XRange").grid(row=24,column=0) self.lb2b=Label(frame,text="YRange").grid(row=26,column=0) self.lb2c=Label(frame,text="VarRange").grid(row=28,column=0) self.xrmin = Entry(frame,width=15) self.xrmin.grid(row=24,column=1) self.xrmin.insert(0,'') self.xrmax = Entry(frame,width=15) self.xrmax.grid(row=24,column=2) self.xrmax.insert(0,'') self.yrmin = Entry(frame,width=15) self.yrmin.grid(row=26,column=1) self.yrmin.insert(0,'') self.yrmax = Entry(frame,width=15) self.yrmax.grid(row=26,column=2) self.yrmax.insert(0,'') self.varmin = Entry(frame,width=15) self.varmin.grid(row=28,column=1) self.varmin.insert(0,'') self.varmax = Entry(frame,width=15) self.varmax.grid(row=28,column=2) self.varmax.insert(0,'') if self.Geom == '1D': self.yrmin.config(state='disabled') self.yrmax.config(state='disabled') ################ CONTOURS ################################# self.lb3=Label(frame,text="Contours").grid(row=16,column=0) self.contvar = IntVar() self.chkb = Checkbutton(frame,text="Contour",variable=self.contvar,onvalue=1,offvalue=0,command=self.contchkcall) self.chkb.grid(row=6,column=2,sticky=W)#(row=16,column=0,sticky=W) self.plcont = StringVar() self.contkeys = ["None"] if "bx3" in self.varkeys: for item in self.varkeys: self.contkeys.append(item) self.contkeys.append("x1*bx3") if "Ax3" in self.varkeys: self.contkeys.append("x1*Ax3") else: for item in self.varkeys: self.contkeys.append(item) self.plcont.set("None") self.contmenu = OptionMenu(frame, self.plcont,*self.contkeys) self.contmenu.grid(row=16,column=1) self.xlevb = Entry(frame,width=15) self.xlevb.grid(row=16,column=2,sticky=W) self.xlevb.insert(0, "Levels") self.xlevb.config(state='disabled') self.contmenu.config(state='disabled') if self.Geom == '1D': self.chkb.config(state = 'disabled') ################ ARROWS ################################# self.lb4=Label(frame,text="Arrows").grid(row=19,column=0) self.arrowvar = IntVar() self.arrowchkb = Checkbutton(frame,text="Arrows",variable=self.arrowvar,onvalue=1,offvalue=0,command=self.arrchkcall) self.arrowchkb.grid(row=7,column=2,sticky=W)#(row=16,column=0,sticky=W) self.arrspb = Entry(frame,width=15) self.arrspb.grid(row=19,column=2,sticky=W) self.arrspb.insert(0, "20") self.plarr = StringVar() self.arrkeys = ["None"] self.arrkeys.append("Vp") self.arrkeys.append("Vp_norm") if "bx1" in self.varkeys: self.arrkeys.append("Bp") self.arrkeys.append("Bp_norm") self.plarr.set("None") self.arrmenu = OptionMenu(frame,self.plarr,*self.arrkeys) self.arrmenu.grid(row=19,column=1) self.arrmenu.config(state='disabled') self.arrspb.config(state='disabled') if self.Geom == '1D': self.arrowchkb.config(state = 'disabled') ################ VARIOUS PLOTTING BUTTONS ################################# self.pltbutton=Button(frame,text="Plot",command=self.plotfinal) self.pltbutton.grid(row=36,column=0) if self.Geom == '1D': self.pltbutton.config(state='active') else: self.pltbutton.config(state='disabled') self.surfbutton=Button(frame,text="Surface",command=self.plotsurface) self.surfbutton.grid(row=36,column=1) self.surfbutton.config(state='disabled') #if self.Geom == '1D': # self.surfbutton.config(state='disabled') self.clrbutton=Button(frame,text="Clear",command=self.plotclear) self.clrbutton.grid(row=36,column=2) ################ INFORMATION ################################# self.lbinf0 = Label(frame,text="Information",font=("Times",12,"bold")) self.lbinf0.grid(row=47,column=0,sticky=W,columnspan=3) self.lbinf1a = Label(frame,text="Dir :",font=("Times",10,"bold")).grid(row=49,column=0,sticky=W,columnspan=3) self.lbinf1 = Label(frame,text=self.wdir).grid(row=50,column=0,sticky=W,columnspan=3) self.lbinf2a = Label(frame,text="Domain :",font=("Times",10,"bold")).grid(row=51,column=0,sticky=W,columnspan=3) self.lbinf2 = Label(frame,text="n1 x n2 x n3 = %d x %d x %d " % (self.myData.n1,self.myData.n2,self.myData.n3)).grid(row=52,column=0,sticky=W,columnspan=3) self.lbinf3a = Label(frame,text="Time Status",font=("Times",10,"bold")).grid(row=53,column=0,sticky=W,columnspan=3) self.lbinf4 = Label(frame,text="Nlast = %d"% pp.nlast_info(w_dir=self.wdir,datatype=self.datatype)['nlast']).grid(row=54,column=0,sticky=W,columnspan=3) self.lbinf5 = Label(frame,textvariable = self.LoadedNstep).grid(row=55,column=0,sticky=W,columnspan=3) self.lbinf6 = Label(frame,textvariable = self.PresentTime).grid(row=56,column=0,sticky=W,columnspan=3) ################ VARIOUS FUNCTIONS ################################# def loaddata(self): try: int(self.enstep.get().strip().split()[0]) except (ValueError, IndexError): print "Specify the proper value of Nstep" else: mynstep=int(self.enstep.get()) self.D = pp.pload(mynstep,datatype=self.datatype) self.LoadedNstep.set("Loaded Nstep = "+self.enstep.get()) self.PresentTime.set("Present Time = "+str(self.D.SimTime) + " [cu]") return self.D def getmyvar(self): try: self.v.get() != "None" except KeyError: print "Specify the variable to plot" else: self.myvar=self.v.get() def logchkcall(self): self.logchk = self.logvar.get() def contchkcall(self): self.contchk = self.contvar.get() if self.contchk == 1: self.contmenu.config(state='normal') self.xlevb.config(state='normal') else: self.contmenu.config(state='disabled') self.xlevb.config(state='disabled') def arrchkcall(self): self.arrchk = self.arrowvar.get() if self.arrchk == 1: self.arrmenu.config(state='normal') self.arrspb.config(state='normal') else: self.arrmenu.config(state='disabled') self.arrspb.config(state='disabled') def aspchkcall(self): self.aspchk=self.preaspect.get() def polchkcall(self): self.polchk = self.polarvar.get() def setslice(self): self.slicename=self.slvar.get() if self.slicename == "Along x1" or self.slicename == "Along x2" or self.slicename == "Along x3": self.surfbutton.config(state='disabled') self.arrowchkb.config(state = 'disabled') self.arrowvar.set(0) self.chkb.config(state = 'disabled') self.contvar.set(0) self.pltbutton.config(state='active') self.polchkb.config(state='disabled') self.polarvar.set(0) else: self.pltbutton.config(state='disabled') self.arrowchkb.config(state = 'normal') self.chkb.config(state = 'normal') self.surfbutton.config(state='active') self.polchkb.config(state='normal') if self.slicename == "Along x2-x3": self.polchkb.config(state='disabled') self.polarvar.set(0) def plotclear(self): self.f.clf() self.a = self.f.add_subplot(111) self.canvas.show() def plotfinal(self): if self.getplotvar() == True: self.a.axis([self.getxaxisrange()[0],self.getxaxisrange()[1],self.getvarrange()[0],self.getvarrange()[1]]) self.a.plot(self.x,self.var) self.a.set_aspect('auto') self.a.set_xlabel(self.xlb.get()) self.a.set_ylabel(self.ylb.get()) self.canvas.show() def plotsurface(self): tdum = time.time() self.plotclear() if self.preaspect.get() == 1: self.a.set_aspect('equal') else: self.a.set_aspect('auto') if self.polarvar.get() == 1: if self.drawpolar() == True: self.a.axis([self.getxaxisrange()[0],self.getxaxisrange()[1],self.getyaxisrange()[0],self.getyaxisrange()[1]]) self.image = self.a.imshow(self.SphData[self.myvar], origin='lower',extent=self.extent, interpolation='nearest',cmap="jet", vmin=self.getvarrange()[0],vmax=self.getvarrange()[1]) self.f.colorbar(self.image) else: if self.getsurfvar() == True: self.a.axis([self.getxaxisrange()[0],self.getxaxisrange()[1],self.getyaxisrange()[0],self.getyaxisrange()[1]]) self.image=self.a.pcolormesh(self.x,self.y,self.var,cmap='jet',vmin=self.getvarrange()[0],vmax=self.getvarrange()[1]) self.f.colorbar(self.image) if self.contvar.get() == 1: try: self.plcont.get() != "None" except KeyError: print "Specify the variable for Contour" else: self.drawcontour() self.contlevlist=[] self.contlevstr = string.split(self.xlevb.get(),',') try: if self.contlevstr[0] == 'log': self.flevel = self.contlevstr[1] self.varcont = log10(self.varcont) else: self.flevel = self.contlevstr[0] float(self.flevel) self.contlevlist = [float(self.flevel)] except: self.contlevlist = 5 else: for j in range(1,len(self.contlevstr)): self.contlevlist.append(float(self.contlevstr[j])) self.cs1 = self.a.contour(self.xcont,self.ycont,self.varcont,self.contlevlist,colors="w") self.a.clabel(self.cs1,inline=True) if self.arrowvar.get() == 1: try: self.plarr.get() != "None" except KeyError: print "Specify the variable for plotting the arrow" else: self.drawarrow() self.a.quiver(self.xcong, self.ycong, self.xveccong, self.yveccong,color='w') self.a.set_xlabel(self.xlb.get()) self.a.set_ylabel(self.ylb.get()) self.canvas.show() def getvarrange(self): try: float(self.varmin.get()) except: if self.polarvar.get() != 1: self.varminval = min(self.var) else: self.varminval = min(self.SphData[self.myvar][self.isnotnan].flat)#self.minPl else: self.varminval = float(self.varmin.get()) try: float(self.varmax.get()) except: if self.polarvar.get() != 1: self.varmaxval = max(self.var) else: self.varmaxval = max(self.SphData[self.myvar][self.isnotnan].flat)#self.maxPl else: self.varmaxval = float(self.varmax.get()) return [self.varminval,self.varmaxval] def getxaxisrange(self): try: float(self.xrmin.get()) except: if self.polarvar.get() != 1: self.xminval = min(self.x) else: self.xminval = min(self.R.flat) else: self.xminval = float(self.xrmin.get()) try: float(self.xrmax.get()) except: if self.polarvar.get() != 1: self.xmaxval = max(self.x) else: self.xmaxval = max(self.R.flat) else: self.xmaxval = float(self.xrmax.get()) return [self.xminval,self.xmaxval] def getyaxisrange(self): try: float(self.yrmin.get()) except: if self.polarvar.get() != 1: self.yminval = min(self.y) else: self.yminval = min(self.Z.flat) else: self.yminval = float(self.yrmin.get()) try: float(self.yrmax.get()) except: if self.polarvar.get() != 1: self.ymaxval = max(self.y) else: self.ymaxval = max(self.Z.flat) else: self.ymaxval = float(self.yrmax.get()) return [self.yminval,self.ymaxval] def getplotvar(self): self.sucess = False if self.logvar.get() == 1: self.var = log10(self.D.__getattribute__(self.myvar)) else: self.var = self.D.__getattribute__(self.myvar) if self.Geom == '1D': self.x = self.D.x1 self.sucess = True else: if self.slicename == "Along x1": self.x = self.D.x1 if self.D.n3 == 1: try: int(self.ex2.get().strip().split()[0]) except (ValueError, IndexError): print "Specify the value of x2 cut" else: self.var = self.var[:,int(self.ex2.get())] self.sucess = True else: try: int(self.ex2.get().strip().split()[0]) int(self.ex3.get().strip().split()[0]) except (ValueError, IndexError): print "Specify the value of x2 or x3 cut" else: self.var = self.var[:,int(self.ex2.get()),int(self.ex3.get())] self.sucess = True elif self.slicename == "Along x2": self.x = self.D.x2 if self.D.n3 == 1: try: int(self.ex1.get().strip().split()[0]) except (ValueError, IndexError): print "Specify the value of x1 cut" else: self.var = self.var[int(self.ex1.get()),:] self.sucess = True else: try: int(self.ex1.get().strip().split()[0]) int(self.ex3.get().strip().split()[0]) except (ValueError, IndexError): print "Specify the value of x1 or x3 cut" else: self.var = self.var[int(self.ex1.get()),:,int(self.ex3.get())] self.sucess = True else: self.x = self.D.x3 try: int(self.ex1.get().strip().split()[0]) int(self.ex2.get().strip().split()[0]) except (ValueError, IndexError): print "Specify the value of x1 or x2 cut" else: self.var = self.var[int(self.ex1.get()),int(self.ex2.get()),:] self.sucess = True return self.sucess def getsurfvar(self): self.sucess = False if self.logvar.get() == 1: self.var = log10(self.D.__getattribute__(self.myvar)) else: self.var = self.D.__getattribute__(self.myvar) if self.slicename == "Along x1-x2": self.x = self.D.x1 self.y = self.D.x2 xmineed = (abs(self.x-self.getxaxisrange()[0])).argmin() xmaneed = (abs(self.x-self.getxaxisrange()[1])).argmin() ymineed = (abs(self.y-self.getyaxisrange()[0])).argmin() ymaneed = (abs(self.y-self.getyaxisrange()[1])).argmin() self.x = self.x[xmineed:xmaneed] self.y = self.y[ymineed:ymaneed] if self.D.n3 == 1: self.var = self.var[xmineed:xmaneed,ymineed:ymaneed].T self.sucess = True else: try: int(self.ex3.get().strip().split()[0]) except (ValueError, IndexError): print "Specify the value of x3 cut" else: self.var = self.var[xmineed:xmaneed,ymineed:ymaneed,int(self.ex3.get())].T self.sucess = True elif self.slicename == "Along x2-x3": self.x = self.D.x2 self.y = self.D.x3 xmineed = (abs(self.x-self.getxaxisrange()[0])).argmin() xmaneed = (abs(self.x-self.getxaxisrange()[1])).argmin() ymineed = (abs(self.y-self.getyaxisrange()[0])).argmin() ymaneed = (abs(self.y-self.getyaxisrange()[1])).argmin() self.x = self.x[xmineed:xmaneed] self.y = self.y[ymineed:ymaneed] try: int(self.ex1.get().strip().split()[0]) except (ValueError, IndexError): print "Specify the value of x1 cut" else: self.var = self.var[int(self.ex1.get()),xmineed:xmaneed,ymineed:ymaneed].T self.sucess = True else: self.x = self.D.x1 self.y = self.D.x3 xmineed = (abs(self.x-self.getxaxisrange()[0])).argmin() xmaneed = (abs(self.x-self.getxaxisrange()[1])).argmin() ymineed = (abs(self.y-self.getyaxisrange()[0])).argmin() ymaneed = (abs(self.y-self.getyaxisrange()[1])).argmin() self.x = self.x[xmineed:xmaneed]
<filename>cloudmesh/queue/jobqueue.py import json import multiprocessing import os import shlex import sys import time import uuid from dataclasses import dataclass from datetime import datetime from datetime import timedelta # from pathlib import Path from textwrap import dedent from typing import List import oyaml as yaml from cloudmesh.common.Host import Host as commonHost from cloudmesh.common.Printer import Printer from cloudmesh.common.Shell import Shell from cloudmesh.common.console import Console # from cloudmesh.common.parameter import Parameter from cloudmesh.common.util import banner from cloudmesh.common.util import is_local from cloudmesh.common.util import path_expand from cloudmesh.common.util import readfile from cloudmesh.common.util import str_banner from yamldb.YamlDB import YamlDB # from cloudmesh.common.variables import Variables # from cloudmesh.configuration.Configuration import Configuration Console.init() def sysinfo(): # this may already exist in common, if not it should be updated or integrated. """ Returns value of system user from environment variables :return: User name """ user = None if sys.platform == "win32": user = os.environ.get("USERNAME") hostname = os.environ.get("COMPUTERNAME") else: user = os.environ.get("USER") hostname = os.environ.get("HOSTNAME") cpus = multiprocessing.cpu_count() return user, hostname, cpus def _to_string(obj, msg): result = [str_banner(msg)] for field in obj.__dataclass_fields__: try: value = getattr(obj, field) result.append(f"{field:<20}: {value}") except: pass return "\n".join(result) + "\n" def _to_dict(obj): result = {} for field in obj.__dataclass_fields__: try: value = getattr(obj, field) result[str(field)] = value except: pass return result @dataclass class Job: """ The Job class creates a simple job that can be executed asynchronously on a remote computer using ssh. The status of the job is managed through a number of files that can be quered to identify its execution state. I job can be created as follows job = Job(name=f"job1", command="/usr/bin/sleep 120", user="user", host="host") it will create a n experiment directory where the job specification is located. To run it, it needs first to be syncronized and copied to the remote host. job.rsync() After this we can run it with job.run() Please note the the job runs asynchronously and you can probe its state with job.state Note this is a property and not a function for the user. The final state is called "end". Users can define their onw states and add them to the log file so custom actions could be called. To retrieve the CURRENT log file as a string you can use the functions job.get_log() To get the pid on the remote machine we can use job.pid Note that prior to running the command job.run(), the variable job.pid has the value None """ name: str = "TBD" id: str = str(uuid.uuid4().hex) experiment: str = "experiment" directory: str = None input: str = None output: str = None log: str = None status: str = "undefined" gpu: str = None arguments: str = "" executable: str = "" command: str = None shell: str = "bash" shell_path: str = None scriptname: str = None remote_command: str = None nohup_command: str = None # BUG: should this just be remote command? # we may not need to store the nohubcommand as it is # just internal # placement pid: str = None host: str = None user: str = None pyenv: str = None last_probe_check: str = None def __post_init__(self): #print(self.info()) #Console.ok(f"Creating: {self.name}") if self.input is None: self.input = f"{self.name}/input" if self.output is None: self.output = f"{self.name}.out" if self.log is None: self.log = f"{self.name}.log" if self.shell_path is None: self.shell_path = f"/usr/bin/{self.shell}" if self.command: self.set(self.command) if self.host and self.user and self.status == 'undefined': self.status = 'ready' if self.directory is None: self.directory = './' + self.experiment self.scriptname = f"{self.experiment}/{self.name}/{self.name}.{self.shell}" self.generate_command() self.generate_script(shell=self.shell) def ps(self): keys = ["pid", "user", "<KEY>", "%cpu", "%mem", "cmd"] keys_str = ",".join(keys) command = f"ps --format {keys_str} {self.pid}" if not is_local(self.host): command = f"ssh {self.user}@{self.host} \"{command}\"" try: lines = Shell.run(command).splitlines() lines = ' '.join(lines[1].split()).split(" ", len(keys) - 1) i = -1 entry = {} for key in keys: i = i + 1 entry[key] = lines[i] return entry except: return None def check_host_running(self): host = Host(name=self.host,user=self.user) probe_status, probe_time = host.probe() if not probe_status: if self.status == 'start' or self.status =='run': self.status = 'crash' return probe_status def check_host_running2(self,timeout_min=10): if self.last_probe_check is None: raise ValueError ('Job last_probe_time is None') last_probe_time = datetime.strptime(self.last_probe_check, "%d/%m/%Y %H:%M:%S") if datetime.now() > last_probe_time + timedelta(minutes=timeout_min): host = Host(name=self.host, user=self.user) probe_status, probe_time = host.probe() self.last_probe_check = probe_time if not probe_status: if self.status == 'start' or self.status == 'run': self.status = 'crash' return False return True def check_running(self): ps = self.ps() if ps is None: return False return True def check_crashed(self,timeout_min=10): if not is_local(self.host) and (self.status == 'start' or self.status == 'run') \ and not self.check_host_running2(): return True elif self.state == 'start' and not self.check_running(): time.sleep(5) # TODO make this more deterministic if self.state == 'start': if is_local(self.host): command = \ f"cd {self.directory}/{self.name}; " + \ f"{self.logging(msg='crash')};" else: command = f"ssh {self.user}@{self.host} " + \ f"'" + \ f"cd {self.directory}/{self.name}; " + \ f"{self.logging(msg='crash')};" + \ f"'" os.system(command) return True elif self.status == 'start': return False return None def remove_dir(self): # remove local dir command = \ f"cd {self.directory}; " + \ f"rm -rf ./{self.name};" r = os.system(command) # remove remote dir if not is_local(self.host): command = f"ssh {self.user}@{self.host} " + \ f"'" + \ f"cd {self.directory}; " + \ f"rm -rf ./{self.name} ;" + \ f"'" r = os.system(command) if r != 0: return f'Could not delete {self.name} dir on {self.user}@{self.host}\n' return '' @staticmethod def nohup(name=None, shell="bash"): """ returns the nohup command for a remote machine :param name: name of the job :param shell: name of the shell :return: str """ return f"nohup {shell} {name}.{shell} >> {name}-nohup.log 2>&1 &" def to_dict(self): """ Returns a dict of the Job :return: dict """ return _to_dict(self) def order(self): """ returns all keys of the dict represented as dataclass :return: """ return self.__dataclass_fields__ def info(self, banner=None, output="table"): """ Returns an information of the job :return: str """ return Printer.attribute(self.to_dict(), output=output) ''' def info(self): """ Returns an information string of the job :return: str """ result = [] keys = self.__dict__ for key in keys: entry = f"{key} = {keys[key]}" result.append(entry) return "\n".join(result) ''' def __str__(self): """ Returns a string of the job :return: str """ return _to_string(self, f"{self.experiment}/{self.name}/{self.name}") def example(self, name: str, user=None): """ Not implemented :param name: :param user: :return: """ user, hostname, cpus = sysinfo() self.name = name, hostname, cpus def set(self, command: str): """ Sets the command :param str command: the command to be executed :return: None """ self.command = command.strip() if " " in command: _command = shlex.split(command) self.executable = _command[0] self.arguments = " ".join(_command[1:]) else: self.executable = self.command def generate_command(self): """ Generates a command to run it remotely :return: None """ self.nohup_command = self.nohup(name=self.name, shell=self.shell) if is_local(self.host): self.remote_command = \ f"cd {self.directory}/{self.name}; " + \ f"{self.nohup_command}" else: self.remote_command = \ f"ssh {self.user}@{self.host} " + \ f"\"cd {self.directory}/{self.name} ; " + \ f"{self.nohup_command}\"" def generate_script(self, shell="/usr/bin/bash"): """ generates a job script that can be copied with sunc to the remote machine :param shell: name of the shell :return: None """ os.system(f"mkdir -p {self.experiment}/{self.name}") with open(self.scriptname, "w") as f: start_line = self.logging("start", append=False) end_line = self.logging("end") pyenv_cmd = '' if self.pyenv is not None: pyenv_cmd = f'\nsource {self.pyenv}; ' gpu_cmd = '' if self.gpu is not None: gpu_cmd = f'\nexport CUDA_VISIBLE_DEVICES={self.gpu};' script = "\n".join([ f"#! {self.shell_path} -x", f"echo $$ > {self.name}.pid", f"rm -f {self.output}", f"rm -f {self.log}", f"{start_line}", f'echo -ne "# date: " >> {self.log}; date >> {self.log}' + pyenv_cmd + gpu_cmd, f"{self.command} >> {self.output}", f'echo -ne "# date: " >> {self.log}; date >> {self.log}', f"{end_line}", "#"]) f.write(script) def logging(self, msg: str, append=True): if append: return f'echo "# cloudmesh state: {msg}" >> {self.name}.log' else: return f'echo "# cloudmesh state: {msg}" > {self.name}.log' @property def state(self): """ returns the state of the remote job from the log file :return: """ lines = self.get_process_file(self.log) if lines is not None: lines = lines.splitlines() result = Shell.find_lines_with(lines=lines, what="cloudmesh state:") if len(result) != 0: self.status = result[-1].split(":", 1)[1].strip() return self.status @property def rpid(self): """ returns the remote pid from the job :return: """ if self.pid is not None: return self.pid try: lines = self.get_process_file(f"{self.name}.pid") except: return None if lines is
<reponame>birknilson/oyster # -*- coding: utf-8 -*- """ Oyster ~~~~~ **A Python parser of shell commands.** This module strives to support commands executed within the sh, bash and zsh shells alike. An important limitation to mention is that Oyster does not support parsing of scripted commands, i.e: for i in $(seq 10); do echo $i; done This might change in a future version of Oyster - at least in order to support one-liners like the one above. *Features to be included in upcoming releases:* - Extended :class:`Chain` API to ease extending the chain with additional commands and various control operators. - Parse command substitutions :copyright: (c) 2014 by <NAME>. :license: MIT, see LICENSE for more details. """ import shlex from subprocess import list2cmdline __author__ = '<NAME> <<EMAIL>>' __copyright__ = 'Copyright 2014, <NAME>' __license__ = 'MIT' __version__ = '0.1.0' __all__ = [ # Constants 'RESERVED_WORDS', 'CONTROL_OPERATORS', 'STDIN', 'STDOUT', 'STDERR', 'STDFD_MAPPING', 'DEBUG', # Classes 'Redirect', 'Chain', 'Command', # Functions 'split_token_by_operators', 'tokenize', 'is_comment', 'is_script', 'is_quoted', 'is_command', 'parse', ] #: How verbose Oyster debugging should be:: #: * 0 turns of debugging #: * 1 adds basic parse debugging #: * 2 adds tokenize debugging DEBUG = 0 #: Set of words which are reserved in the shell. #: See: http://bit.ly/1baSfhM#tag_02_04 RESERVED_WORDS = frozenset([ '!', ';', '{', '}', 'case', 'do', 'done', 'elif', 'else', 'esac', 'fi', 'for', 'if', 'in', 'then', 'until', 'while', ]) #: Control operators which chain multiple commands CONTROL_OPERATORS = frozenset([';', '|', '&&', '||']) #: Lookup dictionary of control operators CONTROL_OPERATOR_LOOKUP = dict(zip(CONTROL_OPERATORS, CONTROL_OPERATORS)) #: The file descriptor of the standard input file STDIN = 0 #: The file descriptor of the standard output file STDOUT = 1 #: The file descriptor of the standard error file STDERR = 2 #: Mapping of the standard file descriptors and their common names STDFD_MAPPING = { STDIN: 'stdin', STDOUT: 'stdout', STDERR: 'stderr', } class Redirect(object): """A :class:`Redirect` instance represents the various output redirections performed by the command it is attached to. Each redirect has a :attr:`source` and :attr:`destination` in which the source is the value of the standard file descriptor to be redirected to the given :attr:`destination` - which can be either a file descriptor or a filename. The method in which the redirect is performed is determined by the :attr:`mode` which can be either ``w`` or ``a``. The ``w`` mode will write to the :attr:`destination` while ``a`` will append to it, i.e '>' vs. '>>'. When a shell command is parsed all redirects will automatically be initiated and assigned to their respective command as shown below: >>> import oyster >>> cmd = 'cp -v -r myfiles/* >> copied.log 2>> errors.log' >>> command = oyster.parse(cmd)[0] >>> str(command.redirects[0]) '>> copied.log' >>> str(command.redirects[1]) '2>> errors.log' >>> command.redirects[0].is_source_stdout() True :param source: An integer representing the standard file descriptor to be redirected. :param destination: Either an integer representing the standard file descriptor which output should be redirected to or a string representing the filename. :param mode: Either ``w`` or ``a`` depending on whether the redirect should write or append its output to the :attr:`destination`. """ def __init__(self, source, destination, mode='w'): #: Which standard file descriptor to be redirected self.source = source #: The destination of the redirect which can either be a standard #: file descriptor (integer) or a filename (string. self.destination = destination if self.is_destination_stdfd(): mode = 'w' #: The mode in which the redirect should be performed. #: ``w`` represents writes (>) & ``a`` represents appends (>>). self.mode = mode def is_source_stdin(self): """Check if the source is the standard input file descriptor.""" return self.source == STDIN def is_source_stdout(self): """Check if the source is the standard output file descriptor.""" return self.source == STDOUT def is_source_stderr(self): """Check if the source is the standard error file descriptor.""" return self.source == STDERR def is_destination_stdfd(self): """Check if the destination is a standard file descriptor.""" return self.destination in STDFD_MAPPING def is_destination_stdin(self): """Check if the destination is the standard input file descriptor.""" return self.destination == STDIN def is_destination_stdout(self): """Check if the destination is the standard output file descriptor.""" return self.destination == STDOUT def is_destination_stderr(self): """Check if the destination is the standard error file descriptor.""" return self.destination == STDERR def __str__(self): source = str(self.source) if not self.is_source_stdout() else '' if not self.is_destination_stdfd(): separator = ' ' operator = '>' if self.mode == 'w' else '>>' else: separator = '' operator = '>&' destination = str(self.destination) as_string = '{source}{operator}{separator}{destination}' return as_string.format(source=source, operator=operator, separator=separator, destination=destination) class Chain(object): """A list-like object containing all the individual commands which have been chained together using control operators in the shell. Unlike a regular Python list the :class:`Chain` instance does not implement the ``.extend``, ``.sort`` and ``.count`` methods. Also it introduces the ``chain_by`` parameter to the ``.append`` and ``.insert`` methods. Oyster treats all shell commands as a chain even in the case of a single program being executed. This is a design choice to simplify usage of the module since it is easier if :func:`parse` consistently returns the same type. As shown here: >>> import oyster >>> commands = oyster.parse('ps aux | grep python') >>> len(commands) 2 >>> ps, grep = commands >>> ps.arguments ('aux',) >>> ps = oyster.parse('ps aux')[0] >>> ps.program 'ps' """ def __init__(self): #: A list containing all the individual :class:`Command` instances self.commands = [] self._strings = [] self._operators = [] def append(self, command, chained_by=None): """C.append(command[, chained_by=';']) Append given ``command`` to the chain with the ``chained_by`` as the separating control operator. :param command: A string representing the command or an instance of :class:`Command` :param chained_by: One of the control operators defined in the :attr:`CONTROL_OPERATORS` constant. The default is ``;``. """ command = self._normalize_command(command) chained_by = self._normalize_chained_by(chained_by) self.commands.append(command) self._strings.append(str(command)) self._operators.append(chained_by) def insert(self, index, command, chained_by=None): """C.insert(index, command[, chained_by=';']) Insert given ``command`` to the chain at ``index`` with the ``chained_by`` as the separating control operator. :param index: At which index of the chain to insert the command :param command: A string representing the command or an instance of :class:`Command` :param chained_by: One of the control operators defined in the :attr:`CONTROL_OPERATORS` constant. The default is ``;``. """ command = self._normalize_command(command) chained_by = self._normalize_chained_by(chained_by) self.commands.insert(index, command) self._strings.insert(index, str(command)) self._operators.insert(index, chained_by) def index(self, command, *args): """C.index(command, [start, [stop]]) -> first index of command. Raises ValueError if the command is not present. :param command: A string representing the command or an instance of :class:`Command` :param start: At which index to start the search :param stop: At which index to stop the search """ if hasattr(command, 'get_options'): return self.commands.index(command, *args) return self._strings.index(command, *args) def pop(self, *args): """C.pop([index]) -> command -- remove and return item at index (default last). Raises IndexError if list is empty or index is out of range. :param index: Which command to pop by index """ ret = self.commands.pop(*args) self._strings.pop(*args) self._operators.pop(*args) return ret def remove(self, command): """C.remove(command) -- remove first occurrence of command. Raises ValueError if the value is not present. :param command: A string representing the command or an instance of :class:`Command` """ index = self.index(command) del self.commands[index] del self._strings[index] del self._operators[index] def __add__(self, chain): if hasattr(chain, 'isalpha'): chain = parse(chain) c = Chain() c.commands = self.commands + chain.commands c._strings = self._strings + chain._strings c._operators = self._operators + chain._operators return c def __iadd__(self, chain): if hasattr(chain, 'isalpha'): chain = parse(chain) self.commands += chain.commands self._strings += chain._strings self._operators += chain._operators return self def __contains__(self, command): if not hasattr(command, 'isalpha'): return command in self.commands return command in self._strings def __delitem__(self, *args): self.commands.__delitem__(*args) self._strings.__delitem__(*args) self._operators.__delitem__(*args) def __delslice__(self, *args): self.commands.__delslice__(*args) self._strings.__delslice__(*args) self._operators.__delslice__(*args) def __eq__(self, chain): return str(self) == str(chain) def __ne__(self, chain): return not self.__eq__(chain) def __getitem__(self, index): return self.commands.__getitem__(index) def __getslice__(self, *args): c = Chain() c.commands = self.commands.__getslice__(*args) c._strings = self._strings.__getslice__(*args) c._operators = self._operators.__getslice__(*args) return c def __len__(self): return self.commands.__len__() def __str__(self): operators = self._operators[:] operators[0] = None commands = [str(command) for command in self.commands] components = [] for index, operator in enumerate(operators): if operator: whitespace = ' ' if operator == ';': whitespace = '' components.append('{0}{1} '.format(whitespace, operator)) components.append(commands[index]) return ''.join(components) def _normalize_command(self, command): if hasattr(command, 'get_options'): return command chain
'd') # but that data remains the same assert tn1['t1'].data is tn2['t1'].data tn2['t1'].data[:] /= 2 assert_allclose(tn1['t1'].data, tn2['t1'].data) def test_copy_deep(self): a = rand_tensor((2, 3, 4), inds='abc', tags='t0') b = rand_tensor((2, 3, 4), inds='abd', tags='t1') tn1 = TensorNetwork((a, b)) tn2 = tn1.copy(deep=True) # check can modify tensor structure tn2['t1'].modify(inds=('a', 'b', 'X')) assert tn1['t1'] is not tn2['t1'] assert tn2['t1'].inds == ('a', 'b', 'X') assert tn1['t1'].inds == ('a', 'b', 'd') # and that data is not the same assert tn1['t1'].data is not tn2['t1'].data tn2['t1'].data[:] /= 2 assert_allclose(tn1['t1'].data / 2, tn2['t1'].data) def test_TensorNetwork_init_checks(self): a = rand_tensor((2, 3, 4), inds=[0, 1, 2], tags={'red'}) b = rand_tensor((3, 4, 5), inds=[1, 2, 3], tags={'blue'}) c = rand_tensor((3, 4, 5), inds=[1, 2, 3], tags={'blue', 'c'}) with pytest.raises(TypeError): TensorNetwork(a, b) # missing brackets around ``a, b``. tn = a & b with pytest.raises(TypeError): tn['red'] = 1 tn.add_tag('foo') assert len(tn['foo']) == 2 with pytest.raises(KeyError): tn['foo'] = c tn[('foo', 'blue')] = c assert 'c' in tn.tags assert tn[('blue', 'c')] is c assert 'red' in tn.tags del tn['red'] assert 'red' not in tn.tags assert set(tn.tag_map.keys()) == {'blue', 'c'} tn.drop_tags('c') assert set(tn.tag_map.keys()) == {'blue'} tn.drop_tags(['blue']) assert set(tn.tag_map.keys()) == set() def test_conj(self): a_data = np.random.randn(2, 3, 4) + 1.0j * np.random.randn(2, 3, 4) b_data = np.random.randn(3, 4, 5) + 1.0j * np.random.randn(3, 4, 5) c_data = np.random.randn(5, 2, 6) + 1.0j * np.random.randn(5, 2, 6) a = Tensor(a_data, inds=[0, 1, 2], tags={'red', '0'}) b = Tensor(b_data, inds=[1, 2, 3], tags={'blue', '1'}) c = Tensor(c_data, inds=[3, 0, 4], tags={'blue', '2'}) tn = a & b & c new_tn = tn.conj() for i, arr in enumerate((a_data, b_data, c_data)): assert_allclose(new_tn[str(i)].data, arr.conj()) # make sure original network unchanged for i, arr in enumerate((a_data, b_data, c_data)): assert_allclose(tn[str(i)].data, arr) def test_conj_inplace(self): a_data = np.random.randn(2, 3, 4) + 1.0j * np.random.randn(2, 3, 4) b_data = np.random.randn(3, 4, 5) + 1.0j * np.random.randn(3, 4, 5) c_data = np.random.randn(5, 2, 6) + 1.0j * np.random.randn(5, 2, 6) a = Tensor(a_data, inds=[0, 1, 2], tags={'red', 'I0'}) b = Tensor(b_data, inds=[1, 2, 3], tags={'blue', 'I1'}) c = Tensor(c_data, inds=[3, 0, 4], tags={'blue', 'I2'}) tn = a & b & c tn.conj_() for i, arr in enumerate((a_data, b_data, c_data)): assert_allclose(tn[f"I{i}"].data, arr.conj()) def test_multiply(self): a = rand_tensor((2, 3, 4), inds=['0', '1', '2'], tags='red') b = rand_tensor((3, 4, 5), inds=['1', '2', '3'], tags='blue') c = rand_tensor((5, 2, 6), inds=['3', '0', '4'], tags='blue') tn = a & b & c x1 = (tn & tn.H) ^ ... x2 = ((2 * tn) & tn.H) ^ ... assert_allclose(2 * x1, x2) def test_multiply_inplace(self): a = rand_tensor((2, 3, 4), inds=['0', '1', '2'], tags='red') b = rand_tensor((3, 4, 5), inds=['1', '2', '3'], tags='blue') c = rand_tensor((5, 2, 6), inds=['3', '0', '4'], tags='blue') tn = a & b & c x1 = (tn & tn.H) ^ ... tn *= 2 x2 = (tn & tn.H) ^ ... assert_allclose(4 * x1, x2) def test_multiply_each(self): a = rand_tensor((2, 3, 4), inds=['0', '1', '2'], tags='red') b = rand_tensor((3, 4, 5), inds=['1', '2', '3'], tags='blue') c = rand_tensor((5, 2, 6), inds=['3', '0', '4'], tags='blue') tn = a & b & c x1 = (tn & tn.H) ^ ... x2 = (tn.multiply_each(2) & tn.H) ^ ... assert_allclose(2**3 * x1, x2) def test_divide(self): a = rand_tensor((2, 3, 4), inds=['0', '1', '2'], tags='red') b = rand_tensor((3, 4, 5), inds=['1', '2', '3'], tags='blue') c = rand_tensor((5, 2, 6), inds=['3', '0', '4'], tags='blue') tn = a & b & c x1 = (tn & tn.H) ^ ... x2 = ((tn / 2) & tn.H) ^ ... assert_allclose(x1 / 2, x2) def test_divide_inplace(self): a = rand_tensor((2, 3, 4), inds=['0', '1', '2'], tags='red') b = rand_tensor((3, 4, 5), inds=['1', '2', '3'], tags='blue') c = rand_tensor((5, 2, 6), inds=['3', '0', '4'], tags='blue') tn = a & b & c x1 = (tn & tn.H) ^ ... tn /= 2 x2 = (tn & tn.H) ^ ... assert_allclose(x1 / 4, x2) def test_multiply_spread(self): a = rand_tensor([2, 2], inds=['a', 'b'], tags='A') b = Tensor(a.data, ['b', 'c'], tags='B') c = Tensor(a.data, ['c', 'd'], tags='C') tn = (a | b | c) tn.multiply_(-8j + 1 / 3, spread_over=3) assert_allclose(tn['A'].data, tn['B'].data) assert_allclose(tn['B'].data, tn['C'].data) def test_multiply_spread_neg_stays_real(self): a = rand_tensor([2, 2], inds=['a', 'b'], tags='A', dtype='float32') b = Tensor(a.data, ['b', 'c'], tags='B') c = Tensor(a.data, ['c', 'd'], tags='C') tn = (a | b | c) tn.multiply_(-1000) assert a.dtype == b.dtype == c.dtype == 'float32' assert_allclose(abs(tn['A'].data), abs(tn['B'].data)) assert_allclose(abs(tn['B'].data), abs(tn['C'].data)) def test_tensor_network_sum(self): A = qtn.TN_rand_reg(n=6, reg=3, D=2, phys_dim=2, dtype='complex') B = A.copy() B.randomize_() d1 = A.distance(B) AmB = qtn.tensor_network_sum(A, -1 * B) d2 = (AmB | AmB.H).contract(all)**0.5 assert d1 == pytest.approx(d2) def test_contracting_tensors(self): a = rand_tensor((2, 3, 4), inds=[0, 1, 2], tags='red') b = rand_tensor((3, 4, 5), inds=[1, 2, 3], tags='blue') c = rand_tensor((5, 2, 6), inds=[3, 0, 4], tags='blue') a_b_c = a & b & c print(a_b_c) repr(a_b_c) assert isinstance(a_b_c, TensorNetwork) a_bc = a_b_c ^ 'blue' assert isinstance(a_bc, TensorNetwork) assert len(a_bc.tensors) == 2 abc = a_bc ^ ['red', 'blue'] assert isinstance(abc, Tensor) assert_allclose(abc.data, a_b_c.contract().data) assert len(a_b_c.tensors) == 3 a_b_c ^= 'blue' assert len(a_b_c.tensors) == 2 def test_cumulative_contract(self): a = rand_tensor((2, 3, 4), inds=[0, 1, 2], tags='red') b = rand_tensor((3, 4, 5), inds=[1, 2, 3], tags='blue') c = rand_tensor((5, 2, 6), inds=[3, 0, 4], tags='green') d = (a & b & c) d2 = d.copy() cd = d >> ['red', 'green', 'blue'] assert cd.shape == (6,) assert cd.inds == (4,) # make sure inplace operations didn't effect original tensor for tag, names in d2.tag_map.items(): assert d.tag_map[tag] == names # test inplace d >>= ['red', 'green', 'blue'] assert isinstance(d, Tensor) def test_contract_with_slices(self): a = rand_tensor((2, 3, 4), inds=[0, 1, 2], tags='I0') b = rand_tensor((3, 4, 5), inds=[1, 2, 3], tags='I1') c = rand_tensor((5, 2, 6), inds=[3, 0, 4], tags='I2') d = rand_tensor((5, 2, 6), inds=[5, 6, 4], tags='I3') tn = TensorNetwork((a, b, c, d)) tn.view_as_(TensorNetwork1D, L=4, site_tag_id='I{}') assert len((tn ^ slice(2)).tensors) == 3 assert len((tn ^ slice(..., 1, -1)).tensors) == 3 assert len((tn ^ slice(-1, 1)).tensors) == 3 assert len((tn ^ slice(None, -2, -1)).tensors) == 3 assert len((tn ^ slice(-2, 0)).tensors) == 3 def test_contraction_info(self): a = qtn.rand_tensor((8, 8), ('a', 'b')) b = qtn.rand_tensor((8, 8), ('b', 'c')) c = qtn.rand_tensor((8, 8), ('c', 'd')) tn = a | b | c assert tn.contraction_width() == 6 assert tn.contraction_cost() == 2 * 8**3 @pytest.mark.parametrize('method', ('auto', 'dense', 'overlap')) def test_tensor_network_distance(self, method): n = 6 A = qtn.TN_rand_reg(n=n, reg=3, D=2, phys_dim=2, dtype=complex) Ad = A.to_dense([f'k{i}' for i in range(n)]) B = qtn.TN_rand_reg(n=6, reg=3, D=2, phys_dim=2, dtype=complex) Bd = B.to_dense([f'k{i}' for i in range(n)]) d1 = np.linalg.norm(Ad - Bd) d2 = A.distance(B, method=method) assert d1 == pytest.approx(d2) @pytest.mark.parametrize('method,opts', ( ('als', (('enforce_pos', False),)), ('als', (('enforce_pos', True),)), pytest.param('autodiff', (('distance_method', 'dense'),), marks=autograd_mark), pytest.param('autodiff', (('distance_method', 'overlap'),), marks=autograd_mark), )) def test_fit_mps(self, method, opts): k1 = qtn.MPS_rand_state(5, 3, seed=666) k2 = qtn.MPS_rand_state(5, 3, seed=667) assert k1.distance(k2) > 1e-3 k1.fit_(k2, method=method, progbar=True, **dict(opts)) assert k1.distance(k2) < 1e-3 @pytest.mark.parametrize('method,opts', ( ('als', (('enforce_pos', False),)), ('als', (('enforce_pos', True),)), pytest.param('autodiff', (('distance_method', 'dense'),), marks=autograd_mark), pytest.param('autodiff', (('distance_method', 'overlap'),), marks=autograd_mark), )) def test_fit_rand_reg(self, method, opts): r1 = qtn.TN_rand_reg(5, 4, D=2, seed=666, phys_dim=2) k2 = qtn.MPS_rand_state(5, 3, seed=667) assert r1.distance(k2) > 1e-3 r1.fit_(k2, method=method, progbar=True, **dict(opts)) assert r1.distance(k2) < 1e-3 @pytest.mark.parametrize('method,opts', ( ('als', (('enforce_pos', False),)), ('als', (('enforce_pos', True),)), pytest.param('autodiff', (('distance_method', 'dense'),), marks=autograd_mark), pytest.param('autodiff', (('distance_method', 'overlap'),), marks=autograd_mark), )) def test_fit_partial_tags(self, method, opts): k1 = qtn.MPS_rand_state(5, 3, seed=666) k2 = qtn.MPS_rand_state(5, 3, seed=667) d0 = k1.distance(k2) tags = ["I0", "I2", "I4"] k1f = k1.fit(k2, tol=1e-3, tags=tags, method=method, progbar=True, **dict(opts)) assert k1f.distance(k2) < d0 assert (k1f[0] - k1[0]).norm() > 1e-12 assert (k1f[1] - k1[1]).norm() < 1e-12 assert (k1f[2] - k1[2]).norm() > 1e-12 assert (k1f[3] - k1[3]).norm() < 1e-12 assert (k1f[4] - k1[4]).norm() > 1e-12 def test_reindex(self): a = Tensor(np.random.randn(2, 3, 4), inds=[0, 1, 2], tags='red') b = Tensor(np.random.randn(3, 4, 5), inds=[1, 2, 3], tags='blue') c = Tensor(np.random.randn(5, 2, 6), inds=[3, 0, 4], tags='green') a_b_c = (a & b & c) d
from __future__ import annotations from collections import defaultdict from datetime import datetime, timedelta, timezone from logging import Logger, getLogger from typing import Any, Callable, Iterable, Optional, Tuple, Type from uuid import UUID import attr from sqlalchemy import ( Column, Integer, LargeBinary, MetaData, Table, Unicode, and_, bindparam, or_, select) from sqlalchemy.engine import URL from sqlalchemy.exc import CompileError, IntegrityError from sqlalchemy.future import Engine, create_engine from sqlalchemy.sql.ddl import DropTable from sqlalchemy.sql.elements import BindParameter, literal from ...abc import DataStore, Job, Schedule, Serializer from ...enums import ConflictPolicy from ...events import ( Event, EventHub, JobAdded, JobDeserializationFailed, ScheduleAdded, ScheduleDeserializationFailed, ScheduleRemoved, ScheduleUpdated, SubscriptionToken, TaskAdded, TaskRemoved, TaskUpdated) from ...exceptions import ConflictingIdError, SerializationError, TaskLookupError from ...marshalling import callable_to_ref from ...serializers.pickle import PickleSerializer from ...structures import JobResult, Task from ...util import reentrant @reentrant @attr.define(eq=False) class SQLAlchemyDataStore(DataStore): engine: Engine schema: Optional[str] = attr.field(default=None, kw_only=True) serializer: Serializer = attr.field(factory=PickleSerializer, kw_only=True) lock_expiration_delay: float = attr.field(default=30, kw_only=True) max_poll_time: Optional[float] = attr.field(default=1, kw_only=True) max_idle_time: float = attr.field(default=60, kw_only=True) notify_channel: Optional[str] = attr.field(default='apscheduler', kw_only=True) start_from_scratch: bool = attr.field(default=False, kw_only=True) _logger: Logger = attr.field(init=False, factory=lambda: getLogger(__name__)) _events: EventHub = attr.field(init=False, factory=EventHub) def __attrs_post_init__(self) -> None: # Generate the table definitions self._metadata = self.get_table_definitions() self.t_metadata = self._metadata.tables['metadata'] self.t_tasks = self._metadata.tables['tasks'] self.t_schedules = self._metadata.tables['schedules'] self.t_jobs = self._metadata.tables['jobs'] self.t_job_results = self._metadata.tables['job_results'] # Find out if the dialect supports RETURNING update = self.t_jobs.update().returning(self.t_jobs.c.id) try: update.compile(bind=self.engine) except CompileError: self._supports_update_returning = False else: self._supports_update_returning = True @classmethod def from_url(cls, url: str | URL, **options) -> 'SQLAlchemyDataStore': engine = create_engine(url) return cls(engine, **options) def __enter__(self): with self.engine.begin() as conn: if self.start_from_scratch: for table in self._metadata.sorted_tables: conn.execute(DropTable(table, if_exists=True)) self._metadata.create_all(conn) query = select(self.t_metadata.c.schema_version) result = conn.execute(query) version = result.scalar() if version is None: conn.execute(self.t_metadata.insert(values={'schema_version': 1})) elif version > 1: raise RuntimeError(f'Unexpected schema version ({version}); ' f'only version 1 is supported by this version of APScheduler') self._events.__enter__() return self def __exit__(self, exc_type, exc_val, exc_tb): self._events.__exit__(exc_type, exc_val, exc_tb) def get_table_definitions(self) -> MetaData: if self.engine.dialect.name in ('mysql', 'mariadb'): from sqlalchemy.dialects.mysql import TIMESTAMP timestamp_type = TIMESTAMP(fsp=6) else: from sqlalchemy.types import TIMESTAMP timestamp_type = TIMESTAMP(timezone=True) metadata = MetaData() Table( 'metadata', metadata, Column('schema_version', Integer, nullable=False) ) Table( 'tasks', metadata, Column('id', Unicode(500), primary_key=True), Column('func', Unicode(500), nullable=False), Column('state', LargeBinary), Column('max_running_jobs', Integer), Column('misfire_grace_time', Unicode(16)), Column('running_jobs', Integer, nullable=False, server_default=literal(0)) ) Table( 'schedules', metadata, Column('id', Unicode(500), primary_key=True), Column('task_id', Unicode(500), nullable=False, index=True), Column('serialized_data', LargeBinary, nullable=False), Column('next_fire_time', timestamp_type, index=True), Column('acquired_by', Unicode(500)), Column('acquired_until', timestamp_type) ) Table( 'jobs', metadata, Column('id', Unicode(32), primary_key=True), Column('task_id', Unicode(500), nullable=False, index=True), Column('serialized_data', LargeBinary, nullable=False), Column('created_at', timestamp_type, nullable=False), Column('acquired_by', Unicode(500)), Column('acquired_until', timestamp_type) ) Table( 'job_results', metadata, Column('job_id', Unicode(32), primary_key=True), Column('finished_at', timestamp_type, index=True), Column('serialized_data', LargeBinary, nullable=False) ) return metadata def _deserialize_jobs(self, serialized_jobs: Iterable[Tuple[UUID, bytes]]) -> list[Job]: jobs: list[Job] = [] for job_id, serialized_data in serialized_jobs: try: jobs.append(self.serializer.deserialize(serialized_data)) except SerializationError as exc: self._events.publish(JobDeserializationFailed(job_id=job_id, exception=exc)) return jobs def _deserialize_schedules( self, serialized_schedules: Iterable[Tuple[str, bytes]]) -> list[Schedule]: jobs: list[Schedule] = [] for schedule_id, serialized_data in serialized_schedules: try: jobs.append(self.serializer.deserialize(serialized_data)) except SerializationError as exc: self._events.publish( ScheduleDeserializationFailed(schedule_id=schedule_id, exception=exc)) return jobs def subscribe(self, callback: Callable[[Event], Any], event_types: Optional[Iterable[Type[Event]]] = None) -> SubscriptionToken: return self._events.subscribe(callback, event_types) def unsubscribe(self, token: SubscriptionToken) -> None: self._events.unsubscribe(token) def add_task(self, task: Task) -> None: insert = self.t_tasks.insert().\ values(id=task.id, func=callable_to_ref(task.func), max_running_jobs=task.max_running_jobs, misfire_grace_time=task.misfire_grace_time) try: with self.engine.begin() as conn: conn.execute(insert) except IntegrityError: update = self.t_tasks.update().\ values(func=callable_to_ref(task.func), max_running_jobs=task.max_running_jobs, misfire_grace_time=task.misfire_grace_time).\ where(self.t_tasks.c.id == task.id) with self.engine.begin() as conn: conn.execute(update) self._events.publish(TaskUpdated(task_id=task.id)) else: self._events.publish(TaskAdded(task_id=task.id)) def remove_task(self, task_id: str) -> None: delete = self.t_tasks.delete().where(self.t_tasks.c.id == task_id) with self.engine.begin() as conn: result = conn.execute(delete) if result.rowcount == 0: raise TaskLookupError(task_id) else: self._events.publish(TaskRemoved(task_id=task_id)) def get_task(self, task_id: str) -> Task: query = select([self.t_tasks.c.id, self.t_tasks.c.func, self.t_tasks.c.max_running_jobs, self.t_tasks.c.state, self.t_tasks.c.misfire_grace_time]).\ where(self.t_tasks.c.id == task_id) with self.engine.begin() as conn: result = conn.execute(query) row = result.fetch_one() if row: return Task.unmarshal(self.serializer, row._asdict()) else: raise TaskLookupError def get_tasks(self) -> list[Task]: query = select([self.t_tasks.c.id, self.t_tasks.c.func, self.t_tasks.c.max_running_jobs, self.t_tasks.c.state, self.t_tasks.c.misfire_grace_time]).\ order_by(self.t_tasks.c.id) with self.engine.begin() as conn: result = conn.execute(query) tasks = [Task.unmarshal(self.serializer, row._asdict()) for row in result] return tasks def add_schedule(self, schedule: Schedule, conflict_policy: ConflictPolicy) -> None: event: Event serialized_data = self.serializer.serialize(schedule) insert = self.t_schedules.insert().\ values(id=schedule.id, task_id=schedule.task_id, serialized_data=serialized_data, next_fire_time=schedule.next_fire_time) try: with self.engine.begin() as conn: conn.execute(insert) event = ScheduleAdded(schedule_id=schedule.id, next_fire_time=schedule.next_fire_time) self._events.publish(event) except IntegrityError: if conflict_policy is ConflictPolicy.exception: raise ConflictingIdError(schedule.id) from None elif conflict_policy is ConflictPolicy.replace: update = self.t_schedules.update().\ where(self.t_schedules.c.id == schedule.id).\ values(serialized_data=serialized_data, next_fire_time=schedule.next_fire_time) with self.engine.begin() as conn: conn.execute(update) event = ScheduleUpdated(schedule_id=schedule.id, next_fire_time=schedule.next_fire_time) self._events.publish(event) def remove_schedules(self, ids: Iterable[str]) -> None: with self.engine.begin() as conn: delete = self.t_schedules.delete().where(self.t_schedules.c.id.in_(ids)) if self._supports_update_returning: delete = delete.returning(self.t_schedules.c.id) removed_ids: Iterable[str] = [row[0] for row in conn.execute(delete)] else: # TODO: actually check which rows were deleted? conn.execute(delete) removed_ids = ids for schedule_id in removed_ids: self._events.publish(ScheduleRemoved(schedule_id=schedule_id)) def get_schedules(self, ids: Optional[set[str]] = None) -> list[Schedule]: query = select([self.t_schedules.c.id, self.t_schedules.c.serialized_data]).\ order_by(self.t_schedules.c.id) if ids: query = query.where(self.t_schedules.c.id.in_(ids)) with self.engine.begin() as conn: result = conn.execute(query) return self._deserialize_schedules(result) def acquire_schedules(self, scheduler_id: str, limit: int) -> list[Schedule]: with self.engine.begin() as conn: now = datetime.now(timezone.utc) acquired_until = now + timedelta(seconds=self.lock_expiration_delay) schedules_cte = select(self.t_schedules.c.id).\ where(and_(self.t_schedules.c.next_fire_time.isnot(None), self.t_schedules.c.next_fire_time <= now, or_(self.t_schedules.c.acquired_until.is_(None), self.t_schedules.c.acquired_until < now))).\ order_by(self.t_schedules.c.next_fire_time).\ limit(limit).cte() subselect = select([schedules_cte.c.id]) update = self.t_schedules.update().\ where(self.t_schedules.c.id.in_(subselect)).\ values(acquired_by=scheduler_id, acquired_until=acquired_until) if self._supports_update_returning: update = update.returning(self.t_schedules.c.id, self.t_schedules.c.serialized_data) result = conn.execute(update) else: conn.execute(update) query = select([self.t_schedules.c.id, self.t_schedules.c.serialized_data]).\ where(and_(self.t_schedules.c.acquired_by == scheduler_id)) result = conn.execute(query) schedules = self._deserialize_schedules(result) return schedules def release_schedules(self, scheduler_id: str, schedules: list[Schedule]) -> None: with self.engine.begin() as conn: update_events: list[ScheduleUpdated] = [] finished_schedule_ids: list[str] = [] update_args: list[dict[str, Any]] = [] for schedule in schedules: if schedule.next_fire_time is not None: try: serialized_data = self.serializer.serialize(schedule) except SerializationError: self._logger.exception('Error serializing schedule %r – ' 'removing from data store', schedule.id) finished_schedule_ids.append(schedule.id) continue update_args.append({ 'p_id': schedule.id, 'p_serialized_data': serialized_data, 'p_next_fire_time': schedule.next_fire_time }) else: finished_schedule_ids.append(schedule.id) # Update schedules that have a next fire time if update_args: p_id: BindParameter = bindparam('p_id') p_serialized: BindParameter = bindparam('p_serialized_data') p_next_fire_time: BindParameter = bindparam('p_next_fire_time') update = self.t_schedules.update().\ where(and_(self.t_schedules.c.id == p_id, self.t_schedules.c.acquired_by == scheduler_id)).\ values(serialized_data=p_serialized, next_fire_time=p_next_fire_time, acquired_by=None, acquired_until=None) next_fire_times = {arg['p_id']: arg['p_next_fire_time'] for arg in update_args} if self._supports_update_returning: update = update.returning(self.t_schedules.c.id) updated_ids = [row[0] for row in conn.execute(update, update_args)] else: # TODO: actually check which rows were updated? conn.execute(update, update_args) updated_ids = list(next_fire_times) for schedule_id in updated_ids: event = ScheduleUpdated(schedule_id=schedule_id, next_fire_time=next_fire_times[schedule_id]) update_events.append(event) # Remove schedules that have no next fire time or failed to serialize if finished_schedule_ids: delete = self.t_schedules.delete().\ where(self.t_schedules.c.id.in_(finished_schedule_ids)) conn.execute(delete) for event in update_events: self._events.publish(event) for schedule_id in finished_schedule_ids: self._events.publish(ScheduleRemoved(schedule_id=schedule_id)) def get_next_schedule_run_time(self) -> Optional[datetime]: query = select(self.t_schedules.c.id).\ where(self.t_schedules.c.next_fire_time.isnot(None)).\ order_by(self.t_schedules.c.next_fire_time).\ limit(1) with self.engine.begin() as conn: result = conn.execute(query) return result.scalar() def add_job(self, job: Job) -> None: now = datetime.now(timezone.utc) serialized_data = self.serializer.serialize(job) insert = self.t_jobs.insert().values(id=job.id.hex, task_id=job.task_id, created_at=now, serialized_data=serialized_data) with self.engine.begin() as conn: conn.execute(insert) event = JobAdded(job_id=job.id, task_id=job.task_id, schedule_id=job.schedule_id, tags=job.tags) self._events.publish(event) def get_jobs(self, ids: Optional[Iterable[UUID]] = None) -> list[Job]: query = select([self.t_jobs.c.id, self.t_jobs.c.serialized_data]).\ order_by(self.t_jobs.c.id) if ids: job_ids = [job_id.hex for job_id in ids] query = query.where(self.t_jobs.c.id.in_(job_ids)) with self.engine.begin() as conn: result = conn.execute(query) return self._deserialize_jobs(result) def acquire_jobs(self, worker_id: str, limit: Optional[int] = None) -> list[Job]: with self.engine.begin() as conn: now = datetime.now(timezone.utc) acquired_until = now + timedelta(seconds=self.lock_expiration_delay) query = select([self.t_jobs.c.id, self.t_jobs.c.serialized_data]).\ join(self.t_tasks, self.t_tasks.c.id == self.t_jobs.c.task_id).\ where(or_(self.t_jobs.c.acquired_until.is_(None), self.t_jobs.c.acquired_until < now)).\ order_by(self.t_jobs.c.created_at).\ limit(limit) result = conn.execute(query) if not result: return [] # Mark the jobs as acquired by this worker jobs = self._deserialize_jobs(result) task_ids: set[str] = {job.task_id for job in jobs} # Retrieve the limits query = select([self.t_tasks.c.id, self.t_tasks.c.max_running_jobs - self.t_tasks.c.running_jobs]).\ where(self.t_tasks.c.max_running_jobs.isnot(None), self.t_tasks.c.id.in_(task_ids)) result = conn.execute(query) job_slots_left = dict(result.fetchall()) # Filter out jobs that don't have free slots acquired_jobs: list[Job] = [] increments: dict[str, int] = defaultdict(lambda: 0) for job in jobs: # Don't acquire the job if there are no free slots left slots_left = job_slots_left.get(job.task_id) if slots_left == 0: continue elif slots_left is not None: job_slots_left[job.task_id] -= 1 acquired_jobs.append(job) increments[job.task_id] += 1 if acquired_jobs: # Mark the acquired jobs as acquired by this worker acquired_job_ids = [job.id.hex for job in acquired_jobs] update = self.t_jobs.update().\ values(acquired_by=worker_id, acquired_until=acquired_until).\ where(self.t_jobs.c.id.in_(acquired_job_ids)) conn.execute(update) # Increment the running job counters on each task p_id: BindParameter = bindparam('p_id') p_increment: BindParameter = bindparam('p_increment') params = [{'p_id': task_id, 'p_increment': increment} for task_id, increment in increments.items()] update = self.t_tasks.update().\ values(running_jobs=self.t_tasks.c.running_jobs + p_increment).\ where(self.t_tasks.c.id == p_id) conn.execute(update, params) return acquired_jobs def release_job(self, worker_id: str, job: Job, result: Optional[JobResult]) -> None: with self.engine.begin() as conn: # Insert the job result now = datetime.now(timezone.utc) serialized_result = self.serializer.serialize(result) insert = self.t_job_results.insert().\ values(job_id=job.id.hex,
import json import httplib2 import http.client import base64 import urllib.request, urllib.parse, urllib.error import urllib.request, urllib.error, urllib.parse import ssl import socket import paramiko from security.rbacTest import rbacTest from security.rbacmain import rbacmain from remote.remote_util import RemoteMachineShellConnection from security.ldapGroupBase import ldapGroupBase from ast import literal_eval class ServerInfo(): def __init__(self, ip, port, ssh_username, ssh_password, ssh_key=''): self.ip = ip self.ssh_username = ssh_username self.ssh_password = <PASSWORD> self.port = port self.ssh_key = ssh_key class rbacclitest(rbacTest): def setUp(self): super(rbacclitest, self).setUp() self.ldapUser = self.input.param('ldapuser','Administrator') self.ldapPass = self.input.param('ldappass','password') self.user_name = self.input.param("user_name","") self.user_id = self.input.param('user_id','') self.auth_type = self.input.param('auth_type','local') self.user_role = self.input.param('user_role','admin') def tearDown(self): super(rbacclitest, self).tearDown() def execute_admin_role_manage(self, options): cli_command = 'user-manage' options = options remote_client = RemoteMachineShellConnection(self.master) output, error = remote_client.execute_couchbase_cli(cli_command=cli_command, \ options=options, cluster_host="localhost", user=self.ldapUser, password=self.ldapPass) return output, error def execute_password_policy(self, options): cli_command = 'setting-password-policy' options = options remote_client = RemoteMachineShellConnection(self.master) output, error = remote_client.execute_couchbase_cli(cli_command=cli_command, \ options=options, cluster_host="localhost", user=self.ldapUser, password=self.ldapPass) return output, error def _get_user_role(self): final_user_id = rbacmain().returnUserList(self.user_id) final_roles = rbacmain()._return_roles(self.user_role) return final_user_id, final_roles def test_create_user_without_auth(self): users, roles = self._get_user_role() options = "--set " + "--rbac-username " + users[0][0] + " --rbac-password " + users[0][1] + " --roles " + roles output, error = self.execute_admin_role_manage(options) self.assertTrue("ERROR: --auth-domain is required with the --set option" in output[0], "Issue with command without auth") def test_create_user_without_rbac_user(self): users, roles = self._get_user_role() options = "--set " + " --rbac-password " + users[0][1] + " --roles " + roles output, error = self.execute_admin_role_manage(options) self.assertTrue("ERROR: --rbac-username is required with the --set option" in output[0], "Issue with command without rbacusername") def test_create_user_without_rbac_pass(self): users, roles = self._get_user_role() options = "--set " + "--rbac-username " + users[0][0] + " --roles " + roles + " --auth-domain local" output, error = self.execute_admin_role_manage(options) self.assertTrue("ERROR: --rbac-password is required with the --set option" in output[0], "Issue with command without rbac_pass") def test_create_user_without_role(self): users, roles = self._get_user_role() options = "--set " + "--rbac-username " + users[0][0] + " --rbac-password " + users[0][1] + \ " --auth-domain " + self.auth_type output, error = self.execute_admin_role_manage(options) self.assertTrue("ERROR: --roles is required with the --set option" in output[0],"Issue with command without role") def test_create_user(self): users, roles = self._get_user_role() options = "--set " + "--rbac-username " + users[0][0] + " --roles " + roles \ + " --auth-domain " + self.auth_type if self.auth_type == "local": options += " --rbac-password " + users[0][1] output, error = self.execute_admin_role_manage(options) self.assertTrue("SUCCESS: User " in output[0],"Issue with command create_user") def test_create_user_name(self): users, roles = self._get_user_role() options = "--set " + "--rbac-username " + users[0][0] + " --rbac-password " + users[0][1] + " --roles " + roles \ + " --auth-domain " + self.auth_type + " --rbac-name " + self.user_name if self.auth_type == "local": options += " --rbac-password " + users[0][1] output, error = self.execute_admin_role_manage(options) if 'WARNING' in output[0]: output= output[1:] self.assertTrue("SUCCESS: User " in output[0],"Issue with command create user name") def test_delete_user(self): self.test_create_user() users, roles = self._get_user_role() options = "--delete " + "--rbac-username " + users[0][0] + " --auth-domain " + self.auth_type output, error = self.execute_admin_role_manage(options) self.assertTrue("SUCCESS: User " in output[0], "Issue with command of delete user") def test_my_role(self): final_out = '' options = "--my-roles " self.test_create_user() users, roles = self._get_user_role() self.ldapUser = users[0][0] self.ldapPass = users[0][1] output, error = self.execute_admin_role_manage(options) for out in output: final_out = final_out + out test = json.loads(final_out) for role in test['roles']: self.assertTrue(role['role'] in roles,"Issue with --my-roles") def test_create_user_without_rbac_pass_value(self): users, roles = self._get_user_role() options = "--set " + " --rbac-username " + users[0][0] + " --rbac-password --roles " + roles output, error = self.execute_admin_role_manage(options) self.assertTrue("ERROR: argument --rbac-password: expected one argument" in output[0], "Issue with command without" + \ " rbac-password value") def test_create_user_invalid_character(self): self.auth_type='local' final_users = [["\"r;itam\"",'password'],["\"r(itam\"",'password'],["\"r)itam\"",'password'], ["\"r<itam\"",'password'], \ ["\"r>itam\"", 'password'], ["\"r@itam\"",'password'], ["\"r,itam\"",'password'], ["\"r;itam\"",'password'], \ ["\"r:itam\"", 'password'], ["\"r\itam\"",'password'], ["\"r[itam\"",'password'], \ ["\"r]itam\"", 'password'], ["\"r[itam\"", 'password'], ["\"r]itam\"", 'password'], \ ["\"r=itam\"", 'password'], ["\"r{itam\"", 'password'], ["\"r}itam\"", 'password']] #["\"r/itam\"",'password'], ["\"r?itam\"", 'password'], roles = 'admin' for users in final_users: self.log.info ("------Username tested is ------------{0}".format(users[0])) options = "--set " + "--rbac-username " + users[0] + " --roles " + roles \ + " --auth-domain " + self.auth_type + " --rbac-name " + self.user_name if self.auth_type == "local": options += " --rbac-password " + users[1] output, error = self.execute_admin_role_manage(options) self.assertTrue("ERROR: _ - Username must not contain spaces, control or any" in output[0], "Issue with command without" + \ " rbac-password value") def test_invalid_password_less_6_char(self): if self.auth_type=='local': users, roles = self._get_user_role() options = "--set " + " --rbac-username " + users[0][0] + " --rbac-password " + users[0][1] + " --roles " + \ roles + " --auth-domain " + self.auth_type output, error = self.execute_admin_role_manage(options) self.assertTrue("ERROR: password - The password must be at least 6 characters long." in output[0], "Issue with password < 6 characters") def test_change_password(self): self.new_password = self.input.param("<PASSWORD>_password") users, roles = self._get_user_role() options = "--set " + "--rbac-username " + users[0][0] + " --roles " + roles \ + " --auth-domain " + self.auth_type if self.auth_type == "local": options += " --rbac-password " + users[0][1] output, error = self.execute_admin_role_manage(options) self.assertTrue("SUCCESS: User {0} set".format(users[0][0]) in output[0], "Issue with command create_user") if self.new_password is not None: options = "" options = "--set " + "--rbac-username " + users[0][0] + " --roles " + roles \ + " --auth-domain " + self.auth_type if self.auth_type == "local": options += " --rbac-password " + self.new_password output, error = self.execute_admin_role_manage(options) self.assertTrue("SUCCESS: User {0} set".format(users[0][0]) in output[0], "Issue with command create_user") def test_invalid_passwords(self): final_policy = "" users, roles = self._get_user_role() correct_pass = self.input.param("correctpass",False) policy_type = self.input.param("policy_type") if ":" in policy_type: policy_type = policy_type.split(":") for policy in policy_type: final_policy = final_policy + " --" + policy policy_type = final_policy if policy_type == "uppercase": error_msg = "ERROR: argument --uppercase: expected one argument" elif policy_type == "lowercase": error_msg = "ERROR: password - The password must contain at least one lowercase letter" elif policy_type == "digit": error_msg = "ERROR: password - The password must contain at least one digit" elif policy_type == "special-char": error_msg = "ERROR: password - The password must contain at least one of the following characters: @%+\/'\"!#$^?:,(){}[]~`-_" elif policy_type == " --special-char --digit": error_msg = "ERROR: password - The password must contain at least one digit" elif policy_type == " --uppercase --lowercase": error_msg = "ERROR: password - The password must contain at least one lowercase letter" elif policy_type == " --uppercase --lowercase --digit --special-char": error_msg = "ERROR: password - The password must contain at least one lowercase letter" try: if "--" in policy_type: options = "--set --min-length 6 " + policy_type else: options = "--set --min-length 6 --" + policy_type output, error = self.execute_password_policy(options) options = "--set " + " --rbac-username " + users[0][0] + " --rbac-password " + users[0][1] + " --roles " + \ roles + " --auth-domain " + self.auth_type output, error = self.execute_admin_role_manage(options) if 'WARNING' in output[0]: output = output[1:] if correct_pass: self.assertTrue("SUCCESS: User {0} set".format(users[0][0]) in output[0], "Issue with command create_user") else: if 'ERROR' in output[0]: self.assertTrue(error_msg in output[0], "Issue with password < 6 characters") else: self.assertTrue("SUCCESS: User " in output[0], "Issue with command create_user") finally: options = "--set --min-length 6" output, error = self.execute_password_policy(options) self.assertTrue("SUCCESS: Password policy updated" in output[0], "Issue with setting the policy ") def test_delete_user_noexist(self): users, roles = self._get_user_role() options = "--delete " + "--rbac-username userdoesexist --auth-type " + self.auth_type output, error = self.execute_admin_role_manage(options) self.assertTrue("ERROR: \"User was not found." in output[0], "Issue with delete user that does not exist") def test_my_role(self): final_out = '' options = "--my-roles " self.test_create_user() users, roles = self._get_user_role() self.ldapUser = users[0][0] self.ldapPass = users[0][1] output, error = self.execute_admin_role_manage(options) for out in output: final_out = final_out + out test = json.loads(final_out) for role in test['roles']: self.assertTrue(role['role'] in roles,"Issue with --my-roles") def test_list_roles(self): final_out = '' options = "--list " self.test_create_user() users, roles = self._get_user_role() self.ldapUser = users[0][0] self.ldapPass = users[0][1] output, error = self.execute_admin_role_manage(options) final_out ="" for out in output: final_out = final_out + out if roles not in ['admin','ro_admin','security_admin']: if type(final_out) == str : self.log.info("The test failed as expected") else: test = json.loads(final_out) usrTest =[] for usr in test: if usr['id']
_API_DELETE = "/delrule" _API_GET = "/showrule" _API_LIST = "/showrule" API_INIT_PARAMS = { "name": "Name", "pattern": "Pattern" } _API_BASE_PARAMS = { "name": "Name", "type": "Type", "pattern": "Pattern" } _API_DEFAULT_ATTRIBUTES = { "name": "Name", "type": "Type", "pattern": "Pattern", "matchtype": "MatchType", "addhost": "AddHost", "negate": "Negate", "caseindependant": "CaseIndependent", "includequery": "IncludeQuery", "header": "Header", "mustfail": "MustFail", "headervalue": "HeaderValue", "replacement": "Replacement", "setflagonmatch": "SetFlagOnMatch", "onlyonflag": "OnlyOnFlag" } @property def type_string(self): types = { "0": "MatchContentRule", "1": "AddHeaderRule", "2": "DeleteHeaderRule", "3": "ReplaceHeaderRule", "4": "ModifyURLRule" } if self.type is None: return None return types[str(self.type)] @type_string.setter def type_string(self, value): types = { "MatchContentRule": "0", "AddHeaderRule": "1", "DeleteHeaderRule": "2", "ReplaceHeaderRule": "3", "ModifyURLRule": "4" } if value is None: self.type = None else: self.type = types[value] def __init__(self, loadmaster_info, name, pattern): self.populate_default_attributes({}) self.name = name self.pattern = pattern try: self.endpoint = loadmaster_info["endpoint"] except KeyError: raise RuleMissingLoadmasterInfo("endpoint") try: self.ip_address = loadmaster_info["ip_address"] except KeyError: raise RuleMissingLoadmasterInfo("ip_address") super(Rule, self).__init__(loadmaster_info) def __str__(self): return 'Rule {} on LoadMaster {}'.format( self.name, self.ip_address) def _get_base_parameters(self): base_parameters = super(Rule, self)._get_base_parameters() # Pattern is not necessary for AddHeader rules if self.type == 1: base_parameters.pop("pattern") return base_parameters def populate_default_attributes(self, params): """Populate object instance with standard defaults""" # Get data from inside tag # Tag is unknown since different rule types have # different tag names. The generic code using API_TAG # isn't usable in this case. #params = params.popitem()[1] for attribute, tag in self._API_DEFAULT_ATTRIBUTES.items(): setattr(self, attribute, params.get(tag, None)) self.type_string = self.type class Sso(BaseKempObject): def __init__(self, loadmaster_info, name): self.name = name try: self.endpoint = loadmaster_info["endpoint"] except KeyError: raise RangeMissingLoadmasterInfo("endpoint") super(Sso, self).__init__(loadmaster_info) def __str__(self): return 'SSO {} on LoadMaster {}'.format( self.name, self.ip_address) def _get_base_parameters(self): """Returns the bare minimum FQDN parameters.""" return { "domain": self.name } def save(self, update=False): if not update: response = self._get("/adddomain", self._get_base_parameters()) if not is_successful(response): raise KempTechApiException(get_error_msg(response)) response = self._get("/moddomain", self.to_api_dict()) if is_successful(response): sso_data = get_data(response) self.populate_default_attributes(sso_data) else: raise KempTechApiException(get_error_msg(response)) def delete(self): response = self._get("/deldomain", self._get_base_parameters()) return send_response(response) def populate_default_attributes(self, params): """Populate SSO instance with standard defaults""" self.id = params.get('Id', None) self.name = params.get('Name', None) self.testuser = params.get('testuser', None) self.ldap_version = params.get('ldap_version', None) self.server_side = params.get('server_side', None) self.auth_type = params.get('auth_type', None) self.logon_fmt = params.get('logon_fmt', None) self.logon_fmt2 = params.get('logon_fmt2', None) self.logon_transcode = params.get('logon_transcode', None) self.logon_domain = params.get('logon_domain', None) self.kerberos_domain = params.get('kerberos_domain', None) self.kerberos_kdc = params.get('kerberos_kdc', None) self.kcd_username = params.get('kcd_username', None) self.max_failed_auths = params.get('max_failed_auths', None) self.reset_fail_tout = params.get('reset_fail_tout', None) self.unblock_tout = params.get('unblock_tout', None) self.sess_tout_type = params.get('sess_tout_type', None) self.sess_tout_idle_pub = params.get('sess_tout_idle_pub', None) self.sess_tout_duration_pub = params.get('sess_tout_duration_pub', None) self.sess_tout_idle_priv = params.get('sess_tout_idle_priv', None) self.sess_tout_duration_priv = params.get('sess_tout_duration_priv', None) self.cert_check_asi = params.get('cert_check_asi', None) class Fqdn(BaseKempObject): _API_ADD = "/addfqdn" _API_MOD = "/modfqdn" _API_DELETE = "/delfqdn" _API_GET = "/showfqdn" _API_LIST = "/listfqdns" API_TAG = "fqdn" API_INIT_PARAMS = { "fqdn": "FullyQualifiedDomainName" } _API_BASE_PARAMS = [ "fqdn" ] _API_DEFAULT_ATTRIBUTES = { "fqdn": "FullyQualifiedDomainName", "status": "Status", "selectioncriteria": "SelectionCriteria", "failtime": "FailTime", "siterecoverymode": "SiteRecoveryMode", "failover": "failover", "publicrequestvalue": "publicRequestValue", "privaterequestvalue": "privateRequestValue", "localsettings": "LocalSettings", "localttl": "LocalTTL", "localsticky": "LocalSticky", "unanimouschecks": "UnanimousChecks" } def __init__(self, loadmaster_info, fqdn): self.fqdn = fqdn # to avoid AttributeErrors later super(Fqdn, self).__init__(loadmaster_info) def __str__(self): return 'FQDN {} on LoadMaster {}'.format( self.fqdn, self.ip_address) def save(self, update=False): try: if self.selectioncriteria != "lb": # Failover is not available when not using Location Based del self.failover except AttributeError: pass super(Fqdn, self).save(update) self.refresh() def populate_default_attributes(self, params): super(Fqdn, self).populate_default_attributes(params) # Failtime is set by minute, but recorded by second try: # Try to cast to integer first self.failtime = int(self.failtime) # Check if failtime is a non-zero factor of 60 if self.failtime > 0 and self.failtime % 60 == 0: # Convert from seconds to minutes self.failtime = int(self.failtime / 60) except (TypeError, AttributeError): self.failtime = None @property def sites(self): return {site.ipaddress: site for site in self.get_sites()} def create_site(self, ip): """Site factory with pre-configured LoadMaster connection.""" return Site(self.access_info, ip) def get_site(self, ip): validate_ip(ip) service_id = { "fqdn": self.fqdn, "ipaddress": ip } response = self._get("/showfqdn", service_id) xml_object = get_data(response) maps = xml_object["fqdn"].get(Site.API_TAG, {}) if not isinstance(maps, list): maps = [maps] map = [m for m in maps if m['IPAddress'] == service_id["ipaddress"]] # This shouldn't happen, but we should catch it anyway if len(map) != 1: raise LoadMasterParameterError( "Unexpected number of matching sites specified.", map) return build_object(Site, self.access_info, map[0]) def get_sites(self): fqdn = { "fqdn": self.fqdn } try: response = self._get(self._API_LIST, fqdn) data = get_data(response) xml_object = data[self.API_TAG].get(Site.API_TAG, []) except KempTechApiException: xml_object = [] obj_list = [] # If there is no API_TAG key, build will fail with a # ValidationError, which is the best we can do for now # (without changing the upstream code and raising an # exception earlier, possibly retrying) xml_object = cast_to_list(xml_object) for x in xml_object: obj = self.build_site(x) obj_list.append(obj) return obj_list def build_site(self, site): """Create a object instance with standard defaults""" build_parameters = {} for parameter, tag in Site.API_INIT_PARAMS.items(): build_parameters[parameter] = site.get(tag) obj = Site(self.access_info, **build_parameters) obj.populate_default_attributes(site) return obj class Site(BaseKempObject): _API_ADD = "/addmap" _API_MOD = "/modmap" _API_DELETE = "/delmap" _API_GET = "/showfqdn" _API_LIST = "/showfqdn" API_TAG = "Map" API_INIT_PARAMS = { "ip": "IPAddress" } _API_BASE_PARAMS = { "fqdn": "fqdn", "ip": "ip" } _API_DEFAULT_ATTRIBUTES = { "index": "Index", "status": "Status", "clustervsaddress": "ClusterVSAddress", "checker": "Checker", "checkeraddr": "checkerAddr", "checkerport": "CheckerPort", "weight": "Weight", "enable": "Enable", "locationlatitude": "LocationLatitude", "locationlongitude": "LocationLongitude", "continent": "continent", "country": "country", "customlocation": "customLocation", "cluster": "Cluster", "mapaddress": "MappedAddress", "mapport": "MappedPort" } _API_IGNORE = ( "log_urls", "ip_address", "endpoint", "index", "status", "continent", "country", "customlocation", "ipaddress" ) # Remap ipaddress to ip because the API is inconsistent @property def ipaddress(self): return self.ip @ipaddress.setter def ipaddress(self, value): self.ip = value @property def mappedaddress(self): return self.mapaddress @mappedaddress.setter def mappedaddress(self, value): self.mapaddress = value @property def mappedport(self): return self.mapport @mappedport.setter def mappedport(self, value): self.mapport = value def __init__(self, loadmaster_fqdn_info, ip): self.fqdn = loadmaster_fqdn_info["fqdn"] self.ip = ip validate_ip(ip) try: self.fqdn = loadmaster_fqdn_info["fqdn"] except KeyError: raise SiteMissingFQDNInfo("fqdn") try: self.endpoint = loadmaster_fqdn_info["endpoint"] except KeyError: raise SiteMissingLoadmasterInfo("endpoint") try: self.ip_address = loadmaster_fqdn_info["ip_address"] except KeyError: raise SiteMissingLoadmasterInfo("ip_address") super(Site, self).__init__(loadmaster_fqdn_info) def __str__(self): return 'Site {} in FQDN {} on LoadMaster {}'.format( self.ip, self.fqdn, self.ip_address) def _get_base_parameters(self): return { "fqdn": self.fqdn, "ip": self.ip } def populate_default_attributes(self, params): super(Site, self).populate_default_attributes(params) # Fix annoying API inconsistencies # Normalize location lists so we always get a regular list if not isinstance(self.continent, list): if self.continent is None: self.continent = [] else: self.continent = [self.continent] if not isinstance(self.country, list): if self.country is None: self.country = [] else: self.country = [self.country] if not isinstance(self.customlocation, list): if self.customlocation is None: self.customlocation = [] else: self.customlocation = [self.customlocation] try: self.checkerport = int(self.checkerport) except (ValueError, AttributeError): self.checkerport = None finally: if not 1 < self.checkerport < 65530: self.checkerport = None def save(self, update=False): if not update: response = self._get(self._API_ADD, self._get_base_parameters()) else: response = self._get(self._API_MOD, self.to_api_dict()) if not is_successful(response): raise KempTechApiException(get_error_msg(response)) # Secondary request is needed because the add/mod action # does not return any data. Therefore, we need to explicitly # retrieve the info. response = self._get(self._API_GET, self._get_base_parameters()) if is_successful(response): response = self._get(self._API_GET, self._get_base_parameters()) data = get_data(response) maps = data["fqdn"].get(self.API_TAG, {}) if not isinstance(maps, list): maps = [maps] map = [m for m in maps if m['IPAddress'] == self.ipaddress] # This shouldn't happen, but we should catch it anyway if len(map) > 1: raise LoadMasterParameterError( "Multiple matching sites specified.", map) if len(map) < 1: raise LoadMasterParameterError( "No matching sites specified.", map) site = map[0] self.populate_default_attributes(site) else: raise KempTechApiException(get_error_msg(response)) def refresh(self): response = self._get( self._API_GET, self._get_base_parameters()) if is_successful(response): response = self._get(self._API_GET, self._get_base_parameters()) data = get_data(response) maps = data["fqdn"].get(self.API_TAG, {}) if not isinstance(maps, list): maps = [maps] map = [m for m in maps if m['IPAddress'] == self.ipaddress] # This shouldn't happen, but we should catch it anyway if len(map) > 1: raise LoadMasterParameterError( "Multiple matching sites specified.", map) if len(map) < 1: raise LoadMasterParameterError( "No matching sites specified.", map) site = map[0] self.populate_default_attributes(site) else: raise KempTechApiException(get_error_msg(response)) @property def locations(self): return { "continent": self.continent, "country": self.country, "customlocation": self.customlocation } @staticmethod def __get_map_parameters(location, is_continent=False, is_custom=False): if is_custom is False: parameters = { "countrycode": location.upper() } if is_continent is True: parameters["iscontinent"] = "yes" else: parameters["iscontinent"] = "no" else: parameters =
<filename>programs/representations/representations.py #Copyright 2020 DB Engineering #Licensed under the Apache License, Version 2.0 (the "License"); #you may not use this file except in compliance with the License. #You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 #Unless required by applicable law or agreed to in writing, software #distributed under the License is distributed on an "AS IS" BASIS, #WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. #See the License for the specific language governing permissions and #limitations under the License. import json import base64 import sys sys.path.append('..\\') import ontology.ontology from pretty import PrettyPrint def _convert_to_base64(data): """ Convert a data object into a base64 message. Used as a codeword to uniquely identify each asset """ if isinstance(data,set): data = list(data) data.sort() data = tuple(data) data = str(data) if isinstance(data,list): data.sort() data = tuple(data) data = str(data) if isinstance(data,tuple): data = str(data) encoded_bytes = base64.b64encode(data.encode("utf-8")) encoded_str = str(encoded_bytes, "utf-8") return encoded_str class Asset: """ An asset model for the loadsheet data. Holds all the relevant loadsheet asset-related data and serves as a wrapper for the Field class, allowing user to add/update fields directly on the asset object. """ def __init__(self,building,general_type,type_name,asset_name,full_asset_name): """ Initialize the model args: - building: string building name - general_type: string asset type e.g. VAV - type_name: Unique name for type definitions - asset_name: string physical name - full_asset_name: BMS internal name returns: new asset objects """ self.building = building self.general_type = general_type self.type_name = type_name self.asset_name = asset_name self.full_asset_name = full_asset_name self.fields = {} self.matched = False self.placeholderid = 10000 def add_field(self,field_name,bms_info,bacnet_address,manually_mapped=False,placeholder=False): """ Adds a field to the asset object args: - field_name: string point name - bms_info: dictionary, describing bms type, location, controlProgram, name, path, and type - bacnet_address: dictionary describing deviceId, objectId, objectName, objectType, and units - manuallyMapped: flag if field is manually filled in, set false by default - placeholder: flag for placeholder field creation, default false returns: N/A """ assert field_name not in self.fields, "Field {} already set.".format(field_name) if placeholder: self.bms_info={'bms_type':"",'location':'', 'controlprogram':'', 'name':'Placeholder', 'path':'x', 'type':'x'} self.bacnet_address={'deviceid':'', 'objectid':self.placeholderid, 'objectname':'x', 'objecttype':'x', 'units':''} self.placeholderid += 1 self.fields[field_name] = Field(field_name,self.bms_info,self.bacnet_address,manually_mapped, placeholder = True) else: self.fields[field_name] = Field(field_name,bms_info,bacnet_address,manually_mapped) def update_field(self,field_name,bms_info,bacnet_address,manually_mapped=False): """ Update a field on the asset. args: - field_name: string point name - bms_info: dictionary, describing bms type, location, controlProgram, name, path, and type - bacnet_address: dictionary describing deviceID, objectID, objectName, objectType, and units - manuallyMapped: flag if field is manually filled in, set false by default returns: N/A """ assert field_name in self.fields, "Field not defined." del self.fields[field_name] self.fields[field_name] = Field(field_name,bms_info,bacnet_address,manually_mapped) def update_type(self,type_name): """ Sets the type_name. args: - type_name: #TODO returns: N/A """ self.type_name = type_name def remove_field(self,field_name): """ Remove a field from the asset. args: - field_name: string point name to be removed returns: N/A """ assert field_name in self.fields, "Field not defined; cannot remove." del self.fields[field_name] def get_general_type(self): """ Get the general type for the asset. returns: general_type string """ return self.general_type def get_fields(self): """ Get the field names on the asset. returns: list of field name strings """ return [field for field in self.fields] def get_field_details(self,field_name): """ Get the details for a specified field. args: - field_name: string field name to retrieve returns: dictionary of BMS info of passed field """ assert field_name in self.fields, "Field not defined; cannot find." return self.fields[field_name].get_field_details() def get_all_field_details(self): """ Get the details for all fields on the asset. returns: dictionary of BMS info for all fields """ field_details = {} for field in self.fields: field_details[field] = self.fields[field].get_field_details() return field_details def get_asset_details(self): """ Get all the asset details stored in the object. returns: dictionary of asset details """ asset_details = { 'building':self.building, 'general_type':self.general_type, 'type_name':self.type_name, 'asset_name':self.asset_name, 'full_asset_name':self.full_asset_name } return asset_details def add_match(self, match): """ adds match to asset args: - match: match object to connect """ self.match = match self.matched = True def apply_match(self): """ applies match object details to the asset adds necessary placeholder fields and updates name """ if self.matched: #apply type names self.update_type(self.match.ont_type_name) #apply fields existing_fields = self.get_fields() for field in self.match.ont_type_fields: if field[0] not in existing_fields and field[1]: self.add_field(field[0], '', '', placeholder=True) def dump(self): """ Dump all asset details. returns: dictionary of asset and field details """ details = self.get_asset_details() details.update({'fields':self.get_all_field_details()}) return details class Field: """ A field model for the loadsheet data. Requires BMS specific metadata and BACnet address info. """ #TODO: Add in BMS type functionality that spans the different classes def __init__(self,field_name,bms_info,bacnet_address,manually_mapped=False,placeholder=False): """ Initialize the model. args: - field_name: string point name - bms_info: dictionary, describing bms type, location, controlProgram, name, path, and type - bacnet_address: dictionary describing deviceID, objectID, objectName, objectType, and units - manuallyMapped: flag if field is manually filled in, set false by default - placeholder: flag for placeholder field creation, default false returns: field object """ self.field_name=field_name self.manually_mapped=manually_mapped if not placeholder: self.bms_info = bms_info assert 'bms_type' in self.bms_info, "Argument 'bms_info' requires a 'bms_type' key." if bms_info['bms_type'] == 'ALC': required_fields = ['location','controlprogram','name','type','path'] for field in required_fields: assert field in self.bms_info, "Field '{}' not in 'bms_info' argument.".format(field) self.bacnet_address = bacnet_address bacnet_requirements = ['deviceid','objecttype','objectid','objectname','units'] for field in bacnet_requirements: assert field in bacnet_requirements, "Field '{}' not in 'bacnet_address' argument.".format(field) else: self.bms_info = bms_info self.bacnet_address = bacnet_address def get_field_details(self): """ Return all the field details in a single dictionary. returns: dictionary of BMS info of passed field """ details = {'bms_info':self.bms_info,'bacnet_address':self.bacnet_address,'manually_mapped':self.manually_mapped} return details class Assets: """ A wrapper class to handle asset models. Holds all relevant loadsheet data for all asset object passed in. """ def __init__(self): """ Initialize the class. """ self.assets = {} self.determined_types = {} self.ununsed_data = [] def add_asset(self,building,general_type,type_name,asset_name,full_asset_name): """ Update an asset or add it if it doesnt exist yet. args: - building: string building name - general_type: string asset type e.g. VAV - type_name: unique name for type definitions - asset_name: string physical name - full_asset_name: BMS internal name """ assert full_asset_name not in self.assets, "Asset {} already exists.".format(full_asset_name) asset = Asset(building,general_type,type_name,asset_name,full_asset_name) self.assets[full_asset_name] = asset def remove_asset(self,full_asset_name): """ Remove an asset. args: - full_asset_name: name of asset to remove """ assert full_asset_name in self.assets, "Asset {} does not exist.".format(full_asset_name) del self.assets[full_asset_name] def update_type(self,full_asset_name,type_name): """ Update type of a given asset. args: - full_asset_name: name of asset to update - type_name: string type name to update asset to match """ self.assets[full_asset_name].update_type(type_name) def add_field(self,full_asset_name,field_name,bms_info,bacnet_address,manually_mapped=False): """ Add a field. args: - full_asset_name: name of asset to add field to - field_name: string point name - bms_info: dictionary, describing location, controlProgram, name, path, and type - bacnet_address: dictionary describing deviceID, objectID, objectName, objectType, and units - manuallyMapped: flag if field is manually filled in, set false by default """ self.assets[full_asset_name].add_field(field_name,bms_info,bacnet_address,manually_mapped) def remove_field(self,full_asset_name,field_name): """ Remove a field. args: - full_asset_name: name of asset to remove field from - field_name: string point name to be removed """ self.assets[full_asset_name].remove_field(field_name) def get_fields(self,full_asset_name): """ Get fields for an asset. args: - full_asset_name: name of asset ot get fields of returns: list of field objects """ return self.assets[full_asset_name].get_fields() def get_all_asset_fields(self): """ Get all distinct fields in all assets. Easy for validation. returns: list of unique fields in assets """ unique_fields = set() for asset in self.assets: fields = self.get_fields(asset) for field in fields: unique_fields.add(field) return unique_fields def get_general_type(self,full_asset_name): """ Get the general type for the asset. args: - full_asset_name: asset to get general_type of returns: general type of asset """ return self.assets[full_asset_name].get_general_type() def get_general_types(self): """ Get all general types defined for all assets. returns: list of all general types """ general_types = set() for asset in self.assets: gt = self.assets[asset].get_general_type() general_types.add(gt) return general_types def dump_asset(self,full_asset_name): """ Dump asset contents. args: - full_asset_name: asset to get dump results: full asset dump """ dump_details = self.assets[full_asset_name].dump() return dump_details def dump_all_assets(self): """ Dump all assets. returns: full data dump """ dump_details = {} for asset in self.assets: dump_details[asset] = self.dump_asset(asset) return dump_details def load_from_row(self,data_row): """ Load from a row of data. args: - data_row: row of data to add """ if data_row['fullassetpath'] not in self.assets: self.add_asset( data_row['building'], data_row['generaltype'], data_row['typename'], data_row['assetname'], data_row['fullassetpath'] ) bms_info = { 'bms_type':'ALC', 'location':data_row['location'], 'controlprogram':data_row['controlprogram'], 'name':data_row['name'], 'type':data_row['type'], 'path':data_row['path'] } bacnet_address = { 'deviceid':data_row['deviceid'], 'objectid':data_row['objectid'], 'objecttype':data_row['objecttype'], 'objectname':data_row['objectname'], 'units':data_row['units'] } self.add_field(data_row['fullassetpath'],data_row['standardfieldname'],bms_info,bacnet_address,data_row['manuallymapped']) def load_from_data(self,data): """ Load from a data object. args: - data: dictionary of lists representing loadsheet data """ for row in data: if row['required'] == 'YES': self.load_from_row(row) else: self.ununsed_data.append(row) def dump_to_data(self): """ Dump the assets object into the original data format. Append any unused rows of data that were not applied to assets. returns: dictionary of lists representing loadsheet data """ # TODO: Create loadsheet config object set data = self.dump_all_assets() out_data = [] for asset in data: for field in data[asset]['fields']: fullAssetPath = data[asset]['full_asset_name'] assetName = data[asset]['asset_name'] building = data[asset]['building'] generalType = data[asset]['general_type'] typeName = data[asset]['type_name'] standardFieldName = field deviceId = data[asset]['fields'][field]['bacnet_address']['deviceid'] objectId = data[asset]['fields'][field]['bacnet_address']['objectid'] objectName = data[asset]['fields'][field]['bacnet_address']['objectname'] objectType = data[asset]['fields'][field]['bacnet_address']['objecttype'] units = data[asset]['fields'][field]['bacnet_address']['units'] location = data[asset]['fields'][field]['bms_info']['location'] controlProgram = data[asset]['fields'][field]['bms_info']['controlprogram'] manually_mapped = data[asset]['fields'][field]['manually_mapped'] name = data[asset]['fields'][field]['bms_info']['name'] path = data[asset]['fields'][field]['bms_info']['path'] ttype = data[asset]['fields'][field]['bms_info']['type'] row = { 'location':location, 'controlprogram':controlProgram, 'name':name, 'type':ttype, 'path':path, 'deviceid':deviceId, 'objecttype':objectType, 'objectid':objectId, 'objectname':objectName, 'units':units, 'required':'YES', 'manuallymapped':manually_mapped, 'building':building, 'generaltype':generalType, 'typename':typeName, 'assetname':assetName, 'fullassetpath':fullAssetPath, 'standardfieldname':standardFieldName } out_data.append(row) if len(self.ununsed_data)>0: for row in self.ununsed_data: out_data.append(row) return out_data def determine_types(self): """ Use the unique fields for each asset to create a list of unique types. returns: list of unique types """ unique_types = {} for asset in self.assets: fields = self.get_fields(asset) general_type = self.get_general_type(asset) field_code = _convert_to_base64(fields) if field_code not in unique_types: unique_types[field_code] = {'general_type':general_type,'fields':fields,'assets':[asset]} else: unique_types[field_code]['assets'].append(asset) return unique_types def validate_without_errors(self, ontology): """ Validate the subfields and fields against the ontology. Only prints errors seen, but runs through everything args: - ontology: the ontology object to validate the assets against """ fields = self.get_all_asset_fields() invalid_subfields = ontology.check_subfields(fields) invalid_fields = ontology.check_fields(fields) has_errors = False if len(invalid_subfields)>0: has_errors = True print('Undefined subfields (define them or change them):') for subfield in invalid_subfields: print('\t{}'.format(subfield)) if len(invalid_fields)>0: has_errors = True print('Undefined fields (define them or change them):') for field in invalid_fields: print('\t{}'.format(field)) if has_errors == False: print("No representation errors!") def validate(self,ontology): """ Validate the type subfields and fields against the ontology. Throws errors when issue encountered args: - ontology: ontology object to check assets against """ fields = self.get_all_asset_fields() invalid_subfields = ontology.check_subfields(fields) invalid_fields = ontology.check_fields(fields) assert len(invalid_subfields) == 0, "Undefined subfields (define them or change them): {}".format(str(invalid_subfields)) assert len(invalid_fields) == 0, "Undefined fields (define them or change them): {}".format(str(invalid_fields)) print("[INFO]\tNo representation errors!") ''' #functionality not complete #removed 20200727 akoltko def dump_to_steve_format(self): """ Dump the data content to the Steve format. args: - """ # TODO: Add functionality for this to CLI and Handler # Output for STEVE format. steve_headers = ( 'location','controlProgram','name','type','objectType','deviceId','objectName','units','path', 'required','bacnetAvailable','building','generalType','assetName','fullAssetPath','standardFieldName' ) data = self.dump_to_data() s = '\t' print(s.join(steve_headers)) for row in data: out_row = {} for i in steve_headers: if i in row: if i == 'objectType': out_row['objectType'] = row['objectType'] +':'+str(row['objectId']) elif i == 'deviceId': out_row['deviceId'] = 'DEV:' + str(row['deviceId']) else: out_row[i] = row[i] else: out_row[i] = '' s = '\t' print(s.join(out_row.values())) ''' ### Test block. if __name__ ==
<gh_stars>1-10 import playfab.PlayFabErrors as PlayFabErrors import playfab.PlayFabHTTP as PlayFabHTTP import playfab.PlayFabSettings as PlayFabSettings """ API methods for managing multiplayer servers. API methods for managing parties. """ def CancelAllMatchmakingTicketsForPlayer(request, callback, customData = None, extraHeaders = None): """ Cancel all active tickets the player is a member of in a given queue. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking/cancelallmatchmakingticketsforplayer """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/CancelAllMatchmakingTicketsForPlayer", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CancelAllServerBackfillTicketsForPlayer(request, callback, customData = None, extraHeaders = None): """ Cancel all active backfill tickets the player is a member of in a given queue. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking/cancelallserverbackfillticketsforplayer """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/CancelAllServerBackfillTicketsForPlayer", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CancelMatchmakingTicket(request, callback, customData = None, extraHeaders = None): """ Cancel a matchmaking ticket. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking/cancelmatchmakingticket """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/CancelMatchmakingTicket", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CancelServerBackfillTicket(request, callback, customData = None, extraHeaders = None): """ Cancel a server backfill ticket. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking/cancelserverbackfillticket """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/CancelServerBackfillTicket", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CreateBuildAlias(request, callback, customData = None, extraHeaders = None): """ Creates a multiplayer server build alias. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/createbuildalias """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/CreateBuildAlias", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CreateBuildWithCustomContainer(request, callback, customData = None, extraHeaders = None): """ Creates a multiplayer server build with a custom container. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/createbuildwithcustomcontainer """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/CreateBuildWithCustomContainer", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CreateBuildWithManagedContainer(request, callback, customData = None, extraHeaders = None): """ Creates a multiplayer server build with a managed container. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/createbuildwithmanagedcontainer """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/CreateBuildWithManagedContainer", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CreateBuildWithProcessBasedServer(request, callback, customData = None, extraHeaders = None): """ Creates a multiplayer server build with the server running as a process. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/createbuildwithprocessbasedserver """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/CreateBuildWithProcessBasedServer", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CreateMatchmakingTicket(request, callback, customData = None, extraHeaders = None): """ Create a matchmaking ticket as a client. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking/creatematchmakingticket """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/CreateMatchmakingTicket", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CreateRemoteUser(request, callback, customData = None, extraHeaders = None): """ Creates a remote user to log on to a VM for a multiplayer server build. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/createremoteuser """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/CreateRemoteUser", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CreateServerBackfillTicket(request, callback, customData = None, extraHeaders = None): """ Create a backfill matchmaking ticket as a server. A backfill ticket represents an ongoing game. The matchmaking service automatically starts matching the backfill ticket against other matchmaking tickets. Backfill tickets cannot match with other backfill tickets. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking/createserverbackfillticket """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/CreateServerBackfillTicket", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def CreateServerMatchmakingTicket(request, callback, customData = None, extraHeaders = None): """ Create a matchmaking ticket as a server. The matchmaking service automatically starts matching the ticket against other matchmaking tickets. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking/createservermatchmakingticket """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/CreateServerMatchmakingTicket", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def DeleteAsset(request, callback, customData = None, extraHeaders = None): """ Deletes a multiplayer server game asset for a title. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/deleteasset """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/DeleteAsset", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def DeleteBuild(request, callback, customData = None, extraHeaders = None): """ Deletes a multiplayer server build. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/deletebuild """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/DeleteBuild", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def DeleteBuildAlias(request, callback, customData = None, extraHeaders = None): """ Deletes a multiplayer server build alias. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/deletebuildalias """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/DeleteBuildAlias", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def DeleteBuildRegion(request, callback, customData = None, extraHeaders = None): """ Removes a multiplayer server build's region. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/deletebuildregion """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/DeleteBuildRegion", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def DeleteCertificate(request, callback, customData = None, extraHeaders = None): """ Deletes a multiplayer server game certificate. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/deletecertificate """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/DeleteCertificate", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def DeleteContainerImageRepository(request, callback, customData = None, extraHeaders = None): """ Deletes a container image repository. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/deletecontainerimagerepository """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/DeleteContainerImageRepository", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def DeleteRemoteUser(request, callback, customData = None, extraHeaders = None): """ Deletes a remote user to log on to a VM for a multiplayer server build. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/deleteremoteuser """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/DeleteRemoteUser", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def EnableMultiplayerServersForTitle(request, callback, customData = None, extraHeaders = None): """ Enables the multiplayer server feature for a title. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/enablemultiplayerserversfortitle """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/EnableMultiplayerServersForTitle", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def GetAssetUploadUrl(request, callback, customData = None, extraHeaders = None): """ Gets the URL to upload assets to. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/getassetuploadurl """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/GetAssetUploadUrl", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def GetBuild(request, callback, customData = None, extraHeaders = None): """ Gets a multiplayer server build. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/getbuild """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/GetBuild", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def GetBuildAlias(request, callback, customData = None, extraHeaders = None): """ Gets a multiplayer server build alias. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/getbuildalias """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/GetBuildAlias", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def GetContainerRegistryCredentials(request, callback, customData = None, extraHeaders = None): """ Gets the credentials to the container registry. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/getcontainerregistrycredentials """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/MultiplayerServer/GetContainerRegistryCredentials", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def GetMatch(request, callback, customData = None, extraHeaders = None): """ Get a match. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking/getmatch """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/GetMatch", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def GetMatchmakingQueue(request, callback, customData = None, extraHeaders = None): """ SDK support is limited to C# and Java for this API. Get a matchmaking queue configuration. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking-admin/getmatchmakingqueue """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/GetMatchmakingQueue", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def GetMatchmakingTicket(request, callback, customData = None, extraHeaders = None): """ Get a matchmaking ticket by ticket Id. https://docs.microsoft.com/rest/api/playfab/multiplayer/matchmaking/getmatchmakingticket """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must call GetEntityToken before calling this method") def wrappedCallback(playFabResult, error): if callback: callback(playFabResult, error) PlayFabHTTP.DoPost("/Match/GetMatchmakingTicket", request, "X-EntityToken", PlayFabSettings._internalSettings.EntityToken, wrappedCallback, customData, extraHeaders) def GetMultiplayerServerDetails(request, callback, customData = None, extraHeaders = None): """ Gets multiplayer server session details for a build. https://docs.microsoft.com/rest/api/playfab/multiplayer/multiplayerserver/getmultiplayerserverdetails """ if not PlayFabSettings._internalSettings.EntityToken: raise PlayFabErrors.PlayFabException("Must
#!/usr/bin/env python # -*- coding: utf-8 -*- # # rtk.hardware.ListBook.py is part of the RTK Project # # All rights reserved. # Copyright 2007 - 2017 <NAME> andrew.rowland <AT> reliaqual <DOT> com # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # # 1. Redistributions of source code must retain the above copyright notice, # this list of conditions and the following disclaimer. # # 2. Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # # 3. Neither the name of the copyright holder nor the names of its contributors # may be used to endorse or promote products derived from this software # without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A # PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER # OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, # EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, # PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR # PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF # LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING # NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS # SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. """ ############################### Hardware Package List Book View ############################### """ import sys # Import modules for localization support. import gettext import locale # Modules required for the GUI. import pango try: import pygtk pygtk.require('2.0') except ImportError: sys.exit(1) try: import gtk except ImportError: sys.exit(1) try: import gtk.glade except ImportError: sys.exit(1) try: import gobject except ImportError: sys.exit(1) # Import other RTK modules. try: import Configuration import gui.gtk.Widgets as Widgets from gui.gtk.Matrix import Matrix as rtkMatrix except ImportError: import rtk.Configuration as Configuration import rtk.gui.gtk.Widgets as Widgets from rtk.gui.gtk.Matrix import Matrix as rtkMatrix __author__ = '<NAME>' __email__ = '<EMAIL>' __organization__ = 'ReliaQual Associates, LLC' __copyright__ = 'Copyright 2007 - 2016 Andrew "weibullguy" Rowland' try: locale.setlocale(locale.LC_ALL, Configuration.LOCALE) except locale.Error: locale.setlocale(locale.LC_ALL, '') _ = gettext.gettext class ListView(gtk.VBox): """ The List Book view displays all the matrices and lists associated with the Hardware Class. The attributes of a Hardware List Book view are: :ivar _dtc_matrices: the :py:class:`rtk.datamodels.Matrix.Matrix` data controller instance. :ivar _lst_handler_id: list containing the signal handler ID's for each of the gtk.Widget()s who have a callback method. :ivar gtk.Button btnSaveFuncHard: the gtk.Button() to save the Hardware/ Hardware Matrix. :ivar gtk.Button btnSaveFuncSoft: the gtk.Button() to save the Hardware/ Software Matrix. :ivar gtk.Button btnSaveFuncTest: the gtk.Button() to save the Hardware/ Testing Matrix. :ivar mtxHardware: the :py:class:`rtk.gui.gtk.Matrix.Matrix` that displays the Hardware/Hardware Matrix. :ivar mtxSoftware: the :py:class:`rtk.gui.gtk.Matrix.Matrix` that displays the Hardware/Software Matrix. :ivar mtxTesting: the :py:class:`rtk.gui.gtk.Matrix.Matrix` that displays the Hardware/Testing Matrix. :ivar gtk.TreeView tvwPartsList: the gtk.TreeView() that displays the list of components/parts directly comprising the selected Hardware Assembly. :ivar gtk.TreeView tvwIncidentsList: the gtk.TreeView() that displays the list of program incidents related to the selected Hardware Assembly. """ def __init__(self, modulebook): """ Initializes the List Book view for the Hardware package. :param modulebook: the :py:class:`rtk.function.ModuleBook` to associate with this List Book. """ gtk.VBox.__init__(self) # Define private dictionary attributes. # Define private list attributes. self._lst_handler_id = [] # Define private scalar attributes. self._dtc_matrices = modulebook.mdcRTK.dtcMatrices self._mdcRTK = modulebook.mdcRTK # Define public dictionary attributes. # Define public list attributes. # Define public scalar attributes. # Parts List page widgets. self.tvwPartsList = gtk.TreeView() self.tvwPartsList.set_grid_lines(gtk.TREE_VIEW_GRID_LINES_BOTH) # Incidents List page widgets. self.tvwIncidentList = gtk.TreeView() self.tvwIncidentList.set_grid_lines(gtk.TREE_VIEW_GRID_LINES_BOTH) # Testing Matrix page widgets. self.btnSaveHardTest = Widgets.make_button(width=35, image='save') self.mtxTesting = rtkMatrix() self.mtxTesting.n_fixed_columns = 3 # Validation Matrix page widgets. self.btnSaveHardVal = Widgets.make_button(width=35, image='save') self.mtxValidation = rtkMatrix() self.mtxValidation.n_fixed_columns = 3 # Set tooltips for the gtk.Widgets(). self.tvwPartsList.set_tooltip_markup(_(u"Displays the list of " u"components/parts directly " u"comprising the selected " u"Hardware assembly.")) self.tvwIncidentList.set_tooltip_markup(_(u"Displays the list of " u"incidents associated with " u"the selected Hardware " u"assembly.")) self.mtxTesting.treeview.set_tooltip_markup(_(u"Displays the " u"relationship between " u"system Hardware and " u"system development " u"tests. This matrix " u"shows which tests " u"partially (P) or " u"completely (C) " u"test a Hardware item, " u"if at all.")) self.mtxValidation.treeview.set_tooltip_markup(_(u"Displays the " u"relationship " u"between system " u"Hardware and " u"program Validation " u"tasks. This " u"matrix shows which " u"Validation task " u"partially (P) or " u"completely (C) " u"validates a " u"Hardware item, if " u"at all.")) # Connect widget signals to callback methods. We do this here rather # than in each method so the _lst_handler_id index is the same as the # dicMatrix key for each Matrix. self._lst_handler_id.append( self.mtxTesting.connect('changed', self._on_matrix_changed, 0)) self._lst_handler_id.append( self.mtxValidation.connect('changed', self._on_matrix_changed, 1)) self._lst_handler_id.append( self.btnSaveHardTest.connect('clicked', self._on_button_clicked, 2)) self._lst_handler_id.append( self.btnSaveHardVal.connect('clicked', self._on_button_clicked, 3)) # Put it all together. _notebook = self._create_notebook() self.pack_start(_notebook) self.show_all() def _create_notebook(self): """ Method to create the Hardware class List View gtk.Notebook(). :return: _notebook :rtype: gtk.Notebook """ _notebook = gtk.Notebook() # Set the user's preferred gtk.Notebook tab position. if Configuration.TABPOS[1] == 'left': _notebook.set_tab_pos(gtk.POS_LEFT) elif Configuration.TABPOS[1] == 'right': _notebook.set_tab_pos(gtk.POS_RIGHT) elif Configuration.TABPOS[1] == 'top': _notebook.set_tab_pos(gtk.POS_TOP) else: _notebook.set_tab_pos(gtk.POS_BOTTOM) self._create_parts_list_page(_notebook) self._create_incident_list_page(_notebook) self._create_testing_matrix_page(_notebook) self._create_validation_matrix_page(_notebook) return _notebook def _create_parts_list_page(self, notebook): """ Method to create the Parts List page in the List View. :param gtk.Notebook notebook: the gtk.Notebook() to add the page. :return: False if successful or True if an error is encountered. :rtype: bool """ # Build up the containers for the Parts List page. _scrollwindow = gtk.ScrolledWindow() _scrollwindow.set_policy(gtk.POLICY_AUTOMATIC, gtk.POLICY_AUTOMATIC) _scrollwindow.add(self.tvwPartsList) _frame = Widgets.make_frame() _frame.set_shadow_type(gtk.SHADOW_ETCHED_OUT) _frame.add(_scrollwindow) _model = gtk.TreeStore(gobject.TYPE_STRING, gobject.TYPE_STRING, gobject.TYPE_STRING) self.tvwPartsList.set_model(_model) _headings = [_(u"Reference\nDesignator"), _(u"Name"), _(u"Part Number")] for _index, _heading in enumerate(_headings): _cell = gtk.CellRendererText() _cell.set_property('background', 'light grey') _cell.set_property('editable', 0) _cell.set_property('wrap-width', 250) _cell.set_property('wrap-mode', pango.WRAP_WORD_CHAR) _cell.set_property('yalign', 0.1) _label = gtk.Label() _label.set_line_wrap(True) _label.set_alignment(xalign=0.5, yalign=0.5) _label.set_justify(gtk.JUSTIFY_CENTER) _label.set_markup("<span weight='bold'>" + _heading + "</span>") _label.set_use_markup(True) _label.show_all() _column = gtk.TreeViewColumn() _column.set_widget(_label) _column.set_visible(True) _column.set_sizing(gtk.TREE_VIEW_COLUMN_AUTOSIZE) _column.pack_start(_cell, True) _column.set_attributes(_cell, text=_index) self.tvwPartsList.append_column(_column) # Add the Parts List page to the gtk.Notebook(). _label = gtk.Label() _label.set_markup(_(u"<span weight='bold'>Parts\nList</span>")) _label.set_alignment(xalign=0.5, yalign=0.5) _label.set_justify(gtk.JUSTIFY_CENTER) _label.show_all() _label.set_tooltip_text(_(u"Displays the list of components/parts " u"directly comprising the selected Hardware " u"assembly.")) notebook.insert_page(_frame, tab_label=_label, position=-1) return False def _create_incident_list_page(self, notebook): """ Method to create the Incident List page in the List View. :param gtk.Notebook notebook: the gtk.Notebook() to add the page. :return: False if successful or True if an error is encountered. :rtype: bool """ # Build up the containers for the Incident List page. _scrollwindow = gtk.ScrolledWindow() _scrollwindow.set_policy(gtk.POLICY_AUTOMATIC, gtk.POLICY_AUTOMATIC) _scrollwindow.add(self.tvwIncidentList) _frame = Widgets.make_frame() _frame.set_shadow_type(gtk.SHADOW_ETCHED_OUT) _frame.add(_scrollwindow) _model = gtk.TreeStore(gobject.TYPE_INT, gobject.TYPE_STRING, gobject.TYPE_STRING) self.tvwIncidentList.set_model(_model) _headings = [_(u"Incident\nID"), _(u"Short\nDescription"), _(u"Incident\nStatus")] for _index, _heading in enumerate(_headings): _cell = gtk.CellRendererText() _cell.set_property('background', 'light grey') _cell.set_property('editable', 0) _cell.set_property('wrap-width', 250) _cell.set_property('wrap-mode', pango.WRAP_WORD_CHAR) _cell.set_property('yalign', 0.1) _label = gtk.Label() _label.set_line_wrap(True) _label.set_alignment(xalign=0.5, yalign=0.5) _label.set_justify(gtk.JUSTIFY_CENTER) _label.set_markup("<span weight='bold'>" + _heading + "</span>") _label.set_use_markup(True) _label.show_all() _column = gtk.TreeViewColumn() _column.set_widget(_label) _column.set_visible(True) _column.set_sizing(gtk.TREE_VIEW_COLUMN_AUTOSIZE) _column.pack_start(_cell, True) _column.set_attributes(_cell, text=_index) self.tvwIncidentList.append_column(_column) # Add the Incident List page to the gtk.Notebook(). _label = gtk.Label() _label.set_markup(_(u"<span weight='bold'>Incident\nList</span>")) _label.set_alignment(xalign=0.5, yalign=0.5) _label.set_justify(gtk.JUSTIFY_CENTER) _label.show_all() _label.set_tooltip_text(_(u"Displays the list of incidents associated " u"with the selected Hardware assembly or " u"Hardware component.")) notebook.insert_page(_frame, tab_label=_label, position=-1) return False def _create_testing_matrix_page(self, notebook): """ Method to create the Hardware/Testing matrix page in the List View. :param gtk.Notebook notebook: the gtk.Notebook() to add the page. :return: False if successful or True if an error is encountered. :rtype: boolean """ # Build up the containers for the Hardware/Testing matrix page. _hbox = gtk.HBox() _bbox = gtk.VButtonBox() _bbox.set_layout(gtk.BUTTONBOX_START) _bbox.pack_start(self.btnSaveHardTest, False, False) _hbox.pack_start(_bbox, False, True) _scrollwindow = gtk.ScrolledWindow() _scrollwindow.set_policy(gtk.POLICY_AUTOMATIC, gtk.POLICY_AUTOMATIC) _scrollwindow.add(self.mtxTesting.treeview) _frame = Widgets.make_frame() _frame.set_shadow_type(gtk.SHADOW_ETCHED_OUT) _frame.add(_scrollwindow) _hbox.pack_end(_frame, True, True) _label = gtk.Label() _label.set_markup(_(u"<span weight='bold'>Testing\nMatrix</span>")) _label.set_alignment(xalign=0.5, yalign=0.5) _label.set_justify(gtk.JUSTIFY_CENTER) _label.show_all() _label.set_tooltip_text(_(u"Displays the matrix showing relationships " u"between system hardware and system " u"tests.")) notebook.insert_page(_hbox, tab_label=_label, position=-1) return False def _create_validation_matrix_page(self, notebook): """ Method to create the Hardware/Validation matrix page in the List View. :param gtk.Notebook notebook: the gtk.Notebook() to add the page. :return: False if successful or True if an error is encountered. :rtype: bool """ # Build up the containers for the Hardware/Validation
<reponame>google-cloud-sdk-unofficial/google-cloud-sdk<filename>lib/googlecloudsdk/command_lib/app/staging.py<gh_stars>1-10 # -*- coding: utf-8 -*- # # Copyright 2016 Google LLC. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Code to provide a hook for staging. Some App Engine runtimes require an additional staging step before deployment (e.g. when deploying compiled artifacts, or vendoring code that normally lives outside of the app directory). This module contains (1) a registry mapping runtime/environment combinations to staging commands, and (2) code to run said commands. The interface is defined as follows: - A staging command is an executable (binary or script) that takes two positional parameters: the path of the `<service>.yaml` in the directory containing the unstaged application code, and the path of an empty directory in which to stage the application code. - On success, the STDOUT and STDERR of the staging command are logged at the INFO level. On failure, a StagingCommandFailedError is raised containing the STDOUT and STDERR of the staging command (which are surfaced to the user as an ERROR message). """ from __future__ import absolute_import from __future__ import division from __future__ import unicode_literals import abc import io import os import re import shutil import tempfile from googlecloudsdk.api_lib.app import env from googlecloudsdk.api_lib.app import runtime_registry from googlecloudsdk.command_lib.app import jarfile from googlecloudsdk.command_lib.util import java from googlecloudsdk.core import config from googlecloudsdk.core import exceptions from googlecloudsdk.core import execution_utils from googlecloudsdk.core import log from googlecloudsdk.core.updater import update_manager from googlecloudsdk.core.util import files from googlecloudsdk.core.util import platforms import six _JAVA_APPCFG_ENTRY_POINT = 'com.google.appengine.tools.admin.AppCfg' _JAVA_APPCFG_STAGE_FLAGS = ['--enable_new_staging_defaults'] _STAGING_COMMAND_OUTPUT_TEMPLATE = """\ ------------------------------------ STDOUT ------------------------------------ {out}\ ------------------------------------ STDERR ------------------------------------ {err}\ -------------------------------------------------------------------------------- """ class StagingCommandNotFoundError(exceptions.Error): """Base error indicating that a staging command could not be found.""" class NoSdkRootError(StagingCommandNotFoundError): def __init__(self): super(NoSdkRootError, self).__init__( 'No SDK root could be found. Please check your installation.') class NoMainClassError(exceptions.Error): def __init__(self): super(NoMainClassError, self).__init__( 'Invalid jar file: it does not contain a Main-Class Manifest entry.') class MavenPomNotSupported(exceptions.Error): def __init__(self): super(MavenPomNotSupported, self).__init__( 'Maven source deployment is not supported for Java8 GAE project.') class GradleBuildNotSupported(exceptions.Error): def __init__(self): super(GradleBuildNotSupported, self).__init__( 'Gradle source deployment is not supported for Java8 GAE project.') class StagingCommandFailedError(exceptions.Error): def __init__(self, args, return_code, output_message): super(StagingCommandFailedError, self).__init__( 'Staging command [{0}] failed with return code [{1}].\n\n{2}'.format( ' '.join(args), return_code, output_message)) # TODO(b/65026284): eliminate "mappers" entirely by making a shim command def _JavaStagingMapper(command_path, descriptor, app_dir, staging_dir): """Map a java staging request to the right args. Args: command_path: str, path to the jar tool file. descriptor: str, path to the `appengine-web.xml` app_dir: str, path to the unstaged app directory staging_dir: str, path to the empty staging dir Raises: java.JavaError, if Java is not installed. Returns: [str], args for executable invocation. """ del descriptor # Unused, app_dir is sufficient java_bin = java.RequireJavaInstalled('local staging for java') args = ([java_bin, '-classpath', command_path, _JAVA_APPCFG_ENTRY_POINT] + _JAVA_APPCFG_STAGE_FLAGS + ['stage', app_dir, staging_dir]) return args class _Command(six.with_metaclass(abc.ABCMeta, object)): """Interface for a staging command to be invoked on the user source. This abstract class facilitates running an executable command that conforms to the "staging command" interface outlined in the module docstring. It implements the parts that are common to any such command while allowing interface implementors to swap out how the command is created. """ @abc.abstractmethod def EnsureInstalled(self): """Ensure that the command is installed and available. May result in a command restart if installation is required. """ raise NotImplementedError() @abc.abstractmethod def GetPath(self): """Returns the path to the command. Returns: str, the path to the command Raises: StagingCommandNotFoundError: if the staging command could not be found. """ raise NotImplementedError() def GetArgs(self, descriptor, app_dir, staging_dir, explicit_appyaml=None): """Get the args for the command to execute. Args: descriptor: str, path to the unstaged <service>.yaml or appengine-web.xml app_dir: str, path to the unstaged app directory staging_dir: str, path to the directory to stage in. explicit_appyaml: str or None, the app.yaml location to used for deployment. Returns: list of str, the args for the command to run """ return [self.GetPath(), descriptor, app_dir, staging_dir] def Run(self, staging_area, descriptor, app_dir, explicit_appyaml=None): """Invokes a staging command with a given <service>.yaml and temp dir. Args: staging_area: str, path to the staging area. descriptor: str, path to the unstaged <service>.yaml or appengine-web.xml app_dir: str, path to the unstaged app directory explicit_appyaml: str or None, the app.yaml location to used for deployment. Returns: str, the path to the staged directory or None if staging was not required. Raises: StagingCommandFailedError: if the staging command process exited non-zero. """ staging_dir = tempfile.mkdtemp(dir=staging_area) args = self.GetArgs(descriptor, app_dir, staging_dir) log.info('Executing staging command: [{0}]\n\n'.format(' '.join(args))) out = io.StringIO() err = io.StringIO() return_code = execution_utils.Exec( args, no_exit=True, out_func=out.write, err_func=err.write) message = _STAGING_COMMAND_OUTPUT_TEMPLATE.format( out=out.getvalue(), err=err.getvalue()) message = message.replace('\r\n', '\n') log.info(message) if return_code: raise StagingCommandFailedError(args, return_code, message) # Optionally use the custom app yaml if available: if explicit_appyaml: shutil.copyfile(explicit_appyaml, os.path.join(staging_dir, 'app.yaml')) return staging_dir class NoopCommand(_Command): """A command that does nothing. Many runtimes do not require a staging step; this isn't a problem. """ def EnsureInstalled(self): pass def GetPath(self): return None def GetArgs(self, descriptor, app_dir, staging_dir, appyaml=None): return None def Run(self, staging_area, descriptor, app_dir, appyaml=None): """Does nothing.""" pass def __eq__(self, other): return isinstance(other, NoopCommand) class CreateJava11ProjectCommand(_Command): """A command that creates a java11 runtime app.yaml.""" def EnsureInstalled(self): pass def GetPath(self): return def GetArgs(self, descriptor, staging_dir, appyaml=None): return def Run(self, staging_area, config_file, project_dir, explicit_appyaml=None): # Logic is: copy/symlink the project in the staged area, and create a # simple file app.yaml for runtime: java11 if it does not exist. # If it exists in the standard and documented default location # (in project_dir/src/main/appengine/app.yaml), copy it in the staged # area. appenginewebxml = os.path.join(project_dir, 'src', 'main', 'webapp', 'WEB-INF', 'appengine-web.xml') if os.path.exists(appenginewebxml): raise self.error() if explicit_appyaml: shutil.copyfile(explicit_appyaml, os.path.join(staging_area, 'app.yaml')) else: appyaml = os.path.join(project_dir, 'src', 'main', 'appengine', 'app.yaml') if os.path.exists(appyaml): # Put the user app.yaml at the root of the staging directory to deploy # as required by the Cloud SDK. shutil.copy2(appyaml, staging_area) else: # Create a very simple 1 liner app.yaml for Java11 runtime. files.WriteFileContents( os.path.join(staging_area, 'app.yaml'), 'runtime: java11\n') for name in os.listdir(project_dir): # Do not deploy locally built artifacts, buildpack will clean this anyway. if name == self.ignore: continue srcname = os.path.join(project_dir, name) dstname = os.path.join(staging_area, name) try: os.symlink(srcname, dstname) except (AttributeError, OSError): # AttributeError can occur if this is a Windows machine with an older # version of Python, in which case os.symlink is not defined. If this is # a newer version of Windows, but the user is not allowed to create # symlinks, we'll get an OSError saying "symbolic link privilege not # held." In both cases, we just fall back to copying the files. log.debug('Could not symlink files in staging directory, falling back ' 'to copying') if os.path.isdir(srcname): files.CopyTree(srcname, dstname) else: shutil.copy2(srcname, dstname) return staging_area def __eq__(self, other): return isinstance(other, CreateJava11ProjectCommand) class CreateJava11MavenProjectCommand(CreateJava11ProjectCommand): """A command that creates a java11 runtime app.yaml from a pom.xml file.""" def __init__(self): self.error = MavenPomNotSupported self.ignore = 'target' super(CreateJava11MavenProjectCommand, self).__init__() def __eq__(self, other): return isinstance(other, CreateJava11GradleProjectCommand) class CreateJava11GradleProjectCommand(CreateJava11ProjectCommand): """A command that creates a java11 runtime app.yaml from a build.gradle file.""" def __init__(self): self.error = GradleBuildNotSupported self.ignore = 'build' super(CreateJava11GradleProjectCommand, self).__init__() def __eq__(self, other): return isinstance(other, CreateJava11GradleProjectCommand) class CreateJava11YamlCommand(_Command): """A command that creates a java11 runtime app.yaml from a jar file.""" def EnsureInstalled(self): pass def GetPath(self): return None def GetArgs(self, descriptor, jar_file, staging_dir, appyaml=None): return None def Run(self, staging_area, jar_file, app_dir, appyaml=None): # Logic is simple: copy the jar in the staged area, and create a simple # file app.yaml for runtime: java11. shutil.copy2(jar_file, staging_area) if appyaml: shutil.copyfile(appyaml, os.path.join(staging_area, 'app.yaml')) else: files.WriteFileContents( os.path.join(staging_area, 'app.yaml'), 'runtime: java11\n', private=True) manifest = jarfile.ReadManifest(jar_file) if manifest: main_entry = manifest.main_section.get('Main-Class') if main_entry is None: raise NoMainClassError() classpath_entry = manifest.main_section.get('Class-Path') if classpath_entry: libs = classpath_entry.split() for lib in libs: dependent_file = os.path.join(app_dir, lib) # We copy the dep jar in the correct staging sub directories # and only if it exists, if os.path.isfile(dependent_file):
#!/usr/bin/env python3 """This script will take the output of cactus-align-batch (which was run on the output of cactus-graphmap-split). This would be a set of .vg files, one for each chromosome. It will do the following in order to make a single output graph - clip unmapped regions out of each graph - join the ids of the clipped graph - convert each clipped graph to gfa - merge the gfas into a whole-genome graph - convert the gfa into a gbwt/gbwt-graph pair - export the gbwt to xg - export the xg/gbwt to vcf so the final output will be - set of clipped vg graphs - graph.gfa.gz - graph.gbwt - graph.gg - graph.xg - graph.snarls - graph.vcf.gz - graph.vcf.gz.tbi """ import os from argparse import ArgumentParser import xml.etree.ElementTree as ET import copy import timeit from operator import itemgetter from cactus.progressive.seqFile import SeqFile from cactus.progressive.multiCactusTree import MultiCactusTree from cactus.shared.common import setupBinaries, importSingularityImage from cactus.progressive.multiCactusProject import MultiCactusProject from cactus.shared.experimentWrapper import ExperimentWrapper from cactus.shared.common import cactusRootPath from cactus.shared.configWrapper import ConfigWrapper from cactus.pipeline.cactus_workflow import CactusWorkflowArguments from cactus.pipeline.cactus_workflow import addCactusWorkflowOptions from cactus.shared.common import makeURL, catFiles from cactus.shared.common import enableDumpStack from cactus.shared.common import cactus_override_toil_options from cactus.shared.common import cactus_call from cactus.shared.common import getOptionalAttrib, findRequiredNode from cactus.shared.common import unzip_gz, write_s3 from cactus.preprocessor.fileMasking import get_mask_bed_from_fasta from toil.job import Job from toil.common import Toil from toil.statsAndLogging import logger from toil.statsAndLogging import set_logging_from_options from toil.realtimeLogger import RealtimeLogger from toil.lib.threading import cpu_count from sonLib.nxnewick import NXNewick from sonLib.bioio import getTempDirectory, getTempFile, catFiles def main(): parser = ArgumentParser() Job.Runner.addToilOptions(parser) addCactusWorkflowOptions(parser) parser.add_argument("--vg", required=True, nargs='+', help = "Input vg files (PackedGraph or HashGraph format)") parser.add_argument("--outDir", required=True, type=str, help = "Output directory") parser.add_argument("--outName", required=True, type=str, help = "Basename of all output files") parser.add_argument("--reference", required=True, type=str, help = "Reference event name") parser.add_argument("--vcfReference", type=str, help = "Produce additional VCF for given reference event") parser.add_argument("--rename", nargs='+', default = [], help = "Path renaming, each of form src>dest (see clip-vg -r)") parser.add_argument("--clipLength", type=int, default=None, help = "clip out unaligned sequences longer than this") parser.add_argument("--wlineSep", type=str, help = "wline separator for vg convert") parser.add_argument("--indexCores", type=int, default=1, help = "cores for general indexing and VCF constructions") parser.add_argument("--giraffeCores", type=int, default=None, help = "cores for giraffe-specific indexing (defaults to --indexCores)") parser.add_argument("--decoyGraph", help= "decoy sequences vg graph to add (PackedGraph or HashGraph format)") parser.add_argument("--hal", nargs='+', default = [], help = "Input hal files (for merging)") parser.add_argument("--vcf", action="store_true", help= "make VCF") parser.add_argument("--giraffe", action="store_true", help= "make Giraffe-specific indexes (distance and minimizer)") parser.add_argument("--normalizeIterations", type=int, default=None, help="Run this many iterations of vg normamlization (shared prefix zipping)") parser.add_argument("--gfaffix", action="store_true", help="Run GFAFfix normalization") parser.add_argument("--vgClipOpts", nargs='+', help = "If specified, run vg clip with given options (surround in quotes; multiple allowed to chain multiple clip commands)") parser.add_argument("--unclipSeqFile",type=str, help = "seqfile of unclipped sequences. If given, halUnclip will be run on the HAL output to restore original sequences (removing _sub suffixes)") #Progressive Cactus Options parser.add_argument("--configFile", dest="configFile", help="Specify cactus configuration file", default=os.path.join(cactusRootPath(), "cactus_progressive_config.xml")) parser.add_argument("--latest", dest="latest", action="store_true", help="Use the latest version of the docker container " "rather than pulling one matching this version of cactus") parser.add_argument("--containerImage", dest="containerImage", default=None, help="Use the the specified pre-built containter image " "rather than pulling one from quay.io") parser.add_argument("--binariesMode", choices=["docker", "local", "singularity"], help="The way to run the Cactus binaries", default=None) options = parser.parse_args() setupBinaries(options) set_logging_from_options(options) enableDumpStack() if options.outDir and not options.outDir.startswith('s3://'): if not os.path.isdir(options.outDir): os.makedirs(options.outDir) if options.hal and len(options.hal) != len(options.vg): raise RuntimeError("If --hal and --vg should specify the same number of files") if not options.giraffeCores: options.giraffeCores = options.indexCores if options.unclipSeqFile and not options.hal: raise RuntimeError("--unclipSeqFile can only be used with --hal") # Mess with some toil options to create useful defaults. cactus_override_toil_options(options) start_time = timeit.default_timer() runCactusGraphMapJoin(options) end_time = timeit.default_timer() run_time = end_time - start_time logger.info("cactus-graphmap-join has finished after {} seconds".format(run_time)) def runCactusGraphMapJoin(options): with Toil(options) as toil: importSingularityImage(options) #Run the workflow if options.restart: wf_output = toil.restart() else: options.cactusDir = getTempDirectory() #load cactus config configNode = ET.parse(options.configFile).getroot() config = ConfigWrapper(configNode) config.substituteAllPredefinedConstantsWithLiterals() # load up the vgs vg_ids = [] for vg_path in options.vg: logger.info("Importing {}".format(vg_path)) vg_ids.append(toil.importFile(makeURL(vg_path))) # tack on the decoys if options.decoyGraph: logger.info("Importing decoys {}".format(options.decoyGraph)) vg_ids.append(toil.importFile(makeURL(options.decoyGraph))) # we'll treat it like any other graph downstream, except clipping # where we'll check first using the path name options.vg.append(options.decoyGraph) # load up the hals hal_ids = [] for hal_path in options.hal: logger.info("Importing {}".format(hal_path)) hal_ids.append(toil.importFile(makeURL(hal_path))) # load up the sequences unclip_seq_id_map = {} if options.unclipSeqFile: seqFile = SeqFile(options.unclipSeqFile) leaves = set([seqFile.tree.getName(node) for node in seqFile.tree.getLeaves()]) for genome, seq in seqFile.pathMap.items(): if genome in leaves: if os.path.isdir(seq): tmpSeq = getTempFile() catFiles([os.path.join(seq, subSeq) for subSeq in os.listdir(seq)], tmpSeq) seq = tmpSeq seq = makeURL(seq) logger.info("Importing {}".format(seq)) unclip_seq_id_map[genome] = (seq, toil.importFile(seq)) # run the workflow wf_output = toil.start(Job.wrapJobFn(graphmap_join_workflow, options, config, vg_ids, hal_ids, unclip_seq_id_map)) #export the split data export_join_data(toil, options, wf_output[0], wf_output[1]) def graphmap_join_workflow(job, options, config, vg_ids, hal_ids, unclip_seq_id_map): root_job = Job() job.addChild(root_job) # run clip-vg on each input clipped_vg_ids = [] for vg_path, vg_id in zip(options.vg, vg_ids): clip_job = root_job.addChildJobFn(clip_vg, options, config, vg_path, vg_id, disk=vg_id.size * 2, memory=vg_id.size * 4) clipped_vg_ids.append(clip_job.rv()) # join the ids join_job = root_job.addFollowOnJobFn(join_vg, options, config, clipped_vg_ids, disk=sum([f.size for f in vg_ids])) clipped_vg_ids = join_job.rv() # optional clipping -- we do this down here after joining and normalization so # our graph is id-compatible with a graph that wasn't clipped (but run with same parameters otherwise) if options.vgClipOpts: clip_root_job = Job() join_job.addFollowOn(clip_root_job) clipped_vg_ids = [] for i in range(len(vg_ids)): vg_clip_job = clip_root_job.addChildJobFn(vg_clip_vg, options, config, options.vg[i], join_job.rv(i), disk=vg_ids[i].size * 2) join_job.addFollowOn(vg_clip_job) clipped_vg_ids.append(vg_clip_job.rv()) join_job = clip_root_job # make a gfa for each gfa_root_job = Job() join_job.addFollowOn(gfa_root_job) clipped_gfa_ids = [] for i in range(len(options.vg)): vg_path = options.vg[i] clipped_id = clipped_vg_ids[i] if options.vgClipOpts else join_job.rv(i) vg_id = vg_ids[i] gfa_job = gfa_root_job.addChildJobFn(vg_to_gfa, options, config, vg_path, clipped_id, disk=vg_id.size * 5) clipped_gfa_ids.append(gfa_job.rv()) # merge up the gfas and make the various vg indexes gfa_merge_job = gfa_root_job.addFollowOnJobFn(vg_indexes, options, config, clipped_gfa_ids, cores=options.indexCores, disk=sum(f.size for f in vg_ids) * 5) out_dicts = [gfa_merge_job.rv()] # optional vcf if options.vcf: deconstruct_job = gfa_merge_job.addFollowOnJobFn(make_vcf, options.outName, options.reference, out_dicts[0], cores=options.indexCores, disk = sum(f.size for f in vg_ids) * 2) out_dicts.append(deconstruct_job.rv()) # optional vcf with different reference if options.vcfReference: ref_deconstruct_job = gfa_merge_job.addFollowOnJobFn(make_vcf, options.outName, options.vcfReference, out_dicts[0], tag=options.vcfReference + '.', cores=options.indexCores, disk = sum(f.size for f in vg_ids) * 2) out_dicts.append(ref_deconstruct_job.rv()) # optional giraffe if options.giraffe: giraffe_job = gfa_merge_job.addFollowOnJobFn(make_giraffe_indexes, options, out_dicts[0], cores=options.giraffeCores, disk = sum(f.size for f in vg_ids) * 4) out_dicts.append(giraffe_job.rv()) # optional hal merge if hal_ids: hal_merge_job = root_job.addChildJobFn(merge_hal, options, hal_ids, cores = 1, disk=sum(f.size for f in hal_ids) * 2) hal_id_dict = hal_merge_job.rv() if unclip_seq_id_map: # optional hal unclip unzip_seq_ids_job = root_job.addChildJobFn(unzip_seqfile, unclip_seq_id_map, disk=sum(f.size for f in hal_ids) * 2) hal_unclip_job = unzip_seq_ids_job.addFollowOnJobFn(unclip_hal, hal_merge_job.rv(), unzip_seq_ids_job.rv(), disk=sum(f.size for f in hal_ids) * 5) hal_merge_job.addFollowOn(hal_unclip_job) hal_id_dict = hal_unclip_job.rv() out_dicts.append(hal_id_dict) return clipped_vg_ids, out_dicts def clip_vg(job, options, config, vg_path, vg_id): """ run clip-vg """ work_dir = job.fileStore.getLocalTempDir() is_decoy = vg_path == options.decoyGraph vg_path = os.path.join(work_dir, os.path.basename(vg_path)) job.fileStore.readGlobalFile(vg_id, vg_path) clipped_path = vg_path + '.clip' out_path = vg_path + '.out' # remove masked unaligned regions with clip-vg cmd = ['clip-vg', vg_path, '-f'] if options.clipLength is not None and not is_decoy: cmd += ['-u', str(options.clipLength)] for rs in options.rename: cmd += ['-r', rs] if options.reference: cmd += ['-e', options.reference] if getOptionalAttrib(findRequiredNode(config.xmlRoot, "hal2vg"), "includeMinigraph", typeFn=bool, default=False): # our vg file has minigraph sequences -- we'll filter them out, along with any nodes # that don't appear in a non-minigraph path graph_event = getOptionalAttrib(findRequiredNode(config.xmlRoot, "graphmap"), "assemblyName", default="_MINIGRAPH_") cmd += ['-d', graph_event] cactus_call(parameters=cmd, outfile=clipped_path) # optional normalization. this will (in theory) correct a lot of small underalignments due to cactus bugs # by zipping up redundant nodes. done before clip-vg otherwise ref paths not guaranteed to be forwardized # todo: would be nice if clip-vg worked on stdin if options.normalizeIterations: normalized_path = clipped_path + '.normalized' mod_cmd = ['vg', 'mod', '-O', '-U', str(options.normalizeIterations), clipped_path] if options.reference: mod_cmd += ['-z', options.reference] cactus_call(parameters=mod_cmd, outfile=normalized_path) # worth it cactus_call(parameters=['vg', 'validate', normalized_path]) clipped_path = normalized_path # GFAFfix is a tool written just to normalize graphs, and alters a (faster) alternative to vg # (though requires GFA conversion) if options.gfaffix: normalized_path = clipped_path + '.gfaffixed' gfa_in_path = vg_path + '.gfa' gfa_out_path = normalized_path + '.gfa' cactus_call(parameters=['vg', 'convert', '-f', clipped_path], outfile=gfa_in_path) fix_cmd = ['gfaffix', gfa_in_path, '--output_refined', gfa_out_path] if
'''pipeline runner''' import os import json import time import glob import logging import tempfile import datetime import yaml import utils.pipeline import postgres.metrics import postgres.utils def filter_list(alist, blist): '''remove blist from alist''' return list(set(alist)-set(blist)) def get_cwl_steps(cwlwf): '''get cwl steps names''' cwl = dict() with open(cwlwf, 'r') as fhandle: cwl = yaml.load(fhandle) cwl_steps = cwl['steps'].keys() return cwl_steps def dict_to_string(list_of_dict): '''convert list of dict to list of strings''' list_of_string = [] if list_of_dict: for i in list_of_dict: list_of_string.append(str(i)) else: return None return list_of_string def run_alignment(args): '''run alignment''' input_data = utils.pipeline.load_template_json()['alignment_template'] sample_list = [args.aliquot_id] * len(args.readgroup_names) pu_list = [args.job_uuid] * len(args.readgroup_names) rgl_list = ['@RG\tCN:CGR\tPL:ILLUMINA\tID:{RG}\tSM:{SM}\tPU:{PU}\tLB:Library'\ .format(RG=rg, SM=sm, PU=pu) \ for rg, sm, pu in zip(args.readgroup_names, sample_list, pu_list)] input_data['job_uuid'] = args.job_uuid input_data['fastq_read1_uri'] = args.fastq_read1_uri input_data['fastq_read2_uri'] = args.fastq_read2_uri input_data['fastq_read1_md5'] = args.fastq_read1_md5 input_data['fastq_read2_md5'] = args.fastq_read2_md5 input_data['readgroup_lines'] = rgl_list input_data['readgroup_names'] = args.readgroup_names workflow_meta = { 'basedir': args.basedir, 'pipeline': args.choice, 'project': args.project, 'job_uuid': args.job_uuid, 'aliquot_id': args.aliquot_id, 'input_table': args.input_table, 'cwlwf': args.cwlwf } genomel = GenomelIndiv( workflow_meta=workflow_meta, input_data=input_data, psql_conf=args.psql_conf ) genomel.run() def run_harmonization(args): '''run harmonization''' input_data = utils.pipeline.load_template_json()['harmonization_template'] input_data['job_uuid'] = args.job_uuid input_data['bam_uri'] = args.bam_uri input_data['bam_md5'] = args.bam_md5 workflow_meta = { 'basedir': args.basedir, 'pipeline': args.choice, 'project': args.project, 'job_uuid': args.job_uuid, 'aliquot_id': args.aliquot_id, 'input_table': args.input_table, 'cwlwf': args.cwlwf } genomel = GenomelIndiv( workflow_meta=workflow_meta, input_data=input_data, psql_conf=args.psql_conf ) genomel.run() def run_cohort_genotyping(args): '''run cohort genotyping''' cohort_template_json = os.path.join( os.path.dirname(os.path.dirname(os.path.realpath(__file__))), "etc/cohort_genotyping.json" ) input_data = utils.pipeline.load_json(cohort_template_json) input_data['job_uuid'] = args.job_uuid input_data['gvcf_files'] = utils.pipeline.create_cwl_array_input(args.gvcf_files_manifest) input_data['gatk4_genotyping_thread_count'] = args.gatk4_genotyping_thread_count input_data['number_of_chunks_for_gatk'] = args.number_of_chunks_for_gatk input_data['bam_files'] = utils.pipeline.create_cwl_array_input(args.bam_files_manifest) input_data['freebayes_thread_count'] = args.freebayes_thread_count input_data['number_of_chunks_for_freebayes'] = args.number_of_chunks_for_freebayes input_data['upload_s3_bucket'] = os.path.join( args.upload_s3_bucket, args.project, args.batch_id, args.job_uuid ) workflow_meta = { 'basedir': args.basedir, 'project': args.project, 'batch_id': args.batch_id, 'job_uuid': args.job_uuid, 'input_table': args.input_table, 'cromwell_config': os.path.join( os.path.dirname( os.path.dirname( os.path.dirname( os.path.realpath(__file__) ) ) ), "cromwell/cromwell.conf" ), 'cromwell_jar_path': args.cromwell_jar_path, 'cwlwf': os.path.join( os.path.dirname( os.path.dirname( os.path.dirname( os.path.realpath(__file__) ) ) ), "genomel_cohort_genotyping.cwl" ), 'cwl_pack': os.path.join( os.path.dirname( os.path.dirname( os.path.dirname( os.path.realpath(__file__) ) ) ), "cwl.zip" ) } genomel = GenomelCohort( workflow_meta=workflow_meta, input_data=input_data, psql_conf=args.psql_conf ) genomel.run() def run_cohort_gatk(args): '''run cohort gatk4''' cohort_template_json = os.path.join( os.path.dirname(os.path.dirname(os.path.realpath(__file__))), "etc/cohort_gatk.prod.json" ) input_data = utils.pipeline.load_json(cohort_template_json) input_data['job_uuid'] = args.job_uuid input_data['gvcf_files'] = utils.pipeline.create_cwl_array_input(args.gvcf_files_manifest) input_data['gatk4_genotyping_thread_count'] = args.gatk4_genotyping_thread_count input_data['number_of_chunks_for_gatk'] = args.number_of_chunks_for_gatk input_data['upload_s3_bucket'] = os.path.join( args.upload_s3_bucket, args.project, args.batch_id, args.job_uuid ) workflow_meta = { 'basedir': args.basedir, 'project': args.project, 'batch_id': args.batch_id, 'job_uuid': args.job_uuid, 'input_table': args.input_table, 'cromwell_config': os.path.join( os.path.dirname( os.path.dirname( os.path.dirname( os.path.realpath(__file__) ) ) ), "cromwell/cromwell.conf" ), 'cromwell_jar_path': args.cromwell_jar_path, 'cwlwf': os.path.join( os.path.dirname( os.path.dirname( os.path.dirname( os.path.realpath(__file__) ) ) ), "genomel_cohort_gatk4.cwl" ), 'cwl_pack': os.path.join( os.path.dirname( os.path.dirname( os.path.dirname( os.path.realpath(__file__) ) ) ), "cwl.zip" ) } genomel = GenomelCohort( workflow_meta=workflow_meta, input_data=input_data, psql_conf=args.psql_conf ) genomel.run() def run_cohort_freebayes(args): '''run cohort genotyping''' cohort_template_json = os.path.join( os.path.dirname(os.path.dirname(os.path.realpath(__file__))), "etc/cohort_freebayes.json" ) input_data = utils.pipeline.load_json(cohort_template_json) input_data['job_uuid'] = args.job_uuid input_data['bed_files'] = utils.pipeline.create_cwl_array_input(args.bed_files_manifest) input_data['freebayes_thread_count'] = args.freebayes_thread_count input_data['number_of_chunks_for_freebayes'] = args.number_of_chunks_for_freebayes input_data['upload_s3_bucket'] = os.path.join( args.upload_s3_bucket, args.project, args.batch_id, args.job_uuid ) workflow_meta = { 'basedir': args.basedir, 'project': args.project, 'batch_id': args.batch_id, 'job_uuid': args.job_uuid, 'input_table': args.input_table, 'cromwell_config': os.path.join( os.path.dirname( os.path.dirname( os.path.dirname( os.path.realpath(__file__) ) ) ), "cromwell/cromwell.conf" ), 'cromwell_jar_path': args.cromwell_jar_path, 'cwlwf': os.path.join( os.path.dirname( os.path.dirname( os.path.dirname( os.path.realpath(__file__) ) ) ), "genomel_cohort_freebayes.cwl" ), 'cwl_pack': os.path.join( os.path.dirname( os.path.dirname( os.path.dirname( os.path.realpath(__file__) ) ) ), "cwl.zip" ) } genomel = GenomelCohort( workflow_meta=workflow_meta, input_data=input_data, psql_conf=args.psql_conf ) genomel.run() def run_fbc(args): '''run post-qc on freebayes chunks''' input_data = utils.pipeline.load_template_json()['post_freebayes_template'] input_data['job_uuid'] = args.job_uuid input_data['vcf']['path'] = args.vcf workflow_meta = { 'basedir': args.basedir, 'job_uuid': args.job_uuid, 'bed': args.bed, 'cwlwf': args.cwlwf } genomel = PostFreebayes( workflow_meta=workflow_meta, input_data=input_data, psql_conf=args.psql_conf ) genomel.run() class GenomelIndiv(object): '''this class describes GenoMEL-Bionimbus Protected Data Cloud pipelines''' def __init__(self, workflow_meta, input_data, psql_conf): ''' workflow_meta.keys() = [ 'basedir', 'pipeline', 'project', 'job_uuid', 'aliquot_id', 'input_table', 'cwlwf' ] ''' self.input_data = input_data self.pg_data = utils.pipeline.pg_data_template() self.psql_conf = psql_conf self.psql_class = postgres.metrics.GenomelIndividualMetrics # setup workflow metadata self.workflow_meta = workflow_meta self.workflow_meta['base_s3_loc'] = os.path.join( self.input_data['upload_s3_bucket'], self.workflow_meta['job_uuid'] ) self.workflow_meta['log_file'] = None self.workflow_meta['cwl_input_json'] = self._cwl_input_json() self.workflow_meta['cwl_output_json'] = self._cwl_output_json() self.workflow_meta['log_dir'] = None self.workflow_meta['cwl_log_tar'] = None self.workflow_meta['cwl_start'] = None self.workflow_meta['cwl_end'] = None self.workflow_meta['cwl_failure'] = False self.workflow_meta['runner_failure'] = False self.workflow_meta['pipeline_time'] = 0.0 self.workflow_meta['pipeline_avg_cpu_percentage'] = 0 self.workflow_meta['haplotypecaller_time'] = 0.0 self.workflow_meta['haplotypecaller_avg_cpu_percentage'] = 0 def run(self): '''main pipeline''' # setup start-time self.workflow_meta['cwl_start'] = time.time() self.workflow_meta['datetime_start'] = str(datetime.datetime.now()) # setup work env os.chdir(self.workflow_meta['basedir']) tmpdir = self.create_tmp_dir('tmpdir_') logger = self._log() # cwl cmd cmd = [ '/home/ubuntu/.virtualenvs/p2/bin/cwltool', '--debug', '--relax-path-checks', '--outdir', self.workflow_meta['basedir'], '--tmpdir-prefix', tmpdir, '--tmp-outdir-prefix', tmpdir, self.workflow_meta['cwlwf'], self.workflow_meta['cwl_input_json'] ] # run cwl cwl_exit = utils.pipeline.run_command(cmd, logger, self.workflow_meta['cwl_output_json']) # cwl status if cwl_exit: self.workflow_meta['cwl_failure'] = True # calculate cpu percentage self._calculate_cpu_percentage() # tar all logs tar_exit = self._tar_log(logger) if tar_exit: self.workflow_meta['runner_failure'] = True # upload ancillary files upload_exit = self._upload_ancillary_files(logger) if upload_exit: self.workflow_meta['runner_failure'] = True # update psql if not self.workflow_meta['cwl_failure'] and not self.workflow_meta['runner_failure']: self._process_cwl_success() else: self._process_cwl_fail() engine = postgres.utils.get_db_engine(self.psql_conf) postgres.metrics.add_metrics(engine, self.psql_class, self.pg_data) # clean up utils.pipeline.remove_dir(self.workflow_meta['basedir']) def _cwl_input_json(self): '''prepare cwl input json''' cwl_input_json = os.path.join( self.workflow_meta['basedir'], 'genomel_individual.{0}.{1}.{2}.{3}.json'.format( self.workflow_meta['pipeline'], self.workflow_meta['project'], self.workflow_meta['job_uuid'], self.workflow_meta['aliquot_id'] ) ) with open(cwl_input_json, 'wt') as ohandle: json.dump(self.input_data, ohandle, indent=4) return cwl_input_json def _cwl_output_json(self): '''prepare cwl output json''' cwl_output_json = os.path.join( self.workflow_meta['basedir'], 'genomel_individual.{0}.{1}.{2}.{3}.output'.format( self.workflow_meta['pipeline'], self.workflow_meta['project'], self.workflow_meta['job_uuid'], self.workflow_meta['aliquot_id'] ) ) return cwl_output_json def create_tmp_dir(self, prefix): '''create cwl tmp directory''' tmpdir = tempfile.mkdtemp(prefix="{}".format(prefix), dir=self.workflow_meta['basedir']) return tmpdir def _log(self): '''setup log file''' log_file = os.path.join( os.path.dirname(self.workflow_meta['basedir']), 'genomel_individual.{0}.{1}.{2}.{3}.log'.format( self.workflow_meta['pipeline'], self.workflow_meta['project'], self.workflow_meta['job_uuid'], self.workflow_meta['aliquot_id'] ) ) self.workflow_meta['log_file'] = log_file logger = utils.pipeline.setup_logging( logging.INFO, self.workflow_meta['job_uuid'], log_file ) return logger def _calculate_cpu_percentage(self): '''calculate average cpu percentage''' cwl_logs = glob.glob( '{}/{}*time.json'.format( self.workflow_meta['basedir'], self.workflow_meta['job_uuid'] ) ) pipeline_cpu_usage = [] pipeline_cpu_time = [] haplotypecaller_cpu_usage = [] haplotypecaller_cpu_time = [] if cwl_logs: for log in cwl_logs: dic = utils.pipeline.load_json(log) cpu_percent = float(dic['percent_of_cpu'][:-1]) step_weight = float(dic['wall_clock']) if 'gatk3' in log or 'picard' in log: haplotypecaller_cpu_usage.append(cpu_percent * step_weight) haplotypecaller_cpu_time.append(step_weight) else: pipeline_cpu_usage.append(cpu_percent * step_weight) pipeline_cpu_time.append(step_weight) pipeline_time = sum(pipeline_cpu_time) pipeline_avg_cpu_usage = str(int(sum(pipeline_cpu_usage)/sum(pipeline_cpu_time))) + '%' haplotypecaller_time = sum(haplotypecaller_cpu_time) haplotypecaller_avg_cpu_usage = str( int(sum(haplotypecaller_cpu_usage)/sum(haplotypecaller_cpu_time)) ) + '%' else: pipeline_time = None pipeline_avg_cpu_usage = None haplotypecaller_time = None haplotypecaller_avg_cpu_usage = None self.workflow_meta['pipeline_time'] = pipeline_time self.workflow_meta['pipeline_avg_cpu_percentage'] = pipeline_avg_cpu_usage self.workflow_meta['haplotypecaller_time'] = haplotypecaller_time self.workflow_meta['haplotypecaller_avg_cpu_percentage'] = haplotypecaller_avg_cpu_usage def _tar_log(self, logger): '''make tar for all cwl time logs''' cwl_logs = glob.glob('{}/*time.json'.format(self.workflow_meta['basedir'])) if cwl_logs: self.workflow_meta['log_dir'] = self.create_tmp_dir('cwl_logs_') for log in cwl_logs: utils.pipeline.move_file(log, self.workflow_meta['log_dir']) self.workflow_meta['cwl_log_tar'] = os.path.join( self.workflow_meta['basedir'], \ 'genomel_individual.{0}.{1}.{2}.{3}.cwl_logs.tar.bz2'.format( self.workflow_meta['pipeline'], self.workflow_meta['project'], self.workflow_meta['job_uuid'], self.workflow_meta['aliquot_id'] ) ) exit_code = utils.pipeline.targz_compress( logger, self.workflow_meta['cwl_log_tar'], self.workflow_meta['log_dir'] ) else: exit_code = 1 return exit_code def _upload_ancillary_files(self, logger): '''upload tar file of all cwl logs''' to_upload_dir = self.create_tmp_dir('to_upload_') utils.pipeline.move_file(self.workflow_meta['cwl_input_json'], to_upload_dir) if self.workflow_meta['cwl_log_tar']: utils.pipeline.move_file(self.workflow_meta['cwl_log_tar'], to_upload_dir) remote_loc = os.path.join( self.input_data['upload_s3_bucket'], self.workflow_meta['job_uuid'] ) exit_code = utils.pipeline.aws_s3_put( logger=logger, remote_output=remote_loc, local_input=to_upload_dir, profile=self.input_data['upload_s3_profile'], endpoint_url=self.input_data['upload_s3_endpoint'], recursive=True ) return exit_code def _time(self, handle): '''extract time from cwl logs''' logs = glob.glob('{}/{}'.format(self.workflow_meta['log_dir'], handle)) time_list = [] if logs: for log in logs: dic = utils.pipeline.load_json(log) _time = float(dic['wall_clock']) time_list.append(_time) total_time = sum(time_list) else: total_time = None return total_time def _stage_local(self, indiv): '''stage cwl output to local gluster''' indiv_dir = os.path.join( '/mnt/glusterfs', 'genomel_individual.{0}.{1}.{2}.{3}'.format( self.workflow_meta['pipeline'], self.workflow_meta['project'], self.workflow_meta['job_uuid'], self.workflow_meta['aliquot_id'] ) ) if not os.path.isdir(indiv_dir): os.mkdir(indiv_dir) utils.pipeline.move_file(indiv, indiv_dir) return os.path.join(indiv_dir, os.path.basename(indiv)) def _process_cwl_success(self): '''process when cwl successes''' download_time = self._time('aws_download*') bam_upload_time = self._time('aws_upload*duplicates_marked.sorted*') gvcf_upload_time = self._time('aws_upload*haplotypecaller*') cwl_output = utils.pipeline.load_json(self.workflow_meta['cwl_output_json']) bam_local_path = self._stage_local( cwl_output['genomel_bam']['path'] ) self._stage_local(cwl_output['genomel_bam']['secondaryFiles'][0]['path']) gvcf_local_path = self._stage_local( cwl_output['genomel_gvcf']['path'] ) self._stage_local(cwl_output['genomel_gvcf']['secondaryFiles'][0]['path']) self.workflow_meta['cwl_end'] = time.time() self.pg_data['job_uuid'] = self.workflow_meta['job_uuid'] self.pg_data['aliquot_id'] = self.workflow_meta['aliquot_id'] self.pg_data['input_table'] = self.workflow_meta['input_table'] self.pg_data['project'] = self.workflow_meta['project'] self.pg_data['status'] = "COMPLETED" self.pg_data['datetime_start'] = self.workflow_meta['datetime_start'] self.pg_data['datetime_end'] = str(datetime.datetime.now()) self.pg_data['download_time'] = download_time self.pg_data['bam_upload_time'] = bam_upload_time self.pg_data['gvcf_upload_time'] = gvcf_upload_time self.pg_data['bam_url'] = os.path.join( self.workflow_meta['base_s3_loc'], cwl_output['genomel_bam']['basename'] ) self.pg_data['gvcf_url'] = os.path.join( self.workflow_meta['base_s3_loc'], cwl_output['genomel_gvcf']['basename'] ) self.pg_data['bam_local_path'] = bam_local_path self.pg_data['gvcf_local_path'] = gvcf_local_path self.pg_data['bam_md5sum'] = utils.pipeline.get_md5(bam_local_path) self.pg_data['gvcf_md5sum'] = utils.pipeline.get_md5(gvcf_local_path) self.pg_data['bam_filesize'] = utils.pipeline.get_file_size(bam_local_path) self.pg_data['gvcf_filesize'] = utils.pipeline.get_file_size(gvcf_local_path) if self.workflow_meta['pipeline'] == 'alignment': self.pg_data['alignment_cwl_walltime'] = self.workflow_meta['pipeline_time'] self.pg_data['alignment_cwl_cpu_percentage'] = self.workflow_meta\ ['pipeline_avg_cpu_percentage'] else: self.pg_data['harmonization_cwl_walltime'] = self.workflow_meta['pipeline_time'] self.pg_data['harmonization_cwl_cpu_percentage'] = self.workflow_meta\ ['pipeline_avg_cpu_percentage'] self.pg_data['haplotypecaller_cwl_walltime'] = self.workflow_meta['haplotypecaller_time'] self.pg_data['haplotypecaller_cwl_cpu_percentage'] = self.workflow_meta\ ['haplotypecaller_avg_cpu_percentage'] self.pg_data['whole_workflow_elapsed'] = float( self.workflow_meta['cwl_end'] - self.workflow_meta['cwl_start'] ) self.pg_data['cwl_input_json'] = os.path.join( self.workflow_meta['base_s3_loc'], os.path.basename(self.workflow_meta['cwl_input_json']) ) self.pg_data['time_metrics_json'] = os.path.join( self.workflow_meta['base_s3_loc'], os.path.basename(self.workflow_meta['cwl_log_tar']) ) self.pg_data['debug_path'] = self.workflow_meta['log_file'] def _process_cwl_fail(self): '''process when cwl fails''' if self.workflow_meta['cwl_failure']: cwl_output = utils.pipeline.load_json(self.workflow_meta['cwl_output_json']) if cwl_output: try: if cwl_output['genomel_gvcf']: status = "FAILED_WHEN_UPLOAD" elif cwl_output['genomel_bam']: status = "FAILED_IN_VARIANT_CALLING" else: status = "FAILED_IN_EARLY_STAGE" except ValueError: status = "FAILED" else: status = "FAILED_IN_CWL" else: status = "FAILED_IN_PYTHON_RUNNER" self.workflow_meta['cwl_end'] = time.time() self.pg_data['job_uuid'] = self.workflow_meta['job_uuid'] self.pg_data['aliquot_id'] = self.workflow_meta['aliquot_id'] self.pg_data['input_table'] = self.workflow_meta['input_table'] self.pg_data['project'] = self.workflow_meta['project'] self.pg_data['status'] = status self.pg_data['datetime_start'] = self.workflow_meta['datetime_start'] self.pg_data['datetime_end'] = str(datetime.datetime.now()) self.pg_data['whole_workflow_elapsed'] = float( self.workflow_meta['cwl_end'] - self.workflow_meta['cwl_start'] ) self.pg_data['cwl_input_json'] = os.path.join( self.workflow_meta['base_s3_loc'], os.path.basename(self.workflow_meta['cwl_input_json']) ) self.pg_data['debug_path'] = self.workflow_meta['log_file'] class GenomelCohort(object): '''this class describes GenoMEL-Bionimbus Protected Data Cloud cohort genotyping pipeline''' def __init__(self, workflow_meta, input_data, psql_conf): ''' workflow_meta.keys() =
Literal["BinomialJoshi4ConvertibleEngine"] ] = "BinomialJoshi4ConvertibleEngine" value: GeneralizedBlackScholesProcess steps: int class Futures(BaseModel): resource_name: Optional[Literal["Futures"]] = "Futures" class OvernightIndexFuture(BaseModel): resource_name: Optional[Literal["OvernightIndexFuture"]] = "OvernightIndexFuture" class Pillar(BaseModel): resource_name: Optional[Literal["Pillar"]] = "Pillar" class DatedOISRateHelper(BaseModel): resource_name: Optional[Literal["DatedOISRateHelper"]] = "DatedOISRateHelper" startDate: Date endDate: Date rate: QuoteHandle index: OvernightIndex discountingCurve: Optional[YieldTermStructureHandle] = None class Discount(BaseModel): resource_name: Optional[Literal["Discount"]] = "Discount" class ZeroYield(BaseModel): resource_name: Optional[Literal["ZeroYield"]] = "ZeroYield" class ForwardRate(BaseModel): resource_name: Optional[Literal["ForwardRate"]] = "ForwardRate" class IterativeBootstrap(BaseModel): resource_name: Optional[Literal["IterativeBootstrap"]] = "IterativeBootstrap" accuracy: Optional[Optional[float]] = None minValue: Optional[Optional[float]] = None maxValue: Optional[Optional[float]] = None class GlobalBootstrap0(BaseModel): resource_name: Optional[Literal["GlobalBootstrap"]] = "GlobalBootstrap" additionalHelpers: List[RateHelper] additionalDates: List[Date] accuracy: Optional[Optional[float]] = None class GlobalBootstrap1(BaseModel): resource_name: Optional[Literal["GlobalBootstrap"]] = "GlobalBootstrap" accuracy: Optional[Optional[float]] = None class DefaultProbabilityTermStructureHandle(BaseModel): resource_name: Optional[ Literal["DefaultProbabilityTermStructureHandle"] ] = "DefaultProbabilityTermStructureHandle" value: Optional[DefaultProbabilityTermStructure] = None class RelinkableDefaultProbabilityTermStructureHandle(BaseModel): resource_name: Optional[ Literal["RelinkableDefaultProbabilityTermStructureHandle"] ] = "RelinkableDefaultProbabilityTermStructureHandle" value: Optional[DefaultProbabilityTermStructure] = None class FlatHazardRate0(BaseModel): resource_name: Optional[Literal["FlatHazardRate"]] = "FlatHazardRate" settlementDays: int calendar: Calendar hazardRate: QuoteHandle dayCounter: DayCounter class FlatHazardRate1(BaseModel): resource_name: Optional[Literal["FlatHazardRate"]] = "FlatHazardRate" todaysDate: Date hazardRate: QuoteHandle dayCounter: DayCounter class HazardRate(BaseModel): resource_name: Optional[Literal["HazardRate"]] = "HazardRate" class DefaultDensity(BaseModel): resource_name: Optional[Literal["DefaultDensity"]] = "DefaultDensity" class Protection(BaseModel): resource_name: Optional[Literal["Protection"]] = "Protection" class FaceValueClaim(BaseModel): resource_name: Optional[Literal["FaceValueClaim"]] = "FaceValueClaim" class MidPointCdsEngine(BaseModel): resource_name: Optional[Literal["MidPointCdsEngine"]] = "MidPointCdsEngine" probability: DefaultProbabilityTermStructureHandle recoveryRate: float discountCurve: YieldTermStructureHandle class BlackCdsOptionEngine(BaseModel): resource_name: Optional[Literal["BlackCdsOptionEngine"]] = "BlackCdsOptionEngine" value: DefaultProbabilityTermStructureHandle recoveryRate: float termStructure: YieldTermStructureHandle vol: QuoteHandle class NormalDistribution(BaseModel): resource_name: Optional[Literal["NormalDistribution"]] = "NormalDistribution" average: Optional[float] = None sigma: Optional[float] = None class CumulativeNormalDistribution(BaseModel): resource_name: Optional[ Literal["CumulativeNormalDistribution"] ] = "CumulativeNormalDistribution" average: Optional[float] = None sigma: Optional[float] = None class InverseCumulativeNormal(BaseModel): resource_name: Optional[ Literal["InverseCumulativeNormal"] ] = "InverseCumulativeNormal" average: Optional[float] = None sigma: Optional[float] = None class MoroInverseCumulativeNormal(BaseModel): resource_name: Optional[ Literal["MoroInverseCumulativeNormal"] ] = "MoroInverseCumulativeNormal" average: Optional[float] = None sigma: Optional[float] = None class BivariateCumulativeNormalDistribution(BaseModel): resource_name: Optional[ Literal["BivariateCumulativeNormalDistribution"] ] = "BivariateCumulativeNormalDistribution" rho: float class BinomialDistribution(BaseModel): resource_name: Optional[Literal["BinomialDistribution"]] = "BinomialDistribution" p: float n: float class CumulativeBinomialDistribution(BaseModel): resource_name: Optional[ Literal["CumulativeBinomialDistribution"] ] = "CumulativeBinomialDistribution" p: float n: float class BivariateCumulativeNormalDistributionDr78(BaseModel): resource_name: Optional[ Literal["BivariateCumulativeNormalDistributionDr7"] ] = "BivariateCumulativeNormalDistributionDr7" rho: float class BivariateCumulativeNormalDistributionWe04DP(BaseModel): resource_name: Optional[ Literal["BivariateCumulativeNormalDistributionWe04DP"] ] = "BivariateCumulativeNormalDistributionWe04DP" rho: float class CumulativeChiSquareDistribution(BaseModel): resource_name: Optional[ Literal["CumulativeChiSquareDistribution"] ] = "CumulativeChiSquareDistribution" df: float class NonCentralCumulativeChiSquareDistribution(BaseModel): resource_name: Optional[ Literal["NonCentralCumulativeChiSquareDistribution"] ] = "NonCentralCumulativeChiSquareDistribution" df: float ncp: float class InverseNonCentralCumulativeChiSquareDistribution(BaseModel): resource_name: Optional[ Literal["InverseNonCentralCumulativeChiSquareDistribution"] ] = "InverseNonCentralCumulativeChiSquareDistribution" df: float ncp: float maxEvaluations: Optional[int] = None accuracy: Optional[float] = None class CumulativeGammaDistribution(BaseModel): resource_name: Optional[ Literal["CumulativeGammaDistribution"] ] = "CumulativeGammaDistribution" a: float class GammaFunction(BaseModel): resource_name: Optional[Literal["GammaFunction"]] = "GammaFunction" class PoissonDistribution(BaseModel): resource_name: Optional[Literal["PoissonDistribution"]] = "PoissonDistribution" mu: float class CumulativePoissonDistribution(BaseModel): resource_name: Optional[ Literal["CumulativePoissonDistribution"] ] = "CumulativePoissonDistribution" mu: float class InverseCumulativePoisson(BaseModel): resource_name: Optional[ Literal["InverseCumulativePoisson"] ] = "InverseCumulativePoisson" lambda_: float = Field(..., alias="lambda") class StudentDistribution(BaseModel): resource_name: Optional[Literal["StudentDistribution"]] = "StudentDistribution" n: int class CumulativeStudentDistribution(BaseModel): resource_name: Optional[ Literal["CumulativeStudentDistribution"] ] = "CumulativeStudentDistribution" n: int class InverseCumulativeStudent(BaseModel): resource_name: Optional[ Literal["InverseCumulativeStudent"] ] = "InverseCumulativeStudent" n: int accuracy: Optional[float] = None maxIterations: Optional[int] = None class Money0(BaseModel): resource_name: Optional[Literal["Money"]] = "Money" currency: Currency value: float class Money1(BaseModel): resource_name: Optional[Literal["Money"]] = "Money" value: float currency: Currency class ExchangeRate(BaseModel): resource_name: Optional[Literal["ExchangeRate"]] = "ExchangeRate" source: Currency target: Currency rate: float class ExchangeRateManager(BaseModel): resource_name: Optional[Literal["ExchangeRateManager"]] = "ExchangeRateManager" class Settings(BaseModel): resource_name: Optional[Literal["Settings"]] = "Settings" class Fdm1dMesherBase(BaseModel): resource_name: Optional[Literal["Fdm1dMesher"]] = "Fdm1dMesher" size: int class FdmBlackScholesMesher(BaseModel): resource_name: Optional[Literal["FdmBlackScholesMesher"]] = "FdmBlackScholesMesher" size: int process: GeneralizedBlackScholesProcess maturity: float strike: float xMinConstraint: Optional[Optional[float]] = None xMaxConstraint: Optional[Optional[float]] = None eps: Optional[float] = None scaleFactor: Optional[float] = None cPoint: Optional[List[Union[float, float]]] = None dividendSchedule: Optional[List[Dividend]] = None fdmQuantoHelper: Optional[FdmQuantoHelper] = None spotAdjustment: Optional[float] = None class Concentrating1dMesher0(BaseModel): resource_name: Optional[Literal["Concentrating1dMesher"]] = "Concentrating1dMesher" start: float end: float size: int cPoints: List[List[Union[float, float, bool]]] tol: Optional[float] = None class Concentrating1dMesher1(BaseModel): resource_name: Optional[Literal["Concentrating1dMesher"]] = "Concentrating1dMesher" start: float end: float size: int cPoints: Optional[List[Union[float, float]]] = None requireCPoint: Optional[bool] = None class ExponentialJump1dMesher(BaseModel): resource_name: Optional[ Literal["ExponentialJump1dMesher"] ] = "ExponentialJump1dMesher" steps: int beta: float jumpIntensity: float eta: float eps: Optional[float] = None class FdmCEV1dMesher(BaseModel): resource_name: Optional[Literal["FdmCEV1dMesher"]] = "FdmCEV1dMesher" size: int f0: float alpha: float beta: float maturity: float eps: Optional[float] = None scaleFactor: Optional[float] = None cPoint: Optional[List[Union[float, float]]] = None class FdmHestonVarianceMesher(BaseModel): resource_name: Optional[ Literal["FdmHestonVarianceMesher"] ] = "FdmHestonVarianceMesher" size: int process: HestonProcess maturity: float tAvgSteps: Optional[int] = None epsilon: Optional[float] = None class FdmHestonLocalVolatilityVarianceMesher(BaseModel): resource_name: Optional[ Literal["FdmHestonLocalVolatilityVarianceMesher"] ] = "FdmHestonLocalVolatilityVarianceMesher" size: int process: HestonProcess leverageFct: LocalVolTermStructure maturity: float tAvgSteps: Optional[int] = None epsilon: Optional[float] = None class Uniform1dMesher(BaseModel): resource_name: Optional[Literal["Uniform1dMesher"]] = "Uniform1dMesher" start: float end: float size: int class Predefined1dMesher(BaseModel): resource_name: Optional[Literal["Predefined1dMesher"]] = "Predefined1dMesher" x: List[float] class Glued1dMesher(BaseModel): resource_name: Optional[Literal["Glued1dMesher"]] = "Glued1dMesher" leftMesher: Fdm1dMesher rightMesher: Fdm1dMesher class MesherItem(BaseModel): resource_name: Optional[Literal["MesherItem"]] = "MesherItem" class FdmMesherComposite0(BaseModel): resource_name: Optional[Literal["FdmMesherComposite"]] = "FdmMesherComposite" mesher: Union[MesherItem, Fdm1dMesher] class FdmMesherComposite1(BaseModel): resource_name: Optional[Literal["FdmMesherComposite"]] = "FdmMesherComposite" m1: Fdm1dMesher m2: Fdm1dMesher m3: Optional[Fdm1dMesher] = None m4: Optional[Fdm1dMesher] = None class FdmBlackScholesOp(BaseModel): resource_name: Optional[Literal["FdmBlackScholesOp"]] = "FdmBlackScholesOp" mesher: FdmMesher process: GeneralizedBlackScholesProcess strike: float localVol: Optional[bool] = None illegalLocalVolOverwrite: Optional[Optional[float]] = None direction: Optional[int] = None quantoHelper: Optional[FdmQuantoHelper] = None class Fdm2dBlackScholesOp(BaseModel): resource_name: Optional[Literal["Fdm2dBlackScholesOp"]] = "Fdm2dBlackScholesOp" mesher: FdmMesher p1: GeneralizedBlackScholesProcess p2: GeneralizedBlackScholesProcess correlation: float maturity: float localVol: Optional[bool] = None illegalLocalVolOverwrite: Optional[Optional[float]] = None class FdmCEVOp(BaseModel): resource_name: Optional[Literal["FdmCEVOp"]] = "FdmCEVOp" mesher: FdmMesher rTS: YieldTermStructure f0: float alpha: float beta: float direction: int class FdmG2Op(BaseModel): resource_name: Optional[Literal["FdmG2Op"]] = "FdmG2Op" mesher: FdmMesher model: G2 direction1: int direction2: int class FdmHestonHullWhiteOp(BaseModel): resource_name: Optional[Literal["FdmHestonHullWhiteOp"]] = "FdmHestonHullWhiteOp" mesher: FdmMesher hestonProcess: HestonProcess hwProcess: HullWhiteProcess equityShortRateCorrelation: float class FdmHestonOp(BaseModel): resource_name: Optional[Literal["FdmHestonOp"]] = "FdmHestonOp" mesher: FdmMesher hestonProcess: HestonProcess quantoHelper: Optional[FdmQuantoHelper] = None leverageFct: Optional[LocalVolTermStructure] = None class FdmHullWhiteOp(BaseModel): resource_name: Optional[Literal["FdmHullWhiteOp"]] = "FdmHullWhiteOp" mesher: FdmMesher model: HullWhite direction: int class FdmLocalVolFwdOp(BaseModel): resource_name: Optional[Literal["FdmLocalVolFwdOp"]] = "FdmLocalVolFwdOp" mesher: FdmMesher spot: Quote rTS: YieldTermStructure qTS: YieldTermStructure localVol: LocalVolTermStructure direction: Optional[int] = None class FdmOrnsteinUhlenbeckOp(BaseModel): resource_name: Optional[ Literal["FdmOrnsteinUhlenbeckOp"] ] = "FdmOrnsteinUhlenbeckOp" mesher: FdmMesher p: OrnsteinUhlenbeckProcess rTS: YieldTermStructure direction: Optional[int] = None class FdmSabrOp(BaseModel): resource_name: Optional[Literal["FdmSabrOp"]] = "FdmSabrOp" mesher: FdmMesher rTS: YieldTermStructure f0: float alpha: float beta: float nu: float rho: float class FdmZabrOp(BaseModel): resource_name: Optional[Literal["FdmZabrOp"]] = "FdmZabrOp" mesher: FdmMesher beta: float nu: float rho: float gamma: float class FdmDupire1dOp(BaseModel): resource_name: Optional[Literal["FdmDupire1dOp"]] = "FdmDupire1dOp" mesher: FdmMesher localVolatility: Array class FdmBlackScholesFwdOp(BaseModel): resource_name: Optional[Literal["FdmBlackScholesFwdOp"]] = "FdmBlackScholesFwdOp" mesher: FdmMesher process: GeneralizedBlackScholesProcess strike: float localVol: Optional[bool] = None illegalLocalVolOverwrite: Optional[float] = None direction: Optional[int] = None class TripleBandLinearOpBase(BaseModel): resource_name: Optional[Literal["TripleBandLinearOp"]] = "TripleBandLinearOp" direction: int mesher: FdmMesher class FirstDerivativeOp(BaseModel): resource_name: Optional[Literal["FirstDerivativeOp"]] = "FirstDerivativeOp" direction: int mesher: FdmMesher class SecondDerivativeOp(BaseModel): resource_name: Optional[Literal["SecondDerivativeOp"]] = "SecondDerivativeOp" direction: int mesher: FdmMesher class NinePointLinearOpBase(BaseModel): resource_name: Optional[Literal["NinePointLinearOp"]] = "NinePointLinearOp" d0: int d1: int mesher: FdmMesher class SecondOrderMixedDerivativeOp(BaseModel): resource_name: Optional[ Literal["SecondOrderMixedDerivativeOp"] ] = "SecondOrderMixedDerivativeOp" d0: int d1: int mesher: FdmMesher class NthOrderDerivativeOp(BaseModel): resource_name: Optional[Literal["NthOrderDerivativeOp"]] = "NthOrderDerivativeOp" direction: int order: int nPoints: int mesher: FdmMesher class FdmLogInnerValue(BaseModel): resource_name: Optional[Literal["FdmLogInnerValue"]] = "FdmLogInnerValue" payoff: Payoff mesher: FdmMesher direction: int class FdmLogBasketInnerValue(BaseModel): resource_name: Optional[ Literal["FdmLogBasketInnerValue"] ] = "FdmLogBasketInnerValue" payoff: BasketPayoff mesher: FdmMesher class FdmSnapshotCondition(BaseModel): resource_name: Optional[Literal["FdmSnapshotCondition"]] = "FdmSnapshotCondition" t: float class FdmAmericanStepCondition(BaseModel): resource_name: Optional[ Literal["FdmAmericanStepCondition"] ] = "FdmAmericanStepCondition" mesher: FdmMesher calculator: FdmInnerValueCalculator class FdmArithmeticAverageCondition(BaseModel): resource_name: Optional[ Literal["FdmArithmeticAverageCondition"] ] = "FdmArithmeticAverageCondition" averageTimes: List[float] real: float pastFixings: int mesher: FdmMesher equityDirection: int class FdmBermudanStepCondition(BaseModel): resource_name: Optional[ Literal["FdmBermudanStepCondition"] ] = "FdmBermudanStepCondition" exerciseDates: List[Date] referenceDate: Date dayCounter: DayCounter mesher: FdmMesher calculator: FdmInnerValueCalculator class FdmSimpleStorageCondition(BaseModel): resource_name: Optional[ Literal["FdmSimpleStorageCondition"] ] = "FdmSimpleStorageCondition" exerciseTimes: List[float] mesher: FdmMesher calculator: FdmInnerValueCalculator changeRate: float class FdmSimpleSwingCondition(BaseModel): resource_name: Optional[ Literal["FdmSimpleSwingCondition"] ] = "FdmSimpleSwingCondition" exerciseTimes: List[float] mesher: FdmMesher calculator: FdmInnerValueCalculator swingDirection: int minExercises: Optional[int] = None class FdmDividendHandler(BaseModel): resource_name: Optional[Literal["FdmDividendHandler"]] = "FdmDividendHandler" schedule: List[Dividend] mesher: FdmMesher referenceDate: Date dayCounter: DayCounter equityDirection: int class BSMRNDCalculator(BaseModel): resource_name: Optional[Literal["BSMRNDCalculator"]] = "BSMRNDCalculator" process: GeneralizedBlackScholesProcess class CEVRNDCalculator(BaseModel): resource_name: Optional[Literal["CEVRNDCalculator"]] = "CEVRNDCalculator" f0: float alpha: float beta: float class GBSMRNDCalculator(BaseModel): resource_name: Optional[Literal["GBSMRNDCalculator"]] = "GBSMRNDCalculator" process: GeneralizedBlackScholesProcess class HestonRNDCalculator(BaseModel): resource_name: Optional[Literal["HestonRNDCalculator"]] = "HestonRNDCalculator" hestonProcess: HestonProcess integrationEps: Optional[float] = None maxIntegrationIterations: Optional[int] = None class LocalVolRNDCalculator(BaseModel): resource_name: Optional[Literal["LocalVolRNDCalculator"]] = "LocalVolRNDCalculator" spot: Quote rTS: YieldTermStructure qTS: YieldTermStructure localVol: LocalVolTermStructure xGrid: Optional[int] = None tGrid: Optional[int] = None x0Density: Optional[float] = None localVolProbEps: Optional[float] = None maxIter: Optional[int] = None gaussianStepSize: Optional[float] = None class SquareRootProcessRNDCalculator(BaseModel): resource_name: Optional[ Literal["SquareRootProcessRNDCalculator"] ] = "SquareRootProcessRNDCalculator" v0: float kappa: float theta: float sigma: float class ExponentialSplinesFitting(BaseModel): resource_name: Optional[ Literal["ExponentialSplinesFitting"] ] = "ExponentialSplinesFitting" constrainAtZero: Optional[bool] = None weights: Optional[Array] = None class NelsonSiegelFitting(BaseModel): resource_name: Optional[Literal["NelsonSiegelFitting"]] = "NelsonSiegelFitting" weights: Optional[Array] = None class SvenssonFitting(BaseModel): resource_name: Optional[Literal["SvenssonFitting"]] = "SvenssonFitting" weights: Optional[Array] = None class CubicBSplinesFitting(BaseModel): resource_name: Optional[Literal["CubicBSplinesFitting"]] = "CubicBSplinesFitting" knotVector: List[float] constrainAtZero: Optional[bool] = None weights: Optional[Array] = None class SimplePolynomialFitting(BaseModel): resource_name: Optional[ Literal["SimplePolynomialFitting"] ] = "SimplePolynomialFitting" degree: float constrainAtZero: Optional[bool] = None weights: Optional[Array] = None class Position(BaseModel): resource_name: Optional[Literal["Position"]] = "Position" class Gsr(BaseModel): resource_name: Optional[Literal["Gsr"]] = "Gsr" termStructure: YieldTermStructureHandle volstepdates: List[Date] volatilities: List[QuoteHandle] reversions: List[QuoteHandle] T: Optional[float] = None class MarkovFunctionalModelSettings0(BaseModel): resource_name: Optional[ Literal["MarkovFunctionalModelSettings"] ] = "MarkovFunctionalModelSettings" yGridPoints: Optional[int]
power = {'BUSES': {'Area': 1.33155, 'Bus/Area': 1.33155, 'Bus/Gate Leakage': 0.00662954, 'Bus/Peak Dynamic': 0.0, 'Bus/Runtime Dynamic': 0.0, 'Bus/Subthreshold Leakage': 0.0691322, 'Bus/Subthreshold Leakage with power gating': 0.0259246, 'Gate Leakage': 0.00662954, 'Peak Dynamic': 0.0, 'Runtime Dynamic': 0.0, 'Subthreshold Leakage': 0.0691322, 'Subthreshold Leakage with power gating': 0.0259246}, 'Core': [{'Area': 32.6082, 'Execution Unit/Area': 8.2042, 'Execution Unit/Complex ALUs/Area': 0.235435, 'Execution Unit/Complex ALUs/Gate Leakage': 0.0132646, 'Execution Unit/Complex ALUs/Peak Dynamic': 5.66814e-06, 'Execution Unit/Complex ALUs/Runtime Dynamic': 0.202693, 'Execution Unit/Complex ALUs/Subthreshold Leakage': 0.20111, 'Execution Unit/Complex ALUs/Subthreshold Leakage with power gating': 0.0754163, 'Execution Unit/Floating Point Units/Area': 4.6585, 'Execution Unit/Floating Point Units/Gate Leakage': 0.0656156, 'Execution Unit/Floating Point Units/Peak Dynamic': 2.02403e-05, 'Execution Unit/Floating Point Units/Runtime Dynamic': 0.304033, 'Execution Unit/Floating Point Units/Subthreshold Leakage': 0.994829, 'Execution Unit/Floating Point Units/Subthreshold Leakage with power gating': 0.373061, 'Execution Unit/Gate Leakage': 0.122718, 'Execution Unit/Instruction Scheduler/Area': 2.17927, 'Execution Unit/Instruction Scheduler/FP Instruction Window/Area': 0.328073, 'Execution Unit/Instruction Scheduler/FP Instruction Window/Gate Leakage': 0.00115349, 'Execution Unit/Instruction Scheduler/FP Instruction Window/Peak Dynamic': 1.20978, 'Execution Unit/Instruction Scheduler/FP Instruction Window/Runtime Dynamic': 0.369616, 'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage': 0.017004, 'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage with power gating': 0.00962066, 'Execution Unit/Instruction Scheduler/Gate Leakage': 0.00730101, 'Execution Unit/Instruction Scheduler/Instruction Window/Area': 1.00996, 'Execution Unit/Instruction Scheduler/Instruction Window/Gate Leakage': 0.00529112, 'Execution Unit/Instruction Scheduler/Instruction Window/Peak Dynamic': 2.07911, 'Execution Unit/Instruction Scheduler/Instruction Window/Runtime Dynamic': 0.64004, 'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage': 0.0800117, 'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage with power gating': 0.0455351, 'Execution Unit/Instruction Scheduler/Peak Dynamic': 4.84781, 'Execution Unit/Instruction Scheduler/ROB/Area': 0.841232, 'Execution Unit/Instruction Scheduler/ROB/Gate Leakage': 0.000856399, 'Execution Unit/Instruction Scheduler/ROB/Peak Dynamic': 1.55892, 'Execution Unit/Instruction Scheduler/ROB/Runtime Dynamic': 0.367081, 'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage': 0.0178624, 'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage with power gating': 0.00897339, 'Execution Unit/Instruction Scheduler/Runtime Dynamic': 1.37674, 'Execution Unit/Instruction Scheduler/Subthreshold Leakage': 0.114878, 'Execution Unit/Instruction Scheduler/Subthreshold Leakage with power gating': 0.0641291, 'Execution Unit/Integer ALUs/Area': 0.47087, 'Execution Unit/Integer ALUs/Gate Leakage': 0.0265291, 'Execution Unit/Integer ALUs/Peak Dynamic': 0.365347, 'Execution Unit/Integer ALUs/Runtime Dynamic': 0.101344, 'Execution Unit/Integer ALUs/Subthreshold Leakage': 0.40222, 'Execution Unit/Integer ALUs/Subthreshold Leakage with power gating': 0.150833, 'Execution Unit/Peak Dynamic': 5.59398, 'Execution Unit/Register Files/Area': 0.570804, 'Execution Unit/Register Files/Floating Point RF/Area': 0.208131, 'Execution Unit/Register Files/Floating Point RF/Gate Leakage': 0.000232788, 'Execution Unit/Register Files/Floating Point RF/Peak Dynamic': 3.82383e-06, 'Execution Unit/Register Files/Floating Point RF/Runtime Dynamic': 0.0133989, 'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage': 0.00399698, 'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage with power gating': 0.00176968, 'Execution Unit/Register Files/Gate Leakage': 0.000622708, 'Execution Unit/Register Files/Integer RF/Area': 0.362673, 'Execution Unit/Register Files/Integer RF/Gate Leakage': 0.00038992, 'Execution Unit/Register Files/Integer RF/Peak Dynamic': 0.0968933, 'Execution Unit/Register Files/Integer RF/Runtime Dynamic': 0.0990927, 'Execution Unit/Register Files/Integer RF/Subthreshold Leakage': 0.00614175, 'Execution Unit/Register Files/Integer RF/Subthreshold Leakage with power gating': 0.00246675, 'Execution Unit/Register Files/Peak Dynamic': 0.0968971, 'Execution Unit/Register Files/Runtime Dynamic': 0.112492, 'Execution Unit/Register Files/Subthreshold Leakage': 0.0101387, 'Execution Unit/Register Files/Subthreshold Leakage with power gating': 0.00423643, 'Execution Unit/Results Broadcast Bus/Area Overhead': 0.0442632, 'Execution Unit/Results Broadcast Bus/Gate Leakage': 0.00607074, 'Execution Unit/Results Broadcast Bus/Peak Dynamic': 0.234135, 'Execution Unit/Results Broadcast Bus/Runtime Dynamic': 0.601487, 'Execution Unit/Results Broadcast Bus/Subthreshold Leakage': 0.0920413, 'Execution Unit/Results Broadcast Bus/Subthreshold Leakage with power gating': 0.0345155, 'Execution Unit/Runtime Dynamic': 2.69879, 'Execution Unit/Subthreshold Leakage': 1.83518, 'Execution Unit/Subthreshold Leakage with power gating': 0.709678, 'Gate Leakage': 0.372997, 'Instruction Fetch Unit/Area': 5.86007, 'Instruction Fetch Unit/Branch Predictor/Area': 0.138516, 'Instruction Fetch Unit/Branch Predictor/Chooser/Area': 0.0435221, 'Instruction Fetch Unit/Branch Predictor/Chooser/Gate Leakage': 0.000278362, 'Instruction Fetch Unit/Branch Predictor/Chooser/Peak Dynamic': 0.0168831, 'Instruction Fetch Unit/Branch Predictor/Chooser/Runtime Dynamic': 0.00417854, 'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage': 0.00759719, 'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage with power gating': 0.0039236, 'Instruction Fetch Unit/Branch Predictor/Gate Leakage': 0.000757657, 'Instruction Fetch Unit/Branch Predictor/Global Predictor/Area': 0.0435221, 'Instruction Fetch Unit/Branch Predictor/Global Predictor/Gate Leakage': 0.000278362, 'Instruction Fetch Unit/Branch Predictor/Global Predictor/Peak Dynamic': 0.0168831, 'Instruction Fetch Unit/Branch Predictor/Global Predictor/Runtime Dynamic': 0.00417854, 'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage': 0.00759719, 'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage with power gating': 0.0039236, 'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Area': 0.0257064, 'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Gate Leakage': 0.000154548, 'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Peak Dynamic': 0.0142575, 'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Runtime Dynamic': 0.00365895, 'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage': 0.00384344, 'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage with power gating': 0.00198631, 'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Area': 0.0151917, 'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Gate Leakage': 8.00196e-05, 'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Peak Dynamic': 0.00527447, 'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Runtime Dynamic': 0.00142708, 'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage': 0.00181347, 'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage with power gating': 0.000957045, 'Instruction Fetch Unit/Branch Predictor/Peak Dynamic': 0.0597838, 'Instruction Fetch Unit/Branch Predictor/RAS/Area': 0.0105732, 'Instruction Fetch Unit/Branch Predictor/RAS/Gate Leakage': 4.63858e-05, 'Instruction Fetch Unit/Branch Predictor/RAS/Peak Dynamic': 0.0117602, 'Instruction Fetch Unit/Branch Predictor/RAS/Runtime Dynamic': 0.00142347, 'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage': 0.000932505, 'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage with power gating': 0.000494733, 'Instruction Fetch Unit/Branch Predictor/Runtime Dynamic': 0.0134395, 'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage': 0.0199703, 'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage with power gating': 0.0103282, 'Instruction Fetch Unit/Branch Target Buffer/Area': 0.64954, 'Instruction Fetch Unit/Branch Target Buffer/Gate Leakage': 0.00272758, 'Instruction Fetch Unit/Branch Target Buffer/Peak Dynamic': 0.177867, 'Instruction Fetch Unit/Branch Target Buffer/Runtime Dynamic': 0.0393685, 'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage': 0.0811682, 'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage with power gating': 0.0435357, 'Instruction Fetch Unit/Gate Leakage': 0.0590479, 'Instruction Fetch Unit/Instruction Buffer/Area': 0.0226323, 'Instruction Fetch Unit/Instruction Buffer/Gate Leakage': 6.83558e-05, 'Instruction Fetch Unit/Instruction Buffer/Peak Dynamic': 0.606827, 'Instruction Fetch Unit/Instruction Buffer/Runtime Dynamic': 0.0952604, 'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage': 0.00151885, 'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage with power gating': 0.000701682, 'Instruction Fetch Unit/Instruction Cache/Area': 3.14635, 'Instruction Fetch Unit/Instruction Cache/Gate Leakage': 0.029931, 'Instruction Fetch Unit/Instruction Cache/Peak Dynamic': 6.05938, 'Instruction Fetch Unit/Instruction Cache/Runtime Dynamic': 0.360214, 'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage': 0.367022, 'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage with power gating': 0.180386, 'Instruction Fetch Unit/Instruction Decoder/Area': 1.85799, 'Instruction Fetch Unit/Instruction Decoder/Gate Leakage': 0.0222493, 'Instruction Fetch Unit/Instruction Decoder/Peak Dynamic': 1.37404, 'Instruction Fetch Unit/Instruction Decoder/Runtime Dynamic': 0.323547, 'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage': 0.442943, 'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage with power gating': 0.166104, 'Instruction Fetch Unit/Peak Dynamic': 8.57647, 'Instruction Fetch Unit/Runtime Dynamic': 0.831829, 'Instruction Fetch Unit/Subthreshold Leakage': 0.932587, 'Instruction Fetch Unit/Subthreshold Leakage with power gating': 0.408542, 'L2/Area': 4.53318, 'L2/Gate Leakage': 0.015464, 'L2/Peak Dynamic': 0.0734183, 'L2/Runtime Dynamic': 0.0164294, 'L2/Subthreshold Leakage': 0.834142, 'L2/Subthreshold Leakage with power gating': 0.401066, 'Load Store Unit/Area': 8.80969, 'Load Store Unit/Data Cache/Area': 6.84535, 'Load Store Unit/Data Cache/Gate Leakage': 0.0279261, 'Load Store Unit/Data Cache/Peak Dynamic': 4.12483, 'Load Store Unit/Data Cache/Runtime Dynamic': 1.41181, 'Load Store Unit/Data Cache/Subthreshold Leakage': 0.527675, 'Load Store Unit/Data Cache/Subthreshold Leakage with power gating': 0.25085, 'Load Store Unit/Gate Leakage': 0.0351387, 'Load Store Unit/LoadQ/Area': 0.0836782, 'Load Store Unit/LoadQ/Gate Leakage': 0.00059896, 'Load Store Unit/LoadQ/Peak Dynamic': 0.0934243, 'Load Store Unit/LoadQ/Runtime Dynamic': 0.0934243, 'Load Store Unit/LoadQ/Subthreshold Leakage': 0.00941961, 'Load Store Unit/LoadQ/Subthreshold Leakage with power gating': 0.00536918, 'Load Store Unit/Peak Dynamic': 4.5678, 'Load Store Unit/Runtime Dynamic': 1.96598, 'Load Store Unit/StoreQ/Area': 0.322079, 'Load Store Unit/StoreQ/Gate Leakage': 0.00329971, 'Load Store Unit/StoreQ/Peak Dynamic': 0.230368, 'Load Store Unit/StoreQ/Runtime Dynamic': 0.460737, 'Load Store Unit/StoreQ/Subthreshold Leakage': 0.0345621, 'Load Store Unit/StoreQ/Subthreshold Leakage with power gating': 0.0197004, 'Load Store Unit/Subthreshold Leakage': 0.591622, 'Load Store Unit/Subthreshold Leakage with power gating': 0.283406, 'Memory Management Unit/Area': 0.434579, 'Memory Management Unit/Dtlb/Area': 0.0879726, 'Memory Management Unit/Dtlb/Gate Leakage': 0.00088729, 'Memory Management Unit/Dtlb/Peak Dynamic': 0.0817585, 'Memory Management Unit/Dtlb/Runtime Dynamic': 0.082562, 'Memory Management Unit/Dtlb/Subthreshold Leakage': 0.0155699, 'Memory Management Unit/Dtlb/Subthreshold Leakage with power gating': 0.00887485, 'Memory Management Unit/Gate Leakage': 0.00813591, 'Memory Management Unit/Itlb/Area': 0.301552, 'Memory Management Unit/Itlb/Gate Leakage': 0.00393464, 'Memory Management Unit/Itlb/Peak Dynamic': 0.37675, 'Memory Management Unit/Itlb/Runtime Dynamic': 0.0599378, 'Memory Management Unit/Itlb/Subthreshold Leakage': 0.0413758, 'Memory Management Unit/Itlb/Subthreshold Leakage with power gating': 0.0235842, 'Memory Management Unit/Peak Dynamic': 0.676593, 'Memory Management Unit/Runtime Dynamic': 0.1425, 'Memory Management Unit/Subthreshold Leakage': 0.0769113, 'Memory Management Unit/Subthreshold Leakage with power gating': 0.0399462, 'Peak Dynamic': 24.0499, 'Renaming Unit/Area': 0.369768, 'Renaming Unit/FP Front End RAT/Area': 0.168486, 'Renaming Unit/FP Front End RAT/Gate Leakage': 0.00489731, 'Renaming Unit/FP Front End RAT/Peak Dynamic': 3.33511, 'Renaming Unit/FP Front End RAT/Runtime Dynamic': 1.38203e-05, 'Renaming Unit/FP Front End RAT/Subthreshold Leakage': 0.0437281, 'Renaming Unit/FP Front End RAT/Subthreshold Leakage with power gating': 0.024925, 'Renaming Unit/Free List/Area': 0.0414755, 'Renaming Unit/Free List/Gate Leakage': 4.15911e-05, 'Renaming Unit/Free List/Peak Dynamic': 0.0401324, 'Renaming Unit/Free List/Runtime Dynamic': 0.0189003, 'Renaming Unit/Free List/Subthreshold Leakage': 0.000670426, 'Renaming Unit/Free List/Subthreshold Leakage with power gating': 0.000377987, 'Renaming Unit/Gate Leakage': 0.00863632, 'Renaming Unit/Int Front End RAT/Area': 0.114751, 'Renaming Unit/Int Front End RAT/Gate Leakage': 0.00038343, 'Renaming Unit/Int Front End RAT/Peak Dynamic': 0.86945, 'Renaming Unit/Int Front End RAT/Runtime Dynamic': 0.191359, 'Renaming Unit/Int Front End RAT/Subthreshold
die niet bestaat kijken we of er iets in /etc/hostname staat (computernaam) # maar dat is niet te testen zonder /etc/hosts aan te passen assert rhfn.get_tldname() == 'lemoncurry.nl' def add_to_hostsfile(self): # not really testable (yet) pass def add_to_server(self): # not really testable (yet) pass def test_init_css(self, monkeypatch, capsys): def mock_read_settings_empty(*args): return {'css': [] } def mock_read_settings_basic_plus(*args): return {'css': ['html4css1.css', 'reset.css', '960.css', 'myowncss.css', 'http://www.example.com/static/css.css'] } def mock_copyfile(*args): print('copying `{}` to `{}`'.format(*args)) def mock_update_settings(*args): print('update_settings called with args `{}` `{}`'.format(*args)) monkeypatch.setattr(rhfn.dml, 'read_settings', mock_read_settings_empty) monkeypatch.setattr(rhfn.shutil, 'copyfile', mock_copyfile) monkeypatch.setattr(rhfn.dml, 'update_settings', mock_update_settings) # als deze nog niet bestaat wordt er een directory css aangemaakt onder `sitename` # alle files in BASIC_CSS die nog niet in conf['css'] zitten worden daarin opgevoerd # en ook aan conf['css'] toegevoegd dat daarna aangepast wordt sitename = 'testsite' here = rhfn.HERE / 'static' there = rhfn.WEBROOT / sitename / 'css' there_present = there.parent.exists() copy_lines = ['copying `{0}/{2}` to `{1}/{2}`\n'.format(here, there, x) for x in rhfn.BASIC_CSS] update_lines = ["'url + css/{}'".format(x) for x in rhfn.BASIC_CSS] if not there_present: # make sure cssdir.mkdir doesn't fail there.parent.mkdir(parents=True, exist_ok=True) rhfn.init_css(sitename) assert capsys.readouterr().out == (''.join(copy_lines) + "update_settings called with" " args `testsite` `{{'css': [{}, {}, {}]}}`" "\n".format(*update_lines)) if not there_present: # teardown if necessary there.parent.rmdir() monkeypatch.setattr(rhfn.dml, 'read_settings', mock_read_settings_basic_plus) rhfn.init_css(sitename) assert capsys.readouterr().out == '' def test_list_confs(self, monkeypatch): def mock_list_sites_none(): return [] def mock_list_sites_one(): return ['one'] def mock_list_sites_more(): return ['first', 'next', 'last'] monkeypatch.setattr(rhfn.dml, 'list_sites', mock_list_sites_none) assert rhfn.list_confs() == '' monkeypatch.setattr(rhfn.dml, 'list_sites', mock_list_sites_one) assert rhfn.list_confs() == '<option>one</option>' assert rhfn.list_confs('two') == '<option>one</option>' monkeypatch.setattr(rhfn.dml, 'list_sites', mock_list_sites_more) assert rhfn.list_confs() == ('<option>first</option><option>next</option>' '<option>last</option>') assert rhfn.list_confs('last') == ('<option>first</option><option>next</option>' '<option selected="selected">last</option>') def test_read_conf(self, monkeypatch): mocked_settings = {'x': 'y'} def mock_read_settings_notfound(*args): raise FileNotFoundError def mock_read_settings_found(*args): return mocked_settings monkeypatch.setattr(rhfn.dml, 'read_settings', mock_read_settings_notfound) assert rhfn.read_conf('testsite') == ('no_such_sett', None) monkeypatch.setattr(rhfn.dml, 'read_settings', mock_read_settings_found) assert rhfn.read_conf('testsite') == ('', mocked_settings) def test_conf2text(self, monkeypatch): def mock_save_config_data(confdict, **kwargs): return confdict monkeypatch.setattr(rhfn, 'save_config_data', mock_save_config_data) conf_in = {'test': 'tested', 'url': 'gargl', 'css': ['gargl/snork.css', 'test.css']} conf_out = {'test': 'tested', 'url': 'gargl', 'css': ['url + snork.css', 'test.css']} assert rhfn.conf2text(conf_in) == conf_out def check_url(self, monkeypatch): def mock_urlopen_fout(*args): raise rhfn.urllib.error.HTTPError def test_text2conf(self, monkeypatch): def mock_get_text(*args): return args[0] + ': {}' def mock_load_config_data_error(*args): raise rhfn.ParserError def mock_load_config_data_empty(*args): return {} def mock_load_config_data_basic(*args): return rhfn.DFLT_CONF def mock_load_config_data_hig_fout(*args): conf = {x: y for x, y in rhfn.DFLT_CONF.items()} conf['hig'] = 'hallo' return conf def mock_load_config_data_lang_fout(*args): conf = {x: y for x, y in rhfn.DFLT_CONF.items()} conf['lang'] = 'du' return conf def mock_load_config_url_not_http(*args): conf = {x: y for x, y in rhfn.DFLT_CONF.items()} conf['url'] = 'x' print(conf) return conf def mock_load_config_url_other(*args): conf = {x: y for x, y in rhfn.DFLT_CONF.items()} conf['url'] = 'http://x/' return conf def mock_check_url(*args): # raise rhfn.urllib.error.HTTPError raise rhfn.urllib.error.URLError('x') def mock_load_config_css_simple(*args): conf = {x: y for x, y in rhfn.DFLT_CONF.items()} conf['css'] = 'a_string' return conf def mock_load_config_css_double(*args): conf = {x: y for x, y in rhfn.DFLT_CONF.items()} conf['url'] = 'http://x' conf['css'] = ['url + a_string', 'http://stuff'] return conf def mock_check_url_ok(*args): pass monkeypatch.setattr(rhfn, 'get_text', mock_get_text) monkeypatch.setattr(rhfn, 'load_config_data', mock_load_config_data_error) assert rhfn.text2conf('') == ('sett_no_good: {}', {}) monkeypatch.setattr(rhfn, 'load_config_data', mock_load_config_data_empty) assert rhfn.text2conf('') == ('sett_invalid: wid', {}) monkeypatch.setattr(rhfn, 'load_config_data', mock_load_config_data_basic) assert rhfn.text2conf('') == ('', rhfn.DFLT_CONF) monkeypatch.setattr(rhfn, 'load_config_data', mock_load_config_data_hig_fout) assert rhfn.text2conf('') == ('sett_invalid: hig', {}) monkeypatch.setattr(rhfn, 'load_config_data', mock_load_config_data_lang_fout) assert rhfn.text2conf('') == ('sett_invalid: lang', {}) monkeypatch.setattr(rhfn, 'load_config_data', mock_load_config_url_not_http) assert rhfn.text2conf('') == ('sett_invalid: url', {}) monkeypatch.setattr(rhfn, 'load_config_data', mock_load_config_url_other) monkeypatch.setattr(rhfn, 'check_url', mock_check_url) assert rhfn.text2conf('') == ('sett_invalid: url', {}) monkeypatch.setattr(rhfn, 'load_config_data', mock_load_config_css_simple) expected = {x: y for x, y in rhfn.DFLT_CONF.items()} expected.update({'css': ['https://a_string']}) assert rhfn.text2conf('') == ('', expected) monkeypatch.setattr(rhfn, 'load_config_data', mock_load_config_css_double) monkeypatch.setattr(rhfn, 'check_url', mock_check_url_ok) expected = {x: y for x, y in rhfn.DFLT_CONF.items()} expected.update({'url': 'http://x','css': ['http://x/a_string', 'http://stuff']}) assert rhfn.text2conf('') == ('', expected) def test_check_url(self, monkeypatch): def mock_urlopen_ok(*args): pass def mock_urlopen(*args): raise rhfn.urllib.error.URLError('x') monkeypatch.setattr(rhfn.urllib.request, 'urlopen', mock_urlopen_ok) assert rhfn.check_url('') == None monkeypatch.setattr(rhfn.urllib.request, 'urlopen', mock_urlopen) with pytest.raises(rhfn.urllib.error.URLError): rhfn.check_url('http://test/testerdetest') def test_save_conf(self, monkeypatch, capsys): def mock_read_settings_error(*args): raise FileNotFoundError def mock_read_settings(*args): return {} def mock_get_text(*args): return 'no_such_sett for `{}`' def mock_text2conf_error(*args): return True, {} def mock_text2conf(*args): return False, {'url': False} def mock_update_settings(*args): print('called update_settings for `{}` `{}`'.format(*args)) monkeypatch.setattr(rhfn.dml, 'read_settings', mock_read_settings_error) monkeypatch.setattr(rhfn, 'get_text', mock_get_text) assert rhfn.save_conf('testsite', '') == 'no_such_sett for `testsite`' monkeypatch.setattr(rhfn.dml, 'read_settings', mock_read_settings) monkeypatch.setattr(rhfn, 'text2conf', mock_text2conf_error) assert rhfn.save_conf('testsite', '') monkeypatch.setattr(rhfn, 'text2conf', mock_text2conf) monkeypatch.setattr(rhfn.dml, 'update_settings', mock_update_settings) assert not rhfn.save_conf('testsite', '') assert capsys.readouterr().out == "called update_settings for `testsite` `{'url': False}`\n" class TestSiteRelated: def test_list_subdirs(self, monkeypatch, capsys): def mock_list_dirs(*args): print('ext arg is', args[1]) return ['my_hovercraft', 'cheese_shop'] def mock_list_dirs_empty(*args): print('ext arg is', args[1]) return [] def mock_list_dirs_error(*args): print('ext arg is', args[1]) raise FileNotFoundError sitename = 'testsite' monkeypatch.setattr(rhfn.dml, 'list_dirs', mock_list_dirs) assert rhfn.list_subdirs(sitename) == ['cheese_shop/', 'my_hovercraft/'] assert capsys.readouterr().out == 'ext arg is src\n' monkeypatch.setattr(rhfn.dml, 'list_dirs', mock_list_dirs_empty) assert rhfn.list_subdirs(sitename, 'dest') == [] assert capsys.readouterr().out == 'ext arg is dest\n' monkeypatch.setattr(rhfn.dml, 'list_dirs', mock_list_dirs) assert rhfn.list_subdirs(sitename, 'xxxx') == ['cheese_shop/', 'my_hovercraft/'] assert capsys.readouterr().out == 'ext arg is dest\n' monkeypatch.setattr(rhfn.dml, 'list_dirs', mock_list_dirs_error) assert rhfn.list_subdirs(sitename, 'src') == [] assert capsys.readouterr().out == 'ext arg is src\n' def test_list_files(self, monkeypatch): def mock_list_docs(*args, **kwargs): return ['luxury-yacht', 'throatwobbler-mangrove'] def mock_list_docs_empty(*args, **kwargs): return [] def mock_list_docs_not_found(*args, **kwargs): raise FileNotFoundError def mock_list_docs_wrong_type(*args, **kwargs): return def mock_list_subdirs(*args): return ['my_hovercraft/', 'cheese_shop/'] def mock_list_subdirs_empty(*args): return [] def mock_list_templates(*args): return ['letter.tpl', 'number.tpl'] def mock_list_templates_empty(*args): return [] sitename = 'testsite' monkeypatch.setattr(rhfn.dml, 'list_docs', mock_list_docs_not_found) assert rhfn.list_files(sitename) == 'Site not found' monkeypatch.setattr(rhfn.dml, 'list_docs', mock_list_docs_wrong_type) assert rhfn.list_files(sitename, ext='xxx') == 'Wrong type: `xxx`' monkeypatch.setattr(rhfn.dml, 'list_docs', mock_list_docs) assert rhfn.list_files(sitename, deleted=True) == ['luxury-yacht', 'throatwobbler-mangrove'] monkeypatch.setattr(rhfn.dml, 'list_templates', mock_list_templates_empty) assert rhfn.list_files(sitename) == ('<option>luxury-yacht.rst</option>' '<option>throatwobbler-mangrove.rst</option>') monkeypatch.setattr(rhfn, 'list_subdirs', mock_list_subdirs_empty) assert rhfn.list_files(sitename, current='enormous') == ( '<option>..</option>' '<option>luxury-yacht.rst</option>' '<option>throatwobbler-mangrove.rst</option>') monkeypatch.setattr(rhfn.dml, 'list_templates', mock_list_templates) assert rhfn.list_files(sitename, naam='luxury-yacht.rst') == ( '<option>-- letter.tpl --</option>' '<option>-- number.tpl --</option>' '<option selected="selected">luxury-yacht.rst</option>' '<option>throatwobbler-mangrove.rst</option>') monkeypatch.setattr(rhfn, 'list_subdirs', mock_list_subdirs) assert rhfn.list_files(sitename, ext='dest') == ( '<option>my_hovercraft/</option>' '<option>cheese_shop/</option>' '<option>luxury-yacht.html</option>' '<option>throatwobbler-mangrove.html</option>') def test_make_new_dir(self, monkeypatch, capsys): def mock_create_new_dir(*args): print('create_new_dir called') def mock_create_new_dir_failed(*args): raise FileExistsError sitename, filename = 'testsite', 'testname' monkeypatch.setattr(rhfn.dml, 'create_new_dir', mock_create_new_dir) assert rhfn.make_new_dir(sitename, filename) == '' assert capsys.readouterr().out == 'create_new_dir called\n' monkeypatch.setattr(rhfn.dml, 'create_new_dir', mock_create_new_dir_failed) assert rhfn.make_new_dir(sitename, filename) == 'dir_name_taken' class TestSourceRelated: sitename, filename = 'testsite', 'testname' def test_read_src_data(self, monkeypatch, capsys): def mock_get_doc_contents(*args, **kwargs): print('got args `{}`, `{}`, `{}`, `{}`'.format(*args)) def mock_get_doc_contents_error_1(*args, **kwargs): raise AttributeError def mock_get_doc_contents_error_2(*args, **kwargs): raise FileNotFoundError assert rhfn.read_src_data(self.sitename, '', self.filename + '.x') == ( 'rst_filename_error', '') monkeypatch.setattr(rhfn.dml, 'get_doc_contents', mock_get_doc_contents) rhfn.read_src_data(self.sitename, '', self.filename + '.rst') assert capsys.readouterr().out == 'got args `testsite`, `testname`, `src`, ``\n' monkeypatch.setattr(rhfn.dml, 'get_doc_contents', mock_get_doc_contents_error_1) assert rhfn.read_src_data(self.sitename, '', self.filename) == ('src_name_missing', '') monkeypatch.setattr(rhfn.dml, 'get_doc_contents', mock_get_doc_contents_error_2) assert rhfn.read_src_data(self.sitename, '', self.filename) == ('src_file_missing', '') def test_check_if_rst(self, monkeypatch): assert rhfn.check_if_rst('', '') == 'supply_text' assert rhfn.check_if_rst('...', '') == 'rst_invalid' assert rhfn.check_if_rst('...', rhfn.RST) == '' assert rhfn.check_if_rst('...', rhfn.RST, 'x') == '' assert rhfn.check_if_rst('...', rhfn.RST, '') == 'src_name_missing' assert rhfn.check_if_rst('...', rhfn.RST, 'x/') == 'src_name_missing' assert rhfn.check_if_rst('...', rhfn.RST, '-- new --') == 'src_name_missing' assert rhfn.check_if_rst('...', rhfn.RST, '..') == 'src_name_missing' def test_save_src_data(self, monkeypatch, capsys): def mock_list_subdirs(*args): return ['hello/'] def mock_create_new_dir(*args): print('args for creating dir: `{}` `{}`'.format(*args)) def mock_create_new_dir_exists(*args): raise FileExistsError def mock_create_new_doc(*args, **kwargs): print('args for creating doc: `{}` `{}`'.format(args[0], args[1], kwargs['directory'])) def mock_create_new_doc_exists(*args, **kwargs): raise FileExistsError def mock_update_rst(*args, **kwargs): print('args for update_rst: `{}` `{}` `{}` `{}`'.format(args[0], args[1], args[2], kwargs['directory'])) def mock_update_rst_error_1(*args, **kwargs): raise AttributeError('name') def mock_update_rst_error_2(*args, **kwargs): raise AttributeError('contents') def mock_update_rst_error_3(*args, **kwargs): raise AttributeError('something else') def mock_update_rst_error_4(*args, **kwargs): raise FileNotFoundError assert rhfn.save_src_data(self.sitename, '', self.filename + '.x', '...') == ( 'rst_filename_error') monkeypatch.setattr(rhfn.dml, 'create_new_dir', mock_create_new_dir) monkeypatch.setattr(rhfn.dml, 'create_new_doc', mock_create_new_doc_exists) monkeypatch.setattr(rhfn.dml, 'update_rst', mock_update_rst) assert rhfn.save_src_data(self.sitename, 'test', self.filename + '.rst', '...', True) == ( 'src_name_taken') assert capsys.readouterr().out == 'args for creating dir: `testsite` `test`\n' monkeypatch.setattr(rhfn.dml, 'create_new_doc', mock_create_new_doc) assert rhfn.save_src_data(self.sitename, 'test', self.filename + '.rst', '...') == '' assert capsys.readouterr().out == ('args for creating dir: `testsite` `test`\n' 'args for update_rst: `testsite` `testname` `...` ' '`test`\n') monkeypatch.setattr(rhfn.dml, 'create_new_dir', mock_create_new_dir_exists) assert rhfn.save_src_data(self.sitename, 'test', self.filename + '.rst', '...', True) == '' assert capsys.readouterr().out == ('args for creating doc: `testsite` `testname.rst`\n' 'args for update_rst: `testsite` `testname` `...` ' '`test`\n') monkeypatch.setattr(rhfn.dml, 'update_rst', mock_update_rst_error_1) assert rhfn.save_src_data(self.sitename, 'hello', self.filename + '.rst', '...') == ( 'src_name_missing') monkeypatch.setattr(rhfn.dml, 'update_rst', mock_update_rst_error_2) assert rhfn.save_src_data(self.sitename, 'hello', self.filename + '.rst', '...') == ( 'supply_text') monkeypatch.setattr(rhfn.dml, 'update_rst', mock_update_rst_error_3) assert rhfn.save_src_data(self.sitename, 'hello', self.filename + '.rst', '...') == ( 'something else') monkeypatch.setattr(rhfn.dml, 'update_rst', mock_update_rst_error_4) assert rhfn.save_src_data(self.sitename, 'hello', self.filename + '.rst', '...') == ( 'src_file_missing') def test_revert_src(self, monkeypatch, capsys): def
# # This file is part of LiteX. # # Copyright (c) 2019-2020 <NAME> <<EMAIL>> # Copyright (c) 2020 <NAME> <<EMAIL>> # Copyright (c) 2020 <NAME> <<EMAIL>> # SPDX-License-Identifier: BSD-2-Clause import os from migen import * from migen.fhdl.specials import Tristate from migen.genlib.resetsync import AsyncResetSynchronizer from litex.soc.interconnect import wishbone from litex.soc.interconnect import axi from litex.soc.cores.cpu import CPU # Zynq 7000 ---------------------------------------------------------------------------------------- class Zynq7000(CPU): variants = ["standard"] family = "arm" name = "zynq7000" human_name = "Zynq7000" data_width = 32 endianness = "little" reset_address = 0x00000000 gcc_triple = "arm-xilinx-eabi" linker_output_format = "elf32-littlearm" nop = "nop" io_regions = {0x00000000: 0x100000000} # Origin, Length. # Memory Mapping. @property def mem_map(self): return {"csr": 0x00000000} def __init__(self, platform, variant): platform.ps7_cfg = {} self.platform = platform self.reset = Signal() self.periph_buses = [] # Peripheral buses (Connected to main SoC's bus). self.memory_buses = [] # Memory buses (Connected directly to LiteDRAM). self.axi_gp_masters = [] # General Purpose AXI Masters. self.axi_gp_slaves = [] # General Purpose AXI Slaves. self.axi_hp_slaves = [] # High Performance AXI Slaves. # # # # PS7 Clocking. self.clock_domains.cd_ps7 = ClockDomain() # PS7 (Minimal) ---------------------------------------------------------------------------- self.ps7_name = None self.ps7_tcl = [] ps7_rst_n = Signal() ps7_ddram_pads = platform.request("ps7_ddram") self.cpu_params = dict( # Clk / Rst. io_PS_CLK = platform.request("ps7_clk"), io_PS_PORB = platform.request("ps7_porb"), io_PS_SRSTB = platform.request("ps7_srstb"), # MIO. io_MIO = platform.request("ps7_mio"), # DDRAM. io_DDR_Addr = ps7_ddram_pads.addr, io_DDR_BankAddr = ps7_ddram_pads.ba, io_DDR_CAS_n = ps7_ddram_pads.cas_n, io_DDR_Clk_n = ps7_ddram_pads.ck_n, io_DDR_Clk = ps7_ddram_pads.ck_p, io_DDR_CKE = ps7_ddram_pads.cke, io_DDR_CS_n = ps7_ddram_pads.cs_n, io_DDR_DM = ps7_ddram_pads.dm, io_DDR_DQ = ps7_ddram_pads.dq, io_DDR_DQS_n = ps7_ddram_pads.dqs_n, io_DDR_DQS = ps7_ddram_pads.dqs_p, io_DDR_ODT = ps7_ddram_pads.odt, io_DDR_RAS_n = ps7_ddram_pads.ras_n, io_DDR_DRSTB = ps7_ddram_pads.reset_n, io_DDR_WEB = ps7_ddram_pads.we_n, io_DDR_VRN = ps7_ddram_pads.vrn, io_DDR_VRP = ps7_ddram_pads.vrp, # USB0. i_USB0_VBUS_PWRFAULT = 0, # Fabric Clk / Rst. o_FCLK_CLK0 = ClockSignal("ps7"), o_FCLK_RESET0_N = ps7_rst_n ) self.specials += AsyncResetSynchronizer(self.cd_ps7, ~ps7_rst_n) # Enet0 mdio ------------------------------------------------------------------------------- ps7_enet0_mdio_pads = platform.request("ps7_enet0_mdio", loose=True) if ps7_enet0_mdio_pads is not None: self.cpu_params.update( o_ENET0_MDIO_MDC = ps7_enet0_mdio_pads.mdc, i_ENET0_MDIO_I = ps7_enet0_mdio_pads.i, o_ENET0_MDIO_O = ps7_enet0_mdio_pads.o, o_ENET0_MDIO_T = ps7_enet0_mdio_pads.t ) # Enet0 ------------------------------------------------------------------------------------ ps7_enet0_pads = platform.request("ps7_enet0", loose=True) if ps7_enet0_pads is not None: self.cpu_params.update( o_ENET0_GMII_TX_EN = ps7_enet0_pads.tx_en, o_ENET0_GMII_TX_ER = ps7_enet0_pads.tx_er, o_ENET0_GMII_TXD = ps7_enet0_pads.txd, i_ENET0_GMII_COL = ps7_enet0_pads.col, i_ENET0_GMII_CRS = ps7_enet0_pads.crs, i_ENET0_GMII_RX_CLK = ps7_enet0_pads.rx_clk, i_ENET0_GMII_RX_DV = ps7_enet0_pads.rx_dv, i_ENET0_GMII_RX_ER = ps7_enet0_pads.rx_er, i_ENET0_GMII_TX_CLK = ps7_enet0_pads.tx_clk, i_ENET0_GMII_RXD = ps7_enet0_pads.rxd ) # SDIO0 ------------------------------------------------------------------------------------ ps7_sdio0_pads = platform.request("ps7_sdio0", loose=True) if ps7_sdio0_pads is not None: self.cpu_params.update( o_SDIO0_CLK = ps7_sdio0_pads.clk, i_SDIO0_CLK_FB = ps7_sdio0_pads.clk_fb, o_SDIO0_CMD_O = ps7_sdio0_pads.cmd_o, i_SDIO0_CMD_I = ps7_sdio0_pads.cmd_i, o_SDIO0_CMD_T = ps7_sdio0_pads.cmd_t, o_SDIO0_DATA_O = ps7_sdio0_pads.data_o, i_SDIO0_DATA_I = ps7_sdio0_pads.data_i, o_SDIO0_DATA_T = ps7_sdio0_pads.data_t, o_SDIO0_LED = ps7_sdio0_pads.led, o_SDIO0_BUSPOW = ps7_sdio0_pads.buspow, o_SDIO0_BUSVOLT = ps7_sdio0_pads.busvolt, ) # SDIO0_CD --------------------------------------------------------------------------------- ps7_sdio0_cd_pads = platform.request("ps7_sdio0_cd", loose=True) if ps7_sdio0_cd_pads is not None: self.cpu_params.update(i_SDIO0_CDN = ps7_sdio0_cd_pads.cdn) # SDIO0_WP --------------------------------------------------------------------------------- ps7_sdio0_wp_pads = platform.request("ps7_sdio0_wp", loose=True) if ps7_sdio0_wp_pads is not None: self.cpu_params.update(i_SDIO0_WP = ps7_sdio0_wp_pads.wp) # TODO compare this possibly redundant homebrew zynq config thingy against upstream litex functionality def gen_ps7_ip(self, preset='ZedBoard'): ''' To customize Zynq PS configuration, add key value pairs to self.platform.ps7_cfg. Use vivado gui to find valid settings: * open project: `build/gateware/*.xpr` * open `ps7_cfg` in the project manager * customize Peripheral I/O Pins / Fabric clocks / etc, OK * Generate Output Products: Skip * File, Project, Open Journal File * Copy the lines starting with `set_proerty`, strip the `CONFIG.` from the key and add them to ps7_cfg dict TODO better integration with the litex build process ''' print('gen_ps7_ip()', self.platform.ps7_cfg) cmds = self.platform.toolchain.pre_synthesis_commands preset = '{{' + preset + '}}' cmds += [ 'create_ip -name processing_system7 -vendor xilinx.com -library ip -version 5.5 -module_name ps7_cfg', f'set_property -dict [list CONFIG.preset {preset}] [get_ips ps7_cfg]', ] for k, v in self.platform.ps7_cfg.items(): v = '{{' + v + '}}' cmds.append(f'set_property CONFIG.{k} {v} [get_ips ps7_cfg]') cmds += [ 'upgrade_ip [get_ips ps7_cfg]', 'generate_target all [get_ips ps7_cfg]', 'set_msg_config -id {{Vivado 12-5447}} -new_severity {{Info}}', 'synth_ip [get_ips ps7_cfg]' ] def set_ps7_xci(self, xci): # Add .xci as Vivado IP and set ps7_name from .xci filename. self.ps7_xci = xci self.ps7_name = os.path.splitext(os.path.basename(xci))[0] self.platform.add_ip(xci) def add_ps7_config(self, config): # Check that PS7 has been set. if self.ps7_name is None: raise Exception("Please set PS7 with set_ps7 method first.") # Config must be provided as a config, value dict. assert isinstance(config, dict) # Add configs to PS7. self.ps7_tcl.append("set_property -dict [list \\") for config, value in config.items(): self.ps7_tcl.append("CONFIG.{} {} \\".format(config, '{{' + value + '}}')) self.ps7_tcl.append(f"] [get_ips {self.ps7_name}]") def set_ps7(self, name=None, xci=None, preset=None, config=None): # Check that PS7 has not already been set. if self.ps7_name is not None: raise Exception(f"PS7 has already been set to {self.ps7_name}.") self.ps7_name = preset if name is None else name # User should provide an .xci file, preset_name or config dict but not all at once. if (xci is not None) and (preset is not None): raise Exception("PS7 .xci and preset specified, please only provide one.") # User provides an .xci file... if xci is not None: self.set_ps7_xci(xci) # User provides a preset or/and config else: self.ps7_tcl.append(f"set ps7 [create_ip -vendor xilinx.com -name processing_system7 -module_name {self.ps7_name}]") if preset is not None: assert isinstance(preset, str) self.ps7_tcl.append("set_property -dict [list CONFIG.preset {}] [get_ips {}]".format("{{" + preset + "}}", self.ps7_name)) if config is not None: self.add_ps7_config(config) # AXI General Purpose Master ------------------------------------------------------------------- def add_axi_gp_master(self): assert len(self.axi_gp_masters) < 2 n = len(self.axi_gp_masters) axi_gpn = axi.AXIInterface(data_width=32, address_width=32, id_width=12) self.axi_gp_masters.append(axi_gpn) self.cpu_params.update({ # AXI GP clk. f"i_M_AXI_GP{n}_ACLK" : ClockSignal("ps7"), # AXI GP aw. f"o_M_AXI_GP{n}_AWVALID" : axi_gpn.aw.valid, f"i_M_AXI_GP{n}_AWREADY" : axi_gpn.aw.ready, f"o_M_AXI_GP{n}_AWADDR" : axi_gpn.aw.addr, f"o_M_AXI_GP{n}_AWBURST" : axi_gpn.aw.burst, f"o_M_AXI_GP{n}_AWLEN" : axi_gpn.aw.len[:4], f"o_M_AXI_GP{n}_AWSIZE" : axi_gpn.aw.size[:3], f"o_M_AXI_GP{n}_AWID" : axi_gpn.aw.id, f"o_M_AXI_GP{n}_AWLOCK" : axi_gpn.aw.lock, f"o_M_AXI_GP{n}_AWPROT" : axi_gpn.aw.prot, f"o_M_AXI_GP{n}_AWCACHE" : axi_gpn.aw.cache, f"o_M_AXI_GP{n}_AWQOS" : axi_gpn.aw.qos, # AXI GP w. f"o_M_AXI_GP{n}_WVALID" : axi_gpn.w.valid, f"o_M_AXI_GP{n}_WLAST" : axi_gpn.w.last, f"i_M_AXI_GP{n}_WREADY" : axi_gpn.w.ready, f"o_M_AXI_GP{n}_WID" : axi_gpn.w.id, f"o_M_AXI_GP{n}_WDATA" : axi_gpn.w.data, f"o_M_AXI_GP{n}_WSTRB" : axi_gpn.w.strb, # AXI GP b. f"i_M_AXI_GP{n}_BVALID" : axi_gpn.b.valid, f"o_M_AXI_GP{n}_BREADY" : axi_gpn.b.ready, f"i_M_AXI_GP{n}_BID" : axi_gpn.b.id, f"i_M_AXI_GP{n}_BRESP" : axi_gpn.b.resp, # AXI GP ar. f"o_M_AXI_GP{n}_ARVALID" : axi_gpn.ar.valid, f"i_M_AXI_GP{n}_ARREADY" : axi_gpn.ar.ready, f"o_M_AXI_GP{n}_ARADDR" : axi_gpn.ar.addr, f"o_M_AXI_GP{n}_ARBURST" : axi_gpn.ar.burst, f"o_M_AXI_GP{n}_ARLEN" : axi_gpn.ar.len[:4], f"o_M_AXI_GP{n}_ARID" : axi_gpn.ar.id, f"o_M_AXI_GP{n}_ARLOCK" : axi_gpn.ar.lock, f"o_M_AXI_GP{n}_ARSIZE" : axi_gpn.ar.size[:3], f"o_M_AXI_GP{n}_ARPROT" : axi_gpn.ar.prot, f"o_M_AXI_GP{n}_ARCACHE" : axi_gpn.ar.cache, f"o_M_AXI_GP{n}_ARQOS" : axi_gpn.ar.qos, # AXI GP r. f"i_M_AXI_GP{n}_RVALID" : axi_gpn.r.valid, f"o_M_AXI_GP{n}_RREADY" : axi_gpn.r.ready, f"i_M_AXI_GP{n}_RLAST" : axi_gpn.r.last, f"i_M_AXI_GP{n}_RID" : axi_gpn.r.id, f"i_M_AXI_GP{n}_RRESP" : axi_gpn.r.resp, f"i_M_AXI_GP{n}_RDATA" : axi_gpn.r.data, }) return axi_gpn # AXI General Purpose Slave -------------------------------------------------------------------- def add_axi_gp_slave(self): raise NotImplementedError # AXI High Performance Slave ------------------------------------------------------------------- def add_axi_hp_slave(self): assert len(self.axi_hp_slaves) < 4 n = len(self.axi_hp_slaves) axi_hpn = axi.AXIInterface(data_width=64, address_width=32, id_width=6) self.axi_hp_slaves.append(axi_hpn) self.cpu_params.update({ # AXI HP0 clk. f"i_S_AXI_HP{n}_ACLK" : ClockSignal("ps7"), # AXI HP0 aw. f"i_S_AXI_HP{n}_AWVALID" : axi_hpn.aw.valid, f"o_S_AXI_HP{n}_AWREADY" : axi_hpn.aw.ready, f"i_S_AXI_HP{n}_AWADDR" : axi_hpn.aw.addr, f"i_S_AXI_HP{n}_AWBURST" : axi_hpn.aw.burst, f"i_S_AXI_HP{n}_AWLEN" : axi_hpn.aw.len, f"i_S_AXI_HP{n}_AWSIZE" : axi_hpn.aw.size, f"i_S_AXI_HP{n}_AWID" : axi_hpn.aw.id, f"i_S_AXI_HP{n}_AWLOCK" : axi_hpn.aw.lock, f"i_S_AXI_HP{n}_AWPROT" : axi_hpn.aw.prot, f"i_S_AXI_HP{n}_AWCACHE" : axi_hpn.aw.cache, f"i_S_AXI_HP{n}_AWQOS" : axi_hpn.aw.qos, # AXI HP0 w. f"i_S_AXI_HP{n}_WVALID" : axi_hpn.w.valid, f"i_S_AXI_HP{n}_WLAST" : axi_hpn.w.last, f"o_S_AXI_HP{n}_WREADY" : axi_hpn.w.ready, f"i_S_AXI_HP{n}_WID" : axi_hpn.w.id, f"i_S_AXI_HP{n}_WDATA" : axi_hpn.w.data, f"i_S_AXI_HP{n}_WSTRB" : axi_hpn.w.strb, # AXI HP0 b. f"o_S_AXI_HP{n}_BVALID" : axi_hpn.b.valid, f"i_S_AXI_HP{n}_BREADY" : axi_hpn.b.ready, f"o_S_AXI_HP{n}_BID" : axi_hpn.b.id, f"o_S_AXI_HP{n}_BRESP" : axi_hpn.b.resp, # AXI HP0 ar. f"i_S_AXI_HP{n}_ARVALID" : axi_hpn.ar.valid, f"o_S_AXI_HP{n}_ARREADY" : axi_hpn.ar.ready, f"i_S_AXI_HP{n}_ARADDR" : axi_hpn.ar.addr, f"i_S_AXI_HP{n}_ARBURST" : axi_hpn.ar.burst, f"i_S_AXI_HP{n}_ARLEN" : axi_hpn.ar.len, f"i_S_AXI_HP{n}_ARID" : axi_hpn.ar.id, f"i_S_AXI_HP{n}_ARLOCK" : axi_hpn.ar.lock, f"i_S_AXI_HP{n}_ARSIZE" : axi_hpn.ar.size, f"i_S_AXI_HP{n}_ARPROT" : axi_hpn.ar.prot, f"i_S_AXI_HP{n}_ARCACHE" : axi_hpn.ar.cache, f"i_S_AXI_HP{n}_ARQOS" : axi_hpn.ar.qos, # AXI HP0 r. f"o_S_AXI_HP{n}_RVALID" : axi_hpn.r.valid, f"i_S_AXI_HP{n}_RREADY" : axi_hpn.r.ready, f"o_S_AXI_HP{n}_RLAST" : axi_hpn.r.last, f"o_S_AXI_HP{n}_RID" : axi_hpn.r.id, f"o_S_AXI_HP{n}_RRESP" : axi_hpn.r.resp, f"o_S_AXI_HP{n}_RDATA" : axi_hpn.r.data, }) return axi_hpn def add_emio_spi(self, spi_pads, n=0): ''' Connect a PS SPI interfaces to some IO pads. n selects which one (0 or 1). ''' self.platform.ps7_cfg[f'CONFIG.PCW_SPI{n}_PERIPHERAL_ENABLE'] = '1' p = spi_pads for s, v in zip(["SCLK", "MOSI", "SS"], [p.clk, p.mosi, p.cs_n]): self.cpu_params["o_SPI{}_{}_O".format(n, s)] = v try: miso = p.miso except AttributeError: print("add_emio_spi(): MISO pin hard-wired to 0") miso = 0 self.cpu_params["i_SPI{}_MISO_I".format(n)] = miso # ---------------- # unused PS pins # ---------------- for s, v in zip(["SCLK", "MOSI", "SS"], [0, 0, 1]): self.cpu_params["i_SPI{}_{}_I".format(n, s)] = v # o_SPI0_SS1_O= # o_SPI0_SS2_O= # o_SPI0_SCLK_T= # o_SPI0_MOSI_T= # o_SPI0_SS_T= def add_emio_gpio(self, target_pads=None, N=32): ''' Connect a PS GPIO interfaces to some IO pads. N selects width of GPIO port. ''' self.platform.ps7_cfg.update( PCW_GPIO_EMIO_GPIO_ENABLE='1', PCW_GPIO_EMIO_GPIO_IO=str(N) ) GPIO_O = Signal(N) GPIO_T = Signal(N) GPIO_I = Signal(N) self.cpu_params.update( o_GPIO_O=GPIO_O, o_GPIO_T=GPIO_T, i_GPIO_I=GPIO_I ) if target_pads: self.specials += Tristate(target_pads, GPIO_O, ~GPIO_T, GPIO_I) def add_emio_i2c(self,
<reponame>online-ml/creme<filename>river/tree/hoeffding_tree.py import collections import functools import io import math import typing from abc import ABC, abstractmethod from river import base from river.utils.skmultiflow_utils import ( calculate_object_size, normalize_values_in_dict, ) from .nodes.branch import ( DTBranch, NominalBinaryBranch, NominalMultiwayBranch, NumericBinaryBranch, NumericMultiwayBranch, ) from .nodes.leaf import HTLeaf try: import graphviz GRAPHVIZ_INSTALLED = True except ImportError: GRAPHVIZ_INSTALLED = False class HoeffdingTree(ABC): """Base class for Hoeffding Decision Trees. This is an **abstract class**, so it cannot be used directly. It defines base operations and properties that all the Hoeffding decision trees must inherit or implement according to their own design. Parameters ---------- max_depth The maximum depth a tree can reach. If `None`, the tree will grow indefinitely. binary_split If True, only allow binary splits. max_size The max size of the tree, in Megabytes (MB). memory_estimate_period Interval (number of processed instances) between memory consumption checks. stop_mem_management If True, stop growing as soon as memory limit is hit. remove_poor_attrs If True, disable poor attributes to reduce memory usage. merit_preprune If True, enable merit-based tree pre-pruning. """ def __init__( self, max_depth: int = None, binary_split: bool = False, max_size: float = 100.0, memory_estimate_period: int = 1000000, stop_mem_management: bool = False, remove_poor_attrs: bool = False, merit_preprune: bool = True, ): # Properties common to all the Hoeffding trees self._split_criterion: str = "" self._leaf_prediction: str = "" self.max_depth: float = max_depth if max_depth is not None else math.inf self.binary_split: bool = binary_split self._max_size: float = max_size self._max_byte_size: float = self._max_size * (2**20) # convert to byte self.memory_estimate_period: int = memory_estimate_period self.stop_mem_management: bool = stop_mem_management self.remove_poor_attrs: bool = remove_poor_attrs self.merit_preprune: bool = merit_preprune self._root: typing.Union[DTBranch, HTLeaf, None] = None self._n_active_leaves: int = 0 self._n_inactive_leaves: int = 0 self._inactive_leaf_size_estimate: float = 0.0 self._active_leaf_size_estimate: float = 0.0 self._size_estimate_overhead_fraction: float = 1.0 self._growth_allowed = True self._train_weight_seen_by_model: float = 0.0 @staticmethod def _hoeffding_bound(range_val, confidence, n): r"""Compute the Hoeffding bound, used to decide how many samples are necessary at each node. Notes ----- The Hoeffding bound is defined as: $\\epsilon = \\sqrt{\\frac{R^2\\ln(1/\\delta))}{2n}}$ where: $\\epsilon$: Hoeffding bound. $R$: Range of a random variable. For a probability the range is 1, and for an information gain the range is log *c*, where *c* is the number of classes. $\\delta$: Confidence. 1 minus the desired probability of choosing the correct attribute at any given node. $n$: Number of samples. Parameters ---------- range_val Range value. confidence Confidence of choosing the correct attribute. n Number of processed samples. """ return math.sqrt( (range_val * range_val * math.log(1.0 / confidence)) / (2.0 * n) ) @property def max_size(self): """Max allowed size tree can reach (in MB).""" return self._max_size @max_size.setter def max_size(self, size): self._max_size = size self._max_byte_size = self._max_size * (2**20) @property def height(self) -> int: if self._root: return self._root.height @property def n_nodes(self): if self._root: return self._root.n_nodes @property def n_branches(self): if self._root: return self._root.n_branches @property def n_leaves(self): if self._root: return self._root.n_leaves @property def n_active_leaves(self): return self._n_active_leaves @property def n_inactive_leaves(self): return self._n_inactive_leaves @property def summary(self): """Collect metrics corresponding to the current status of the tree in a string buffer. """ summary = { "n_nodes": self.n_nodes, "n_branches": self.n_branches, "n_leaves": self.n_leaves, "n_active_leaves": self.n_active_leaves, "n_inactive_leaves": self.n_inactive_leaves, "height": self.height, "total_observed_weight": self._train_weight_seen_by_model, } return summary def to_dataframe(self): """Return a representation of the current tree structure organized in a `pandas.DataFrame` object. In case the tree is empty or it only contains a single node (a leaf), `None` is returned. Returns ------- df A `pandas.DataFrame` depicting the tree structure. """ if self._root is not None and isinstance(self._root, DTBranch): return self._root.to_dataframe() def _branch_selector( self, numerical_feature=True, multiway_split=False ) -> typing.Type[DTBranch]: """Create a new split node.""" if numerical_feature: if not multiway_split: return NumericBinaryBranch else: return NumericMultiwayBranch else: if not multiway_split: return NominalBinaryBranch else: return NominalMultiwayBranch @abstractmethod def _new_leaf( self, initial_stats: dict = None, parent: typing.Union[HTLeaf, DTBranch] = None ) -> HTLeaf: """Create a new learning node. The characteristics of the learning node depends on the tree algorithm. Parameters ---------- initial_stats Target statistics set from the parent node. parent Parent node to inherit from. Returns ------- A new learning node. """ @property def split_criterion(self) -> str: """Return a string with the name of the split criterion being used by the tree.""" return self._split_criterion @split_criterion.setter @abstractmethod def split_criterion(self, split_criterion): """Define the split criterion to be used by the tree.""" @property def leaf_prediction(self) -> str: """Return the prediction strategy used by the tree at its leaves.""" return self._leaf_prediction @leaf_prediction.setter @abstractmethod def leaf_prediction(self, leaf_prediction): """Define the prediction strategy used by the tree in its leaves.""" def _enforce_size_limit(self): """Track the size of the tree and disable/enable nodes if required. This memory-management routine shared by all the Hoeffding Trees is based on [^1]. References ---------- [^1]: <NAME>., 2007. Improving hoeffding trees (Doctoral dissertation, The University of Waikato). """ tree_size = self._size_estimate_overhead_fraction * ( self._active_leaf_size_estimate + self._n_inactive_leaves * self._inactive_leaf_size_estimate ) if self._n_inactive_leaves > 0 or tree_size > self._max_byte_size: if self.stop_mem_management: self._growth_allowed = False return leaves = self._find_leaves() leaves.sort(key=lambda leaf: leaf.calculate_promise()) max_active = 0 while max_active < len(leaves): max_active += 1 if ( ( max_active * self._active_leaf_size_estimate + (len(leaves) - max_active) * self._inactive_leaf_size_estimate ) * self._size_estimate_overhead_fraction ) > self._max_byte_size: max_active -= 1 break cutoff = len(leaves) - max_active for i in range(cutoff): if leaves[i].is_active(): leaves[i].deactivate() self._n_inactive_leaves += 1 self._n_active_leaves -= 1 for i in range(cutoff, len(leaves)): if not leaves[i].is_active() and leaves[i].depth < self.max_depth: leaves[i].activate() self._n_active_leaves += 1 self._n_inactive_leaves -= 1 def _estimate_model_size(self): """Calculate the size of the model and trigger tracker function if the actual model size exceeds the max size in the configuration. This memory-management routine shared by all the Hoeffding Trees is based on [^1]. References ---------- [^1]: <NAME>., 2007. Improving hoeffding trees (Doctoral dissertation, The University of Waikato). """ leaves = self._find_leaves() total_active_size = 0 total_inactive_size = 0 for leaf in leaves: if leaf.is_active(): total_active_size += calculate_object_size(leaf) else: total_inactive_size += calculate_object_size(leaf) if total_active_size > 0: self._active_leaf_size_estimate = total_active_size / self._n_active_leaves if total_inactive_size > 0: self._inactive_leaf_size_estimate = ( total_inactive_size / self._n_inactive_leaves ) actual_model_size = calculate_object_size(self) estimated_model_size = ( self._n_active_leaves * self._active_leaf_size_estimate + self._n_inactive_leaves * self._inactive_leaf_size_estimate ) self._size_estimate_overhead_fraction = actual_model_size / estimated_model_size if actual_model_size > self._max_byte_size: self._enforce_size_limit() def _deactivate_all_leaves(self): """Deactivate all leaves.""" leaves = self._find_leaves() for leaf in leaves: leaf.deactivate() self._n_inactive_leaves += 1 self._n_active_leaves -= 1 def _find_leaves(self) -> typing.List[HTLeaf]: """Find learning nodes in the tree. Returns ------- List of learning nodes in the tree. """ return [leaf for leaf in self._root.iter_leaves()] # Adapted from creme's original implementation def debug_one(self, x: dict) -> typing.Union[str, None]: """Print an explanation of how `x` is predicted. Parameters ---------- x A dictionary of features. Returns ------- A representation of the path followed by the tree to predict `x`; `None` if the tree is empty. Notes ----- Currently, Label Combination Hoeffding Tree Classifier (for multi-label classification) is not supported. """ if self._root is None: return # We'll redirect all the print statement to a buffer, we'll return the content of the # buffer at the end buffer = io.StringIO() _print = functools.partial(print, file=buffer) for node in self._root.walk(x, until_leaf=True): if isinstance(node, HTLeaf): _print(repr(node)) else: try: child_index = node.branch_no(x) # noqa except KeyError: child_index, _ = node.most_common_path() _print(node.repr_branch(child_index)) # noqa return buffer.getvalue() def draw(self, max_depth: int = None): """Draw the tree using the `graphviz` library. Since the tree is drawn without passing incoming samples, classification trees will show the majority class in their leaves, whereas regression trees will use the target mean. Parameters ---------- max_depth Only the root will be drawn when set to `0`. Every node will be drawn when set to `None`. Notes ----- Currently, Label Combination Hoeffding Tree Classifier (for multi-label classification) is not supported. Examples -------- >>> from river import datasets >>> from river import tree >>> model = tree.HoeffdingTreeClassifier( ... grace_period=5, ... split_confidence=1e-5, ... split_criterion='gini', ... max_depth=10, ... tie_threshold=0.05, ... ) >>> for x, y in datasets.Phishing(): ... model = model.learn_one(x, y) >>> dot = model.draw() .. image:: ../../docs/img/dtree_draw.svg :align: center """ counter = 0 def iterate(node=None): if node is None: yield None, None, self._root, 0, None yield from iterate(self._root) nonlocal counter
prop @pulumi.output_type class KikChannelPropertiesResponse(dict): """ The parameters to provide for the Kik channel. """ def __init__(__self__, *, api_key: str, is_enabled: bool, user_name: str, is_validated: Optional[bool] = None): """ The parameters to provide for the Kik channel. :param str api_key: Kik API key. Value only returned through POST to the action Channel List API, otherwise empty. :param bool is_enabled: Whether this channel is enabled for the bot :param str user_name: The Kik user name :param bool is_validated: Whether this channel is validated for the bot """ pulumi.set(__self__, "api_key", api_key) pulumi.set(__self__, "is_enabled", is_enabled) pulumi.set(__self__, "user_name", user_name) if is_validated is not None: pulumi.set(__self__, "is_validated", is_validated) @property @pulumi.getter(name="apiKey") def api_key(self) -> str: """ Kik API key. Value only returned through POST to the action Channel List API, otherwise empty. """ return pulumi.get(self, "api_key") @property @pulumi.getter(name="isEnabled") def is_enabled(self) -> bool: """ Whether this channel is enabled for the bot """ return pulumi.get(self, "is_enabled") @property @pulumi.getter(name="userName") def user_name(self) -> str: """ The Kik user name """ return pulumi.get(self, "user_name") @property @pulumi.getter(name="isValidated") def is_validated(self) -> Optional[bool]: """ Whether this channel is validated for the bot """ return pulumi.get(self, "is_validated") def _translate_property(self, prop): return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop @pulumi.output_type class KikChannelResponse(dict): """ Kik channel definition """ def __init__(__self__, *, channel_name: str, properties: Optional['outputs.KikChannelPropertiesResponse'] = None): """ Kik channel definition :param str channel_name: The channel name Expected value is 'KikChannel'. :param 'KikChannelPropertiesResponseArgs' properties: The set of properties specific to Kik channel resource """ pulumi.set(__self__, "channel_name", 'KikChannel') if properties is not None: pulumi.set(__self__, "properties", properties) @property @pulumi.getter(name="channelName") def channel_name(self) -> str: """ The channel name Expected value is 'KikChannel'. """ return pulumi.get(self, "channel_name") @property @pulumi.getter def properties(self) -> Optional['outputs.KikChannelPropertiesResponse']: """ The set of properties specific to Kik channel resource """ return pulumi.get(self, "properties") def _translate_property(self, prop): return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop @pulumi.output_type class MsTeamsChannelPropertiesResponse(dict): """ The parameters to provide for the Microsoft Teams channel. """ def __init__(__self__, *, is_enabled: bool, calling_web_hook: Optional[str] = None, enable_calling: Optional[bool] = None): """ The parameters to provide for the Microsoft Teams channel. :param bool is_enabled: Whether this channel is enabled for the bot :param str calling_web_hook: Webhook for Microsoft Teams channel calls :param bool enable_calling: Enable calling for Microsoft Teams channel """ pulumi.set(__self__, "is_enabled", is_enabled) if calling_web_hook is not None: pulumi.set(__self__, "calling_web_hook", calling_web_hook) if enable_calling is not None: pulumi.set(__self__, "enable_calling", enable_calling) @property @pulumi.getter(name="isEnabled") def is_enabled(self) -> bool: """ Whether this channel is enabled for the bot """ return pulumi.get(self, "is_enabled") @property @pulumi.getter(name="callingWebHook") def calling_web_hook(self) -> Optional[str]: """ Webhook for Microsoft Teams channel calls """ return pulumi.get(self, "calling_web_hook") @property @pulumi.getter(name="enableCalling") def enable_calling(self) -> Optional[bool]: """ Enable calling for Microsoft Teams channel """ return pulumi.get(self, "enable_calling") def _translate_property(self, prop): return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop @pulumi.output_type class MsTeamsChannelResponse(dict): """ Microsoft Teams channel definition """ def __init__(__self__, *, channel_name: str, properties: Optional['outputs.MsTeamsChannelPropertiesResponse'] = None): """ Microsoft Teams channel definition :param str channel_name: The channel name Expected value is 'MsTeamsChannel'. :param 'MsTeamsChannelPropertiesResponseArgs' properties: The set of properties specific to Microsoft Teams channel resource """ pulumi.set(__self__, "channel_name", 'MsTeamsChannel') if properties is not None: pulumi.set(__self__, "properties", properties) @property @pulumi.getter(name="channelName") def channel_name(self) -> str: """ The channel name Expected value is 'MsTeamsChannel'. """ return pulumi.get(self, "channel_name") @property @pulumi.getter def properties(self) -> Optional['outputs.MsTeamsChannelPropertiesResponse']: """ The set of properties specific to Microsoft Teams channel resource """ return pulumi.get(self, "properties") def _translate_property(self, prop): return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop @pulumi.output_type class ServiceProviderParameterResponseResult(dict): """ Extra Parameters specific to each Service Provider """ def __init__(__self__, *, default: str, description: str, display_name: str, help_url: str, name: str, type: str): """ Extra Parameters specific to each Service Provider :param str default: Default Name for the Service Provider :param str description: Description of the Service Provider :param str display_name: Display Name of the Service Provider :param str help_url: Help Url for the Service Provider :param str name: Name of the Service Provider :param str type: Type of the Service Provider """ pulumi.set(__self__, "default", default) pulumi.set(__self__, "description", description) pulumi.set(__self__, "display_name", display_name) pulumi.set(__self__, "help_url", help_url) pulumi.set(__self__, "name", name) pulumi.set(__self__, "type", type) @property @pulumi.getter def default(self) -> str: """ Default Name for the Service Provider """ return pulumi.get(self, "default") @property @pulumi.getter def description(self) -> str: """ Description of the Service Provider """ return pulumi.get(self, "description") @property @pulumi.getter(name="displayName") def display_name(self) -> str: """ Display Name of the Service Provider """ return pulumi.get(self, "display_name") @property @pulumi.getter(name="helpUrl") def help_url(self) -> str: """ Help Url for the Service Provider """ return pulumi.get(self, "help_url") @property @pulumi.getter def name(self) -> str: """ Name of the Service Provider """ return pulumi.get(self, "name") @property @pulumi.getter def type(self) -> str: """ Type of the Service Provider """ return pulumi.get(self, "type") @pulumi.output_type class ServiceProviderPropertiesResponseResult(dict): """ The Object used to describe a Service Provider supported by Bot Service """ def __init__(__self__, *, dev_portal_url: str, display_name: str, icon_url: str, id: str, service_provider_name: str, parameters: Optional[Sequence['outputs.ServiceProviderParameterResponseResult']] = None): """ The Object used to describe a Service Provider supported by Bot Service :param str dev_portal_url: Display Name of the Service Provider :param str display_name: Display Name of the Service Provider :param str icon_url: Display Name of the Service Provider :param str id: Id for Service Provider :param str service_provider_name: Display Name of the Service Provider :param Sequence['ServiceProviderParameterResponseArgs'] parameters: The list of parameters for the Service Provider """ pulumi.set(__self__, "dev_portal_url", dev_portal_url) pulumi.set(__self__, "display_name", display_name) pulumi.set(__self__, "icon_url", icon_url) pulumi.set(__self__, "id", id) pulumi.set(__self__, "service_provider_name", service_provider_name) if parameters is not None: pulumi.set(__self__, "parameters", parameters) @property @pulumi.getter(name="devPortalUrl") def dev_portal_url(self) -> str: """ Display Name of the Service Provider """ return pulumi.get(self, "dev_portal_url") @property @pulumi.getter(name="displayName") def display_name(self) -> str: """ Display Name of the Service Provider """ return pulumi.get(self, "display_name") @property @pulumi.getter(name="iconUrl") def icon_url(self) -> str: """ Display Name of the Service Provider """ return pulumi.get(self, "icon_url") @property @pulumi.getter def id(self) -> str: """ Id for Service Provider """ return pulumi.get(self, "id") @property @pulumi.getter(name="serviceProviderName") def service_provider_name(self) -> str: """ Display Name of the Service Provider """ return pulumi.get(self, "service_provider_name") @property @pulumi.getter def parameters(self) -> Optional[Sequence['outputs.ServiceProviderParameterResponseResult']]: """ The list of parameters for the Service Provider """ return pulumi.get(self, "parameters") @pulumi.output_type class ServiceProviderResponseResult(dict): """ Service Provider Definition """ def __init__(__self__, *, properties: Optional['outputs.ServiceProviderPropertiesResponseResult'] = None): """ Service Provider Definition :param 'ServiceProviderPropertiesResponseArgs' properties: The Properties of a Service Provider Object """ if properties is not None: pulumi.set(__self__, "properties", properties) @property @pulumi.getter def properties(self) -> Optional['outputs.ServiceProviderPropertiesResponseResult']: """ The Properties of a Service Provider Object """ return pulumi.get(self, "properties") @pulumi.output_type class SkuResponse(dict): """ The SKU of the cognitive services account. """ def __init__(__self__, *, name: str, tier: str): """ The SKU of the cognitive services account. :param str name: The sku name :param str tier: Gets the sku tier. This is based on the SKU name. """ pulumi.set(__self__, "name", name) pulumi.set(__self__, "tier", tier) @property @pulumi.getter def name(self) -> str: """ The sku name """ return pulumi.get(self, "name") @property @pulumi.getter def tier(self) -> str: """ Gets the sku tier. This is based on the SKU name. """ return pulumi.get(self, "tier") def _translate_property(self, prop): return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop @pulumi.output_type class SkypeChannelPropertiesResponse(dict): """ The parameters to provide for the Microsoft Teams channel. """ def __init__(__self__, *, is_enabled: bool, calling_web_hook: Optional[str] = None, enable_calling: Optional[bool] = None, enable_groups: Optional[bool] = None, enable_media_cards: Optional[bool] = None, enable_messaging: Optional[bool] = None, enable_screen_sharing: Optional[bool] = None, enable_video: Optional[bool] = None, groups_mode: Optional[str] = None): """ The parameters to provide for the Microsoft Teams channel. :param bool is_enabled: Whether this channel is enabled for the bot :param str calling_web_hook: Calling web hook for Skype channel :param bool enable_calling: Enable calling for Skype channel :param bool enable_groups: Enable groups for Skype channel :param bool enable_media_cards: Enable media cards for Skype channel :param bool enable_messaging: Enable messaging for Skype channel :param bool enable_screen_sharing: Enable screen sharing for Skype channel :param bool enable_video: Enable video for Skype channel :param str groups_mode: Group mode for Skype channel """ pulumi.set(__self__, "is_enabled", is_enabled) if calling_web_hook is not None: pulumi.set(__self__, "calling_web_hook", calling_web_hook) if enable_calling is not None: pulumi.set(__self__, "enable_calling", enable_calling) if enable_groups is not None: pulumi.set(__self__, "enable_groups", enable_groups) if enable_media_cards is not None: pulumi.set(__self__, "enable_media_cards", enable_media_cards)
from __future__ import unicode_literals, print_function import uuid from django.test import TestCase from kong_admin import models from kong_admin import logic from kong_admin.factory import get_kong_client from kong_admin.enums import Plugins from .factories import APIReferenceFactory, PluginConfigurationReferenceFactory, ConsumerReferenceFactory, \ BasicAuthReferenceFactory, KeyAuthReferenceFactory, OAuth2ReferenceFactory from .fake import fake from kong_admin.models import PluginConfigurationReference class APIReferenceLogicTestCase(TestCase): def setUp(self): self.client = get_kong_client() self._cleanup_api = [] def tearDown(self): self.client.close() for api_ref in self._cleanup_api: self.assertTrue(isinstance(api_ref, models.APIReference)) api_ref = models.APIReference.objects.get(id=api_ref.id) # reloads!! logic.withdraw_api(self.client, api_ref) def test_sync_incomplete_api(self): # Create incomplete api_ref api_ref = APIReferenceFactory(upstream_url=fake.url()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Try to sync, expect an error with self.assertRaises(ValueError): logic.synchronize_api(self.client, api_ref) self.assertFalse(api_ref.synchronized) # Fix api_ref api_ref.request_host = fake.domain_name() api_ref.save() # Sync again logic.synchronize_api(self.client, api_ref) self.assertTrue(api_ref.synchronized) # Check kong result = self.client.apis.retrieve(api_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['upstream_url'], api_ref.upstream_url) self.assertEqual(result['request_host'], api_ref.request_host) def test_sync_api(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Sync logic.synchronize_api(self.client, api_ref) self.assertTrue(api_ref.synchronized) # Check kong result = self.client.apis.retrieve(api_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['upstream_url'], api_ref.upstream_url) self.assertEqual(result['request_host'], api_ref.request_host) def test_sync_updated_api(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Publish logic.synchronize_api(self.client, api_ref) self.assertTrue(api_ref.synchronized) # Check kong result = self.client.apis.retrieve(api_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['upstream_url'], api_ref.upstream_url) self.assertEqual(result['request_host'], api_ref.request_host) self.assertEqual(result['name'], api_ref.request_host) # Update new_name = fake.api_name() self.assertNotEqual(new_name, api_ref.name) api_ref.name = new_name api_ref.save() # Publish logic.synchronize_api(self.client, api_ref) self.assertTrue(api_ref.synchronized) # Check kong result = self.client.apis.retrieve(api_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['upstream_url'], api_ref.upstream_url) self.assertEqual(result['request_host'], api_ref.request_host) self.assertEqual(result['name'], new_name) def test_withdraw_api(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Publish logic.synchronize_api(self.client, api_ref) self.assertTrue(api_ref.synchronized) # Check kong result = self.client.apis.retrieve(api_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['upstream_url'], api_ref.upstream_url) self.assertEqual(result['request_host'], api_ref.request_host) # Store kong_id kong_id = api_ref.kong_id # You can delete afterwards logic.withdraw_api(self.client, api_ref) self.assertFalse(api_ref.synchronized) # Check kong with self.assertRaises(ValueError): _ = self.client.apis.retrieve(kong_id) def test_delete_api(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Publish logic.synchronize_api(self.client, api_ref) self.assertTrue(api_ref.synchronized) # Check kong result = self.client.apis.retrieve(api_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['upstream_url'], api_ref.upstream_url) self.assertEqual(result['request_host'], api_ref.request_host) # You can delete afterwards api_kong_id = api_ref.kong_id api_ref.delete() # Check kong with self.assertRaises(ValueError): _ = self.client.apis.retrieve(api_kong_id) def test_sync_plugin_configuration_before_api(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Create plugin_configuration plugin_configuration_ref = PluginConfigurationReferenceFactory(api=api_ref) # Attempt to publish with self.assertRaises(ValueError): logic.synchronize_plugin_configuration(self.client, plugin_configuration_ref) def test_sync_plugin_configuration_without_fields(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Publish api logic.synchronize_api(self.client, api_ref) # Check if remote upstream_url matches the locally known upstream_url result = self.client.apis.retrieve(api_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['upstream_url'], api_ref.upstream_url) # Create plugin_configuration plugin_configuration_ref = PluginConfigurationReferenceFactory(api=api_ref, config={}) # Attempt to publish with self.assertRaises(ValueError): logic.synchronize_plugin_configuration(self.client, plugin_configuration_ref) # Make sure we did not get a Kong ID (meaning it did not sync to Kong) self.assertIsNone(plugin_configuration_ref.kong_id) def test_sync_plugin_configuration(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Publish api logic.synchronize_api(self.client, api_ref) # Check if remote upstream_url matches the locally known upstream_url result = self.client.apis.retrieve(api_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['upstream_url'], api_ref.upstream_url) # Create plugin_configuration plugin_configuration_ref = PluginConfigurationReferenceFactory(api=api_ref) # Publish plugin_configuration logic.synchronize_plugin_configuration(self.client, plugin_configuration_ref) # Check result = self.client.apis.plugins(api_ref.kong_id).retrieve(plugin_configuration_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['name'], Plugins.label(plugin_configuration_ref.plugin)) def test_withdraw_plugin_configuration(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Publish api logic.synchronize_api(self.client, api_ref) # Create plugin_configuration plugin_configuration_ref = PluginConfigurationReferenceFactory(api=api_ref) # Publish plugin_configuration logic.synchronize_plugin_configuration(self.client, plugin_configuration_ref) # Check if remote plugin name matches the locally known plugin result = self.client.apis.plugins(api_ref.kong_id).retrieve(plugin_configuration_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['name'], Plugins.label(plugin_configuration_ref.plugin)) # Withdraw plugin_configuration logic.withdraw_plugin_configuration(self.client, plugin_configuration_ref) # Check with self.assertRaises(ValueError): _ = self.client.apis.plugins(api_ref.kong_id).retrieve(plugin_configuration_ref.kong_id) def test_delete_synchronized_plugin_configuration(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Publish api logic.synchronize_api(self.client, api_ref) # Create plugin_configuration plugin_configuration_ref = PluginConfigurationReferenceFactory(api=api_ref) # Publish plugin_configuration logic.synchronize_plugin_configuration(self.client, plugin_configuration_ref) # Check if remote plugin name matches the locally known plugin result = self.client.apis.plugins(api_ref.kong_id).retrieve(plugin_configuration_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['name'], Plugins.label(plugin_configuration_ref.plugin)) # Delete plugin_configuration plugin_configuration_kong_id = plugin_configuration_ref.kong_id plugin_configuration_ref.delete() # Check with self.assertRaises(ValueError): _ = self.client.apis.plugins(api_ref.kong_id).retrieve(plugin_configuration_kong_id) def test_disable_synchronized_plugin_configuration(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Publish api logic.synchronize_api(self.client, api_ref) # Create plugin_configuration plugin_configuration_ref = PluginConfigurationReferenceFactory(api=api_ref) # Publish plugin_configuration logic.synchronize_plugin_configuration(self.client, plugin_configuration_ref) # Check if remote plugin name matches the locally known plugin, and that it is enabled result = self.client.apis.plugins(api_ref.kong_id).retrieve(plugin_configuration_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['name'], Plugins.label(plugin_configuration_ref.plugin)) self.assertTrue(result['enabled']) # Update plugin_configuration logic.enable_plugin_configuration(self.client, plugin_configuration_ref, enabled=False) # Check result = self.client.apis.plugins(api_ref.kong_id).retrieve(plugin_configuration_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['name'], Plugins.label(plugin_configuration_ref.plugin)) self.assertFalse(result['enabled']) def test_update_synchronized_plugin_configuration(self): # Create api_ref api_ref = APIReferenceFactory(upstream_url=fake.url(), request_host=fake.domain_name()) # Mark for auto cleanup self._cleanup_afterwards(api_ref) # Publish api logic.synchronize_api(self.client, api_ref) # Create plugin_configuration plugin_configuration_ref = PluginConfigurationReferenceFactory(api=api_ref) # Publish plugin_configuration logic.synchronize_plugin_configuration(self.client, plugin_configuration_ref) # Check if remote plugin name matches the locally known plugin, and that the configuration matches the locally # known configuration result = self.client.apis.plugins(api_ref.kong_id).retrieve(plugin_configuration_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['name'], Plugins.label(plugin_configuration_ref.plugin)) self.assertEqual(result['config']['second'], plugin_configuration_ref.config['second']) # Update plugin_configuration new_value = 5 self.assertNotEqual(new_value, plugin_configuration_ref.config['second']) plugin_configuration_ref.config['second'] = new_value plugin_configuration_ref.save() logic.publish_plugin_configuration(self.client, plugin_configuration_ref) # Check result = self.client.apis.plugins(api_ref.kong_id).retrieve(plugin_configuration_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['name'], Plugins.label(plugin_configuration_ref.plugin)) self.assertEqual(result['config']['second'], plugin_configuration_ref.config['second']) def _cleanup_afterwards(self, api_ref): self._cleanup_api.append(api_ref) return api_ref class ConsumerReferenceLogicTestCase(TestCase): def setUp(self): self.client = get_kong_client() self._cleanup_consumers = [] def tearDown(self): self.client.close() for consumer_ref in self._cleanup_consumers: self.assertTrue(isinstance(consumer_ref, models.ConsumerReference)) consumer_ref = models.ConsumerReference.objects.get(id=consumer_ref.id) # reloads!! logic.withdraw_consumer(self.client, consumer_ref) def test_incomplete_consumer(self): # Create incomplete consumer_ref consumer_ref = ConsumerReferenceFactory() # Mark for auto cleanup self._cleanup_afterwards(consumer_ref) # Try to sync, expect an error with self.assertRaises(ValueError): logic.synchronize_consumer(self.client, consumer_ref) self.assertFalse(consumer_ref.synchronized) # Fix consumer_ref consumer_ref.username = fake.consumer_name() consumer_ref.save() # Sync again logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Make sure the remote username matches the locally known username result = self.client.consumers.retrieve(consumer_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['username'], consumer_ref.username) def test_sync_consumer(self): # Create consumer_ref consumer_ref = ConsumerReferenceFactory(username=fake.consumer_name()) # Mark for auto cleanup self._cleanup_afterwards(consumer_ref) # Sync logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Make sure the remote username matches the locally known username result = self.client.consumers.retrieve(consumer_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['username'], consumer_ref.username) def test_sync_updated_consumer(self): # Create consumer_ref consumer_ref = ConsumerReferenceFactory(username=fake.consumer_name()) # Mark for auto cleanup self._cleanup_afterwards(consumer_ref) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Make sure the remote username matches the locally known username result = self.client.consumers.retrieve(consumer_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['username'], consumer_ref.username) # Update new_name = fake.consumer_name() self.assertNotEqual(new_name, consumer_ref.username) consumer_ref.username = new_name consumer_ref.save() # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Make sure the remote username matches the new username result = self.client.consumers.retrieve(consumer_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['username'], new_name) def test_withdraw_consumer(self): # Create consumer_ref consumer_ref = ConsumerReferenceFactory(username=fake.consumer_name()) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Make sure the remote username matches the locally known username result = self.client.consumers.retrieve(consumer_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['username'], consumer_ref.username) # Store kong_id kong_id = consumer_ref.kong_id # You can delete afterwards logic.withdraw_consumer(self.client, consumer_ref) self.assertFalse(consumer_ref.synchronized) # Check kong with self.assertRaises(ValueError): _ = self.client.consumers.retrieve(kong_id) def test_delete_consumer(self): # Create consumer_ref consumer_ref = ConsumerReferenceFactory(username=fake.consumer_name()) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Make sure the remote username matches the locally known username result = self.client.consumers.retrieve(consumer_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['username'], consumer_ref.username) # You can delete afterwards consumer_kong_id = consumer_ref.kong_id consumer_ref.delete() # Check kong with self.assertRaises(ValueError): _ = self.client.consumers.retrieve(consumer_kong_id) def test_sync_consumer_basic_auth(self): # Create consumer_ref consumer_ref = ConsumerReferenceFactory(username=fake.consumer_name()) # Mark for auto cleanup self._cleanup_afterwards(consumer_ref) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Check kong amount = self.client.consumers.basic_auth(consumer_ref.kong_id).count() self.assertEqual(amount, 0) # Create auth auth_ref = BasicAuthReferenceFactory(consumer=consumer_ref) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Reload auth_ref = models.BasicAuthReference.objects.get(id=auth_ref.id) self.assertIsNotNone(auth_ref.kong_id) # Make sure the remote username matches the locally known username result = self.client.consumers.basic_auth(consumer_ref.kong_id).retrieve(auth_ref.kong_id) self.assertIsNotNone(result) self.assertEqual(result['username'], auth_ref.username) self.assertIsNotNone(result['password']) def test_sync_consumer_multiple_basic_auth(self): amount = 3 # Create consumer_ref consumer_ref = ConsumerReferenceFactory(username=fake.consumer_name()) # Mark for auto cleanup self._cleanup_afterwards(consumer_ref) # Create auths auths = [] for i in range(amount): auths.append(BasicAuthReferenceFactory(consumer=consumer_ref)) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Check self.assertEqual(self.client.consumers.basic_auth(consumer_ref.kong_id).count(), amount) # Reload for i in range(len(auths)): auths[i] = models.BasicAuthReference.objects.get(id=auths[i].id) self.assertIsNotNone(auths[i].kong_id) # Check kong result = self.client.consumers.basic_auth(consumer_ref.kong_id).list() self.assertIsNotNone(result) self.assertEqual( sorted([(uuid.UUID(r['id']), r['username']) for r in result['data']], key=lambda x: x[0]), sorted([(obj.kong_id, obj.username) for obj in auths], key=lambda x: x[0])) def test_withdraw_consumer_basic_auth(self): # Create consumer_ref consumer_ref = ConsumerReferenceFactory(username=fake.consumer_name()) # Create auth auth_ref = BasicAuthReferenceFactory(consumer=consumer_ref) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Reload auth_ref = models.BasicAuthReference.objects.get(id=auth_ref.id) self.assertIsNotNone(auth_ref.kong_id) self.assertTrue(auth_ref.synchronized) # Withdraw logic.withdraw_consumer(self.client, consumer_ref) self.assertFalse(consumer_ref.synchronized) # Reload auth_ref = models.BasicAuthReference.objects.get(id=auth_ref.id) self.assertIsNone(auth_ref.kong_id) self.assertFalse(auth_ref.synchronized) def test_delete_consumer_basic_auth(self): # Create consumer_ref consumer_ref = ConsumerReferenceFactory(username=fake.consumer_name()) # Create auth auth_ref1 = BasicAuthReferenceFactory(consumer=consumer_ref) BasicAuthReferenceFactory(consumer=consumer_ref) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Check self.assertEqual(self.client.consumers.basic_auth(consumer_ref.kong_id).count(), 2) # Delete auth_ref1 auth_ref1.delete() # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Check self.assertEqual(self.client.consumers.basic_auth(consumer_ref.kong_id).count(), 1) # Delete consumer consumer_kong_id = consumer_ref.kong_id consumer_ref.delete() # Check with self.assertRaises(ValueError): self.client.consumers.basic_auth(consumer_kong_id).count() def test_sync_consumer_key_auth(self): # Create consumer_ref consumer_ref = ConsumerReferenceFactory(username=fake.consumer_name()) # Mark for auto cleanup self._cleanup_afterwards(consumer_ref) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Check kong amount = self.client.consumers.key_auth(consumer_ref.kong_id).count() self.assertEqual(amount, 0) # Create auth auth_ref = KeyAuthReferenceFactory(consumer=consumer_ref) # Publish logic.synchronize_consumer(self.client, consumer_ref) self.assertTrue(consumer_ref.synchronized) # Reload auth_ref = models.KeyAuthReference.objects.get(id=auth_ref.id) self.assertIsNotNone(auth_ref.kong_id) #
"""Module for general matrix class and related unit tests.""" import random import unittest import exceptions as exc __version__ = "0.1" class Matrix: """A class to represent a general matrix.""" def __init__(self, m, n, init=True): """Initalise matrix dimensions and contents.""" # initialise matrix dimensions if not (isinstance(m, int) and isinstance(n, int)): raise TypeError("dimensions must be integral") if m <= 0 or n <= 0: raise ValueError("dimensions must be positive") self.m = m self.n = n # initalise matrix contents if not isinstance(init, bool): raise TypeError("init must be Boolean") if init: self.rows = [[0]*n for _ in range(m)] else: self.rows = [] def __str__(self): """Generate text representation of matrix.""" s = '\n'.join([' '.join([str(elem) for elem in row]) for row in self.rows]) return s + '\n' def __repl__(self): """Generate reproducible representation of matrix.""" s = "Matrix of dimension " + str(self.m) + " by " \ + str(self.n) + '\n' s = s + "with data" + '\n' s = s + '\n'.join([' '.join([str(elem) for elem in row]) for row in self.rows]) return s + '\n' def __eq__(self, mtrx): """Evaluate whether two matrices are equivalent.""" return self.rows == mtrx.rows def __add__(self, obj): """Add a valid object to this matrix and return the result. Doesn't modify the current matrix. Valid objects include other matrices and numeric scalars """ if isinstance(obj, Matrix): if not (self.m == obj.m and self.n == obj.n): raise exc.ComformabilityError( "matrices must have the same dimensions") res = Matrix(self.m, self.n) for i in range(self.m): for j in range(self.n): val = self[i, j] + obj[i, j] res[i, j] = val return res elif self.isNumeric(obj): res = Matrix(self.m, self.n) for i in range(self.m): for j in range(self.n): val = self[i, j] + obj res[i, j] = val return res else: raise TypeError( "cannot add object of type " + type(obj) + " to matrix") def __sub__(self, obj): """Subtract a valid object from this matrix and return the result. Doesn't modify the current matrix. Valid objects include other matrices and numeric scalars """ if isinstance(obj, Matrix): if not (self.m == obj.m and self.n == obj.n): raise exc.ComformabilityError( "matrices must have the same dimensions") res = Matrix(self.m, self.n) for i in range(self.m): for j in range(self.n): val = self[i, j] - obj[i, j] res[i, j] = val return res elif self.isNumeric(obj): res = Matrix(self.m, self.n) for i in range(self.m): for j in range(self.n): val = self[i, j] - obj res[i, j] = val return res else: raise TypeError( "cannot subtract object of type " + type(obj) + "from matrix") def __mul__(self, obj): """Multiply this matrix by a valid object and return the result. Doesn't modify the current matrix. Valid objects include other matrices and numeric scalars. In the case where the other object is a matrix, multiplication occurs with the current matrix on the left-hand side """ if isinstance(obj, Matrix): if not self.n == obj.m: raise exc.ComformabilityError( "column dimension of first matrix much match row " + "dimension of second matrix") res = Matrix(self.m, obj.n) for i in range(self.m): for j in range(obj.n): val = sum([self[i, k] * obj[k, j] for k in range(self.m)]) res[i, j] = val return res elif self.isNumeric(obj): res = Matrix(self.m, self.n) for i in range(self.m): for j in range(self.n): val = self[i, j] * obj res[i, j] = val return res else: raise TypeError( "cannot multiply matrix by object of type " + type(obj)) def __pos__(self): """Make all elements of matrix positive.""" res = Matrix(self.m, self.n) for i in range(self.m): for j in range(self.n): val = +self[i, j] res[i, j] = val return res def __neg__(self): """Make all elements of matrix negative.""" res = Matrix(self.m, self.n) for i in range(self.m): for j in range(self.n): val = -self[i, j] res[i, j] = val return res def __iadd__(self, mtrx): """Add a matrix to this matrix, modifying it in the process.""" # calls __add__ tmp = self + mtrx self.rows = tmp.rows return self def __isub__(self, mtrx): """Subtract a matrix from this matrix, modifying it in the process.""" # calls __sub__ tmp = self - mtrx self.rows = tmp.rows return self def __imul__(self, mtrx): """Right multiply this matrix by another and modify. Multiply this matrix by another matrix (on the right), modifying it in the process. """ # calls __mul__ tmp = self * mtrx self.rows = tmp.rows self.m, self.n = tmp.dim() return self def dim(self): """Get matrix dimensions as tuple.""" return (self.m, self.n) def __getitem__(self, key): """Get element in (i, j)th position.""" self.__check_key_validity(key) return self.rows[key[0]][key[1]] def __setitem__(self, key, val): """Set element in (i, j)th position.""" self.__check_key_validity(key) self.rows[key[0]][key[1]] = val def __check_key_validity(self, key): if not isinstance(key, tuple): raise TypeError("key must be a tuple") if len(key) != 2: raise ValueError("key must be of length two") if not (isinstance(key[0], int) and isinstance(key[1], int)): raise TypeError("elements of key must be integers") if not ((0 <= key[0] < self.m) and (0 <= key[1] < self.n)): raise exc.OutOfBoundsError("key is out of bounds") def subset(self, rows, cols): # validation on rows/cols if not (isinstance(rows, list) and isinstance(rows, list)): raise TypeError("arguments must be lists") if len(rows) == 0 or len(cols) == 0: raise ValueError("subset cannot be empty") # validation on elements of rows/cols for i, elem in enumerate(rows + cols): if not isinstance(elem, int): raise TypeError("elements of rows/cols must be integers") # if element represents a row if i < len(rows): if not 0 <= elem < self.m: raise exc.OutOfBoundsError("key is out of bounds") else: if not 0 <= elem < self.n: raise exc.OutOfBoundsError("key is out of bounds") # subset matrix obj = Matrix(len(rows), len(cols), init=False) for r in rows: obj.rows.append([self[r, c] for c in cols]) return obj @classmethod def makeRandom(cls, m, n, min=0, max=1): """Create random matrix. Make a random matrix of dimension m by n with elements chosen independently and uniformly from the interval (min, max). """ obj = Matrix(m, n, init=False) for _1 in range(m): obj.rows.append([random.randrange(min, max) for _2 in range(n)]) return obj @classmethod def makeZero(cls, m, n): """Make a zero matrix of dimension m by n.""" return Matrix(m, n, init=True) @classmethod def makeIdentity(cls, m): """Make an identity matrix of dimension m by m.""" obj = Matrix(m, m, init=False) for i in range(m): obj.rows.append([1 if i == j else 1 for j in range(m)]) return obj @classmethod def fromRows(cls, rows): """Make a matrix from a list of rows.""" m = len(rows) n = len(rows[0]) # check that list of rows is valid if any([len(row) != n for row in rows[1:]]): raise ValueError("inconsistent row lengths") obj = Matrix(m, n, init=False) obj.rows = rows return(obj) @classmethod def fromList(cls, elems, **kwargs): """Make matrix from list. Make a matrix from a list of elements, filling along rows, when given at least one dimension of the matrix. """ if not ('m' in kwargs or 'n' in kwargs): raise ValueError("at least one of m and n must be specified") m = kwargs['m'] n = kwargs['n'] if m * n != len(elems): raise ValueError("dimension does not match number of elements in" "list") obj = Matrix(m, m, init=False) for i in range(m): obj.rows.append(elems[i * m: i * (m + 1)]) return obj @classmethod def isNumeric(cls, obj): """Check if a given object is of a numeric type. Note that since bool inherits from int, that this will accept Boolean values """ return isinstance(obj, (int, float, complex)) class MatrixTests(unittest.TestCase): """Unit test functions.""" def testAdd(self): """Test addition operator.""" # test addition by matrix m1 = Matrix.fromRows([[1, 2], [3, 4]]) m2 = Matrix.fromRows([[5, 6], [7, 8]]) m3 = m1 + m2 self.assertTrue(m3 == Matrix.fromRows([[6, 8], [10, 12]])) # test addition by scalar m4 = m1 + 1 self.assertTrue(m4 == Matrix.fromRows([[2, 3], [4, 5]])) # test addition by non-conforming matrix m5 = Matrix.fromRows([[9, 10]]) with self.assertRaises(exc.ComformabilityError): m1 + m5 # test addition by non-matrix/numeric object with self.assertRaises(TypeError): m1 + 'spam' def testSub(self): """Test subtraction operator.""" # test subtraction by matrix m1 = Matrix.fromRows([[1, 2], [3, 4]]) m2
############################################################################### # # Package: NetMsgs # # File: NetMsgsBase.py # """ NetMsgs Base Data Module """ ## \file ## \package NetMsgs.NetMsgsBase ## ## $LastChangedDate: 2012-07-23 14:06:10 -0600 (Mon, 23 Jul 2012) $ ## $Rev: 2098 $ ## ## \brief NetMsgs Base Data Module ## ## \sa ## \htmlonly ## <a href="../pydoc/NetMsgs.NetMsgsBase.html">PyDoc Generated Documentation</a> ## \endhtmlonly ## ## \author <NAME> (<EMAIL>) ## ## \copyright ## \h_copy 2009-2017. RoadNarrows LLC.\n ## http://www.roadnarrows.com\n ## All Rights Reserved ## # Permission is hereby granted, without written agreement and without # license or royalty fees, to use, copy, modify, and distribute this # software and its documentation for any purpose, provided that # (1) The above copyright notice and the following two paragraphs # appear in all copies of the source code and (2) redistributions # including binaries reproduces these notices in the supporting # documentation. Substantial modifications to this software may be # copyrighted by their authors and need not follow the licensing terms # described here, provided that the new terms are clearly indicated in # all files where they apply. # # IN NO EVENT SHALL THE AUTHOR, ROADNARROWS LLC, OR ANY MEMBERS/EMPLOYEES # OF ROADNARROW LLC OR DISTRIBUTORS OF THIS SOFTWARE BE LIABLE TO ANY # PARTY FOR DIRECT, INDIRECT, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL # DAMAGES ARISING OUT OF THE USE OF THIS SOFTWARE AND ITS DOCUMENTATION, # EVEN IF THE AUTHORS OR ANY OF THE ABOVE PARTIES HAVE BEEN ADVISED OF # THE POSSIBILITY OF SUCH DAMAGE. # # THE AUTHOR AND ROADNARROWS LLC SPECIFICALLY DISCLAIM ANY WARRANTIES, # INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND # FITNESS FOR A PARTICULAR PURPOSE. THE SOFTWARE PROVIDED HEREUNDER IS ON AN # "AS IS" BASIS, AND THE AUTHORS AND DISTRIBUTORS HAVE NO OBLIGATION TO # PROVIDE MAINTENANCE, SUPPORT, UPDATES, ENHANCEMENTS, OR MODIFICATIONS. # ############################################################################### import sys from NetMsgs.NetMsgsCore import * ## Message Encoding Type Enumeration NMEncoding = ['flat', 'itv'] # future , 'cli'] ## Message Byte Ordering Type Enumeration NMEndian = ['big', 'little', 'native'] ## ## Built-In message field types, keyed by XML field type name. ## code - message field type byte code ## desc - short description ## flen - packed message field length (bytes) ## comp - complexity. one of: simple compound na ## T - C/C++ type specifier ## pre - member name prefix (quasi-Hungarian) ## NMBuiltInFieldTypes = { 'pad': { # not really a field type 'code': NMFTypePad, 'desc': "pad byte", 'flen': 1, 'comp': 'na', 'T': '', 'pre': '', }, 'char': { 'code': NMFTypeChar, 'desc': "8-bit character", 'flen': NMFVAL_LEN_CHAR, 'comp': 'simple', 'T': 'char', 'pre': 'c', }, 'u8': { 'code': NMFTypeU8, 'desc': "unsigned 8-bit integer", 'flen': NMFVAL_LEN_U8, 'comp': 'simple', 'T': 'byte_t', 'pre': 'by', }, 's8': { 'code': NMFTypeS8, 'desc': "signed 8-bit integer", 'flen': NMFVAL_LEN_S8, 'comp': 'simple', 'T': 'signed char', 'pre': 'hhi', }, 'bool': { 'code': NMFTypeBool, 'desc': "boolean 0=false, 1(non-zero)=true", 'flen': NMFVAL_LEN_BOOL, 'comp': 'simple', 'T': 'bool_t', 'pre': 'b', }, 'u16': { 'code': NMFTypeU16, 'desc': "unsigned 16-bit integer", 'flen': NMFVAL_LEN_U16, 'comp': 'simple', 'T': 'ushort_t', 'pre': 'hu', }, 's16': { 'code': NMFTypeS16, 'desc': "signed 16-bit integer", 'flen': NMFVAL_LEN_S16, 'comp': 'simple', 'T': 'short', 'pre': 'hi', }, 'u32': { 'code': NMFTypeU32, 'desc': "unsigned 32-bit integer", 'flen': NMFVAL_LEN_U32, 'comp': 'simple', 'T': 'uint_t', 'pre': 'u', }, 's32': { 'code': NMFTypeS32, 'desc': "signed 32-bit integer", 'flen': NMFVAL_LEN_S32, 'comp': 'simple', 'T': 'int', 'pre': 'i', }, 'u64': { 'code': NMFTypeU64, 'desc': "unsigned 64-bit integer", 'flen': NMFVAL_LEN_U64, 'comp': 'simple', 'T': 'ulonglong_t', 'pre': 'llu', }, 's64': { 'code': NMFTypeS64, 'desc': "signed 64-bit integer", 'flen': NMFVAL_LEN_S64, 'comp': 'simple', 'T': 'long long', 'pre': 'lli', }, 'f32': { 'code': NMFTypeF32, 'desc': "32-bit floating-point number", 'flen': NMFVAL_LEN_F32, 'comp': 'simple', 'T': 'float', 'pre': 'hf', }, 'f64': { 'code': NMFTypeF64, 'desc': "64-bit floating-point number", 'flen': NMFVAL_LEN_F64, 'comp': 'simple', 'T': 'double', 'pre': 'f', }, 'p32': { 'code': NMFTypeP32, 'desc': "32-bit pointer", 'flen': NMFVAL_LEN_P32, 'comp': 'simple', 'T': 'void *', 'pre': 'p', }, 'p64': { 'code': NMFTypeP64, 'desc': "64-bit pointer", 'flen': NMFVAL_LEN_P64, 'comp': 'simple', 'T': 'void *', 'pre': 'p', }, 'string': { 'code': NMFTypeString, 'desc': "char[] string", 'flen': 'variable', 'comp': 'compound', 'T': 'char', 'pre': 's', }, 'struct': { 'code': NMFTypeStruct, 'desc': "structure", 'flen': 'variable', 'comp': 'compound', 'T': 'struct', 'pre': 'st', }, 'vector': { 'code': NMFTypeVector, 'desc': "vector - one dimensional array", 'flen': 'variable', 'comp': 'compound', 'T': '', 'pre': 'vec', }, } ## # # Aliases # NMBuiltInFieldTypes['byte'] = NMBuiltInFieldTypes['u8'] NMBuiltInFieldTypes['schar'] = NMBuiltInFieldTypes['s8'] NMBuiltInFieldTypes['ushort'] = NMBuiltInFieldTypes['u16'] NMBuiltInFieldTypes['short'] = NMBuiltInFieldTypes['s16'] NMBuiltInFieldTypes['uint'] = NMBuiltInFieldTypes['u32'] NMBuiltInFieldTypes['int'] = NMBuiltInFieldTypes['s32'] NMBuiltInFieldTypes['ulonglong'] = NMBuiltInFieldTypes['u64'] NMBuiltInFieldTypes['longlong'] = NMBuiltInFieldTypes['s64'] NMBuiltInFieldTypes['pointer'] = NMBuiltInFieldTypes['p32'] NMBuiltInFieldTypes['longpointer'] = NMBuiltInFieldTypes['p64'] NMBuiltInFieldTypes['float'] = NMBuiltInFieldTypes['f32'] NMBuiltInFieldTypes['double'] = NMBuiltInFieldTypes['f64'] ## Get NetMsgs field type code given the XML field type. NMFCode = lambda xmlftype: NMBuiltInFieldTypes[xmlftype]['code'] ## The full set of XML ftype values NMAliasMap = { 'byte': 'u8', 'schar': 's8', 'ushort': 'u16', 'short': 'u16', 'uint': 'u32', 'int': 's32', 'ulonglong': 'u64', 'longlong': 's64', 'pointer': 'p32', 'longpointer': 'p64', 'float': 'f32', 'double': 'f64', } ## Special DB dictionary order key NMKeyOrder = '>' ## Special DB pad field key NMKeyPad = '#' ## XML ftype attribute vector suffix string NMVectorSuffix = '[]' ## List of simple field types by XML ftype NMFTypeSimple = [ 'char', 'u8', 's8', 'bool', 'u16', 's16', 'u32', 's32', 'u64', 's64', 'f32', 'f64', 'p32', 'p64', ] ## List of simple field types by field type code NMFTypeCodeSimple = [ NMFCode('char'), NMFCode('u8'), NMFCode('s8'), NMFCode('bool'), NMFCode('u16'), NMFCode('s16'), NMFCode('u32'), NMFCode('s32'), NMFCode('u64'), NMFCode('s64'), NMFCode('f32'), NMFCode('f64'), NMFCode('p32'), NMFCode('p64') ] ## List of compound field types by XML ftype NMFTypeCompound = [ 'string', 'struct', 'vector' ] ## List of compound field types by field type code NMFTypeCodeCompound = [NMFCode('string'), NMFCode('struct'), NMFCode('vector')] ## List of number field types by XML ftype NMFTypeNumber = [ 'u8', 's8', 'u16', 's16', 'u32', 's32', 'u64', 's64', 'f32', 'f64' ] ## Field type code to XML file type map NMFTypeCode2Xml = { NMFCode('bool'): 'bool', NMFCode('char'): 'char', NMFCode('u8'): 'u8', NMFCode('s8'): 's8', NMFCode('u16'): 'u16', NMFCode('s16'): 's16', NMFCode('u32'): 'u32', NMFCode('s32'): 's32', NMFCode('u64'): 'u64', NMFCode('s64'): 's64', NMFCode('f32'): 'f32', NMFCode('f64'): 'f64', NMFCode('p32'): 'p32', NMFCode('p64'): 'p64', NMFCode('string'): 'string', NMFCode('pad'): 'pad', NMFCode('struct'): 'struct', NMFCode('vector'): 'vector' } ## Field Header Lengths keyed by message encoding NMFHdrLen = { 'flat': {'simple': 0, 'string': 0, 'struct': 0, 'vector': 0}, 'itv': { 'simple': NMITV_FHDR_SIZE_SIMPLE, 'string': NMITV_FHDR_SIZE_STRING, 'struct': NMITV_FHDR_SIZE_STRUCT, 'vector': NMITV_FHDR_SIZE_VECTOR}, } ## No field id value NMFIdNone = NMFID_NONE ## Default pad count NMPadDftCount = 1 ## Pad field value NMPadFVal = NMFTypePadTr ## Maximum and default string maximum length NMStringMaxCount = NMFVAL_LEN_MAX_STRING ## Maximum and default vector maximum item count NMVectorMaxCount = NMFVAL_LEN_MAX_VECTOR ## space quickie space = lambda indent: "%*s" % (indent, '') #-- def StrError(ecode): """ Get the error string describing the NetMsgs error code. The absolute value of the error code is taken prior retrieving the string. An unknown or out-of-range error code will be mapped to NM_ECODE_BADEC. Parameters: ecode - NetMsgs error code. Return: The appropriate error code string. """ sErr = nmStrError(ecode) if not sErr: sErr = 'Error' return sErr ## #------------------------------------------------------------------------------ # CLASS: NetMsgsError #------------------------------------------------------------------------------ class NetMsgsError(Exception): """ NetMsgs Exception Class. """ def __init__(self, msg='XML Parser Error'): """ Raise exception. Parameters: msg - Exception message string. """ Exception.__init__(self, msg) ## #------------------------------------------------------------------------------- # Support Utilities #------------------------------------------------------------------------------- #-- def IsIdentifier(token): """ Returns True if token is a valid identifier, else False. Parameters: token - Parsed token. """ if not token: return False c = token[0] if not c.isalpha() and c != "_": return False for c in token[1:]: if not c.isalnum() and c != "_": return False return True ## #-- def PrettyPrintCols(fp, cursor, *args, **kwargs): """ Pretty print argument strings aligned to column. Parameters: cursor - Current column cursor position. args - List of argument (pos, s) 2-tuples. kwargs - Print control keywords. """ while len(args) >= 2: linecont = kwargs.get('linecont', '') force = kwargs.get('force', False) pos = args[0] s = args[1] args = args[2:] if (pos <= cursor) and (cursor > 0): if not force or cursor > 78: fp.write("%s\n" % (linecont)) cursor = 0 else: fp.write(" ") cursor += 1 if pos > cursor: fp.write(space(pos-cursor)) cursor = pos fp.write("%s" % (s)) cursor += len(s) return cursor ## #-- def PrintBuf(buf, count=None, preface='', nlfreq=None, indent=0, col=0, fp=sys.stderr): """ Pretty print binary buffer to opened file stream. Parameters: buf - Buffer to print. count - Number of bytes to print. preface - Optional buffer preface string. nlfreq - Newline frequency (None for no newlines). ident - Indentation column alignment. col - Current column position. fp - Output file pointer. """ if preface: s = "%s: " % (preface) col += len(s) fp.write(s) if count is None: count = len(buf) if (count > 0) and (col < indent): fp.write(space(indent-col)) i = 0 while i
pd.DataFrame(frame_data2) pandas_df2 = pandas.DataFrame(frame_data2) join_types = ["left", "right", "outer", "inner"] for how in join_types: modin_join = modin_df.join(modin_df2, how=how) pandas_join = pandas_df.join(pandas_df2, how=how) df_equals(modin_join, pandas_join) frame_data3 = {"col7": [1, 2, 3, 5, 6, 7, 8]} modin_df3 = pd.DataFrame(frame_data3) pandas_df3 = pandas.DataFrame(frame_data3) join_types = ["left", "outer", "inner"] for how in join_types: modin_join = modin_df.join([modin_df2, modin_df3], how=how) pandas_join = pandas_df.join([pandas_df2, pandas_df3], how=how) df_equals(modin_join, pandas_join) @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) def test_keys(self, data): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) df_equals(modin_df.keys(), pandas_df.keys()) def test_kurt(self): data = test_data_values[0] with pytest.warns(UserWarning): pd.DataFrame(data).kurt() def test_kurtosis(self): data = test_data_values[0] with pytest.warns(UserWarning): pd.DataFrame(data).kurtosis() def test_last(self): i = pd.date_range("2018-04-09", periods=4, freq="2D") ts = pd.DataFrame({"A": [1, 2, 3, 4]}, index=i) with pytest.warns(UserWarning): ts.last("3D") @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) def test_last_valid_index(self, data): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) assert modin_df.last_valid_index() == (pandas_df.last_valid_index()) @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) def test_loc(self, request, data): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) # We skip nan datasets because nan != nan if "nan" not in request.node.name: key1 = modin_df.columns[0] key2 = modin_df.columns[1] # Scaler assert modin_df.loc[0, key1] == pandas_df.loc[0, key1] # Series df_equals(modin_df.loc[0], pandas_df.loc[0]) df_equals(modin_df.loc[1:, key1], pandas_df.loc[1:, key1]) df_equals(modin_df.loc[1:2, key1], pandas_df.loc[1:2, key1]) # DataFrame df_equals(modin_df.loc[[1, 2]], pandas_df.loc[[1, 2]]) # List-like of booleans indices = [ True if i % 3 == 0 else False for i in range(len(modin_df.index)) ] columns = [ True if i % 5 == 0 else False for i in range(len(modin_df.columns)) ] modin_result = modin_df.loc[indices, columns] pandas_result = pandas_df.loc[indices, columns] df_equals(modin_result, pandas_result) # See issue #80 # df_equals(modin_df.loc[[1, 2], ['col1']], pandas_df.loc[[1, 2], ['col1']]) df_equals(modin_df.loc[1:2, key1:key2], pandas_df.loc[1:2, key1:key2]) # From issue #421 df_equals(modin_df.loc[:, [key2, key1]], pandas_df.loc[:, [key2, key1]]) df_equals(modin_df.loc[[2, 1], :], pandas_df.loc[[2, 1], :]) # Write Item modin_df_copy = modin_df.copy() pandas_df_copy = pandas_df.copy() modin_df_copy.loc[[1, 2]] = 42 pandas_df_copy.loc[[1, 2]] = 42 df_equals(modin_df_copy, pandas_df_copy) def test_loc_multi_index(self): modin_df = pd.read_csv( "modin/pandas/test/data/blah.csv", header=[0, 1, 2, 3], index_col=0 ) pandas_df = pandas.read_csv( "modin/pandas/test/data/blah.csv", header=[0, 1, 2, 3], index_col=0 ) df_equals(modin_df.loc[1], pandas_df.loc[1]) df_equals(modin_df.loc[1, "Presidents"], pandas_df.loc[1, "Presidents"]) df_equals( modin_df.loc[1, ("Presidents", "Pure mentions")], pandas_df.loc[1, ("Presidents", "Pure mentions")], ) assert ( modin_df.loc[1, ("Presidents", "Pure mentions", "IND", "all")] == pandas_df.loc[1, ("Presidents", "Pure mentions", "IND", "all")] ) df_equals( modin_df.loc[(1, 2), "Presidents"], pandas_df.loc[(1, 2), "Presidents"] ) tuples = [ ("bar", "one"), ("bar", "two"), ("bar", "three"), ("bar", "four"), ("baz", "one"), ("baz", "two"), ("baz", "three"), ("baz", "four"), ("foo", "one"), ("foo", "two"), ("foo", "three"), ("foo", "four"), ("qux", "one"), ("qux", "two"), ("qux", "three"), ("qux", "four"), ] modin_index = pd.MultiIndex.from_tuples(tuples, names=["first", "second"]) pandas_index = pandas.MultiIndex.from_tuples(tuples, names=["first", "second"]) frame_data = np.random.randint(0, 100, size=(16, 100)) modin_df = pd.DataFrame( frame_data, index=modin_index, columns=["col{}".format(i) for i in range(100)], ) pandas_df = pandas.DataFrame( frame_data, index=pandas_index, columns=["col{}".format(i) for i in range(100)], ) df_equals(modin_df.loc["bar", "col1"], pandas_df.loc["bar", "col1"]) assert ( modin_df.loc[("bar", "one"), "col1"] == pandas_df.loc[("bar", "one"), "col1"] ) df_equals( modin_df.loc["bar", ("col1", "col2")], pandas_df.loc["bar", ("col1", "col2")], ) def test_lookup(self): data = test_data_values[0] with pytest.warns(UserWarning): pd.DataFrame(data).lookup([0, 1], ["col1", "col2"]) def test_mad(self): data = test_data_values[0] with pytest.warns(UserWarning): pd.DataFrame(data).mad() def test_mask(self): df = pd.DataFrame(np.arange(10).reshape(-1, 2), columns=["A", "B"]) m = df % 3 == 0 with pytest.warns(UserWarning): try: df.mask(~m, -df) except ValueError: pass @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) @pytest.mark.parametrize("axis", axis_values, ids=axis_keys) @pytest.mark.parametrize( "skipna", bool_arg_values, ids=arg_keys("skipna", bool_arg_keys) ) @pytest.mark.parametrize( "numeric_only", bool_arg_values, ids=arg_keys("numeric_only", bool_arg_keys) ) def test_max(self, request, data, axis, skipna, numeric_only): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) try: pandas_result = pandas_df.max( axis=axis, skipna=skipna, numeric_only=numeric_only ) except Exception: with pytest.raises(TypeError): modin_df.max(axis=axis, skipna=skipna, numeric_only=numeric_only) else: modin_result = modin_df.max( axis=axis, skipna=skipna, numeric_only=numeric_only ) df_equals(modin_result, pandas_result) try: pandas_result = pandas_df.T.max( axis=axis, skipna=skipna, numeric_only=numeric_only ) except Exception: with pytest.raises(TypeError): modin_df.T.max(axis=axis, skipna=skipna, numeric_only=numeric_only) else: modin_result = modin_df.T.max( axis=axis, skipna=skipna, numeric_only=numeric_only ) df_equals(modin_result, pandas_result) @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) @pytest.mark.parametrize("axis", axis_values, ids=axis_keys) @pytest.mark.parametrize( "skipna", bool_arg_values, ids=arg_keys("skipna", bool_arg_keys) ) @pytest.mark.parametrize( "numeric_only", bool_arg_values, ids=arg_keys("numeric_only", bool_arg_keys) ) def test_mean(self, request, data, axis, skipna, numeric_only): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) try: pandas_result = pandas_df.mean( axis=axis, skipna=skipna, numeric_only=numeric_only ) except Exception as e: with pytest.raises(type(e)): modin_df.mean(axis=axis, skipna=skipna, numeric_only=numeric_only) else: modin_result = modin_df.mean( axis=axis, skipna=skipna, numeric_only=numeric_only ) df_equals(modin_result, pandas_result) try: pandas_result = pandas_df.T.mean( axis=axis, skipna=skipna, numeric_only=numeric_only ) except Exception as e: with pytest.raises(type(e)): modin_df.T.mean(axis=axis, skipna=skipna, numeric_only=numeric_only) else: modin_result = modin_df.T.mean( axis=axis, skipna=skipna, numeric_only=numeric_only ) df_equals(modin_result, pandas_result) @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) @pytest.mark.parametrize("axis", axis_values, ids=axis_keys) @pytest.mark.parametrize( "skipna", bool_arg_values, ids=arg_keys("skipna", bool_arg_keys) ) @pytest.mark.parametrize( "numeric_only", bool_arg_values, ids=arg_keys("numeric_only", bool_arg_keys) ) def test_median(self, request, data, axis, skipna, numeric_only): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) try: pandas_result = pandas_df.median( axis=axis, skipna=skipna, numeric_only=numeric_only ) except Exception: with pytest.raises(TypeError): modin_df.median(axis=axis, skipna=skipna, numeric_only=numeric_only) else: modin_result = modin_df.median( axis=axis, skipna=skipna, numeric_only=numeric_only ) df_equals(modin_result, pandas_result) try: pandas_result = pandas_df.T.median( axis=axis, skipna=skipna, numeric_only=numeric_only ) except Exception: with pytest.raises(TypeError): modin_df.T.median(axis=axis, skipna=skipna, numeric_only=numeric_only) else: modin_result = modin_df.T.median( axis=axis, skipna=skipna, numeric_only=numeric_only ) df_equals(modin_result, pandas_result) class TestDFPartTwo: def test_melt(self): data = test_data_values[0] with pytest.warns(UserWarning): pd.DataFrame(data).melt() @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) @pytest.mark.parametrize( "index", bool_arg_values, ids=arg_keys("index", bool_arg_keys) ) def test_memory_usage(self, data, index): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) # noqa F841 modin_result = modin_df.memory_usage(index=index) pandas_result = pandas_df.memory_usage(index=index) df_equals(modin_result, pandas_result) def test_merge(self): frame_data = { "col1": [0, 1, 2, 3], "col2": [4, 5, 6, 7], "col3": [8, 9, 0, 1], "col4": [2, 4, 5, 6], } modin_df = pd.DataFrame(frame_data) pandas_df = pandas.DataFrame(frame_data) frame_data2 = {"col1": [0, 1, 2], "col2": [1, 5, 6]} modin_df2 = pd.DataFrame(frame_data2) pandas_df2 = pandas.DataFrame(frame_data2) join_types = ["outer", "inner"] for how in join_types: # Defaults modin_result = modin_df.merge(modin_df2, how=how) pandas_result = pandas_df.merge(pandas_df2, how=how) df_equals(modin_result, pandas_result) # left_on and right_index modin_result = modin_df.merge( modin_df2, how=how, left_on="col1", right_index=True ) pandas_result = pandas_df.merge( pandas_df2, how=how, left_on="col1", right_index=True ) df_equals(modin_result, pandas_result) # left_index and right_on modin_result = modin_df.merge( modin_df2, how=how, left_index=True, right_on="col1" ) pandas_result = pandas_df.merge( pandas_df2, how=how, left_index=True, right_on="col1" ) df_equals(modin_result, pandas_result) # left_on and right_on col1 modin_result = modin_df.merge( modin_df2, how=how, left_on="col1", right_on="col1" ) pandas_result = pandas_df.merge( pandas_df2, how=how, left_on="col1", right_on="col1" ) df_equals(modin_result, pandas_result) # left_on and right_on col2 modin_result = modin_df.merge( modin_df2, how=how, left_on="col2", right_on="col2" ) pandas_result = pandas_df.merge( pandas_df2, how=how, left_on="col2", right_on="col2" ) df_equals(modin_result, pandas_result) # left_index and right_index modin_result = modin_df.merge( modin_df2, how=how, left_index=True, right_index=True ) pandas_result = pandas_df.merge( pandas_df2, how=how, left_index=True, right_index=True ) df_equals(modin_result, pandas_result) # Named Series promoted to DF s = pd.Series(frame_data2.get("col1")) with pytest.raises(ValueError): modin_df.merge(s) s = pd.Series(frame_data2.get("col1"), name="col1") df_equals(modin_df.merge(s), modin_df.merge(modin_df2[["col1"]])) with pytest.raises(ValueError): modin_df.merge("Non-valid type") @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) @pytest.mark.parametrize("axis", axis_values, ids=axis_keys) @pytest.mark.parametrize( "skipna", bool_arg_values, ids=arg_keys("skipna", bool_arg_keys) ) @pytest.mark.parametrize( "numeric_only", bool_arg_values, ids=arg_keys("numeric_only", bool_arg_keys) ) def test_min(self, data, axis, skipna, numeric_only): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) try: pandas_result = pandas_df.min( axis=axis, skipna=skipna, numeric_only=numeric_only ) except Exception: with pytest.raises(TypeError): modin_df.min(axis=axis, skipna=skipna, numeric_only=numeric_only) else: modin_result = modin_df.min( axis=axis, skipna=skipna, numeric_only=numeric_only ) df_equals(modin_result, pandas_result) try: pandas_result = pandas_df.T.min( axis=axis, skipna=skipna, numeric_only=numeric_only ) except Exception: with pytest.raises(TypeError): modin_df.T.min(axis=axis, skipna=skipna, numeric_only=numeric_only) else: modin_result = modin_df.T.min( axis=axis, skipna=skipna, numeric_only=numeric_only ) df_equals(modin_result, pandas_result) @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) @pytest.mark.parametrize("axis", axis_values, ids=axis_keys) @pytest.mark.parametrize( "numeric_only", bool_arg_values, ids=arg_keys("numeric_only", bool_arg_keys) ) def test_mode(self, request, data, axis, numeric_only): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) try: pandas_result = pandas_df.mode(axis=axis, numeric_only=numeric_only) except Exception: with pytest.raises(TypeError): modin_df.mode(axis=axis, numeric_only=numeric_only) else: modin_result = modin_df.mode(axis=axis, numeric_only=numeric_only) df_equals(modin_result, pandas_result) @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) def test_ndim(self, data): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) assert modin_df.ndim == pandas_df.ndim def test_nlargest(self): df = pd.DataFrame( { "population": [ 59000000, 65000000, 434000, 434000, 434000, 337000, 11300, 11300, 11300, ], "GDP": [1937894, 2583560, 12011, 4520, 12128, 17036, 182, 38, 311], "alpha-2": ["IT", "FR", "MT", "MV", "BN", "IS", "NR", "TV", "AI"], }, index=[ "Italy", "France", "Malta", "Maldives", "Brunei", "Iceland", "Nauru", "Tuvalu", "Anguilla", ], ) with pytest.warns(UserWarning): df.nlargest(3, "population") @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) def test_notna(self, data): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) df_equals(modin_df.notna(), pandas_df.notna()) @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) def test_notnull(self, data): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) df_equals(modin_df.notnull(), pandas_df.notnull()) def test_nsmallest(self): df = pd.DataFrame( { "population": [ 59000000, 65000000, 434000, 434000, 434000, 337000, 11300, 11300, 11300, ], "GDP": [1937894, 2583560, 12011, 4520, 12128, 17036, 182, 38, 311], "alpha-2": ["IT", "FR", "MT", "MV", "BN", "IS", "NR", "TV", "AI"], }, index=[ "Italy", "France", "Malta", "Maldives", "Brunei", "Iceland", "Nauru", "Tuvalu", "Anguilla", ], ) with pytest.warns(UserWarning): df.nsmallest(3, "population") @pytest.mark.parametrize("data", test_data_values, ids=test_data_keys) @pytest.mark.parametrize("axis", axis_values, ids=axis_keys) @pytest.mark.parametrize( "dropna", bool_arg_values, ids=arg_keys("dropna", bool_arg_keys) ) def test_nunique(self, data, axis, dropna): modin_df = pd.DataFrame(data) pandas_df = pandas.DataFrame(data) modin_result = modin_df.nunique(axis=axis, dropna=dropna) pandas_result = pandas_df.nunique(axis=axis, dropna=dropna) df_equals(modin_result, pandas_result) modin_result
sg filters resolved_filters = filters results = [ # Apply the filters for every single entities for the given entity type. row for row in self._db[entity_type].values() if self._row_matches_filters( entity_type, row, resolved_filters, filter_operator, retired_only ) ] # handle the ordering of the recordset if order: # order: [{"field_name": "code", "direction": "asc"}, ... ] for order_entry in order: if "field_name" not in order_entry: raise ValueError("Order clauses must be list of dicts with keys 'field_name' and 'direction'!") order_field = order_entry["field_name"] if order_entry["direction"] == "asc": desc_order = False elif order_entry["direction"] == "desc": desc_order = True else: raise ValueError("Unknown ordering direction") results = sorted(results, key=lambda k: k[order_field], reverse=desc_order) if fields is None: fields = set(["type", "id"]) else: fields = set(fields) | set(["type", "id"]) # get the values requested val = [dict((field, self._get_field_from_row(entity_type, row, field)) for field in fields) for row in results] return val def find_one( self, entity_type, filters, fields=None, order=None, filter_operator=None, retired_only=False ): results = self.find( entity_type, filters, fields=fields, order=order, filter_operator=filter_operator, retired_only=retired_only ) return results[0] if results else None def batch(self, requests): results = [] for request in requests: if request["request_type"] == "create": results.append(self.create(request["entity_type"], request["data"])) elif request["request_type"] == "update": # note: Shotgun.update returns a list of a single item results.append(self.update(request["entity_type"], request["entity_id"], request["data"])[0]) elif request["request_type"] == "delete": results.append(self.delete(request["entity_type"], request["entity_id"])) else: raise ShotgunError("Invalid request type %s in request %s" % (request["request_type"], request)) return results def create(self, entity_type, data, return_fields=None): # special handling of storage fields - if a field value # is a dict with a key local_path, then add fields # local_path_linux, local_path_windows, local_path_mac # as a reflection of this for d in data: if isinstance(data[d], dict) and "local_path" in data[d]: # partly imitate some of the business logic happening on the # server side of shotgun when a file/link entity value is created if "local_storage" not in data[d]: data[d]["local_storage"] = {"id": 0, "name": "auto_generated_by_mockgun", "type": "LocalStorage"} if "local_path_linux" not in data[d]: data[d]["local_path_linux"] = data[d]["local_path"] if "local_path_windows" not in data[d]: data[d]["local_path_windows"] = data[d]["local_path"] if "local_path_mac" not in data[d]: data[d]["local_path_mac"] = data[d]["local_path"] self._validate_entity_type(entity_type) self._validate_entity_data(entity_type, data) self._validate_entity_fields(entity_type, return_fields) try: # get next id in this table next_id = max(self._db[entity_type]) + 1 except ValueError: next_id = 1 row = self._get_new_row(entity_type) self._update_row(entity_type, row, data) row["id"] = next_id self._db[entity_type][next_id] = row if return_fields is None: result = dict((field, self._get_field_from_row(entity_type, row, field)) for field in data) else: result = dict((field, self._get_field_from_row(entity_type, row, field)) for field in return_fields) result["type"] = row["type"] result["id"] = row["id"] return result def update(self, entity_type, entity_id, data): self._validate_entity_type(entity_type) self._validate_entity_data(entity_type, data) self._validate_entity_exists(entity_type, entity_id) row = self._db[entity_type][entity_id] self._update_row(entity_type, row, data) return [dict((field, item) for field, item in row.items() if field in data or field in ("type", "id"))] def delete(self, entity_type, entity_id): self._validate_entity_type(entity_type) self._validate_entity_exists(entity_type, entity_id) row = self._db[entity_type][entity_id] if not row["__retired"]: row["__retired"] = True return True else: return False def revive(self, entity_type, entity_id): self._validate_entity_type(entity_type) self._validate_entity_exists(entity_type, entity_id) row = self._db[entity_type][entity_id] if row["__retired"]: row["__retired"] = False return True else: return False def upload(self, entity_type, entity_id, path, field_name=None, display_name=None, tag_list=None): raise NotImplementedError def upload_thumbnail(self, entity_type, entity_id, path, **kwargs): pass ################################################################################################### # internal methods and members def _validate_entity_type(self, entity_type): if entity_type not in self._schema: raise ShotgunError("%s is not a valid entity" % entity_type) def _validate_entity_data(self, entity_type, data): if "id" in data or "type" in data: raise ShotgunError("Can't set id or type on create or update") self._validate_entity_fields(entity_type, data.keys()) for field, item in data.items(): if item is None: # none is always ok continue field_info = self._schema[entity_type][field] if field_info["data_type"]["value"] == "multi_entity": if not isinstance(item, list): raise ShotgunError( "%s.%s is of type multi_entity, but data %s is not a list" % (entity_type, field, item) ) elif item and any(not isinstance(sub_item, dict) for sub_item in item): raise ShotgunError( "%s.%s is of type multi_entity, but data %s contains a non-dictionary" % (entity_type, field, item) ) elif item and any("id" not in sub_item or "type" not in sub_item for sub_item in item): raise ShotgunError( "%s.%s is of type multi-entity, but an item in data %s does not contain 'type' and 'id'" % (entity_type, field, item) ) elif item and any( sub_item["type"] not in field_info["properties"]["valid_types"]["value"] for sub_item in item ): raise ShotgunError( "%s.%s is of multi-type entity, but an item in data %s has an invalid type (expected one of %s)" % (entity_type, field, item, field_info["properties"]["valid_types"]["value"]) ) elif field_info["data_type"]["value"] == "entity": if not isinstance(item, dict): raise ShotgunError( "%s.%s is of type entity, but data %s is not a dictionary" % (entity_type, field, item) ) elif "id" not in item or "type" not in item: raise ShotgunError( "%s.%s is of type entity, but data %s does not contain 'type' and 'id'" % (entity_type, field, item) ) # elif item["type"] not in field_info["properties"]["valid_types"]["value"]: # raise ShotgunError( # "%s.%s is of type entity, but data %s has an invalid type (expected one of %s)" % # (entity_type, field, item, field_info["properties"]["valid_types"]["value"]) # ) else: try: sg_type = field_info["data_type"]["value"] python_type = {"number": int, "float": float, "checkbox": bool, "percent": int, "text": six.string_types, "serializable": dict, "date": datetime.date, "date_time": datetime.datetime, "list": six.string_types, "status_list": six.string_types, "url": dict}[sg_type] except KeyError: raise ShotgunError( "Field %s.%s: Handling for ShotGrid type %s is not implemented" % (entity_type, field, sg_type) ) if not isinstance(item, python_type): raise ShotgunError( "%s.%s is of type %s, but data %s is not of type %s" % (entity_type, field, type(item), sg_type, python_type) ) # TODO: add check for correct timezone def _validate_entity_fields(self, entity_type, fields): self._validate_entity_type(entity_type) if fields is not None: valid_fields = set(self._schema[entity_type].keys()) for field in fields: try: field2, entity_type2, field3 = field.split(".", 2) self._validate_entity_fields(entity_type2, [field3]) except ValueError: if field not in valid_fields and field not in ("type", "id"): raise ShotgunError("%s is not a valid field for entity %s" % (field, entity_type)) def _get_default_value(self, entity_type, field): field_info = self._schema[entity_type][field] if field_info["data_type"]["value"] == "multi_entity": default_value = [] else: default_value = field_info["properties"]["default_value"]["value"] return default_value def _get_new_row(self, entity_type): row = {"type": entity_type, "__retired": False} for field in self._schema[entity_type]: field_info = self._schema[entity_type][field] if field_info["data_type"]["value"] == "multi_entity": default_value = [] else: default_value = field_info["properties"]["default_value"]["value"] row[field] = default_value return row def _compare(self, field_type, lval, operator, rval): """ Compares a field using the operator and value provide by the filter. :param str field_type: Type of the field we are operating on. :param lval: Value inside that field. Can be of any type: datetime, date, int, str, bool, etc. :param str operator: Name of the operator to use. :param rval: The value following the operator in a filter. :returns: The result of the operator that was applied. :rtype: bool """ # If we have a list of scalar values if isinstance(lval, list) and field_type != "multi_entity": # Compare each one. If one matches the predicate we're good! return any((self._compare(field_type, sub_val, operator, rval)) for sub_val in lval) if field_type == "checkbox": if operator == "is": return lval == rval elif operator == "is_not": return lval != rval elif field_type in ("float", "number", "date", "date_time"): if operator == "is": return lval == rval elif operator == "is_not": return lval != rval elif operator == "less_than": return lval < rval elif operator == "greater_than": return lval > rval elif operator == "between": return lval >= rval[0] and lval <= rval[1] elif operator == "not_between": return lval < rval[0] or lval > rval[1] elif operator == "in": return lval in rval elif field_type in ("list", "status_list"): if operator == "is": return lval == rval elif operator == "is_not": return lval != rval elif operator == "in": return lval in rval elif operator == "not_in": return lval not in rval elif field_type == "entity_type": if operator == "is": return lval == rval elif field_type == "text": if operator == "is": return lval == rval elif operator == "is_not": return lval != rval elif operator == "in": return lval in rval elif operator == "contains": return rval in lval elif operator == "not_contains": return lval not in rval elif operator == "starts_with": return lval.startswith(rval) elif operator == "ends_with": return lval.endswith(rval) elif operator == "not_in": return lval
# e means error. if (self.show_stream and self.augmented) or self.show_stream: self.mark_object(self.current_frame, ex, ey, ew, eh, 30, 50, (255, 0, 0), 2) self.target_locker.check_error(ex, ey, ew, eh) break if self.__check_loop_ended(stop_thread): break self.stop_recording() self.is_watching = False def detect_initiate(self, stop_thread, format="bgr"): """Method to serve as the entry point to detection, recognition and tracking features of t_system's vision ability. Args: stop_thread: Stop flag of the tread about terminating it outside of the function's loop. format: Color space format. """ self.is_watching = True detected_boxes = [] rgb = None self.target_locker.scan(False) for frame in self.camera.capture_continuous(self.raw_capture, format=format, use_video_port=True): self.current_frame = frame.array self.__truncate_stream() rgb, detected_boxes = self.detect_things(self.current_frame) if not detected_boxes: gray = cv2.cvtColor(rgb, cv2.COLOR_BGR2GRAY) if (self.show_stream and self.augmented) or self.show_stream: cv2.putText(gray, "Scanning...", (int(self.frame_width - self.frame_width * 0.2), int(self.frame_height * 0.1)), cv2.FONT_HERSHEY_SIMPLEX, 0.75, (200, 0, 0), 2) # self.__show_frame(gray, "Initiate") if self.__check_loop_ended(lambda: False): break else: self.target_locker.scan_thread_stop = True break if self.__check_loop_ended(lambda: False) or self.stop_thread: self.target_locker.scan_thread_stop = True break self.is_watching = False return rgb, detected_boxes def scan(self, stop_thread, resolution=3): """Method to provide the scanning around for security mode of T_System. Args: stop_thread: Stop flag of the tread about terminating it outside of the function's loop. resolution: angle's step width between 0 - 180 degree. """ while True: if stop_thread(): break for angle in range(0, 180, resolution): if stop_thread(): break self.target_locker.pan.move(float(angle), 180.0) angle_for_ellipse_move = calc_ellipsoidal_angle(float(angle) - 90, 180.0, 75.0) # 75 degree is for physical conditions. self.target_locker.tilt.move(angle_for_ellipse_move, 75.0) # last parameter not used for both funcs time.sleep(0.1) for angle in range(180, 0, resolution * -1): if stop_thread(): break self.target_locker.pan.move(float(angle), 180.0) angle_for_ellipse_move = calc_ellipsoidal_angle(float(angle) - 90, 180.0, 75.0) self.target_locker.tilt.move(angle_for_ellipse_move, 75.0) # last parameter not used for both funcs time.sleep(0.1) def reload_target_locker(self, ai=None, non_moving_target=None, arm_expansion=None, current_angles=None): """The top-level method to set locking system's locker of Vision as given AI and target object status parameters. Args: ai (str): AI type that will using during locking the target. non_moving_target (bool): Non-moving target flag. arm_expansion (bool): Flag for the loading locker as expansion of the T_System's robotic arm. current_angles (list): Current angles of the target locking system's collimators. """ if current_angles is None: current_angles = [None, None] return self.target_locker.load_locker(ai, non_moving_target, arm_expansion, current_angles) def serve_frame_online(self): """The top-level method to provide the serving video stream online for sending Flask framework based remote_ui. """ is_success, im_buf_arr = cv2.imencode(".jpg", self.current_frame) return im_buf_arr.tobytes() # image in byte format. def track_focused_point(self): """Method to provide the tracking predetermined non-moving target according to with locking_system's current position for track mode of T_System. """ pass def __show_frame(self, frame, window="Frame"): """Method to show the captured frame. Args: frame: Frame matrix in bgr format. window: Name of the frame showing window. """ if (self.show_stream and self.augmented) or self.show_stream: # show the frame cv2.imshow(window, frame) def __truncate_stream(self): """Method to clear the stream in preparation for the next frame. """ self.raw_capture.seek(0) self.raw_capture.truncate() def __check_loop_ended(self, stop_thread): """Method to control end of the vision loop. Args: stop_thread: Stop flag of the tread about terminating it outside of the function's loop. """ # if the `q` key was pressed, break from the loop key = cv2.waitKey(1) & 0xFF if (key == ord("q") or stop_thread()) and (self.augmented or self.active_threads): logger.info("All threads killed. In progress...") return True elif (key == ord("q") or stop_thread()) and not self.augmented: cv2.destroyAllWindows() self.release_members() return True def __detect_with_hog_or_cnn(self, frame): """Method to detecting FACES with hog or cnn methoda. Args: frame: Frame matrix in bgr format. """ rgb = cv2.cvtColor(frame, cv2.COLOR_BGR2RGB) # rgb = cv2.resize(rgb, (0, 0), fx=0.25, fy=0.25) # r = frame.shape[1] / float(rgb.shape[1]) detected_boxes = face_recognition.face_locations(rgb, model=self.detection_model) return rgb, detected_boxes def __detect_with_haarcascade(self, frame): """Method to detecting objects with haarcascade method. Args: frame: Frame matrix in bgr format. """ gray = cv2.cvtColor(frame, cv2.COLOR_BGR2GRAY) # gray = cv2.equalizeHist(gray) reworked_boxes = [] for object_cascade in self.object_cascades: detected_boxes = object_cascade.detectMultiScale(gray, 1.3, 5) # Following list's member change is for face recognition format compatibility. for box in detected_boxes: # box[3] is x, # box[0] is y, # box[1] is x + w, # box[2] is y + h. reworked_boxes.append((box[1], box[0] + box[2], box[1] + box[3], box[0])) rgb = cv2.cvtColor(frame, cv2.COLOR_BGR2RGB) # For __recognize_things compatibility. return rgb, reworked_boxes def __recognize_things(self, rgb, boxes): """Method to recognizing objects with encodings pickle files. Args: rgb: Frame matrix in rgb format. boxes: Tuple variable of locations of detected objects. """ encodings = face_recognition.face_encodings(rgb, boxes) names = [] for encoding in encodings: # attempt to match each face in the input image to our known encodings matches = face_recognition.compare_faces(self.recognition_data["encodings"], encoding) name = "Unknown" # check to see if we have found a match if True in matches: # find the indexes of all matched faces then initialize a # dictionary to count the total number of times each face # was matched matched_idxs = [i for (i, b) in enumerate(matches) if b] counts = {} # loop over the matched indexes and maintain a count for # each recognized face for i in matched_idxs: name = self.recognition_data["names"][i] counts[name] = counts.get(name, 0) + 1 # determine the recognized face with the largest number # of votes (note: in the event of an unlikely tie Python # will select first entry in the dictionary) name = max(counts, key=counts.get) # update the list of names names.append(name) return names def __create_tracker_by_name(self): """Method to creating a tracker object via type that is chosen by the user. """ if self.tracker_type == self.tracker_types[0]: tracker = cv2.TrackerBoosting_create() elif self.tracker_type == self.tracker_types[1]: tracker = cv2.TrackerMIL_create() elif self.tracker_type == self.tracker_types[2]: tracker = cv2.TrackerKCF_create() elif self.tracker_type == self.tracker_types[3]: tracker = cv2.TrackerTLD_create() elif self.tracker_type == self.tracker_types[4]: tracker = cv2.TrackerMedianFlow_create() elif self.tracker_type == self.tracker_types[5]: tracker = cv2.TrackerGOTURN_create() elif self.tracker_type == self.tracker_types[6]: tracker = cv2.TrackerMOSSE_create() elif self.tracker_type == self.tracker_types[7]: tracker = cv2.TrackerCSRT_create() else: tracker = None logger.error('Incorrect tracker name') logger.info('Available trackers are:') for t in self.tracker_types: logger.info(t) return tracker @staticmethod def __relocate_detected_coords(detected_boxes): """Method to relocating members of detected boxes from given shape to wanted shape. Args: detected_boxes (tuple): Top left and bottom right coordinates of the detected thing. """ reworked_boxes = [] for box in detected_boxes: # box[3] is x, # box[0] is y, # box[1] is x + w, # box[2] is y + h. reworked_boxes.append((box[3], box[0], box[1] - box[3], box[2] - box[0])) return reworked_boxes def change_tracked_thing(self, file): """The top-level method to changing tracking objects. Args: file: The haarcascade trained xml file. """ self.object_cascades = [] ccade_xml_file = T_SYSTEM_PATH + "/haarcascade/" + file + ".xml" self.object_cascades.append(cv2.CascadeClassifier(ccade_xml_file)) self.decider.set_db(file) @staticmethod def __mark_as_single_rect(frame, x, y, w, h, radius, physically_distance, color, thickness): """Method to set mark_object method as drawing method with OpenCV's basic rectangle. Args: frame: Frame matrix. x : the column number of the top left point of found object from the detection method. y : the row number of the top left point of found object from the detection method. w : the width of found object from the detection method. h : the height of found object from the detection method. radius: Radius of the aim. physically_distance: Physically distance of the targeted object as pixel count. color (tuple): Color of the drawing shape. In RGB Space. thickness (int): Thickness of the drawing shape. """ cv2.rectangle(frame, (x, y), (x + w, y + h), color, thickness) def __mark_as_partial_rect(self, frame, x, y, w, h, radius, physically_distance, color, thickness): """Method to set mark_object method as drawing method with aimer's partial rect. Args: frame: Frame matrix. x : the column number of the top left point of found object from the detection method. y : the row number of the top left point of found object from the detection method. w : the width of found object from the detection method. h : the height of found object from the detection method. radius: Radius of the aim. physically_distance: Physically distance of the targeted object as pixel count. color (tuple): Color of the drawing shape. In RGB
# some qsub error, e.g. maybe wrong queue specified, don't have permission to submit, etc... msg = ('Error in job submission with PBS file {f} and cmd {c}\n'.format(f=script_file, c=cmd) + 'The error response reads: {}'.format(process.stderr.read())) raise self.Error(msg) except Exception as exc: # random error, e.g. no qsub on machine! raise self.Error("Running qsub caused an error...\n%s" % str(exc)) def get_njobs_in_queue(self, username=None): return None # Initialize username if username is None: username = getpass.getuser() # run qstat try: qstat = Command(['qstat', '-a', '-u', username]).run(timeout=5) # parse the result if qstat.status == 0: # lines should have this form # '1339044.sdb username queuename 2012-02-29-16-43 20460 -- -- -- 00:20 C 00:09' # count lines that include the username in it # TODO: only count running or queued jobs. or rather, *don't* count jobs that are 'C'. outs = qstat.output.split('\n') njobs = len([line.split() for line in outs if username in line]) logger.info('The number of jobs currently in the queue is: {}'.format(njobs)) return njobs except: # there's a problem talking to qstat server? print(qstat.output.split('\n')) err_msg = ('Error trying to get the number of jobs in the queue using qstat service\n' + 'The error response reads: {}'.format(qstat.error)) logger.critical(boxed(err_msg)) return None # no need to raise an error, if False is returned the fixer may try something else, we don't need to kill the # scheduler just yet def exclude_nodes(self, nodes): logger.warning('exluding nodes, not implemented yet pbs') return False def increase_mem(self, factor=1): base_increase = 2001 new_mem = self.qparams["pvmem"] + factor*base_increase if new_mem < self.LIMITS['mem']: self.set_mem_per_cpu(new_mem) print('set mem to ', new_mem) return True else: logger.warning('could not increase mem further') print('new_mem reached max ', new_mem) return False def increase_time(self, factor=1.5): days, hours, minutes = 0, 0, 0 try: # a pbe time parser [HH:MM]:SS # feel free to pull this out and mak time in minutes always n = str(self.qparams['time']).count(':') if n == 0: hours = int(float(self.qparams['time'])) elif n > 1: hours = int(float(self.qparams['time'].split(':')[0])) minutes = int(float(self.qparams['time'].split(':')[1])) time = hours * 60 + minutes time *= factor if time < self.LIMITS['time']: self.qparams['time'] = str(int(time / 60)) + ':' + str(int(time - 60 * int(time / 60))) + ':00' logger.info('increased time to %s minutes' % time) return True else: raise QueueAdapterError except (KeyError, QueueAdapterError): return False def increase_cpus(self, factor): base_increase = 12 new_cpus = self.qparams['select'] + factor * base_increase if new_cpus < self.LIMITS['max_select']: self.qparams['select'] = new_cpus return True else: logger.warning('increasing cpus reached the limit') return False class TorqueAdapter(PbsProAdapter): """Adapter for Torque.""" QTYPE = "torque" QTEMPLATE = """\ #!/bin/bash #PBS -A $${account} #PBS -N $${job_name} #PBS -l walltime=$${walltime} #PBS -q $${queue} #PBS -l model=$${model} #PBS -l place=$${place} #PBS -W group_list=$${group_list} ####PBS -l select=$${select}:ncpus=1:vmem=$${vmem}mb:mpiprocs=1:ompthreads=$${ompthreads} ####PBS -l pvmem=$${pvmem}mb #PBS -l pmem=$${pmem}mb ####PBS -l mppwidth=$${mppwidth} #PBS -l nodes=$${nodes}:ppn=$${ppn} #PBS -M $${mail_user} #PBS -m $${mail_type} # Submission environment #PBS -V #PBS -o $${_qout_path} #PBS -e $${_qerr_path} """ LIMITS = {'max_total_tasks': 3888, 'time': 48, 'max_nodes': 16} def set_mem_per_cpu(self, mem_mb): """Set the memory per core in Megabytes""" self.qparams["pmem"] = mem_mb self.qparams["mem"] = mem_mb @property def mpi_procs(self): """Number of MPI processes.""" return self.qparams.get("nodes", 1)*self.qparams.get("ppn", 1) def set_mpi_procs(self, mpi_procs): """Set the number of CPUs used for MPI.""" self.qparams["nodes"] = 1 self.qparams["ppn"] = mpi_procs def increase_nodes(self, factor): base_increase = 1 new_nodes = self.qparams['nodes'] + factor * base_increase if new_nodes < self.LIMITS['max_nodes']: self.qparams['nodes'] = new_nodes return True else: logger.warning('increasing cpus reached the limit') return False class SGEAdapter(AbstractQueueAdapter): """ Adapter for Sun Grid Engine (SGE) task submission software. """ QTYPE = "sge" QTEMPLATE = """\ #!/bin/bash #$ -A $${account} #$ -N $${job_name} #$ -l h rt=$${walltime} #$ -pe $${queue} $${ncpus} #$ -cwd #$ -j y #$ -m n #$ -e $${_qerr_path} #$ -o $${_qout_path} #$ -S /bin/bash """ @property def mpi_procs(self): """Number of CPUs used for MPI.""" return self.qparams.get("ncpus", 1) def set_mpi_procs(self, mpi_procs): """Set the number of CPUs used for MPI.""" self.qparams["ncpus"] = mpi_procs def set_omp_threads(self, omp_threads): """Set the number of OpenMP threads.""" self.omp_env["OMP_NUM_THREADS"] = omp_threads warnings.warn("set_omp_threads not availabe for %s" % self.__class__.__name__) def set_mem_per_cpu(self, mem_mb): """Set the memory per CPU in Megabytes""" raise NotImplementedError("") #self.qparams["mem_per_cpu"] = mem_mb ## Remove mem if it's defined. #self.qparams.pop("mem", None) def cancel(self, job_id): return os.system("qdel %d" % job_id) def submit_to_queue(self, script_file): """Submit a job script to the queue.""" if not os.path.exists(script_file): raise self.Error('Cannot find script file located at: {}'.format(script_file)) # submit the job try: cmd = ['qsub', script_file] process = Popen(cmd, stdout=PIPE, stderr=PIPE) process.wait() # grab the returncode. SGE returns 0 if the job was successful if process.returncode == 0: try: # output should of the form # Your job 1659048 ("NAME_OF_JOB") has been submitted queue_id = int(process.stdout.read().split(' ')[2]) logger.info('Job submission was successful and queue_id is {}'.format(queue_id)) except: # probably error parsing job code logger.warning("Could not parse job id following qsub...") queue_id = None finally: return process, queue_id else: # some qsub error, e.g. maybe wrong queue specified, don't have permission to submit, etc... msg = ('Error in job submission with PBS file {f} and cmd {c}\n'.format(f=script_file, c=cmd) + 'The error response reads: {}'.format(process.stderr.read())) raise self.Error(msg) except: # random error, e.g. no qsub on machine! raise self.Error("Running qsub caused an error...") def get_njobs_in_queue(self, username=None): # Initialize username if username is None: username = getpass.getuser() # run qstat qstat = Command(['qstat', '-u', username]).run(timeout=5) # parse the result if qstat.status == 0: # lines should contain username # count lines that include the username in it # TODO: only count running or queued jobs. or rather, *don't* count jobs that are 'C'. outs = qstat.output.split('\n') njobs = len([line.split() for line in outs if username in line]) logger.info('The number of jobs currently in the queue is: {}'.format(njobs)) return njobs # there's a problem talking to qstat server? err_msg = ('Error trying to get the number of jobs in the queue using qstat service\n' + 'The error response reads: {}'.format(qstat.error)) logger.critical(err_msg) return None def exclude_nodes(self, nodes): """ Method to exclude nodes in the calculation """ raise NotImplementedError("exclude_nodes") def increase_mem(self, factor): """ Method to increase the amount of memory asked for, by factor. """ raise NotImplementedError("increase_mem") def increase_time(self, factor): """ Method to increase the available wall time asked for, by factor. """ raise NotImplementedError("increase_time") def increase_cpus(self, factor): raise NotImplementedError("increase_cpus") class MOABAdapter(AbstractQueueAdapter): """https://computing.llnl.gov/tutorials/moab/""" QTYPE = "moab" QTEMPLATE = """\ #!/bin/bash #MSUB -a $${eligible_date} #MSUB -A $${account} #MSUB -c $${checkpoint_interval} #MSUB -l feature=$${feature} #MSUB -l gres=$${gres} #MSUB -l nodes=$${nodes} #MSUB -l partition=$${partition} #MSUB -l procs=$${procs} #MSUB -l ttc=$${ttc} #MSUB -l walltime=$${walltime} #MSUB -l $${resources} #MSUB -p $${priority} #MSUB -q $${queue} #MSUB -S $${shell} #MSUB -N $${job_name} #MSUB -v $${variable_list} #MSUB -o $${_qout_path} #MSUB -e $${_qerr_path} """ @property def mpi_procs(self): """Number of CPUs used for MPI.""" return self.qparams.get("procs", 1) def set_mpi_procs(self, mpi_procs): """Set the number of CPUs used for MPI.""" self.qparams["procs"] = mpi_procs def set_omp_threads(self, omp_threads): """Set the number of OpenMP threads.""" self.omp_env["OMP_NUM_THREADS"] = omp_threads def cancel(self, job_id): return os.system("canceljob %d" % job_id) def submit_to_queue(self, script_file, submit_err_file="sbatch.err"): """Submit a job script to the queue.""" if not os.path.exists(script_file): raise self.Error('Cannot find script file located at: {}'.format(script_file)) submit_err_file = os.path.join(os.path.dirname(script_file), submit_err_file) # submit the job try: cmd = ['msub', script_file] process = Popen(cmd, stdout=PIPE, stderr=PIPE) # write the err output to file, a error parser may read it and a fixer may know what to do ... with open(submit_err_file, mode='w') as f: f.write('msub submit process stderr:') f.write(str(process.stderr.read())) f.write('qparams:') f.write(str(self.qparams)) process.wait() # grab the returncode. MOAB returns 0 if the job was successful if process.returncode == 0: try: # output should be the queue_id queue_id = int(process.stdout.read().split()[0]) logger.info('Job submission was successful and queue_id is {}'.format(queue_id)) except: # probably error parsing job code queue_id = None logger.warning('Could not parse job id following msub...') finally: return process, queue_id else: # some qsub error, e.g. maybe wrong queue specified, don't have permission to submit, etc... err_msg = ("Error in job submission with MOAB file {f} and cmd {c}\n".format(f=script_file, c=cmd) + "The error response reads: {c}".format(c=process.stderr.read())) raise self.Error(err_msg) except Exception as details: msg = 'Error while submitting job:\n' + str(details) logger.critical(msg) with open(submit_err_file, mode='a') as f: f.write(msg) try: print('sometimes we land here, no idea what is happening ... Michiel') print("details:\n", details, "cmd\n", cmd, "\nprocess.returcode:", process.returncode) except: pass # random error, e.g. no qsub on machine!
| | | as it gives moire’-free results. But when the image | | | | is zoomed, it is similar to the INTER_NEAREST method. | +-----+-----------------+-------------------------------------------------------+ |(4) | INTER_LANCZOS4 | Lanczos interpolation over 8x8 pixel neighborhood | +-----+-----------------+-------------------------------------------------------+ :param mmode: (None) mmode to create mapped file. if mpath is specified loads image, converts to mapped file and then loads mapping file with mode {None, 'r+', 'r', 'w+', 'c'} (it is slow for big images). If None, loads mapping file to memory (useful to keep image copy for session even if original image is deleted or modified). :param mpath: (None) path to create mapped file. None, do not create mapping file "", uses path directory; "*", uses working directory; else, uses specified directory. .. note:: If mmode is None and mpath is given it creates mmap file but loads from it to memory. It is useful to create physical copy of data to keep loading from (data can be reloaded even if original file is moved or deleted). """ def __init__(self, path, flag=0, dsize=None, dst=None, fx=None, fy=None, interpolation=None, mmode=None, mpath=None, throw=True): self.path = path self._flag = flag self._dsize = dsize self._dst = dst self._fx = fx self._fy = fy self._interpolation = interpolation self._mmode = mmode self._mpath = mpath self._throw = throw self.load = loadFunc(flag, dsize, dst, fx, fy, interpolation, mmode, mpath, throw) #i = loadFunc.__doc__.find(":param") #__init__.__doc__ = loadFunc.__doc__[:i] + __init__.__doc__ + loadFunc.__doc__[i:] # builds documentation dynamically # del i # job done, delete def __call__(self): return self.load(self.path) def getConfiguration(self, **kwargs): """ Get Custom configuration from default configuration. :param kwargs: keys to customize default configuration. If no key is provided default configuration is returned. :return: dictionary of configuration """ temp = {"flag": self._flag, "dsize": self._dsize, "dst": self._dst, "fx": self._fx, "fy": self._fy, "interpolation": self._interpolation, "mmode": self._mmode, "mpath": self._mpath, "throw": self._throw} if kwargs: temp.update(kwargs) return temp def temp(self, **kwargs): """ loads from temporal loader created with customized and default parameters. :param kwargs: keys to customize default configuration. :return: loaded image. """ if len(kwargs) == 1 and "path" in kwargs: return self.load(kwargs["path"]) path = kwargs.get("path", self.path) # get path # build a new loader and load path return loadFunc(**self.getConfiguration(**kwargs))(path) class PathLoader(MutableSequence): """ Class to standardize loading images from list of paths and offer lazy evaluations. :param fns: list of paths :param loader: path loader (loadcv,loadsfrom, or function from loadFunc) Also see:: :func:`loadcv`, :func:`loadsfrom`, :func:`loadFunc` Example:: fns = ["/path to/image 1.ext","/path to/image 2.ext"] imgs = pathLoader(fns) print imgs[0] # loads image in path 0 print imgs[1] # loads image in path 1 """ def __init__(self, fns=None, loader=None): # create factory functions self._fns = fns or [] self._loader = loader or loadFunc() def __call__(self): """ if called returns the list of paths """ return self._fns def __getitem__(self, key): return self._loader(self._fns[key]) def __setitem__(self, key, value): self._fns[key] = value def __delitem__(self, key): del self._fns[key] def __len__(self): return len(self._fns) def insert(self, index, value): self._fns.insert(index, value) class LoaderDict(ResourceManager): """ Class to standardize loading objects and manage memory efficiently. :param loader: default loader for objects (e.g. load from file or create instance object) :param maxMemory: (None) max memory in specified unit to keep in check optimization (it does not mean that memory never surpasses maxMemory). :param margin: (0.8) margin from maxMemory to trigger optimization. It is in percentage of maxMemory ranging from 0 (0%) to maximum 1 (100%). So optimal memory is inside range: maxMemory*margin < Memory < maxMemory :param unit: (MB) maxMemory unit, it can be GB (Gigabytes), MB (Megabytes), B (bytes) :param all: if True used memory is from all alive references, if False used memory is only from keptAlive references. :param config: (Not Implemented) """ def __init__(self, loader=None, maxMemory=None, margin=0.8, unit="MB", all=True, config=None): super(LoaderDict, self).__init__(maxMemory, margin, unit, all) # create factory functions #if config is None: from config import MANAGER as config #self._config = config self._default_loader = loader or loadFunc() def register(self, key, path=None, method=None): if method is not None: def func(): return method(func.path) else: def func(): return self._default_loader(func.path) func.path = path super(LoaderDict, self).register(key=key, method=func) def try_loads(fns, func=cv2.imread, paths=None, debug=False, addpath=False): """ Try to load images from paths. :param fns: list of file names :param func: loader function :param paths: paths to try. By default it loads working dir and test path :param debug: True to show debug messages :param addpath: add path as second argument :return: image else None """ default = ("", str(MANAGER["TESTPATH"])) if paths is None: paths = [] if isinstance(paths, basestring): paths = [paths] paths = list(paths) for i in default: if i not in paths: paths.append(i) for fn in fns: for path in paths: try: if path[-1] not in ("/", "\\"): # ensures path path += "/" except: pass path += fn im = func(path) # foreground if im is not None: if debug: print(path, " Loaded...") if addpath: return im, path return im def hist_match(source, template, alpha=None): """ Adjust the pixel values of an image to match those of a template image. :param source: image to transform colors to template :param template: template image () :param alpha: :return: transformed source """ # theory https://en.wikipedia.org/wiki/Histogram_matching # explanation http://dsp.stackexchange.com/a/16175 and # http://fourier.eng.hmc.edu/e161/lectures/contrast_transform/node3.html # based on implementation http://stackoverflow.com/a/33047048/5288758 # see http://www.mathworks.com/help/images/ref/imhistmatch.html if len(source.shape) > 2: matched = np.zeros_like(source) for i in range(3): matched[:, :, i] = hist_match(source[:, :, i], template[:, :, i]) return matched else: oldshape = source.shape source = source.ravel() template = template.ravel() # get the set of unique pixel values and their corresponding indices and # counts s_values, bin_idx, s_counts = np.unique(source, return_inverse=True, return_counts=True) t_values, t_counts = np.unique(template, return_counts=True) # take the cumsum of the counts and normalize by the number of pixels to # get the empirical cumulative distribution functions for the source and # template images (maps pixel value --> quantile) s_quantiles = np.cumsum(s_counts).astype(np.float64) s_quantiles /= s_quantiles[-1] t_quantiles = np.cumsum(t_counts).astype(np.float64) t_quantiles /= t_quantiles[-1] # interpolate linearly to find the pixel values in the template image # that correspond most closely to the quantiles in the source image interp_t_values = np.interp(s_quantiles, t_quantiles, t_values) return interp_t_values[bin_idx].reshape(oldshape) # reconstruct image ############################# GETCOORS ################################### # http://docs.opencv.org/master/db/d5b/tutorial_py_mouse_handling.html # http://docs.opencv.org/modules/highgui/doc/qt_new_functions.html class ImCoors(object): """ Image's coordinates class. Example:: a = ImCoors(np.array([(116, 161), (295, 96), (122, 336), (291, 286)])) print a.__dict__ print "mean depend on min and max: ", a.mean print a.__dict__ print "after mean max has been already been calculated: ", a.max a.data = np.array([(116, 161), (295, 96)]) print a.__dict__ print "mean and all its dependencies are processed again: ", a.mean """ def __init__(self, pts, dtype=FLOAT, deg=False): """ Initiliazes ImCoors. :param pts: list of points :param dtype: return data as dtype. Default is config.FLOAT """ self._pts = pts # supports bigger numbers self._dtype = dtype self._deg = deg @property def pts(self): return self._pts @pts.setter def pts(self, value): getattr(self, "__dict__").clear() self._pts = value @pts.deleter def pts(self): raise Exception("Cannot delete attribute") @property def dtype(self): return self._dtype @dtype.setter def dtype(self, value): getattr(self, "__dict__").clear() self._dtype = value @dtype.deleter def dtype(self): raise Exception("Cannot delete attribute") # DATA METHODS def __len__(self): return len(self._pts) @cache def max(self): """ Maximum in each axis. :return: x_max, y_max """ #self.max_x, self.max_y = np.max(self.data,0) return tuple(np.max(self._pts, 0)) @cache def min(self): """ Minimum in each axis. :return: x_min, y_min """ #self.min_x, self.min_y = np.min(self.data,0) return tuple(np.min(self._pts, 0)) @cache def rectbox(self): """ Rectangular box enclosing points (origin and end point or rectangle). :return: (x0,y0),(x,y) """ return (self.min, self.max) @cache def boundingRect(self): """ Rectangular box dimensions enclosing points. example:: P = np.ones((400,400)) a = ImCoors(np.array([(116, 161), (295, 96), (122, 336), (291, 286)])) x0,y0,w,h = a.boundingRect P[y0:y0+h,x0:x0+w] = 0 :return: x0,y0,w,h """ return cv2.boundingRect(self._pts) @cache def minAreaRect(self): return cv2.minAreaRect(self._pts) @cache def rotatedBox(self): """ Rotated rectangular box enclosing points. :return: 4 points. """ try: # opencv 2 return self._dtype(cv2.cv.BoxPoints(self.minAreaRect)) except AttributeError: # opencv 3 return self._dtype(cv2.boxPoints(self.minAreaRect)) @cache def boxCenter(self): """ Mean in each axis. :return: x_mean, y_mean """ #self.mean_x = (self.max_x+self.min_x)/2 #self.mean_y = (self.max_y+self.min_y)/2 xX, xY = self.max nX, nY = self.min
import time import argparse from copy import deepcopy from progress.bar import IncrementalBar import numpy as np import torch from torch import nn import torch.nn.functional as F import torch.optim as optim from torchvision import utils as vutils from itertools import chain from gan.generator import MuseGenerator from gan.critic import MuseCritic from gan.utils import initialize_weights, Normal from criterion import WassersteinLoss, GradientPenalty def copy_G_params(model): flatten = deepcopy(list(p.data for p in model.parameters())) return flatten def load_params(model, new_param): for p, new_p in zip(model.parameters(), new_param): p.data.copy_(new_p) def get_item(pred): return pred.mean().item() dist = Normal() class MuseGAN(): def __init__(self, c_dimension=10, z_dimension=32, g_channels=1024, g_features=1024, c_channels=128, c_features=1024, g_lr=0.001, c_lr=0.001, device='cpu'): self.c_dim = c_dimension self.z_dim = z_dimension self.device = device self.one_hot = True # generator and optimizer self.generator = MuseGenerator(c_dimension = c_dimension, z_dimension = z_dimension, hid_channels = g_channels, hid_features = g_features, out_channels = 1).to(device) self.generator = self.generator.apply(initialize_weights) self.g_optimizer = torch.optim.Adam(self.generator.parameters(), lr=g_lr, betas=(0.5, 0.9)) # critic and optimizer self.critic = MuseCritic(c_dimension = c_dimension, hid_channels = c_channels, hid_features = c_features, out_features = 1).to(device) self.critic = self.critic.apply(initialize_weights) self.c_optimizer = torch.optim.Adam(self.critic.parameters(), lr=c_lr, betas=(0.5, 0.9)) self.opt_info = optim.Adam(chain(self.generator.parameters(), self.critic.pred_c.parameters()), lr=(g_lr+c_lr)/2, betas=(0.5, 0.99)) self.running_avg_g = None self.real_images = None self.prob_c = False self.recon_weight = 1.0 self.onehot_weight = 1.0 # loss functions and gradient penalty (critic is wasserstein-like gan) self.g_criterion = WassersteinLoss().to(device) self.c_criterion = WassersteinLoss().to(device) self.c_penalty = GradientPenalty().to(device) # dictionary to save history self.data = {'g_loss':[], 'c_loss':[], 'cf_loss':[], 'cr_loss':[], 'cp_loss':[], 'cs_loss':[], 'o_loss':[]} print('MuseGAN initialized.') def generate_random_sample(self, save_path, z=None, c=None, batch_size=16): backup_para = copy_G_params(self.generator) load_params(self.generator, self.running_avg_g) #self.generator.eval() if self.z_dim > 0 and z is None: z = torch.randn(batch_size, self.z_dim).to(self.device) if self.c_dim > 0 and c is None: c = torch.randn(batch_size, self.c_dim).uniform_(0,1).to(self.device) #c = torch.randn(1, self.c_dim).uniform_(0,1).repeat(batch_size,1).to(self.device) with torch.no_grad(): g_img = self.generator(c=c, z=z).cpu() vutils.save_image(g_img.add_(1).mul_(0.5), save_path.replace(".jpg", "_random.jpg"), pad_value=0) del g_img #self.generator.train() load_params(self.generator, backup_para) def generate_each_dim(self, save_path, dim=0, z=None, c=None, num_interpolate=10, num_samples=8): #self.generator.eval() if self.running_avg_g is not None: backup_para = copy_G_params(self.generator) load_params(self.generator, self.running_avg_g) if self.z_dim > 0 and z is None: z = torch.randn(num_samples, self.z_dim).to(self.device) z = z.unsqueeze(1).repeat(1, num_interpolate, 1).view(-1, self.z_dim) if self.c_dim > 0 and c is None: c = torch.randn(num_samples, self.c_dim).uniform_(0.2, 0.6).to(self.device) c = c.unsqueeze(1).repeat(1, num_interpolate, 1) #.view(-1, self.z_dim) c_line = torch.linspace(0, 1, num_interpolate).to(self.device) c_line = c_line.unsqueeze(0).repeat(num_samples, 1) c[:,:,dim] = c_line c = c.view(-1, self.c_dim) with torch.no_grad(): g_img = self.generator(c=c, z=z) vutils.save_image(g_img.add_(1).mul_(0.5), \ save_path.replace(".jpg", "_dim_%d.jpg"%(dim)), pad_value=0,nrow=num_interpolate) del g_img if self.running_avg_g is not None: load_params(self.generator, backup_para) def neg_log_density(self, sample, params): constant = torch.Tensor([np.log(2 * np.pi)]).to(self.device) mu = params[:,:self.c_dim] logsigma = params[:,self.c_dim:] inv_sigma = torch.exp(-logsigma) tmp = (sample - mu) * inv_sigma return 0.5 * (tmp * tmp + 2 * logsigma + constant) def sample_hot_c(self, batch_size, c_dim, num_hot=1): y_onehot = torch.zeros(batch_size, c_dim) # print("num_hot: ", num_hot) if num_hot==1: y = torch.LongTensor(batch_size, 1).random_() % c_dim # print("y_onehot: ", y_onehot.shape, y_onehot.dtype) # print("torch.ones_like(y_onehot).to(y_onehot): ", torch.ones_like(y_onehot).to(y_onehot).shape, torch.ones_like(y_onehot).to(y_onehot).dtype) # print("y: ", y.shape, y.dtype) # print("torch.ones_like(y): ", torch.ones_like(y).shape, torch.ones_like(y).dtype) # print("torch.ones_like(y).to(y): ", torch.ones_like(y).to(y).shape, torch.ones_like(y).to(y).dtype) y_onehot.scatter_(1, y, 1.0) # print("c_idx: ", y.view(-1).shape, y.view(-1, 1).shape, y.view([-1, 1]).shape) return y_onehot.to(self.device), y.to(self.device) else: for _ in range(num_hot): y = torch.LongTensor(batch_size,1).random_() % c_dim y_onehot.scatter_(1, y, torch.ones_like(y).to(y)) return y_onehot.to(self.device) def sample_z_and_c(self, batch_size, n_iter): # sample z from Normal distribution z = None if self.z_dim > 0: z = torch.randn(batch_size, 10, self.z_dim).to(self.device) # sample c alternativaly from uniform and onehot c_idx = None if n_iter%4==0 and self.one_hot: c = torch.Tensor(batch_size, self.c_dim).uniform_(0.2,0.6).to(self.device) # chosen_section = np.random.randint(0, 10) choosen_dim = np.random.randint(0, self.c_dim) c[:, choosen_dim] = 1 c_idx = torch.Tensor(batch_size).fill_(choosen_dim).long().to(self.device) elif n_iter%2==0 and self.one_hot: c, c_idx = self.sample_hot_c(batch_size, c_dim=self.c_dim, num_hot=1) else: c = torch.Tensor(batch_size, self.c_dim).uniform_(0, 1).to(self.device) return z, c, c_idx def compute_gradient_penalty(self, real_images, fake_images): # Compute gradient penalty # print("real_images, fake_images: ", real_images.shape, fake_images.shape) alpha = torch.rand(real_images.size(0), 1, 1, 1, 1).expand_as(real_images).to(self.device) interpolated = (alpha * real_images + (1 - alpha) * fake_images).clone().detach().requires_grad_(True) out = self.critic(interpolated)[0] exp_grad = torch.ones(out.size()).to(self.device) grad = torch.autograd.grad(outputs=out, inputs=interpolated, grad_outputs=exp_grad, retain_graph=True, create_graph=True, only_inputs=True)[0] grad = grad.view(grad.size(0), -1) grad_l2norm = torch.sqrt(torch.sum(grad ** 2, dim=1)) d_loss_gp = torch.mean((grad_l2norm - 1) ** 2) return d_loss_gp def compute_total_correlation(self): real_images = torch.cat(self.real_images, dim=0) batch_size = real_images.size(0) # print(batch_size) self.critic.eval() with torch.no_grad(): c_params = self.critic(real_images)[1] self.critic.train() sample_c = dist.sample(params=c_params.view(batch_size, self.c_dim, 2)) _logqc = dist.log_density( sample_c.view(-1, 1, self.c_dim), c_params.view(1, -1, self.c_dim, 2) ) logqc_prodmarginals = (logsumexp(_logqc, dim=1, keepdim=False) - math.log(batch_size)).sum(1) logqc = (logsumexp(_logqc.sum(2), dim=1, keepdim=False) - math.log(batch_size)) #print( logqc, logqc_prodmarginals ) self.real_images = None return (logqc - logqc_prodmarginals).mean().item() def train_step(self, real_image, n_iter): cfb_loss, crb_loss, cpb_loss, cb_loss = 0, 0, 0, 0 if self.running_avg_g is None: self.running_avg_g = copy_G_params(self.generator) batch_size = real_image.size(0) c_ratio = 5 for _ in range(c_ratio): ### prepare data part z, c, c_idx = self.sample_z_and_c(batch_size, n_iter) g_img = self.generator(c=c, z=z) r_img = real_image.to(self.device) ### critic part self.critic.zero_grad() # pred_r, _ = self.critic(r_img) # pred_f, _ = self.critic(g_img.detach()) # get critic's `fake` loss fake_pred, _ = self.critic(g_img) fake_target = - torch.ones_like(fake_pred) fake_loss = self.c_criterion(fake_pred, fake_target) # get critic's `real` loss real_pred, _ = self.critic(r_img) real_target = torch.ones_like(real_pred) real_loss = self.c_criterion(real_pred, real_target) # mix `real` and `fake` melody realfake = self.alpha * r_img + (1. - self.alpha) * g_img # get critic's penalty realfake_pred, _ = self.critic(realfake) # print("realfake: ", realfake.shape) # print("realfake_pred: ", realfake_pred.shape) penalty = self.c_penalty(realfake, realfake_pred) # sum up losses closs = fake_loss + real_loss + 10 * penalty # retain graph closs.backward(retain_graph=True) # update critic parameters self.c_optimizer.step() # devide by number of critic updates in the loop (5) cfb_loss += fake_loss.item()/c_ratio crb_loss += real_loss.item()/c_ratio cpb_loss += 10* penalty.item()/c_ratio cb_loss += closs.item()/c_ratio ### prepare data part z, c, c_idx = self.sample_z_and_c(batch_size, n_iter) g_img = self.generator(c=c, z=z) r_img = real_image.to(self.device) ### Generator part self.generator.zero_grad() pred_g, _ = self.critic(g_img) loss_g = -pred_g.mean() loss_g.backward() self.g_optimizer.step() ### Mutual Information between c and c' Part self.generator.zero_grad() self.critic.zero_grad() z, c, c_idx = self.sample_z_and_c(batch_size, n_iter) g_img = self.generator(c=c, z=z) pred_g, pred_c_params = self.critic(g_img) # print("c, c_pred: ", c.shape, pred_c_params.shape) if self.prob_c: loss_g_recon_c = self.neg_log_density(c, pred_c_params).mean() else: loss_g_recon_c = F.l1_loss(pred_c_params, c) loss_g_onehot = torch.Tensor([0]).to(self.device) # if n_iter%2==0 and self.one_hot: # print("cp, c_idx: ", pred_c_params[:,:self.c_dim].shape, c_idx.shape) if n_iter%4==0 and self.one_hot: loss_g_onehot = 0.2*F.cross_entropy(pred_c_params[:,:self.c_dim], c_idx.view(-1)) elif n_iter%2==0 and self.one_hot: loss_g_onehot = 0.8*F.cross_entropy(pred_c_params[:,:self.c_dim], c_idx.view(-1)) loss_info = self.recon_weight * loss_g_recon_c + self.onehot_weight * loss_g_onehot loss_info.backward() self.opt_info.step() for p, avg_p in zip(self.generator.parameters(), self.running_avg_g): avg_p.mul_(0.999).add_(0.001, p.data) # print("losses: ", cfb_loss, crb_loss, cpb_loss, cb_loss, loss_g.item(), loss_g_onehot.item(), loss_g_recon_c.item()) return cfb_loss, crb_loss, cpb_loss, cb_loss, loss_g.item(), loss_g_onehot.item(), loss_g_recon_c.item() def train(self, dataloader, epochs=500, batch_size=64, display_epoch=10, device='cpu'): # alpha parameter for mixing images self.alpha = torch.rand((batch_size, 1, 1, 1, 1)).requires_grad_().to(device) for epoch in range(epochs): ge_loss, ce_loss = 0, 0 cfe_loss, cre_loss, cpe_loss, oe_loss, cse_loss = 0, 0, 0, 0, 0 start = time.time() bar = IncrementalBar(f'[Epoch {epoch+1}/{epochs}]', max=len(dataloader)) # print("epoch: ", epoch) for real in dataloader: # real: real image batch # print("real: ", real.shape) cfb_loss, crb_loss, cpb_loss, cb_loss, gb_loss, ob_loss, csb_loss = self.train_step(real, epoch) """ real = real.to(device) # train Critic cb_loss=0 cfb_loss, crb_loss, cpb_loss = 0, 0, 0 for _ in range(5): # create random `noises` cords = torch.randn(batch_size, 32).to(device) style = torch.randn(batch_size, 32).to(device) melody = torch.randn(batch_size, 4, 32).to(device) groove = torch.randn(batch_size, 4, 32).to(device) # forward to generator self.c_optimizer.zero_grad() with torch.no_grad(): fake = self.generator(cords, style, melody, groove).detach() # get critic's `fake` loss fake_pred, c_pred = self.critic(fake) fake_target = - torch.ones_like(fake_pred) fake_loss = self.c_criterion(fake_pred, fake_target) # get critic's `real` loss real_pred = self.critic(real) real_target = torch.ones_like(real_pred) real_loss = self.c_criterion(real_pred, real_target) # mix `real` and `fake` melody realfake = self.alpha * real + (1. - self.alpha) * fake # get critic's penalty realfake_pred = self.critic(realfake) penalty = self.c_penalty(realfake, realfake_pred) # sum up losses closs = fake_loss + real_loss + 10 * penalty # retain graph closs.backward(retain_graph=True) # update critic parameters self.c_optimizer.step() # devide by number of critic updates in the loop (5) cfb_loss += fake_loss.item()/5 crb_loss += real_loss.item()/5 cpb_loss += 10* penalty.item()/5 cb_loss += closs.item()/5 cfe_loss += cfb_loss/len(dataloader) cre_loss += crb_loss/len(dataloader) cpe_loss += cpb_loss/len(dataloader) ce_loss += cb_loss/len(dataloader) # train generator self.g_optimizer.zero_grad() # create random `noises` cords = torch.randn(batch_size, 32).to(device) style = torch.randn(batch_size, 32).to(device) melody = torch.randn(batch_size, 4, 32).to(device) groove = torch.randn(batch_size, 4, 32).to(device) # forward to
label=ugettext_lazy("Web Apps should use"), initial=None, required=False, choices=( ('stars', ugettext_lazy('Latest starred version')), ('nostars', ugettext_lazy('Highest numbered version (not recommended)')), ), help_text=ugettext_lazy("Choose whether Web Apps should use the latest starred build or highest numbered " "build in your application.") ) def __init__(self, *args, **kwargs): super(DomainMetadataForm, self).__init__(*args, **kwargs) if self.project.cloudcare_releases == 'default' or not domain_has_privilege(self.domain, privileges.CLOUDCARE): # if the cloudcare_releases flag was just defaulted, don't bother showing # this setting at all del self.fields['cloudcare_releases'] if not domain_has_privilege(self.domain, privileges.GEOCODER): del self.fields['default_geocoder_location'] def save(self, request, domain): res = DomainGlobalSettingsForm.save(self, request, domain) if not res: return False try: cloudcare_releases = self.cleaned_data.get('cloudcare_releases') if cloudcare_releases and domain.cloudcare_releases != 'default': # you're never allowed to change from default domain.cloudcare_releases = cloudcare_releases domain.save() return True except Exception as e: logging.exception("couldn't save project settings - error is %s" % e) return False def tuple_of_copies(a_list, blank=True): ret = [(item, item) for item in a_list] if blank: ret.insert(0, ('', '---')) return tuple(ret) class PrivacySecurityForm(forms.Form): restrict_superusers = BooleanField( label=ugettext_lazy("Restrict Dimagi Staff Access"), required=False, help_text=ugettext_lazy( "CommCare support staff sometimes require access " "to your project space to provide rapid, in-depth support. " "Checking this box will restrict the degree of support they " "will be able to provide in the event that you report an issue. " "You may also miss out on important communications and updates. " "Regardless of whether this option is checked, " "Commcare support staff will have access " "to your billing information and project metadata; " "and CommCare system administrators will also have direct access " "to data infrastructure strictly for the purposes of system administration " "as outlined in our " '<a href="https://www.dimagi.com/terms/latest/privacy/">Privacy Policy</a>.' ) ) secure_submissions = BooleanField( label=ugettext_lazy("Secure submissions"), required=False, help_text=ugettext_lazy(mark_safe( "Secure Submissions prevents others from impersonating your mobile workers." "This setting requires all deployed applications to be using secure " "submissions as well. " "<a href='https://help.commcarehq.org/display/commcarepublic/Project+Space+Settings'>" "Read more about secure submissions here</a>")) ) secure_sessions = BooleanField( label=ugettext_lazy("Shorten Inactivity Timeout"), required=False, help_text=ugettext_lazy("All web users on this project will be logged out after {} minutes " "of inactivity").format(settings.SECURE_TIMEOUT) ) secure_sessions_timeout = IntegerField( label=ugettext_lazy("Inactivity Timeout Length"), required=False, help_text=ugettext_lazy("Override the default {}-minute length of the inactivity timeout. Has no effect " "unless inactivity timeout is on. Note that when this is updated, users may need " "to log out and back in for it to take effect.").format(settings.SECURE_TIMEOUT) ) allow_domain_requests = BooleanField( label=ugettext_lazy("Web user requests"), required=False, help_text=ugettext_lazy("Allow unknown users to request web access to the domain."), ) hipaa_compliant = BooleanField( label=ugettext_lazy("HIPAA compliant"), required=False, ) two_factor_auth = BooleanField( label=ugettext_lazy("Two Factor Authentication"), required=False, help_text=ugettext_lazy("All users on this project will be required to enable two factor authentication") ) strong_mobile_passwords = BooleanField( label=ugettext_lazy("Require Strong Passwords for Mobile Workers"), required=False, help_text=ugettext_lazy("All mobile workers in this project will be required to have a strong password") ) ga_opt_out = BooleanField( label=ugettext_lazy("Disable Google Analytics"), required=False, ) def __init__(self, *args, **kwargs): user_name = kwargs.pop('user_name') domain = kwargs.pop('domain') super(PrivacySecurityForm, self).__init__(*args, **kwargs) self.helper = hqcrispy.HQFormHelper(self) self.helper[0] = twbscrispy.PrependedText('restrict_superusers', '') self.helper[1] = twbscrispy.PrependedText('secure_submissions', '') self.helper[2] = twbscrispy.PrependedText('secure_sessions', '') self.helper[3] = crispy.Field('secure_sessions_timeout') self.helper[4] = twbscrispy.PrependedText('allow_domain_requests', '') self.helper[5] = twbscrispy.PrependedText('hipaa_compliant', '') self.helper[6] = twbscrispy.PrependedText('two_factor_auth', '') self.helper[7] = twbscrispy.PrependedText('strong_mobile_passwords', '') self.helper[8] = twbscrispy.PrependedText('ga_opt_out', '') if not domain_has_privilege(domain, privileges.ADVANCED_DOMAIN_SECURITY): self.helper.layout.pop(8) self.helper.layout.pop(7) self.helper.layout.pop(6) if not HIPAA_COMPLIANCE_CHECKBOX.enabled(user_name): self.helper.layout.pop(5) if not SECURE_SESSION_TIMEOUT.enabled(domain): self.helper.layout.pop(3) if not domain_has_privilege(domain, privileges.ADVANCED_DOMAIN_SECURITY): self.helper.layout.pop(2) self.helper.all().wrap_together(crispy.Fieldset, 'Edit Privacy Settings') self.helper.layout.append( hqcrispy.FormActions( StrictButton( _("Update Privacy Settings"), type="submit", css_class='btn-primary', ) ) ) def save(self, domain): domain.restrict_superusers = self.cleaned_data.get('restrict_superusers', False) domain.allow_domain_requests = self.cleaned_data.get('allow_domain_requests', False) domain.secure_sessions = self.cleaned_data.get('secure_sessions', False) domain.secure_sessions_timeout = self.cleaned_data.get('secure_sessions_timeout', None) new_two_factor_auth_setting = self.cleaned_data.get('two_factor_auth', False) if domain.two_factor_auth != new_two_factor_auth_setting and MONITOR_2FA_CHANGES.enabled(domain.name): from corehq.apps.hqwebapp.utils import monitor_2fa_soft_assert status = "ON" if new_two_factor_auth_setting else "OFF" monitor_2fa_soft_assert(False, f'{domain.name} turned 2FA {status}') domain.two_factor_auth = new_two_factor_auth_setting domain.strong_mobile_passwords = self.cleaned_data.get('strong_mobile_passwords', False) secure_submissions = self.cleaned_data.get( 'secure_submissions', False) apps_to_save = [] if secure_submissions != domain.secure_submissions: for app in get_apps_in_domain(domain.name): if app.secure_submissions != secure_submissions: app.secure_submissions = secure_submissions apps_to_save.append(app) domain.secure_submissions = secure_submissions domain.hipaa_compliant = self.cleaned_data.get('hipaa_compliant', False) domain.ga_opt_out = self.cleaned_data.get('ga_opt_out', False) domain.save() if apps_to_save: apps = [app for app in apps_to_save if isinstance(app, Application)] remote_apps = [app for app in apps_to_save if isinstance(app, RemoteApp)] if apps: Application.bulk_save(apps) if remote_apps: RemoteApp.bulk_save(remote_apps) return True class DomainInternalForm(forms.Form, SubAreaMixin): sf_contract_id = CharField(label="Salesforce Contract ID", required=False) sf_account_id = CharField(label="Salesforce Account ID", required=False) initiative = forms.MultipleChoiceField(label="Initiative", widget=forms.CheckboxSelectMultiple(), choices=tuple_of_copies(DATA_DICT["initiatives"], blank=False), required=False) workshop_region = CharField( label="Workshop Region", required=False, help_text="e.g. US, LAC, SA, Sub-Saharan Africa, Southeast Asia, etc.") self_started = ChoiceField( label="Self Started?", choices=tf_choices('Yes', 'No'), required=False, help_text=( "The organization built and deployed their app themselves. Dimagi may have provided indirect support" )) is_test = ChoiceField( label="Real Project", choices=(('none', 'Unknown'), ('true', 'Test'), ('false', 'Real'),) ) area = ChoiceField( label="Sector*", required=False, choices=tuple_of_copies(AREA_CHOICES)) sub_area = ChoiceField( label="Sub-Sector*", required=False, choices=tuple_of_copies(SUB_AREA_CHOICES)) organization_name = CharField( label="Organization Name*", required=False, help_text="Quick 1-2 sentence summary of the project.", ) notes = CharField(label="Notes*", required=False, widget=forms.Textarea) phone_model = CharField( label="Device Model", help_text="Add Web Apps, if this project is using Web Apps as well", required=False, ) business_unit = forms.ChoiceField( label='Business Unit', choices=tuple_of_copies(BUSINESS_UNITS), required=False, ) countries = forms.MultipleChoiceField( label="Countries", choices=sorted(list(COUNTRIES.items()), key=lambda x: x[0]), required=False, ) commtrack_domain = ChoiceField( label="CommCare Supply Project", choices=tf_choices('Yes', 'No'), required=False, help_text="This app aims to improve the supply of goods and materials" ) performance_threshold = IntegerField( label="Performance Threshold", required=False, help_text=( 'The number of forms submitted per month for a user to count as "performing well". ' 'The default value is 15.' ) ) experienced_threshold = IntegerField( label="Experienced Threshold", required=False, help_text=( "The number of different months in which a worker must submit forms to count as experienced. " "The default value is 3." ) ) amplifies_workers = ChoiceField( label="Service Delivery App", choices=[(AMPLIFIES_NOT_SET, '* Not Set'), (AMPLIFIES_YES, 'Yes'), (AMPLIFIES_NO, 'No')], required=False, help_text=("This application is used for service delivery. Examples: An " "FLW who uses CommCare to improve counseling and screening of pregnant women. " "An FLW that uses CommCare Supply to improve their supply of medicines. A teacher " "who uses CommCare to assess and improve students' performance." ) ) amplifies_project = ChoiceField( label="Amplifies Project", choices=[(AMPLIFIES_NOT_SET, '* Not Set'), (AMPLIFIES_YES, 'Yes'), (AMPLIFIES_NO, 'No')], required=False, help_text=("Amplifies the impact of a Frontline Program (FLP). " "Examples: Programs that use M&E data collected by CommCare. " "Programs that use CommCare data to make programmatic decisions." ) ) data_access_threshold = IntegerField( label="Minimum Monthly Data Accesses", required=False, help_text=( "Minimum number of times project staff are expected to access CommCare data each month. " "The default value is 20." ) ) partner_technical_competency = IntegerField( label="Partner Technical Competency", required=False, min_value=1, max_value=5, help_text=( "Please rate the technical competency of the partner on a scale from " "1 to 5. 1 means low-competency, and we should expect LOTS of basic " "hand-holding. 5 means high-competency, so if they report a bug it's " "probably a real issue with CommCareHQ or a really good idea." ), ) support_prioritization = IntegerField( label="Support Prioritization", required=False, min_value=1, max_value=3, help_text=( "Based on the impact of this project and how good this partner was " "to work with, how much would you prioritize support for this " 'partner? 1 means "Low. Take your time." You might rate a partner ' '"1" because they\'ve been absolutely terrible to you and low impact. ' '3 means "High priority. Be nice". You might rate a partner "3" ' "because even though they can't afford a PRO plan, you know they " "are changing the world. Or they are an unusually high priority " "strategic partner." ), ) gs_continued_involvement = ChoiceField( label="GS Continued Involvement", choices=[(AMPLIFIES_NOT_SET, '* Not Set'), (AMPLIFIES_YES, 'Yes'), (AMPLIFIES_NO, 'No')], required=False, help_text=( "Do you want to continue to be involved in this project? No, please " "only reach out if absolutely necessary. Yes. I want to see what " "happens and be kept in the loop." ), ) technical_complexity = ChoiceField( label="Technical Complexity", choices=[(AMPLIFIES_NOT_SET, '* Not Set'), (AMPLIFIES_YES, 'Yes'), (AMPLIFIES_NO, 'No')], required=False, help_text=( "Is this an innovation project involving unusual technology which" "we expect will require different support than a typical deployment?" ), ) app_design_comments = CharField( label="App Design Comments", widget=forms.Textarea, required=False, help_text=(
peridural, durante o puerpério'), ('O89.6', 'Falha na ou dificuldade de entubação, durante o puerpério'), ('O89.8', 'Outras complicações da anestesia durante o puerpério'), ('O89.9', 'Complicação devida a anestesia, durante o puerpério, não especificada'), ('O90.0', 'Ruptura da incisão de cesariana'), ('O90.1', 'Ruptura da incisão obstétrica, no períneo'), ('O90.2', 'Hematoma da incisão obstétrica'), ('O90.3', 'Cardiomiopatia no puerpério'), ('O90.4', 'Insuficiência renal aguda do pós-parto'), ('O90.5', 'Tireoidite do pós-parto'), ('O90.8', 'Outras complicações do puerpério, não classificadas em outra parte'), ('O90.9', 'Complicação do puerpério não especificada'), ('O91.0', 'Infecção do mamilo associada ao parto'), ('O91.1', 'Abscesso da mama associada ao parto'), ('O91.2', 'Mastite não purulenta associada ao parto'), ('O92.0', 'Mamilo retraído associado ao parto'), ('O92.1', 'Fissuras do mamilo associadas ao parto'), ('O92.2', 'Outras afecções da mama, e as não especificadas, associadas ao parto'), ('O92.3', 'Agalactia'), ('O92.4', 'Hipogalactia'), ('O92.5', 'Suspensão da lactação'), ('O92.6', 'Galactorréia'), ('O92.7', 'Outros distúrbios da lactação e os não especificados'), ('O95', ' Morte obstétrica de causa não especificada'), ('O96', ' Morte, por qualquer causa obstétrica, que ocorre mais de 42 dias, mas menos de 1 ano, após o parto'), ('O97', ' Morte por seqüelas de causas obstétricas diretas'), ('O98.0', 'Tuberculose complicando a gravidez, o parto e o puerpério'), ('O98.1', 'Sífilis complicando a gravidez, o parto e o puerpério'), ('O98.2', 'Gonorréia complicando a gravidez, o parto e o puerpério'), ('O98.3', 'Outras infecções em que a via de transmissão é predominantemente sexual, complicando a gravidez, o parto e o puerpério'), ('O98.4', 'Hepatite viral complicando a gravidez, o parto e o puerpério'), ('O98.5', 'Outras doenças virais complicando a gravidez, o parto e o puerpério'), ('O98.6', 'Doenças causadas por protozoários complicando a gravidez, o parto e o puerpério'), ('O98.8', 'Outras doenças infecciosas e parasitárias maternas complicando a gravidez, o parto e o puerpério'), ('O98.9', 'Doenças infecciosas e parasitárias maternas, não especificadas, complicando a gravidez, o parto e o puerpério'), ('O99.0', 'Anemia complicando a gravidez, o parto e o puerpério'), ('O99.1', 'Outras doenças do sangue e dos órgãos hematopoéticos e alguns transtornos que comprometem o sistema imunológico, complicando a gravidez, o parto e o puerpério'), ('O99.2', 'Doenças endócrinas, nutricionais e metabólicas complicando a gravidez, o parto e o puerpério'), ('O99.3', 'Transtornos mentais e doenças do sistema nervoso complicando a gravidez, o parto e o puerpério'), ('O99.4', 'Doenças do aparelho circulatório complicando a gravidez, o parto e o puerpério'), ('O99.5', 'Doenças do aparelho respiratório complicando a gravidez, o parto e o puerpério'), ('O99.6', 'Doenças do aparelho digestivo complicando a gravidez, o parto e o puerpério'), ('O99.7', 'Doenças da pele e do tecido subcutâneo complicando a gravidez, o parto e o puerpério'), ('O99.8', 'Outras doenças e afecções especificadas complicando a gravidez, o parto e o puerpério'), ('P00.0', 'Feto e recém-nascido afetados por transtornos maternos hipertensivos'), ('P00.1', 'Feto e recém-nascido afetados por doenças maternas renais e das vias urinárias'), ('P00.2', 'Feto e recém-nascido afetados por doenças infecciosas e parasitárias da mãe'), ('P00.3', 'Feto e recém-nascido afetados por outras doenças circulatórias e respiratórias maternas'), ('P00.4', 'Feto e recém-nascido afetados por transtornos nutricionais maternos'), ('P00.5', 'Feto e recém-nascido afetados por traumatismo materno'), ('P00.6', 'Feto e recém-nascido afetados por intervenção cirúrgica na mãe'), ('P00.7', 'Feto e recém-nascido afetados por outros procedimentos médicos na mãe, não classificados em outra parte'), ('P00.8', 'Feto e recém-nascido afetados por outras afecções maternas'), ('P00.9', 'Feto e recém-nascido afetados por afecção materna não especificada'), ('P01.0', 'Feto e recém-nascido afetados por incompetência do colo uterino'), ('P01.1', 'Feto e recém-nascido afetados por ruptura prematura das membranas'), ('P01.2', 'Feto e recém-nascido afetados por oligohidrâmnio'), ('P01.3', 'Feto e recém-nascido afetados por polihidrâmnio'), ('P01.4', 'Feto e recém-nascido afetados por gravidez ectópica'), ('P01.5', 'Feto e recém-nascido afetados por gravidez múltipla'), ('P01.6', 'Feto e recém-nascido afetados por morte materna'), ('P01.7', 'Feto e recém-nascido afetados por apresentação anormal antes do trabalho de parto'), ('P01.8', 'Feto e recém-nascido afetados por outras complicações maternas da gravidez'), ('P01.9', 'Feto e recém-nascido afetados por afecções maternas da gravidez, não especificadas'), ('P02.0', 'Feto e recém-nascido afetados por placenta prévia'), ('P02.1', 'Feto e recém-nascido afetados por outras formas de descolamento da placenta e hemorragia'), ('P02.2', 'Feto e recém-nascido afetados por outras anormalidades morfológicas e funcionais da placenta e as não especificadas'), ('P02.3', 'Feto e recém-nascido afetados por síndromes de transfusão placentária'), ('P02.4', 'Feto e recém-nascido afetados por prolapso de cordão umbilical'), ('P02.5', 'Feto e recém-nascido afetados por outras compressões do cordão umbilical'), ('P02.6', 'Feto e recém-nascido afetados por outras afecções do cordão umbilical e as não especificadas'), ('P02.7', 'Feto e recém-nascido afetados por corioamnionite'), ('P02.8', 'Feto e recém-nascido afetados por outras anormalidades das membranas'), ('P02.9', 'Feto e recém-nascido afetados por anormalidade não especificada das membranas'), ('P03.0', 'Feto e recém-nascido afetados por parto e extração pélvicas'), ('P03.1', 'Feto e recém-nascido afetados por outras apresentações anormais, má-posições e desproporções durante o trabalho de parto e o parto'), ('P03.2', 'Feto e recém-nascido afetados por parto por fórceps'), ('P03.3', 'Feto e recém-nascido afetados por parto por vácuo-extrator [ventosa]'), ('P03.4', 'Feto e recém-nascido afetados por parto por cesariana'), ('P03.5', 'Feto e recém-nascido afetados por parto precipitado'), ('P03.6', 'Feto e recém-nascido afetados por contrações uterinas anormais'), ('P03.8', 'Feto e recém-nascido afetados por outras complicações especificadas do trabalho de parto e do parto'), ('P03.9', 'Feto e recém-nascido afetados por complicações não especificadas do trabalho de parto e do parto'), ('P04.0', 'Feto e recém-nascido afetados por anestesia e analgesia materna durante a gravidez, trabalho de parto e parto'), ('P04.1', 'Feto e recém-nascido afetados por outros medicamentos utilizados pela mãe'), ('P04.2', 'Feto e recém-nascido afetados pelo uso de fumo pela mãe'), ('P04.3', 'Feto e recém-nascido afetados pelo uso de álcool pela mãe'), ('P04.4', 'Feto e recém-nascido afetados pelo uso de drogas que causam dependência pela mãe'), ('P04.5', 'Feto e recém-nascido afetados por uso materno de substâncias químicas dos alimentos'), ('P04.6', 'Feto e recém-nascido afetados pela exposição da mãe a substâncias químicas do meio ambiente'), ('P04.8', 'Feto e recém-nascido afetados por outras influências nocivas maternas'), ('P04.9', 'Feto e recém-nascido afetados por influências nocivas maternas não especificadas'), ('P05.0', 'Recém-nascido de baixo peso para a idade gestacional'), ('P05.1', 'Pequeno para a idade gestacional'), ('P05.2', 'Desnutrição fetal sem menção de peso e comprimento baixos para a idade gestacional'), ('P05.9', 'Retardo não especificado do crescimento fetal'), ('P07.0', 'Recém-nascido com peso muito baixo'), ('P07.1', 'Outros recém-nascidos de peso baixo'), ('P07.2', 'Imaturidade extrema'), ('P07.3', 'Outros recém-nascidos de pré-termo'), ('P08.0', 'Recém-nascido de tamanho excessivamente grande'), ('P08.1', 'Outros recém-nascidos grandes para a idade gestacional'), ('P08.2', 'Recém-nascido pós-termo, não-grande para a idade gestacional'), ('P10.0', 'Hemorragia subdural devida a traumatismo de parto'), ('P10.1', 'Hemorragia cerebral devida a traumatismo de parto'), ('P10.2', 'Hemorragia intraventricular devida a traumatismo de parto'), ('P10.3', 'Hemorragia subaracnoídea devida a traumatismo de parto'), ('P10.4', 'Ruptura tentorial devida a traumatismo de parto'), ('P10.8', 'Outras lacerações e hemorragias intracranianas devidas a traumatismo de parto'), ('P10.9', 'Laceração e hemorragia intracranianas não especificadas devidas a traumatismo de parto'), ('P11.0', 'Edema cerebral devido a traumatismo de parto'), ('P11.1', 'Outras lesões cerebrais especificadas devidas a traumatismo de parto'), ('P11.2', 'Lesão cerebral não especificada devida a traumatismo de parto'), ('P11.3', 'Traumatismo de parto do nervo facial'), ('P11.4', 'Traumatismo de parto de outros nervos cranianos'), ('P11.5', 'Traumatismo de parto da coluna e da medula espinhal'), ('P11.9', 'Traumatismo de parto não especificado do sistema nervoso central'), ('P12.0', 'Céfalo-hematoma devido a traumatismo de parto'), ('P12.1', '"Chignon" devido a traumatismo de parto'), ('P12.2', 'Hemorragia subaponeurótica epicraniana devida a traumatismo de parto'), ('P12.3', 'Esmagamento do couro cabeludo devido a traumatismo de parto'), ('P12.4', 'Lesão por monitorização do couro cabeludo do recém-nascido'), ('P12.8', 'Outras lesões do couro cabeludo devidas a traumatismo de parto'), ('P12.9', 'Lesão não especificada do couro cabeludo devida a traumatismo de parto'), ('P13.0', 'Fratura de crânio devida a traumatismo de parto'), ('P13.1', 'Outras lesões cranianas devidas a traumatismo de parto'), ('P13.2', 'Lesão do fêmur devida a traumatismo de parto'), ('P13.3', 'Lesão de outros ossos longos devida a traumatismo de parto'), ('P13.4', 'Fratura da clavícula devida a traumatismo de parto'), ('P13.8', 'Lesões de outras partes do esqueleto devidas a traumatismo de parto'), ('P13.9', 'Lesões não especificadas do esqueleto devidas a traumatismo de parto'), ('P14.0', 'Paralisia de Erb devida a traumatismo de parto'), ('P14.1', 'Paralisia de Klumpke devida a traumatismo de parto'), ('P14.2', 'Paralisia do nervo frênico devida a traumatismo de parto'), ('P14.3', 'Outras lesões do plexo braquial devidas a traumatismo de parto'), ('P14.8', 'Outras lesões de outras partes do sistema nervoso periférico devidas a traumatismo de parto'), ('P14.9', 'Lesão não especificada do sistema nervoso periférico devida a traumatismo de parto'), ('P15.0', 'Lesão do fígado devida a traumatismo de parto'), ('P15.1', 'Lesão do baço devida a traumatismo de parto'), ('P15.2', 'Lesão do esternomastóide devida a traumatismo de parto'), ('P15.3', 'Lesão dos olhos devida a traumatismo de parto'), ('P15.4', 'Lesão da face ao nascer'), ('P15.5', 'Lesão dos órgãos
self._state_a.change_state(data, False) if self._pipe_condition_mask: return condition_mask return changed class ChangeStateConditionalTransition(_Transition, ConditionalMixin): """ Change a state where external condition is true Parameters: name: str state_a: Union[_State, Tuple[_State, Union[bool, Callable[[DataDict, TCondition], np.ndarray]]] State to change. Can either be a `_State`, in which case the state will be set to true or a tuple, where the second item is the value the state should be set to or a Callable returning the value. condition: TCondition pipe_condition_mask: bool If true, the call to this transition will return a boolean `np.ndarray` encoding the rows for which `condition` is True. """ _state_a: _State _state_a_val: bool def __init__( self, name: str, state_a: Union[ _State, Tuple[ _State, Union[bool, Callable[[DataDict, TCondition], np.ndarray]] ] ], condition: TCondition = None, pipe_condition_mask: bool = False, *args, **kwargs, ): _Transition.__init__(self, name, pipe_condition_mask, *args, **kwargs) ConditionalMixin.__init__(self, condition, *args, **kwargs) if isinstance(state_a, tuple): self._state_a = state_a[0] self._state_a_val = state_a[1] else: self._state_a = state_a self._state_a_val = True @log_call def __call__( self, data: DataDict, condition_mask: Optional[np.ndarray] = None) -> np.ndarray: """ Perform the transition. All rows in data which are in state A and for which the external condition is true are transitioned to a new value. Parameters: data: DataDict condition_mask: Optional[np.ndarray] Additional condition in form of a boolean np.ndarray. """ cond = self.unify_condition(data) if condition_mask is not None: cond = cond & condition_mask if callable(self._state_a_val): parsed_val = self._state_a_val(data, cond & self._state_a(data)) else: parsed_val = self._state_a_val changed = self._state_a.change_state(data, parsed_val, cond) if self._pipe_condition_mask: return condition_mask return changed class ConditionalTransition(_Transition, ConditionalMixin): """ Perform a transition from state_a to state_b where an external condition is true Parameters: name: str state_a: _State state_b: _State condition: TCondition, pipe_condition_mask: bool If true, the call to this transition will return a boolean `np.ndarray` encoding the rows for which `condition` is True. """ def __init__( self, name: str, state_a: _State, state_b: _State, condition: TCondition, pipe_condition_mask: bool = False, *args, **kwargs, ): _Transition.__init__(self, name, pipe_condition_mask, *args, **kwargs) ConditionalMixin.__init__(self, condition, *args, **kwargs) self._state_a = state_a self._state_b = state_b @log_call def __call__( self, data: DataDict, condition_mask: Optional[np.ndarray] = None) -> np.ndarray: cond = self.unify_condition(data) if condition_mask is not None: cond = cond & condition_mask (~self._state_b).change_state(data, True, cond & self._state_a(data)) changed = self._state_a.change_state(data, False, cond) if self._pipe_condition_mask: return condition_mask return changed class DecreaseTimerTransition(_Transition, ConditionalMixin): """ Decrease the value of a FloatState by one Parameters: name: str state_a: FloatState condition: Optional[TCondition], pipe_condition_mask: bool If true, the call to this transition will return a boolean `np.ndarray` encoding the rows for which `condition` is True. """ def __init__( self, name: str, state_a: FloatState, condition: TCondition = None, pipe_condition_mask: bool = False, *args, **kwargs, ): _Transition.__init__(self, name, pipe_condition_mask, *args, **kwargs) ConditionalMixin.__init__(self, condition, *args, **kwargs) self._state_a = state_a @log_call def __call__( self, data: DataDict, condition_mask: Optional[np.ndarray] = None) -> np.ndarray: cond = self.unify_condition(data) if condition_mask is not None: cond = cond & condition_mask state_condition = self._state_a(data) # Current state value cur_state = self._state_a.get_state_value(data)[cond & state_condition] changed = self._state_a.change_state(data, cur_state - 1, cond) if self._pipe_condition_mask: return condition_mask return changed class IncreaseTimerTransition(_Transition, ConditionalMixin): """ Increase the value of a FloatState by one Parameters: name: str state_a: FloatState condition: Optional[TCondition], pipe_condition_mask: bool If true, the call to this transition will return a boolean `np.ndarray` encoding the rows for which `condition` is True. """ def __init__( self, name: str, state_a: FloatState, condition: TCondition = None, pipe_condition_mask = False, *args, **kwargs, ): _Transition.__init__(self, name, pipe_condition_mask, *args, **kwargs) ConditionalMixin.__init__(self, condition, *args, **kwargs) self._state_a = state_a @log_call def __call__( self, data: DataDict, condition_mask: Optional[np.ndarray] = None) -> np.ndarray: cond = self.unify_condition(data) if condition_mask is not None: cond = cond & condition_mask state_condition = self._state_a(data) # Current state value cur_state = self._state_a.get_state_value(data)[cond & state_condition] changed = self._state_a.change_state(data, cur_state + 1, cond) if self._pipe_condition_mask: return condition_mask return changed class InitializeTimerTransition(_Transition, ConditionalMixin): """ Initialize a timer state to values drawn from a PDF Parameters: name: str state_a: FloatState initialization_pdf: Optional[PDF] This pdf is used to initialize the state values upon activation. condition: Optional[TCondition] pipe_condition_mask: bool If true, the call to this transition will return a boolean `np.ndarray` encoding the rows for which `condition` is True. stateful_init_func: Optional[ Callable[[DataDict, np.ndarray], np.ndarray]] Supply a Callable that takes a DataDict as first and a boolean mask encoding the inactive states as second argument when `initialization_pdf` is None. The callable will be used to initialize the state. """ def __init__( self, name: str, state_a: FloatState, initialization_pdf: Optional[PDF] = None, condition: TCondition = None, pipe_condition_mask: bool = False, stateful_init_func: Callable[[DataDict, np.ndarray], np.ndarray]=None, log=False, *args, **kwargs, ): _Transition.__init__(self, name, *args, **kwargs) ConditionalMixin.__init__(self, condition) self._state_a = state_a if initialization_pdf is None and stateful_init_func is None: raise ValueError( "Must either supply initialization_pdf or stateful_init_func") if initialization_pdf is not None and stateful_init_func is not None: raise ValueError( "Supply only one of initialization_pdf or stateful_init_func") self._initialization_pdf = initialization_pdf self._stateful_init_func = stateful_init_func self._log = log @log_call def __call__( self, data: DataDict, condition_mask: Optional[np.ndarray] = None) -> np.ndarray: cond = self.unify_condition(data) if condition_mask is not None: cond = cond & condition_mask # Rows which are currently 0 zero_rows = (~self._state_a(data)) & cond num_zero_rows = zero_rows.sum(axis=0) if self._initialization_pdf is not None: initial_vals = self._initialization_pdf.rvs(num_zero_rows) else: initial_vals = self._stateful_init_func(data, zero_rows) # print(len(initial_vals), (~self._state_a(data)).sum()) changed = (~self._state_a).change_state(data, initial_vals, cond) if self._log: print(self._name) # print("Nonzero cond ", np.nonzero(condition_mask)) if np.any(np.nonzero(cond)[0] == 0): print("Time until second ", data["time_until_second_test"][0]) if self._pipe_condition_mask: return condition_mask return changed class InitializeCounterTransition(_Transition, ConditionalMixin): """ Initialize a counter state Parameters: name: str state_a: FloatState start: int condition: Optional[TCondition] """ def __init__( self, name: str, state_a: FloatState, start: int = 0, condition: TCondition = None, pipe_condition_mask: bool = False, *args, **kwargs, ): _Transition.__init__(self, name, *args, **kwargs) ConditionalMixin.__init__(self, condition) self._state_a = state_a self._start = start self._pipe_condition_mask = pipe_condition_mask @log_call def __call__( self, data: DataDict, condition_mask: Optional[np.ndarray] = None) -> np.ndarray: cond = self.unify_condition(data) if condition_mask is not None: cond = cond & condition_mask initial_vals = self._start # Initializes counter at 1 changed = (~self._state_a).change_state(data, initial_vals, cond) if self._pipe_condition_mask: return condition_mask return changed class MultiStateConditionalTransition(_Transition, ConditionalMixin): """ Perform a transition from state_a to multiple other states Parameters: name: str state_a: Union[_State, Tuple[_State, bool]] State to change. Can either be a `_State`, in which case the state will be set to true or a Tuple[_State, bool], where the second item is the value the state should be set to. states_b: List[Union[_State, Tuple[_State, bool]]] List of states to change. Can either be a `_State`, in which case the state will be set to true or a Tuple[_State, bool], where the second item is the value the state should be set to. """ _states_b: List[_State] _states_b_vals: List[bool] def __init__( self, name: str, state_a: Union[ _State, Tuple[_State, bool], Tuple[_State, Callable[[DataDict, np.ndarray], np.ndarray]] ], states_b: List[Union[_State, Tuple[_State, bool]]], condition: TCondition, pipe_condition_mask: bool = False, *args, **kwargs, ): _Transition.__init__(self, name, *args, **kwargs) ConditionalMixin.__init__(self, condition, *args, **kwargs) self._pipe_condition_mask = pipe_condition_mask if isinstance(state_a, tuple): self._state_a = state_a[0] self._state_a_val = state_a[1] else: self._state_a = state_a self._state_a_val = False self._states_b = [] self._states_b_vals = [] for state in states_b: if isinstance(state, tuple): self._states_b.append(state[0]) self._states_b_vals.append(state[1]) else: self._states_b.append(state) self._states_b_vals.append(True) @log_call def __call__( self, data: DataDict, condition_mask: Optional[np.ndarray] = None): cond = self.unify_condition(data) if condition_mask is not None: cond = cond & condition_mask is_in_state_a = self._state_a(data) cond_and_a = cond & is_in_state_a for state, val in zip(self._states_b, self._states_b_vals): if callable(val): parsed_val = val(data, cond_and_a) else: parsed_val = val (~state).change_state(data, parsed_val, cond_and_a) changed = self._state_a.change_state(data, self._state_a_val, cond) if self._pipe_condition_mask: return condition_mask return changed class TransitionChain(ConditionalMixin): def __init__( self, name: str, transitions: List[_Transition], carry_condition: bool = True, loop_until: Optional[TCondition] = None, *args, **kwargs, ): ConditionalMixin.__init__(self, loop_until, *args, **kwargs) self._name = name self._transitions = transitions self._carry_condition = carry_condition def __call__(self, data: DataDict) -> np.ndarray: changed = None loopcnt = 0 while True: for transition in self._transitions: try: if self._carry_condition: changed = transition(data, changed) else: transition(data) except Exception as e: print("Caught exception in transition: ", transition.name) raise e cond = self.unify_condition(data) if ~np.any(cond) or self._condition is None: break loopcnt += 1 @property def name(self): return self._name class
Machine.objects.filter(machine_group=machine_group).filter(deployed=deployed) else: machines = Machine.objects.none() # send the machines and the data to the plugin for plugin in manager.getAllPlugins(): if plugin.name == pluginName: (machines, title) = plugin.plugin_object.filter_machines(machines, data) return machines, title # Table ajax for dataTables @login_required def tableajax(request, pluginName, data, page='front', theID=None): # Pull our variables out of the GET request get_data = request.GET['args'] get_data = json.loads(get_data.decode('string_escape')) draw = get_data.get('draw', 0) start = int(get_data.get('start', 0)) length = int(get_data.get('length', 0)) search_value = '' if 'search' in get_data: if 'value' in get_data['search']: search_value = get_data['search']['value'] # default ordering order_column = 2 order_direction = 'desc' order_name = '' if 'order' in get_data: order_column = get_data['order'][0]['column'] order_direction = get_data['order'][0]['dir'] for column in get_data.get('columns', None): if column['data'] == order_column: order_name = column['name'] break if pluginName == 'Status' and data == 'undeployed_machines': deployed = False else: deployed = True (machines, title) = plugin_machines(request, pluginName, data, page, theID) # machines = machines.filter(deployed=deployed) if len(order_name) != 0: if order_direction == 'desc': order_string = "-%s" % order_name else: order_string = "%s" % order_name if len(search_value) != 0: searched_machines = machines.filter(Q(hostname__icontains=search_value) | Q(console_user__icontains=search_value) | Q(last_checkin__icontains=search_value)).order_by(order_string) else: searched_machines = machines.order_by(order_string) limited_machines = searched_machines[start:(start+length)] return_data = {} return_data['draw'] = int(draw) return_data['recordsTotal'] = machines.count() return_data['recordsFiltered'] = machines.count() return_data['data'] = [] settings_time_zone = None try: settings_time_zone = pytz.timezone(settings.TIME_ZONE) except: pass for machine in limited_machines: if machine.last_checkin: #formatted_date = pytz.utc.localize(machine.last_checkin) if settings_time_zone: formatted_date = machine.last_checkin.astimezone(settings_time_zone).strftime("%Y-%m-%d %H:%M %Z") else: formatted_date = machine.last_checkin.strftime("%Y-%m-%d %H:%M") else: formatted_date = "" hostname_link = "<a href=\"%s\">%s</a>" % (reverse('machine_detail', args=[machine.id]), machine.hostname) list_data = [hostname_link, machine.console_user, formatted_date] return_data['data'].append(list_data) return JsonResponse(return_data) # Plugin machine list @login_required def machine_list(request, pluginName, data, page='front', theID=None): (machines, title) = plugin_machines(request, pluginName, data, page, theID, get_machines=False) user = request.user c = {'user':user, 'plugin_name': pluginName, 'machines': machines, 'req_type': page, 'title': title, 'bu_id': theID, 'request':request, 'data':data } return render(request, 'server/overview_list_all.html', c) # Plugin machine list @login_required def plugin_load(request, pluginName, page='front', theID=None): user = request.user title = None # Build the manager manager = PluginManager() # Tell it the default place(s) where to find plugins manager.setPluginPlaces([settings.PLUGIN_DIR, os.path.join(settings.PROJECT_DIR, 'server/plugins')]) # Load all plugins manager.collectPlugins() # get a list of machines (either from the BU or the group) if page == 'front': # get all machines if user.userprofile.level == 'GA': machines = Machine.deployed_objects.all() else: machines = Machine.objects.none() for business_unit in user.businessunit_set.all(): for group in business_unit.machinegroup_set.all(): machines = machines | group.machine_set.all().filter(deployed=True) if page == 'bu_dashboard': # only get machines for that BU # Need to make sure the user is allowed to see this business_unit = get_object_or_404(BusinessUnit, pk=theID) machine_groups = MachineGroup.objects.filter(business_unit=business_unit).all() machines = Machine.deployed_objects.filter(machine_group__in=machine_groups) if page == 'group_dashboard': # only get machines from that group machine_group = get_object_or_404(MachineGroup, pk=theID) # check that the user has access to this machines = Machine.deployed_objects.filter(machine_group=machine_group) if page =='machine_detail': machines = Machine.objects.get(pk=theID) # send the machines and the data to the plugin for plugin in manager.getAllPlugins(): if plugin.name == pluginName: html = plugin.plugin_object.widget_content(page, machines, theID) return HttpResponse(html) @login_required def report_load(request, pluginName, page='front', theID=None): user = request.user title = None business_unit = None machine_group = None # Build the manager manager = PluginManager() # Tell it the default place(s) where to find plugins manager.setPluginPlaces([settings.PLUGIN_DIR, os.path.join(settings.PROJECT_DIR, 'server/plugins')]) # Load all plugins manager.collectPlugins() # get a list of machines (either from the BU or the group) if page == 'front': # get all machines if user.userprofile.level == 'GA': machines = Machine.deployed_objects.all() else: machines = Machine.objects.none() for business_unit in user.businessunit_set.all(): for group in business_unit.machinegroup_set.all(): machines = machines | group.machine_set.all().filter(deployed=True) if page == 'bu_dashboard': # only get machines for that BU # Need to make sure the user is allowed to see this business_unit = get_object_or_404(BusinessUnit, pk=theID) machine_groups = MachineGroup.objects.filter(business_unit=business_unit).all() machines = Machine.deployed_objects.filter(machine_group=machine_groups) if page == 'group_dashboard': # only get machines from that group machine_group = get_object_or_404(MachineGroup, pk=theID) # check that the user has access to this machines = Machine.deployed_objects.filter(machine_group=machine_group) if page =='machine_detail': machines = Machine.objects.get(pk=theID) output = '' # send the machines and the data to the plugin for plugin in manager.getAllPlugins(): if plugin.name == pluginName: output = plugin.plugin_object.widget_content(page, machines, theID) reports = [] enabled_reports = Report.objects.all() for enabled_report in enabled_reports: for plugin in manager.getAllPlugins(): if enabled_report.name == plugin.name: # If plugin_type isn't set, it can't be a report try: plugin_type = plugin.plugin_object.plugin_type() except: plugin_type = 'widget' if plugin_type == 'report': data = {} data['name'] = plugin.name data['title'] = plugin.plugin_object.get_title() reports.append(data) break c = {'user': request.user, 'output': output, 'page':page, 'business_unit': business_unit, 'machine_group': machine_group, 'reports': reports} return render(request, 'server/display_report.html', c) class Echo(object): """An object that implements just the write method of the file-like interface. """ def write(self, value): """Write the value by returning it, instead of storing in a buffer.""" return value def get_csv_row(machine, facter_headers, condition_headers, plugin_script_headers): row = [] for name, value in machine.get_fields(): if name != 'id' and name !='machine_group' and name != 'report' and name != 'activity' and name != 'os_family' and name != 'install_log' and name != 'install_log_hash': try: row.append(utils.safe_unicode(value)) except: row.append('') row.append(machine.machine_group.business_unit.name) row.append(machine.machine_group.name) return row def stream_csv(header_row, machines, facter_headers, condition_headers, plugin_script_headers): # Helper function to inject headers if header_row: yield header_row for machine in machines: yield get_csv_row(machine, facter_headers, condition_headers, plugin_script_headers) @login_required def export_csv(request, pluginName, data, page='front', theID=None): user = request.user title = None # Build the manager manager = PluginManager() # Tell it the default place(s) where to find plugins manager.setPluginPlaces([settings.PLUGIN_DIR, os.path.join(settings.PROJECT_DIR, 'server/plugins')]) # Load all plugins manager.collectPlugins() if pluginName == 'Status' and data == 'undeployed_machines': deployed = False else: deployed = True # get a list of machines (either from the BU or the group) if page == 'front': # get all machines if user.userprofile.level == 'GA': # machines = Machine.objects.all().prefetch_related('facts','conditions','pluginscriptsubmission_set','pluginscriptsubmission_set__pluginscriptrow_set') machines = Machine.objects.all().filter(deployed=deployed).defer('report','activity','os_family','install_log', 'install_log_hash') else: machines = Machine.objects.none().defer('report','activity','os_family','install_log', 'install_log_hash') for business_unit in user.businessunit_set.all(): for group in business_unit.machinegroup_set.all(): machines = machines | group.machine_set.all().filter(deployed=deployed) if page == 'bu_dashboard': # only get machines for that BU # Need to make sure the user is allowed to see this business_unit = get_object_or_404(BusinessUnit, pk=theID) machine_groups = MachineGroup.objects.filter(business_unit=business_unit).prefetch_related('machine_set').all() if machine_groups.count() != 0: machines = machine_groups[0].machine_set.all() for machine_group in machine_groups[1:]: machines = machines | machine_group.machine_set.all().filter(deployed=deployed).defer('report','activity','os_family','install_log', 'install_log_hash') else: machines = None if page == 'group_dashboard': # only get machines from that group machine_group = get_object_or_404(MachineGroup, pk=theID) # check that the user has access to this # machines = Machine.objects.filter(machine_group=machine_group).prefetch_related('facts','conditions','pluginscriptsubmission_set','pluginscriptsubmission_set__pluginscriptrow_set') machines = Machine.objects.filter(machine_group=machine_group).filter(deployed=deployed).defer('report','activity','os_family','install_log', 'install_log_hash') if page =='machine_detail': machines = Machine.objects.get(pk=theID) # send the machines and the data to the plugin for plugin in manager.getAllPlugins(): if plugin.name == pluginName: (machines, title) = plugin.plugin_object.filter_machines(machines, data) pseudo_buffer = Echo() writer = csv.writer(pseudo_buffer) # Fields header_row = [] fields = Machine._meta.get_fields() for field in fields: if not field.is_relation and field.name != 'id' and field.name != 'report' and field.name != 'activity' and field.name != 'os_family' and field.name != 'install_log' and field.name != 'install_log_hash': header_row.append(field.name) # distinct_facts = Fact.objects.values('fact_name').distinct().order_by('fact_name') facter_headers = [] condition_headers = [] plugin_script_headers = [] header_row.append('business_unit') header_row.append('machine_group') response = StreamingHttpResponse( (writer.writerow(row) for row in stream_csv( header_row=header_row, machines=machines, facter_headers=facter_headers, condition_headers=condition_headers, plugin_script_headers=plugin_script_headers)), content_type="text/csv") # Create the HttpResponse object with the appropriate CSV header. if getattr(settings, 'DEBUG_CSV', False): pass else: response['Content-Disposition'] = 'attachment; filename="%s.csv"' % title # # # if getattr(settings, 'DEBUG_CSV', False): # writer.writerow(['</body>']) return response # New BU @login_required def new_business_unit(request): c = {} c.update(csrf(request)) if request.method == 'POST': form = BusinessUnitForm(request.POST) if form.is_valid(): new_business_unit = form.save(commit=False) new_business_unit.save() form.save_m2m() return redirect('bu_dashboard', new_business_unit.id) else: form = BusinessUnitForm() c = {'form': form} user = request.user user_level = user.userprofile.level if user_level != 'GA': return redirect(index) return render(request, 'forms/new_business_unit.html', c) # Edit BU @login_required def edit_business_unit(request, bu_id): user = request.user user_level = user.userprofile.level if user_level != 'GA': return redirect(index) business_unit = get_object_or_404(BusinessUnit, pk=int(bu_id)) c = {} c.update(csrf(request)) if request.method == 'POST': if user.is_staff: form = EditUserBusinessUnitForm(request.POST, instance=business_unit) else: form = EditBusinessUnitForm(request.POST, instance=business_unit) if form.is_valid(): new_business_unit = form.save(commit=False) new_business_unit.save() form.save_m2m() return redirect('bu_dashboard', new_business_unit.id) else: if user.is_staff: form = EditUserBusinessUnitForm(instance=business_unit) else: form = EditBusinessUnitForm(instance=business_unit) c = {'form': form, 'business_unit':business_unit} user = request.user user_level = user.userprofile.level if user_level != 'GA': return redirect(index) return render(request, 'forms/edit_business_unit.html', c) @login_required def delete_business_unit(request, bu_id): user = request.user user_level = user.userprofile.level if user_level != 'GA': return redirect(index) business_unit = get_object_or_404(BusinessUnit, pk=int(bu_id)) machine_groups = business_unit.machinegroup_set.all() machines =
27, 5, -1): (0, 1), (7, 27, 5, 0): (0, 1), (7, 27, 5, 1): (0, 1), (7, 27, 5, 2): (0, 0), (7, 27, 5, 3): (-1, -1), (7, 27, 5, 4): (0, 1), (7, 27, 5, 5): (0, 1), (7, 28, -5, -5): (0, 1), (7, 28, -5, -4): (0, 1), (7, 28, -5, -3): (0, 1), (7, 28, -5, -2): (0, 1), (7, 28, -5, -1): (0, 1), (7, 28, -5, 0): (0, 1), (7, 28, -5, 1): (0, 1), (7, 28, -5, 2): (0, 1), (7, 28, -5, 3): (0, 1), (7, 28, -5, 4): (0, 0), (7, 28, -5, 5): (-1, -1), (7, 28, -4, -5): (0, 1), (7, 28, -4, -4): (0, 1), (7, 28, -4, -3): (0, 1), (7, 28, -4, -2): (0, 1), (7, 28, -4, -1): (0, 1), (7, 28, -4, 0): (-1, 1), (7, 28, -4, 1): (-1, 1), (7, 28, -4, 2): (-1, 1), (7, 28, -4, 3): (0, 1), (7, 28, -4, 4): (0, 0), (7, 28, -4, 5): (-1, -1), (7, 28, -3, -5): (0, 1), (7, 28, -3, -4): (0, 1), (7, 28, -3, -3): (0, 1), (7, 28, -3, -2): (0, 1), (7, 28, -3, -1): (0, 1), (7, 28, -3, 0): (0, 1), (7, 28, -3, 1): (-1, 1), (7, 28, -3, 2): (-1, 1), (7, 28, -3, 3): (0, 1), (7, 28, -3, 4): (0, 0), (7, 28, -3, 5): (-1, -1), (7, 28, -2, -5): (0, 1), (7, 28, -2, -4): (0, 1), (7, 28, -2, -3): (0, 1), (7, 28, -2, -2): (0, 1), (7, 28, -2, -1): (0, 1), (7, 28, -2, 0): (1, 1), (7, 28, -2, 1): (1, 1), (7, 28, -2, 2): (-1, 1), (7, 28, -2, 3): (-1, 1), (7, 28, -2, 4): (-1, 0), (7, 28, -2, 5): (-1, -1), (7, 28, -1, -5): (-1, 1), (7, 28, -1, -4): (-1, 1), (7, 28, -1, -3): (-1, 1), (7, 28, -1, -2): (-1, 1), (7, 28, -1, -1): (1, 1), (7, 28, -1, 0): (1, 1), (7, 28, -1, 1): (0, 1), (7, 28, -1, 2): (0, 0), (7, 28, -1, 3): (-1, 1), (7, 28, -1, 4): (-1, 1), (7, 28, -1, 5): (-1, 1), (7, 28, 0, -5): (-1, 1), (7, 28, 0, -4): (1, 1), (7, 28, 0, -3): (1, 1), (7, 28, 0, -2): (1, 1), (7, 28, 0, -1): (0, 1), (7, 28, 0, 0): (0, 1), (7, 28, 0, 1): (-1, 1), (7, 28, 0, 2): (-1, 0), (7, 28, 0, 3): (-1, -1), (7, 28, 0, 4): (-1, -1), (7, 28, 0, 5): (-1, -1), (7, 28, 1, -5): (1, 1), (7, 28, 1, -4): (1, 1), (7, 28, 1, -3): (1, 1), (7, 28, 1, -2): (1, 1), (7, 28, 1, -1): (-1, 1), (7, 28, 1, 0): (-1, 1), (7, 28, 1, 1): (-1, 0), (7, 28, 1, 2): (-1, -1), (7, 28, 1, 3): (-1, -1), (7, 28, 1, 4): (-1, -1), (7, 28, 1, 5): (-1, 1), (7, 28, 2, -5): (1, 1), (7, 28, 2, -4): (1, 1), (7, 28, 2, -3): (1, 1), (7, 28, 2, -2): (1, 1), (7, 28, 2, -1): (1, 1), (7, 28, 2, 0): (1, 1), (7, 28, 2, 1): (1, 0), (7, 28, 2, 2): (1, -1), (7, 28, 2, 3): (1, 1), (7, 28, 2, 4): (1, 0), (7, 28, 2, 5): (1, 0), (7, 28, 3, -5): (0, 1), (7, 28, 3, -4): (0, 1), (7, 28, 3, -3): (0, 1), (7, 28, 3, -2): (0, 1), (7, 28, 3, -1): (0, 1), (7, 28, 3, 0): (0, 1), (7, 28, 3, 1): (0, 0), (7, 28, 3, 2): (0, -1), (7, 28, 3, 3): (0, 1), (7, 28, 3, 4): (0, 1), (7, 28, 3, 5): (0, 1), (7, 28, 4, -5): (0, 1), (7, 28, 4, -4): (0, 1), (7, 28, 4, -3): (0, 1), (7, 28, 4, -2): (0, 1), (7, 28, 4, -1): (0, 1), (7, 28, 4, 0): (0, 1), (7, 28, 4, 1): (0, 0), (7, 28, 4, 2): (-1, -1), (7, 28, 4, 3): (0, 1), (7, 28, 4, 4): (0, 1), (7, 28, 4, 5): (0, 1), (7, 28, 5, -5): (0, 1), (7, 28, 5, -4): (0, 1), (7, 28, 5, -3): (0, 1), (7, 28, 5, -2): (0, 1), (7, 28, 5, -1): (0, 1), (7, 28, 5, 0): (0, 1), (7, 28, 5, 1): (0, 0), (7, 28, 5, 2): (-1, -1), (7, 28, 5, 3): (0, 1), (7, 28, 5, 4): (0, 1), (7, 28, 5, 5): (0, 1), (7, 29, -5, -5): (0, 1), (7, 29, -5, -4): (0, 1), (7, 29, -5, -3): (0, 1), (7, 29, -5, -2): (0, 1), (7, 29, -5, -1): (0, 1), (7, 29, -5, 0): (0, 1), (7, 29, -5, 1): (0, 1), (7, 29, -5, 2): (0, 1), (7, 29, -5, 3): (0, 0), (7, 29, -5, 4): (-1, -1), (7, 29, -5, 5): (0, 1), (7, 29, -4, -5): (0, 1), (7, 29, -4, -4): (0, 1), (7, 29, -4, -3): (0, 1), (7, 29, -4, -2): (0, 1), (7, 29, -4, -1): (-1, 1), (7, 29, -4, 0): (-1, 1), (7, 29, -4, 1): (-1, 1), (7, 29, -4, 2): (0, 1), (7, 29, -4, 3): (0, 0), (7, 29, -4, 4): (-1, -1), (7, 29, -4, 5): (0, 1), (7, 29, -3, -5): (0, 1), (7, 29, -3, -4): (0, 1), (7, 29, -3, -3): (0, 1), (7, 29, -3, -2): (0, 1), (7, 29, -3, -1): (0, 1), (7, 29, -3, 0): (-1, 1), (7, 29, -3, 1): (-1, 1), (7, 29, -3, 2): (0, 1), (7, 29, -3, 3): (0, 0), (7, 29, -3, 4): (-1, -1), (7, 29, -3, 5): (0, 1), (7, 29, -2, -5): (0, 1), (7, 29, -2, -4): (0, 1), (7, 29, -2, -3): (0, 1), (7, 29, -2, -2): (0, 1), (7, 29, -2, -1): (0, 1), (7, 29, -2, 0): (1, 1), (7, 29, -2, 1): (1, 1), (7, 29, -2, 2): (-1, 1), (7, 29, -2, 3): (-1, 0), (7, 29, -2, 4): (-1, -1), (7, 29, -2, 5): (-1, 1), (7, 29, -1, -5): (-1, 1), (7, 29, -1, -4): (-1, 1), (7, 29, -1, -3): (-1, 1), (7, 29, -1, -2): (-1, 1), (7, 29, -1, -1): (1, 1), (7, 29, -1, 0): (0, 1), (7, 29, -1, 1): (0, 1), (7, 29, -1, 2): (-1, 1), (7, 29, -1, 3): (-1, 0), (7, 29, -1, 4): (-1, -1), (7, 29, -1, 5): (-1, 1), (7, 29, 0, -5): (1, 1), (7, 29, 0, -4): (1, 1), (7, 29, 0, -3): (1, 1), (7, 29, 0, -2): (1, 1), (7, 29, 0, -1): (0, 1), (7, 29, 0, 0): (-1, 1), (7, 29, 0, 1): (-1, 1), (7, 29, 0, 2): (-1, 0), (7, 29, 0, 3): (-1, -1), (7, 29, 0, 4): (-1, -1), (7, 29, 0, 5): (-1, 1), (7, 29, 1, -5): (1, 1), (7, 29, 1, -4): (1, 1), (7, 29, 1, -3): (1, 1), (7, 29, 1, -2): (1, 1), (7, 29, 1, -1): (-1, 1), (7, 29, 1, 0): (-1, 1), (7, 29, 1, 1): (-1, 0), (7, 29, 1, 2): (-1, -1), (7, 29, 1, 3): (-1, -1), (7, 29, 1, 4): (-1, -1), (7, 29, 1, 5): (-1, 1), (7, 29, 2, -5): (1, 1), (7, 29, 2, -4): (1, 1), (7, 29, 2, -3): (1, 1), (7, 29, 2, -2): (1, 1), (7, 29, 2, -1): (1, 1), (7, 29, 2, 0): (1, 0), (7, 29, 2, 1): (1, -1), (7, 29, 2, 2): (1, 1), (7, 29, 2,
How widgets are aligned within their cells. See `set_alignment()` for more details about this option. """ custom_default_cell_size = 'expand' """ How much space a cell will consume if no size is specified. See `set_default_cell_size()` for more details about this option. """ def __init__(self, default_cell_size=None): """ Initialize the container. See `add()` for more details about the `default_cell_size` argument. """ super().__init__() self._children = [] self._children_can_overlap = False self._sizes = {} self._grid = drawing.Grid() self.cell_padding = first_not_none(( self.custom_cell_padding, self.custom_padding, 0)) self.cell_alignment = self.custom_cell_alignment self.default_cell_size = first_not_none(( default_cell_size, self.custom_default_cell_size)) def __iter__(self): yield from self._children def add(self, widget, size=None): """ Add the given widget to the layout. The widget will be added to the back of the layout (i.e. right for `HBox`, bottom for `VBox`). The `size` argument specifies how much space (i.e. width for `HBox`, height for `VBox`) to allocate for the "cell" that will contain the widget (if you think of the hbox/vbox as a 1-dimensional grid). The size can either be an integer number of pixels or the string `'expand'`: - number of pixels (int): The specified number of pixels will be allocated for the widget, unless that number is smaller than the widget's minimum size (i.e. its claim). In that case, the widget's minimum size will be allocated instead (because a widget can't be smaller than its minimum size). For this reason, `size=0` is a common setting meaning: "take as little space as possible". Of course, you can also specify `size=100` to make a cell exactly 100px wide/tall, assuming that the widget in question is smaller than that. - `'expand'` (str): A special value indicating that the widget should expand to fill any space available to the container but not used by any other cells. For example, imagine you have a `HBox` that's 500px wide (or a `VBox that's 500 px tall). If you add two widgets with `size='expand'`, each will get 250 px. If you add one widget with `size=100` and two with `size='expand'`, the first will If no size is specified, a default is used. The default can be set (in order of precedence) either via `set_default_cell_size()`, an argument to the constructor, or the `custom_default_cell_size` class variable. Examples: These are with `HBox`, but could equivalently be with `VBox`. Assume for the sake of simplicity that the `HBox` is 500px wide. Further assume that `w1`, `w2`, and `w3` are arbitrary widgets with no minimum size (e.g. `Placeholder`). In this example, `w1` and `w2` will both be 250px wide (i.e. half the width of the container): >>> h1 = glooey.HBox() # 500px wide >>> h1.add(w1, size='expand') >>> h1.add(w2, size='expand') In this example, `w1` will be 100px wide and `w2` and `w3` will split the remaining space and be 200px each: >>> h2 = glooey.HBox() # 500px wide >>> h2.add(w1, size=100) >>> h2.add(w2, size='expand') >>> h2.add(w3, size='expand') """ self.add_back(widget, size) def add_front(self, widget, size=None): """ Add the given widget to the front of the layout. The same as `add()`, except the widget will be added to the front of the layout (i.e. left for `HBox`, top for `VBox`). """ self.insert(widget, 0, size) def add_back(self, widget, size=None): """ Add the given widget to the back of the layout. This is an alias for `add()`. """ self.insert(widget, len(self._children), size) def pack(self, widget): """ Add the given widget to the layout such that it takes as little space as possible. This is an alias for `add(widget, size=0)` """ self.add(widget, size=0) def pack_front(self, widget): """ Add the given widget to the front of layout such that it takes as little space as possible. This is an alias for `add_front(widget, size=0)` """ self.add_front(widget, size=0) def pack_back(self, widget): """ Add the given widget to the back of layout such that it takes as little space as possible. This is an alias for `add_back(widget, size=0)` """ self.add_back(widget, size=0) def insert(self, widget, index, size=None): """ Insert the given widget at the given position in the layout. See `add()` for details about the `size` argument. """ self._attach_child(widget) self._children.insert(index, widget) self._sizes[widget] = size self._repack_and_regroup_children() def replace(self, old_widget, new_widget): """ Remove the given old widget from the layout and replace it with the given new widget. The new widget will be given the same size (e.g. the `size` argument to `add()`) as the old widget. That said, the new widget could still take up a different amount of space, if it's claim is different. The layout will be repacked automatically if this is the case. """ old_index = self._children.index(old_widget) old_size = self._sizes[old_widget] with self.hold_updates(): self.remove(old_widget) self.insert(new_widget, old_index, old_size) def remove(self, widget): """ Remove the given widget from the layout. """ self._detach_child(widget) self._children.remove(widget) del self._sizes[widget] self._repack_and_regroup_children() def clear(self): """ Remove every widget from the layout. """ for child in self._children: self._detach_child(child) self._children = [] self._sizes = {} self._repack_and_regroup_children() def do_claim(self): """ Claim enough space for all the child widgets put together in the direction of the layout (e.g. horizontal for `HBox`, vertical for `VBox`) and just enough space for the largest child widget in the opposite direction. """ self.do_set_row_col_sizes({ i: self._sizes[child] for i, child in enumerate(self._children) if self._sizes[child] is not None }) min_cell_rects = { self.do_get_row_col(i): child.claimed_rect for i, child in enumerate(self._children) } return self._grid.make_claim(min_cell_rects) def do_resize_children(self): """ Allocate space to the child widgets according to how much space they asked for when added to the layout (e.g. their "size") and how much space they need (e.g. their "claim"). """ cell_rects = self._grid.make_cells(self.rect) for i, child in enumerate(self._children): box = cell_rects[self.do_get_row_col(i)] align_widget_in_box(child, box, self.cell_alignment) def do_find_children_near_mouse(self, x, y): """ Speed up the search for the child widget under the mouse based This reimplementation is faster than the default implementation, which simply checks every child widget for collisions with the given mouse coordinate, because it searches underlying the grid layout instead. This takes advantage of the following two facts: 1. We know that only one widget can be under the mouse, so we can stop the search as soon as we find that widget. 2. We only need to check for collisions in the direction of the layout (i.e. horizontal for `HBox`, vertical for `VBox`), because we know that all the child widgets will overlap in the opposite direction. """ cell = self._grid.find_cell_under_mouse(x, y) if cell is None: return child = self._children[self.do_get_index(*cell)] if child is None: return yield child def do_get_index(self, row, col): """ Given row and columns number of a child widget, return the index of that widget in the 1-dimensional `_children` data structure. This would be the column for `HBox` and the row for `VBox`. """ raise NotImplementedError def do_get_row_col(self, index): """ Given the index of a child widget, return its row and column numbers as a tuple. The "on-axis" number (e.g. column for `Hbox`, row for `VBox`) should just be the given index. The "off-axis" number should be 1. """ raise NotImplementedError def do_set_row_col_sizes(self, sizes): """ Copy child size information into the underlying grid data structure. The `sizes` argument is a dictionary mapping 1-dimensional child indices to the sizes provided by `add()` (e.g. 0, 'expand', etc). This information either needs to be applied to the columns (`HBox`) or rows (`VBox`) of the underlying grid data structure. """ raise NotImplementedError def get_children(self): """ Return the child widgets being organized by this container. The return value is a tuple so that the list of children won't be mutable, and so the caller can't somehow inadvertently change the list of children held by the container. """ return tuple(self._children) def get_padding(self): """
= 2*np.pi * np.sqrt( (np.clip(a, 0, a)**3)/(GLOB_G*M) ) # Units = sec * pc / km T = _t * GLOB_SecToYr * GLOB_PcToKm _OE = OrbitElem(a, e_norm, omega * 180 / np.pi, LAN * 180 / np.pi, i * 180 / np.pi, MeanM * 180 / np.pi, T, nu) return _OE def OE_Essentials(_parVec:list) -> OrbitElem: """ Only calculate e and T to be bounds checked for fit Parameters ---------- _parVec : Parameter Vector for current orbit Returns ------- OrbitalElem Object """ Pars = ParVecToParams(_parVec) M = Pars[0] r0 = Pars[1] v0 = Pars[2] # momentum vector h = np.cross(r0, v0) # eccentricity vector e = np.cross(v0, h) / (GLOB_G*M) - r0/np.linalg.norm(r0) # eccentricity e_norm = np.linalg.norm(e) # semi mayor axis a = 1/( 2/np.linalg.norm(r0) - np.linalg.norm(v0)**2/(GLOB_G * M) ) _t = 2*np.pi * np.sqrt( (np.clip(a, 0, a)**3)/(GLOB_G*M) ) # Units = sec * pc / km T = _t * GLOB_SecToYr * GLOB_PcToKm _OE = OrbitElem(a, e_norm, 0, 0, 0, 0, T, 0) return _OE # UTILITY def PosRadToReal(_r:np.ndarray, _dist:float) -> np.ndarray: ''' converts the first 2 radial elements to real distance, given the distance returns position vector in pc ''' return _r*_dist*GLOB_masToRad def RadToReal(_x:float, _dist:float) -> float: ''' return distance in pc for one coordinate ''' return _x*_dist*GLOB_masToRad def PosRealToRad(_r:np.ndarray, _dist:float) -> np.ndarray: ''' converts the real position to radial position in the first 2 elements. Used for plotting only returns postion vector with units ('','',pc) ''' _t = np.array([ _dist*GLOB_masToRad, _dist*GLOB_masToRad, 1 ]) return _r/_t def potential(r:np.ndarray,v:np.ndarray,_M:float, r_SGRA:np.ndarray=np.array([0,0,0])) -> np.ndarray: """ return Kepler acceleration Parameters ---------- r : [vector] position of particle to evaluate potential at _M : [scalar] Mass of central object Returns ------- Potential Strength """ # true distance from star to srg a* dist = r - r_SGRA return -(GLOB_G*_M*dist) / (np.linalg.norm(dist)**3) def potentialSchwarz(r:np.ndarray,v:np.ndarray,_M:float, r_SGRA:np.ndarray=np.array([0,0,0])) -> np.ndarray: """ return the Schwarzschild acceleration Parameters ---------- r : [vector] position of particle to evaluate potential at v : [vector] velocity of particle _M : [scalar] Mass of central object Returns ------- Schwarzschild Potential Strength: Kepler Potential + a/r^3 """ h = np.cross(r,v) # specific angular momentum kepl = potential(r,v,_M) Schw = (3 * GLOB_G * _M * np.dot(h,h) * r) / (GLOB_c**2 * np.linalg.norm(r)**5) return kepl + Schw def VerletStep(h:float,r0:np.ndarray,v0:np.ndarray,f0:np.ndarray,_M:float, r_SGRA:np.ndarray=np.array([0,0,0])) -> np.ndarray: """ Orbital Integration using the Verlet Algorithm Parameters ---------- h : [scalar] stepsize -> delta t r0 : [vector] position of particle from last evaluation v0 : [vector] velocity of particle from last evaluation f0 : [scalar] potential strength from last evaluation step _M : [scalar] Mass of central object func : [function] Potential function to evaluate Returns ------- [r1, v1, f1] position, velocity and potential of new step """ pp = np.add(v0, h/2*f0) # 1/2 Delta velocity r1 = np.add(r0, h*pp) # new position = r0 + del v*del t f1 = potential(r1,v0,_M, r_SGRA) # new potential at new position v1 = np.add(pp, h/2*f1) # new velocity = v0 + 1/2 del a0*del t + 1/2 del a1*del t return np.array([r1,v1,f1]) def VerletStepSchwarz(h:float,r0:np.ndarray,v0:np.ndarray,f0:np.ndarray,_M:float, r_SGRA:np.ndarray=np.array([0,0,0])) -> np.ndarray: """ Orbital Integration using the Verlet Algorithm Parameters ---------- h : [scalar] stepsize -> delta t r0 : [vector] position of particle from last evaluation v0 : [vector] velocity of particle from last evaluation f0 : [scalar] potential strength from last evaluation step _M : [scalar] Mass of central object func : [function] Potential function to evaluate Returns ------- [r1, v1, f1] position, velocity and potential of new step """ pp = np.add(v0, h/2*f0) # 1/2 Delta velocity r1 = np.add(r0, h*pp) # new position = r0 + del v*del t f1 = potentialSchwarz(r1,pp,_M) # new potential at new position v1 = np.add(pp, h/2*f1) # new velocity = v0 + 1/2 del a0*del t + 1/2 del a1*del t return np.array([r1,v1,f1]) def returnDataError(rData:np.ndarray, rDataErr:np.ndarray, rTime:np.ndarray, Fake:np.ndarray, fTimeEnd:float) -> list: """ evaluates how much fake deviates from data data and fake must begin at the same point, for this to work Parameters ---------- rData : np.ndarray real Data to compare Fake Data against rDataErr : np.ndarray Error for real Data, used in chi calculation rTime : np.ndarray Timestamps for all real Data points Fake : np.ndarray Fake Data points that will be compared to real Data fTimeEnd : float Total End Time of Fake Data, this function will create its own time array based on this value Returns ------- [ x_time, y_UsedData, chi^2 value] """ # create timing for fake data fakeTimeline = np.linspace(0,fTimeEnd, len(Fake)) newTimeOfFake = np.empty(len(rTime)) newValues = np.empty(len(rTime)) j = 0 # determine closest fakeTime for every measured timestamp # if fake orbit shorter than measured time => last measured points get ignored # if fake orbit longer than measured time => last fake points get ignored for i in range(len(rTime)): for k in range(j, len(fakeTimeline)): if (fakeTimeline[k] >= rTime[i]): newTimeOfFake[i] = fakeTimeline[k] newValues[i] = Fake[k] j = k break chi2 = ((rData - newValues)/rDataErr)**2 return [newTimeOfFake, newValues, np.sum( chi2 ), chi2] def returnCombinedError(StarData:DataContainer, FitData:FitContainer, _in, redshiftCorr:bool = False) -> float: """ combines all measurement errors Parameters ---------- StarData : DataContainer The Star Data FitData : FitContainer The Fit Data, prior to any Error Calculation, Error will be overwritten _in : [_index_R, _index_V] Index point of starting data redshiftCorr : bool use redshift correction in error calculation? Only for Schwarzschild potential Returns ------- chi^2 value for current parameters """ if FitData.success: # create timing for fake data _eT = StarData.TimeP[_in[0]] - StarData.TimeP[0] + FitData.OrbitNumber * FitData.OrbElem.Period # error on every measurement Err_RA = returnDataError(StarData.RA, StarData.eRA, StarData.TimeP - StarData.TimeP[0], FitData.PosPath[0], _eT) Err_DE = returnDataError(StarData.DE, StarData.eDE, StarData.TimeP - StarData.TimeP[0], FitData.PosPath[1], _eT) # rad vel points need to be shifted by the same amount as the position data for consistency if redshiftCorr: fakeTimeline = np.linspace(0,_eT, len(FitData.VPath)) j = 0 rTime = StarData.TimeV - StarData.TimeP[0] #newVR_Timeline = np.empty(len(rTime)) LengthAtVR = np.empty(len(rTime)) newFakeVR = np.empty(len(rTime)) for i in range(len(rTime)): for k in range(j, len(fakeTimeline)): if (fakeTimeline[k] >= rTime[i]): #newVR_Timeline[i] = fakeTimeline[k] LengthAtVR[i] = np.linalg.norm(FitData.PositionArray[k]) #FitData.PositionArray[k][2] # newFakeVR[i] = FitData.VPath[k] j = k break PN_VR = StarData.VR - getGravRedshift(FitData.Mass, LengthAtVR) _chi2 = ((PN_VR - newFakeVR)/StarData.eVR)**2 Err_Vz = [StarData.TimeV - StarData.TimeP[0], PN_VR, np.sum( _chi2 ), _chi2] else: Err_Vz = returnDataError(StarData.VR, StarData.eVR, StarData.TimeV - StarData.TimeP[0], FitData.VPath, _eT) lenPos = len(StarData.RA) lenVel = len(StarData.VR) NPos = lenPos / (lenPos + lenVel) NVel = lenVel / (lenPos + lenVel) #print("len: ", len(Err_RA[3]) + len(Err_DE[3]) + len(Err_Vz[3])) FitData.initErrorData(Err_RA, Err_DE, Err_Vz) # save individual errors in FitData # chi^2 value #chi2 = (Err_RA[2] + Err_DE[2] + Err_Vz[2]) chi2 = (NPos * Err_RA[2] + NPos * Err_DE[2] + NVel * Err_Vz[2]) #Nlen = len(Err_RA[3]) + len(Err_DE[3]) + len(Err_Vz[3]) #chi2 = chi2/Nlen return chi2 else: return 1E10 def returnCombinedErrorFromFile(SD:DataContainer, FitData:FitContainer, _in) -> float: _OFile = open(OrbitFileForewrd, 'r') _line = _OFile.readline() NumberLines = -2 StartBackwards = -1 while _line: NumberLines += 1 if _line[0] == '#' and NumberLines > 0: StartBackwards = NumberLines _line = _OFile.readline() _OFile.close() _OFile = open(OrbitFileForewrd, 'r') _line = _OFile.readline() chi2RA = 0 chi2DE = 0 chi2VR = 0 fCount = -1 PositionRealTime = SD.TimeP - SD.TimeP[0] VelocityRealTime = SD.TimeV - SD.TimeP[0] # end of time _eT = SD.TimeP[_in[0]] - SD.TimeP[0] + FitData.OrbitNumber * FitData.OrbElem.Period # time from index point to ent of time fakeTimeline = np.linspace(SD.TimeP[_in[0]] - SD.TimeP[0], _eT, StartBackwards - 1) fakeTimelineBack = np.linspace(0, SD.TimeP[_in[0]] - SD.TimeP[0], NumberLines - StartBackwards) fakeTimelineBack = np.flip(fakeTimelineBack) rUsedF = [] vUsedF = [] RAIndex = 0 VRIndex = 0 count = 1 # forward while _line: if count > StartBackwards: break count += 1 _t = _line.strip() _line = _OFile.readline() if _t[0] != '#': _t = _t.split(" ") _t = [float(x) for x in _t] r = np.array(_t[:3]) v = np.array(_t[3:]) if fakeTimeline[count-1] >= PositionRealTime[RAIndex]: rUsedF.append(r) RAIndex = count - 1 if fakeTimeline[count - 1] >= VelocityRealTime[VRIndex]: vUsedF.append(v) VRIndex
numpy. if issubclass(b.dtype.type, numpy.complexfloating): # if complex roots are all complex conjugates, the roots are real. roots = numpy.asarray(z, complex) pos_roots = numpy.compress(roots.imag > 0, roots) neg_roots = numpy.conjugate(numpy.compress(roots.imag < 0, roots)) if len(pos_roots) == len(neg_roots): if numpy.all(numpy.sort_complex(neg_roots) == numpy.sort_complex(pos_roots)): b = b.real.copy() if issubclass(a.dtype.type, numpy.complexfloating): # if complex roots are all complex conjugates, the roots are real. roots = numpy.asarray(p, complex) pos_roots = numpy.compress(roots.imag > 0, roots) neg_roots = numpy.conjugate(numpy.compress(roots.imag < 0, roots)) if len(pos_roots) == len(neg_roots): if numpy.all(numpy.sort_complex(neg_roots) == numpy.sort_complex(pos_roots)): a = a.real.copy() return b, a def tf2sos(b, a, pairing='nearest'): """ Return second-order sections from transfer function representation Parameters ---------- b : array_like Numerator polynomial coefficients. a : array_like Denominator polynomial coefficients. pairing : {'nearest', 'keep_odd'}, optional The method to use to combine pairs of poles and zeros into sections. See `zpk2sos`. Returns ------- sos : ndarray Array of second-order filter coefficients, with shape ``(n_sections, 6)``. See `sosfilt` for the SOS filter format specification. See Also -------- zpk2sos, sosfilt Notes ----- It is generally discouraged to convert from TF to SOS format, since doing so usually will not improve numerical precision errors. Instead, consider designing filters in ZPK format and converting directly to SOS. TF is converted to SOS by first converting to ZPK format, then converting ZPK to SOS. .. versionadded:: 0.16.0 """ return zpk2sos(*tf2zpk(b, a), pairing=pairing) def sos2tf(sos): """ Return a single transfer function from a series of second-order sections Parameters ---------- sos : array_like Array of second-order filter coefficients, must have shape ``(n_sections, 6)``. See `sosfilt` for the SOS filter format specification. Returns ------- b : ndarray Numerator polynomial coefficients. a : ndarray Denominator polynomial coefficients. Notes ----- .. versionadded:: 0.16.0 """ sos = np.asarray(sos) b = [1.] a = [1.] n_sections = sos.shape[0] for section in range(n_sections): b = np.polymul(b, sos[section, :3]) a = np.polymul(a, sos[section, 3:]) return b, a def sos2zpk(sos): """ Return zeros, poles, and gain of a series of second-order sections Parameters ---------- sos : array_like Array of second-order filter coefficients, must have shape ``(n_sections, 6)``. See `sosfilt` for the SOS filter format specification. Returns ------- z : ndarray Zeros of the transfer function. p : ndarray Poles of the transfer function. k : float System gain. Notes ----- .. versionadded:: 0.16.0 """ sos = np.asarray(sos) n_sections = sos.shape[0] z = np.empty(n_sections*2, np.complex128) p = np.empty(n_sections*2, np.complex128) k = 1. for section in range(n_sections): zpk = tf2zpk(sos[section, :3], sos[section, 3:]) z[2*section:2*(section+1)] = zpk[0] p[2*section:2*(section+1)] = zpk[1] k *= zpk[2] return z, p, k def _nearest_real_complex_idx(fro, to, which): """Get the next closest real or complex element based on distance""" assert which in ('real', 'complex') order = np.argsort(np.abs(fro - to)) mask = np.isreal(fro[order]) if which == 'complex': mask = ~mask return order[np.where(mask)[0][0]] def zpk2sos(z, p, k, pairing='nearest'): """ Return second-order sections from zeros, poles, and gain of a system Parameters ---------- z : array_like Zeros of the transfer function. p : array_like Poles of the transfer function. k : float System gain. pairing : {'nearest', 'keep_odd'}, optional The method to use to combine pairs of poles and zeros into sections. See Notes below. Returns ------- sos : ndarray Array of second-order filter coefficients, with shape ``(n_sections, 6)``. See `sosfilt` for the SOS filter format specification. See Also -------- sosfilt Notes ----- The algorithm used to convert ZPK to SOS format is designed to minimize errors due to numerical precision issues. The pairing algorithm attempts to minimize the peak gain of each biquadratic section. This is done by pairing poles with the nearest zeros, starting with the poles closest to the unit circle. *Algorithms* The current algorithms are designed specifically for use with digital filters. (The output coefficents are not correct for analog filters.) The steps in the ``pairing='nearest'`` and ``pairing='keep_odd'`` algorithms are mostly shared. The ``nearest`` algorithm attempts to minimize the peak gain, while ``'keep_odd'`` minimizes peak gain under the constraint that odd-order systems should retain one section as first order. The algorithm steps and are as follows: As a pre-processing step, add poles or zeros to the origin as necessary to obtain the same number of poles and zeros for pairing. If ``pairing == 'nearest'`` and there are an odd number of poles, add an additional pole and a zero at the origin. The following steps are then iterated over until no more poles or zeros remain: 1. Take the (next remaining) pole (complex or real) closest to the unit circle to begin a new filter section. 2. If the pole is real and there are no other remaining real poles [#]_, add the closest real zero to the section and leave it as a first order section. Note that after this step we are guaranteed to be left with an even number of real poles, complex poles, real zeros, and complex zeros for subsequent pairing iterations. 3. Else: 1. If the pole is complex and the zero is the only remaining real zero*, then pair the pole with the *next* closest zero (guaranteed to be complex). This is necessary to ensure that there will be a real zero remaining to eventually create a first-order section (thus keeping the odd order). 2. Else pair the pole with the closest remaining zero (complex or real). 3. Proceed to complete the second-order section by adding another pole and zero to the current pole and zero in the section: 1. If the current pole and zero are both complex, add their conjugates. 2. Else if the pole is complex and the zero is real, add the conjugate pole and the next closest real zero. 3. Else if the pole is real and the zero is complex, add the conjugate zero and the real pole closest to those zeros. 4. Else (we must have a real pole and real zero) add the next real pole closest to the unit circle, and then add the real zero closest to that pole. .. [#] This conditional can only be met for specific odd-order inputs with the ``pairing == 'keep_odd'`` method. .. versionadded:: 0.16.0 Examples -------- Design a 6th order low-pass elliptic digital filter for a system with a sampling rate of 8000 Hz that has a pass-band corner frequency of 1000 Hz. The ripple in the pass-band should not exceed 0.087 dB, and the attenuation in the stop-band should be at least 90 dB. In the following call to `signal.ellip`, we could use ``output='sos'``, but for this example, we'll use ``output='zpk'``, and then convert to SOS format with `zpk2sos`: >>> from scipy import signal >>> z, p, k = signal.ellip(6, 0.087, 90, 1000/(0.5*8000), output='zpk') Now convert to SOS format. >>> sos = signal.zpk2sos(z, p, k) The coefficients of the numerators of the sections: >>> sos[:, :3] array([[ 0.0014154 , 0.00248707, 0.0014154 ], [ 1. , 0.72965193, 1. ], [ 1. , 0.17594966, 1. ]]) The symmetry in the coefficients occurs because all the zeros are on the unit circle. The coefficients of the denominators of the sections: >>> sos[:, 3:] array([[ 1. , -1.32543251, 0.46989499], [ 1. , -1.26117915, 0.6262586 ], [ 1. , -1.25707217, 0.86199667]]) The next example shows the effect of the `pairing` option. We have a system with three poles and three zeros, so the SOS array will have shape (2, 6). The means there is, in effect, an extra pole and an extra zero at the origin in the SOS representation. >>> z1 = np.array([-1, -0.5-0.5j, -0.5+0.5j]) >>> p1 = np.array([0.75, 0.8+0.1j, 0.8-0.1j]) With ``pairing='nearest'`` (the default), we obtain >>> signal.zpk2sos(z1, p1, 1) array([[ 1. , 1. , 0.5 , 1. , -0.75, 0. ], [ 1. , 1. , 0. , 1. , -1.6 , 0.65]]) The first section has the zeros {-0.5-0.05j, -0.5+0.5j} and the poles {0, 0.75}, and the second section has the zeros {-1, 0}
# coding: utf-8 """ Copyright (c) 2021 Aspose.Cells Cloud Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE """ from pprint import pformat from six import iteritems import re class Shape(object): """ NOTE: This class is auto generated by the swagger code generator program. Do not edit the class manually. """ """ Attributes: swagger_types (dict): The key is attribute name and the value is attribute type. attribute_map (dict): The key is attribute name and the value is json key in definition. """ swagger_types = { 'link': 'Link', 'alternative_text': 'str', 'bottom': 'int', 'top': 'int', 'width': 'int', 'html_text': 'str', 'text_vertical_alignment': 'str', 'auto_shape_type': 'str', 'is_printable': 'bool', 'upper_left_column': 'int', 'is_lock_aspect_ratio': 'bool', 'is_group': 'bool', 'rotation_angle': 'float', 'z_order_position': 'int', 'text_horizontal_overflow': 'str', 'mso_drawing_type': 'str', 'text_orientation_type': 'str', 'placement': 'str', 'name': 'str', 'is_word_art': 'bool', 'linked_cell': 'str', 'upper_left_row': 'int', 'is_locked': 'bool', 'lower_right_row': 'int', 'is_text_wrapped': 'bool', 'y': 'int', 'x': 'int', 'is_hidden': 'bool', 'left': 'int', 'right': 'int', 'text': 'str', 'lower_right_column': 'int', 'height': 'int', 'text_horizontal_alignment': 'str', 'text_vertical_overflow': 'str' } attribute_map = { 'link': 'link', 'alternative_text': 'AlternativeText', 'bottom': 'Bottom', 'top': 'Top', 'width': 'Width', 'html_text': 'HtmlText', 'text_vertical_alignment': 'TextVerticalAlignment', 'auto_shape_type': 'AutoShapeType', 'is_printable': 'IsPrintable', 'upper_left_column': 'UpperLeftColumn', 'is_lock_aspect_ratio': 'IsLockAspectRatio', 'is_group': 'IsGroup', 'rotation_angle': 'RotationAngle', 'z_order_position': 'ZOrderPosition', 'text_horizontal_overflow': 'TextHorizontalOverflow', 'mso_drawing_type': 'MsoDrawingType', 'text_orientation_type': 'TextOrientationType', 'placement': 'Placement', 'name': 'Name', 'is_word_art': 'IsWordArt', 'linked_cell': 'LinkedCell', 'upper_left_row': 'UpperLeftRow', 'is_locked': 'IsLocked', 'lower_right_row': 'LowerRightRow', 'is_text_wrapped': 'IsTextWrapped', 'y': 'Y', 'x': 'X', 'is_hidden': 'IsHidden', 'left': 'Left', 'right': 'Right', 'text': 'Text', 'lower_right_column': 'LowerRightColumn', 'height': 'Height', 'text_horizontal_alignment': 'TextHorizontalAlignment', 'text_vertical_overflow': 'TextVerticalOverflow' } @staticmethod def get_swagger_types(): return Shape.swagger_types @staticmethod def get_attribute_map(): return Shape.attribute_map def get_from_container(self, attr): if attr in self.container: return self.container[attr] return None def __init__(self, link=None, alternative_text=None, bottom=None, top=None, width=None, html_text=None, text_vertical_alignment=None, auto_shape_type=None, is_printable=None, upper_left_column=None, is_lock_aspect_ratio=None, is_group=None, rotation_angle=None, z_order_position=None, text_horizontal_overflow=None, mso_drawing_type=None, text_orientation_type=None, placement=None, name=None, is_word_art=None, linked_cell=None, upper_left_row=None, is_locked=None, lower_right_row=None, is_text_wrapped=None, y=None, x=None, is_hidden=None, left=None, right=None, text=None, lower_right_column=None, height=None, text_horizontal_alignment=None, text_vertical_overflow=None, **kw): """ Associative dict for storing property values """ self.container = {} """ Shape - a model defined in Swagger """ self.container['link'] = None self.container['alternative_text'] = None self.container['bottom'] = None self.container['top'] = None self.container['width'] = None self.container['html_text'] = None self.container['text_vertical_alignment'] = None self.container['auto_shape_type'] = None self.container['is_printable'] = None self.container['upper_left_column'] = None self.container['is_lock_aspect_ratio'] = None self.container['is_group'] = None self.container['rotation_angle'] = None self.container['z_order_position'] = None self.container['text_horizontal_overflow'] = None self.container['mso_drawing_type'] = None self.container['text_orientation_type'] = None self.container['placement'] = None self.container['name'] = None self.container['is_word_art'] = None self.container['linked_cell'] = None self.container['upper_left_row'] = None self.container['is_locked'] = None self.container['lower_right_row'] = None self.container['is_text_wrapped'] = None self.container['y'] = None self.container['x'] = None self.container['is_hidden'] = None self.container['left'] = None self.container['right'] = None self.container['text'] = None self.container['lower_right_column'] = None self.container['height'] = None self.container['text_horizontal_alignment'] = None self.container['text_vertical_overflow'] = None if link is not None: self.link = link if alternative_text is not None: self.alternative_text = alternative_text if bottom is not None: self.bottom = bottom if top is not None: self.top = top if width is not None: self.width = width if html_text is not None: self.html_text = html_text if text_vertical_alignment is not None: self.text_vertical_alignment = text_vertical_alignment if auto_shape_type is not None: self.auto_shape_type = auto_shape_type if is_printable is not None: self.is_printable = is_printable if upper_left_column is not None: self.upper_left_column = upper_left_column if is_lock_aspect_ratio is not None: self.is_lock_aspect_ratio = is_lock_aspect_ratio if is_group is not None: self.is_group = is_group if rotation_angle is not None: self.rotation_angle = rotation_angle if z_order_position is not None: self.z_order_position = z_order_position if text_horizontal_overflow is not None: self.text_horizontal_overflow = text_horizontal_overflow if mso_drawing_type is not None: self.mso_drawing_type = mso_drawing_type if text_orientation_type is not None: self.text_orientation_type = text_orientation_type if placement is not None: self.placement = placement if name is not None: self.name = name if is_word_art is not None: self.is_word_art = is_word_art if linked_cell is not None: self.linked_cell = linked_cell if upper_left_row is not None: self.upper_left_row = upper_left_row if is_locked is not None: self.is_locked = is_locked if lower_right_row is not None: self.lower_right_row = lower_right_row if is_text_wrapped is not None: self.is_text_wrapped = is_text_wrapped if y is not None: self.y = y if x is not None: self.x = x if is_hidden is not None: self.is_hidden = is_hidden if left is not None: self.left = left if right is not None: self.right = right if text is not None: self.text = text if lower_right_column is not None: self.lower_right_column = lower_right_column if height is not None: self.height = height if text_horizontal_alignment is not None: self.text_horizontal_alignment = text_horizontal_alignment if text_vertical_overflow is not None: self.text_vertical_overflow = text_vertical_overflow @property def link(self): """ Gets the link of this Shape. :return: The link of this Shape. :rtype: Link """ return self.container['link'] @link.setter def link(self, link): """ Sets the link of this Shape. :param link: The link of this Shape. :type: Link """ self.container['link'] = link @property def alternative_text(self): """ Gets the alternative_text of this Shape. :return: The alternative_text of this Shape. :rtype: str """ return self.container['alternative_text'] @alternative_text.setter def alternative_text(self, alternative_text): """ Sets the alternative_text of this Shape. :param alternative_text: The alternative_text of this Shape. :type: str """ self.container['alternative_text'] = alternative_text @property def bottom(self): """ Gets the bottom of this Shape. :return: The bottom of this Shape. :rtype: int """ return self.container['bottom'] @bottom.setter def bottom(self, bottom): """ Sets the bottom of this Shape. :param bottom: The bottom of this Shape. :type: int """ self.container['bottom'] = bottom @property def top(self): """ Gets the top of this Shape. :return: The top of this Shape. :rtype: int """ return self.container['top'] @top.setter def top(self, top): """ Sets the top of this Shape. :param top: The top of this Shape. :type: int """ self.container['top'] = top @property def width(self): """ Gets the width of this Shape. :return: The width of this Shape. :rtype: int """ return self.container['width'] @width.setter def width(self, width): """ Sets the width of this Shape. :param width: The width of this Shape. :type: int """ self.container['width'] = width @property def html_text(self): """ Gets the html_text of this Shape. :return: The html_text of this Shape. :rtype: str """ return self.container['html_text'] @html_text.setter def html_text(self, html_text): """ Sets the html_text of this Shape. :param html_text: The html_text of this Shape. :type: str """ self.container['html_text'] = html_text @property def text_vertical_alignment(self): """ Gets the text_vertical_alignment of this Shape. :return: The text_vertical_alignment of this Shape. :rtype: str """ return self.container['text_vertical_alignment'] @text_vertical_alignment.setter def text_vertical_alignment(self, text_vertical_alignment): """ Sets the text_vertical_alignment of this Shape. :param text_vertical_alignment: The text_vertical_alignment of this Shape. :type: str """ self.container['text_vertical_alignment'] = text_vertical_alignment @property def auto_shape_type(self): """ Gets the auto_shape_type of this Shape. :return: The auto_shape_type of this Shape. :rtype: str """ return self.container['auto_shape_type'] @auto_shape_type.setter def auto_shape_type(self, auto_shape_type): """ Sets the auto_shape_type of this Shape. :param auto_shape_type: The auto_shape_type of this Shape. :type: str """ self.container['auto_shape_type'] = auto_shape_type @property def is_printable(self): """ Gets the is_printable of this Shape. :return: The is_printable of this Shape. :rtype: bool """ return self.container['is_printable'] @is_printable.setter def is_printable(self, is_printable): """ Sets the is_printable of this Shape. :param is_printable: The is_printable of this Shape. :type: bool """ self.container['is_printable'] = is_printable @property def upper_left_column(self): """ Gets the upper_left_column of this Shape. :return: The upper_left_column of this Shape. :rtype: int """ return self.container['upper_left_column'] @upper_left_column.setter def upper_left_column(self, upper_left_column): """ Sets the upper_left_column of this Shape. :param upper_left_column: The upper_left_column of this Shape. :type: int """ self.container['upper_left_column'] = upper_left_column
"""+==========================+========-========*========-========+==========================+ || Lab11.5: Othello2 || || Name: <NAME> Date: 01/13/15 || +==========================+========-========*========-========+==========================+ This program plays a game of Othello using alpha and beta """ ##############################################<START OF PROGRAM>############################################## def setUpCanvas(root): # These are the REQUIRED magic lines to enter graphics mode. root.title("A Tk/Python Graphics Program") # Your screen size may be different from 1270 x 780. canvas = Canvas(root, width = 1270, height = 780, bg = 'GREY30') canvas.pack(expand = YES, fill = BOTH) return canvas #----------------------------------------------------------------------------------------------------Othello-- def createMatrix(): # = the initial position, with Black = 1, and white = -1. OK M = [ [0, 0, 0, 0, 0, 0, 0, 0,], [0, 0, 0, 0, 0, 0, 0, 0,], [0, 0, 0, 0, 0, 0, 0, 0,], [0, 0, 0,-1, 1, 0, 0, 0,], # The matrix M is GLOBAL. [0, 0, 0, 1,-1, 0, 0, 0,], [0, 0, 0, 0, 0, 0, 0, 0,], [0, 0, 0, 0, 0, 0, 0, 0,], [0, 0, 0, 0, 0, 0, 0, 0,],] return M #----------------------------------------------------------------------------------------------------Othello-- def initializePointMatrices(): global pointValueMatrixforWhite, pointValueMatrixforBlack #---The COMPUTER's strategy will be based off of this GLOBAL matrix, which will be modified as # the board configuration changes. Remember: row (going down) is first: P[row][col]. pointValueMatrixforWhite = \ [ [48, 6, 6, 6, 6, 6, 6, 48,], # P[0][0], P[0][1], ..., P[0][7] [ 6, -24, -4, -4, -4, -4, -24, 6,], # P[1][0], P[1][1], ..., P[1][7] [ 6, -4, 1, 1, 1, 1, -4, 6,], # P[2][0], P[2][1], ..., P[2][7] [ 6, -4, 1, 1, 1, 1, -4, 6,], # P[3][0], P[3][1], ..., P[3][7] [ 6, -4, 1, 1, 1, 1, -4, 6,], # P[4][0], P[4][1], ..., P[4][7] [ 6, -4, 1, 1, 1, 1, -4, 6,], # P[5][0], P[5][1], ..., P[5][7] [ 6, -24, -4, -4, -4, -4, -24, 6,], # P[6][0], P[6][1], ..., P[6][7] [48, 6, 6, 6, 6, 6, 6, 48,],]# P[7][0], P[7][1], ..., P[7][7] from copy import deepcopy pointValueMatrixforBlack = deepcopy(pointValueMatrixforWhite) return pointValueMatrixforWhite, pointValueMatrixforBlack #----------------------------------------------------------------------------------------------------Othello-- def updateTheFourCorners(): global pointValueMatrixforWhite, pointValueMatrixforBlack #---1B. Modify upper-left corner cell's values if the HUMAN has taken that corner. if M[0][0] == 1: if M[0][2] in [0,-1]: pointValueMatrixforWhite[0][1] = -4 # bad move for white (computer) if M[2][0] in [0,-1]: pointValueMatrixforWhite[1][0] = -4 # bad move for white (computer) pointValueMatrixforWhite[1][1] = -4 # bad move for white (computer) pointValueMatrixforBlack[1][1] = 3 # good move for black (human) #---2B. Modify upper-right corner cell's values if the HUMAN has taken that corner. if M[0][7] == 1: if M[0][5] in [0,-1]: pointValueMatrixforWhite[0][6] = -4 # bad move for white (computer) if M[2][7] in [0,-1]: pointValueMatrixforWhite[1][7] = -4 # bad move for white (computer) pointValueMatrixforWhite[1][6] = -4 # bad move for white (computer) pointValueMatrixforBlack[1][6] = 3 # good move for black (human) #---3B. Modify lower-left corner cell's values if the HUMAN has taken that corner. if M[7][0] == 1: if M[5][0] in [0,-1]: pointValueMatrixforWhite[6][0] = -4 # bad move for white (computer) if M[7][2] in [0,-1]: pointValueMatrixforWhite[7][1] = -4 # bad move for white (computer) pointValueMatrixforWhite[6][1] = -4 # bad move for white (computer) pointValueMatrixforBlack[6][1] = 3 # good move for black (human) #---4B. Modify lower-right corner cell's values if the HUMAN has taken that corner. if M[7][7] == 1: if M[7][5] in [0,-1]: pointValueMatrixforWhite[7][6] = -4 # bad move for white (computer) if M[5][7] in [0,-1]: pointValueMatrixforWhite[6][7] = -4 # bad move for white (computer) pointValueMatrixforWhite[6][6] = -4 # bad move for white (computer) pointValueMatrixforBlack[6][6] = 3 # good move for black (human) #++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ #---1W. Modify upper-left corner cell's values if the COMPUTER has taken that corner. if M[0][0] == -1: if M[0][2] in [0,1]: pointValueMatrixforBlack[0][1] = -4 # bad move for black (human) if M[2][0] in [0,1]: pointValueMatrixforBlack[1][0] = -4 # bad move for black (human) pointValueMatrixforBlack[1][1] = -4 # bad move for black (human) pointValueMatrixforWhite[1][1] = 3 # good move for white (computer) #---2W. Modify upper-right corner cell's values if the COMPUTER has taken that corner. if M[0][7] == -1: if M[0][5] in [0,1]: pointValueMatrixforBlack[0][6] = -4 # bad move for black (human) if M[2][7] in [0,1]: pointValueMatrixforBlack[1][7] = -4 # bad move for black (human) pointValueMatrixforBlack[1][6] = -4 # bad move for black (human) pointValueMatrixforWhite[1][6] = 3 # good move for white (computer) #---3W. Modify lower-left corner cell's values if the COMPUTER has taken that corner. if M[7][0] == -1: if M[5][0] in [0,1]: pointValueMatrixforBlack[6][0] = -4 # bad move for black (human) if M[7][2] in [0,1]: pointValueMatrixforBlack[7][1] = -4 # bad move for black (human) pointValueMatrixforBlack[6][1] = -4 # bad move for black (human) pointValueMatrixforWhite[6][1] = 3 # good move for white (computer) #---4W. Modify lower-right corner cell's values if the COMPUTER has taken that corner. if M[7][7] == -1: if M[7][5] in [0,1]: pointValueMatrixforBlack[7][6] = -4 # bad move for black (human) if M[5][7] in [0,1]: pointValueMatrixforBlack[6][7] = -4 # bad move for black (human) pointValueMatrixforBlack[6][6] = -4 # bad move for black (human)) pointValueMatrixforWhite[6][6] = 3 # good move for white (computer) #----------------------------------------------------------------------------------------------------Othello-- def updateTheMiddleRowsAndColumns(): global pointValueMatrixforWhite, pointValueMatrixforBlack for n in range (2, 6): if M[0][n] == -1: pointValueMatrixforWhite[1][n] = 2 # TOP row pointValueMatrixforBlack[1][n] = -1 # TOP row if M[7][n] == -1: pointValueMatrixforWhite[6][n] = 2 # BOTTOM row pointValueMatrixforBlack[6][n] = -1 # BOTTOM row if M[n][0] == -1: pointValueMatrixforWhite[n][1] = 2 # LEFT column pointValueMatrixforBlack[n][1] = -1 # LEFT column if M[n][7] == -1: pointValueMatrixforWhite[n][6] = 2 # RIGHT column pointValueMatrixforBlack[n][6] = -1 # RIGHT column if M[0][n] == 1: pointValueMatrixforWhite[1][n] = -1 # TOP row pointValueMatrixforBlack[1][n] = 2 # TOP row if M[7][n] == 1: pointValueMatrixforWhite[6][n] = -1 # BOTTOM row pointValueMatrixforBlack[6][n] = 2 # BOTTOM row if M[n][0] == 1: pointValueMatrixforWhite[n][1] = -1 # LEFT column pointValueMatrixforBlack[n][1] = 2 # LEFT column if M[n][7] == 1: pointValueMatrixforWhite[n][6] = -1 # RIGHT column pointValueMatrixforBlack[n][6] = 2 # RIGHT column #----------------------------------------------------------------------------------------------------Othello-- def updateThePointMatrices(): initializePointMatrices() updateTheFourCorners() updateTheMiddleRowsAndColumns() #----------------------------------------------------------------------------------------------------Othello-- def copyMatrixToScreen(): canvas.create_text(30,30, text="x", fill = 'BLACK', font = ('Helvetica',1)) for r in range (8): for c in range (8): if M[r][c] == 1: sx = c*70 + 85 sy = r*70 + 105 canvas.create_oval(sx-25,sy-25, sx+25, sy+25, fill = 'BLACK') if M[r][c] == -1: sx = c*70 + 85 sy = r*70 + 105 canvas.create_oval(sx-25,sy-25, sx+25, sy+25, fill = 'WHITE') canvas.update() #----------------------------------------------------------------------------------------------------Othello-- def showComputersMovesInRedOnScreen (r, c, pieces): #---If white just moved, then make that stone red sy = r*70 + 105 sx = c*70 + 85 canvas.create_oval(sx-15,sy-15, sx+15, sy+15, fill = 'RED') #------Turn any black stones partially white if they are about to be about to be turned over. for r,c in pieces: sy = r*70 + 105 sx = c*70 + 85 canvas.create_oval(sx-15,sy-15, sx+15, sy+15, fill = 'WHITE') canvas.update() sleep(PAUSE_TIME) #----------------------------------------------------------------------------------------------------Othello-- def copyOldBoardToScreenInMiniaturizedForm(rr, cc): #--erase previous miniature board canvas.create_rectangle(650, 400, 821, 567, width = 5, fill = 'GRAY30') ch = chr(9679) for r in range (8): for c in range (8): sx = c*20 + 665 sy = r*20 + 412 if M[r][c] == 1: canvas.create_text(sx, sy, text = ch, fill = 'BLACK', font = ('Helvetica', 20, 'bold') ) if M[r][c] == -1: canvas.create_text(sx, sy, text = ch, fill = 'WHITE', font = ('Helvetica', 20, 'bold') ) canvas.create_text(cc*20 + 665, rr*20 + 413, text = 'B', fill = 'BLACK', \ font = ('Helvetica', 9, 'bold') ) canvas.update() # make all previous changes to the canvas #----------------------------------------------------------------------------------------------------Othello-- def score(): # returns the number of black disks and white disks. whiteTotal = 0; blackTotal = 0 for r in range(8): for c in range (8): if M[r][c] == 1: blackTotal += 1 if M[r][c] == -1: whiteTotal += 1 return (blackTotal, whiteTotal) #----------------------------------------------------------------------------------------------------Othello-- # This function prints the matrices M , pointValueMatrixforWhite, and pointValueMatrixforBlack # to the console for debugging. def printMatrices(): print('\n Matrix M') print (' 0 1 2 3 4 5 6 7') print (' +--------------------------+') for r in range(8): print (r, '|', end = '') for c in range (8): if M[r][c] == 1: ch = '#' if M[r][c] ==-1: ch = 'O' if M[r][c] == 0: ch = '-' if M[r][c]
direction and value of D[7:0] pins # 8b<value>: 0 - low level, 1 - high level # 8b<direction>: 0 - input, 1 - output # Selected direction stays until explicitly changed # It seems that the value gets written to the pin first and only then it's direction gets written # Therefore attention needs to be paid when changing both port value from 1 to 0 and it's direction from output to input as it might produce a narrow runt pulse as there are 75 kOhm internal pull-up on every I/O pin 'get_pins_d' : 0x81, # Get value of D[7:0] pins 'set_pins_c' : 0x82, # Set direction and value of C[7:0] pins 'get_pins_c' : 0x83, # Get value of C[7:0] pins #-------------------------------------------------- 'enable_loopback' : 0x84, # Enable internal TDI->TDO loopback 'disable_loopback' : 0x85, # Disable internal TDI->TDO loopback 'set_clock_divider' : 0x86, # Set master clock divider to obtain required TCK/SCK/SCL frequency 'send_immediate' : 0x87, # Send RESPONSES back to host immediately not waiting for the read latency timer 'wait_pin_high' : 0x88, # Wait until GPIOL1 is high. Following MPSSE instructions are kept in TX buffer and not processed during this wait 'wait_pin_low' : 0x89, # Wait until GPIOL1 is low. Following MPSSE instructions are kept in TX buffer and not processed during this wait 'disable_x5_clock_divider' : 0x8A, # Disable master clock x5 divider 'enable_3_phase_clocking' : 0x8C, # Enable 3-phase clocking (required for I2C): data setup for 1/2 clock period -> pulse clock for 1/2 clock period -> data hold for 1/2 clock period 'disable_3_phase_clocking' : 0x8D, # Disable 3-phase clocking: data setup for 1/2 clock period -> pulse clock for 1/2 clock period 'clock_pulse_bit' : 0x8E, # 8b<length> # Pulse clock with no data transfer # 8b<length>: 0 - generate 1 pulse, ..., 7 - generate 8 pulses 'clock_pulse_byte' : 0x8F, # 8b<length[7:0]>, 8b<length[15:8]> # Pulse clock with no data transfer # 16b<length>: 0x0000 - generate 8 pulses, ..., 0xFFFF - generate 524288 pulses 'invalid_command_0' : 0xAA, # First invalid command for checking if MPSSE is operational 'invalid_command_1' : 0xAB} # Second invalid command for checking if MPSSE is operational RESPONSES = {'invalid_command' : 0xFA} # Response to invalid command which is followed by echoing the invalid command # Master clock is 60 MHz after /5 clock divider is disabled # required_clock = master_clock / ((1 + divider) * 2) # divider = master_clock / required_clock / 2 - 1 FREQUENCIES = {'1 kHz' : 29999, '10 kHz' : 2999, '100 kHz' : 299, # I2C Standard-mode '400 kHz' : 74, # I2C Fast-mode '1 MHz' : 29, # I2C Fast-mode Plus '1.11 MHz' : 26, '1.2 MHz' : 24, '1.25 MHz' : 23, '1.5 MHz' : 19, '1.67 MHz' : 17, '1.875 MHz' : 15, '2 MHz' : 14, '2.5 MHz' : 11, '3 MHz' : 9, '3.33 MHz' : 8, '3.75 MHz' : 7, '5 MHz' : 5, '6 MHz' : 4, '7.5 MHz' : 3, '10 MHz' : 2, '15 MHz' : 1, '30 MHz' : 0} # These delays are created using high-speed USB microframe time (125 us) and are equal to half of the selected clock period # Minimum achievable delay is 250 us (based on actual measurements) DELAYS = {'1 kHz' : 2000, # 2000 * 250 ns = 500 us '10 kHz' : 200, # 200 * 250 ns = 50 us '100 kHz' : 20, # 20 * 250 ns = 5 us '400 kHz' : 5, # 5 * 250 ns = 1.25 us '1 MHz' : 2, # 2 * 250 ns = 0.5 us '2 MHz' : 1, # 1 * 250 ns = 0.25 us '3 MHz' : 1, # 1 * 250 ns = 0.25 us, minimum achievable delay '5 MHz' : 1, # 1 * 250 ns = 0.25 us, minimum achievable delay '6 MHz' : 1, # 1 * 250 ns = 0.25 us, minimum achievable delay '7.5 MHz' : 1, # 1 * 250 ns = 0.25 us, minimum achievable delay '10 MHz' : 1, # 1 * 250 ns = 0.25 us, minimum achievable delay '15 MHz' : 1, # 1 * 250 ns = 0.25 us, minimum achievable delay '30 MHz' : 1} # 1 * 250 ns = 0.25 us, minimum achievable delay #=============================================================================== # exceptions #=============================================================================== class FTDIError(Exception): '''Custom class for recoverable error handling''' pass class FTDICritical(Exception): '''Custom class for unrecoverable error handling''' pass #=============================================================================== # classes #=============================================================================== class FTDI: def __init__(self, device): self.device = device self.port_jtag = None self.port_spi = None self.port_i2c = None if PRODUCT_IDS[self.device.idProduct] == 'FT232H': self.ports = {'A' : 0x0001} self.jtag_buffer_size = 1000 self.spi_buffer_size = 1000 self.i2c_buffer_size = 1000 elif PRODUCT_IDS[self.device.idProduct] == 'FT2232H': # FTDI device port indexes self.ports = {'A' : 0x0001, 'B' : 0x0002} # FTDI device uses FIFO for data transfer so there is no fixed-size buffer per se self.jtag_buffer_size = 8000 # This value was determined experimentally by shifting 65465 bits through TDI->TDO when in internal loopback mode at TCK = 100 kHz, 1 MHz, 10 MHz, 30 MHz self.spi_buffer_size = 8000 # This value was determined experimentally by shifting 65465 bits through MOSI->MISO when in internal loopback mode at SCK = 100 kHz, 1 MHz, 10 MHz, 30 MHz self.i2c_buffer_size = 4000 # This value was determined experimentally by writing and reading full array of the Microchip 24LC512 EEPROM (64 kbyte) at SCL = 100 kHz, 400 kHz, 1 MHz elif PRODUCT_IDS[self.device.idProduct] == 'FT4232H': self.ports = {'A' : 0x0001, 'B' : 0x0002} self.jtag_buffer_size = 4000 self.spi_buffer_size = 4000 self.i2c_buffer_size = 2000 else: logger.critical(f'FAIL: Wrong USB idProduct: 0x{self.device.idProduct:04X}') raise FTDICritical def __enter__(self): logger.debug('Initialize FTDI device') # Set default timeout (ms) self.device.default_timeout = 1000 # 1 s timeout # logger.debug(f'| FTDI device found on bus {self.device.bus:03d}, address {self.device.address:03d}\n{self.device}') # Detach from kernel driver for configuration in self.device: # Iterate over device configurations for interface in configuration: # Iterate over configuration interfaces if self.device.is_kernel_driver_active(interface = interface.bInterfaceNumber) is True: logger.debug(f'| OS: Detach kernel driver from configuration {configuration.bConfigurationValue}, interface {interface.bInterfaceNumber}') self.device.detach_kernel_driver(interface = interface.bInterfaceNumber) # Set configuration configuration = self.device.get_active_configuration() logger.debug(f'| USB: Active configuration: {"none" if configuration is None else configuration.bConfigurationValue}') if configuration is None or configuration.bConfigurationValue != 1: logger.debug('| USB: Set active configuration: 1') self.device.set_configuration(configuration = 1) # Claim interfaces for configuration in self.device: # Iterate over device configurations for interface in configuration: # Iterate over configuration interfaces logger.debug(f'| USB: Claim configuration {configuration.bConfigurationValue}, interface {interface.bInterfaceNumber}') usb.util.claim_interface(device = self.device, interface = interface.bInterfaceNumber) # Check if active configuration is still the same as other software might have activated another one configuration = self.device.get_active_configuration() if configuration is None or configuration.bConfigurationValue != 1: logger.error(f'FAIL: Wrong current active configuration: {"none" if configuration is None else configuration.bConfigurationValue}') raise FTDIError # Reset the USB port device is connected to (generic USB command) logger.debug('| USB: Reset port device is connected to') self.device.reset() for port in self.ports.keys(): # Reset UART BUFFERS (vendor-specific command) logger.debug(f'| FTDI device, port {port}: Reset UART BUFFERS') self.device.ctrl_transfer(bmRequestType = usb.util.build_request_type(direction = usb.util.CTRL_OUT, type = usb.util.CTRL_TYPE_VENDOR, recipient = usb.util.CTRL_RECIPIENT_DEVICE), bRequest = CONTROL_REQUESTS['reset_buffer'], wValue = BUFFERS['rx_tx'], wIndex = self.ports[port]) # Set receive buffer latency timer (vendor-specific command) # Latency Timer is used as a timeout to flush short packets of data back to the host # The default is 16 ms, but it can be altered between 0 ms and 255 ms # At 0 ms latency packet transfer is done on every high speed microframe (every 125 us) # For MPSSE it's recommended to set it to the default 16 ms and use "send_immediate" command to send bytes back to host when required # This approach seems to be working fine for FT2232H but with FT232H there seems to be a latency delay present on the first small packet transfer therefore latency is set to 1 # This was observed while programming SPI flash and checking its status register
<reponame>cdleong/shiba<gh_stars>10-100 import json import math import os import urllib from pathlib import Path from types import SimpleNamespace from typing import Dict, Optional, Tuple import torch from shiba.codepoint_tokenizer import CodepointTokenizer from shiba.local_transformer_encoder_layer import LocalTransformerEncoderLayer from shiba.multi_hashing_embedder import MultiHashingEmbedder from shiba.position_embedder import PositionEmbedder class ShibaConfig(SimpleNamespace): def to_dict(self): out = self.__dict__.copy() del out['self'] return out def to_json_string(self): return json.dumps(self.to_dict()) class Shiba(torch.nn.Module): # defaults modeled after CANINE # https://github.com/google-research/language/blob/186ce9002180d0c45bfa2a680085b890c76647dc/language/canine/modeling.py#L40 def __init__(self, downsampling_rate: int = 4, upsampling_kernel_size: int = 4, embedder_slice_count: int = 8, embedder_bucket_count: int = 16000, hidden_size: int = 768, local_attention_window: int = 128, deep_transformer_stack: Optional[torch.nn.Module] = None, deep_transformer_requires_transpose: bool = True, attention_heads: int = 12, transformer_ff_size: int = 3072, dropout: float = 0.1, activation: str = 'gelu', padding_id: int = 0, max_length: int = 2048, shiba_specific_code: bool = False, deep_transformer_stack_layers: Optional[int] = None): super(Shiba, self).__init__() self.config = ShibaConfig(**{key: val for key, val in locals().items() if key in self.__init__.__code__.co_varnames}) if max_length % downsampling_rate != 0: # if this isn't true, padding so we don't miss any characters can bring us over max length raise RuntimeError(f"max length must be divisible by downsampling rate, but got " f"{max_length} and {downsampling_rate} respectively") activations = { 'relu': torch.nn.ReLU, 'gelu': torch.nn.GELU } if activation not in activations: raise RuntimeError(f'activation must be in {set(activations.keys())}, but was {activation}') else: self.activation = activations[activation]() self.dropout = torch.nn.Dropout(p=dropout) # "Hash Embedding" self.embedder = MultiHashingEmbedder(hidden_size, slice_count=embedder_slice_count, bucket_count=embedder_bucket_count) self.position_embedder = PositionEmbedder(max_length, hidden_size) self.embedder_ln = torch.nn.LayerNorm(hidden_size) # "Single Local Transformer" # note the CANINE paper says "local transformer", but it means "local transformer encoder" just like BERT self.local_transformer = LocalTransformerEncoderLayer(hidden_size, attention_heads, dropout=dropout, activation=activation, dim_feedforward=transformer_ff_size) # "Downsample (Strided Convolution) " self.downsample_conv = torch.nn.Conv1d(hidden_size, hidden_size, kernel_size=downsampling_rate, stride=downsampling_rate) self.downsample_attention_pool = torch.nn.MaxPool1d(kernel_size=downsampling_rate, stride=downsampling_rate) self.downsample_ln = torch.nn.LayerNorm(hidden_size) self.cls_linear = torch.nn.Linear(hidden_size, hidden_size) # "Deep Transformer Stack" if deep_transformer_stack is not None: if deep_transformer_stack_layers is not None: raise RuntimeError('deep_transformer_stack_layers and deep_transformer_stack both provided - please ' 'provide only one.') # TODO: perform some kind of basic verification that this is actually a torch module that can be used # in place of the default deep transformer stack self.deep_transformer = deep_transformer_stack else: layers = deep_transformer_stack_layers if deep_transformer_stack_layers is not None else 12 self.deep_transformer = torch.nn.TransformerEncoder(torch.nn.TransformerEncoderLayer(hidden_size, attention_heads, dim_feedforward=transformer_ff_size, dropout=dropout, activation=activation), num_layers=layers) self.config.deep_transformer_requires_transpose = True # "Conv + Single Transformer" self.upsample_conv = torch.nn.Conv1d(hidden_size * 2, hidden_size, kernel_size=upsampling_kernel_size, stride=1) self.upsample_ln = torch.nn.LayerNorm(hidden_size) self.final_transformer = torch.nn.TransformerEncoder( torch.nn.TransformerEncoderLayer(hidden_size, attention_heads, dim_feedforward=transformer_ff_size, dropout=dropout, activation=activation), 1) # CLS Token self.cls_linear_final = torch.nn.Linear(hidden_size, hidden_size) self.cls_activation = torch.nn.Tanh() # "Upsampling" def _repeat_molecules(self, molecules: torch.Tensor, char_seq_length: int): repeated_molecules = molecules.repeat_interleave(self.config.downsampling_rate, axis=1) remainder_length = char_seq_length % self.config.downsampling_rate # as the canine implementation does, we repeat the last molecule extra times to get to a multiple of 4 last_molecule = molecules[:, -1:, :] last_molecule_repeated = last_molecule.repeat_interleave(remainder_length, axis=1) return torch.cat((repeated_molecules, last_molecule_repeated), dim=1) def forward(self, input_ids: torch.Tensor, attention_mask: torch.Tensor, predict_indices: Optional[torch.Tensor] = None) -> Dict[str, torch.Tensor]: if input_ids.shape[1] > self.config.max_length: raise RuntimeError(f'Input tensor of shape {input_ids.shape} exceeded configured max length' f'{self.config.max_length}') if any(input_ids[:, 0:1] != CodepointTokenizer.CLS): raise RuntimeError('All input sequences must start wit [CLS] codepoint') # https://github.com/google-research/language/blob/186ce9002180d0c45bfa2a680085b890c76647dc/language/canine/modeling.py#L221 # https://github.com/google-research/language/blob/13dc35ccad77309354ff8ed2950c560c16b083b1/language/canine/bert_modeling.py#L448 char_embeddings = self.position_embedder(self.embedder(input_ids)) # https://github.com/google-research/language/blob/186ce9002180d0c45bfa2a680085b890c76647dc/language/canine/modeling.py#L253 contextualized_chars = self.local_transformer(char_embeddings, attention_mask) # h_init # https://github.com/google-research/language/blob/186ce9002180d0c45bfa2a680085b890c76647dc/language/canine/modeling.py#L287 cls_embedding = self.dropout(self.cls_linear(contextualized_chars[:, 0:1, :])) if self.config.shiba_specific_code: # remove the CLS token from the tokens that get downsampled so its information isn't used twice contextualized_chars = contextualized_chars[:, 1:, :] attention_mask = attention_mask[:, 1:] # pad so the convolution can't drop information from final characters contextualized_chars = self._pad_to_avoid_missed_characters(contextualized_chars) attention_mask = self._pad_to_avoid_missed_characters(attention_mask.unsqueeze(2)).squeeze() # note that even with shiba specific code turned off, we don't truncate the last char like CANINE does sampleable_characters = contextualized_chars.transpose(1, 2).contiguous() sampleable_mask = attention_mask.float() molecules = self.downsample_conv(sampleable_characters).transpose(1, 2) # h_down molecules = self.downsample_ln(self.activation(molecules)) molecules = torch.cat((cls_embedding, molecules), dim=1) # unlike CANINE we don't assume a fixed size and truncate, so we have to add to the attention mask for the # CLS slot. squeezing and unsqueezing is a fix for https://github.com/pytorch/pytorch/issues/51954 downsampled_attention_mask = self.downsample_attention_pool(sampleable_mask.unsqueeze(0)).squeeze(0) molecule_attention_mask = torch.nn.functional.pad(downsampled_attention_mask.bool(), (1, 0), value=True) # https://github.com/google-research/language/blob/186ce9002180d0c45bfa2a680085b890c76647dc/language/canine/modeling.py#L343 if self.config.deep_transformer_requires_transpose: # TODO: if we switch out the deep transformer to something that calls its attention mask # anything other than "src_key_padding_mask" this will break contextualized_molecules = self.deep_transformer(molecules.transpose(0, 1), src_key_padding_mask=molecule_attention_mask).transpose(0, 1) # h`_down else: contextualized_molecules = self.deep_transformer(molecules, src_key_padding_mask=molecule_attention_mask) # https://github.com/google-research/language/blob/186ce9002180d0c45bfa2a680085b890c76647dc/language/canine/modeling.py#L371 molecules_without_cls = contextualized_molecules[:, 1:, :] # remove CLS to avoid upsampling it repeated_molecules = self._repeat_molecules(molecules_without_cls, contextualized_chars.shape[1]) # https://github.com/google-research/language/blob/186ce9002180d0c45bfa2a680085b890c76647dc/language/canine/modeling.py#L468 concatenated = torch.cat((contextualized_chars, repeated_molecules), dim=2) concatenated = self._pad_for_convolution_to_same_length(concatenated, self.upsample_conv) upsampled_embeddings = self.activation(self.upsample_conv(concatenated.transpose(1, 2).contiguous()). transpose(1, 2)) upsampled_embeddings = self.dropout(self.upsample_ln(upsampled_embeddings)) # h_up if predict_indices is not None: # this is MLM of some kind - we don't need to do the final CLS computation and we can only do the # final transformer for the positions we're predicting embeddings_for_pred = torch.stack([upsampled_embeddings[i, predict_indices[i], :] for i in range(upsampled_embeddings.shape[0])]) # no attention mask because we are presumably not trying to predict padding final_embeddings = self.final_transformer(embeddings_for_pred.transpose(0, 1)).transpose(0, 1) else: # https://github.com/google-research/language/blob/master/language/canine/modeling.py#L551 contextualized_cls = contextualized_molecules[:, 0:1, :] final_cls = self.cls_activation(self.cls_linear_final(contextualized_cls)) # confusingly, key_padding_mask does for the pytorch transformer what attention_mask does for the # local attention implementation (and huggingface/allennlp) # also, we drop the first embedding (CLS token) because we're going to use final_cls anyway final_embeddings = self.final_transformer(upsampled_embeddings[:, 1:, :].transpose(0, 1), src_key_padding_mask=attention_mask[:, 1:]).transpose(0, 1) final_embeddings = torch.cat((final_cls, final_embeddings), dim=1) # replace CLS embedding return { 'embeddings': final_embeddings } def _pad_to_avoid_missed_characters(self, char_embeddings: torch.Tensor) -> torch.Tensor: if char_embeddings.shape[1] % self.config.downsampling_rate == 0: return char_embeddings else: target_length = math.ceil(char_embeddings.shape[1] / self.config.downsampling_rate)\ * self.config.downsampling_rate total_padding = target_length - char_embeddings.shape[1] lhs_padding = math.floor(total_padding / 2) rhs_padding = math.ceil(total_padding / 2) return torch.nn.functional.pad(char_embeddings, (0, 0, lhs_padding, rhs_padding)) def _pad_for_convolution_to_same_length(self, hidden_state: torch.Tensor, convolution: torch.nn.Conv1d) -> torch.Tensor: # we have to manually pad, see: https://discuss.pytorch.org/t/same-padding-equivalent-in-pytorch/85121/2 # so we solve for total padding from the formula for output length # https://pytorch.org/docs/stable/generated/torch.nn.Conv1d.html # hidden state has shape [batch_size, sequence_length, embedding_size] l = hidden_state.shape[1] s = convolution.stride[0] d = convolution.dilation[0] k = convolution.kernel_size[0] total_padding = l * s - l + d * k - d + 1 - s lhs_padding = math.floor(total_padding / 2) rhs_padding = math.ceil(total_padding / 2) return torch.nn.functional.pad(hidden_state, (0, 0, lhs_padding, rhs_padding)) def get_pretrained_state_dict(): download_url = 'https://storage.googleapis.com/shiba.octanove.com/published_checkpoints/shiba_check45k.pt' save_location = Path.home() / '.shiba' / 'pretrained_shiba.pt' if not save_location.parent.exists(): os.makedirs(save_location.parent, exist_ok=True) if not save_location.exists(): print('Downloading shiba state dict to', save_location) with open(save_location, 'wb') as state_dict_file: response = urllib.request.urlopen(download_url) data = response.read() state_dict_file.write(data) print('Done') return torch.load(save_location, map_location=torch.device('cpu')) class ShibaForTask(torch.nn.Module): def __init__(self, **kwargs): super(ShibaForTask, self).__init__() self.shiba_model = Shiba(**kwargs) def load_encoder_checkpoint(self, checkpoint_location: Optional[str] = None): if checkpoint_location is None: state_dict = get_pretrained_state_dict() else: state_dict = torch.load(checkpoint_location, map_location=torch.device('cpu')) self.shiba_model.load_state_dict(state_dict) class ShibaForSequenceLabeling(ShibaForTask): def __init__(self, vocab_size: int, **kwargs): super(ShibaForSequenceLabeling, self).__init__(**kwargs) self.vocab_size = vocab_size self.config = self.shiba_model.config self.config.vocab_size = self.vocab_size self.label_layer = torch.nn.Linear(self.shiba_model.config.hidden_size, self.vocab_size) self.dropout = torch.nn.Dropout(p=self.shiba_model.config.dropout) self.log_softmax = torch.nn.LogSoftmax(dim=2) self.loss = torch.nn.NLLLoss() def forward(self, input_ids: torch.Tensor, labels: Optional[torch.Tensor], attention_mask: torch.Tensor) -> Tuple: embeddings = self.shiba_model(input_ids, attention_mask, None)['embeddings'] label_hidden_states = self.label_layer(self.dropout(embeddings)) label_probs = self.log_softmax(label_hidden_states) output = { 'embeddings': embeddings, 'label_probs': label_probs } if labels is not None: output['loss'] = self.loss(label_probs.transpose(1, 2), labels) return output.get('loss', None), output['label_probs'], output['embeddings'] class ShibaForClassification(ShibaForTask): def __init__(self, vocab_size: int, **kwargs): super(ShibaForClassification, self).__init__(**kwargs) self.vocab_size = vocab_size self.config = self.shiba_model.config self.config.vocab_size = self.vocab_size self.label_layer = torch.nn.Linear(self.shiba_model.config.hidden_size, self.vocab_size) self.dropout = torch.nn.Dropout(p=self.shiba_model.config.dropout) self.log_softmax = torch.nn.LogSoftmax(dim=1) self.loss = torch.nn.NLLLoss() def forward(self, input_ids: torch.Tensor, labels: Optional[torch.Tensor], attention_mask: torch.Tensor) -> Tuple: cls_embeddings = self.shiba_model(input_ids, attention_mask, None)['embeddings'][:, 0, :] class_hidden_states = self.label_layer(self.dropout(cls_embeddings)) class_probs = self.log_softmax(class_hidden_states) output = { 'cls_embeddings': cls_embeddings, 'class_probs': class_probs } if labels is not None: output['loss'] = self.loss(class_probs, labels) return output.get('loss', None), output['class_probs'], output['cls_embeddings'] class ShibaForMaskedLanguageModeling(ShibaForTask): def __init__(self, vocab_size: int, **kwargs): """If vocab size is < than special token codepoints (which it likely is, at least for Japanese), the model will be unable to predict special tokens. However, the model shouldn't be trained to predict special tokens anyway""" super(ShibaForMaskedLanguageModeling, self).__init__(**kwargs) self.vocab_size = vocab_size + 1 self.unk_token = vocab_size # we hash the input so there are unknown tokens, but our output vocab is limited self.lm_layer = torch.nn.Linear(self.shiba_model.config.hidden_size, self.vocab_size) self.config = self.shiba_model.config self.config.vocab_size = self.vocab_size self.log_softmax = torch.nn.LogSoftmax(dim=2) self.loss = torch.nn.NLLLoss(reduction="none") # https://github.com/microsoft/DeepSpeed/issues/962 def _replace_unkown_tokens(self, labels: torch.Tensor) -> torch.Tensor: return labels.where(labels < self.vocab_size, torch.full(labels.shape, self.unk_token, device=labels.device).long()) def
"""Base Plotting module.""" from __future__ import annotations from . import State, units from CoolProp.CoolProp import PropsSI import matplotlib.pyplot as plt import numpy as np from abc import ABC, abstractmethod from dataclasses import dataclass, field @dataclass class PlottedState: """Data class to efficiently store states in the self.states dictionary.""" key: str state: State # key: Plot axes string (Tv, pv) # value: Line2D instance for that plot of the marker for this state markers: dict = field(default_factory=dict) class PlottingBase(ABC): """Basic Plotting manager for thermodynamic states. Parameters ---------- substance : `str` One of the substances supported by CoolProp """ axis_units = { "v": "m**3/kg", "T": "K", "s": "J/(kg*K)", "p": "pascal", "u": "J/kg", "h": "J/kg", "x": "dimensionless", } allowed_processes = { "isochoric": "v", "isovolumetric": "v", "isometric": "v", "isobaric": "p", "isothermal": "T", "isoenergetic": "u", "isoenthalpic": "h", "isentropic": "s", } def __init__(self, substance: str): self.states = {} self.plots = {} self.processes = {} @abstractmethod def plot(self, x_axis: str, y_axis: str): # pragma: no cover """Hold the place of a plot function that a child class must establish.""" pass def add_state(self, state: State, key: str | None = None, label: str | None = None): """Add a state to the self.states dictionary and plot it.""" if key is None: key = repr(state) if label is not None: state.label = label plotted_state = PlottedState(key=key, state=state) for plot_key, value in self.plots.items(): x_data = [] y_data = [] fig, axis = value x_axis, y_axis = plot_key x_data.append(getattr(state, x_axis).magnitude) y_data.append(getattr(state, y_axis).magnitude) x_data = np.array(x_data) * getattr(units, self.axis_units[x_axis]) y_data = np.array(y_data) * getattr(units, self.axis_units[y_axis]) (line,) = axis.plot(x_data, y_data, marker="o") if state.label is not None: axis.annotate( state.label, (x_data[0], y_data[0]), textcoords="offset pixels", xytext=(5, 5), ) plotted_state.markers[plot_key] = line self.states[key] = plotted_state def remove_state(self, state: State | None = None, key: str | None = None): """Remove a state from the self.states dictionary and plots.""" if state is None and key is None: raise ValueError("No state or key was entered. Unable to find state") if state is not None and repr(state) in self.states: state_to_be_removed = self.states[repr(state)] elif key is not None and key in self.states: state_to_be_removed = self.states[key] elif key is not None and key not in self.states and state is None: raise ValueError("Couldn't find key") else: for key, s_2 in self.states.items(): if state == s_2.state: state_to_be_removed = self.states[key] break else: raise ValueError("Couldn't find the state") for line in state_to_be_removed.markers.values(): line.remove() del self.states[state_to_be_removed.key] def remove_process( self, state_1: State, state_2: State, remove_states: bool = False ): """Remove a process from the self.process dictionary. The process to be removed is specified by the states that were used to initially create the process. It is optional to keep the points associated with the states while still removing the line object. Parameters ---------- state_1: `~thermostate.thermostate.State` The starting state for this process. state_2: `~thermostate.thermostate.State` The final state for this process. remove_states: `bool` If ``True``, the associated states are removed from the instance. """ key_1 = None key_2 = None for key, plotted_state in self.states.items(): if state_1 is plotted_state.state: key_1 = key if state_2 is plotted_state.state: key_2 = key for line in self.processes[key_1 + key_2].values(): line.remove() del self.processes[key_1 + key_2] if remove_states: self.remove_state(state_1) self.remove_state(state_2) def add_process( self, state_1: State, state_2: State, process_type: str | None = None, label_1: str | None = None, label_2: str | None = None, ): """Add a thermodynamic process to the self.process dictionary and plots it. A property of the states is held constant and all intermediate states are traced out in a line between the two states on the graph. The property that is held constant is specified by the user with the ``process_type`` input. If no property is to be held constant then a straight line between the two points is drawn. Parameters ---------- state_1: `~thermostate.thermostate.State` The starting state for this process. state_2: `~thermostate.thermostate.State` The final state for this process. process_type: optional, `str` If given, specifies the property that is held constant during the process. Must be one of ``"isochoric"``, ``"isovolumetric"``, ``"isobaric"``, ``"isothermal"``, ``"isoenergetic"``, ``"isoenthalpic"``, ``"isentropic"``, or ``None``. If not specified, a straight line is drawn between the states. label_1: optional, `str` If given, will be used to label the first state. label_2: optional, `str` If given, will be used to label the second state. """ if ( process_type not in self.allowed_processes.keys() and process_type is not None ): raise ValueError( f"Not a supported process type: '{process_type}.\n" f"Supported process types are: {list(self.allowed_processes.keys())}" ) if process_type is not None: constant_prop = self.allowed_processes[process_type] constant1 = getattr(state_1, constant_prop) constant2 = getattr(state_2, constant_prop) if not np.isclose(constant1, constant2): raise ValueError(f"Property: '{constant_prop}' was not held constant") missing_state_1 = True missing_state_2 = True key_1 = None key_2 = None sub1 = state_1.sub sub2 = state_2.sub if sub1 != sub2: raise ValueError( f"Substance of input states do not match: '{sub1}', '{sub2}'" ) for key, plotted_state in self.states.items(): if state_1 is plotted_state.state: missing_state_1 = False key_1 = key if state_2 is plotted_state.state: missing_state_2 = False key_2 = key if missing_state_1: key_1 = repr(state_1) self.add_state(state_1, key_1, label_1) if missing_state_2: key_2 = repr(state_2) self.add_state(state_2, key_2, label_2) plot_key = key_1 + key_2 self.processes[plot_key] = {} if process_type in ("isochoric", "isovolumetric", "isometric"): p_1 = np.log10(state_1.p.magnitude) p_2 = np.log10(state_2.p.magnitude) v_range = np.logspace(p_1, p_2) * units.pascal elif process_type is not None: v_1 = np.log10(state_1.v.magnitude) v_2 = np.log10(state_2.v.magnitude) # Due to numerical approximation by CoolProp, an error occurs # if the state is too close to a saturated liquid. Here an # imperceptibly small offset is introduced to the specific volume # to avoid this error. if state_1.x is not None: if np.isclose(state_1.x.magnitude, 0.0): v_1 *= 1.0 + 1.0e-14 elif np.isclose(state_1.x.magnitude, 1.0): v_1 *= 1.0 - 1.0e-12 if state_2.x is not None: if np.isclose(state_2.x.magnitude, 0.0): v_2 *= 1.0 + 1.0e-14 elif np.isclose(state_2.x.magnitude, 1.0): v_2 *= 1.0 - 1.0e-12 v_range = np.logspace(v_1, v_2) * units("m**3/kg") for key, value in self.plots.items(): x_data = [] y_data = [] fig, axis = value x_axis, y_axis = key if process_type is None: x_data.append(getattr(state_1, x_axis).magnitude) y_data.append(getattr(state_1, y_axis).magnitude) x_data.append(getattr(state_2, x_axis).magnitude) y_data.append(getattr(state_2, y_axis).magnitude) x_data = np.array(x_data) * getattr(units, self.axis_units[x_axis]) y_data = np.array(y_data) * getattr(units, self.axis_units[y_axis]) (line,) = axis.plot(x_data, y_data, marker="None", linestyle="--") self.processes[plot_key][key] = line else: state = State(state_1.sub) for v in v_range: if process_type in ("isochoric", "isovolumetric", "isometric"): state.pv = v, state_1.v elif process_type == "isobaric": state.pv = state_1.p, v elif process_type == "isothermal": state.Tv = state_1.T, v elif process_type == "isoenergetic": state.uv = state_1.u, v elif process_type == "isoenthalpic": state.hv = state_1.h, v elif process_type == "isentropic": state.sv = state_1.s, v x_data.append(getattr(state, x_axis).magnitude) y_data.append(getattr(state, y_axis).magnitude) x_data = np.array(x_data) * getattr(units, self.axis_units[x_axis]) y_data = np.array(y_data) * getattr(units, self.axis_units[y_axis]) (line,) = axis.plot(x_data, y_data, linestyle="-") self.processes[plot_key][key] = line def set_xscale(self, x_axis, y_axis, scale="linear"): """Access a plot in self.plots and change the scale of its x axis.""" key = x_axis + y_axis fig, axis = self.plots[key] axis.set_xscale(scale) def set_yscale(self, x_axis, y_axis, scale="linear"): """Access a plot in self.plots and change the scale of its y axis.""" key = x_axis + y_axis fig, axis = self.plots[key] axis.set_yscale(scale) class VaporDome(PlottingBase): """Class for plotting graphs with a vapor dome.""" def __init__(self, substance, *args): super().__init__(substance) min_temp = PropsSI("Tmin", substance) max_temp = PropsSI("Tcrit", substance) T_range = np.logspace(np.log10(min_temp), np.log10(max_temp), 400) * units.K self.st_f = [State(substance, T=T, x=0 * units.dimensionless) for T in T_range] self.st_g = [State(substance, T=T, x=1 * units.dimensionless) for T in T_range] for axes in args: self.plot(axes[0], axes[1]) def plot(self, x_axis, y_axis): """Add a plot with a vapor dome to this instance with given x and y axes. Parameters ---------- x_axis: `str` The string representing the x axis for this plot. Allowed axes are "T", "p", "u", "s", "v", and "h". y_axis: `str` The string representing the y axis for this plot. Allowed axes are "T", "p", "u", "s", "v", and "h". """ if x_axis + y_axis not in self.plots: fig, axis = plt.subplots() self.plots[x_axis + y_axis] = (fig, axis) x_f = [getattr(st, x_axis).magnitude for st in self.st_f] x_f = np.array(x_f) * getattr(units, self.axis_units[x_axis]) y_f = [getattr(st, y_axis).magnitude
absoluteFidelity.__class__.__name__ ) raise BaseException(strMessage) def delAbsoluteFidelity(self): self._absoluteFidelity = None absoluteFidelity = property( getAbsoluteFidelity, setAbsoluteFidelity, delAbsoluteFidelity, "Property for absoluteFidelity", ) # Methods and properties for the 'relativeFidelity' attribute def getRelativeFidelity(self): return self._relativeFidelity def setRelativeFidelity(self, relativeFidelity): if relativeFidelity is None: self._relativeFidelity = None elif relativeFidelity.__class__.__name__ == "XSDataDouble": self._relativeFidelity = relativeFidelity else: strMessage = ( "ERROR! XSDataInputBioSaxsSmartMergev1_0.setRelativeFidelity argument is not XSDataDouble but %s" % relativeFidelity.__class__.__name__ ) raise BaseException(strMessage) def delRelativeFidelity(self): self._relativeFidelity = None relativeFidelity = property( getRelativeFidelity, setRelativeFidelity, delRelativeFidelity, "Property for relativeFidelity", ) # Methods and properties for the 'sample' attribute def getSample(self): return self._sample def setSample(self, sample): if sample is None: self._sample = None elif sample.__class__.__name__ == "XSDataBioSaxsSample": self._sample = sample else: strMessage = ( "ERROR! XSDataInputBioSaxsSmartMergev1_0.setSample argument is not XSDataBioSaxsSample but %s" % sample.__class__.__name__ ) raise BaseException(strMessage) def delSample(self): self._sample = None sample = property(getSample, setSample, delSample, "Property for sample") # Methods and properties for the 'mergedCurve' attribute def getMergedCurve(self): return self._mergedCurve def setMergedCurve(self, mergedCurve): if mergedCurve is None: self._mergedCurve = None elif mergedCurve.__class__.__name__ == "XSDataFile": self._mergedCurve = mergedCurve else: strMessage = ( "ERROR! XSDataInputBioSaxsSmartMergev1_0.setMergedCurve argument is not XSDataFile but %s" % mergedCurve.__class__.__name__ ) raise BaseException(strMessage) def delMergedCurve(self): self._mergedCurve = None mergedCurve = property( getMergedCurve, setMergedCurve, delMergedCurve, "Property for mergedCurve" ) # Methods and properties for the 'subtractedCurve' attribute def getSubtractedCurve(self): return self._subtractedCurve def setSubtractedCurve(self, subtractedCurve): if subtractedCurve is None: self._subtractedCurve = None elif subtractedCurve.__class__.__name__ == "XSDataFile": self._subtractedCurve = subtractedCurve else: strMessage = ( "ERROR! XSDataInputBioSaxsSmartMergev1_0.setSubtractedCurve argument is not XSDataFile but %s" % subtractedCurve.__class__.__name__ ) raise BaseException(strMessage) def delSubtractedCurve(self): self._subtractedCurve = None subtractedCurve = property( getSubtractedCurve, setSubtractedCurve, delSubtractedCurve, "Property for subtractedCurve", ) # Methods and properties for the 'runId' attribute def getRunId(self): return self._runId def setRunId(self, runId): if runId is None: self._runId = None elif runId.__class__.__name__ == "XSDataString": self._runId = runId else: strMessage = ( "ERROR! XSDataInputBioSaxsSmartMergev1_0.setRunId argument is not XSDataString but %s" % runId.__class__.__name__ ) raise BaseException(strMessage) def delRunId(self): self._runId = None runId = property(getRunId, setRunId, delRunId, "Property for runId") # Methods and properties for the 'bufferCurves' attribute def getBufferCurves(self): return self._bufferCurves def setBufferCurves(self, bufferCurves): if bufferCurves is None: self._bufferCurves = [] elif bufferCurves.__class__.__name__ == "list": self._bufferCurves = bufferCurves else: strMessage = ( "ERROR! XSDataInputBioSaxsSmartMergev1_0.setBufferCurves argument is not list but %s" % bufferCurves.__class__.__name__ ) raise BaseException(strMessage) def delBufferCurves(self): self._bufferCurves = None bufferCurves = property( getBufferCurves, setBufferCurves, delBufferCurves, "Property for bufferCurves" ) def addBufferCurves(self, value): if value is None: strMessage = "ERROR! XSDataInputBioSaxsSmartMergev1_0.addBufferCurves argument is None" raise BaseException(strMessage) elif value.__class__.__name__ == "XSDataFile": self._bufferCurves.append(value) else: strMessage = ( "ERROR! XSDataInputBioSaxsSmartMergev1_0.addBufferCurves argument is not XSDataFile but %s" % value.__class__.__name__ ) raise BaseException(strMessage) def insertBufferCurves(self, index, value): if index is None: strMessage = "ERROR! XSDataInputBioSaxsSmartMergev1_0.insertBufferCurves argument 'index' is None" raise BaseException(strMessage) if value is None: strMessage = "ERROR! XSDataInputBioSaxsSmartMergev1_0.insertBufferCurves argument 'value' is None" raise BaseException(strMessage) elif value.__class__.__name__ == "XSDataFile": self._bufferCurves[index] = value else: strMessage = ( "ERROR! XSDataInputBioSaxsSmartMergev1_0.addBufferCurves argument is not XSDataFile but %s" % value.__class__.__name__ ) raise BaseException(strMessage) def export(self, outfile, level, name_="XSDataInputBioSaxsSmartMergev1_0"): showIndent(outfile, level) outfile.write(unicode("<%s>\n" % name_)) self.exportChildren(outfile, level + 1, name_) showIndent(outfile, level) outfile.write(unicode("</%s>\n" % name_)) def exportChildren(self, outfile, level, name_="XSDataInputBioSaxsSmartMergev1_0"): XSDataInput.exportChildren(self, outfile, level, name_) for inputCurves_ in self.getInputCurves(): inputCurves_.export(outfile, level, name_="inputCurves") if self.getInputCurves() == []: warnEmptyAttribute("inputCurves", "XSDataFile") if self._absoluteFidelity is not None: self.absoluteFidelity.export(outfile, level, name_="absoluteFidelity") if self._relativeFidelity is not None: self.relativeFidelity.export(outfile, level, name_="relativeFidelity") if self._sample is not None: self.sample.export(outfile, level, name_="sample") if self._mergedCurve is not None: self.mergedCurve.export(outfile, level, name_="mergedCurve") else: warnEmptyAttribute("mergedCurve", "XSDataFile") if self._subtractedCurve is not None: self.subtractedCurve.export(outfile, level, name_="subtractedCurve") if self._runId is not None: self.runId.export(outfile, level, name_="runId") for bufferCurves_ in self.getBufferCurves(): bufferCurves_.export(outfile, level, name_="bufferCurves") def build(self, node_): for child_ in node_.childNodes: nodeName_ = child_.nodeName.split(":")[-1] self.buildChildren(child_, nodeName_) def buildChildren(self, child_, nodeName_): if child_.nodeType == Node.ELEMENT_NODE and nodeName_ == "inputCurves": obj_ = XSDataFile() obj_.build(child_) self.inputCurves.append(obj_) elif child_.nodeType == Node.ELEMENT_NODE and nodeName_ == "absoluteFidelity": obj_ = XSDataDouble() obj_.build(child_) self.setAbsoluteFidelity(obj_) elif child_.nodeType == Node.ELEMENT_NODE and nodeName_ == "relativeFidelity": obj_ = XSDataDouble() obj_.build(child_) self.setRelativeFidelity(obj_) elif child_.nodeType == Node.ELEMENT_NODE and nodeName_ == "sample": obj_ = XSDataBioSaxsSample() obj_.build(child_) self.setSample(obj_) elif child_.nodeType == Node.ELEMENT_NODE and nodeName_ == "mergedCurve": obj_ = XSDataFile() obj_.build(child_) self.setMergedCurve(obj_) elif child_.nodeType == Node.ELEMENT_NODE and nodeName_ == "subtractedCurve": obj_ = XSDataFile() obj_.build(child_) self.setSubtractedCurve(obj_) elif child_.nodeType == Node.ELEMENT_NODE and nodeName_ == "runId": obj_ = XSDataString() obj_.build(child_) self.setRunId(obj_) elif child_.nodeType == Node.ELEMENT_NODE and nodeName_ == "bufferCurves": obj_ = XSDataFile() obj_.build(child_) self.bufferCurves.append(obj_) XSDataInput.buildChildren(self, child_, nodeName_) # Method for marshalling an object def marshal(self): oStreamString = StringIO() oStreamString.write(unicode('<?xml version="1.0" ?>\n')) self.export(oStreamString, 0, name_="XSDataInputBioSaxsSmartMergev1_0") oStringXML = oStreamString.getvalue() oStreamString.close() return oStringXML # Only to export the entire XML tree to a file stream on disk def exportToFile(self, _outfileName): outfile = open(_outfileName, "w") outfile.write(unicode('<?xml version="1.0" ?>\n')) self.export(outfile, 0, name_="XSDataInputBioSaxsSmartMergev1_0") outfile.close() # Deprecated method, replaced by exportToFile def outputFile(self, _outfileName): print( "WARNING: Method outputFile in class XSDataInputBioSaxsSmartMergev1_0 is deprecated, please use instead exportToFile!" ) self.exportToFile(_outfileName) # Method for making a copy in a new instance def copy(self): return XSDataInputBioSaxsSmartMergev1_0.parseString(self.marshal()) # Static method for parsing a string def parseString(_inString): doc = minidom.parseString(_inString) rootNode = doc.documentElement rootObj = XSDataInputBioSaxsSmartMergev1_0() rootObj.build(rootNode) # Check that all minOccurs are obeyed by marshalling the created object oStreamString = StringIO() rootObj.export(oStreamString, 0, name_="XSDataInputBioSaxsSmartMergev1_0") oStreamString.close() return rootObj parseString = staticmethod(parseString) # Static method for parsing a file def parseFile(_inFilePath): doc = minidom.parse(_inFilePath) rootNode = doc.documentElement rootObj = XSDataInputBioSaxsSmartMergev1_0() rootObj.build(rootNode) return rootObj parseFile = staticmethod(parseFile) # end class XSDataInputBioSaxsSmartMergev1_0 class XSDataInputBioSaxsSubtractv1_0(XSDataInput): """Runs sequentially subtraction of buffer and SaxsAnalysis""" def __init__( self, configuration=None, gnomFile=None, subtractedCurve=None, sample=None, bufferCurves=None, sampleCurve=None, ): XSDataInput.__init__(self, configuration) if sampleCurve is None: self._sampleCurve = None elif sampleCurve.__class__.__name__ == "XSDataFile": self._sampleCurve = sampleCurve else: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0 constructor argument 'sampleCurve' is not XSDataFile but %s" % self._sampleCurve.__class__.__name__ ) raise BaseException(strMessage) if bufferCurves is None: self._bufferCurves = [] elif bufferCurves.__class__.__name__ == "list": self._bufferCurves = bufferCurves else: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0 constructor argument 'bufferCurves' is not list but %s" % self._bufferCurves.__class__.__name__ ) raise BaseException(strMessage) if sample is None: self._sample = None elif sample.__class__.__name__ == "XSDataBioSaxsSample": self._sample = sample else: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0 constructor argument 'sample' is not XSDataBioSaxsSample but %s" % self._sample.__class__.__name__ ) raise BaseException(strMessage) if subtractedCurve is None: self._subtractedCurve = None elif subtractedCurve.__class__.__name__ == "XSDataFile": self._subtractedCurve = subtractedCurve else: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0 constructor argument 'subtractedCurve' is not XSDataFile but %s" % self._subtractedCurve.__class__.__name__ ) raise BaseException(strMessage) if gnomFile is None: self._gnomFile = None elif gnomFile.__class__.__name__ == "XSDataFile": self._gnomFile = gnomFile else: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0 constructor argument 'gnomFile' is not XSDataFile but %s" % self._gnomFile.__class__.__name__ ) raise BaseException(strMessage) # Methods and properties for the 'sampleCurve' attribute def getSampleCurve(self): return self._sampleCurve def setSampleCurve(self, sampleCurve): if sampleCurve is None: self._sampleCurve = None elif sampleCurve.__class__.__name__ == "XSDataFile": self._sampleCurve = sampleCurve else: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0.setSampleCurve argument is not XSDataFile but %s" % sampleCurve.__class__.__name__ ) raise BaseException(strMessage) def delSampleCurve(self): self._sampleCurve = None sampleCurve = property( getSampleCurve, setSampleCurve, delSampleCurve, "Property for sampleCurve" ) # Methods and properties for the 'bufferCurves' attribute def getBufferCurves(self): return self._bufferCurves def setBufferCurves(self, bufferCurves): if bufferCurves is None: self._bufferCurves = [] elif bufferCurves.__class__.__name__ == "list": self._bufferCurves = bufferCurves else: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0.setBufferCurves argument is not list but %s" % bufferCurves.__class__.__name__ ) raise BaseException(strMessage) def delBufferCurves(self): self._bufferCurves = None bufferCurves = property( getBufferCurves, setBufferCurves, delBufferCurves, "Property for bufferCurves" ) def addBufferCurves(self, value): if value is None: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0.addBufferCurves argument is None" ) raise BaseException(strMessage) elif value.__class__.__name__ == "XSDataFile": self._bufferCurves.append(value) else: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0.addBufferCurves argument is not XSDataFile but %s" % value.__class__.__name__ ) raise BaseException(strMessage) def insertBufferCurves(self, index, value): if index is None: strMessage = "ERROR! XSDataInputBioSaxsSubtractv1_0.insertBufferCurves argument 'index' is None" raise BaseException(strMessage) if value is None: strMessage = "ERROR! XSDataInputBioSaxsSubtractv1_0.insertBufferCurves argument 'value' is None" raise BaseException(strMessage) elif value.__class__.__name__ == "XSDataFile": self._bufferCurves[index] = value else: strMessage = ( "ERROR! XSDataInputBioSaxsSubtractv1_0.addBufferCurves argument is not XSDataFile but %s" % value.__class__.__name__ ) raise BaseException(strMessage) # Methods and properties for the 'sample' attribute def getSample(self): return self._sample def setSample(self, sample): if sample is None: self._sample
<filename>cgnet/tests/test_geometry_statistics.py # Author: <NAME> # Contributors : <NAME> import numpy as np import scipy.spatial import torch from cgnet.feature import GeometryFeature, GeometryStatistics # The following sets up our pseud-simulation data # Number of frames frames = np.random.randint(1, 10) # Number of coarse-grained beads. We need at least 8 so we can do # dihedrals in the backbone tests (where every other atom is designated # as a backbone atom) beads = np.random.randint(8, 20) # Number of dimensions; for now geometry only handles 3 dims = 3 # Create a pseudo simulation dataset data = np.random.randn(frames, beads, dims).astype(np.float64) data_tensor = torch.Tensor(data).double() geom_feature = GeometryFeature(feature_tuples='all_backbone', n_beads=beads) _ = geom_feature.forward(data_tensor) stats = GeometryStatistics(data_tensor, backbone_inds='all', get_all_distances=True, get_backbone_angles=True, get_backbone_dihedrals=True, get_redundant_distance_mapping=True) def test_feature_tuples(): # Tests to see if the feature_tuples attribute is assembled correctly unique_tuples = [] for desc in stats.order: # for each type of feature sub_list = stats.descriptions[desc] # list the feature tuples for bead_tuple in sub_list: if bead_tuple not in unique_tuples: unique_tuples.append(bead_tuple) np.testing.assert_array_equal(unique_tuples, stats.feature_tuples) def test_custom_feature_shapes(): # Tests whether statistics object has the right number of distances, # angles, and dihedrals when custom features are given # First generate the starts of features to be used for distances, # angles, and dihedrals custom_starts = np.unique([np.random.randint(beads - 4) for _ in range(5)]) custom_distance_pairs = [(i, i+2) for i in custom_starts] custom_angle_triples = [(i, i+1, i+2) for i in custom_starts] custom_dihed_quads = [(i, i+1, i+2, i+3) for i in custom_starts] custom_features = (custom_distance_pairs + custom_angle_triples + custom_dihed_quads) custom_stats = GeometryStatistics(data_tensor, custom_features) # We just want to make sure that no other features (like backbone) # showed up assert len(custom_starts) == len(custom_stats._distance_pairs) assert len(custom_starts) == len(custom_stats._angle_trips) assert len(custom_starts) == len(custom_stats._dihedral_quads) def test_custom_feature_consistency_with_backbone(): # Tests whether manually specifying backbone indices gives the same result # as automatically calculating backbone features backbone_angles = [(i, i+1, i+2) for i in range(beads - 2)] backbone_diheds = [(i, i+1, i+2, i+3) for i in range(beads - 3)] custom_features = backbone_angles + backbone_diheds backbone_stats = GeometryStatistics(data_tensor, backbone_inds='all', get_backbone_angles=True, get_backbone_dihedrals=True) backbone_stats_dict = backbone_stats.get_prior_statistics() custom_stats = GeometryStatistics(data_tensor, custom_features) custom_stats_dict = custom_stats.get_prior_statistics() np.testing.assert_array_equal(backbone_stats_dict, custom_stats_dict) def test_manual_backbone_calculations(): # Make sure backbone distance, angle, and dihedral statistics work # for manually specified backbone # Arbitrarily specify backbone indices # The test should be robust to changing this backbone_inds = [i for i in range(beads) if i % 2 == 0] # Create a backbone-only coordinate data tensor data_tensor_bb_only = data_tensor[:, backbone_inds] stats_bb_inds = GeometryStatistics(data_tensor, backbone_inds=backbone_inds, get_all_distances=True, get_backbone_angles=True, get_backbone_dihedrals=True) stats_bb_only = GeometryStatistics(data_tensor_bb_only, backbone_inds='all', get_all_distances=True, get_backbone_angles=True, get_backbone_dihedrals=True) # Distances will be different because there are a different number # of beads in each dataset, but the bonds (which default to the adjacent # backbone beads unless bond_pairs are specified) will be the same # in each case, so we use return_indices to get only the "bond" distances # for testing stats_bb_inds_bond_dists = stats_bb_inds.distances[:, stats_bb_inds.return_indices(stats_bb_inds.bond_pairs)] stats_bb_only_bond_dists = stats_bb_only.distances[:, stats_bb_only.return_indices(stats_bb_only.bond_pairs)] np.testing.assert_allclose(stats_bb_inds_bond_dists, stats_bb_only_bond_dists) # Angles and dihedrals calculate the backbone only by default, so we don't # need to process these first np.testing.assert_allclose(stats_bb_inds.angles, stats_bb_only.angles) np.testing.assert_allclose(stats_bb_inds.dihedral_cosines, stats_bb_only.dihedral_cosines) np.testing.assert_allclose(stats_bb_inds.dihedral_sines, stats_bb_only.dihedral_sines) def test_manual_backbone_descriptions(): # Make sure backbone distance, angle, and dihedral descriptions work # for manually specified backbone # Arbitrarily specify backbone indices # The test should be robust to changing this backbone_inds = [i for i in range(beads) if i % 2 == 0] # Create a backbone-only coordinate data tensor data_tensor_bb_only = data_tensor[:, backbone_inds] stats_bb_inds = GeometryStatistics(data_tensor, backbone_inds=backbone_inds, get_all_distances=True, get_backbone_angles=True, get_backbone_dihedrals=True) stats_bb_only = GeometryStatistics(data_tensor_bb_only, backbone_inds='all', get_all_distances=True, get_backbone_angles=True, get_backbone_dihedrals=True) # Manually specify what all the descriptions should be bb_inds_bond_descs = [(backbone_inds[i], backbone_inds[i+1]) for i in range(len(backbone_inds)-1)] bb_only_bond_descs = [(i, i+1) for i in range(len(backbone_inds)-1)] bb_ind_angle_descs = [(backbone_inds[i], backbone_inds[i+1], backbone_inds[i+2]) for i in range(len(backbone_inds)-2)] bb_only_angle_descs = [(i, i+1, i+2) for i in range(len(backbone_inds)-2)] bb_ind_dihed_descs = [(backbone_inds[i], backbone_inds[i+1], backbone_inds[i+2], backbone_inds[i+3]) for i in range(len(backbone_inds)-3)] bb_only_dihed_descs = [(i, i+1, i+2, i+3) for i in range(len(backbone_inds)-3)] np.testing.assert_array_equal(stats_bb_inds.bond_pairs, bb_inds_bond_descs) np.testing.assert_array_equal(stats_bb_only.bond_pairs, bb_only_bond_descs) np.testing.assert_array_equal(stats_bb_inds.descriptions['Angles'], bb_ind_angle_descs) np.testing.assert_array_equal(stats_bb_only.descriptions['Angles'], bb_only_angle_descs) np.testing.assert_array_equal(stats_bb_inds.descriptions['Dihedral_cosines'], bb_ind_dihed_descs) np.testing.assert_array_equal(stats_bb_only.descriptions['Dihedral_cosines'], bb_only_dihed_descs) np.testing.assert_array_equal(stats_bb_inds.descriptions['Dihedral_sines'], bb_ind_dihed_descs) np.testing.assert_array_equal(stats_bb_only.descriptions['Dihedral_sines'], bb_only_dihed_descs) def test_backbone_means_and_stds(): # Make sure distance, angle, and dihedral statistics are consistent with # numpy feature_dist_mean = np.mean(geom_feature.distances.numpy(), axis=0) feature_dist_std = np.std(geom_feature.distances.numpy(), axis=0) np.testing.assert_allclose(feature_dist_mean, stats._stats_dict['Distances']['mean'], rtol=1e-6) np.testing.assert_allclose(feature_dist_std, stats._stats_dict['Distances']['std'], rtol=1e-6) feature_angle_mean = np.mean(geom_feature.angles.numpy(), axis=0) feature_angle_std = np.std(geom_feature.angles.numpy(), axis=0) np.testing.assert_allclose(feature_angle_mean, stats._stats_dict['Angles']['mean'], rtol=1e-5) np.testing.assert_allclose(feature_angle_std, stats._stats_dict['Angles']['std'], rtol=1e-5) feature_dihed_cos_mean = np.mean(geom_feature.dihedral_cosines.numpy(), axis=0) feature_dihed_cos_std = np.std(geom_feature.dihedral_cosines.numpy(), axis=0) feature_dihed_sin_mean = np.mean(geom_feature.dihedral_sines.numpy(), axis=0) feature_dihed_sin_std = np.std(geom_feature.dihedral_sines.numpy(), axis=0) np.testing.assert_allclose(feature_dihed_cos_mean, stats._stats_dict['Dihedral_cosines']['mean'], rtol=1e-4) np.testing.assert_allclose(feature_dihed_cos_std, stats._stats_dict['Dihedral_cosines']['std'], rtol=1e-4) np.testing.assert_allclose(feature_dihed_sin_mean, stats._stats_dict['Dihedral_sines']['mean'], rtol=1e-4) np.testing.assert_allclose(feature_dihed_sin_std, stats._stats_dict['Dihedral_sines']['std'], rtol=1e-4) def test_prior_statistics_shape_1(): # Make sure the "flipped" prior statistics dict has the right structure # We want to arbitrarily choose among the get_* arguments of # GeometryStatistics, so we create a bool_list that has at minimum # one True entry, and shuffle it bool_list = [True] + [bool(np.random.randint(2)) for _ in range(2)] np.random.shuffle(bool_list) stats_ = GeometryStatistics(data_tensor, backbone_inds='all', get_all_distances=bool_list[0], get_backbone_angles=bool_list[1], get_backbone_dihedrals=bool_list[2]) zscore_dict = stats_.get_prior_statistics(flip_dict=True) # The outer keys in the flipped dictionary are the feature tuples. # So we can calculate how many keys it should have by knowing how # many of each calculated feature there should be. n_keys = (bool_list[0]*beads*(beads-1)/2 + bool_list[1]*(beads-2) + bool_list[2]*2*(beads-3)) assert len(zscore_dict) == n_keys def test_prior_statistics_shape_2(): # Make sure the prior statistics dict has the right structure # We want to arbitrarily choose among the get_* arguments of # GeometryStatistics, so we create a bool_list that has at minimum # one True entry, and shuffle it bool_list = [True] + [bool(np.random.randint(2)) for _ in range(2)] np.random.shuffle(bool_list) stats_ = GeometryStatistics(data_tensor, backbone_inds='all', get_all_distances=bool_list[0], get_backbone_angles=bool_list[1], get_backbone_dihedrals=bool_list[2]) zscore_dict = stats_.get_prior_statistics(flip_dict=False) n_keys = (bool_list[0]*beads*(beads-1)/2 + bool_list[1]*(beads-2) + bool_list[2]*2*(beads-3)) # The INNER keys in the flipped dictionary are the feature tuples. # So we can calculate how many keys each entry of zscore_dict has # by knowing how many of each calculated feature there should be. for k in zscore_dict.keys(): assert len(zscore_dict[k]) == n_keys def test_prior_statistics(): # Make sure distance means and stds are returned correctly # Here we choose some random beads at which to start bonds and then # create bonds of random lengths for our random starts bond_starts = [np.random.randint(beads-4) for _ in range(4)] bond_starts = np.unique(bond_starts) custom_bond_pairs = [(bs, bs+np.random.randint(1, 5)) for bs in bond_starts] # We manually calculate the means and stds of the bond distances pair_means = [] pair_stds = [] for pair in sorted(custom_bond_pairs): pair_means.append(np.mean(np.linalg.norm(data[:, pair[1], :] - data[:, pair[0], :], axis=1))) pair_stds.append(np.std(np.linalg.norm(data[:, pair[1], :] - data[:, pair[0], :], axis=1))) # We input our custom bonds into stats, and see if they match our # manual calculations stats_dict = stats.get_prior_statistics(custom_bond_pairs, tensor=False) np.testing.assert_allclose(pair_means, [stats_dict[k]['mean'] for k in sorted(stats_dict.keys())], rtol=1e-6) np.testing.assert_allclose(pair_stds, [stats_dict[k]['std'] for k in sorted(stats_dict.keys())], rtol=1e-5) def test_prior_statistics_2(): # Make sure that prior statistics shuffle correctly # Here we create a shuffled list of feature tuples all_possible_features = stats.master_description_tuples my_inds = np.arange(len(all_possible_features)) np.random.shuffle(my_inds) cutoff = np.random.randint(1, len(my_inds)) my_inds = my_inds[:cutoff] all_stats = stats.get_prior_statistics() some_stats = stats.get_prior_statistics([all_possible_features[i] for i in my_inds]) # We make sure that the shuffling returns the correct statistics # by indexing all_corresponding_dicts by our shuffled feature tuples some_dicts = [some_stats[k] for k in some_stats.keys()] all_corresponding_dicts = [all_stats[k] for k in some_stats.keys()] np.testing.assert_array_equal(some_dicts, all_corresponding_dicts) def test_return_indices_shape_1(): # Test proper retrieval of feature indices for sizes # We want to arbitrarily choose among the get_* arguments of # GeometryStatistics, so we create a bool_list that has at minimum # one True entry, and shuffle it bool_list = [True] + [bool(np.random.randint(2)) for _ in range(2)] np.random.shuffle(bool_list) stats_ = GeometryStatistics(data_tensor, backbone_inds='all', get_all_distances=bool_list[0], get_backbone_angles=bool_list[1], get_backbone_dihedrals=bool_list[2]) # We know how many of each feature there should be, so we manually # calculate those numbers and compare them to what we get out. if bool_list[0]: assert len(stats_.return_indices('Distances')) == ( beads) * (beads - 1) / 2 assert len(stats_.return_indices('Bonds')) == beads - 1 if bool_list[1]: assert len(stats_.return_indices('Angles')) == beads - 2 if bool_list[2]: assert len(stats_.return_indices('Dihedral_cosines')) == beads - 3 assert len(stats_.return_indices('Dihedral_sines')) == beads - 3 sum_feats = np.sum([len(stats_.descriptions[feat_name]) for feat_name in stats_.order]) check_sum_feats = (bool_list[0] * (beads) * (beads - 1) / 2 + bool_list[1] * (beads - 2) + bool_list[2] * (beads - 3) * 2 ) assert sum_feats == check_sum_feats def test_return_indices_1(): # Test proper retrieval of
far. A list of the on-line status of all generators. overall_online = [g.online for g in case.generators] # The objective function value is the total system cost. overall_cost = solution["f"] # Best case for this stage. stage_online = overall_online stage_cost = overall_cost # Shutdown at most one generator per stage. while True: # 4. Form a candidate list of generators with minimum # generation limits binding. # Activate generators according to the stage best. for i, generator in enumerate(case.generators): generator.online = stage_online[i] # Get candidates for shutdown. Lagrangian multipliers are often # very small so we round to four decimal places. candidates = [g for g in case.online_generators if \ (round(g.mu_pmin, 4) > 0.0) and (g.p_min > 0.0)] if len(candidates) == 0: break # Assume no improvement during this stage. done = True i_stage += 1 logger.debug("De-commitment stage %d." % i_stage) for candidate in candidates: # 5. For each generator on the candidate list, solve an OPF to # find the total system cost with the generator shut down. # Activate generators according to the stage best. for i, generator in enumerate(case.generators): generator.online = stage_online[i] # Shutdown candidate generator. candidate.online = False logger.debug("Solving OPF with generator '%s' shutdown." % candidate.name) # Run OPF. solution = super(UDOPF, self).solve(solver_klass) # Compare total system costs for improvement. if solution["converged"] == True \ and (solution["f"] < overall_cost): logger.debug("System cost improvement: $%.3f ($%.3f)" % (stage_cost - solution["f"], solution["f"])) # 6. Replace the current best solution with this one if # it has a lower cost. overall_online = [g.online for g in case.generators] overall_cost = solution["f"] best_candidate = candidate # Check for further decommitment. done = False else: logger.debug("Candidate OPF failed [%s]." % solution["output"]["message"]) # Reactivate the candidate before deactivating the next. # candidate.online = True if done: # Decommits at this stage did not help. break else: # 7. If any of the candidate solutions produced an improvement, # return to step 3. # Shutting something else down helps, so let's keep going. logger.info("Shutting down generator '%s'.", best_candidate.name) stage_online = overall_online stage_cost = overall_cost # 8. Use the best overall solution as the final solution. for i, generator in enumerate(case.generators): generator.online = overall_online[i] # One final solve using the best case to ensure all results are # up-to-date. solution = super(UDOPF, self).solve(solver_klass) logger.debug("UDOPF system cost: $%.3f" % solution["f"]) # Compute elapsed time and log it. elapsed = time() - t0 plural = "" if i_stage == 1 else "s" logger.info("Unit decommitment OPF solved in %.3fs (%d decommitment " "stage%s)." % (elapsed, i_stage, plural)) return solution #------------------------------------------------------------------------------ # "OPFModel" class: #------------------------------------------------------------------------------ class OPFModel(object): """ Defines a model for optimal power flow. Based on @opf_model in MATPOWER by <NAME>, developed at PSERC Cornell. See U{http://www.pserc.cornell.edu/matpower/} for more info. """ def __init__(self, case): #: Case to which the model relates. self.case = case #: Optimisation variables. self.vars = [] #: Linear constraints. self.lin_constraints = [] #: Non-linear constraints. self.nln_constraints = [] #: User defined costs. self.costs = [] @property def var_N(self): return sum([v.N for v in self.vars]) def add_var(self, var): """ Adds a variable to the model. """ if var.name in [v.name for v in self.vars]: logger.error("Variable set named '%s' already exists." % var.name) return var.i1 = self.var_N var.iN = self.var_N + var.N - 1 self.vars.append(var) def add_vars(self, vars): """ Adds a set of variables to the model. """ for var in vars: self.add_var(var) def get_var(self, name): """ Returns the variable set with the given name. """ for var in self.vars: if var.name == name: return var else: raise ValueError def get_var_N(self, name): """ Return the number of variables in the named set. """ return self.get_var(name).N @property def nln_N(self): return sum([c.N for c in self.nln_constraints]) @property def lin_N(self): return sum([c.N for c in self.lin_constraints]) @property def lin_NS(self): return len(self.lin_constraints) def linear_constraints(self): """ Returns the linear constraints. """ if self.lin_N == 0: return None, array([]), array([]) A = lil_matrix((self.lin_N, self.var_N), dtype=float64) l = -Inf * ones(self.lin_N) u = -l for lin in self.lin_constraints: if lin.N: # non-zero number of rows to add Ak = lin.A # A for kth linear constrain set i1 = lin.i1 # starting row index iN = lin.iN # ending row index vsl = lin.vs # var set list kN = -1 # initialize last col of Ak used Ai = lil_matrix((lin.N, self.var_N), dtype=float64) for v in vsl: var = self.get_var(v) j1 = var.i1 # starting column in A jN = var.iN # ending column in A k1 = kN + 1 # starting column in Ak kN = kN + var.N # ending column in Ak if j1 == jN: # FIXME: Single column slicing broken in lil. for i in range(Ai.shape[0]): Ai[i, j1] = Ak[i, k1] else: Ai[:, j1:jN + 1] = Ak[:, k1:kN + 1] A[i1:iN + 1, :] = Ai l[i1:iN + 1] = lin.l u[i1:iN + 1] = lin.u return A.tocsr(), l, u def add_constraint(self, con): """ Adds a constraint to the model. """ if isinstance(con, LinearConstraint): N, M = con.A.shape if con.name in [c.name for c in self.lin_constraints]: logger.error("Constraint set named '%s' already exists." % con.name) return False else: con.i1 = self.lin_N# + 1 con.iN = self.lin_N + N - 1 nv = 0 for vs in con.vs: nv = nv + self.get_var_N(vs) if M != nv: logger.error("Number of columns of A does not match number" " of variables, A is %d x %d, nv = %d", N, M, nv) self.lin_constraints.append(con) elif isinstance(con, NonLinearConstraint): N = con.N if con.name in [c.name for c in self.nln_constraints]: logger.error("Constraint set named '%s' already exists." % con.name) return False else: con.i1 = self.nln_N# + 1 con.iN = self.nln_N + N self.nln_constraints.append(con) else: raise ValueError return True def add_constraints(self, constraints): """ Adds constraints to the model. """ for con in constraints: self.add_constraint(con) def get_lin_constraint(self, name): """ Returns the constraint set with the given name. """ for c in self.lin_constraints: if c.name == name: return c else: raise ValueError def get_nln_constraint(self, name): """ Returns the constraint set with the given name. """ for c in self.nln_constraints: if c.name == name: return c else: raise ValueError @property def cost_N(self): return sum([c.N for c in self.costs]) def get_cost_params(self): """ Returns the cost parameters. """ return [c.params for c in self.costs] #------------------------------------------------------------------------------ # "_Set" class: #------------------------------------------------------------------------------ class _Set(_Named): def __init__(self, name, N): #: String identifier. self.name = name #: Starting index. self.i0 = 0 #: Ending index. self.iN = 0 #: Number in set. self.N = N #: Number of sets. self.NS = 0 #: Ordered list of sets. self.order = [] #------------------------------------------------------------------------------ # "Variable" class: #------------------------------------------------------------------------------ class Variable(_Set): """ Defines a set of variables. """ def __init__(self, name, N, v0=None, vl=None , vu=None): """ Initialises a new Variable instance. """ super(Variable, self).__init__(name, N) #: Initial value of the variables. Zero by default. if v0 is None: self.v0 = zeros(N) else: self.v0 = v0 #: Lower bound on the variables. Unbounded below be default. if vl is None: self.vl = -Inf * ones(N) else: self.vl = vl #: Upper bound on the variables. Unbounded above by default. if vu is None: self.vu = Inf * ones(N) else: self.vu = vu #------------------------------------------------------------------------------ # "LinearConstraint" class: #------------------------------------------------------------------------------ class LinearConstraint(_Set): """ Defines a set of linear constraints. """ def __init__(self, name, AorN, l=None, u=None, vs=None): N, _ = AorN.shape super(LinearConstraint, self).__init__(name, N) self.A = AorN self.l = -Inf * ones(N) if l is None else l self.u = Inf * ones(N) if u is None else u # Varsets. self.vs = [] if vs is None else vs if (self.l.shape[0] != N) or (self.u.shape[0] != N): logger.error("Sizes of A, l and u must match.") #------------------------------------------------------------------------------ # "NonLinearConstraint" class: #------------------------------------------------------------------------------ class NonLinearConstraint(_Set): """ Defines a set of non-linear constraints. """ pass #------------------------------------------------------------------------------ # "Cost" class: #------------------------------------------------------------------------------ class Cost(_Set): def __init__(self): self.N = None self.H = None self.Cw = None self.dd = None self.rh = None self.kk = None self.mm = None self.vs = None self.params = None #
u('\u6e56\u5357\u7701\u682a\u6d32\u5e02')}, '861586975':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861586976':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861586977':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861586978':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861586979':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861586980':{'en': 'Chenzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u90f4\u5dde\u5e02')}, '861586981':{'en': 'Chenzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u90f4\u5dde\u5e02')}, '861586982':{'en': 'Chenzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u90f4\u5dde\u5e02')}, '861586983':{'en': 'Chenzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u90f4\u5dde\u5e02')}, '861586984':{'en': 'Chenzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u90f4\u5dde\u5e02')}, '861586985':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '861586986':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '861586987':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '861586988':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '861586989':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '861586990':{'en': 'Huaihua, Hunan', 'zh': u('\u6e56\u5357\u7701\u6000\u5316\u5e02')}, '861586991':{'en': 'Huaihua, Hunan', 'zh': u('\u6e56\u5357\u7701\u6000\u5316\u5e02')}, '861586992':{'en': 'Huaihua, Hunan', 'zh': u('\u6e56\u5357\u7701\u6000\u5316\u5e02')}, '861586993':{'en': 'Huaihua, Hunan', 'zh': u('\u6e56\u5357\u7701\u6000\u5316\u5e02')}, '861586994':{'en': 'Huaihua, Hunan', 'zh': u('\u6e56\u5357\u7701\u6000\u5316\u5e02')}, '861586995':{'en': 'Yongzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u6c38\u5dde\u5e02')}, '861586996':{'en': 'Yongzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u6c38\u5dde\u5e02')}, '861586997':{'en': 'Yongzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u6c38\u5dde\u5e02')}, '861586998':{'en': 'Yongzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u6c38\u5dde\u5e02')}, '861586999':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u6c38\u5dde\u5e02')}, '861587000':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u5357\u660c\u5e02')}, '861587001':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u5357\u660c\u5e02')}, '861587002':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u5357\u660c\u5e02')}, '861587003':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u5357\u660c\u5e02')}, '861587004':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u8d63\u5dde\u5e02')}, '861587005':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u666f\u5fb7\u9547\u5e02')}, '861587006':{'en': 'Jingdezhen, Jiangxi', 'zh': u('\u6c5f\u897f\u7701\u666f\u5fb7\u9547\u5e02')}, '861587007':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u840d\u4e61\u5e02')}, '861587008':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u840d\u4e61\u5e02')}, '861587009':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u65b0\u4f59\u5e02')}, '861587010':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u9075\u4e49\u5e02')}, '861587011':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u9075\u4e49\u5e02')}, '861587012':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u9075\u4e49\u5e02')}, '861587013':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u9075\u4e49\u5e02')}, '861587014':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u9075\u4e49\u5e02')}, '861587015':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u5b89\u987a\u5e02')}, '861587016':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u5b89\u987a\u5e02')}, '861587017':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u5b89\u987a\u5e02')}, '861587018':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u94dc\u4ec1\u5730\u533a')}, '861587019':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u94dc\u4ec1\u5730\u533a')}, '86158702':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u9ed4\u4e1c\u5357\u82d7\u65cf\u4f97\u65cf\u81ea\u6cbb\u5dde')}, '86158703':{'en': '<NAME>', 'zh': u('\u8d35\u5dde\u7701\u9ed4\u897f\u5357\u5e03\u4f9d\u65cf\u82d7\u65cf\u81ea\u6cbb\u5dde')}, '861587030':{'en': 'Liupanshui, Guizhou', 'zh': u('\u8d35\u5dde\u7701\u516d\u76d8\u6c34\u5e02')}, '861587031':{'en': 'Liupanshui, Guizhou', 'zh': u('\u8d35\u5dde\u7701\u516d\u76d8\u6c34\u5e02')}, '861587032':{'en': 'Liupanshui, Guizhou', 'zh': u('\u8d35\u5dde\u7701\u516d\u76d8\u6c34\u5e02')}, '86158704':{'en': 'Chongqing', 'zh': u('\u91cd\u5e86\u5e02')}, '86158705':{'en': 'Chongqing', 'zh': u('\u91cd\u5e86\u5e02')}, '86158706':{'en': 'Nanchang, Jiangxi', 'zh': u('\u6c5f\u897f\u7701\u5357\u660c\u5e02')}, '861587070':{'en': 'Ganzhou, Jiangxi', 'zh': u('\u6c5f\u897f\u7701\u8d63\u5dde\u5e02')}, '861587071':{'en': 'Ganzhou, Jiangxi', 'zh': u('\u6c5f\u897f\u7701\u8d63\u5dde\u5e02')}, '861587072':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u8d63\u5dde\u5e02')}, '861587073':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u8d63\u5dde\u5e02')}, '861587074':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u8d63\u5dde\u5e02')}, '861587075':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u629a\u5dde\u5e02')}, '861587076':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u629a\u5dde\u5e02')}, '861587077':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u629a\u5dde\u5e02')}, '861587078':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u629a\u5dde\u5e02')}, '861587079':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u629a\u5dde\u5e02')}, '86158708':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u4e5d\u6c5f\u5e02')}, '86158709':{'en': '<NAME>', 'zh': u('\u6c5f\u897f\u7701\u4e0a\u9976\u5e02')}, '86158710':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587108':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u5341\u5830\u5e02')}, '861587109':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u5341\u5830\u5e02')}, '86158711':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u9ec4\u77f3\u5e02')}, '861587110':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u5341\u5830\u5e02')}, '861587111':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u5341\u5830\u5e02')}, '861587112':{'en': 'Shiyan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5341\u5830\u5e02')}, '861587120':{'en': 'Huangshi, Hubei', 'zh': u('\u6e56\u5317\u7701\u9ec4\u77f3\u5e02')}, '861587121':{'en': 'Huangshi, Hubei', 'zh': u('\u6e56\u5317\u7701\u9ec4\u77f3\u5e02')}, '861587122':{'en': 'Suizhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u968f\u5dde\u5e02')}, '861587123':{'en': 'Suizhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u968f\u5dde\u5e02')}, '861587124':{'en': 'Suizhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u968f\u5dde\u5e02')}, '861587125':{'en': 'Suizhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u968f\u5dde\u5e02')}, '861587126':{'en': 'Xiaogan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b5d\u611f\u5e02')}, '861587127':{'en': 'Xiaogan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b5d\u611f\u5e02')}, '861587128':{'en': 'Xiaogan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b5d\u611f\u5e02')}, '861587129':{'en': 'Xiaogan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b5d\u611f\u5e02')}, '861587130':{'en': 'Xiaogan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b5d\u611f\u5e02')}, '861587131':{'en': 'Xiaogan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b5d\u611f\u5e02')}, '861587132':{'en': 'Xiaogan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b5d\u611f\u5e02')}, '861587133':{'en': 'Xiaogan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b5d\u611f\u5e02')}, '861587134':{'en': 'Xiaogan, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b5d\u611f\u5e02')}, '861587135':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587136':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587137':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587138':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587139':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '86158714':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '86158715':{'en': 'Yichang, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b9c\u660c\u5e02')}, '861587150':{'en': 'Ezhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u9102\u5dde\u5e02')}, '861587151':{'en': 'Ezhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u9102\u5dde\u5e02')}, '861587152':{'en': 'Ezhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u9102\u5dde\u5e02')}, '861587153':{'en': 'Ezhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u9102\u5dde\u5e02')}, '86158716':{'en': 'Yichang, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b9c\u660c\u5e02')}, '861587168':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587169':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '86158717':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '86158718':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587190':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587191':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587192':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587193':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587194':{'en': 'Xianning, Hubei', 'zh': u('\u6e56\u5317\u7701\u54b8\u5b81\u5e02')}, '861587195':{'en': 'Xianning, Hubei', 'zh': u('\u6e56\u5317\u7701\u54b8\u5b81\u5e02')}, '861587196':{'en': 'Xiangfan, Hubei', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587197':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587198':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8346\u95e8\u5e02')}, '861587199':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8346\u95e8\u5e02')}, '86158720':{'en': '<NAME>i', 'zh': u('\u6e56\u5317\u7701\u54b8\u5b81\u5e02')}, '861587209':{'en': 'Jingzhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u8346\u5dde\u5e02')}, '86158721':{'en': 'Jingzhou, Hubei', 'zh': u('\u6e56\u5317\u7701\u8346\u5dde\u5e02')}, '861587216':{'en': '<NAME>i', 'zh': u('\u6e56\u5317\u7701\u8346\u95e8\u5e02')}, '861587217':{'en': '<NAME>i', 'zh': u('\u6e56\u5317\u7701\u8346\u95e8\u5e02')}, '861587218':{'en': 'Jingmen, Hubei', 'zh': u('\u6e56\u5317\u7701\u8346\u95e8\u5e02')}, '861587219':{'en': 'Jingmen, Hubei', 'zh': u('\u6e56\u5317\u7701\u8346\u95e8\u5e02')}, '86158722':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587230':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587231':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587232':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587233':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587234':{'en': 'Xiangfan, Hubei', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587235':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587236':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587237':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587238':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587239':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587240':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587241':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587242':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587243':{'en': 'Wuhan, Hubei', 'zh': u('\u6e56\u5317\u7701\u6b66\u6c49\u5e02')}, '861587244':{'en': 'Xiangfan, Hubei', 'zh': u('\u6e56\u5317\u7701\u8944\u6a0a\u5e02')}, '861587245':{'en': 'Yichang, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b9c\u660c\u5e02')}, '861587246':{'en': 'Yichang, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b9c\u660c\u5e02')}, '861587247':{'en': 'Yichang, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b9c\u660c\u5e02')}, '861587248':{'en': 'Yichang, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b9c\u660c\u5e02')}, '861587249':{'en': 'Yichang, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b9c\u660c\u5e02')}, '86158725':{'en': 'Yichang, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b9c\u660c\u5e02')}, '86158726':{'en': 'Yichang, Hubei', 'zh': u('\u6e56\u5317\u7701\u5b9c\u660c\u5e02')}, '861587268':{'en': 'Sh<NAME>', 'zh': u('\u6e56\u5317\u7701\u5341\u5830\u5e02')}, '861587269':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u5341\u5830\u5e02')}, '86158727':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u5341\u5830\u5e02')}, '861587276':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u54b8\u5b81\u5e02')}, '861587277':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u54b8\u5b81\u5e02')}, '861587278':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u54b8\u5b81\u5e02')}, '861587279':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u54b8\u5b81\u5e02')}, '86158728':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u54b8\u5b81\u5e02')}, '861587288':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8346\u95e8\u5e02')}, '861587289':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8346\u95e8\u5e02')}, '86158729':{'en': '<NAME>', 'zh': u('\u6e56\u5317\u7701\u8346\u95e8\u5e02')}, '86158730':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u5cb3\u9633\u5e02')}, '86158731':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u957f\u6c99\u5e02')}, '86158732':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u6e58\u6f6d\u5e02')}, '86158733':{'en': 'Zhuzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u682a\u6d32\u5e02')}, '86158734':{'en': 'Hengyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u8861\u9633\u5e02')}, '86158735':{'en': 'Chenzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u90f4\u5dde\u5e02')}, '86158736':{'en': 'Changde, Hunan', 'zh': u('\u6e56\u5357\u7701\u5e38\u5fb7\u5e02')}, '861587370':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861587371':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861587372':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861587373':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861587374':{'en': 'Yiyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u76ca\u9633\u5e02')}, '861587375':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '861587376':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '861587377':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '861587378':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '861587379':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '86158738':{'en': 'Loudi, Hunan', 'zh': u('\u6e56\u5357\u7701\u5a04\u5e95\u5e02')}, '86158739':{'en': 'Shaoyang, Hunan', 'zh': u('\u6e56\u5357\u7701\u90b5\u9633\u5e02')}, '86158740':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u957f\u6c99\u5e02')}, '86158741':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u957f\u6c99\u5e02')}, '86158742':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u957f\u6c99\u5e02')}, '86158743':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u6e58\u897f\u571f\u5bb6\u65cf\u82d7\u65cf\u81ea\u6cbb\u5dde')}, '86158744':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u5f20\u5bb6\u754c\u5e02')}, '86158745':{'en': 'Hu<NAME>', 'zh': u('\u6e56\u5357\u7701\u6000\u5316\u5e02')}, '86158746':{'en': 'Yongzhou, Hunan', 'zh': u('\u6e56\u5357\u7701\u6c38\u5dde\u5e02')}, '86158747':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u8861\u9633\u5e02')}, '86158748':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u957f\u6c99\u5e02')}, '86158749':{'en': '<NAME>', 'zh': u('\u6e56\u5357\u7701\u957f\u6c99\u5e02')}, '86158750':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6c5f\u95e8\u5e02')}, '861587510':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u97f6\u5173\u5e02')}, '861587511':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u97f6\u5173\u5e02')}, '861587512':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u97f6\u5173\u5e02')}, '861587513':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u97f6\u5173\u5e02')}, '861587514':{'en': 'Yangjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u9633\u6c5f\u5e02')}, '861587515':{'en': 'Yangjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u9633\u6c5f\u5e02')}, '861587516':{'en': 'Yangjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u9633\u6c5f\u5e02')}, '861587517':{'en': 'Yangjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u9633\u6c5f\u5e02')}, '861587518':{'en': 'Yangjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u9633\u6c5f\u5e02')}, '861587519':{'en': 'Jieyang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u63ed\u9633\u5e02')}, '86158752':{'en': 'Huizhou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u60e0\u5dde\u5e02')}, '861587530':{'en': 'Guangzhou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u5e7f\u5dde\u5e02')}, '861587531':{'en': 'Guangzhou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u5e7f\u5dde\u5e02')}, '861587532':{'en': 'Guangzhou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u5e7f\u5dde\u5e02')}, '861587533':{'en': 'Guangzhou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u5e7f\u5dde\u5e02')}, '861587534':{'en': 'Guangzhou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u5e7f\u5dde\u5e02')}, '861587535':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '861587536':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '861587537':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '861587538':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '861587539':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '86158754':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '86158755':{'en': 'Shenzhen, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6df1\u5733\u5e02')}, '86158756':{'en': 'Zhuhai, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u73e0\u6d77\u5e02')}, '86158757':{'en': 'Foshan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4f5b\u5c71\u5e02')}, '861587580':{'en': 'Zhaoqing, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8087\u5e86\u5e02')}, '861587581':{'en': 'Zhaoqing, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8087\u5e86\u5e02')}, '861587582':{'en': 'Zhaoqing, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8087\u5e86\u5e02')}, '861587583':{'en': 'Zhaoqing, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8087\u5e86\u5e02')}, '861587584':{'en': 'Zhaoqing, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8087\u5e86\u5e02')}, '861587585':{'en': 'Maoming, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8302\u540d\u5e02')}, '861587586':{'en': 'Maoming, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8302\u540d\u5e02')}, '861587587':{'en': 'Maoming, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8302\u540d\u5e02')}, '861587588':{'en': 'Maoming, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8302\u540d\u5e02')}, '861587589':{'en': 'Maoming, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u8302\u540d\u5e02')}, '86158759':{'en': 'Zhanjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6e5b\u6c5f\u5e02')}, '86158760':{'en': 'Zhongshan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4e2d\u5c71\u5e02')}, '861587610':{'en': 'Foshan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4f5b\u5c71\u5e02')}, '861587611':{'en': 'Foshan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4f5b\u5c71\u5e02')}, '861587612':{'en': 'Foshan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4f5b\u5c71\u5e02')}, '861587613':{'en': 'Foshan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4f5b\u5c71\u5e02')}, '861587614':{'en': 'Foshan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4f5b\u5c71\u5e02')}, '861587615':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '861587616':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '861587617':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '861587618':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '861587619':{'en': 'Shantou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5934\u5e02')}, '861587620':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6cb3\u6e90\u5e02')}, '861587621':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6cb3\u6e90\u5e02')}, '861587622':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6cb3\u6e90\u5e02')}, '861587623':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6cb3\u6e90\u5e02')}, '861587624':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6cb3\u6e90\u5e02')}, '861587625':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6c5f\u95e8\u5e02')}, '861587626':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6c5f\u95e8\u5e02')}, '861587627':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6c5f\u95e8\u5e02')}, '861587628':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6c5f\u95e8\u5e02')}, '861587629':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6c5f\u95e8\u5e02')}, '86158763':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6e05\u8fdc\u5e02')}, '861587636':{'en': 'Zhanjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6e5b\u6c5f\u5e02')}, '861587637':{'en': 'Zhanjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6e5b\u6c5f\u5e02')}, '861587638':{'en': 'Zhanjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6e5b\u6c5f\u5e02')}, '861587639':{'en': 'Zhanjiang, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6e5b\u6c5f\u5e02')}, '86158764':{'en': 'Dongguan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4e1c\u839e\u5e02')}, '86158765':{'en': 'Guangzhou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u5e7f\u5dde\u5e02')}, '86158766':{'en': 'Zhuhai, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u73e0\u6d77\u5e02')}, '861587660':{'en': 'Yunfu, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4e91\u6d6e\u5e02')}, '861587661':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u4e91\u6d6e\u5e02')}, '861587670':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6885\u5dde\u5e02')}, '861587671':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6885\u5dde\u5e02')}, '861587672':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6885\u5dde\u5e02')}, '861587673':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6885\u5dde\u5e02')}, '861587674':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5c3e\u5e02')}, '861587675':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5c3e\u5e02')}, '861587676':{'en': '<NAME>', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5c3e\u5e02')}, '861587677':{'en': 'Shanwei, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6c55\u5c3e\u5e02')}, '861587678':{'en': 'Zhongshan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4e2d\u5c71\u5e02')}, '861587679':{'en': 'Zhongshan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4e2d\u5c71\u5e02')}, '86158768':{'en': 'Chaozhou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u6f6e\u5dde\u5e02')}, '861587689':{'en': 'Guangzhou, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u5e7f\u5dde\u5e02')}, '86158769':{'en': 'Dongguan, Guangdong', 'zh': u('\u5e7f\u4e1c\u7701\u4e1c\u839e\u5e02')}, '861587700':{'en': 'Guilin, Guangxi', 'zh': u('\u5e7f\u897f\u6842\u6797\u5e02')}, '861587701':{'en': 'Guilin, Guangxi', 'zh': u('\u5e7f\u897f\u6842\u6797\u5e02')}, '861587702':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u6842\u6797\u5e02')}, '861587703':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u6842\u6797\u5e02')}, '861587704':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u6842\u6797\u5e02')}, '861587705':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u7389\u6797\u5e02')}, '861587706':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u7389\u6797\u5e02')}, '861587707':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u7389\u6797\u5e02')}, '861587708':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u7389\u6797\u5e02')}, '861587709':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u7389\u6797\u5e02')}, '86158771':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u5357\u5b81\u5e02')}, '86158772':{'en': '<NAME>', 'zh': u('\u5e7f\u897f\u67f3\u5dde\u5e02')}, '861587730':{'en': '<NAME>', 'zh': u('\u9655\u897f\u7701\u6c49\u4e2d\u5e02')}, '861587731':{'en': '<NAME>', 'zh':
<reponame>Apteco/apteco-api<gh_stars>1-10 # coding: utf-8 """ Apteco API An API to allow access to Apteco Marketing Suite resources # noqa: E501 The version of the OpenAPI document: v2 Contact: <EMAIL> Generated by: https://openapi-generator.tech """ import pprint import re # noqa: F401 import six class CommunicationStatistics(object): """NOTE: This class is auto generated by OpenAPI Generator. Ref: https://openapi-generator.tech Do not edit the class manually. """ """ Attributes: openapi_types (dict): The key is attribute name and the value is attribute type. attribute_map (dict): The key is attribute name and the value is json key in definition. """ openapi_types = { 'days': 'list[str]', 'communications_counts': 'list[int]', 'total_communications_count': 'int', 'deliveries_counts': 'list[int]', 'total_deliveries_count': 'int', 'messages_counts': 'list[int]', 'total_messages_count': 'int', 'campaigns_counts': 'list[int]', 'total_campaigns_count': 'int', 'people_counts': 'list[int]', 'communication_statistics_timestamp': 'datetime', 'campaign_statistics_timestamp': 'datetime', 'people_statistics_timestamp': 'datetime' } attribute_map = { 'days': 'days', 'communications_counts': 'communicationsCounts', 'total_communications_count': 'totalCommunicationsCount', 'deliveries_counts': 'deliveriesCounts', 'total_deliveries_count': 'totalDeliveriesCount', 'messages_counts': 'messagesCounts', 'total_messages_count': 'totalMessagesCount', 'campaigns_counts': 'campaignsCounts', 'total_campaigns_count': 'totalCampaignsCount', 'people_counts': 'peopleCounts', 'communication_statistics_timestamp': 'communicationStatisticsTimestamp', 'campaign_statistics_timestamp': 'campaignStatisticsTimestamp', 'people_statistics_timestamp': 'peopleStatisticsTimestamp' } def __init__(self, days=None, communications_counts=None, total_communications_count=None, deliveries_counts=None, total_deliveries_count=None, messages_counts=None, total_messages_count=None, campaigns_counts=None, total_campaigns_count=None, people_counts=None, communication_statistics_timestamp=None, campaign_statistics_timestamp=None, people_statistics_timestamp=None): # noqa: E501 """CommunicationStatistics - a model defined in OpenAPI""" # noqa: E501 self._days = None self._communications_counts = None self._total_communications_count = None self._deliveries_counts = None self._total_deliveries_count = None self._messages_counts = None self._total_messages_count = None self._campaigns_counts = None self._total_campaigns_count = None self._people_counts = None self._communication_statistics_timestamp = None self._campaign_statistics_timestamp = None self._people_statistics_timestamp = None self.discriminator = None self.days = days self.communications_counts = communications_counts self.total_communications_count = total_communications_count self.deliveries_counts = deliveries_counts self.total_deliveries_count = total_deliveries_count self.messages_counts = messages_counts self.total_messages_count = total_messages_count self.campaigns_counts = campaigns_counts self.total_campaigns_count = total_campaigns_count self.people_counts = people_counts if communication_statistics_timestamp is not None: self.communication_statistics_timestamp = communication_statistics_timestamp if campaign_statistics_timestamp is not None: self.campaign_statistics_timestamp = campaign_statistics_timestamp if people_statistics_timestamp is not None: self.people_statistics_timestamp = people_statistics_timestamp @property def days(self): """Gets the days of this CommunicationStatistics. # noqa: E501 The set of days where communication information is available # noqa: E501 :return: The days of this CommunicationStatistics. # noqa: E501 :rtype: list[str] """ return self._days @days.setter def days(self, days): """Sets the days of this CommunicationStatistics. The set of days where communication information is available # noqa: E501 :param days: The days of this CommunicationStatistics. # noqa: E501 :type: list[str] """ if days is None: raise ValueError("Invalid value for `days`, must not be `None`") # noqa: E501 self._days = days @property def communications_counts(self): """Gets the communications_counts of this CommunicationStatistics. # noqa: E501 The set of counts representing the number of communications on the corresponding day. The first figure is data for the first day in the Days list, and so on. # noqa: E501 :return: The communications_counts of this CommunicationStatistics. # noqa: E501 :rtype: list[int] """ return self._communications_counts @communications_counts.setter def communications_counts(self, communications_counts): """Sets the communications_counts of this CommunicationStatistics. The set of counts representing the number of communications on the corresponding day. The first figure is data for the first day in the Days list, and so on. # noqa: E501 :param communications_counts: The communications_counts of this CommunicationStatistics. # noqa: E501 :type: list[int] """ if communications_counts is None: raise ValueError("Invalid value for `communications_counts`, must not be `None`") # noqa: E501 self._communications_counts = communications_counts @property def total_communications_count(self): """Gets the total_communications_count of this CommunicationStatistics. # noqa: E501 The total number of communications across all days # noqa: E501 :return: The total_communications_count of this CommunicationStatistics. # noqa: E501 :rtype: int """ return self._total_communications_count @total_communications_count.setter def total_communications_count(self, total_communications_count): """Sets the total_communications_count of this CommunicationStatistics. The total number of communications across all days # noqa: E501 :param total_communications_count: The total_communications_count of this CommunicationStatistics. # noqa: E501 :type: int """ if total_communications_count is None: raise ValueError("Invalid value for `total_communications_count`, must not be `None`") # noqa: E501 self._total_communications_count = total_communications_count @property def deliveries_counts(self): """Gets the deliveries_counts of this CommunicationStatistics. # noqa: E501 The set of counts representing the number of deliveries that have run on the corresponding day. The first figure is data for the first day in the Days list, and so on. # noqa: E501 :return: The deliveries_counts of this CommunicationStatistics. # noqa: E501 :rtype: list[int] """ return self._deliveries_counts @deliveries_counts.setter def deliveries_counts(self, deliveries_counts): """Sets the deliveries_counts of this CommunicationStatistics. The set of counts representing the number of deliveries that have run on the corresponding day. The first figure is data for the first day in the Days list, and so on. # noqa: E501 :param deliveries_counts: The deliveries_counts of this CommunicationStatistics. # noqa: E501 :type: list[int] """ if deliveries_counts is None: raise ValueError("Invalid value for `deliveries_counts`, must not be `None`") # noqa: E501 self._deliveries_counts = deliveries_counts @property def total_deliveries_count(self): """Gets the total_deliveries_count of this CommunicationStatistics. # noqa: E501 The total number of deliveries that have run across all days # noqa: E501 :return: The total_deliveries_count of this CommunicationStatistics. # noqa: E501 :rtype: int """ return self._total_deliveries_count @total_deliveries_count.setter def total_deliveries_count(self, total_deliveries_count): """Sets the total_deliveries_count of this CommunicationStatistics. The total number of deliveries that have run across all days # noqa: E501 :param total_deliveries_count: The total_deliveries_count of this CommunicationStatistics. # noqa: E501 :type: int """ if total_deliveries_count is None: raise ValueError("Invalid value for `total_deliveries_count`, must not be `None`") # noqa: E501 self._total_deliveries_count = total_deliveries_count @property def messages_counts(self): """Gets the messages_counts of this CommunicationStatistics. # noqa: E501 The set of counts representing the number of messages that have had at least one delivery run on the corresponding day. The first figure is data for the first day in the Days list, and so on. # noqa: E501 :return: The messages_counts of this CommunicationStatistics. # noqa: E501 :rtype: list[int] """ return self._messages_counts @messages_counts.setter def messages_counts(self, messages_counts): """Sets the messages_counts of this CommunicationStatistics. The set of counts representing the number of messages that have had at least one delivery run on the corresponding day. The first figure is data for the first day in the Days list, and so on. # noqa: E501 :param messages_counts: The messages_counts of this CommunicationStatistics. # noqa: E501 :type: list[int] """ if messages_counts is None: raise ValueError("Invalid value for `messages_counts`, must not be `None`") # noqa: E501 self._messages_counts = messages_counts @property def total_messages_count(self): """Gets the total_messages_count of this CommunicationStatistics. # noqa: E501 The total number of messages that have had at least one delivery run across all days # noqa: E501 :return: The total_messages_count of this CommunicationStatistics. # noqa: E501 :rtype: int """ return self._total_messages_count @total_messages_count.setter def total_messages_count(self, total_messages_count): """Sets the total_messages_count of this CommunicationStatistics. The total number of messages that have had at least one delivery run across all days # noqa: E501 :param total_messages_count: The total_messages_count of this CommunicationStatistics. # noqa: E501 :type: int """ if total_messages_count is None: raise ValueError("Invalid value for `total_messages_count`, must not be `None`") # noqa: E501 self._total_messages_count = total_messages_count @property def campaigns_counts(self): """Gets the campaigns_counts of this CommunicationStatistics. # noqa: E501 The set of counts representing the number of campaigns that have had at least one delivery run on the corresponding day. The first figure is data for the first day in the Days list, and so on. # noqa: E501 :return: The campaigns_counts of this CommunicationStatistics. # noqa: E501 :rtype: list[int] """ return self._campaigns_counts @campaigns_counts.setter def campaigns_counts(self, campaigns_counts): """Sets the campaigns_counts of this CommunicationStatistics. The set of counts representing the number of campaigns that have had at least one delivery run on the corresponding day. The first figure is data for the first day in the Days list, and so on. # noqa: E501 :param campaigns_counts: The campaigns_counts of this CommunicationStatistics. # noqa: E501 :type: list[int] """ if campaigns_counts is None: raise ValueError("Invalid value for `campaigns_counts`, must not be `None`") # noqa: E501 self._campaigns_counts = campaigns_counts @property def total_campaigns_count(self): """Gets the total_campaigns_count of this CommunicationStatistics. # noqa: E501 The total number of campaigns that have had at least one delivery run across all days # noqa: E501 :return: The total_campaigns_count of this CommunicationStatistics. # noqa: E501 :rtype: int """ return self._total_campaigns_count @total_campaigns_count.setter def total_campaigns_count(self, total_campaigns_count): """Sets the total_campaigns_count of this CommunicationStatistics. The total number of campaigns
other elif other%2 == 1: # odd power powL = self.__lo ** other powH = self.__hi ** other elif other < 0: if other%2 == 0: # even power if self.__lo >= 0: powL = self.__hi ** other powH = self.__lo ** other elif self.__hi < 0: powL = self.__lo ** other powH = self.__hi ** other else: # interval contains zero print("Error. \nThe interval contains zero, so negative powers should return \u00B1 Infinity") elif other%2 == 1: # odd power if self.__lo != 0: powL = self.__hi ** other powH = self.__lo ** other else: # interval contains zero print("Error. \nThe interval contains zero, so negative powers should return \u00B1 Infinity") elif otherType == "float": if self.__lo >= 0: if other > 0: powL = self.__lo ** other powH = self.__hi ** other elif other < 0: powL = self.__hi ** other powH = self.__lo ** other elif other == 0: powL = 1 powH = 1 return Interval(powL,powH) def __rpow__(self,left): raise TypeError('Interval exponents are not needed for this library.') def __lt__(self, other): if other.__class__.__name__ in intervalDataTypes(): return self.sup() < other.inf() elif other.__class__.__name__ in numberDataTypes(): return self.sup() < other def __rlt__(self,left): if left.__class__.__name__ in intervalDataTypes(): return left.sup() < self.inf() elif left.__class__.__name__ in numberDataTypes(): return left < self.inf() def __gt__(self, other): if other.__class__.__name__ in intervalDataTypes(): return self.inf() > other.sup() elif other.__class__.__name__ in numberDataTypes(): return self.inf() > other def __rgt__(self, left): if left.__class__.__name__ in intervalDataTypes(): return left.inf() > self.sup() elif left.__class__.__name__ in numberDataTypes(): return left > self.sup() def __le__(self, other): if other.__class__.__name__ in intervalDataTypes(): return self.sup() <= other.inf() elif other.__class__.__name__ in numberDataTypes(): return self.sup() <= other def __rle__(self,left): if left.__class__.__name__ in intervalDataTypes(): return left.sup() <= self.inf() elif left.__class__.__name__ in numberDataTypes(): return left <= self.inf() def __ge__(self, other): if other.__class__.__name__ in intervalDataTypes(): return self.inf() >= other.sup() elif other.__class__.__name__ in numberDataTypes(): return self.inf() >= other def __rge__(self, left): if left.__class__.__name__ in intervalDataTypes(): return left.inf() >= self.sup() elif left.__class__.__name__ in numberDataTypes(): return left >= self.sup() def __eq__(self, other): if other.__class__.__name__ in intervalDataTypes(): return hash(self)==hash(other) else: return False def __ne__(self,other): return not(self == other) #------------------------------------------------------------------------------------------------------ # Override arithmetic operators END #------------------------------------------------------------------------------------------------------ class ComplexInterval(): # simple complex interval class """ Created on Mon Jul 13 2020 Author: <NAME> University of Liverpool github.com/marcodeangelis GNU LGPL v3.0 In the *interval Fourier transform* code this class is only used for addition and scalar multiplication. Support for subintervalization was also removed to make the code slimmer. """ def __repr__(self): # return return "【%g%+gi, %g%+gi】"%(self.__lo.real,self.__lo.imag,self.__hi.real,self.__hi.imag) def __str__(self): # print return "【%g%+gi, %g%+gi】"%(self.__lo.real,self.__lo.imag,self.__hi.real,self.__hi.imag) def __init__(self,*args): if (args is None) | (len(args)==0): lo, hi = -1-1j, 1+1j if len(args)==1: lo, hi = args[0], args[0] if len(args)==2: lo, hi = args[0], args[1] self.__lo = lo self.__hi = hi # ------------------------------------ # ## ---- Class methods start here ---- ## def lo(self): return self.__lo def hi(self): return self.__hi def mid(self): return (self.__lo + self.__hi)/2 def rad(self): return (self.__hi - self.__lo)/2 def width(self): return self.__hi - self.__lo def stradzero(self): iszeroin = [False,False] if (self.__lo.real <= 0) & (self.__hi.real >= 0): iszeroin[0] = True if (self.__lo.imag <= 0) & (self.__hi.imag >= 0): iszeroin[1] = True return iszeroin def slider(self,p): return self.__lo + p * self.width() def real(self): return Interval(self.__lo.real, self.__hi.real) def imag(self): return Interval(self.__lo.imag, self.__hi.imag) def conjugate(self): return ComplexInterval(self.__lo.conjugate(),self.__hi.conjugate()) def absolute(self): return (self.real()**2 + self.imag()**2)**0.5 def __abs__(self): return self.absolute() ## ------ Class methods end here ------ ## #----------------------------------------# # Override arithmetical operations START # #----------------------------------------# def __add__(self,other): otherType = other.__class__.__name__ if otherType in numberDataTypes(): # add support for numpy addL = self.__lo + other addH = self.__hi + other return ComplexInterval(addL,addH) elif otherType in intervalDataTypes(): addL = self.__lo + other.lo() addH = self.__hi + other.hi() return ComplexInterval(addL,addH) else: raise TypeError('Addition only allowed between numbers.') def __radd__(self, left): leftType = left.__class__.__name__ if leftType in numberDataTypes(): return self.__add__(left) else: raise TypeError('Addition only allowed between numbers.') def __sub__(self, other): otherType = other.__class__.__name__ if otherType in numberDataTypes(): subL = self.__lo - other subH = self.__hi - other return ComplexInterval(subL,subH) elif otherType in intervalDataTypes(): subL = self.__lo - other.hi() subH = self.__hi - other.lo() return ComplexInterval(subL,subH) def __rsub__(self, left): leftType = left.__class__.__name__ if leftType in numberDataTypes(): subL = left - self.__hi subH = left - self.__lo return ComplexInterval(subL,subH) else: raise TypeError('Subtraction only allowed between numbers.') def __mul__(self,other): otherType = other.__class__.__name__ if otherType in numberDataTypes(): Real = self.real()*other.real - self.imag()*other.imag Imag = self.real()*other.imag + self.imag()*other.real mulL = Real.lo()+1j*Imag.lo() mulH = Real.hi()+1j*Imag.hi() return ComplexInterval(mulL,mulH) elif otherType in intervalDataTypes(): if otherType == 'ComplexInterval': Real = self.real()*other.real() - self.imag()*other.imag() Imag = self.real()*other.imag() + self.imag()*other.real() mulL = Real.lo()+1j*Imag.lo() mulH = Real.hi()+1j*Imag.hi() return ComplexInterval(mulL,mulH) else: Real = self.real()*other # - self.imag()*other.imag() Imag = self.imag()*other #self.real()*other.imag() + self.imag()*other.real() mulL = Real.lo()+1j*Imag.lo() mulH = Real.hi()+1j*Imag.hi() return ComplexInterval(mulL,mulH) def __rmul__(self, left): leftType = left.__class__.__name__ if leftType in numberDataTypes(): return self.__mul__(left) else: raise TypeError('Multiplication only allowed between numbers.') def __truediv__(self,other): otherType = other.__class__.__name__ if otherType in numberDataTypes(): a,b,c,d = self.real(), self.imag(), other.real, other.imag Real = (a*c + b*d)/(c**2 + d**2) Imag = (b*c - a*d)/(c**2 + d**2) divL = Real.lo()+1j*Imag.lo() divH = Real.hi()+1j*Imag.hi() return ComplexInterval(divL,divH) elif otherType in intervalDataTypes(): if otherType == 'ComplexInterval': a,b = self.real(), self.imag()#, other.real(), other.imag() a,b,c,d = self.real(), self.imag(), other.real(), other.imag() Real = (a*c + b*d)/(c**2 + d**2) Imag = (b*c - a*d)/(c**2 + d**2) divL = Real.lo()+1j*Imag.lo() divH = Real.hi()+1j*Imag.hi() return ComplexInterval(divL,divH) else: a,b,c = self.real(), self.imag(), other Real = a/c Imag = b/c divL = Real.lo()+1j*Imag.lo() divH = Real.hi()+1j*Imag.hi() return ComplexInterval(divL,divH) def __rtruediv__(self, left): leftType = left.__class__.__name__ if leftType in numberDataTypes(): if leftType in complexNumberTypes(): a,b,c,d = left.real, left.imag, self.real(), self.imag() Real = (a*c + b*d)/(c**2 + d**2) Imag = (b*c - a*d)/(c**2 + d**2) divL = Real.lo()+1j*Imag.lo() divH = Real.hi()+1j*Imag.hi() return ComplexInterval(divL,divH) else: a,c,d = left, self.real(), self.imag() Real = (a*c)/(c**2 + d**2) Imag = -(a*d)/(c**2 + d**2) divL = Real.lo()+1j*Imag.lo() divH = Real.hi()+1j*Imag.hi() return ComplexInterval(divL,divH) else: raise TypeError('Division only allowed between numbers.') #-------------------------------------# # Override arithmetical operations END #-------------------------------------# class IntervalVector(): # wrapper class of the scalar class interval with some plotting facilities """ Created on Mon Jul 24 17:09:51 2020 @author: <NAME> University of Liverpool github.com/marcodeangelis GNU LGPL v3.0 """ def __repr__(self): # return if len(self)>10: a = [str(i) for i in self] s = '\n'.join(a[:5]+['...']+a[-5:-1]) else: s = '\n'.join([str(i) for i in self]) return s def __str__(self): # print return self.__repr__() def __len__(self): return len([i for i in self]) def __init__(self,*args,notation='infsup',axis=1,name=''): self.name = name # initialise this with an empty string if len(args)==0: # what should an empty IntervalArray(object) look like? self.__lo = [-1] self.__hi = [1] elif len(args)==1: # this must be a list, tuple (array?) of intervals assert args[0].__class__.__name__ in ['list', 'tuple','IntervalVector'], 'single input must be list or a tuple of intervals.' if args[0][0].__class__.__name__ in ['Interval','ComplexInterval']: self.__lo = [x.lo() for x in args[0]] self.__hi = [x.hi() for x in args[0]] elif args[0][0].__class__.__name__ in ['list','tuple']: if axis == 0: assert len(args[0]) == 2, 'a list or tuple is needed.' self.__lo, self.__hi = args[0][0], args[0][1] elif axis == 1: self.__lo = list([x for x in zip(*args[0])][0]) self.__hi = list([x for x in zip(*args[0])][1]) elif len(args)==2: if args[0].__class__.__name__ == 'list': self.__lo, self.__hi = args[0], args[1] else: self.__lo = list() self.__hi = list() for a in args: if a.__class__.__name__ == 'tuple': self.__lo.append(a[0]) self.__hi.append(a[1]) elif a.__class__.__name__ == 'Interval': self.__lo.append(a.lo()) self.__hi.append(a.hi()) else: raise TypeError('multiple arguments must be a tuple or an interval.') def __iter__(self): # make class iterable for l,u in zip(self.__lo,self.__hi): yield Interval(l,u) def __getitem__(self,index): # make class subscrictable if index.__class__.__name__ in ['list','tuple']: if len(index)>0: return IntervalVector([Interval(self.__lo[i],self.__hi[i]) for i in index]) else: return IntervalVector([]) # todo: create empty dataset else: return Interval(self.__lo[index],self.__hi[index]) def inf(self): return self.__lo def lo(self): return self.__lo def sup(self): return self.__hi def hi(self): return self.__hi def tolist(self): return [Interval(l,h) for l,h in zip(self.__lo,self.__hi)] def toarray(self, order='F'): if order=='F': return numpy.array([self.__lo, self.__hi]) elif order=='C': return numpy.array([self.__lo, self.__hi]).T def slider(self,p=0.5): if p.__class__.__name__ in
child.""" def doFit(): size = self.GetBestChildSize() if size == self.ManagedChild.Size: return self.ManagedChild.Size = size self.AdjustToSize(size) self.Parent.ContainingSizer.Layout() self._fit = True doFit() wx.CallLater(1, doFit) # Might need recalculation after first layout def GetBestChildSize(self): """Returns size for managed child fitting content in resize directions.""" linesmax, widthmax = -1, -1 if "posix" == os.name: # GetLineLength() does not account for wrapped lines in linux w, dc = self.ManagedChild.Size[0], wx.ClientDC(self.ManagedChild) t = wx.lib.wordwrap.wordwrap(self.ManagedChild.Value, w, dc) linesmax = t.count("\n") # DoGetBorderSize() appears not implemented under Gtk borderw, borderh = (x / 2. for x in self.ManagedChild.GetWindowBorderSize()) else: while self.ManagedChild.GetLineLength(linesmax + 1) >= 0: linesmax += 1 t = self.ManagedChild.GetLineText(linesmax) widthmax = max(widthmax, self.ManagedChild.GetTextExtent(t)[0]) borderw, borderh = self.ManagedChild.DoGetBorderSize() _, charh = self.ManagedChild.GetTextExtent("X") size = self.Size size[0] -= wx.lib.resizewidget.RW_THICKNESS size[1] -= wx.lib.resizewidget.RW_THICKNESS if self._direction & wx.HORIZONTAL: size[0] = 2 * borderw + widthmax if self._direction & wx.VERTICAL: size[1] = 2 * borderh + charh * (linesmax + 1) return size def OnLeftDClick(self, event=None): """Handles the wx.EVT_LEFT_DCLICK event, toggling fit-mode on or off.""" if self._fit: self._fit = False self.ManagedChild.Size = self.ManagedChild.EffectiveMinSize self.AdjustToSize(self.ManagedChild.Size) self.Parent.ContainingSizer.Layout() else: self.Fit() def OnLeftUp(self, evt): """Handles the wx.EVT_LEFT_UP event.""" self._dragPos = None if self.HasCapture(): self.ReleaseMouse() self.InvalidateBestSize() def OnMouseLeave(self, event): """Handles the wx.EVT_LEAVE_WINDOW event.""" if not self.HasCapture() and self._resizeCursor: self.SetCursor(wx.Cursor(wx.CURSOR_ARROW)) self._resizeCursor = False def OnMouseMove(self, evt): """ Handles wx.EVT_MOTION event. Overrides inherited .OnMouseMove to constrain resize to configured directions only. """ pos = evt.GetPosition() if self._hitTest(pos) and self._resizeEnabled: if not self._resizeCursor: self.SetCursor(wx.Cursor(wx.CURSOR_SIZENWSE)) self._resizeCursor = True elif not self.HasCapture(): if self._resizeCursor: self.SetCursor(wx.Cursor(wx.CURSOR_ARROW)) self._resizeCursor = False if evt.Dragging() and self._dragPos is not None: self._fit = False delta, posDelta = wx.Size(), self._dragPos - pos if self._direction & wx.HORIZONTAL: delta[0] = posDelta[0] if self._direction & wx.VERTICAL: delta[1] = posDelta[1] newSize = self.GetSize() - delta self._adjustNewSize(newSize) if newSize != self.GetSize(): self.SetSize(newSize) self._dragPos = pos self._bestSize = newSize self.InvalidateBestSize() self._sendEvent() def OnSize(self, evt): """Handles wx.EVT_SIZE event, resizing control if control fitted.""" if self._ignoresizeevt: return super(ResizeWidget, self).OnSize(evt) if self._fit and not self._ignoresizeevt: self._ignoresizeevt = True wx.CallAfter(self.Fit) wx.CallLater(100, setattr, self, "_ignoresizeevt", False) def DoGetBestSize(self): """Returns the best size.""" if self.HasCapture(): return self._bestSize HANDLE = wx.lib.resizewidget.RW_THICKNESS c = self.ManagedChild size, csize = wx.Size(*self._bestSize), c.EffectiveMinSize # Allow external resizing to function from child size if not self._direction & wx.HORIZONTAL: size[0] = csize[0] + HANDLE if not self._direction & wx.VERTICAL: size[1] = csize[1] + HANDLE return size class SortableUltimateListCtrl(wx.lib.agw.ultimatelistctrl.UltimateListCtrl, wx.lib.mixins.listctrl.ColumnSorterMixin): """ A sortable list control that can be batch-populated, autosizes its columns, can be filtered by string value matched on any row column, supports clipboard copy. """ COL_PADDING = 30 SORT_ARROW_UP = wx.lib.embeddedimage.PyEmbeddedImage( "iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAABHNCSVQICAgIfAhkiAAAADxJ" "REFUOI1jZGRiZqA<KEY>P/f3/9kGwDTjM8QnAaga8JlCG3CAJdt2MQxDCAUaOjyjKMp" "cRAYAABS2CPsss3BWQAAAABJRU5ErkJggg==") #---------------------------------------------------------------------- SORT_ARROW_DOWN = wx.lib.embeddedimage.PyEmbeddedImage( "iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAABHNCSVQICAgIfAhkiAAAAEhJ" "<KEY>" "<KEY>) def __init__(self, *args, **kwargs): kwargs.setdefault("agwStyle", 0) if hasattr(wx.lib.agw.ultimatelistctrl, "ULC_USER_ROW_HEIGHT"): kwargs["agwStyle"] |= wx.lib.agw.ultimatelistctrl.ULC_USER_ROW_HEIGHT if hasattr(wx.lib.agw.ultimatelistctrl, "ULC_SHOW_TOOLTIPS"): kwargs["agwStyle"] |= wx.lib.agw.ultimatelistctrl.ULC_SHOW_TOOLTIPS wx.lib.agw.ultimatelistctrl.UltimateListCtrl.__init__(self, *args, **kwargs) wx.lib.mixins.listctrl.ColumnSorterMixin.__init__(self, 0) try: ColourManager.Manage(self._headerWin, "ForegroundColour", wx.SYS_COLOUR_BTNTEXT) ColourManager.Manage(self._mainWin, "BackgroundColour", wx.SYS_COLOUR_WINDOW) except Exception: pass self.itemDataMap = {} # {item_id: [values], } for ColumnSorterMixin self._data_map = {} # {item_id: row dict, } currently visible data self._id_rows = [] # [(item_id, {row dict}), ] all data items self._id_images = {} # {item_id: imageIds} self._columns = [] # [(name, label), ] self._filter = "" # Filter string self._col_widths = {} # {col_index: width in pixels, } self._col_maxwidth = -1 # Maximum width for auto-sized columns self._top_row = None # List top row data dictionary, if any self._drag_start = None # Item index currently dragged self.counter = lambda x={"c": 0}: x.update(c=1+x["c"]) or x["c"] self.AssignImageList(self._CreateImageList(), wx.IMAGE_LIST_SMALL) # Default row column formatter function frmt = lambda: lambda r, c: "" if r.get(c) is None else unicode(r[c]) self._formatters = collections.defaultdict(frmt) id_copy = wx.NewIdRef().Id entries = [(wx.ACCEL_CMD, x, id_copy) for x in KEYS.INSERT + (ord("C"), )] self.SetAcceleratorTable(wx.AcceleratorTable(entries)) self.Bind(wx.EVT_MENU, self.OnCopy, id=id_copy) self.Bind(wx.EVT_LIST_COL_CLICK, self.OnSort) self.Bind(wx.lib.agw.ultimatelistctrl.EVT_LIST_BEGIN_DRAG, self.OnDragStart) self.Bind(wx.lib.agw.ultimatelistctrl.EVT_LIST_END_DRAG, self.OnDragStop) self.Bind(wx.lib.agw.ultimatelistctrl.EVT_LIST_BEGIN_RDRAG, self.OnDragCancel) self.Bind(wx.EVT_SYS_COLOUR_CHANGED, self.OnSysColourChange) def GetScrollThumb(self, orientation): """Returns the scrollbar size in pixels.""" # Workaround for wxpython v4 bug of missing orientation parameter return self._mainWin.GetScrollThumb(orientation) if self._mainWin else 0 def GetScrollRange(self, orientation): """Returns the scrollbar range in pixels.""" # Workaround for wxpython v4 bug of missing orientation parameter return self._mainWin.GetScrollRange(orientation) if self._mainWin else 0 def GetSortImages(self): """For ColumnSorterMixin.""" return (0, 1) def AssignImages(self, images): """ Assigns images associated with the control. SetTopRow/AppendRow/InsertRow/Populate use imageIds from this list. @param images list of wx.Bitmap objects """ for x in images: self.GetImageList(wx.IMAGE_LIST_SMALL).Add(x) if hasattr(self, "SetUserLineHeight"): h = images[0].Size[1] self.SetUserLineHeight(int(h * 1.5)) def SetTopRow(self, data, imageIds=()): """ Adds special top row to list, not subject to sorting or filtering. @param data item data dictionary @param imageIds list of indexes for the images associated to top row """ self._top_row = data if imageIds: self._id_images[-1] = self._ConvertImageIds(imageIds) else: self._id_images.pop(-1, None) self._PopulateTopRow() def SetColumnFormatters(self, formatters): """ Sets the functions used for formatting displayed column values. @param formatters {col_name: function(rowdict, col_name), } """ self._formatters.clear() if formatters: self._formatters.update(formatters) def Populate(self, rows, imageIds=()): """ Populates the control with rows, clearing previous data, if any. Re-selects the previously selected row, if any. @param rows a list of data dicts @param imageIds list of indexes for the images associated to rows """ if rows: self._col_widths.clear() self._id_rows[:] = [] if imageIds: imageIds = self._ConvertImageIds(imageIds) for r in rows: item_id = self.counter() self._id_rows += [(item_id, r)] if imageIds: self._id_images[item_id] = imageIds self.RefreshRows() def AppendRow(self, data, imageIds=()): """ Appends the specified data to the control as a new row. @param data item data dictionary @param imageIds list of indexes for the images associated to this row """ self.InsertRow(self.GetItemCount(), data, imageIds) def InsertRow(self, index, data, imageIds=()): """ Inserts the specified data to the control at specified index as a new row. @param data item data dictionary @param imageIds list of indexes for the images associated to this row """ item_id = self.counter() if imageIds: imageIds = self._id_images[item_id] = self._ConvertImageIds(imageIds) index = min(index, self.GetItemCount()) if self._RowMatchesFilter(data): columns = [c[0] for c in self._columns] for i, col_name in enumerate(columns): col_value = self._formatters[col_name](data, col_name) if imageIds and not i: self.InsertImageStringItem(index, col_value, imageIds) elif not i: self.InsertStringItem(index, col_value) else: self.SetStringItem(index, i, col_value) self.SetItemData(index, item_id) self.itemDataMap[item_id] = [data[c] for c in columns] self._data_map[item_id] = data self.SetItemTextColour(index, self.ForegroundColour) self.SetItemBackgroundColour(index, self.BackgroundColour) self._id_rows.insert(index - (1 if self._top_row else 0), (item_id, data)) if self.GetSortState()[0] >= 0: self.SortListItems(*self.GetSortState()) def GetFilter(self): return self._filter def SetFilter(self, value, force_refresh=False): """ Sets the text to filter list by. Any row not containing the text in any column will be hidden. @param force_refresh if True, all content is refreshed even if filter value did not change """ if force_refresh or value != self._filter: self._filter = value if force_refresh: self._col_widths.clear() if self._id_rows: self.RefreshRows() def FindItem(self, text): """ Find an item whose primary label matches the text. @return item index, or -1 if not found """ for i in range(self.GetItemCount()): if self.GetItemText(i) == text: return i return -1 def RefreshRows(self): """ Clears the list and inserts all unfiltered rows, auto-sizing the columns. """ selected_ids, selected_idxs, selected = [], [], self.GetFirstSelected() while selected >= 0: selected_ids.append(self.GetItemData(selected)) selected_idxs.append(selected) selected = self.GetNextSelected(selected) self.Freeze() try: for i in selected_idxs: self._mainWin.SendNotify(i, wx.wxEVT_COMMAND_LIST_ITEM_DESELECTED) wx.lib.agw.ultimatelistctrl.UltimateListCtrl.DeleteAllItems(self) self._PopulateTopRow() self._PopulateRows(selected_ids) finally: self.Thaw() def RefreshRow(self, row): """Refreshes row with specified index from item data.""" if not self.GetItemCount(): return if row < 0: row = row % self.GetItemCount() data = not row and self._top_row or self._data_map.get(self.GetItemData(row)) if not data: return for i, col_name in enumerate([c[0] for c in self._columns]): col_value = self._formatters[col_name](data, col_name) self.SetStringItem(row, i, col_value) self.SetItemTextColour(row, self.ForegroundColour) self.SetItemBackgroundColour(row, self.BackgroundColour) def ResetColumnWidths(self): """Resets the stored column widths, triggering a fresh autolayout.""" self._col_widths.clear() self.RefreshRows() def DeleteItem(self, index): """Deletes the row at the specified index.""" item_id = self.GetItemData(index) data = self._data_map.get(item_id) del self._data_map[item_id] self._id_rows.remove((item_id, data)) self._id_images.pop(item_id, None) return wx.lib.agw.ultimatelistctrl.UltimateListCtrl.DeleteItem(self, index) def DeleteAllItems(self): """Deletes all items data and clears the list.""" self.itemDataMap = {} self._data_map = {} self._id_rows = [] for item_id in self._id_images: if item_id >= 0: self._id_images.pop(item_id) self.Freeze() try: result = wx.lib.agw.ultimatelistctrl.UltimateListCtrl.DeleteAllItems(self) self._PopulateTopRow() finally: self.Thaw() return result def GetItemCountFull(self): """Returns the full row count, including items hidden by filter.""" return len(self._id_rows) + bool(self._top_row) def GetItemTextFull(self,
<gh_stars>10-100 import base64 import datetime import jsonschema import os import pymongo import traceback import webapp2 from .. import util from .. import config from ..types import Origin from ..auth.authproviders import AuthProvider from ..auth.apikeys import APIKey from ..web import errors from elasticsearch import ElasticsearchException from ..dao.hierarchy import get_parent_tree from ..web.request import log_access, AccessType class RequestHandler(webapp2.RequestHandler): json_schema = None def __init__(self, request=None, response=None): # pylint: disable=super-init-not-called """Set uid, public_request, and superuser""" self.initialize(request, response) self.uid = None self.origin = None # If user is attempting to log in through `/login`, ignore Auth here: # In future updates, move login and logout handlers to class that overrides this init if self.request.path == '/api/login': return try: # TODO: This should be taken out of base.RequestHandler so `handle_exception()` # can properly catch exceptions raised by this logic as well as uninteded exceptions # For now, wrap in a try/catch to prevent stack traces from getting to the client # For more info see scitran/core #733 self.initialization_auth() except Exception as e: # pylint: disable=broad-except error = self.handle_exception(e, self.app.debug, return_json=True) self.abort(error['status_code'], error['message']) def initialize(self, request, response): super(RequestHandler, self).initialize(request, response) request.logger.debug("Initialized request") def initialization_auth(self): drone_request = False job_context = None session_token = self.request.headers.get('Authorization', None) drone_secret = self.request.headers.get('X-SciTran-Auth', None) drone_method = self.request.headers.get('X-SciTran-Method', None) drone_name = self.request.headers.get('X-SciTran-Name', None) if session_token: if session_token.startswith('<PASSWORD> '): # User (API key) authentication key = session_token.split()[1] api_key = APIKey.validate(key) self.uid = api_key['uid'] if 'job' in api_key: job_context = api_key['job'] elif session_token.startswith('sc<PASSWORD>-drone '): # Drone (API key) authentication # When supported, remove custom headers and shared secret self.abort(401, 'Drone API keys are not yet supported') else: # User (oAuth) authentication self.uid = self.authenticate_user_token(session_token) # Drone shared secret authentication elif drone_secret is not None: if drone_method is None or drone_name is None: self.abort(400, 'X-SciTran-Method or X-SciTran-Name header missing') if config.get_item('core', 'drone_secret') is None: self.abort(401, 'drone secret not configured') if drone_secret != config.get_item('core', 'drone_secret'): self.abort(401, 'invalid drone secret') drone_request = True self.public_request = not drone_request and not self.uid if self.public_request: self.superuser_request = False self.user_is_admin = False elif drone_request: self.superuser_request = True self.user_is_admin = True else: user = config.db.users.find_one({'_id': self.uid}, ['root', 'disabled']) if not user: self.abort(402, 'User {} will need to be added to the system before managing data.'.format(self.uid)) if user.get('disabled', False) is True: self.abort(402, 'User {} is disabled.'.format(self.uid)) if user.get('root'): self.user_is_admin = True else: self.user_is_admin = False if self.is_true('root'): if user.get('root'): self.superuser_request = True else: self.abort(403, 'user ' + self.uid + ' is not authorized to make superuser requests') else: self.superuser_request = False self.origin = None self.set_origin(drone_request, job_context) def authenticate_user_token(self, session_token): """ AuthN for user accounts. Calls self.abort on failure. Returns the user's UID. """ uid = None timestamp = datetime.datetime.utcnow() cached_token = config.db.authtokens.find_one({'_id': session_token}) if cached_token: # Check if site has inactivity timeout try: inactivity_timeout = config.get_item('site', 'inactivity_timeout') except KeyError: inactivity_timeout = None if inactivity_timeout: last_seen = cached_token.get('last_seen') # If now - last_seen is greater than inactivity timeout, clear out session if last_seen and (timestamp - last_seen).total_seconds() > inactivity_timeout: # Token expired and no refresh token, remove and deny request config.db.authtokens.delete_one({'_id': cached_token['_id']}) config.db.refreshtokens.delete({'uid': cached_token['uid'], 'auth_type': cached_token['auth_type']}) self.abort(401, 'Inactivity timeout') # set last_seen to now config.db.authtokens.update_one({'_id': cached_token['_id']}, {'$set': {'last_seen': timestamp}}) # Check if token is expired if cached_token.get('expires') and timestamp > cached_token['expires']: # look to see if the user has a stored refresh token: unverified_uid = cached_token['uid'] auth_type = cached_token['auth_type'] refresh_token = config.db.refreshtokens.find_one({'uid': unverified_uid, 'auth_type': cached_token['auth_type']}) if refresh_token: # Attempt to refresh the token, update db try: auth_provider = AuthProvider.factory(auth_type) except NotImplementedError as e: self.abort(401, str(e)) try: updated_token_info = auth_provider.refresh_token(refresh_token['token']) except errors.APIAuthProviderException as e: # Remove the bad refresh token and session token: config.db.refreshtokens.delete_one({'_id': refresh_token['_id']}) config.db.authtokens.delete_one({'_id': cached_token['_id']}) # TODO: Rework auth so it's not tied to init, then: # - Raise a refresh token exception specifically in this situation # - Alerts clients they may need to re-ask for `offline` permission # Until then, the key `invalid_refresh_token` alerts the client self.abort(401, 'invalid_refresh_token') config.db.authtokens.update_one({'_id': cached_token['_id']}, {'$set': updated_token_info}) else: # Token expired and no refresh token, remove and deny request config.db.authtokens.delete_one({'_id': cached_token['_id']}) self.abort(401, 'invalid_refresh_token') uid = cached_token['uid'] else: self.abort(401, 'Invalid session token') return uid @log_access(AccessType.user_login) def log_in(self): """ Return succcess boolean if user successfully authenticates. Used for access logging. Not required to use system as logged in user. """ payload = self.request.json_body if 'code' not in payload or 'auth_type' not in payload: self.abort(400, 'Auth code and type required for login') auth_type = payload['auth_type'] try: auth_provider = AuthProvider.factory(auth_type) except NotImplementedError as e: self.abort(400, str(e)) registration_code = payload.get('registration_code') token_entry = auth_provider.validate_code(payload['code'], registration_code=registration_code) timestamp = datetime.datetime.utcnow() self.uid = token_entry['uid'] # If this is the first time they've logged in, record that config.db.users.update_one({'_id': self.uid, 'firstlogin': None}, {'$set': {'firstlogin': timestamp}}) # Unconditionally set their most recent login time config.db.users.update_one({'_id': self.uid}, {'$set': {'lastlogin': timestamp}}) session_token = base64.urlsafe_b64encode(os.urandom(42)) token_entry['_id'] = session_token token_entry['timestamp'] = timestamp config.db.authtokens.insert_one(token_entry) # Set origin now that the uid is known self.set_origin(False, None) return {'token': session_token} @log_access(AccessType.user_logout) def log_out(self): """ Remove all cached auth tokens associated with caller's uid. """ token = self.request.headers.get('Authorization', None) if not token: self.abort(401, 'User not logged in.') result = config.db.authtokens.delete_one({'_id': token}) return {'tokens_removed': result.deleted_count} def set_origin(self, drone_request, job_context): """ Add an origin to the request object. Used later in request handler logic. Pretty clear duplication of logic with superuser_request / drone_request; this map serves a different purpose, and specifically matches the desired file-origin map. Might be a good future project to remove one or the other. """ if self.uid is not None: self.origin = { 'type': str(Origin.user), 'id': self.uid } if job_context: self.origin['via'] = { 'type': str(Origin.job), 'id': job_context } elif drone_request: method = self.request.headers.get('X-SciTran-Method') name = self.request.headers.get('X-SciTran-Name') self.origin = { 'id': (method + '_' + name).replace(' ', '_'), 'type': str(Origin.device), 'method': method, 'name': name } # Upsert device record, with last-contacted time. # In the future, consider merging any keys into self.origin? config.db['devices'].find_one_and_update({ '_id': self.origin['id'] }, { '$set': { '_id': self.origin['id'], 'last_seen': datetime.datetime.utcnow(), 'method': self.origin['method'], 'name': self.origin['name'], 'errors': [] # Reset errors list if device checks in } }, upsert=True, return_document=pymongo.collection.ReturnDocument.AFTER ) # Bit hackish - detect from route if a job is the origin, and if so what job ID. # Could be removed if routes get reorganized. POST /api/jobs/id/result, maybe? is_job_upload = self.request.path.startswith('/api/engine') job_id = self.request.GET.get('job') # This runs after the standard drone-request upsert above so that we can still update the last-seen timestamp. if is_job_upload and job_id is not None: self.origin = { 'type': str(Origin.job), 'id': job_id } else: self.origin = { 'type': str(Origin.unknown), 'id': None } def is_true(self, param): return self.request.GET.get(param, '').lower() in ('1', 'true') def get_param(self, param, default=None): return self.request.GET.get(param, default) def handle_exception(self, exception, debug, return_json=False): # pylint: disable=arguments-differ """ Send JSON response for exception For HTTP and other known exceptions, use its error code For all others use a generic 500 error code and log the stack trace """ request_id = self.request.id custom_errors = None message = str(exception) if isinstance(exception, webapp2.HTTPException): code = exception.code elif isinstance(exception, errors.InputValidationException): code = 400 elif isinstance(exception, errors.APIAuthProviderException): code = 401 elif isinstance(exception, errors.APIRefreshTokenException): code = 401 custom_errors = exception.errors elif isinstance(exception, errors.APIUnknownUserException): code = 402 elif isinstance(exception, errors.APIConsistencyException): code = 400 elif isinstance(exception, errors.APIPermissionException): custom_errors = exception.errors code = 403 elif isinstance(exception, errors.APINotFoundException): code = 404 elif isinstance(exception, errors.APIConflictException): code = 409 elif isinstance(exception, errors.APIValidationException): code = 422 custom_errors = exception.errors elif isinstance(exception, errors.FileStoreException): code = 400 elif isinstance(exception, errors.FileFormException): code = 400 elif isinstance(exception, errors.FileFormException): code = 400 elif isinstance(exception, ElasticsearchException): code = 503 message = "Search is currently down. Try again later." self.request.logger.error(traceback.format_exc()) elif isinstance(exception, KeyError): code = 500 message = "Key {} was not found".format(str(exception)) else: code = 500 if code == 500: tb = traceback.format_exc() self.request.logger.error(tb) if return_json: return util.create_json_http_exception_response(message, code, request_id, custom=custom_errors) util.send_json_http_exception(self.response, message, code, request_id, custom=custom_errors) def log_user_access(self, access_type, cont_name=None, cont_id=None, filename=None, multifile=False, origin_override=None): if not config.get_item('core', 'access_log_enabled'): return if not isinstance(access_type, AccessType): raise Exception('Unknown access type.') log_map = { 'access_type': access_type.value, 'request_method': self.request.method, 'request_path': self.request.path, 'origin': origin_override if origin_override is not None else self.origin, 'timestamp': datetime.datetime.utcnow() }
<filename>xcs_soxs/spectra.py from __future__ import division import numpy as np import subprocess import tempfile import shutil import os from xcs_soxs.utils import soxs_files_path, mylog, \ parse_prng, parse_value, soxs_cfg, line_width_equiv, \ DummyPbar from xcs_soxs.lib.broaden_lines import broaden_lines from xcs_soxs.constants import erg_per_keV, hc, \ cosmic_elem, metal_elem, atomic_weights, clight, \ m_u, elem_names, sigma_to_fwhm, abund_tables, sqrt2pi import astropy.io.fits as pyfits import astropy.units as u import h5py from scipy.interpolate import InterpolatedUnivariateSpline from xcs_soxs.instrument import AuxiliaryResponseFile from six import string_types from astropy.modeling.functional_models import \ Gaussian1D import glob from tqdm import tqdm class Energies(u.Quantity): def __new__(cls, energy, flux): ret = u.Quantity.__new__(cls, energy, unit="keV") ret.flux = u.Quantity(flux, "erg/(cm**2*s)") return ret def _generate_energies(spec, t_exp, rate, prng, quiet=False): cumspec = spec.cumspec n_ph = prng.poisson(t_exp*rate) if not quiet: mylog.info("Creating %d energies from this spectrum." % n_ph) randvec = prng.uniform(size=n_ph) randvec.sort() e = np.interp(randvec, cumspec, spec.ebins.value) if not quiet: mylog.info("Finished creating energies.") return e class Spectrum(object): _units = "photon/(cm**2*s*keV)" def __init__(self, ebins, flux): self.ebins = u.Quantity(ebins, "keV") self.emid = 0.5*(self.ebins[1:]+self.ebins[:-1]) self.flux = u.Quantity(flux, self._units) self.nbins = len(self.emid) self.de = self.ebins[1]-self.ebins[0] self._compute_total_flux() def _compute_total_flux(self): self.total_flux = self.flux.sum()*self.de self.total_energy_flux = (self.flux*self.emid.to("erg")).sum()*self.de/(1.0*u.photon) cumspec = np.cumsum(self.flux.value*self.de.value) cumspec = np.insert(cumspec, 0, 0.0) cumspec /= cumspec[-1] self.cumspec = cumspec self.func = lambda e: np.interp(e, self.emid.value, self.flux.value) def __add__(self, other): if self.nbins != other.nbins or \ not np.isclose(self.ebins.value, other.ebins.value).all(): raise RuntimeError("Energy binning for these two " "spectra is not the same!!") if self._units != other._units: raise RuntimeError("The units for these two spectra " "are not the same!") return Spectrum(self.ebins, self.flux+other.flux) def __mul__(self, other): if isinstance(other, AuxiliaryResponseFile): return ConvolvedSpectrum(self, other) else: return Spectrum(self.ebins, other*self.flux) __rmul__ = __mul__ def __truediv__(self, other): return Spectrum(self.ebins, self.flux/other) __div__ = __truediv__ def __repr__(self): s = "Spectrum (%s - %s)\n" % (self.ebins[0], self.ebins[-1]) s += " Total Flux:\n %s\n %s\n" % (self.total_flux, self.total_energy_flux) return s def __call__(self, e): if hasattr(e, "to_astropy"): e = e.to_astropy() if isinstance(e, u.Quantity): e = e.to("keV").value return u.Quantity(self.func(e), self._units) def get_flux_in_band(self, emin, emax): """ Determine the total flux within a band specified by an energy range. Parameters ---------- emin : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The minimum energy in the band, in keV. emax : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The maximum energy in the band, in keV. Returns ------- A tuple of values for the flux/intensity in the band: the first value is in terms of the photon rate, the second value is in terms of the energy rate. """ emin = parse_value(emin, "keV") emax = parse_value(emax, "keV") range = np.logical_and(self.emid.value >= emin, self.emid.value <= emax) pflux = self.flux[range].sum()*self.de eflux = (self.flux*self.emid.to("erg"))[range].sum()*self.de/(1.0*u.photon) return pflux, eflux @classmethod def from_xspec_script(cls, infile, emin, emax, nbins): """ Create a model spectrum using a script file as input to XSPEC. Parameters ---------- infile : string Path to the script file to use. emin : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The minimum energy of the spectrum in keV. emax : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The maximum energy of the spectrum in keV. nbins : integer The number of bins in the spectrum. """ f = open(infile, "r") xspec_in = f.readlines() f.close() return cls._from_xspec(xspec_in, emin, emax, nbins) @classmethod def from_xspec_model(cls, model_string, params, emin, emax, nbins): """ Create a model spectrum using a model string and parameters as input to XSPEC. Parameters ---------- model_string : string The model to create the spectrum from. Use standard XSPEC model syntax. Example: "wabs*mekal" params : list The list of parameters for the model. Must be in the order that XSPEC expects. emin : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The minimum energy of the spectrum in keV emax : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The maximum energy of the spectrum in keV nbins : integer The number of bins in the spectrum. """ xspec_in = [] model_str = "%s &" % model_string for param in params: model_str += " %g &" % param model_str += " /*" xspec_in.append("model %s\n" % model_str) return cls._from_xspec(xspec_in, emin, emax, nbins) @classmethod def from_xspec(cls, model_string, params, emin, emax, nbins): mylog.warning("The 'from_xspec' method has been deprecated: " "use 'from_xspec_model' instead.") cls.from_xspec_model(model_string, params, emin, emax, nbins) @classmethod def _from_xspec(cls, xspec_in, emin, emax, nbins): emin = parse_value(emin, "keV") emax = parse_value(emax, "keV") tmpdir = tempfile.mkdtemp() curdir = os.getcwd() os.chdir(tmpdir) xspec_in.append("dummyrsp %g %g %d lin\n" % (emin, emax, nbins)) xspec_in += ["set fp [open spec_therm.xspec w+]\n", "tclout energies\n", "puts $fp $xspec_tclout\n", "tclout modval\n", "puts $fp $xspec_tclout\n", "close $fp\n", "quit\n"] f_xin = open("xspec.in", "w") f_xin.writelines(xspec_in) f_xin.close() logfile = os.path.join(curdir, "xspec.log") with open(logfile, "ab") as xsout: subprocess.call(["xspec", "-", "xspec.in"], stdout=xsout, stderr=xsout) f_s = open("spec_therm.xspec", "r") lines = f_s.readlines() f_s.close() ebins = np.array(lines[0].split()).astype("float64") de = np.diff(ebins)[0] flux = np.array(lines[1].split()).astype("float64")/de os.chdir(curdir) shutil.rmtree(tmpdir) return cls(ebins, flux) @classmethod def from_powerlaw(cls, photon_index, redshift, norm, emin, emax, nbins): """ Create a spectrum from a power-law model. Parameters ---------- photon_index : float The photon index of the source. redshift : float The redshift of the source. norm : float The normalization of the source in units of photons/s/cm**2/keV at 1 keV in the source frame. emin : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The minimum energy of the spectrum in keV. emax : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The maximum energy of the spectrum in keV. nbins : integer The number of bins in the spectrum. """ emin = parse_value(emin, 'keV') emax = parse_value(emax, 'keV') ebins = np.linspace(emin, emax, nbins+1) emid = 0.5*(ebins[1:]+ebins[:-1]) flux = norm*(emid*(1.0+redshift))**(-photon_index) return cls(ebins, flux) @classmethod def from_file(cls, filename): """ Read a spectrum from an ASCII or HDF5 file. If ASCII: accepts a file with two columns, the first being the center energy of the bin in keV and the second being the spectrum in the appropriate units, assuming a linear binning with constant bin widths. If HDF5: accepts a file with one array dataset, named "spectrum", which is the spectrum in the appropriate units, and two scalar datasets, "emin" and "emax", which are the minimum and maximum energies in keV. Parameters ---------- filename : string The path to the file containing the spectrum. """ if filename.endswith(".h5"): f = h5py.File(filename, "r") flux = f["spectrum"][()] nbins = flux.size ebins = np.linspace(f["emin"][()], f["emax"][()], nbins+1) f.close() else: emid, flux = np.loadtxt(filename, unpack=True) de = np.diff(emid)[0] ebins = np.append(emid-0.5*de, emid[-1]+0.5*de) return cls(ebins, flux) @classmethod def from_constant(cls, const_flux, emin, emax, nbins): """ Create a spectrum from a constant model using XSPEC. Parameters ---------- const_flux : float The value of the constant flux in the units of the spectrum. emin : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The minimum energy of the spectrum in keV. emax : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The maximum energy of the spectrum in keV. nbins : integer The number of bins in the spectrum. """ emin = parse_value(emin, "keV") emax = parse_value(emax, 'keV') ebins = np.linspace(emin, emax, nbins+1) flux = const_flux*np.ones(nbins) return cls(ebins, flux) def new_spec_from_band(self, emin, emax): """ Create a new :class:`~xcs_soxs.spectra.Spectrum` object from a subset of an existing one defined by a particular energy band. Parameters ---------- emin : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The minimum energy of the band in keV. emax : float, (value, unit) tuple, or :class:`~astropy.units.Quantity` The maximum energy of the band in keV. """ emin = parse_value(emin, "keV") emax = parse_value(emax, 'keV') band = np.logical_and(self.ebins.value >= emin, self.ebins.value <= emax) idxs = np.where(band)[0] ebins = self.ebins.value[idxs] flux = self.flux.value[idxs[:-1]] return Spectrum(ebins, flux) def rescale_flux(self, new_flux, emin=None, emax=None, flux_type="photons"): """ Rescale the flux of the spectrum, optionally using a specific energy band. Parameters ---------- new_flux : float The new flux in units of photons/s/cm**2. emin : float, (value, unit) tuple, or :class:`~astropy.units.Quantity`, optional The minimum energy of the band to consider, in keV. Default: Use the minimum energy of the entire spectrum. emax : float, (value, unit) tuple, or :class:`~astropy.units.Quantity`, optional The maximum energy of the band to consider, in keV. Default: Use the maximum energy
configuration of the " f"reader {get_full_module_name(reader)} cannot be serialized " "in JSON. To resolve this issue, you can consider implementing" " a JSON serialization for that parameter type or changing the" " parameters of this reader. Note that in order for the reader" " to be serialized in JSON, all the variables defined in both " "the default_configs and the configuration passed in during " "pipeline.set_reader() need to be JSON-serializable. You can " "find in the stack trace the type of the un-serializable " "parameter." ), "component": lambda component: ( "One component of the pipeline cannot be JSON serialized. This" " is likely due to some parameters in the configuration of the" f" component {get_full_module_name(component)} cannot be " "serialized in JSON. To resolve this issue, you can consider " "implementing a JSON serialization for that parameter type or " "changing the parameters of the component. Note that in order " "for the component to be serialized in JSON, all the variables" " defined in both the default_configs and the configuration " "passed in during pipeline.add() need to be JSON-serializable." " You can find in the stack trace the type of the " "un-serializable parameter." ), "selector": lambda selector: ( "A selector cannot be JSON serialized. This is likely due to " "some __init__ parameters for class " f"{get_full_module_name(selector)} cannot be serialized in " "JSON. To resolve this issue, you can consider implementing a " "JSON serialization for that parameter type or changing the " "signature of the __init__ function. You can find in the stack" " trace the type of the un-serializable parameter." ), } configs: Dict = { "forte_ir_version": FORTE_IR_VERSION, "components": [], "states": {}, } # Serialize pipeline components configs["components"].append( { "type": get_full_module_name(self._reader), "configs": test_jsonable( test_dict=self._reader_config.todict(), err_msg=get_err_msg["reader"](self._reader), ), } ) for component, config, selector, selector_config in zip( self.components, self.component_configs, self._selectors, self._selectors_configs, ): configs["components"].append( { "type": get_full_module_name(component), "configs": test_jsonable( test_dict=config.todict(), err_msg=get_err_msg["component"](component), ), "selector": { "type": get_full_module_name(selector), "configs": test_jsonable( # pylint: disable=protected-access test_dict=selector_config.todict(), # pylint: enable=protected-access err_msg=get_err_msg["selector"](selector), ), }, } ) # Serialize current states of pipeline configs["states"].update( { "attribute": { attr: getattr(self, attr) for attr in ( "_initialized", "_enable_profiling", "_check_type_consistency", "_do_init_type_check", ) if hasattr(self, attr) }, "resource": {}, } ) if self.resource.contains("onto_specs_dict"): configs["states"]["resource"].update( {"onto_specs_dict": self.resource.get("onto_specs_dict")} ) if self.resource.contains("merged_entry_tree"): configs["states"]["resource"].update( { "merged_entry_tree": self.resource.get( "merged_entry_tree" ).todict() } ) return configs def save(self, path: str): r"""Store the pipeline as an IR(intermediate representation) in yaml. The path can then be passed to ``init_from_config_path`` to initialize a pipeline. Note that calling ``init_from_config`` from a different python environment may not work for some self defined component classes because their module name is `__main__`. Args: path: The file path to save configurations. """ with open(path, "w", encoding="utf-8") as f: yaml.safe_dump(self._dump_to_config(), f) def _remote_service_app( self, service_name: str = "", input_format: str = "string" ): r"""Return a FastAPI app that can be used to serve the pipeline. Args: service_name: Assign a name to the pipeline service for validation. This will appear in the `service_name` field on default page and can be queried and validated against the expected service name set by user. Default to `''`. input_format: Specify format of the input for validation. It can be `"string"` or `"DataPack"`. This will appear in the `input_format` field on default page and can be queried and validated against the expected input format set by user. Default to `"string"`. Returns: FastAPI: A FastAPI app for remote service. """ # TODO: Currently we only support the `process` function, but it can # be extended by adding new interfaces that wrap up any Pipeline # method. Refer to https://fastapi.tiangolo.com for more info. app = FastAPI() records: Optional[Dict[str, Set[str]]] = None class RequestBody(BaseModel): args: str = "[]" kwargs: str = "{}" # pylint: disable=unused-variable @app.get("/") def default_page(): return { "status": "OK", "service_name": service_name, "input_format": input_format, "pipeline": self._dump_to_config(), } @app.get("/records") def get_records(): nonlocal records if records is None: # Collect records of each pipeline component for validation records = {} for component in [self._reader] + self.components: component.record(records) return {"status": "OK", "records": records} @app.get("/expectation") def get_expectation(): expectation: Dict[str, Set[str]] = {} if len(self.components) > 0: expectation = self.components[0].expected_types_and_attributes() return {"status": "OK", "expectation": expectation} @app.post("/process") def run_pipeline(body: RequestBody): args = json.loads(body.args) kwargs = json.loads(body.kwargs) result = self.process(*args, **kwargs) return {"status": "OK", "result": result.to_string()} # pylint: enable=unused-variable return app def serve( self, host: str = "localhost", port: int = 8008, service_name: str = "", input_format: str = "string", ): r"""Start a service of the current pipeline at a specified host and port. Args: host: Port number of pipeline service. port: Host name of pipeline service. service_name: Assign a name to the pipeline service for validation. This will appear in the `service_name` field on default page and can be queried and validated against the expected service name set by user. Default to `''`. input_format: Specify format of the input for validation. It can be `"string"` or `"DataPack"`. This will appear in the `input_format` field on default page and can be queried and validated against the expected input format set by user. Default to `"string"`. """ self.initialize() uvicorn.run( self._remote_service_app( service_name=service_name, input_format=input_format ), host=host, port=port, log_level="info", ) def set_profiling(self, enable_profiling: bool = True): r"""Set profiling option. Args: enable_profiling: A boolean of whether to enable profiling for the pipeline or not (the default is True). """ self._enable_profiling = enable_profiling def initialize(self) -> "Pipeline": """ This function should be called before the pipeline can be used to process the actual data. This function will call the `initialize` of all the components inside this pipeline. Returns: """ # create EntryTree type object merged_entry_tree to store the parsed # entry tree from ontology specification file passed in as part of # resource and add the result to resource with key of merged_entry_tree. merged_entry_tree = EntryTree() if self.resource.get("onto_specs_path"): OntologyCodeGenerator().parse_schema_for_no_import_onto_specs_file( ontology_path=self.resource.get("onto_specs_path"), ontology_dict=self.resource.get("onto_specs_dict"), merged_entry_tree=merged_entry_tree, ) self.resource.update(merged_entry_tree=merged_entry_tree) # The process manager need to be assigned first. self._proc_mgr = ProcessManager(len(self._components)) if self._initialized: # The pipeline has already been initialized, so we are doing # re-initialization here. logging.info("Re-initializing the Pipeline.") # Reset the flags of the components before initializing them. self._reader.reset_flags() for c in self._components: c.reset_flags() # Handle the reader. if not self._reader.is_initialized: self._reader.initialize(self.resource, self._reader_config) else: logging.info( "The reader [%s] has already initialized, " "will skip its initialization.", self._reader.name, ) if self._check_type_consistency: self.reader.enforce_consistency(enforce=True) else: self.reader.enforce_consistency(enforce=False) # Handle other components and their selectors. self.initialize_components() self.initialize_selectors() self._initialized = True # Create profiler if self._enable_profiling: self.reader.set_profiling(True) self._profiler = [0.0] * len(self.components) # Check record types and attributes of each pipeline component if self._do_init_type_check: current_records: Dict[str, Set[str]] = {} self._reader.record(current_records) for component in self.components: if hasattr(component, "expected_types_and_attributes"): record_types_and_attributes_check( component.expected_types_and_attributes(), # type: ignore current_records, ) if hasattr(component, "record"): component.record(current_records) # type: ignore return self def initialize_components(self): """ This function will initialize all the components in this pipeline, except the reader. The components are initialized in a FIFO manner based on the order of insertion, During initialization, the component will be configured based on its corresponding configuration. However, if the component is already initialized (for example, being initialized manually or used twice in the same pipeline), the new configuration will be ignored. The pipeline will check for type dependencies between the components inside this pipeline, see :func:`~forte.pipeline_component.PipelineComponent.enforce_consistency` for more details. """ for component, config in zip(self.components, self.component_configs): try: if not component.is_initialized: component.initialize(self.resource, config) else: logging.info( "The component [%s] has already initialized, " "will skip its initialization.", component.name, ) except ProcessorConfigError as e: logging.error( "Exception occur when initializing " "processor %s", component.name, ) raise e component.enforce_consistency(enforce=self._check_type_consistency) def initialize_selectors(self): """ This function will reset the states of selectors """ for selector, config in zip(self._selectors, self._selectors_configs): try: selector.initialize(config) except ValueError as e: logging.error("Exception occur when initializing selectors") raise e def set_reader( self, reader: BaseReader, config: Optional[Union[Config, Dict[str, Any]]] = None, ) -> "Pipeline": """ Set the reader of the pipeline. A reader is the entry point of this pipeline, data flown
dbgDict = self.calcRewardAndCheckDone(debug) #observation of current state obs = self.getObs() if (self.checkBestState) and (rwd > self.bestStRwd): self.bestStRwd = rwd self.bestState = self.state_vector() #ob, reward, done, infoDict return obs, rwd, done, d, dbgDict #calculate the distance between the COm projected onto the level of the COP and the COP itself #if no COP val passed, derive current COP val def calcCOMCOPDist(self, COM, COPVal): COMatCOPHt = np.copy(COM) COMatCOPHt[1] = COPVal[1] #distance is just x/z distCOMCop = np.linalg.norm(COMatCOPHt - COPVal) #distance between COM projected to plane of foot and COP - want to be small return distCOMCop #return skeleton qdot - maybe clipped, maybe not def getSkelqDot(self): return np.clip(self.skel.dq, -self.qDotBnd , self.qDotBnd ) #base check goal functionality - this should be same for all agents, #access by super() def checkSimIsBroken(self): s = self.state_vector() if not(self.isFrwrdSim):#if not frwrd simed then sim won't be broken return False, s, 'FINE' if not (np.isfinite(s).all()): return True, s, 'INFINITE' if not ((np.abs(s[2:]) < 1000).all()): return True, s, 'EXPLODE' return False, s, 'FINE' def checkBNinNameList(self, name, nameList): return any(name in bodyNodeName for bodyNodeName in nameList) #check if passed body nodes are on two different, non-ground, skeletons - return true #don't want this - skeletons should not contact each other except through the ball joint constraint def checkBNKickOtr(self, bn1, bn2): if ('ground' in bn1.name) or ('ground' in bn2.name): return False #if not touching ground, then this is bad contact between robot and ANA - need to check if eef contact, which is good #if != then they are different skeletons contacting each other return (bn1.skel.name != bn2.skel.name) #returns dictionary of per-body node contact info objects def getMyContactInfo(self): allCntctInfo = self.env.getContactInfo() return allCntctInfo[self.skel.name] #returns true only if one body node is a foot on this skeleton and the other is the ground in a contact #also returns body node that is responsible for contact (not ground) whether foot or not def checkMyFootWithGround(self, bn1, bn2): if ('ground' in bn1.name) : return (self.checkBNinNameList(bn2.name, self.feetBodyNames) and (self.skel.name == bn2.skel.name)), bn2 elif ('ground' in bn2.name) : return (self.checkBNinNameList(bn1.name, self.feetBodyNames) and (self.skel.name == bn1.skel.name)), bn1 return False, None #calculate average foot body locations based on COM def calcAvgFootBodyLoc(self): avgFootLoc = np.zeros(3) avgLFootLoc = np.zeros(3) avgRtFootLoc = np.zeros(3) if(len(self.feetBodyNames) >0): for ftBdyName in self.leftFootBodyNames: footLoc = self.skel.body(ftBdyName).com() avgFootLoc += footLoc avgLFootLoc += footLoc avgLFootLoc /= len(self.leftFootBodyNames) for ftBdyName in self.rightFootBodyNames: footLoc = self.skel.body(ftBdyName).com() avgFootLoc += footLoc avgRtFootLoc += footLoc avgLFootLoc /= len(self.rightFootBodyNames) #for each body considered part of a "foot" # for ftBdyName in self.feetBodyNames: # avgFootLoc += self.skel.body(ftBdyName).com() avgFootLoc /= len(self.feetBodyNames) else : print('skelHolder::calcAvgFootBodyLoc : No feet for skelholder {} defined in self.feetBodyNames so avg loc is origin'.format(self.name)) return [avgFootLoc, avgLFootLoc, avgRtFootLoc] #calculate contact's contribution to total contact torques around distant point for COP derivation #cntctBN : the body node in contact with the ground #contact : the contact object def calcSumTrqsForCOP(self, cntctBN, contact): trqPt = contact.point - self.env.ctrTauPt # if(contact.point[1] != 0): # print('!!!!!!!!!!!!!!!!!!!!!! non zero ground contact y : {}'.format(contact.point)) new_COP_tau = np.cross(trqPt, contact.force) new_COP_ttlFrc = contact.force return new_COP_tau,new_COP_ttlFrc #calculate foot contact count and other terms if we want to use them for reward calc def calcAllContactData(self): contacts = self.env.dart_world.collision_result.contacts contactDict = defaultdict(float) COPval = np.zeros(3) COP_tau = np.zeros(3) COP_ttlFrc = np.zeros(3) #tau = loc x frc #COP calculation is the location that, when crossed with total force, will give total moment #we can calculate total moment by crossing all contact forces with all contact locations #we can get total force, and from this we can find the location that would produce the total #torque given the total force (by first constraining one of the dimensions of the point in question) #we choose to constrain the y coordinate to be 0 since we want the cop on the ground for contact in contacts: if (self.skel.name != contact.bodynode1.skeleton.name ) and (self.skel.name != contact.bodynode2.skeleton.name ) : #contact not from this skeleton continue #penalize contact between the two skeletons - getup-human should not touch assistant bot except with assisting hand #only true if one skel contacts other and the other is not the ground - i.e. non-ground non-self contact if self.checkBNKickOtr(contact.bodynode1, contact.bodynode2): contactDict['kickBotContacts'] +=1 #only true if feet are contacting skeleton - kicking self - i.e. non-ground self contact elif (contact.bodynode1.skel.name == contact.bodynode2.skel.name): contactDict['selfContact'] +=1 else: #this is a contact between this skeleton with the ground #cntctBN is skeleton body node responsible for ground contact, or none if no ground contact isGndCntctWFoot, cntctBN = self.checkMyFootWithGround(contact.bodynode1,contact.bodynode2) #save refs to each contact force and which body had contact with ground contactDict[cntctBN.name] +=1 if isGndCntctWFoot: #save for COP calc #foot contact with ground contactDict['COPcontacts'] += 1 contactDict['footGroundContacts'] +=1 #print('With Ground : contact body 1 : {} skel : {} | contact body 2 : {} skel : {} : frc {}'.format(contact.bodynode1,contact.bodynode1.skeleton.name, contact.bodynode2,contact.bodynode2.skeleton.name, contact.force)) #COP shouldnt use butt contact in calculation - want a target to get up #find total moment of all contacts cTau, cTtlFrc = self.calcSumTrqsForCOP(cntctBN, contact) COP_tau += cTau COP_ttlFrc += cTtlFrc elif(self.checkBNinNameList(cntctBN.name, self.handBodyNames)): #hand contact with ground contactDict['COPcontacts'] += 1 contactDict['handGroundContacts']+=1 #non-foot contact with ground - check if contact with non-reaching hand #print('Not Foot With Ground : contact body 1 : {} skel : {} | contact body 2 : {} skel : {}'.format(contact.bodynode1,contact.bodynode1.skeleton.name, contact.bodynode2,contact.bodynode2.skeleton.name)) #find total moment of all contacts of hand to ground cTau, cTtlFrc = self.calcSumTrqsForCOP(cntctBN, contact) COP_tau += cTau COP_ttlFrc += cTtlFrc else : #nonHand nonFoot Contact with ground contactDict['badGroundContact']+=1 #find average foot location (idx 0) avgFootLocAra = self.calcAvgFootBodyLoc() #determines COP based on foot contacts with ground - ignore non-foot contacts for COP calc #COP loc might be redundant - using foot location might be sufficient if((0 < contactDict['COPcontacts']) and (np.abs(COP_ttlFrc[1]) > 0)):#(COP_ttlFrc[1] > 0) and (COP_ttlFrc[0] > 0)): #COP_tau = COPval cross COP_ttlFrc ==> need to constrain possible COPvals -> set COPval.y == 0 since we want the COP at the ground, and then solve eqs : COPval = self.calcCOPFromTauFrc(COP_tau, COP_ttlFrc, self.env.ctrTauPt) else : #estimate COP as center of both feet body node com locations COPval = np.copy(avgFootLocAra[0]) #put it on the ground COPval[1]= 0 return contactDict, COPval, avgFootLocAra #Take total moments, total force, return a suitable point of application of that force to provide that moment - more than 1 answer, want answer on ground plane #COP_tau = COPval cross COP_ttlFrc ==> need to constrain possible COPvals #so set COPval.y == 0 since we want the COP at the ground, and then solve eqs : #ctrTauPt is point far away around which torques are initially calculated, then summed, and then reversed to find COP loc #ctrTauPt[1] should be 0, since can be chosen arbitrarily def calcCOPFromTauFrc(self,COP_tau, COP_ttlFrc, ctrTauPt): #given a cross b (==c : total tau) and b (total force), find a (location vector) : a = (bxc)/(b.b) + tb, where t is any real scalar COPvalTmp = np.cross(COP_ttlFrc,COP_tau)/np.dot(COP_ttlFrc,COP_ttlFrc)#soln for t==0 #solve for t by finding frc[1]*t - COPval[1]=0 since we want COP val to lie on y=0 plane try: t = -float(COPvalTmp[1])/COP_ttlFrc[1] COPval = COPvalTmp + t*COP_ttlFrc #print('Cop Val : {} from COPvalTmp {} W/(t = {}) + ctrTauPt == {}'.format(COPval, COPvalTmp,t,(COPval+ctrTauPt))) except ZeroDivisionError: #should never hit this -> COP ttl force in y dir is not allowed to be 0 to call this - if it is then we use avg loc of feet as COP #print('Cop Val w/ttlFrc[1] == 0 : {} + ctrTauPt : {} '.format(COPvalTmp,ctrTauPt)) COPval = COPvalTmp #displacing COPval by ctrTauPt COPval += ctrTauPt return COPval # def calcCOPFromTauFrc(self,COP_tau, COP_ttlFrc, ctrTauPt): # COPval = np.zeros(3) # COPval[0] = COP_tau[2]/COP_ttlFrc[1] + ctrTauPt[0] # COPval[2] = COP_tau[1]/COP_ttlFrc[0] + (COP_ttlFrc[2] * COPval[0]/COP_ttlFrc[0]) + ctrTauPt[2] # return
<gh_stars>0 # -*- coding: utf-8 -*- # Copyright 2020 Green Valley Belgium NV # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # @@license_version:1.7@@ import base64 import json import logging import threading import time import traceback import types import uuid from copy import deepcopy from random import choice from types import NoneType from concurrent import futures # @UnresolvedImport from google.appengine.api import urlfetch, memcache from google.appengine.api.apiproxy_stub_map import UserRPC from google.appengine.api.app_identity.app_identity import get_application_id from google.appengine.api.taskqueue import TaskRetryOptions from google.appengine.ext import db, deferred from hyper import HTTP20Connection from jose import jwt from jose.constants import Algorithms from mcfw.cache import set_cache_key from mcfw.consts import MISSING from mcfw.properties import azzert from mcfw.rpc import arguments, returns, check_function_metadata, get_parameter_types, run, get_parameters, \ get_type_details, serialize_value, parse_parameter from rogerthat.consts import DEBUG, HIGH_LOAD_WORKER_QUEUE, FAST_QUEUE from rogerthat.dal.app import get_app_by_id from rogerthat.dal.mobile import get_mobile_settings_cached from rogerthat.dal.rpc_call import get_rpc_capi_backlog_parent_by_account, get_rpc_capi_backlog_parent_by_mobile from rogerthat.models import UserProfile from rogerthat.rpc import users from rogerthat.rpc.models import Mobile, RpcAPIResult, RpcCAPICall, OutStandingFirebaseKick, \ ServiceAPICallback, RpcException from rogerthat.settings import get_server_settings from rogerthat.to.push import PushData from rogerthat.to.system import LogErrorRequestTO from rogerthat.utils import now, privatize from rogerthat.utils.cloud_tasks import create_task, schedule_tasks from rogerthat.utils.crypto import encrypt_for_jabber_cloud, decrypt_from_jabber_cloud from rogerthat.utils.transactions import on_trans_committed _CALL_ACTION_RESEND = 1 _CALL_ACTION_MUST_PROCESS = 2 _CALL_ACTION_DO_NOT_PROCESS = 3 BACKLOG_CONCURRENCY_PROTECTION_INTERVAL = 120 MESSAGE_LINGER_INTERVAL = 3600 * 24 * 20 # 20 days MESSAGE_ALLOWED_FUTURE_TIME_INTERVAL = 3600 * 24 BACKLOG_MESSAGE_RETENTION_INTERVAL = 3600 * 24 + MESSAGE_LINGER_INTERVAL # 21 days BACKLOG_DUPLICATE_AVOIDANCE_RETENTION_INTERVAL = 3600 * 24 # 1 day APPENGINE_APP_ID = get_application_id() DO_NOT_SAVE_RPCCALL_OBJECTS = "DO_NOT_SAVE_RPCCALL_OBJECTS" PERFORM_CALLBACK_SYNCHRONOUS = "PERFORM_CALLBACK_SYNCHRONOUS" SKIP_ACCOUNTS = "SKIP_ACCOUNTS" MOBILE_ACCOUNT = "MOBILE_ACCOUNT" DEFER_KICK = "DEFER_KICK" TARGET_MFR = "TARGET_MFR" API_VERSION = u"av" API_DIRECT_PATH_KEY = u"ap" CALL_ID = u"ci" FUNCTION = u"f" PARAMETERS = u"a" STATUS = u"s" STATUS_SUCCESS = u"success" STATUS_FAIL = u"fail" RESULT = u"r" ERROR = u"e" CALL_TIMESTAMP = u"t" CALL_RESEND_TIMEOUT = 120 DEFAULT_RETENTION = 3600 * 24 MANDATORY_CALL_KEYS_SET = {PARAMETERS, API_VERSION, CALL_ID, FUNCTION} SEND_ACK = 1 IGNORE = 2 PRIORITY_NORMAL = 5 PRIORITY_HIGH = 10 DEFAULT_APPLE_PUSH_MESSAGE = base64.encodestring('{"aps":{"content-available":1}}') CAPI_KEYWORD_ARG_PRIORITY = "_cka_priority_" CAPI_KEYWORD_ARG_APPLE_PUSH_MESSAGE = "_cka_apple_push_message_" CAPI_KEYWORD_PUSH_DATA = '_push_data_' def _call_rpc(endpoint, payload): settings = get_server_settings() jabberEndpoint = choice(settings.jabberEndPoints) challenge, data = encrypt_for_jabber_cloud(settings.jabberSecret.encode('utf8'), payload) response = urlfetch.fetch(url="http://%s/%s" % (jabberEndpoint, endpoint), payload=data, method="POST", allow_truncated=False, follow_redirects=False, validate_certificate=False) if response.status_code != 200: logging.error("Failed to call jabber cloud with the following info:\nendpoint: %s\npayload: %s" % (endpoint, payload)) raise Exception(response.content) decrypt_from_jabber_cloud(settings.jabberSecret.encode('utf8'), challenge, response.content) def process_callback(response, sik, service_api_callback, synchronous): # type: (urlfetch._URLFetchResult, str, ServiceAPICallback, bool) -> object from rogerthat.dal.service import get_sik from rogerthat.rpc.service import _process_callback_result if response.status_code != 200: raise Exception("%s failed with http status code %s.\nBody:\n%s" % (response.final_url, response.status_code, response.content)) sik_model = get_sik(sik) if service_api_callback.resultFunction: callback_result = json.loads(response.content) else: callback_result = { 'error': None, 'id': service_api_callback.callid, 'result': None } raw_result_unicode = json.dumps(privatize(deepcopy(callback_result)), ensure_ascii=False) result = _process_callback_result(sik_model, callback_result, raw_result_unicode, service_api_callback, True, synchronous) if result: return result def send_service_api_callback(service_api_callback, sik, url, synchronous, custom_headers=None): response = api_callbacks.append(url, service_api_callback, sik, synchronous=synchronous, custom_headers=custom_headers) if response: return process_callback(response, sik, service_api_callback, synchronous) def _make_api_callback_rpc(service_api_call, sik, endpoint, custom_headers=None): rpc_item = urlfetch.create_rpc(10, None) payload = service_api_call.call.encode('utf8') headers = {} if custom_headers: headers.update(custom_headers) headers.update({ 'Content-type': 'application/json-rpc; charset=utf-8', 'X-Nuntiuz-Service-Key': sik }) urlfetch.make_fetch_call(rpc_item, endpoint, payload, urlfetch.POST, headers, allow_truncated=False, follow_redirects=False) return rpc_item def _finalize_api_callback_rpc(rpc_item, endpoint, start_time, sik, service_api_call, synchronous): # type: (UserRPC, str, int, str, ServiceAPICallback, bool) -> None check_time = time.time() response = rpc_item.get_result() response_time = time.time() logging.info('DirectRpc - Called %s. Elapsed: %sms, checked after %sms', endpoint, int((response_time - start_time) * 1000), int((check_time - start_time) * 1000)) logging.debug('HTTP response status %d and content:\n%s', response.status_code, response.content.decode('utf8')) return process_callback(response, sik, service_api_call, synchronous) def _retry_api_callback(service_api_call, sik, endpoint, custom_headers=None): start_time = now() rpc = _make_api_callback_rpc(service_api_call, sik, endpoint, custom_headers=custom_headers) _finalize_api_callback_rpc(rpc, endpoint, start_time, sik, service_api_call, False) class DirectRpcCaller(threading.local): def __init__(self): self.items = [] def append(self, endpoint, service_api_call, sik, synchronous=False, custom_headers=None): rpc_item = _make_api_callback_rpc(service_api_call, sik, endpoint, custom_headers=custom_headers) if synchronous: return rpc_item.get_result() self.items.append((rpc_item, endpoint, time.time(), service_api_call, sik, custom_headers)) def finalize(self): for rpc_item, endpoint, start_time, service_api_call, sik, custom_headers in self.items: try: _finalize_api_callback_rpc(rpc_item, endpoint, start_time, sik, service_api_call, False) except: logging.warning('Failed to reach %s! Retrying.' % endpoint, exc_info=1) retry_options = TaskRetryOptions(min_backoff_seconds=5, task_retry_limit=3) deferred.defer(_retry_api_callback, service_api_call, sik, endpoint, custom_headers=custom_headers, _queue=HIGH_LOAD_WORKER_QUEUE, _retry_options=retry_options) del self.items[:] class APNSCache(object): def __init__(self): self.jwts = {} def get_jwt(self, app): now_ = time.time() if app.ios_dev_team not in self.jwts or self.jwts[app.ios_dev_team]['expires'] < now_: self.jwts[app.ios_dev_team] = {'data': self._create_jwt(app, now_), 'expires': now_ + 40 * 60} return self.jwts[app.ios_dev_team]['data'] def _create_jwt(self, app, now_): logging.info("APNSConnections._create_jwt start app:%s", app.app_id) token = jwt.encode({'iss': app.ios_dev_team, 'iat': now_}, app.apns_key, algorithm=Algorithms.ES256, headers={ 'alg': Algorithms.ES256, 'kid': app.apns_key_id}) logging.info("APNSConnections._create_jwt end") return token class JabberRpcCaller(threading.local): def __init__(self, endpoint): self.items = list() self.endpoint = endpoint def append(self, payload): settings = get_server_settings() if DEBUG and not settings.jabberEndPoints: logging.debug('Skipping KICK, No jabberEndPoints configured.') return try: payload_dict = json.loads(payload) if 'apns' in payload_dict['t']: app_id = payload_dict['a'] app = get_app_by_id(app_id) if not app: logging.error('Not sending apns to "%s" app doesn\' exist', app_id) return if not app.apple_push_cert_valid_until: logging.debug('Not sending apns to "%s" app is expired', app_id) return if not app.apple_push_cert or not app.apple_push_key: logging.error('Not sending apns to "%s" cert or key was empty', app_id) return else: app = None except: logging.exception("Failed to process JabberRpcCaller.append") return if app and app.apns_key_id: self.do_kick(app, payload_dict) else: jabberEndpoint = choice(settings.jabberEndPoints) rpc_item = urlfetch.create_rpc(5, None) challenge, data = encrypt_for_jabber_cloud(settings.jabberSecret.encode('utf8'), payload) url = "http://%s/%s" % (jabberEndpoint, self.endpoint) urlfetch.make_fetch_call(rpc=rpc_item, url=url, payload=data, method="POST", allow_truncated=False, follow_redirects=False, validate_certificate=False) self.items.append((1, rpc_item, payload, challenge, time.time(), url)) def finalize(self): # Don't fetch server settings when not needed settings = None for item_tuple in self.items: version = item_tuple[0] if version == 1: _, rpc_item, payload, challenge, start_time, url = item_tuple if not settings: settings = get_server_settings() try: check_time = time.time() response = rpc_item.get_result() response_time = time.time() logging.info("JabberRpc - Called %s. Elapsed: %sms, checked after %sms\npayload: %s", url, int((response_time - start_time) * 1000), int((check_time - start_time) * 1000), payload) if response.status_code != 200: logging.error("Failed to call jabber cloud with the following info:\nendpoint: %s\npayload: %s", self.endpoint, payload) raise Exception(response.content) decrypt_from_jabber_cloud(settings.jabberSecret.encode('utf8'), challenge, response.content) except: logging.warn("Failed to reach jabber endpoint on %s, deferring ..." % url) deferred.defer(_call_rpc, self.endpoint, payload) elif version == 2: _, conn, stream_id = item_tuple try: resp = conn.get_response(stream_id) if resp.status != 200: logging.error("Failed to send apple push %s", resp.read()) except: logging.info("failed to get response", exc_info=True) try: stream = conn.streams[stream_id] stream.close() except: logging.info("failed to close stream", exc_info=True) try: conn.reset_streams.discard(stream_id) except: logging.info("failed to discard reset_streams", exc_info=True) del self.items[:] def do_kick(self, app, payload_dict): # todo improve how connections work # 1 connection for every ios_dev_team # 1 jwt for every connection # renew jwt every 40 minutes # APNs does not support authentication tokens from multiple developer accounts over a single connection. # Refresh your token no more than once every 20 minutes and no less than once every 60 minutes. # https://developer.apple.com/documentation/usernotifications/setting_up_a_remote_notification_server/establishing_a_token-based_connection_to_apns if 'd' not in payload_dict: return if not app.ios_dev_team or not app.apns_key_id or not app.apns_key: logging.error('Not sending apns to "%s" ios_dev_team or apns_key_id or apns_key was empty', app.app_id) return token = apns_cache.get_jwt(app) path = '/3/device/{0}'.format(payload_dict['d']) request_headers = { 'apns-expiration': '0', 'apns-priority': str(payload_dict['p']), 'apns-topic': 'com.mobicage.rogerthat.{0}'.format(app.app_id), 'authorization': 'bearer {0}'.format(token.decode('ascii')) } # todo don't base64 and json encode payload_data = json.loads(base64.decodestring(payload_dict['m'])) payload = json.dumps(payload_data).encode('utf-8') conn = HTTP20Connection('api.push.apple.com:443', force_proto='h2') stream_id = conn.request( 'POST', path, payload, headers=request_headers ) self.items.append((2, conn, stream_id)) def create_firebase_request(data, is_gcm=False): # type: (dict) -> UserRPC # See https://firebase.google.com/docs/cloud-messaging/http-server-ref settings = get_server_settings() rpc_item = urlfetch.create_rpc(5, None) url = 'https://fcm.googleapis.com/fcm/send' headers = { 'Content-Type': 'application/json', 'Authorization': 'key=%s' % (settings.gcmKey if is_gcm else settings.firebaseKey) } urlfetch.make_fetch_call(rpc_item, url, json.dumps(data), urlfetch.POST, headers) return rpc_item def retry_firebase_request(payload, is_gcm=False): rpc_item = create_firebase_request(payload, is_gcm=is_gcm) response = rpc_item.get_result() # type: urlfetch._URLFetchResult if response.status_code != 200: raise Exception(response.content) class FirebaseKicker(threading.local): def __init__(self): self.items = [] self.outstandingKicks = [] def kick(self, registration_id, priority, push_data=None, is_gcm=False): if not push_data: push_data = PushData() collapse_key = "rogerthat" if priority == PRIORITY_NORMAL else "rogerthat_high_prio" priority_string = "normal" if priority == PRIORITY_NORMAL else "high" registration_ids = [registration_id] if not isinstance(registration_id, list) else registration_id data = { 'registration_ids': registration_ids, 'collapse_key': collapse_key, 'priority': priority_string } data.update(push_data.to_dict()) if priority == PRIORITY_NORMAL: # There is no guarantee this message will ever reach the device # but in order to avoid throttling of kicks while the user is actively using # Rogerthat we add time_to_live = 0 data['time_to_live'] = 0 self.outstandingKicks.append( (db.get_async(OutStandingFirebaseKick.createKey(registration_id)),
de Configuración: Repositorio</h5> <ul> <li> <b>Repositorio:</b> Repositorio de inversores dispuestos por PVlib.</li> <li> <b>Fabricantes:</b> Lista de fabricantes del repositorio seleccionado.</li> <li> <b>Inversores:</b> Lista de equipos disponibles en el repositorio según el fabricante seleccionado.</li> </ul> <h5>Método de Configuración: PVsyst</h5> <ul> <li> Seleccione el archivo del inversor generado por PVsyst (extensión .OND) y dé clic en 'Cargar OND'.</li> </ul> <h5>Método de Configuración: Manual</h5> <ul> <li> <b>SNL PVlib</b> <ul class='square'> <li> <b>$P_{AC}$ Nominal:</b> Potencia AC nominal del inversor en W.</li> <li> <b>$P_{DC}$ Nominal:</b> Potencia DC nominal del inversor en W.</li> <li> <b>$V_{DC}$ Nominal:</b> Voltaje DC al que se alcanza la Potencia AC nominal con la entrada de Potencia DC en V.</li> <li> <b>$P_{DC}$ de Arraque:</b> Potencia DC necesaria para iniciar el proceso de inversión en W.</li> <li> <b>$C_0$:</b> Parámetro que define la curvatura de la relación entre la Potencia AC y Potencia DC en condición STC en 1/W.</li> <li> <b>$C_1$:</b> Coeficiente empírico que permite que la Potencia DC Nominal varíe linealmente con el Voltaje DC en 1/V.</li> <li> <b>$C_2$:</b> Coeficiente empírico que permite que la Potencia DC de Arranque varíe linealmente con el Voltaje DC en 1/V.</li> <li> <b>$C_3$:</b> Coeficiente empírico que permite que $C_0$ varíe linealmente con el Voltaje DC en 1/V.</li> <li> <b>$P_{AC}$ Consumo Nocturno:</b> Potencia AC consumida por el inversor durante la noche en W.</li> </ul> </li> <li> <b>NREL PVWatts</b> <ul class='square'> <li> <b>$P_{DC}$ Nominal:</b> Potencia DC nominal del inversor en W.</li> <li> <b>Eficiencia Nominal:</b> Eficiencia nominal del inversor en magnitud adimensional.</li> </ul> </li> </ul> ''', layout=widgets.Layout(height='auto')) doc_module = widgets.HTMLMath(''' <h5>Método de Configuración: Repositorio</h5> <ul> <li> <b>Repositorio:</b> Repositorio de módulos fotovoltaicos dispuestos por PVlib (CEC y Sandia).</li> <li> <b>PVFree</b> <ul class='square'> <li> <b>Base de Datos:</b> Repositorio de módulos fotovoltaicos dispuestos en PVFree.</li> <li> <b>ID:</b> Número de identificación del módulo indicado en PVFree.</li> </ul> </li> <li> <b>CEC y Sandia</b> <ul class='square'> <li> <b>Fabricantes:</b> Lista de fabricantes del repositorio seleccionado.</li> <li> <b>Módulos:</b> Lista de equipos disponibles en el repositorio según el fabricante seleccionado.</li> </ul> </li> </ul> <h5>Método de Configuración: PVsyst</h5> <ul> <li> Seleccione el archivo del módulo fotovoltaico generado por PVsyst (extensión .PAN) y dé clic en 'Cargar PAN'.</li> </ul> <h5>Método de Configuración: Manual</h5> <ul> <li> <b>$T_{NOCT}$:</b> Temperatura nominal de funcionamiento de la celda en ºC. </li> <li> <b>Tecnología:</b> Tecnología de la celda fotovoltaica. </li> <li> <b>Número Celdas:</b> Número de celdas fotovoltaicas en serie. </li> <li> <b>$I_{SC}$ en STC:</b> Corriente de corto circuito en condiciones STC en A. </li> <li> <b>$V_{OC}$ en STC:</b> Voltaje de circuito abierto en condiciones STC en V. </li> <li> <b>$I_{MP}$ en STC:</b> Corriente en el punto de máxima potencia en condiciones STC en A. </li> <li> <b>$V_{MP}$ en STC:</b> Voltaje en el punto de máxima potencia en condiciones STC en V.</b> </li> <li> <b>Coef. Temp. $I_{SC}$:</b> Coeficiente de temperatura de la corriente de cortocircuito en A/ºC. </li> <li> <b>Coef. Temp. $V_{OC}$:</b> Coeficiente de temperatura de voltaje de circuito abierto en V/ºC. </li> <li> <b>Coef. Temp. $P_{MP}$:</b> Coeficiente de temperatura de la potencia en el punto máximo en %/ºC. </li> <li> <b>$P_{Nominal}$ en STC:</b> Potencia nominal del módulo fotovoltaico en condiciones STC en W.</li> </ul> <h5>Parámetros Bifacialidad</h5> <ul> <li> <b>Panel Bifacial:</b> Si el panel fotovoltaico es bifacial o no. </li> <li> <b>Bifacialidad:</b> Relación entre la eficiencia del lado frontal y posterior del módulo fotovoltaico, medida en condiciones STC. Utilice un valor porcentual en escala entre 0 y 1. </li> <li> <b>Alto Fila Paneles:</b> Altura de las filas de paneles fotovoltaicos medida en su centro en unidades de metros. </li> <li> <b>Ancho Fila Paneles:</b> Ancho de las filas de paneles fotovoltaicos en el plano 2D considerado en unidades de metros (e.g., 1P, 2P, 4L). </li> </ul> ''', layout=widgets.Layout(height='auto')) doc_sysdesign = widgets.HTMLMath(''' <h5>Subarrays</h5> <ul> <li> <b>Cantidad Subarrays:</b> Conjunto de arreglos conectados a un inversor. Cada subarray se compone de módulos en serie por string, strings en paralelo y el número de entradas al inversor (ya sea entradas completas por inversor o número de entradas MPPT).</li> </ul> <h5>Configuración Eléctrica</h5> <ul> <li> <b>Módulos por String:</b> Cantidad de módulos en serie por string en cada subarray. Para múltiples subarrays, separe los valores con una coma de manera ordenada.</li> <li> <b>Strings por Inversor:</b> Cantidad de strings en paralelo en cada subarray. Para múltiples subarrays, separe los valores con una coma de manera ordenada.</li> <li> <b>Número de Inversores:</b> Cantidad de inversores con configuración eléctrica exactamente igual a la definida. Permite escalar los cálculos de producción.</li> </ul> <h5>Seguidores y Orientación</h5> <ul> <li> <b>Sin Seguidor</b> <ul class='square'> <li> <b>Azimutal:</b> Ángulo azimutal en grados decimales (Norte = 0, Sur = 180, Este = 90, Oeste = 270). Para múltiples subarrays, separe los valores con una coma de manera ordenada (también aplica si el azimutal es el mismo).</li> <li> <b>Elevación:</b> Ángulos de inclinación desde la horizontal en grados decimales. Para múltiples subarrays, separe los valores con una coma de manera ordenada (también aplica si la elevación es la misma).</li> <li> <b>Racking:</b> Tipo de ventilación del montaje. Se utiliza para identificar un conjunto de parámetros para el modelo de temperatura de la celda.</li> </ul> </li> <li> <b>Seguidor 1-Eje</b><br> El ángulo de rotación se determina en un sistema de coordenadas diestro. El seguidor define el eje-y positivo, el eje-x positivo está a 90º en sentido horario desde el eje-y y es paralelo a la superficie, y el eje-z positivo es normal a ambos ejes (-x y -y), y está orientado hacia el cielo. El ángulo de rotación es una rotación hacia la derecha alrededor del eje-y en el sistema de coordenadas e indica la posición del seguidor en relación con la horizontal. Por ejemplo, si Azimutal Eje es 180º (orientado al sur) y Elevación Eje es 0º, entonces un ángulo del seguidor de 0º es horizontal, de 30º es una rotación hacia el oeste, y -90º es una rotación al plano vertical hacia el este. <ul class='square'> <li> <b>Elevación Eje:</b> Elevación del eje de rotación con respecto a la horizontal en grados decimales (e.g., un valor de 0º indica que el eje de soporte de los paneles fotovoltaicos está horizontal). Para múltiples subarrays, separe los valores con una coma de manera ordenada (también aplica si la elevación del eje es la misma).</li> <li> <b>Azimutal Eje:</b> Ángulo perpendicular por regla de la mano derecha al eje de rotación en grados decimales (e.g., un valor de 180º --i.e., dirección sur-- indica una rotación de este a oeste). Para múltiples subarrays, separe los valores con una coma de manera ordenada (también aplica si el azimutal del eje es el mismo).</li> <li> <b>Ángulo Máximo:</b> Ángulo de rotación máximo del seguidor desde su posición horizontal en grados decimales (e.g., un valor de 90º permite que el seguidor gire desde y hasta una posición vertical en la que el panel mira hacia el horizonte). Para múltiples subarrays, separe los valores con una coma de manera ordenada (también aplica si el ángulo máximo es el mismo).</li> <li> <b>Racking:</b> Tipo de ventilación del montaje. Se utiliza para identificar un conjunto de parámetros para el modelo de temperatura de la celda.</li> </ul> </li> </ul> <h5>Parámetros Globales</h5> <ul> <li> <b>Pérdidas DC:</b> Porcentaje de pérdidas globales DC del sistema. Por defecto: 14.6%.</li> <li> <b>$k_{pc}$:</b> Pérdidas de transmisión hasta el punto común de acople de los inversores. Por defecto: 0%.</li> <li> <b>$k_{t}$:</b> Pérdidas asociadas a la transformación (elevación de tensión). Por defecto: 0%.</li> <li> <b>$k_{in}$:</b> Pérdidas de interconexión, transmisión hasta la frontera comercial. Por defecto: 0%.</li> <li> <b>Nombre Planta:</b> Sufijo al nombre del archivo de configuración (system_config_<i>sufijo</i>). Por defecto: system_config.</li> </ul> <h5>Archivo Configuración</h5> <ul> <li> <b>Generar Configuración:</b> Dé clic en este botón para que el algoritmo genere internamente el archivo de configuración con los parámetros previamente asignados. El ícono y la descripción del botón cambiarán para notificar la ejecución de la configuración.</li> <li> <b>Descargar Configuración:</b> Dé
threading.Event().wait(2) final_message = "Finished with 3 errors" completed = True all_ok = False else: custom_env = os.environ.copy() custom_env["LC_ALL"] = "C" pipe = subprocess.Popen( ( "sudo", "-n", "badblocks", "-w", "-s", "-p", "0", "-t", "0x00", "-b", "4096", dev, ), stderr=subprocess.PIPE, env=custom_env, ) # , stdout=subprocess.PIPE) # TODO: restore this code and kill badblocks if it's too slow (the disk is probably broken) # disk_gb = self.disk['features']['capacity-byte'] / 1024 ** 3 # mins_per_gb = 2 # TODO: could be set with a config file? # timeout = 60 * mins_per_gb * disk_gb percent = 0.0 reading_and_comparing = False errors = -1 deleting = False buffer = bytearray() for char in iter(lambda: pipe.stderr.read(1), b""): if char == b"": if pipe.poll() is not None: break elif char == b"\b": if not deleting: result = buffer.decode("utf-8") errors_print = "?" reading_and_comparing = reading_and_comparing or ( "Reading and comparing" in result ) # If other messages are printed, ignore them i = result.index("% done") if i >= 0: # /2 due to the 0x00 test + read & compare percent = float(result[i - 6 : i]) / 2 if reading_and_comparing: percent += 50 i = result.index("(", i) if i >= 0: # errors_str = result[i+1:].split(")", 1)[0] errors_str = result[i + 1 :].split(" ", 1)[0] # The errors are read, write and corruption errors_str = errors_str.split("/") errors = 0 # badblocks prints the 3 totals every time for error in errors_str: errors += int(error) errors_print = str(errors) self._queued_command.notify_percentage( percent, f"{errors_print} errors" ) buffer.clear() deleting = True # elif char == b'\n': # # Skip the first lines (total number of blocks) # buffer.clear() else: if deleting: deleting = False buffer += char # TODO: was this needed? Why were we doing it twice? # pipe.wait() exitcode = pipe.wait() if errors <= -1: all_ok = None errors_print = "an unknown amount of" elif errors == 0: all_ok = True errors_print = "no" else: all_ok = False errors_print = str(errors) final_message = f"Finished with {errors_print} errors" if exitcode == 0: # self._queued_command.notify_finish(final_message) completed = True else: self._queued_command.notify_error() final_message += f" and badblocks exited with status {exitcode}" # self._queued_command.notify_finish(final_message) completed = False # print(pipe.stdout.readline().decode('utf-8')) # print(pipe.stderr.readline().decode('utf-8')) with disks_lock: update_disks_if_needed(self) disk_ref = disks[dev] # noinspection PyBroadException try: disk_ref.update_erase(completed, all_ok) except BaseException as e: final_message = f"Error during upload. {final_message}" self._queued_command.notify_error(final_message) logging.warning( f"[{self._the_id}] Can't update badblocks results of {dev} on tarallo", exc_info=e, ) self._queued_command.notify_finish(final_message) def ping(self, _cmd: str, _nothing: str): self.send_msg("pong", None) # noinspection PyMethodMayBeStatic def close_at_end(self, _cmd: str, _nothing: str): logging.info("Server will close at end") with CLOSE_AT_END_LOCK: global CLOSE_AT_END # Do not start the timer twice if CLOSE_AT_END: return CLOSE_AT_END = True # noinspection PyUnresolvedReferences reactor.callFromThread(reactor.callLater, CLOSE_AT_END_TIMER, try_stop_at_end) def cannolo(self, _cmd: str, dev_and_iso: str): parts: list[Optional[str]] = dev_and_iso.split(" ", 1) while len(parts) < 2: parts.append(None) dev, iso = parts if iso is None: self._queued_command.notify_finish_with_error(f"No iso selected") return if not os.path.exists(iso): self._queued_command.notify_finish_with_error(f"File {iso} does not exist") return if not os.path.isfile(iso): self._queued_command.notify_finish_with_error( f"{iso} is not a file (is it a directory?)" ) return go_ahead = self._unswap() if not go_ahead: return success = True self._queued_command.notify_start("Cannoling") if TEST_MODE: self._queued_command.notify_percentage(10) threading.Event().wait(2) self._queued_command.notify_percentage(20) threading.Event().wait(2) self._queued_command.notify_percentage(30) threading.Event().wait(2) self._queued_command.notify_percentage(40) threading.Event().wait(2) self._queued_command.notify_percentage(50) threading.Event().wait(2) self._queued_command.notify_percentage(60) threading.Event().wait(2) self._queued_command.notify_percentage(70) threading.Event().wait(2) self._queued_command.notify_percentage(80) threading.Event().wait(2) self._queued_command.notify_percentage(90) threading.Event().wait(2) else: pipe = subprocess.Popen( ("sudo", "-n", "cannolo", iso, dev) ) # stderr=subprocess.PIPE), stdout=subprocess.PIPE) exitcode = pipe.wait() if exitcode != 0: self._queued_command.notify_error("cannolo returned " + str(exitcode)) success = False if success: with disks_lock: update_disks_if_needed(self) disk_ref = disks[dev] pretty_iso = self._pretty_print_iso(iso) self._queued_command.notify_percentage(100.0, f"{pretty_iso} installed!") final_message = f"{pretty_iso} installed, Tarallo updated" # noinspection PyBroadException try: disk_ref.update_software(pretty_iso) except BaseException as e: final_message = f"{pretty_iso} installed, failed to update Tarallo" self._queued_command.notify_error( f"{pretty_iso} installed, failed to update Tarallo" ) logging.warning( f"[{self._the_id}] Can't update software of {dev} on tarallo", exc_info=e, ) self._queued_command.notify_finish(final_message) else: self._queued_command.notify_finish() def _unswap(self) -> bool: if TEST_MODE: return True self._queued_command.disk.update_mountpoints() mountpoints = self._queued_command.disk.get_mountpoints_map() unswap_them = [] oh_no = None for part in mountpoints: if mountpoints[part] == "[SWAP]": unswap_them.append(part) else: oh_no = part break if oh_no: self._queued_command.notify_finish_with_error( f"Partition {oh_no} is mounted as {mountpoints[oh_no]}" ) return False if len(unswap_them) > 0: self._queued_command.notify_start("Unswapping the disk") for path in unswap_them: sp = subprocess.Popen(("sudo", "swapoff", path)) exitcode = sp.wait() if exitcode != 0: self._queued_command.notify_finish_with_error( f"Failed to unswap {path}, exit code {str(exitcode)}" ) return False self._queued_command.disk.update_mountpoints() return True def sleep(self, _cmd: str, dev: str): self._queued_command.notify_start("Calling hdparm") exitcode = self.call_hdparm_for_sleep(dev) if exitcode == 0: self._queued_command.notify_finish("Good night!") else: self._queued_command.notify_finish_with_error( f"hdparm exited with status {str(exitcode)}" ) def call_hdparm_for_sleep(self, dev): if TEST_MODE: logging.debug(f"Fake putting {dev} to sleep") return 0 logging.debug(f"[{self._the_id}] Putting {dev} to sleep") res = subprocess.Popen( ("sudo", "hdparm", "-Y", dev), stderr=subprocess.DEVNULL, stdout=subprocess.DEVNULL, ) exitcode = res.wait() if exitcode != 0: logging.warning( f"[{self._the_id}] hdparm for {dev} returned {str(exitcode)}" ) return exitcode def get_smartctl(self, cmd: str, args: str): params = self._get_smartctl(args, False) if params: self.send_msg(cmd, params) def queued_get_smartctl(self, cmd: str, args: str): params = self._get_smartctl(args, True) if params: self.send_msg(cmd, params) def _get_smartctl(self, dev: str, queued: bool): if queued: self._queued_command.notify_start("Getting smarter") pipe = subprocess.Popen( ("sudo", "-n", "smartctl", "-a", dev), stderr=subprocess.PIPE, stdout=subprocess.PIPE, ) output = pipe.stdout.read().decode("utf-8") stderr = pipe.stderr.read().decode("utf-8") exitcode = pipe.wait() if exitcode == 0: smartctl_returned_valid = True else: exitcode_bytes = exitcode.to_bytes(8, "little") if ( exitcode_bytes[0] == 1 or exitcode_bytes[1] == 1 or exitcode_bytes[2] == 1 ): smartctl_returned_valid = False else: # TODO: parse remaining bits (https://github.com/WEEE-Open/pesto/issues/65) smartctl_returned_valid = True updated = False status = None if smartctl_returned_valid: status = get_smartctl_status(output) if queued: if not status: self._queued_command.notify_error( "Error while parsing smartctl status" ) return { "disk": dev, "status": status, "updated": updated, "exitcode": exitcode, "output": output, "stderr": stderr, } else: if queued: self._queued_command.notify_error("smartctl failed") return { "disk": dev, "status": status, "updated": updated, "exitcode": exitcode, "output": output, "stderr": stderr, } if queued and status: self._queued_command.notify_percentage(50.0, "Updating tarallo if needed") with disks_lock: update_disks_if_needed(self) disk_ref = disks[dev] # noinspection PyBroadException try: updated = disk_ref.update_status(status) except BaseException as e: self._queued_command.notify_error("Error during upload") logging.warning( f"[{self._the_id}] Can't update status of {dev} on tarallo", exc_info=e, ) self._queued_command.notify_finish(f"Disk is {status}") return { "disk": dev, "status": status, "updated": updated, "exitcode": exitcode, "output": output, "stderr": stderr, } @staticmethod def _encode_param(param): return json.dumps(param, separators=(",", ":"), indent=None) def send_msg(self, cmd: str, param=None, the_id: Optional[int] = None): logging.debug( f"[{self._the_id}] Sending {cmd}{ ' with args' if param else ''} to client" ) the_id = the_id or self._the_id thread = clients.get(the_id) if thread is None: logging.info( f"[{the_id}] Connection already closed while trying to send {cmd}" ) else: thread: TurboProtocol # noinspection PyBroadException try: if param is None: response_string = cmd else: j_param = self._encode_param(param) response_string = f"{cmd} {j_param}" # It's there but pycharm doesn't believe it # noinspection PyUnresolvedReferences reactor.callFromThread(TurboProtocol.send_msg, thread, response_string) except BaseException: logging.warning( f"[{the_id}] Something blew up while trying to send {cmd} (connection already closed?)" ) def get_disks(self, cmd: str, _nothing: str): result = [] with disks_lock: # Sent regardless update_disks_if_needed(self, False) for disk in disks: result.append(disks[disk].serialize_disk()) self.send_msg(cmd, result) @staticmethod def _pretty_print_iso(iso: str): filename = iso.rsplit("/", 1)[-1] filename = filename.split(".", 1)[0] filename = filename.replace("-", " ").replace("_", " ") return filename class QueuedCommand: def __init__(self, disk: Disk, command_runner: CommandRunner): self.disk = disk self._target = self.disk.get_path() self.command_runner = command_runner self._percentage = 0.0 self._started = False self._finished = False self._error = False self._stopped = False self._stale = False self._notifications_lock = threading.Lock() self._text = "Queued" self._to_delete = False self._deleted = False date = datetime.today().strftime("%Y%m%d%H%M") with queued_commands_lock: self._id = f"{date}-{str(len(queued_commands))}" queued_commands.append(self) with self._notifications_lock: self.send_to_all_clients() def id_is(self, the_id: str): return self._id == the_id def lock_notifications(self): self._notifications_lock.acquire() def unlock_notifications(self): self._notifications_lock.release() def notify_start(self, text: Optional[str] = None): with self._notifications_lock: if text is not None: self._text = text self._started = True self._percentage = 0.0 self.send_to_all_clients() def notify_finish_safe(self, text: Optional[str] = None): with self._notifications_lock: if self._finished: return # TODO: RLock? Probably not needed self.notify_finish(text) def notify_finish(self, text: Optional[str] = None): with self._notifications_lock: if text is not None: self._text = text self._finished = True self._percentage = 100.0 self.send_to_all_clients() if self._to_delete: self.notify_delete() def notify_finish_with_error(self, text: Optional[str] = None): with self._notifications_lock: if text is not None: self._text = text self._finished = True self._error = True
<gh_stars>0 import cv2 import numpy as np import scipy.misc import imageio import os import warnings from helper_code.registration_funcs import model_arena from helper_code.processing_funcs import speed_colors, register_frame def visualize_escape(self): ''' Generate and save escape video clip and dlc tracking clip ''' warnings.filterwarnings("ignore") ''' Initialize variables and backgrounds ''' # open the behaviour video vid = cv2.VideoCapture(self.video_path) vid.set(cv2.CAP_PROP_POS_FRAMES, self.start_frame) # set up the escape clips for saving video = cv2.VideoWriter(os.path.join(self.save_folder, self.videoname + ' vid.mp4'), self.fourcc, self.fps, (self.width, self.height), False) video_dlc = cv2.VideoWriter(os.path.join(self.save_folder, self.videoname + ' vid (DLC).mp4'), self.fourcc,self.fps, (self.width , self.height), True) # load fisheye mapping maps = np.load(self.folders['fisheye_map_location']); map1 = maps[:, :, 0:2]; map2 = maps[:, :, 2] * 0 # set up model arena arena, _, _ = model_arena((self.height, self.width), self.trial_type != 0, registration = False, #self.trial_type > 0 obstacle_type = self.obstacle_type, shelter = ('down' in self.videoname or not 'no shelter' in self.videoname) and not 'food' in self.videoname, dark = self.dark_theme) arena = cv2.cvtColor(arena, cv2.COLOR_GRAY2RGB) # initialize arenas for mouse mask model_mouse_mask_previous = np.zeros(arena.shape[0:2]).astype(np.uint8) model_mouse_mask_initial = np.zeros(arena.shape[0:2]).astype(np.uint8) # initialize more quantities trial_plot = arena.copy() frames_past_stimulus = 0 arrived_at_shelter = False count_down = np.inf color_trail = np.array([.02, -.02, -.02]) # red # color_trail = np.array([-.1, -.1, -.1]) # gray # color_trail = np.array([-.02, -.01, .02]) # blue contour_color = (255, 100, 100) # red # contour_color = (150, 150, 150) # gray # contour_color = (100, 200, 250) # blue # when is the stimulus on, and how is the arena shaped stim_timing_array, shape, size = initialize_stim_visualization(self.obstacle_type) # make a smooth speed trace for coloration smoothed_speed = np.concatenate((np.zeros(6 - 1), np.convolve(self.coordinates['speed'], np.ones(12), mode='valid'), np.zeros(6))) / 12 # set up background arena with previous obstacle dulled out if self.trial_type==0 and (('down' in self.videoname) or ('up' in self.videoname and 'void' in self.videoname)) and False: former_arena, _, _ = model_arena((self.height, self.width), 1, registration = False, obstacle_type = self.obstacle_type, shelter = not 'no shelter' in self.videoname and not 'food' in self.videoname, dark = self.dark_theme) former_arena = cv2.cvtColor(former_arena, cv2.COLOR_GRAY2RGB) discrepancy = ~((arena - former_arena)==0) self.arena_with_prev_trials[discrepancy] = 255 #((former_arena[discrepancy] * 1 + arena[discrepancy].astype(float) * 9) / 10).astype(np.uint8) trial_plot[discrepancy] = 255 # ((former_arena[discrepancy] * 1 + arena[discrepancy].astype(float) * 9) / 10).astype(np.uint8) ''' Loop over each frame, making the video and images ''' # loop over each frame while True: # get the frame ret, frame = vid.read() #get the frame number frame_num = int(vid.get(cv2.CAP_PROP_POS_FRAMES)) frames_past_stimulus = frame_num - self.stim_frame frames_til_abort = count_down - frame_num # stop after 2 secs of shelter if not frames_til_abort: break # apply the registration and fisheye correction if False: frame = register_frame(frame, self.x_offset, self.y_offset, self.session.Registration, map1, map2) # prior to stimulus onset, refresh frame to initialized frame if frames_past_stimulus < 0: video_arena = self.arena_with_prev_trials.copy() #TEMPORARY: arena.copy() # model_mouse_mask_previous = 0 # extract DLC coordinates and make a model mouse mask model_mouse_mask, large_mouse_mask, body_location = make_model_mouse_mask(self.coordinates, frame_num, model_mouse_mask_initial) # use speed to determine model mouse coloration speed_color_light, speed_color_dark = speed_colors(smoothed_speed[frame_num - 1], blue = True) # at the stimulus onset if (frame_num+1) == self.stim_frame: # get a contour of the mouse mask _, contours, _ = cv2.findContours(model_mouse_mask, cv2.RETR_EXTERNAL, cv2.CHAIN_APPROX_SIMPLE) # and store the position of the mouse x_stim = float(body_location[0]); y_stim = float(body_location[1]) # add dark mouse silhouette if distant from the previous dark one elif np.sum(large_mouse_mask * model_mouse_mask_previous) == 0 and not arrived_at_shelter and frames_past_stimulus: # add dark mouse to the video arena video_arena[model_mouse_mask.astype(bool)] = video_arena[model_mouse_mask.astype(bool)] * speed_color_dark if frames_past_stimulus >= -1: trial_plot[model_mouse_mask.astype(bool)] = trial_plot[model_mouse_mask.astype(bool)] * speed_color_dark # set the current model mouse mask as the one to be compared to to see if dark mouse should be added model_mouse_mask_previous = model_mouse_mask # continuous shading, after stimulus onset elif frames_past_stimulus >= 0: # once at shelter, end it if np.sum(self.shelter_roi * large_mouse_mask) \ and not 'no shelter' in self.videoname and not 'Circle shelter moved' in self.videoname: # or 'down' in self.videoname: if not arrived_at_shelter: # end video in 2 seconds arrived_at_shelter = True count_down = frame_num + self.fps * 2 else: # add light mouse to video arena video_arena[model_mouse_mask.astype(bool)] = video_arena[model_mouse_mask.astype(bool)] * speed_color_light # add light mouse to escape image trial_plot[model_mouse_mask.astype(bool)] = trial_plot[model_mouse_mask.astype(bool)] * speed_color_light # add red trail to the previous trials' arena if frames_past_stimulus > 0 and not arrived_at_shelter: dist_from_start = np.sqrt((x_stim - float(body_location[0]))**2 + (y_stim - float(body_location[1]))**2) dist_to_make_red = 150 prev_homing_color = np.array([.98, .98, .98]) + np.max((0,dist_to_make_red - dist_from_start))/dist_to_make_red * color_trail self.arena_with_prev_trials[model_mouse_mask.astype(bool)] = self.arena_with_prev_trials[model_mouse_mask.astype(bool)] * prev_homing_color # redraw this contour on each frame after the stimulus if frame_num >= self.stim_frame: cv2.drawContours(video_arena, contours, 0, (255,255,255), thickness = 1) cv2.drawContours(trial_plot, contours, 0, (255,255,255), thickness = 1) # if wall falls or rises, color mouse in RED if (self.trial_type==1 or self.trial_type==-1) and (frame_num == self.wall_change_frame): _, contours_wall_change, _ = cv2.findContours(model_mouse_mask, cv2.RETR_EXTERNAL, cv2.CHAIN_APPROX_SIMPLE) # cv2.drawContours(video_arena, contours_wall_change, 0, (220,0,220), thickness=-1) cv2.drawContours(trial_plot, contours_wall_change, 0, (220,0,220), thickness=-1) if self.trial_type==1: video_arena[arena==90] = arena[arena==90] self.arena_with_prev_trials[arena == 90] = arena[arena == 90] else: middle_replace_arena = self.arena_with_prev_trials.copy() video_arena[arena==90] = self.arena_with_prev_trials[arena==90] * (255 / 90) video_arena[video_arena==122] = 255 # add a looming spot - for actual loom self.stim_type = 'visual' if self.stim_type == 'visual': stim_radius = 30 * (frame_num - self.stim_frame) * ( (frame_num - self.stim_frame) < 10) * (frame_num > self.stim_frame) else: stim_radius = size * stim_timing_array[frame_num - self.stim_frame] #218 for planning #334 for barnes #347 for void stim_radius = 0 session_trials_plot_show = video_arena.copy() trial_plot_show = trial_plot.copy() if stim_radius: frame = frame.copy() loom_frame = frame.copy() loom_arena = video_arena.copy() loom_arena2 = trial_plot.copy() if self.stim_type == 'visual': # for actual loom stimulus_location = tuple(self.coordinates['center_body_location'][:, self.stim_frame - 1].astype(np.uint16)) cv2.circle(loom_frame, stimulus_location, stim_radius, 100, -1) cv2.circle(loom_arena, stimulus_location, stim_radius, (100,100,100), -1) else: center = (int(frame.shape[1] / 2), int(frame.shape[0] / 2)) if shape == 'circle': cv2.circle(loom_frame, center, stim_radius, 200, 12) cv2.circle(loom_arena, center, stim_radius, (200, 200, 200), 12) cv2.circle(loom_arena2, center, stim_radius, (200, 200, 200), 12) elif shape == 'square': cv2.rectangle(loom_frame, tuple([c+stim_radius for c in center]), tuple([c-stim_radius for c in center]), 200, 12) cv2.rectangle(loom_arena, tuple([c+stim_radius for c in center]), tuple([c-stim_radius for c in center]), (200, 200, 200), 12) cv2.rectangle(loom_arena2, tuple([c+stim_radius for c in center]), tuple([c-stim_radius for c in center]), (200, 200, 200), 12) alpha = .3 cv2.addWeighted(frame, alpha, loom_frame, 1 - alpha, 0, frame) cv2.addWeighted(video_arena, alpha, loom_arena, 1 - alpha, 0, session_trials_plot_show) cv2.addWeighted(trial_plot, alpha, loom_arena2, 1 - alpha, 0, trial_plot_show) # invert colors for opencv display arena_with_prev_trials_show = cv2.cvtColor(self.arena_with_prev_trials, cv2.COLOR_BGR2RGB) video_arena_show = cv2.cvtColor(video_arena, cv2.COLOR_BGR2RGB) # put minute of stimulation in clip # stim_minute = str(int(np.round(self.stim_frame / 60 / 30))) + "'" # frame = frame.copy() # cv2.putText(frame, stim_minute, (20, 50), 0, 1, (255, 255, 255), thickness=2) # display current frames cv2.imshow(self.session_videoname, frame); cv2.imshow(self.session_videoname + ' DLC', video_arena_show) if cv2.waitKey(1) & 0xFF == ord('q'): break # write current frame to video video.write(frame); self.session_video.write(frame) video_dlc.write(video_arena_show); self.session_video_dlc.write(video_arena_show) # end video if frame_num >= self.end_frame: break # wrap up vid.release(); video.release(); video_dlc.release() # draw red silhouette for previous trial arena cv2.drawContours(self.arena_with_prev_trials, contours, 0, contour_color, thickness=-1) # cv2.drawContours(self.arena_with_prev_trials, contours, 0, (0,0,0), thickness=1) # draw purple silhouette for wall change if (self.trial_type == 1 or self.trial_type == -1): try: cv2.drawContours(video_arena, contours_wall_change, 0, (220, 0, 220), thickness=-1) cv2.drawContours(trial_plot, contours_wall_change, 0, (220, 0, 220), thickness=-1) except: print('Obstacle change not picked up for' + self.videoname) # save trial images imageio.imwrite(os.path.join(self.save_folder, self.videoname + ' image.tif'), trial_plot) imageio.imwrite(os.path.join(self.save_folder, self.videoname + ' image with history.tif'), video_arena) # after the last trial, save the session workspace image if self.trial_num == self.number_of_trials: # make all the trials the last frame of the DLC video self.session_video.write(self.arena_with_prev_trials) # save the all trials image scipy.misc.imsave(os.path.join(self.summary_folder, self.videoname + ' image (all trials).tif'), self.arena_with_prev_trials) # wrap up self.session_video.release() self.session_video_dlc.release() cv2.destroyAllWindows() # cv2.drawContours(trial_plot_show, contours, 0, (255, 255, 255), thickness=1) def raw_escape_video(processing): ''' Generate and save peri-stimulus video clip ''' # set up border colors pre_stim_color = [0] post_stim_color = [200] border_size = 40 # open the behaviour video vid = cv2.VideoCapture(processing.video_path) # set up the trial clip for saving video = cv2.VideoWriter(os.path.join(processing.save_folder,videoname+'.mp4'), processing.fourcc, processing.fps, (processing.width, processing.height), False) vid.set(cv2.CAP_PROP_POS_FRAMES, start_frame) # set up fisheye correction if registration: maps = np.load(registration[3]); map1 = maps[:,
<gh_stars>0 from http import HTTPStatus from typing import List, Optional from fastapi import APIRouter, Depends, Header, Query, Response from sqlalchemy.orm import Session import mlrun.api.crud import mlrun.api.utils.auth.verifier import mlrun.api.utils.singletons.project_member import mlrun.errors import mlrun.feature_store from mlrun import v3io_cred from mlrun.api import schemas from mlrun.api.api import deps from mlrun.api.api.utils import log_and_raise, parse_reference from mlrun.data_types import InferOptions from mlrun.datastore.targets import get_default_prefix_for_target from mlrun.feature_store.api import RunConfig, ingest from mlrun.model import DataSource, DataTargetBase router = APIRouter() @router.post("/projects/{project}/feature-sets", response_model=schemas.FeatureSet) def create_feature_set( project: str, feature_set: schemas.FeatureSet, versioned: bool = True, auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.singletons.project_member.get_project_member().ensure_project( db_session, project, auth_info=auth_info ) mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_set, project, feature_set.metadata.name, mlrun.api.schemas.AuthorizationAction.create, auth_info, ) feature_set_uid = mlrun.api.crud.FeatureStore().create_feature_set( db_session, project, feature_set, versioned, ) return mlrun.api.crud.FeatureStore().get_feature_set( db_session, project, feature_set.metadata.name, feature_set.metadata.tag or "latest", feature_set_uid, ) @router.put( "/projects/{project}/feature-sets/{name}/references/{reference}", response_model=schemas.FeatureSet, ) def store_feature_set( project: str, name: str, reference: str, feature_set: schemas.FeatureSet, versioned: bool = True, auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.singletons.project_member.get_project_member().ensure_project( db_session, project, auth_info=auth_info ) mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_set, project, name, mlrun.api.schemas.AuthorizationAction.store, auth_info, ) tag, uid = parse_reference(reference) uid = mlrun.api.crud.FeatureStore().store_feature_set( db_session, project, name, feature_set, tag, uid, versioned, ) return mlrun.api.crud.FeatureStore().get_feature_set( db_session, project, feature_set.metadata.name, tag, uid, ) @router.patch("/projects/{project}/feature-sets/{name}/references/{reference}") def patch_feature_set( project: str, name: str, feature_set_update: dict, reference: str, patch_mode: schemas.PatchMode = Header( schemas.PatchMode.replace, alias=schemas.HeaderNames.patch_mode ), auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_set, project, name, mlrun.api.schemas.AuthorizationAction.update, auth_info, ) tag, uid = parse_reference(reference) mlrun.api.crud.FeatureStore().patch_feature_set( db_session, project, name, feature_set_update, tag, uid, patch_mode, ) return Response(status_code=HTTPStatus.OK.value) @router.get( "/projects/{project}/feature-sets/{name}/references/{reference}", response_model=schemas.FeatureSet, ) def get_feature_set( project: str, name: str, reference: str, auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): tag, uid = parse_reference(reference) feature_set = mlrun.api.crud.FeatureStore().get_feature_set( db_session, project, name, tag, uid ) mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_set, project, name, mlrun.api.schemas.AuthorizationAction.read, auth_info, ) return feature_set @router.delete("/projects/{project}/feature-sets/{name}") @router.delete("/projects/{project}/feature-sets/{name}/references/{reference}") def delete_feature_set( project: str, name: str, reference: str = None, auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_set, project, name, mlrun.api.schemas.AuthorizationAction.delete, auth_info, ) tag = uid = None if reference: tag, uid = parse_reference(reference) mlrun.api.crud.FeatureStore().delete_feature_set( db_session, project, name, tag, uid ) return Response(status_code=HTTPStatus.NO_CONTENT.value) @router.get( "/projects/{project}/feature-sets", response_model=schemas.FeatureSetsOutput ) def list_feature_sets( project: str, name: str = None, state: str = None, tag: str = None, entities: List[str] = Query(None, alias="entity"), features: List[str] = Query(None, alias="feature"), labels: List[str] = Query(None, alias="label"), partition_by: schemas.FeatureStorePartitionByField = Query( None, alias="partition-by" ), rows_per_partition: int = Query(1, alias="rows-per-partition", gt=0), partition_sort_by: schemas.SortField = Query(None, alias="partition-sort-by"), partition_order: schemas.OrderType = Query( schemas.OrderType.desc, alias="partition-order" ), auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.auth.verifier.AuthVerifier().query_project_permissions( project, mlrun.api.schemas.AuthorizationAction.read, auth_info, ) feature_sets = mlrun.api.crud.FeatureStore().list_feature_sets( db_session, project, name, tag, state, entities, features, labels, partition_by, rows_per_partition, partition_sort_by, partition_order, ) feature_sets = mlrun.api.utils.auth.verifier.AuthVerifier().filter_project_resources_by_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_set, feature_sets.feature_sets, lambda feature_set: (feature_set.metadata.project, feature_set.metadata.name,), auth_info, ) return mlrun.api.schemas.FeatureSetsOutput(feature_sets=feature_sets) @router.get( "/projects/{project}/feature-sets/{name}/tags", response_model=schemas.FeatureSetsTagsOutput, ) def list_feature_sets_tags( project: str, name: str, auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): if name != "*": raise mlrun.errors.MLRunInvalidArgumentError( "Listing a specific feature set tags is not supported, set name to *" ) mlrun.api.utils.auth.verifier.AuthVerifier().query_project_permissions( project, mlrun.api.schemas.AuthorizationAction.read, auth_info, ) tag_tuples = mlrun.api.crud.FeatureStore().list_feature_sets_tags( db_session, project, ) feature_set_name_to_tag = {tag_tuple[1]: tag_tuple[2] for tag_tuple in tag_tuples} allowed_feature_set_names = mlrun.api.utils.auth.verifier.AuthVerifier().filter_project_resources_by_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_set, list(feature_set_name_to_tag.keys()), lambda feature_set_name: (project, feature_set_name,), auth_info, ) tags = { tag_tuple[2] for tag_tuple in tag_tuples if tag_tuple[1] in allowed_feature_set_names } return mlrun.api.schemas.FeatureSetsTagsOutput(tags=list(tags)) def _has_v3io_path(data_source, data_targets, feature_set): paths = [] # If no data targets received, then use targets from the feature-set spec. In case it's empty as well, use # default targets (by calling set_targets()) if not data_targets: if not feature_set.spec.targets: feature_set.set_targets() data_targets = feature_set.spec.targets if data_targets: for target in data_targets: # If the target does not have a path (i.e. default target), then retrieve the default path from config. paths.append(target.path or get_default_prefix_for_target(target.kind)) source = data_source or feature_set.spec.source if source: paths.append(source.path) return any( path and (path.startswith("v3io://") or path.startswith("v3ios://")) for path in paths ) @router.post( "/projects/{project}/feature-sets/{name}/references/{reference}/ingest", response_model=schemas.FeatureSetIngestOutput, status_code=HTTPStatus.ACCEPTED.value, ) def ingest_feature_set( project: str, name: str, reference: str, ingest_parameters: Optional[ schemas.FeatureSetIngestInput ] = schemas.FeatureSetIngestInput(), username: str = Header(None, alias="x-remote-user"), auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_set, project, name, mlrun.api.schemas.AuthorizationAction.update, auth_info, ) mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.run, project, "", mlrun.api.schemas.AuthorizationAction.create, auth_info, ) data_source = data_targets = None if ingest_parameters.source: data_source = DataSource.from_dict(ingest_parameters.source.dict()) if data_source.schedule: mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.schedule, project, "", mlrun.api.schemas.AuthorizationAction.create, auth_info, ) tag, uid = parse_reference(reference) feature_set_record = mlrun.api.crud.FeatureStore().get_feature_set( db_session, project, name, tag, uid ) feature_set = mlrun.feature_store.FeatureSet.from_dict(feature_set_record.dict()) if feature_set.spec.function and feature_set.spec.function.function_object: function = feature_set.spec.function.function_object mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.function, function.metadata.project, function.metadata.name, mlrun.api.schemas.AuthorizationAction.read, auth_info, ) # Need to override the default rundb since we're in the server. feature_set._override_run_db(db_session) if ingest_parameters.targets: data_targets = [ DataTargetBase.from_dict(data_target.dict()) for data_target in ingest_parameters.targets ] run_config = RunConfig( owner=username, credentials=mlrun.model.Credentials(ingest_parameters.credentials.access_key), ) # Try to deduce whether the ingest job will need v3io mount, by analyzing the paths to the source and # targets. If it needs it, apply v3io mount to the run_config. Note that the access-key and username are # user-context parameters, we cannot use the api context. if _has_v3io_path(data_source, data_targets, feature_set): access_key = auth_info.data_session if not access_key or not username: log_and_raise( HTTPStatus.BAD_REQUEST.value, reason="Request needs v3io access key and username in header", ) run_config = run_config.apply(v3io_cred(access_key=access_key, user=username)) infer_options = ingest_parameters.infer_options or InferOptions.default() run_params = ingest( feature_set, data_source, data_targets, infer_options=infer_options, return_df=False, run_config=run_config, ) # ingest may modify the feature-set contents, so returning the updated feature-set. result_feature_set = schemas.FeatureSet(**feature_set.to_dict()) return schemas.FeatureSetIngestOutput( feature_set=result_feature_set, run_object=run_params.to_dict() ) @router.get("/projects/{project}/features", response_model=schemas.FeaturesOutput) def list_features( project: str, name: str = None, tag: str = None, entities: List[str] = Query(None, alias="entity"), labels: List[str] = Query(None, alias="label"), auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.auth.verifier.AuthVerifier().query_project_permissions( project, mlrun.api.schemas.AuthorizationAction.read, auth_info, ) features = mlrun.api.crud.FeatureStore().list_features( db_session, project, name, tag, entities, labels ) features = mlrun.api.utils.auth.verifier.AuthVerifier().filter_project_resources_by_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature, features.features, lambda feature_list_output: ( feature_list_output.feature_set_digest.metadata.project, feature_list_output.feature.name, ), auth_info, ) return mlrun.api.schemas.FeaturesOutput(features=features) @router.get("/projects/{project}/entities", response_model=schemas.EntitiesOutput) def list_entities( project: str, name: str = None, tag: str = None, labels: List[str] = Query(None, alias="label"), auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.auth.verifier.AuthVerifier().query_project_permissions( project, mlrun.api.schemas.AuthorizationAction.read, auth_info, ) entities = mlrun.api.crud.FeatureStore().list_entities( db_session, project, name, tag, labels ) entities = mlrun.api.utils.auth.verifier.AuthVerifier().filter_project_resources_by_permissions( mlrun.api.schemas.AuthorizationResourceTypes.entity, entities.entities, lambda entity_list_output: ( entity_list_output.feature_set_digest.metadata.project, entity_list_output.entity.name, ), auth_info, ) return mlrun.api.schemas.EntitiesOutput(entities=entities) @router.post( "/projects/{project}/feature-vectors", response_model=schemas.FeatureVector ) def create_feature_vector( project: str, feature_vector: schemas.FeatureVector, versioned: bool = True, auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.singletons.project_member.get_project_member().ensure_project( db_session, project, auth_info=auth_info ) mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_vector, project, feature_vector.metadata.name, mlrun.api.schemas.AuthorizationAction.create, auth_info, ) _verify_feature_vector_features_permissions( auth_info, project, feature_vector.dict() ) feature_vector_uid = mlrun.api.crud.FeatureStore().create_feature_vector( db_session, project, feature_vector, versioned, ) return mlrun.api.crud.FeatureStore().get_feature_vector( db_session, project, feature_vector.metadata.name, feature_vector.metadata.tag or "latest", feature_vector_uid, ) @router.get( "/projects/{project}/feature-vectors/{name}/references/{reference}", response_model=schemas.FeatureVector, ) def get_feature_vector( project: str, name: str, reference: str, auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): tag, uid = parse_reference(reference) feature_vector = mlrun.api.crud.FeatureStore().get_feature_vector( db_session, project, name, tag, uid ) mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_vector, project, name, mlrun.api.schemas.AuthorizationAction.read, auth_info, ) _verify_feature_vector_features_permissions( auth_info, project, feature_vector.dict() ) return feature_vector @router.get( "/projects/{project}/feature-vectors", response_model=schemas.FeatureVectorsOutput ) def list_feature_vectors( project: str, name: str = None, state: str = None, tag: str = None, labels: List[str] = Query(None, alias="label"), partition_by: schemas.FeatureStorePartitionByField = Query( None, alias="partition-by" ), rows_per_partition: int = Query(1, alias="rows-per-partition", gt=0), partition_sort_by: schemas.SortField = Query(None, alias="partition-sort-by"), partition_order: schemas.OrderType = Query( schemas.OrderType.desc, alias="partition-order" ), auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.auth.verifier.AuthVerifier().query_project_permissions( project, mlrun.api.schemas.AuthorizationAction.read, auth_info, ) feature_vectors = mlrun.api.crud.FeatureStore().list_feature_vectors( db_session, project, name, tag, state, labels, partition_by, rows_per_partition, partition_sort_by, partition_order, ) feature_vectors = mlrun.api.utils.auth.verifier.AuthVerifier().filter_project_resources_by_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_vector, feature_vectors.feature_vectors, lambda feature_vector: ( feature_vector.metadata.project, feature_vector.metadata.name, ), auth_info, ) for feature_vector in feature_vectors: _verify_feature_vector_features_permissions( auth_info, project, feature_vector.dict() ) return mlrun.api.schemas.FeatureVectorsOutput(feature_vectors=feature_vectors) @router.get( "/projects/{project}/feature-vectors/{name}/tags", response_model=schemas.FeatureVectorsTagsOutput, ) def list_feature_vectors_tags( project: str, name: str, auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): if name != "*": raise mlrun.errors.MLRunInvalidArgumentError( "Listing a specific feature vector tags is not supported, set name to *" ) mlrun.api.utils.auth.verifier.AuthVerifier().query_project_permissions( project, mlrun.api.schemas.AuthorizationAction.read, auth_info, ) tag_tuples = mlrun.api.crud.FeatureStore().list_feature_vectors_tags( db_session, project, ) feature_vector_name_to_tag = { tag_tuple[1]: tag_tuple[2] for tag_tuple in tag_tuples } allowed_feature_vector_names = mlrun.api.utils.auth.verifier.AuthVerifier().filter_project_resources_by_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_vector, list(feature_vector_name_to_tag.keys()), lambda feature_vector_name: (project, feature_vector_name,), auth_info, ) tags = { tag_tuple[2] for tag_tuple in tag_tuples if tag_tuple[1] in allowed_feature_vector_names } return mlrun.api.schemas.FeatureVectorsTagsOutput(tags=list(tags)) @router.put( "/projects/{project}/feature-vectors/{name}/references/{reference}", response_model=schemas.FeatureVector, ) def store_feature_vector( project: str, name: str, reference: str, feature_vector: schemas.FeatureVector, versioned: bool = True, auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.singletons.project_member.get_project_member().ensure_project( db_session, project, auth_info=auth_info ) mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_vector, project, name, mlrun.api.schemas.AuthorizationAction.update, auth_info, ) _verify_feature_vector_features_permissions( auth_info, project, feature_vector.dict() ) tag, uid = parse_reference(reference) uid = mlrun.api.crud.FeatureStore().store_feature_vector( db_session, project, name, feature_vector, tag, uid, versioned, ) return mlrun.api.crud.FeatureStore().get_feature_vector( db_session, project, name, tag, uid ) @router.patch("/projects/{project}/feature-vectors/{name}/references/{reference}") def patch_feature_vector( project: str, name: str, feature_vector_patch: dict, reference: str, patch_mode: schemas.PatchMode = Header( schemas.PatchMode.replace, alias=schemas.HeaderNames.patch_mode ), auth_info: mlrun.api.schemas.AuthInfo = Depends(deps.authenticate_request), db_session: Session = Depends(deps.get_db_session), ): mlrun.api.utils.auth.verifier.AuthVerifier().query_project_resource_permissions( mlrun.api.schemas.AuthorizationResourceTypes.feature_vector, project, name, mlrun.api.schemas.AuthorizationAction.update, auth_info, ) _verify_feature_vector_features_permissions( auth_info, project, feature_vector_patch
<gh_stars>0 # -*- coding: utf-8 -*- """ Function: Implementation approach of Noisy Input Gaussian Processing (NIGP); also the Paper implementation : "Gaussian Process Training with Input Noise" Direct calculate the posterior mean and covariance of GP, even the posterior distribution is unknown Parameters: var_x: input noise variance var_y: output noise variance varf : kernal hyperparameter sigma_f l : kernal hyperparameter lengthscale or parameter set Figure 3 with 2 subfigure in PAC-NIGP """ import numpy as np import matplotlib.pyplot as plt import matplotlib import math from scipy.spatial.distance import cdist, pdist, squareform from scipy.optimize import minimize def plot_gp(mu, std, X, X_train=None, Y_train=None, title='NIGP'): # samples=[] X = X.ravel() mu = mu.ravel() # uncertainty = 1.96 * np.sqrt(np.diag(cov)) uncertainty = 1.96 * std plt.fill_between(X, mu + uncertainty, mu - uncertainty, alpha=0.1) plt.plot(X, mu, label='Estimation') # for i, sample in enumerate(samples): # plt.plot(X, sample, lw=1, ls='--', label=f'Sample {i + 1}') if X_train is not None: plt.plot(Xcv, sincsig(Xcv), 'rx', label='Real data') plt.legend() plt.title(title) plt.show() class GPRegressor: # l - Correlation length. Scalar or array of length num_features in X # varf - Signal variance. # normalize_y - Subtract mean of y from y if True. Often a good idea since # we are modeling a zero-mean GP. # num_restarts_hyper - Number of randomly initialized optimizations of the hyperparameters, # that should be performed. More than one is usually a good idea since # the log_marinal_likelihood often has local maxima. # def __init__(self, l=1.0, varf=1.0, normalize_y=True, num_restarts_hyper=1): self.varf = varf self.normalize_y = normalize_y self.num_restarts = num_restarts_hyper self.l = np.array(l) # X - Input prediction data # return_std - Returns GP std.dev. if True # np.zeros_like(M): create zero-matrix with the same shape as M def predict(self, X, return_std=False): l = self.l # [K2]: k(x, X); [self.pred_vec]: K(X,X)+sigma_y*I + sigma_x_regularization self.K2 = self.kernel(X, self.X_train, np.zeros_like(X), self.var_x, l, self.varf) # k(x,X) * inv( K(X,X)+sigma_y*I + sigma_x_regul ) * y mean = np.dot(self.K2, self.pred_vec) + self.mu if return_std: # See equation (7) in paper NIGP: std2 = np.sqrt(np.diag( self.autokernel(X, np.zeros_like(X), l, self.varf) - np.dot(self.K2, np.dot(self.pred_fac, self.K2.T)) )) return mean, std2 else: return mean, 0.0 # kernel and autokernel same shape with different data def kernel(self, X1, X2, var_x1, var_x2, l, varf): # K(x_star,X) kernal func # Equation 9 in NIGPf # squared exponential kernel with Automatic Relevance Determination tmp = 0.0 tmp2 = 1.0 l = l * np.ones(len(self.X_train[0, :])) for i in range(0, len(X1[0, :])): l2 = l[i] * l[i] # ! d1 = cdist(X1[:, i].reshape(-1, 1), X2[:, i].reshape(-1, 1), metric='sqeuclidean') d2 = cdist(var_x1[:, i].reshape(-1, 1), -var_x2[:, i].reshape(-1, 1), metric='euclidean') tmp += d1 / (l2 + d2) tmp2 *= (1.0 + d2 / l2) return varf * np.power(tmp2, -0.5) * np.exp(-0.5 * tmp) def autokernel(self, X, var_x, l, varf): # (self.X_train, self.var_x, l, varf) tmp = 0.0 tmp2 = 1.0 l = l * np.ones(len(self.X_train[0, :])) # diagonal matrix of the kernal for i in range(0, len(X[0, :])): l2 = l[i] * l[i] # Lambda : square of lengthscale of kernal d1 = cdist(X[:, i].reshape(-1, 1), X[:, i].reshape(-1, 1), metric='sqeuclidean') # ||x-x'||^2_2 (N*N) d2 = cdist(var_x[:, i].reshape(-1, 1), -var_x[:, i].reshape(-1, 1), metric='euclidean') # (N*N) Sigma_x variance of input tmp += d1 / (l2 + d2) # (N*N) tmp2 *= (1.0 + d2 / l2) # (N*N) sigma_f^2 * sqrt[Sigma_x in v(Lambda) + I] * exp(-0.5*(x_i-x_j)) return varf * np.power(tmp2, -0.5) * np.exp(-0.5 * tmp) # y_train - Output data (num_samples) # var_x - Variance in input points x # var_y - Variance in output points y # l_bounds - Bounds for the hyperparameters. # Array size (3x2) or ((2+num_features)x2). # l[0] is varf(signal variance), l[1] is noise_variance # and l[2::] is correlation length(s) <---> res here? # None means using the supplied hyperparameters. def fit(self, X_train, y_train, var_x, var_y, l_bounds=None): if self.normalize_y: self.mu = np.mean(y_train, 0) else: self.mu = 0.0 self.X_train = X_train self.y_train = (y_train - self.mu) # if np.iterable(var_x): self.var_x = var_x else: self.var_x = var_x * np.ones_like(X_train) self.var_y = var_y # Fit hyperparameters by maximizing log marginal likelihood. if l_bounds is not None: bounds = [] for i in range(0, len(l_bounds)): bounds.append(l_bounds[i]) best_f = 1e6 # repeat many times to get better parameters for j in range(0, self.num_restarts): loglb = np.log10(l_bounds[:, 0]) loghb = np.log10(l_bounds[:, 1]) l0 = loglb + (loghb - loglb) * np.random.random(size=loglb.shape) l0 = 10.0 ** l0 res = minimize(self.neg_log_marginal_likelihood, l0, method='l-bfgs-b', bounds=bounds, tol=1e-12, options={'disp': False, 'eps': 0.001}) # res: final optimized parameters; l0 is the initialize parameter if res['fun'] < best_f: self.varf = res['x'][0] # kernal hyper-parameter self.alpha = res['x'][1] # varn in nlml function self.l = res['x'][2::] # lengthscale parameter for kernal self.opt_params = res['x'] # print("iter: " + str(j) + ". params: " + "Output variance:" + "varf: " + str(self.varf) + ", alpha: " + str(self.alpha) + ", l: " + str(self.l)) self.var_y += self.alpha # Calculate factors needed for prediction. # K1 = K(X,X) self.K1 = self.autokernel(self.X_train, self.var_x, self.l, self.varf) # self.pred_fac: self.pred_fac = np.linalg.pinv(self.K1 + np.identity(len(self.K1[:, 0])) * self.var_y) # self.pred_vec: self.pred_vec = np.dot(self.pred_fac, self.y_train) def neg_log_marginal_likelihood(self, l): # This nlml three hyperparameters: SEE (2.31) in book GPML varf = l[0] # output variance varn = l[1] # input noise introduced variance, total variance l = l[2::] # lengthscale parameter for kernal # calculate the kernal matrix: K(X,X) + sigma^2 * I + varn' # varn or l[1]: (slope of mean func)^T * Sigma_x * (slope of mean func) K = self.autokernel(self.X_train, self.var_x, l, varf) \ + np.identity(len(self.X_train[:, 0])) * (self.var_y + varn) Kinv = np.linalg.pinv(K) # Calculate the pseudo-inverse of a matrix # print('varf:', varf, 'varn:', varn, 'lenghtscale:', l) return 0.5 * np.dot(self.y_train, np.dot(Kinv, self.y_train)) + 0.5 * np.log(np.linalg.det(K)) \ + 0.5 * len(K[:, 0]) * np.log(2 * math.pi) ## Example insipired from 'Learning Gaussian Process Models from Uncertain Data', Dallaire. if __name__ == "__main__": # def sincsig(x): # return (x >= 0) * np.sinc(x / math.pi) + (x < 0) * (0.5 * (1 + np.exp(-10 * x - 5)) ** (-1) + 0.5) def sincsig(x): return np.sin(x) np.random.seed(9527) Fig_path = None # std: covariance of noisy_X and noisy_y noise_y = 0.1 # Output noisy std noise_x = 0.4 # Iutput noisy std X_train = np.linspace(-10, 10, 150).reshape(-1, 1) Y_train = np.sin(X_train) + noise_y * np.random.randn(*X_train.shape) X_train_obs = X_train + noise_x * np.random.randn(*X_train.shape) X_train = X_train_obs # X_train = np.random.random((150, 1)) * 20.0 - 10.0 # generate 150 data points from interval [-10, 10] y_train = sincsig(X_train[:, 0]) # y_train = sincsig(X_train[:, 0]) X_std = np.random.random(X_train.shape) * 0.0 + noise_x y_std = noise_y * np.ones_like(y_train) y_train += np.random.normal(0.0, y_std) X_train += np.random.normal(0.0, X_std) # create data by constant interval X_test = np.linspace(-10, 10, 100).reshape(-1, 1) Y_test = np.sin(X_test) Xcv = np.linspace(-10, 10, 100).reshape(-1, 1) ycv = sincsig(Xcv[:, 0]) # ************************** GPR ************************ # print('Start standard GP') l_bounds = np.array([[0.01, 0.3], [0.02, 0.2], [0.1, 5.0]]) gp = GPRegressor(1, 1, num_restarts_hyper=1) gp.fit(X_train, y_train, 0.0, 0.0, l_bounds=l_bounds) yp, std = gp.predict(Xcv, True) print('End standard GP') # ************************** GPR plot ************************ # plt.figure(figsize=(6, 4)) plt.style.use('bmh') fontsize = 11 fontfamily = 'Times New Roman' matplotlib.rcParams['font.size'] = fontsize matplotlib.rcParams['font.family'] = fontfamily plt.fill_between(Xcv[:, 0], yp - 1.96 * std, yp + 1.96 * std, alpha=0.2) plt.plot(Xcv[:, 0], yp, '-', label='Estimation') plt.plot(Xcv[:, 0], sincsig(Xcv), '--', label='Real data') # plt.legend(['With input noisy', 'Without input noisy'], loc='best') plt.legend(loc='best') plt.xlabel('Test input') plt.ylabel('Output') # plt.savefig(fname=Fig_path+"Reprod_method1_GPR_4_noisy_input.pdf", format="pdf") plt.show() # ************************** NIGP ************************ # print('Start NIGP') l_bounds = np.array([[0.01, 0.3], [0.01, 0.1], [0.1, 5.0]]) gp = GPRegressor(1, 1, num_restarts_hyper=1) gp.fit(X_train, y_train, X_std ** 2, 0.0, l_bounds=l_bounds) yp, std = gp.predict(Xcv, True) print('End NIGP') # ************************** NIGPR plot ************************ # plt.figure(figsize=(6, 4)) plt.style.use('bmh') fontsize = 11 fontfamily = 'Times New Roman' matplotlib.rcParams['font.size'] = fontsize matplotlib.rcParams['font.family'] = fontfamily plt.fill_between(Xcv[:, 0], yp - 1.96 * std, yp + 1.96 * std, alpha=0.2) plt.plot(Xcv[:, 0], yp, '-', label='Estimation') plt.plot(Xcv[:, 0], sincsig(Xcv), '--', label='Real data') # plt.legend(['With
<= header_size): continue star_X_coord = self.find_star_info(line, star_X_coord_column) star_Y_coord = self.find_star_info(line, star_Y_coord_column) ## avoid empty lines by checking if the X and Y coordinates exist if not star_X_coord: continue if not star_Y_coord: continue counter += 1 star_coord = (int(float(star_X_coord)), int(float(star_Y_coord))) img_coord = self.star2gif(star_coord, self.get_scale_factor(PARAMS['mrc_dimensions'], PARAMS['img_dimensions'])) image_coordinates[ img_coord ] = star_coord # data are linked in this way to avoid transformation data loss print(">> %s particles read from star file %s" % (counter, starfile) ) ## update global dictionary after parsing is complete PARAMS['img_coords'] = image_coordinates return def update_input_widgets(self): """ Updates the input widgets on the main GUI to take on the values of the global dictionary. Mainly used after loading a new settings file. """ global PARAMS mrc_pixel_size_x = PARAMS['mrc_dimensions'][0] mrc_pixel_size_y = PARAMS['mrc_dimensions'][1] box_size = PARAMS['box_size'] angpix = PARAMS['angpix'] self.input_mrc_dimensions.delete(0, tk.END) self.input_mrc_dimensions.insert(0, "%s, %s" % (mrc_pixel_size_x, mrc_pixel_size_y) ) self.input_mrc_box_size.delete(0, tk.END) self.input_mrc_box_size.insert(0, box_size) self.input_angpix.delete(0, tk.END) self.input_angpix.insert(0, angpix) return def save_settings(self): """ Write out a settings file for ease of use on re-launching the program in the same directory """ global PARAMS, brush_size, current_im_data image_list = PARAMS['img_list'] n = PARAMS['index'] mrc_pixel_size_x = PARAMS['mrc_dimensions'][0] mrc_pixel_size_y = PARAMS['mrc_dimensions'][1] angpix = PARAMS['angpix'] box_size= PARAMS['box_size'] save_fname = '.em_dataset_curator.config' ## sanity check a file is loaded into buffer, otherwise no reason to save settings try: current_im_data.any() except: print("Abort autopick :: Image not loaded") return current_img = image_list[n] # os.path.splitext(image_list[n])[0] ## save a settings file only if a project is actively open, as assessed by image_list being populated if len(image_list) > 0: with open(save_fname, 'w') as f : f.write("## Last used settings for em_dataset_curator.py\n") f.write("mrc_pixel_size_x %s\n" % mrc_pixel_size_x) f.write("mrc_pixel_size_y %s\n" % mrc_pixel_size_y) f.write("angpix %s\n" % angpix) f.write("brush_size %s\n" % brush_size) f.write("img_on_save %s\n" % current_img) f.write("box_size %s\n" % box_size) print(" >> Saved current settings to '%s'" % save_fname) def load_settings(self): """ On loadup, search the directory for input files and load them into memory automatically >> marked_imgs.txt :: load these filenames into the 'marked_imgs' list variable """ global PARAMS, brush_size print("============================") print(" load_settings ") print("----------------------------") ## reset marked_imgs global variable marked_imgs = [] ## repopulate the global marked_imgs variable based on the file 'marked_imgs.txt', if present if os.path.exists('marked_imgs.txt'): ## update marked file list with file in directory with open('marked_imgs.txt', 'r') as f : for line in f: if not line.strip() in marked_imgs: marked_imgs.append(line.strip()) PARAMS['marked_imgs'] = marked_imgs settingsfile = '.em_dataset_curator.config' if os.path.exists(settingsfile): ## update marked file list with file in directory with open(settingsfile, 'r') as f : for line in f: line2list = line.split() if not '#' in line2list[0]: ## ignore comment lines if line2list[0] == 'mrc_pixel_size_x': mrc_pixel_size_x = int(line2list[1]) # PARAMS['mrc_pixel_size_x'] = int(line2list[1]) elif line2list[0] == 'mrc_pixel_size_y': mrc_pixel_size_y = int(line2list[1]) # PARAMS['mrc_pixel_size_y'] = int(line2list[1]) elif line2list[0] == 'angpix': PARAMS['angpix'] = float(line2list[1]) elif line2list[0] == 'brush_size': brush_size = int(line2list[1]) elif line2list[0] == 'img_on_save': PARAMS['img_on_save'] = line2list[1] elif line2list[0] == 'box_size': PARAMS['box_size'] = int(line2list[1]) print(" box_size = %s" % PARAMS['box_size']) ## set the dimensions PARAMS['mrc_dimensions'] = (mrc_pixel_size_x, mrc_pixel_size_y) ## update the widgets with the loaded values self.input_mrc_box_size.delete(0, tk.END) self.input_mrc_box_size.insert(0, PARAMS['box_size']) self.input_angpix.delete(0, tk.END) self.input_angpix.insert(0, PARAMS['angpix']) self.input_mrc_dimensions.delete(0, tk.END) self.input_mrc_dimensions.insert(0, "%s, %s" % (PARAMS['mrc_dimensions'][0], PARAMS['mrc_dimensions'][1])) # extract file information from selection file_name = PARAMS['img_on_save'] print("File selected: "+ file_name) # erase any previous image list and repopulate it with the new directory image_list = [] image_list = self.images_in_dir('.') PARAMS['img_list'] = image_list # find the index of the selected image in the new list try: PARAMS['index'] = image_list.index(file_name) except: print(" ERROR: Settings file points to image that does not exist in working directory! Resetting index to 0") ## redraw canvas items with updated global values as the given image index self.load_img() return def new_box_size(self): global PARAMS mrc_pixel_size_x = PARAMS['mrc_dimensions'][0] mrc_pixel_size_y = PARAMS['mrc_dimensions'][1] img_pixel_size_x = PARAMS['img_dimensions'][0] angpix = PARAMS['angpix'] user_input = self.input_mrc_box_size.get().strip() temp = re.findall(r'\d+', user_input) res = list(map(int, temp)) ## kill function if no entry is given or if value is not even if not len(res) == 1 or not isinstance(res[0], int) or not res[0] > 0: self.input_mrc_box_size.delete(0, tk.END) self.input_mrc_box_size.insert(0, "ang boxsize") return elif not (res[0] % 2 == 0): # check if value is even self.input_mrc_box_size.delete(0, tk.END) self.input_mrc_box_size.insert(0, "value must be even") return ## set the global box_size to the input field value box_size = res[0] ## update the global dictionary PARAMS['box_size'] = box_size ## calculate the image box size in pixels scale_factor = mrc_pixel_size_x / img_pixel_size_x img_angpix = angpix * scale_factor img_box_size = int(box_size / img_angpix) PARAMS['img_box_size'] = img_box_size ## redraw boxes by first deleting it then redrawing it self.draw_image_coordinates() ## revert focus to main canvas self.canvas.focus_set() return def new_mrc_dimensions(self): """ Update the global variables for mrc_dimensions from user input in the main window. Call a redraw of the image & boxes after. """ global PARAMS n = PARAMS['index'] image_list = PARAMS['img_list'] file_dir = PARAMS['file_dir'] user_input = self.input_mrc_dimensions.get().strip() temp = re.findall(r'\d+', user_input) res = list(map(int, temp)) if not len(res) == 2: self.input_mrc_dimensions.delete(0, tk.END) self.input_mrc_dimensions.insert(0, "mrc_X, mrc_Y") return else: mrc_pixel_size_x = res[0] mrc_pixel_size_y = res[1] PARAMS['mrc_dimensions'] = (mrc_pixel_size_x, mrc_pixel_size_y) ## check for an associated .star file with input coordinates to read counter = 0 star_coordinate_file = "" ## find the matching star file if it exists for fname in os.listdir(file_dir): ## iterate over the directory base_image_name = os.path.splitext(image_list[n])[0] ## get the base name of the .GIF file counter = 0 star_coordinate_file = "" if base_image_name in fname and fname[-5:] == ".star": ## find any files that match the base .GIF file name and end in .STAR counter += 1 star_coordinate_file = fname if counter > 1: print(">>> WARNING: Multiple .STAR files found for this image (e.g. multiple files match: " + base_image_name + "*.star)") ## This program writes out ..._CURATED.star files, if we find one - use that over all other available .STAR files if star_coordinate_file[-13:] == "_CURATED.star": break ## if a star file is found, load its coordinates # print(" STAR FILE USED FOR COORDS = ", star_coordinate_file) if (star_coordinate_file != ""): self.read_coords_from_star(star_coordinate_file) ## redraw particle positions and boxsize with the new remapped data self.draw_image_coordinates() ## revert focus to main canvas self.canvas.focus_set() return def new_angpix(self): """ Update the global 'angpix' variable from user input in the main window """ global PARAMS user_input = self.input_angpix.get().strip() try: res = float(user_input) angpix = res PARAMS['angpix'] = angpix ## we need to recalculate the label for box size in angstroms # self.box_size_ang.config(text="%s Angstroms" % (box_size * angpix)) except: self.input_angpix.delete(0, tk.END) self.input_angpix.insert(0, "angpix") ## redraw the picked coordinates self.draw_image_coordinates() ## revert focus to main canvas self.canvas.focus_set() def MouseWheelHandler(self, event): """ See: https://stackoverflow.com/questions/17355902/python-tkinter-binding-mousewheel-to-scrollbar Tie the mousewheel to the brush size, draw a green square to show the user the final setting """ global brush_size, PARAMS def delta(event): if event.num == 5 or event.delta < 0: return -2 return 2 brush_size += delta(event) ## avoid negative brush_size values if brush_size <= 0: brush_size = 0 ## draw new brush size x, y = event.x, event.y x_max = int(x + brush_size/2) x_min = int(x - brush_size/2) y_max = int(y + brush_size/2) y_min = int(y - brush_size/2) brush = self.canvas.create_rectangle(x_max, y_max, x_min, y_min, outline="green2", tags='brush') def check_if_two_ranges_intersect(self, x0, x1, y0, y1): """ For two well-ordered ranges (x0 < x1; y0 < 1), check if there is any intersection between them. See: https://stackoverflow.com/questions/3269434/whats-the-most-efficient-way-to-test-two-integer-ranges-for-overlap/25369187 An efficient way to quickly calculate if the erase brush hits a marked coordinate in the image. """ ## sanity check input if (x0 > x1): print("ERROR: Incorrect range provided, x0 -> x1 == %s -> %s" % (x0, x1)) if y0 > y1: print("ERROR: Incorrect range provided, y0 -> y1 == %s -> %s" % (y0, y1)) if x0 <= y1 and y0 <= x1: return True else: return False def delete_brush_cursor(self, event): """ This function is tied to the <Motion> event. It constantly checks if the condition RIGHT_MOUSE_PRESSED is True, in which case it runs the erase-coordinates algorithm """ global RIGHT_MOUSE_PRESSED, brush_size, PARAMS image_coordinates = PARAMS['img_coords'] box_size = PARAMS['box_size'] n
<gh_stars>1-10 from __future__ import annotations __all__ = ('StateBase', 'State', 'StateCollection') import abc import asyncio import collections import itertools from typing import ( Any, AsyncIterable, AsyncIterator, Awaitable, Callable, cast, Collection, Coroutine, Final, Generator, Generic, Iterator, Literal, Mapping, NoReturn, overload, TypeVar, Union, ) from typing_extensions import ParamSpec, Self, TypeAlias from . import amap_iter from ._typing import awaitable, Comparable, Maybe, Nothing, NothingType from .exceptions import StateError, StopAnyIteration _T = TypeVar('_T') _KT = TypeVar('_KT') _VT = TypeVar('_VT') _RT = TypeVar('_RT') _S = TypeVar('_S', bound=object) _RS = TypeVar('_RS', bound=object) _SS = TypeVar('_SS', bound=Collection) _P = ParamSpec('_P') _FutureOrCoro: TypeAlias = Union[asyncio.Future[_T], Coroutine[Any, Any, _T]] _MaybeAsync: TypeAlias = Union[Callable[_P, _T], Callable[_P, Awaitable[_T]]] _DoneStatus: TypeAlias = Literal['stop', 'error', 'cancel'] _DONE_STATUS_KEYS: Final[tuple[_DoneStatus, ...]] = 'stop', 'error', 'cancel' _ST = TypeVar('_ST', bound='State') class StateBase(Generic[_S]): __slots__ = ('__loop', '__future', ) __match_args__ = ('_value_raw',) __loop: asyncio.AbstractEventLoop | None __future: asyncio.Future[_S] | None def __init__(self): self.__loop = None self.__future = None def __del__(self): if (future := self.__future) is None: return try: future.cancel() except RuntimeError: pass def __await__(self) -> Generator[Any, None, _S]: return self._future.__await__() def __repr__(self) -> str: return f'<{type(self).__name__}{self._format()} at {id(self):#x}>' def __str__(self) -> str: return f'<{type(self).__name__}{self._format()}>' @property def readonly(self) -> bool: """Returns true if an asyncio.Task will set the result, otherwise, the asyncio.Future can be set manually. """ return isinstance(self._future, asyncio.Task) @property def is_done(self) -> bool: return self._future.done() @property def is_set(self) -> bool: future = self._future if not future.done(): return False if future.cancelled(): return False return future.exception() is None @property def is_error(self) -> bool: future = self._future if not future.done(): return False if future.cancelled(): return False if (exc := future.exception()) is None: return False return not isinstance(exc, asyncio.CancelledError) @property def is_cancelled(self) -> bool: future = self._future if not future.done(): return False if future.cancelled(): return True return isinstance(future.exception(), asyncio.CancelledError) @property def _loop(self) -> asyncio.AbstractEventLoop: if (loop := self.__loop) is None: if (future := self.__future) is not None: loop = future.get_loop() else: loop = asyncio.get_running_loop() self.__loop = loop return loop @property def _future(self) -> asyncio.Future[_S]: if (future := self.__future) is None: future = self.__future = self._loop.create_future() return future @_future.setter def _future(self, value: asyncio.Future[_S] | _S): if done := (future := self._future).done(): future.result() if asyncio.isfuture(value): future = value else: if done: future = future.get_loop().create_future() future.set_result(cast(_S, value)) self.__future = future @_future.deleter def _future(self): if (future := self.__future) is None or not future.done(): return if future.cancelled(): future.result() # will raise asyncio.CancelledError self.__future = future.get_loop().create_future() @property def _value_raw(self) -> _S | BaseException | None: """For pattern matching.""" fut = self._future if not fut.done(): return None try: return fut.result() except (SystemExit, KeyboardInterrupt): raise except BaseException as exc: return exc def _set(self, value: _S) -> None: self.__as_unset_future().set_result(value) self._on_set(value) def _raise(self, exc: BaseException) -> None: if isinstance(exc, asyncio.CancelledError): self._cancel() return self.__as_unset_future().set_exception(exc) self._on_error(exc) def _cancel(self) -> bool: cancelled = self._future.cancel() self._on_cancel() return cancelled def _on_set(self, value: _S) -> None: ... def _on_error(self, exc: BaseException) -> None: ... def _on_cancel(self) -> None: ... def _format(self) -> str: fut = self._future if fut.done(): return f'({self._value_raw!r})' return '' def __as_unset_future(self): future = self._future if isinstance(future, asyncio.Task): raise StateError(f'{self!r} is readonly') if future.done(): current = future.result() raise StateError(f'{self!r} is already set: {current!r}') return future class State(AsyncIterator[_S], StateBase[_S], Generic[_S]): __slots__ = ( '_key', '_collections', '_producer', '_consumer', '_is_set', '_is_stopped', '_is_error', '_is_cancelled', '__waiters', '__waiter_counter', ) # when provided, states are mapped before they're compared _key: Callable[[_S], Comparable] # change notification to e.g. StateVarTuple _collections: list[tuple[Any, StateCollection[Any, _S, Any]]] # see _set_from(), can be set only once _producer: Maybe[AsyncIterable[Any]] _consumer: Maybe[asyncio.Task[None | NoReturn]] def __init__( self, *, key: Callable[[_S], Comparable] = lambda s: s ) -> None: super().__init__() self._key = key self._consumer = Nothing self._producer = Nothing # TODO use weakref self._collections = [] self._is_set = False self._is_stopped = False self._is_error = False self._is_cancelled = False self.__waiters = {} self.__waiter_counter = itertools.count(0).__next__ def __del__(self): super().__del__() try: self._future.cancel() for waiter in self.__waiters.values(): waiter.cancel() except RuntimeError: pass self._collections.clear() def __eq__(self, other: _S) -> bool: if not self.is_set: return False value = self._get() return bool(value is other or value == other) def __await__(self) -> Generator[Any, None, _S]: if not self.is_set: if (future := self._future).done(): future.result() # reraise if needed return self._wait_next().__await__() return super().__await__() async def __aiter__(self, *, buffer: int | None = 4) -> AsyncIterator[_S]: futures = collections.deque(maxlen=buffer) if self.is_set: futures.append(self._future) waiters = self.__waiters waiter_id = self.__waiter_counter() def _schedule_next(present=None): if present: if present.cancelled(): return if isinstance(present.exception(), StopAsyncIteration): return loop = present.get_loop() else: loop = asyncio.get_running_loop() future = loop.create_future() future.add_done_callback(_schedule_next) assert waiter_id not in waiters or waiters[waiter_id].done() waiters[waiter_id] = future futures.append(future) try: _schedule_next() while not self.is_done: if not len(futures): await asyncio.sleep(0) assert len(futures) try: yield await futures.popleft() except StopAnyIteration: break finally: if waiter_id in waiters: del waiters[waiter_id] async def __anext__(self) -> _S: try: return await self._wait_next() except asyncio.CancelledError: raise StopAsyncIteration __hash__ = None # type: ignore async def _wait_next(self) -> _S: waiters = self.__waiters waiter_id = self.__waiter_counter() future = waiters[waiter_id] = self._loop.create_future() try: return await future finally: del waiters[waiter_id] @property def readonly(self) -> bool: """Returns true if an asyncio.Task will set the result, otherwise, the asyncio.Future can be set manually. """ return self._producer is not Nothing or super().readonly @property def is_set(self) -> bool: return self._is_set @property def is_done(self) -> bool: return self._is_stopped or self._is_error or self._is_cancelled @property def is_stopped(self) -> bool: return self._is_stopped @property def is_error(self) -> bool: return self._is_error @property def is_cancelled(self) -> bool: return self._is_cancelled @overload def map(self, function: Callable[[_S], Awaitable[_S]]) -> Self: ... @overload def map(self, function: Callable[[_S], _S]) -> Self: ... @overload def map( self, function: Callable[[_S], Awaitable[object]], cls: type[_ST], *cls_args: Any, **cls_kwargs: Any, ) -> _ST: ... @overload def map( self, function: Callable[[_S], object], cls: type[_ST], *cls_args: Any, **cls_kwargs: Any, ) -> _ST: ... def map( self, function: Callable[[_S], Awaitable[_RS]] | Callable[[_S], _RS], cls: type[_ST] | None = None, *cls_args: Any, **cls_kwargs: Any, ) -> _ST: """Create a new instance from this state, with the function applied to its value. The function can be either sync or async. Unless specified, the mapped state type will be type(self). """ if cls_kwargs is None: cls_kwargs = {} if 'name' not in cls_kwargs: cls_kwargs['name'] = f'{function.__name__}({self})' res: _ST if cls is None: res = cast(_ST, type(self)(*cls_args, **cls_kwargs)) else: res = cls(*cls_args, **cls_kwargs) if self.is_set: initial = function(self._get()) if awaitable(initial): async def _set_after(): res._set(cast(_RS, await initial)) asyncio.create_task(_set_after()) else: res._set(cast(_RS, initial)) res._set_from(amap_iter(function, self)) return res async def _consume(self) -> None | NoReturn: assert self._producer is not Nothing try: async for state in self._producer: self._set_item(state) except (SystemExit, KeyboardInterrupt) as exc: self._raise(exc) raise except GeneratorExit: # don't attempt to "stop" if the loop was closed try: asyncio.get_running_loop() except RuntimeError: self._cancel() else: self._stop() except StopAnyIteration: self._stop() except asyncio.CancelledError: self._cancel() except BaseException as exc: self._raise(exc) else: await asyncio.sleep(0) self._stop() @overload def _get(self, default: _T) -> _S | _T: ... @overload def _get(self, default: NothingType = ...) -> _S: ... def _get(self, default: Maybe[_T] = Nothing) -> _S | _T: if (future := self._future).done(): try: return future.result() except (GeneratorExit, StopAsyncIteration, asyncio.CancelledError): if default is Nothing: raise return default if default is Nothing: raise LookupError(repr(self)) return default def _set_from(self, producer: AsyncIterable[Any]) -> None: if self._producer is not Nothing: raise StateError(f'{self!r} is already being set') self._producer = producer task_name = f'{self}.consumer' self._consumer = asyncio.create_task(self._consume(), name=task_name) def _set_item(self, value: Any): """Used by the consumer to set the next item""" self._set(cast(_S, value)) def _set(self, value: _S, always: bool = False): if not always and self._equals(value): return 0 del self._future cast(asyncio.Future[_S], self._future).set_result(value) self._on_set(value) self.__notify_waiters(value) def _clear(self) -> None: del self._future self._on_clear() def _stop(self) -> None: exc = StopAsyncIteration future = self._future if not future.done(): future.set_exception(exc) self._on_stop() self.__notify_waiters(exc=exc) def _raise(self, exc: type[BaseException] | BaseException) -> None: if isinstance(exc, type): exc = exc() if isinstance(exc, asyncio.CancelledError): self._cancel() elif isinstance(exc, StopAsyncIteration): self._stop() else: del self._future cast(asyncio.Future[_S], self._future).set_exception(exc) self._on_error(exc) self.__notify_waiters(exc=exc) def _cancel(self) -> None: if self._is_cancelled: return self._future.cancel() self._on_cancel() self.__notify_waiters(cancel=True) def _on_set(self, state: _S) -> None: self._is_set = True for j, parent in self._collections: # noinspection PyProtectedMember parent._on_item_set(j, state) def _on_clear(self) -> None: assert not self._is_cancelled self._is_set = False self._is_error = False self._is_stopped = False for j, parent in self._collections: # noinspection PyProtectedMember
np.isfinite(u_xsum) bg_tcp = interpolate.splrep(np.arange(nx)[u_xsum_ok], np.asarray(u_xsum)[u_xsum_ok], s=smo1) # representative background profile in column u_x = interpolate.splev(np.arange(nx), bg_tcp, ) return u_xsum, u_x, u_std def findBackground(extimg,background_lower=[None,None], background_upper=[None,None],yloc_spectrum=int(slit_width/2), smo1=None, smo2=None, chatter=2): '''Extract the background from the image slice containing the spectrum. Parameters ---------- extimg : 2D array image containing spectrum. Dispersion approximately along x-axis. background_lower : list distance in pixels from `yloc_spectrum` of the limits of the lower background region. background_upper : list distance in pixels from `yloc_spectrum` of the limits of the upper background region. yloc_spectrum : int pixel `Y` location of spectrum smo1 : float smoothing parameter passed to smoothing spline fitting routine. `None` for default. smo2 : float smoothing parameter passed to smoothing spline fitting routine. `None` for default. chatter : int verbosity Returns ------- bg : float mean background bg1, bg2 : 1D arrays bg1 = lower background; bg2 = upper background inherits size from extimg.shape x-xoordinate bgsig : float standard deviation of background bgimg : 2D array image of the background constructed from bg1 and/or bg2 bg_limits_used : list, length 4 limits used for the background in the following order: lower background, upper background (bg1_good, bg1_dis, bg1_dis_good, bg2_good, bg2_dis, bg2_dis_good, bgimg_lin) : tuple various other background measures Notes ----- **Global parameter** - **background_method** : {'boxcar','splinefit'} The two background images can be computed 2 ways: 1. 'splinefit': sigma clip image, then fit a smoothing spline to each row, then average in y for each background region 2. 'boxcar': select the background from the smoothed image created by method 1 below. 3. 'sigmaclip': do sigma clipping on rows and columns to get column profile background, then clip image and mask, interpolate over masked bits. extimg is the image containing the spectrum in the 1-axis centered in 0-axis `ank` is the position of the anchor in the image I create two background images: 1. split the image strip into 40 portions in x, so that the background variation is small compute the mean sigma clip (3 sigma) each area to to the local mean replace out-of-image pixels with mean of whole image (2-sigma clipped) smooth with a boxcar by the smoothing factor 2. compute the background in two regions upper and lower linearly interpolate in Y between the two regions to create a background image bg1 = lower background; bg2 = upper background smo1, smo2 allow one to relax the smoothing factor in computing the smoothing spline fit History ------- - 8 Nov 2011 NPM Kuin complete overhaul things to do: get quality flagging of bad background points, edges perhaps done here? - 13 Aug 2012: possible problem was seen of very bright sources not getting masked out properly and causing an error in the background that extends over a large distance due to the smoothing. The cause is that the sources are more extended than can be handled by this method. A solution would be to derive a global background - 30 Sep 2014: background fails in visible grism e.g., 57977004+1 nearby bright spectrum new method added (4x slower processing) to screen the image using sigma clipping ''' import sys import numpy as np try: from convolve import boxcar except: from stsci.convolve import boxcar from scipy import interpolate import stsci.imagestats as imagestats # initialize parameters bgimg = extimg.copy() out = np.where( (np.abs(bgimg-cval) <= 1e-6) ) in_img = np.where( (np.abs(bgimg-cval) > 1e-6) & np.isfinite(bgimg) ) nx = bgimg.shape[1] # number of points in direction of dispersion ny = bgimg.shape[0] # width of the image # sigma screening of background taking advantage of the dispersion being # basically along the x-axis if _PROFILE_BACKGROUND_: bg, u_x, bg_sig = background_profile(bgimg, smo1=30, badval=cval) u_mask = np.zeros((ny,nx),dtype=bool) for i in range(ny): u_mask[i,(bgimg[i,:].flatten() < u_x) & np.isfinite(bgimg[i,:].flatten())] = True bkg_sc = np.zeros((ny,nx),dtype=float) # the following leaves larger disps in the dispersion but less noise; # tested but not implemented, as it is not as fast and the mean results # are comparable: #for i in range(ny): # uf = interpolate.interp1d(np.where(u_mask[i,:])[0],bgimg[i,u_mask[i,:]],bounds_error=False,fill_value=cval) # bkg_sc[i,:] = uf(np.arange(nx)) #for i in range(nx): # ucol = bkg_sc[:,i] # if len(ucol[ucol != cval]) > 0: # ucol[ucol == cval] = ucol[ucol != cval].mean() for i in range(nx): ucol = bgimg[:,i] if len(ucol[u_mask[:,i]]) > 0: ucol[np.where(u_mask[:,i] == False)[0] ] = ucol[u_mask[:,i]].mean() bkg_sc[:,i] = ucol if background_method == 'sigmaclip': return bkg_sc else: # continue now with the with screened image bgimg = bkg_sc kx0 = 0 ; kx1 = nx # default limits for valid lower background kx2 = 0 ; kx3 = nx # default limits for valid upper background ny4 = int(0.25*ny) # default width of each default background region sig1 = 1 # unit for background offset, width bg_limits_used = [0,0,0,0] # return values used ## in the next section I replace the > 2.5 sigma peaks with the mean ## after subdividing the image strip to allow for the ## change in background level which can be > 2 over the ## image. Off-image parts are set to image mean. # this works most times in the absence of the sigma screening,but # can lead to overestimates of the background. # the call to the imagestats package is only done here, and should # consider replacement. Its not critical for the program. # xlist = np.linspace(0,bgimg.shape[1],80) xlist = np.asarray(xlist,dtype=int) imgstats = imagestats.ImageStats(bgimg[in_img[0],in_img[1]],nclip=3) bg = imgstats.mean bgsig = imgstats.stddev if chatter > 2: sys.stderr.write( 'background statistics: mean=%10.2f, sigma=%10.2f '% (imgstats.mean, imgstats.stddev)) # create boolean image flagging good pixels img_good = np.ones(extimg.shape,dtype=bool) # flag area out of picture as bad img_good[out] = False # replace high values in image with estimate of mean and flag them as not good for i in range(78): # after the sigma screening this is a bit of overkill, leave in for now sub_bg = boxcar(bgimg[:,xlist[i]:xlist[i+2]] , (5,5), mode='reflect', cval=cval) sub_bg_use = np.where( np.abs(sub_bg - cval) > 1.0e-5 ) # list of coordinates imgstats = None if sub_bg_use[0].size > 0: imgstats = imagestats.ImageStats(sub_bg[sub_bg_use],nclip=3) # patch values in image (not out of image) with mean if outliers aval = 2.0*imgstats.stddev img_clip_ = ( (np.abs(bgimg[:,xlist[i]:xlist[i+2]]-cval) < 1e-6) | (np.abs(sub_bg - imgstats.mean) > aval) | (sub_bg <= 0.) | np.isnan(sub_bg) ) bgimg[:,xlist[i]:xlist[i+2]][img_clip_] = imgstats.mean # patch image img_good[:,xlist[i]:xlist[i+2]][img_clip_] = False # flag patches # the next section selects the user-selected or default background for further processing if chatter > 1: if background_method == 'boxcar': sys.stderr.write( "BACKGROUND METHOD: %s; background smoothing = %s\n"% (background_method,background_smoothing)) else: sys.stderr.write( "BACKGROUND METHOD:%s\n"%(background_method )) if not ((background_method == 'splinefit') | (background_method == 'boxcar') ): sys.stderr.write('background method missing; currently reads : %s\n'%(background_method)) if background_method == 'boxcar': # boxcar smooth in x,y using the global parameter background_smoothing bgimg = boxcar(bgimg,background_smoothing,mode='reflect',cval=cval) if background_lower[0] == None: bg1 = bgimg[0:ny4,:].copy() bg_limits_used[0]=0 bg_limits_used[1]=ny4 bg1_good = img_good[0:ny4,:] kx0 = np.min(np.where(img_good[0,:]))+10 # assuming the spectrum is in the top two thirds of the detector kx1 = np.max(np.where(img_good[0,:]))-10 else: # no curvature, no second order: limits bg1_1= np.max(np.array([yloc_spectrum - sig1*background_lower[0],20 ])) #bg1_0= np.max(np.array([yloc_spectrum - sig1*(background_lower[0]+background_lower[1]),0])) bg1_0= np.max(np.array([yloc_spectrum - sig1*(background_lower[1]),0])) bg1 = bgimg[int(bg1_0):int(bg1_1),:].copy() bg_limits_used[0]=bg1_0 bg_limits_used[1]=bg1_1 bg1_good = img_good[int(bg1_0):int(bg1_1),:] kx0 = np.min(np.where(img_good[int(bg1_0),:]))+10 # assuming the spectrum is in the top two thirds of the detector kx1 = np.max(np.where(img_good[int(bg1_0),:]))-10 # corrected for edge effects #if ((kx2-kx0) < 20): # print 'not
bool) def initialize(self, infr=None, use_image=False, init_mode='rereview', review_cfg=None): print('[viz_graph] initialize') self.init_mode = init_mode print('self.init_mode = %r' % (self.init_mode,)) if review_cfg is None: mode = 'filtered' if self.init_mode == 'split' else 'unfiltered' self.preset_config(mode) self.infr = infr self.initialize_menus() self.graph_tab_widget = self.addNewTabWidget(verticalStretch=1) self.statbar1 = self.addNewWidget( ori='horiz', verticalStretch=1, margin=1, spacing=1) self.statbar2 = self.addNewWidget( ori='horiz', verticalStretch=1, margin=1, spacing=1) self.prog_bar = self.addNewProgressBar(visible=False) self.initialize_api_tabs() self.statbar1.addNewButton('Match and Score', min_width=1, pressed=self.match_and_score_edges) self.statbar1.addNewButton('ScoreVsOne', min_width=1, pressed=self.score_edges_vsone) self.statbar1.addNewButton('Edit Filters', min_width=1, pressed=self.edit_filters) self.statbar1.addNewButton('Repopulate', min_width=1, pressed=self.repopulate) self.statbar2.addNewButton('Reset DBState', min_width=1, pressed=self.reset_review) self.statbar2.addNewButton('Reset Rereview', min_width=1, pressed=self.reset_rereview) self.num_names_lbl = self.statbar2.addNewLabel('NUM_NAMES_LBL') self.state_lbl = self.statbar2.addNewLabel('STATE_LBL') self.statbar2.addNewButton('Accept', pressed=self.accept) # _show_graph = self.init_mode in ['split', 'rereview', 'review'] _show_graph = True if _show_graph: # TODO: separate graph view into its own class self.graph_tab = self.graph_tab_widget.addNewTab('Graph') # TODO: make this its own proper widget self.graph_widget = DevGraphWidget(parent=self, self_parent=self, use_image=use_image) self.graph_tab.addWidget(self.graph_widget) # self.graph_widget.connect_kepress_to_slot else: self.graph_widget = None self.graph_tab = None self.init_signals_and_slots() def init_signals_and_slots(self): # https://doc.qt.io/archives/qtjambi-4.5.2_01/com/trolltech/qt/core/Qt.ConnectionType.html # connection_type = QtCore.Qt.AutoConnection # connection_type = QtCore.Qt.BlockingQueuedConnection connection_type = QtCore.Qt.DirectConnection # connection_type = QtCore.Qt.QueuedConnection self.signal_state_update.connect(self.update_state, type=connection_type) def initialize_api_tabs(self): self.api_tabs = {} self.api_widgets = {} def _add_item_widget_tab(key, view_class='table'): title = key.title().replace('_', ' ') self.api_tabs[key] = self.graph_tab_widget.addNewTab(title) self.api_widgets[key] = gt.APIItemWidget(view_class=view_class) self.api_tabs[key].addWidget(self.api_widgets[key]) _add_item_widget_tab('edges') _add_item_widget_tab('nodes') _add_item_widget_tab('name_nodes', view_class='tree') _add_item_widget_tab('name_edges', view_class='tree') node_view = self.api_widgets['nodes'].view node_view.contextMenuClicked.connect(self.node_context) node_view.connect_single_key_to_slot(gt.ALT_KEY, self.on_alt_pressed) name_node_view = self.api_widgets['name_nodes'].view name_node_view.contextMenuClicked.connect(self.node_context) name_node_view.connect_single_key_to_slot(gt.ALT_KEY, self.on_alt_pressed) edge_view = self.api_widgets['edges'].view edge_view.doubleClicked.connect(self.edge_doubleclick) edge_view.contextMenuClicked.connect(self.edge_context) edge_view.connect_keypress_to_slot(self.edge_keypress) edge_view.connect_single_key_to_slot(gt.ALT_KEY, self.on_alt_pressed) name_edge_view = self.api_widgets['name_edges'].view name_edge_view.doubleClicked.connect(self.edge_doubleclick) name_edge_view.contextMenuClicked.connect(self.edge_context) name_edge_view.connect_keypress_to_slot(self.edge_keypress) name_edge_view.connect_single_key_to_slot(gt.ALT_KEY, self.on_alt_pressed) def populate_edge_model(self): print('[viz_graph] populate_edge_model') # if self.init_mode is None: # self.review_cfg['show_match_thumb'] = False key = 'edges' tab = self.api_tabs[key] widget = self.api_widgets[key] api = make_edge_api(self.infr, review_cfg=self.review_cfg) title = key.title().replace('_', ' ') headers = api.make_headers(tblnice=title, tblname=key) widget.change_headers(headers) widget.resize_headers(api) widget.view.verticalHeader().setVisible(True) tab.setTabText('%s (%r)' % (title, widget.model.num_rows_total)) widget.view.verticalHeader().setDefaultSectionSize(221) def populate_node_model(self): print('[viz_graph] populate_node_model') api = make_node_api(self.infr) key = 'nodes' tab = self.api_tabs[key] widget = self.api_widgets[key] title = key.title().replace('_', ' ') headers = api.make_headers(tblnice=title, tblname=key) widget.change_headers(headers) widget.view.verticalHeader().setVisible(True) try: widget.view.verticalHeader().setMovable(True) except AttributeError: widget.view.verticalHeader().setSectionsMovable(True) tab.setTabText('%s (%r)' % (title, widget.model.num_rows_total)) def populate_name_node_model(self): api = make_name_node_api(self.infr, review_cfg=self.review_cfg) key = 'name_nodes' tab = self.api_tabs[key] widget = self.api_widgets[key] title = key.title().replace('_', ' ') headers = api.make_headers(tblnice=title, tblname=key) widget.change_headers(headers) tab.setTabText('%s (%r)' % (title, widget.model.num_rows_total)) def populate_name_edge_model(self): api = make_name_edge_api(self.infr, review_cfg=self.review_cfg) key = 'name_edges' tab = self.api_tabs[key] widget = self.api_widgets[key] title = key.title().replace('_', ' ') headers = api.make_headers(tblnice=title, tblname=key) widget.change_headers(headers) tab.setTabText('%s (%r)' % (title, widget.model.num_rows_total)) def initialize_menus(self): self.menubar = gt.newMenubar(self) self.menus = {} key = 'Dev' menu = self.menus[key] = self.menubar.newMenu(key) menu.newAction(triggered=self.print_info) menu.newAction(triggered=self.embed, shortcut='ctrl+shift+I') menu.newAction(triggered=self.expand_image_and_names) menu.newAction(triggered=self.emit_state_update) menu.newAction(triggered=self.print_staging_table) menu.newAction(triggered=self.print_annotmatch_table) menu.newAction(triggered=self.print_deltas) key = 'Actions' menu = self.menus[key] = self.menubar.newMenu(key) menu.newAction(triggered=self.commit_to_staging) key = 'Debug' menu = self.menus[key] = self.menubar.newMenu(key) menu.newAction(triggered=self.use_ibeis_names) menu.newAction(triggered=self.reset_staging) menu.newAction(triggered=self.reset_annotmatch) menu.newAction(triggered=self.ensure_full) menu.newAction(triggered=self.ensure_cliques) menu.newAction(triggered=self.vsone_subset) menu.newAction(text='relabel_using_reviews', triggered=lambda: self.infr.relabel_using_reviews()) menu.newAction(text='apply_nondynamic_update', triggered=lambda: self.infr.apply_nondynamic_update()) def preset_config(self, mode='filtered'): print('[graph] preset_config mode=%r' % (mode,)) if mode == 'filtered': self.review_cfg = GRAPH_REVIEW_CFG_DEFAULTS.copy() elif mode == 'unfiltered': self.review_cfg = GRAPH_REVIEW_CFG_DEFAULTS.copy() for key in self.review_cfg.keys(): if key.startswith('filter_'): self.review_cfg[key] = False def showEvent(self, event): super(AnnotGraphWidget, self).showEvent(event) ut.cprint('[viz_graph] showEvent', 'green') # Fire initialize event after we show the GUI QtCore.QTimer.singleShot(50, self.init_inference) def init_inference(self): print('[viz_graph] init_inference mode=%r' % (self.init_mode)) if self.init_mode is None: pass elif self.init_mode == 'split': self.preset_config('filtered') self.reset_split() elif self.init_mode == 'rereview': self.preset_config('unfiltered') self.reset_rereview() elif self.init_mode == 'review': self.reset_review() else: raise ValueError('Unknown init_mode=%r' % (self.init_mode,)) self.repopulate() if ut.get_argflag('--graphtab'): index = self.graph_tab_widget.indexOf(self.graph_tab) self.graph_tab_widget.setCurrentIndex(index) # self.graph_tab_widget.setCurrentIndex(2) match = ut.get_argval('--match', type_=list, default=None) import ubelt as ub if match: pairs = list(ub.chunks(match, 2)) self.mark_pair_state(pairs, POSTV) nomatch = ut.get_argval('--nomatch', type_=list, default=None) if nomatch: pairs = list(ub.chunks(nomatch, 2)) self.mark_pair_state(pairs, NEGTV) def repopulate(self): # self.update_state(structure_changed=True) self.emit_state_update(structure_changed=True) def emit_state_update(self, structure_changed=False, disable_global_update=False): self.signal_state_update.emit(structure_changed, disable_global_update) def update_state(self, structure_changed=False, disable_global_update=False): print('[viz_graph] update_state mode=%s' % (self.init_mode,)) #if self.init_mode in ['split', 'rereview']: if not disable_global_update: if self.init_mode == 'split': self.infr.apply_feedback_edges() self.infr.relabel_using_reviews() elif self.init_mode == 'rereview': self.infr.apply_feedback_edges() # self.infr.apply_match_scores() self.infr.relabel_using_reviews() elif self.init_mode == 'review': self.infr.apply_match_edges() self.infr.ensure_mst() self.infr.apply_feedback_edges() # self.infr.apply_match_scores() self.infr.relabel_using_reviews() self.infr.apply_nondynamic_update() # Set gui status indicators status = self.infr.connected_component_status() truth_colors = self.infr._get_truth_colors() if status['num_inconsistent']: self.state_lbl.setText('Inconsistent Names: %d' % (status['num_inconsistent'],)) self.state_lbl.setColor('black', truth_colors[NEGTV][0:3] * 255) else: self.state_lbl.setText('Consistent') self.state_lbl.setColor('black', truth_colors[POSTV][0:3] * 255) self.num_names_lbl.setText('Names: max=%r' % (status['num_names_max'])) # print('[viz_graph] on_update_state mode=%s' % (self.init_mode,)) if structure_changed: # TODO: only make this API if the tab is clicked self.populate_node_model() self.populate_edge_model() self.populate_name_node_model() self.populate_name_edge_model() if self.graph_widget is not None: self.graph_widget.emit_graph_update() for widget in self.api_widgets.values(): model = widget.view.model() # FIXME: should only clear cache in viewport model.clear_cache() model.layoutChanged.emit() def ensure_cliques(self): self.infr.ensure_cliques() self.infr.relabel_using_reviews() self.infr.apply_nondynamic_update() self.repopulate() def ensure_full(self): self.infr.ensure_full() self.infr.relabel_using_reviews() self.infr.apply_nondynamic_update() self.repopulate() def match_and_score_edges(self): with gt.GuiProgContext('Scoring Edges', self.prog_bar) as ctx: # TODO: add in a cfgdict here with settable params self.infr.exec_matching(prog_hook=ctx.prog_hook) self.infr.apply_match_edges(self.review_cfg) # self.infr.apply_match_scores() self.repopulate() def score_edges_vsone(self): # DEPRICATE # TODO: replace with new interface with gt.GuiProgContext('Scoring Edges', self.prog_bar) as ctx: edges = list(self.infr.edges()) self.infr.exec_vsone_subset(edges, prog_hook=ctx.prog_hook) # self.infr.exec_vsone(prog_hook=ctx.prog_hook) # self.infr.apply_match_scores() self.repopulate() def reset_review(self): print('[viz_graph] reset_review') infr = self.infr with gt.GuiProgContext('Reset Review', self.prog_bar) as ctx: ctx.set_progress(0, 3) with ut.Timer('reset_feedback'): infr.reset_feedback('staging', apply=True) with ut.Timer('reinit_name_labels'): infr.reset_labels_to_ibeis() if self.graph_widget is not None: self.graph_widget.set_pin_state(True) with ut.Timer('ensure_mst'): infr.ensure_mst() with ut.Timer('apply_match_edges'): infr.apply_match_edges() # with ut.Timer('apply_match_scores'): # infr.apply_match_scores() # with ut.Timer('relabel_using_reviews'): # self.infr.relabel_using_reviews() # with ut.Timer('apply_nondynamic_update'): # self.infr.apply_nondynamic_update() self.repopulate() ctx.set_progress(3, 3) def reset_annotmatch(self): print('[viz_graph] reset_rereview') infr = self.infr with gt.GuiProgContext('Reset Review', self.prog_bar) as ctx: ctx.set_progress(0, 3) infr.reset_feedback('annotmatch', apply=True) infr.relabel_using_reviews() ctx.set_progress(msg='repopulate') self.repopulate() ctx.set_progress(8, 8) def reset_staging(self): print('[viz_graph] reset_rereview') infr = self.infr with gt.GuiProgContext('Reset Review', self.prog_bar) as ctx: ctx.set_progress(0, 3) infr.reset_feedback('staging', apply=True) infr.relabel_using_reviews() ctx.set_progress(msg='repopulate') self.repopulate() ctx.set_progress(8, 8) def reset_rereview(self): """ Goal: All names are removed. Reset edges so only reviewed edges are shown. You can change the state of those edges. They are not filtered. """ print('[viz_graph] reset_rereview') infr = self.infr self.init_mode = 'rereview' with gt.GuiProgContext('Reset Review', self.prog_bar) as ctx: ctx.set_progress(0, 3) infr.initialize_graph() if self.graph_widget is not None: self.graph_widget.set_pin_state(True) ctx.set_progress(msg='reset name labels') infr.reset_name_labels() ctx.set_progress(msg='reset feedback') infr.reset_feedback('staging', apply=True) ctx.set_progress(msg='remove name labels') infr.clear_name_labels() # ctx.set_progress(msg='apply match scores') # infr.apply_match_scores() ctx.set_progress(msg='repopulate') self.repopulate() ctx.set_progress(8, 8) def reset_split(self): infr = self.infr self.init_mode = 'split' with gt.GuiProgContext('Initializing', self.prog_bar) as ctx: ctx.set_progress(0, 3) infr.initialize_graph() if self.graph_widget is not None: self.graph_widget.set_pin_state(True) ctx.set_progress(1, 3) infr.remove_feedback() ctx.set_progress(2, 3) infr.clear_name_labels() ctx.set_progress(3, 3) def edit_filters(self): # TODO: split up review configs / show thumbs etc... config = dtool.Config.from_dict(self.review_cfg) dlg = gt.ConfigConfirmWidget.as_dialog(self, title='Edit Filters', msg='Edit Filters', with_spoiler=False, config=config) dlg.resize(700, 500) dlg.exec_() print('config = %r' % (config,)) updated_config = dlg.widget.config # NOQA print('updated_config = %r' % (updated_config,)) self.review_cfg = updated_config.asdict() self.repopulate() def edge_doubleclick(self, qtindex): """ qtindex = qtindex = self.api_widgets['edges'].view.get_row_and_qtindex_from_id(1)[0] """ print('[viz_graph] DoubleClicked: ' + str(gt.qtype.qindexinfo(qtindex))) model = qtindex.model() aid1 = model.get_header_data('aid1', qtindex) aid2 = model.get_header_data('aid2', qtindex) cm, aid1, aid2 = self.infr.lookup_cm(aid1, aid2) if cm is not None: cm.ishow_single_annotmatch(self.infr.qreq_, aid2, mode=0) else: # Hack self.graph_widget.deselect() self.graph_widget.toggle_selected_aid([aid1, aid2]) #self.graph_widget.selected_aids = [aid1, aid2] self.graph_widget.show_selected() def mark_pair_state(self, pairs, state): valid_states = {POSTV, NEGTV, INCMP, UNREV} statetags = state.split('+') state = statetags[0] tags = statetags[1].split(';') if len(statetags) > 1 else [] assert state in valid_states for aid1, aid2 in pairs: user_id = ut.get_user_name() + '@' + ut.get_computer_name() + ':qt-mark' self.infr.add_feedback((aid1, aid2), state, tags=tags, user_id=user_id) self.emit_state_update(disable_global_update=True) def make_mark_state_funcs(self, selection_func): def _mark_selected_pair_state(state): self.mark_pair_state(selection_func(), state) options = [ ('Mark &True', ut.partial(_mark_selected_pair_state, POSTV)), ('Mark &False', ut.partial(_mark_selected_pair_state, NEGTV)), ('Mark &Not-Comparable', ut.partial(_mark_selected_pair_state, INCMP)), ('Mark &Photobomb', ut.partial(_mark_selected_pair_state, 'nomatch+photobomb')), ('Mark &SceneryMatch', ut.partial(_mark_selected_pair_state, 'nomatch+scenerymatch')), ('&Unreview', ut.partial(_mark_selected_pair_state, UNREV)), # unreview will only remove internal feedback, anything commited will not change ] return options def name_selection(self, view): selected_qtindex_list_ = view.selectedRows() selected_qtindex_names = [] for qtindex in selected_qtindex_list_: model = qtindex.model() if model.name in {'name_edges', 'name_nodes'}: level = qtindex.internalPointer().level if level == 0: selected_qtindex_names.append(qtindex) name_labels = [] for qtindex in selected_qtindex_names: model = qtindex.model() name_label = model.get_header_data('name_label', qtindex) name_labels.append(name_label) return name_labels def edge_selection(self, view): selected_qtindex_list_ = view.selectedRows() selected_qtindex_edges = [] for qtindex in selected_qtindex_list_: model = qtindex.model() if model.name == 'name_edges': level = qtindex.internalPointer().level if level == 1: selected_qtindex_edges.append(qtindex) elif model.name == 'edges': selected_qtindex_edges.append(qtindex) aid_pairs = [] for qtindex in selected_qtindex_edges: model = qtindex.model() aid1 = model.get_header_data('aid1', qtindex) aid2 = model.get_header_data('aid2', qtindex) aid_pairs.append((aid1, aid2)) return aid_pairs def node_selection(self, view): selected_qtindex_list = view.selectedRows() aids = [ qtindex.model().get_header_data('aid', qtindex) for qtindex in selected_qtindex_list ] return aids def get_node_options(self, aids): """ Context-menu options for annotation nodes """ from ibeis.viz.interact import interact_chip options = [] if len(aids) == 1: options += interact_chip.build_annot_context_options( self.infr.ibs, aids[0], refresh_func=None, with_interact_name=False, config2_=None) if len(aids) > 1: aid_pairs = list(it.combinations(aids, 2)) options += self.get_edge_options(aid_pairs) return options def
# -*- coding: utf-8 -*- """This file contains the Windows NT time zone definitions. The Windows time zone names can be obtained from the following Windows Registry key: HKEY_LOCAL_MACHINE\\SOFTWARE\\Microsoft\\Windows NT\\CurrentVersion\\Time Zones """ # Dictionary to map Windows time zone names to Python equivalents. # Note that spaces have been stripped from the Windows time zone names. TIME_ZONES = { 'AlaskanStandardTime': 'US/Alaska', 'Arabic Standard Time': 'Asia/Baghdad', 'AtlanticStandardTime': 'Canada/Atlantic', 'AzoresStandardTime': 'Atlantic/Azores', 'CanadaCentralStandardTime': 'CST6CDT', 'CapeVerdeStandardTime': 'Atlantic/Azores', 'CentralAmericaStandardTime': 'CST6CDT', 'CentralDaylightTime': 'CST6CDT', 'CentralEuropeanStandardTime': 'Europe/Belgrade', 'CentralEuropeStandardTime': 'Europe/Belgrade', 'Central Standard Time': 'CST6CDT', 'CentralStandardTime': 'CST6CDT', 'ChinaStandardTime': 'Asia/Bangkok', 'EasternDaylightTime': 'EST5EDT', 'EasternStandardTime': 'EST5EDT', 'E.EuropeStandardTime': 'Egypt', 'EgyptStandardTime': 'Egypt', 'GMTStandardTime': 'GMT', 'GreenwichStandardTime': 'GMT', 'HawaiianStandardTime': 'US/Hawaii', 'IndiaStandardTime': 'Asia/Kolkata', 'IsraelStandardTime': 'Egypt', 'KoreaStandardTime': 'Asia/Seoul', 'MalayPeninsulaStandardTime': 'Asia/Kuching', 'MexicoStandardTime2': 'MST7MDT', 'MexicoStandardTime': 'CST6CDT', 'MountainDaylightTime': 'MST7MDT', 'MountainStandardTime': 'MST7MDT', 'NewfoundlandStandardTime': 'Canada/Newfoundland', 'NorthAsiaEastStandardTime': 'Asia/Bangkok', 'PacificDaylightTime': 'PST8PDT', 'PacificSAStandardTime': 'Canada/Atlantic', 'Pacific Standard Time': 'PST8PDT', 'PacificStandardTime': 'PST8PDT', 'RomanceStandardTime': 'Europe/Belgrade', 'RomanceDaylightTime': 'Europe/Belgrade', 'SamoaStandardTime': 'US/Samoa', 'SAPacificStandardTime': 'EST5EDT', 'SAWesternStandardTime': 'Canada/Atlantic', 'SingaporeStandardTime': 'Asia/Bangkok', 'SouthAfricaStandardTime': 'Egypt', 'TaipeiStandardTime': 'Asia/Bangkok', 'TokyoStandardTime': 'Asia/Tokyo', '@tzres.dll,-1010': 'Asia/Aqtau', '@tzres.dll,-1020': 'Asia/Dhaka', '@tzres.dll,-1021': 'Asia/Dhaka', '@tzres.dll,-1022': 'Asia/Dhaka', '@tzres.dll,-104': 'America/Cuiaba', '@tzres.dll,-105': 'America/Cuiaba', '@tzres.dll,-1070': 'Asia/Tbilisi', '@tzres.dll,-10': 'Atlantic/Azores', '@tzres.dll,-110': 'EST5EDT', '@tzres.dll,-111': 'EST5EDT', '@tzres.dll,-1120': 'America/Cuiaba', '@tzres.dll,-112': 'EST5EDT', '@tzres.dll,-1140': 'Pacific/Fiji', '@tzres.dll,-11': 'Atlantic/Azores', '@tzres.dll,-120': 'EST5EDT', '@tzres.dll,-121': 'EST5EDT', '@tzres.dll,-122': 'EST5EDT', '@tzres.dll,-12': 'Atlantic/Azores', '@tzres.dll,-130': 'EST5EDT', '@tzres.dll,-131': 'EST5EDT', '@tzres.dll,-132': 'EST5EDT', '@tzres.dll,-140': 'CST6CDT', '@tzres.dll,-141': 'CST6CDT', '@tzres.dll,-142': 'CST6CDT', '@tzres.dll,-1460': 'Pacific/Port_Moresby', '@tzres.dll,-150': 'America/Guatemala', '@tzres.dll,-151': 'America/Guatemala', '@tzres.dll,-152': 'America/Guatemala', '@tzres.dll,-1530': 'Asia/Yekaterinburg', '@tzres.dll,-160': 'CST6CDT', '@tzres.dll,-161': 'CST6CDT', '@tzres.dll,-162': 'CST6CDT', '@tzres.dll,-1630': 'Europe/Nicosia', '@tzres.dll,-1660': 'America/Bahia', '@tzres.dll,-1661': 'America/Bahia', '@tzres.dll,-1662': 'America/Bahia', '@tzres.dll,-170': 'America/Mexico_City', '@tzres.dll,-171': 'America/Mexico_City', '@tzres.dll,-172': 'America/Mexico_City', '@tzres.dll,-180': 'MST7MDT', '@tzres.dll,-181': 'MST7MDT', '@tzres.dll,-182': 'MST7MDT', '@tzres.dll,-190': 'MST7MDT', '@tzres.dll,-191': 'MST7MDT', '@tzres.dll,-192': 'MST7MDT', '@tzres.dll,-200': 'MST7MDT', '@tzres.dll,-201': 'MST7MDT', '@tzres.dll,-202': 'MST7MDT', '@tzres.dll,-20': 'Atlantic/Cape_Verde', '@tzres.dll,-210': 'PST8PDT', '@tzres.dll,-211': 'PST8PDT', '@tzres.dll,-212': 'PST8PDT', '@tzres.dll,-21': 'Atlantic/Cape_Verde', '@tzres.dll,-220': 'US/Alaska', '@tzres.dll,-221': 'US/Alaska', '@tzres.dll,-222': 'US/Alaska', '@tzres.dll,-22': 'Atlantic/Cape_Verde', '@tzres.dll,-230': 'US/Hawaii', '@tzres.dll,-231': 'US/Hawaii', '@tzres.dll,-232': 'US/Hawaii', '@tzres.dll,-260': 'GMT', '@tzres.dll,-261': 'GMT', '@tzres.dll,-262': 'GMT', '@tzres.dll,-271': 'UTC', '@tzres.dll,-272': 'UTC', '@tzres.dll,-280': 'Europe/Budapest', '@tzres.dll,-281': 'Europe/Budapest', '@tzres.dll,-282': 'Europe/Budapest', '@tzres.dll,-290': 'Europe/Warsaw', '@tzres.dll,-291': 'Europe/Warsaw', '@tzres.dll,-292': 'Europe/Warsaw', '@tzres.dll,-300': 'Europe/Paris', '@tzres.dll,-301': 'Europe/Paris', '@tzres.dll,-302': 'Europe/Paris', '@tzres.dll,-320': 'Europe/Berlin', '@tzres.dll,-321': 'Europe/Berlin', '@tzres.dll,-322': 'Europe/Berlin', '@tzres.dll,-331': 'Europe/Nicosia', '@tzres.dll,-332': 'Europe/Nicosia', '@tzres.dll,-340': 'Africa/Cairo', '@tzres.dll,-341': 'Africa/Cairo', '@tzres.dll,-342': 'Africa/Cairo', '@tzres.dll,-350': 'Europe/Sofia', '@tzres.dll,-351': 'Europe/Sofia', '@tzres.dll,-352': 'Europe/Sofia', '@tzres.dll,-365': 'Egypt', '@tzres.dll,-371': 'Asia/Jerusalem', '@tzres.dll,-372': 'Asia/Jerusalem', '@tzres.dll,-380': 'Africa/Harare', '@tzres.dll,-381': 'Africa/Harare', '@tzres.dll,-382': 'Africa/Harare', '@tzres.dll,-390': 'Asia/Kuwait', '@tzres.dll,-391': 'Asia/Kuwait', '@tzres.dll,-392': 'Asia/Kuwait', '@tzres.dll,-400': 'Asia/Baghdad', '@tzres.dll,-401': 'Asia/Baghdad', '@tzres.dll,-402': 'Asia/Baghdad', '@tzres.dll,-40': 'Brazil/East', '@tzres.dll,-410': 'Africa/Nairobi', '@tzres.dll,-411': 'Africa/Nairobi', '@tzres.dll,-412': 'Africa/Nairobi', '@tzres.dll,-41': 'Brazil/East', '@tzres.dll,-42': 'Brazil/East', '@tzres.dll,-420': 'Europe/Moscow', '@tzres.dll,-421': 'Europe/Moscow', '@tzres.dll,-422': 'Europe/Moscow', '@tzres.dll,-434': 'Asia/Tbilisi', '@tzres.dll,-435': 'Asia/Tbilisi', '@tzres.dll,-440': 'Asia/Muscat', '@tzres.dll,-441': 'Asia/Muscat', '@tzres.dll,-442': 'Asia/Muscat', '@tzres.dll,-447': 'Asia/Baku', '@tzres.dll,-448': 'Asia/Baku', '@tzres.dll,-449': 'Asia/Baku', '@tzres.dll,-450': 'Asia/Yerevan', '@tzres.dll,-451': 'Asia/Yerevan', '@tzres.dll,-452': 'Asia/Yerevan', '@tzres.dll,-460': 'Asia/Kabul', '@tzres.dll,-461': 'Asia/Kabul', '@tzres.dll,-462': 'Asia/Kabul', '@tzres.dll,-471': 'Asia/Yekaterinburg', '@tzres.dll,-472': 'Asia/Yekaterinburg', '@tzres.dll,-480': 'Asia/Karachi', '@tzres.dll,-481': 'Asia/Karachi', '@tzres.dll,-482': 'Asia/Karachi', '@tzres.dll,-490': 'Asia/Kolkata', '@tzres.dll,-491': 'Asia/Kolkata', '@tzres.dll,-492': 'Asia/Kolkata', '@tzres.dll,-500': 'Asia/Kathmandu', '@tzres.dll,-501': 'Asia/Kathmandu', '@tzres.dll,-502': 'Asia/Kathmandu', '@tzres.dll,-510': 'Asia/Dhaka', '@tzres.dll,-511': 'Asia/Aqtau', '@tzres.dll,-512': 'Asia/Aqtau', '@tzres.dll,-570': 'Asia/Chongqing', '@tzres.dll,-571': 'Asia/Chongqing', '@tzres.dll,-572': 'Asia/Chongqing', '@tzres.dll,-60': 'America/Buenos_Aires', '@tzres.dll,-611': 'Australia/Perth', '@tzres.dll,-612': 'Australia/Perth', '@tzres.dll,-621': 'Asia/Seoul', '@tzres.dll,-622': 'Asia/Seoul', '@tzres.dll,-631': 'Asia/Tokyo', '@tzres.dll,-632': 'Asia/Tokyo', '@tzres.dll,-650': 'Australia/Darwin', '@tzres.dll,-651': 'Australia/Darwin', '@tzres.dll,-652': 'Australia/Darwin', '@tzres.dll,-660': 'Australia/Adelaide', '@tzres.dll,-661': 'Australia/Adelaide', '@tzres.dll,-662': 'Australia/Adelaide', '@tzres.dll,-670': 'Australia/Sydney', '@tzres.dll,-671': 'Australia/Sydney', '@tzres.dll,-672': 'Australia/Sydney', '@tzres.dll,-680': 'Australia/Brisbane', '@tzres.dll,-681': 'Australia/Brisbane', '@tzres.dll,-682': 'Australia/Brisbane', '@tzres.dll,-691': 'Australia/Hobart', '@tzres.dll,-692': 'Australia/Hobart', '@tzres.dll,-70': 'Canada/Newfoundland', '@tzres.dll,-71': 'Canada/Newfoundland', '@tzres.dll,-721': 'Pacific/Port_Moresby', '@tzres.dll,-722': 'Pacific/Port_Moresby', '@tzres.dll,-72': 'Canada/Newfoundland', '@tzres.dll,-731': 'Pacific/Fiji', '@tzres.dll,-732': 'Pacific/Fiji', '@tzres.dll,-740': 'Pacific/Auckland', '@tzres.dll,-741': 'Pacific/Auckland', '@tzres.dll,-742': 'Pacific/Auckland', '@tzres.dll,-80': 'Canada/Atlantic', '@tzres.dll,-81': 'Canada/Atlantic', '@tzres.dll,-82': 'Canada/Atlantic', '@tzres.dll,-840': 'America/Argentina/Buenos_Aires', '@tzres.dll,-841': 'America/Argentina/Buenos_Aires', '@tzres.dll,-842': 'America/Argentina/Buenos_Aires', '@tzres.dll,-870': 'Asia/Karachi', '@tzres.dll,-871': 'Asia/Karachi', '@tzres.dll,-872': 'Asia/Karachi', '@tzres.dll,-880': 'UTC', '@tzres.dll,-930': 'UTC', '@tzres.dll,-931': 'UTC', '@tzres.dll,-932': 'UTC', 'USEasternStandardTime': 'EST5EDT', 'USMountainStandardTime': 'MST7MDT', 'W.AustraliaStandardTime': 'Australia/Perth', 'W.CentralAfricaStandardTime': 'Europe/Belgrade', 'W.EuropeStandardTime': 'Europe/Belgrade', '(UTC) Coordinated Universal Time': 'UTC', } # Values of @tzres.dll,-[0-9]+ # 10 (UTC-01:00) Azores # 11 Azores Daylight Time # 12 Azores Standard Time # 20 (UTC-01:00) Cape Verde Is. # 21 Cape Verde Daylight Time # 22 Cape Verde Standard Time # 30 (UTC-02:00) Mid-Atlantic # 31 Mid-Atlantic Daylight Time # 32 Mid-Atlantic Standard Time # 40 (UTC-03:00) Brasilia # 41 E. South America Daylight Time # 42 E. South America Standard Time # 50 (UTC-03:00) Greenland # 51 Greenland Daylight Time # 52 Greenland Standard Time # 60 (UTC-03:00) Buenos Aires, Georgetown # 61 SA Eastern Daylight Time # 62 SA Eastern Standard Time # 70 (UTC-03:30) Newfoundland # 71 Newfoundland Daylight Time # 72 Newfoundland Standard Time # 80 (UTC-04:00) Atlantic Time (Canada) # 81 Atlantic Daylight Time # 82 Atlantic Standard Time # 90 (UTC-04:00) Santiago # 91 Pacific SA Daylight Time # 92 Pacific SA Standard Time # 100 (UTC-04:00) Caracas, La Paz # 101 SA Western Daylight Time # 102 SA Western Standard Time # 103 (UTC-04:00) Manaus # 104 Central Brazilian Daylight Time # 105 Central Brazilian Standard Time # 110 (UTC-05:00) Eastern Time (US & Canada) # 111 Eastern Daylight Time # 112 Eastern Standard Time # 120 (UTC-05:00) Bogota, Lima, Quito, Rio Branco # 121 SA Pacific Daylight Time # 122 SA Pacific Standard Time # 130 (UTC-05:00) Indiana (East) # 131 US Eastern Daylight Time # 132 US Eastern Standard Time # 140 (UTC-06:00) Saskatchewan # 141 Canada Central Daylight Time # 142 Canada Central Standard Time # 150 (UTC-06:00) Central America # 151 Central America Daylight Time # 152 Central America Standard Time # 160 (UTC-06:00) Central Time (US & Canada) # 161 Central Daylight Time # 162 Central Standard Time # 170 (UTC-06:00) Guadalajara, Mexico City, Monterrey # 171 Central Daylight Time (Mexico) # 172 Central Standard Time (Mexico) # 180 (UTC-07:00) Chihuahua, La Paz, Mazatlan # 181 Mountain Daylight Time (Mexico) # 182 Mountain Standard Time (Mexico) # 190 (UTC-07:00) Mountain Time (US & Canada) # 191 Mountain Daylight Time # 192 Mountain Standard Time # 200 (UTC-07:00) Arizona # 201 US Mountain Daylight Time # 202 US Mountain Standard Time # 210 (UTC-08:00) Pacific Time (US & Canada) # 211 Pacific Daylight Time # 212 Pacific Standard Time # 213 (UTC-08:00) Tijuana, Baja California # 214 Pacific Daylight Time (Mexico) # 215 Pacific Standard Time (Mexico) # 220 (UTC-09:00) Alaska # 221 Alaskan Daylight Time # 222 Alaskan Standard Time # 230 (UTC-10:00) Hawaii # 231 Hawaiian Daylight Time # 232 Hawaiian Standard Time # 240 (UTC-11:00) Midway Island, Samoa # 241 Samoa Daylight Time # 242 Samoa Standard Time # 250 (UTC-12:00) International Date Line West # 251 Dateline Daylight Time # 252 Dateline Standard Time # 260 (UTC) Dublin, Edinburgh, Lisbon, London # 261 GMT Daylight Time # 262 GMT Standard Time # 270 (UTC) Casablanca, Monrovia, Reykjavik # 271 Greenwich Daylight Time # 272 Greenwich Standard Time # 280 (UTC+01:00) Belgrade, Bratislava, Budapest, Ljubljana, Prague # 281 Central Europe Daylight Time # 282 Central Europe Standard Time # 290 (UTC+01:00) Sarajevo, Skopje, Warsaw, Zagreb # 291 Central European Daylight Time # 292 Central European Standard Time # 300 (UTC+01:00) Brussels, Copenhagen, Madrid, Paris # 301 Romance Daylight Time # 302 Romance Standard Time # 310 (UTC+01:00) West Central Africa # 311 W. Central Africa Daylight Time # 312 W. Central Africa Standard Time # 320 (UTC+01:00) Amsterdam, Berlin, Bern, Rome, Stockholm, Vienna # 321 W. Europe Daylight Time # 322 W. Europe Standard Time # 330 (UTC+02:00) Minsk # 331 E. Europe Daylight Time # 332 E. Europe Standard Time # 333 (UTC+02:00) Amman # 334 Jordan Daylight Time # 335 Jordan Standard Time # 340 (UTC+02:00) Cairo # 341 Egypt Daylight Time # 342 Egypt Standard Time # 350 (UTC+02:00) Helsinki, Kyiv, Riga, Sofia, Tallinn, Vilnius # 351 FLE Daylight Time # 352 FLE Standard Time # 360 (UTC+02:00) Athens, Bucharest, Istanbul # 361 GTB Daylight Time # 362 GTB Standard Time # 363 (UTC+02:00) Beirut # 364 Middle East Daylight Time # 365 Middle East Standard Time # 370 (UTC+02:00) Jerusalem # 371 Jerusalem Daylight Time # 372 Jerusalem Standard Time # 380 (UTC+02:00) Harare, Pretoria # 381 South Africa Daylight Time # 382 South Africa Standard Time # 383 (UTC+02:00) Windhoek # 384 Namibia Daylight Time # 385 Namibia Standard Time # 390 (UTC+03:00) Kuwait, Riyadh # 391 Arab Daylight Time # 392 Arab Standard Time # 400 (UTC+03:00) Baghdad # 401 Arabic Daylight Time # 402 Arabic Standard Time # 410 (UTC+03:00) Nairobi # 411 E. Africa Daylight Time # 412 E. Africa Standard Time # 420 (UTC+03:00) Moscow, St. Petersburg, Volgograd # 421 Russian Daylight Time # 422 Russian Standard Time # 430 (UTC+03:30) Tehran # 431 Iran Daylight Time # 432 Iran Standard Time # 433 (UTC+03:00) Tbilisi # 434 Georgian Daylight Time # 435 Georgian Standard Time # 440 (UTC+04:00) Abu Dhabi, Muscat # 441 Arabian Daylight Time # 442 Arabian Standard Time # 447 (UTC+04:00) Baku # 448 Azerbaijan Daylight Time # 449 Azerbaijan Standard Time # 450 (UTC+04:00) Yerevan # 451 Caucasus Daylight Time # 452 Caucasus Standard Time # 460 (UTC+04:30) Kabul # 461 Afghanistan Daylight Time # 462 Afghanistan Standard Time # 470 (UTC+05:00) Ekaterinburg # 471 Ekaterinburg Daylight Time # 472 Ekaterinburg Standard Time # 480 (UTC+05:00) Islamabad, Karachi, Tashkent # 481 West Asia Daylight Time # 482 West Asia Standard Time # 490 (UTC+05:30) Chennai, Kolkata, Mumbai, New Delhi # 491 India Daylight Time # 492 India Standard Time # 500 (UTC+05:45) Kathmandu # 501 Nepal Daylight Time # 502 Nepal Standard Time # 510 (UTC+06:00) Astana, Dhaka # 511 Central Asia Daylight Time # 512 Central Asia Standard Time # 520 (UTC+06:00) Almaty, Novosibirsk # 521 N. Central Asia Daylight Time # 522 N. Central Asia Standard Time # 530 (UTC+05:30) Sri Jayawardenepura # 531 Sri Lanka Daylight Time # 532 Sri Lanka Standard Time # 540 (UTC+06:30) Yangon (Rangoon) # 541 Myanmar Daylight Time # 542 Myanmar Standard Time # 550 (UTC+07:00) Krasnoyarsk # 551 North Asia Daylight Time # 552 North Asia Standard Time # 560 (UTC+07:00) Bangkok, Hanoi, Jakarta # 561 SE Asia Daylight Time # 562 SE Asia Standard Time # 570 (UTC+08:00) Beijing, Chongqing, Hong Kong, Urumqi # 571 China Daylight Time # 572 China Standard Time # 580 (UTC+08:00) Irkutsk, Ulaan Bataar # 581 North Asia East Daylight Time # 582 North Asia East Standard Time # 590 (UTC+08:00) Kuala Lumpur, Singapore # 591 Malay Peninsula Daylight Time # 592 Malay Peninsula Standard Time # 600 (UTC+08:00) Taipei # 601 Taipei Daylight Time # 602 Taipei Standard Time # 610 (UTC+08:00) Perth # 611 W. Australia Daylight Time # 612 W. Australia Standard Time # 620 (UTC+09:00) Seoul # 621 Korea Daylight Time # 622 Korea Standard Time # 630 (UTC+09:00) Osaka, Sapporo, Tokyo # 631 Tokyo Daylight Time # 632 Tokyo Standard Time # 640 (UTC+09:00) Yakutsk # 641 Yakutsk Daylight Time # 642 Yakutsk Standard Time # 650 (UTC+09:30) Darwin # 651 AUS Central Daylight Time # 652 AUS Central Standard Time # 660 (UTC+09:30) Adelaide # 661 Cen. Australia Daylight Time # 662 Cen. Australia
from __future__ import absolute_import, print_function, division, unicode_literals import six from sys import version_info import pytest import requests import responses from requests.exceptions import ConnectionError from responses import matchers def assert_response(resp, body=None, content_type="text/plain"): assert resp.status_code == 200 assert resp.reason == "OK" assert resp.headers["Content-Type"] == content_type assert resp.text == body def assert_reset(): assert len(responses._default_mock._matches) == 0 assert len(responses.calls) == 0 def test_query_string_matcher(): @responses.activate def run(): url = "http://example.com?test=1&foo=bar" responses.add( responses.GET, url, body=b"test", match=[matchers.query_string_matcher("test=1&foo=bar")], ) resp = requests.get("http://example.com?test=1&foo=bar") assert_response(resp, "test") resp = requests.get("http://example.com?foo=bar&test=1") assert_response(resp, "test") resp = requests.get("http://example.com/?foo=bar&test=1") assert_response(resp, "test") run() assert_reset() def test_request_matches_post_params(): @responses.activate def run(deprecated): if deprecated: json_params_matcher = getattr(responses, "json_params_matcher") urlencoded_params_matcher = getattr(responses, "urlencoded_params_matcher") else: json_params_matcher = matchers.json_params_matcher urlencoded_params_matcher = matchers.urlencoded_params_matcher responses.add( method=responses.POST, url="http://example.com/", body="one", match=[json_params_matcher({"page": {"name": "first", "type": "json"}})], ) responses.add( method=responses.POST, url="http://example.com/", body="two", match=[urlencoded_params_matcher({"page": "second", "type": "urlencoded"})], ) resp = requests.request( "POST", "http://example.com/", headers={"Content-Type": "x-www-form-urlencoded"}, data={"page": "second", "type": "urlencoded"}, ) assert_response(resp, "two") resp = requests.request( "POST", "http://example.com/", headers={"Content-Type": "application/json"}, json={"page": {"name": "first", "type": "json"}}, ) assert_response(resp, "one") with pytest.deprecated_call(): run(deprecated=True) assert_reset() run(deprecated=False) assert_reset() def test_request_matches_empty_body(): def run(): with responses.RequestsMock(assert_all_requests_are_fired=True) as rsps: # test that both json and urlencoded body are empty in matcher and in request rsps.add( method=responses.POST, url="http://example.com/", body="one", match=[matchers.json_params_matcher(None)], ) rsps.add( method=responses.POST, url="http://example.com/", body="two", match=[matchers.urlencoded_params_matcher(None)], ) resp = requests.request("POST", "http://example.com/") assert_response(resp, "one") resp = requests.request( "POST", "http://example.com/", headers={"Content-Type": "x-www-form-urlencoded"}, ) assert_response(resp, "two") with responses.RequestsMock(assert_all_requests_are_fired=False) as rsps: # test exception raise if matcher body is None but request data is not None rsps.add( method=responses.POST, url="http://example.com/", body="one", match=[matchers.json_params_matcher(None)], ) with pytest.raises(ConnectionError) as excinfo: resp = requests.request( "POST", "http://example.com/", json={"my": "data"}, headers={"Content-Type": "application/json"}, ) msg = str(excinfo.value) assert "request.body doesn't match: {my: data} doesn't match {}" in msg with responses.RequestsMock(assert_all_requests_are_fired=False) as rsps: rsps.add( method=responses.POST, url="http://example.com/", body="two", match=[matchers.urlencoded_params_matcher(None)], ) with pytest.raises(ConnectionError) as excinfo: resp = requests.request( "POST", "http://example.com/", headers={"Content-Type": "x-www-form-urlencoded"}, data={"page": "second", "type": "urlencoded"}, ) msg = str(excinfo.value) assert ( "request.body doesn't match: {page: second, type: urlencoded} doesn't match {}" in msg ) run() assert_reset() def test_request_matches_params(): @responses.activate def run(): url = "http://example.com/test" params = {"hello": "world", "I am": "a big test"} responses.add( method=responses.GET, url=url, body="test", match=[matchers.query_param_matcher(params)], match_querystring=False, ) # exchange parameter places for the test params = { "I am": "a big test", "hello": "world", } resp = requests.get(url, params=params) if six.PY3 and version_info[1] >= 7: # only after py 3.7 dictionaries are ordered, so we can check URL constructed_url = r"http://example.com/test?I+am=a+big+test&hello=world" assert resp.url == constructed_url assert resp.request.url == constructed_url resp_params = getattr(resp.request, "params") assert resp_params == params run() assert_reset() def test_fail_matchers_error(): """ Validate that Exception is raised if request does not match responses.matchers validate matchers.urlencoded_params_matcher validate matchers.json_params_matcher validate matchers.query_param_matcher validate matchers.request_kwargs_matcher :return: None """ def run(): with responses.RequestsMock(assert_all_requests_are_fired=False) as rsps: rsps.add( "POST", "http://example.com", match=[matchers.urlencoded_params_matcher({"foo": "bar"})], ) rsps.add( "POST", "http://example.com", match=[matchers.json_params_matcher({"fail": "json"})], ) with pytest.raises(ConnectionError) as excinfo: requests.post("http://example.com", data={"id": "bad"}) msg = str(excinfo.value) assert ( "request.body doesn't match: {id: bad} doesn't match {foo: bar}" in msg ) assert ( "request.body doesn't match: JSONDecodeError: Cannot parse request.body" in msg ) with responses.RequestsMock(assert_all_requests_are_fired=False) as rsps: rsps.add( "GET", "http://111.com", match=[matchers.query_param_matcher({"my": "params"})], ) rsps.add( method=responses.GET, url="http://111.com/", body="two", match=[matchers.json_params_matcher({"page": "one"})], ) with pytest.raises(ConnectionError) as excinfo: requests.get( "http://111.com", params={"id": "bad"}, json={"page": "two"} ) msg = str(excinfo.value) assert ( "Parameters do not match. {id: bad} doesn't match {my: params}" in msg ) assert ( "request.body doesn't match: {page: two} doesn't match {page: one}" in msg ) with responses.RequestsMock(assert_all_requests_are_fired=False) as rsps: req_kwargs = { "stream": True, "verify": False, } rsps.add( "GET", "http://111.com", match=[matchers.request_kwargs_matcher(req_kwargs)], ) with pytest.raises(ConnectionError) as excinfo: requests.get("http://111.com", stream=True) msg = str(excinfo.value) assert ( "Arguments don't match: " "{stream: True, verify: True} doesn't match {stream: True, verify: False}" ) in msg run() assert_reset() @pytest.mark.parametrize( "req_file,match_file", [ (b"Old World!", "Old World!"), ("Old World!", b"Old World!"), (b"Old World!", b"Old World!"), ("Old World!", "Old World!"), (b"\xacHello World!", b"\xacHello World!"), ], ) def test_multipart_matcher(req_file, match_file): @responses.activate def run(): req_data = {"some": "other", "data": "fields"} responses.add( responses.POST, url="http://httpbin.org/post", match=[ matchers.multipart_matcher( files={"file_name": match_file}, data=req_data ) ], ) resp = requests.post( "http://httpbin.org/post", data=req_data, files={"file_name": req_file} ) assert resp.status_code == 200 with pytest.raises(TypeError): responses.add( responses.POST, url="http://httpbin.org/post", match=[matchers.multipart_matcher(files={})], ) run() assert_reset() def test_multipart_matcher_fail(): """ Validate that Exception is raised if request does not match responses.matchers validate matchers.multipart_matcher :return: None """ def run(): # different file contents with responses.RequestsMock(assert_all_requests_are_fired=False) as rsps: req_data = {"some": "other", "data": "fields"} req_files = {"file_name": b"Old World!"} rsps.add( responses.POST, url="http://httpbin.org/post", match=[matchers.multipart_matcher(req_files, data=req_data)], ) with pytest.raises(ConnectionError) as excinfo: requests.post( "http://httpbin.org/post", data=req_data, files={"file_name": b"New World!"}, ) msg = str(excinfo.value) assert "multipart/form-data doesn't match. Request body differs." in msg if six.PY2: assert ( '\r\nContent-Disposition: form-data; name="file_name"; ' 'filename="file_name"\r\n\r\nOld World!\r\n' ) in msg assert ( '\r\nContent-Disposition: form-data; name="file_name"; ' 'filename="file_name"\r\n\r\nNew World!\r\n' ) in msg else: assert ( r'\r\nContent-Disposition: form-data; name="file_name"; ' r'filename="file_name"\r\n\r\nOld World!\r\n' ) in msg assert ( r'\r\nContent-Disposition: form-data; name="file_name"; ' r'filename="file_name"\r\n\r\nNew World!\r\n' ) in msg # x-www-form-urlencoded request with responses.RequestsMock(assert_all_requests_are_fired=False) as rsps: req_data = {"some": "other", "data": "fields"} req_files = {"file_name": b"Old World!"} rsps.add( responses.POST, url="http://httpbin.org/post", match=[matchers.multipart_matcher(req_files, data=req_data)], ) with pytest.raises(ConnectionError) as excinfo: requests.post("http://httpbin.org/post", data=req_data) msg = str(excinfo.value) assert ( "multipart/form-data doesn't match. Request headers['Content-Type'] is different." in msg ) assert ( "application/x-www-form-urlencoded isn't equal to multipart/form-data; boundary=" in msg ) # empty body request with responses.RequestsMock(assert_all_requests_are_fired=False) as rsps: req_files = {"file_name": b"Old World!"} rsps.add( responses.POST, url="http://httpbin.org/post", match=[matchers.multipart_matcher(req_files)], ) with pytest.raises(ConnectionError) as excinfo: requests.post("http://httpbin.org/post") msg = str(excinfo.value) assert "Request is missing the 'Content-Type' header" in msg run() assert_reset() def test_query_string_matcher_raises(): """ Validate that Exception is raised if request does not match responses.matchers validate matchers.query_string_matcher :return: None """ def run(): with responses.RequestsMock(assert_all_requests_are_fired=False) as rsps: rsps.add( "GET", "http://111.com", match=[matchers.query_string_matcher("didi=pro")], ) with pytest.raises(ConnectionError) as excinfo: requests.get("http://111.com", params={"test": "1", "didi": "pro"}) msg = str(excinfo.value) assert ( "Query string doesn't match. {didi: pro, test: 1} doesn't match {didi: pro}" in msg ) run() assert_reset() def test_request_matches_headers(): @responses.activate def run(): url = "http://example.com/" responses.add( method=responses.GET, url=url, json={"success": True}, match=[matchers.header_matcher({"Accept": "application/json"})], ) responses.add( method=responses.GET, url=url, body="success", match=[matchers.header_matcher({"Accept": "text/plain"})], ) # the actual request can contain extra headers (requests always adds some itself anyway) resp = requests.get( url, headers={"Accept": "application/json", "Accept-Charset": "utf-8"} ) assert_response(resp, body='{"success": true}', content_type="application/json") resp = requests.get(url, headers={"Accept": "text/plain"}) assert_response(resp, body="success", content_type="text/plain") run() assert_reset() def test_request_matches_headers_no_match(): @responses.activate def run(): url = "http://example.com/" responses.add( method=responses.GET, url=url, json={"success": True}, match=[matchers.header_matcher({"Accept": "application/json"})], ) with pytest.raises(ConnectionError) as excinfo: requests.get(url, headers={"Accept": "application/xml"}) msg = str(excinfo.value) assert ( "Headers do not match: {Accept: application/xml} doesn't match " "{Accept: application/json}" ) in msg run() assert_reset() def test_request_matches_headers_strict_match(): @responses.activate def run(): url = "http://example.com/" responses.add( method=responses.GET, url=url, body="success", match=[ matchers.header_matcher({"Accept": "text/plain"}, strict_match=True) ], ) # requests will add some extra headers of its own, so we have to use prepared requests session = requests.Session() # make sure we send *just* the header we're expectin prepped = session.prepare_request( requests.Request( method="GET", url=url, ) ) prepped.headers.clear() prepped.headers["Accept"] = "text/plain" resp = session.send(prepped) assert_response(resp, body="success", content_type="text/plain") # include the "Accept-Charset" header, which will fail to match prepped = session.prepare_request( requests.Request( method="GET", url=url, ) ) prepped.headers.clear() prepped.headers["Accept"] = "text/plain" prepped.headers["Accept-Charset"] = "utf-8" with pytest.raises(ConnectionError) as excinfo: session.send(prepped) msg = str(excinfo.value) assert ( "Headers do not match: {Accept: text/plain, Accept-Charset: utf-8} " "doesn't match {Accept: text/plain}" ) in msg run() assert_reset() def test_fragment_identifier_matcher(): @responses.activate def run(): responses.add( responses.GET, "http://example.com", match=[matchers.fragment_identifier_matcher("test=1&foo=bar")], body=b"test", ) resp = requests.get("http://example.com#test=1&foo=bar") assert_response(resp, "test") run() assert_reset() def test_fragment_identifier_matcher_error(): @responses.activate def run(): responses.add( responses.GET, "http://example.com/", match=[matchers.fragment_identifier_matcher("test=1")], ) responses.add( responses.GET, "http://example.com/", match=[matchers.fragment_identifier_matcher(None)], ) with pytest.raises(ConnectionError) as excinfo: requests.get("http://example.com/#test=2") msg = str(excinfo.value) assert ( "URL fragment identifier is different: test=1 doesn't match test=2" ) in msg assert ( "URL fragment identifier is different: None doesn't match test=2" ) in msg run() assert_reset() def test_fragment_identifier_matcher_and_match_querystring(): @responses.activate def run(): url = "http://example.com?ab=xy&zed=qwe#test=1&foo=bar" responses.add( responses.GET, url, match_querystring=True, match=[matchers.fragment_identifier_matcher("test=1&foo=bar")], body=b"test", ) # two requests to check reversed order of fragment identifier resp = requests.get("http://example.com?ab=xy&zed=qwe#test=1&foo=bar") assert_response(resp, "test") resp = requests.get("http://example.com?zed=qwe&ab=xy#foo=bar&test=1") assert_response(resp, "test") run() assert_reset() def test_matchers_create_key_val_str(): """ Test that matchers._create_key_val_str does recursive conversion """ data = { "my_list": [ 1, 2, "a", {"key1": "val1", "key2": 2, 3: "test"}, "!", [["list", "nested"], {"nested": "dict"}], ], 1: 4, "test": "val", "high": {"nested": "nested_dict"}, } conv_str = matchers._create_key_val_str(data) reference = ( "{1: 4, high: {nested: nested_dict}, my_list:
<gh_stars>0 # -*- coding: utf-8 -*- #!/usr/bin/python import math import numpy as np import os # Please cite https://tc.copernicus.org/articles/9/1797/2015/ # for original source -- #@Article{tc-9-1797-2015, #AUTHOR = {<NAME>}<NAME>.}, #TITLE = {Inter-comparison and evaluation of sea ice algorithms: towards further identification of challenges and optimal approach using passive microwave observations}, #JOURNAL = {The Cryosphere}, #VOLUME = {9}, #YEAR = {2015}, #NUMBER = {5}, #PAGES = {1797--1817}, #URL = {https://tc.copernicus.org/articles/9/1797/2015/}, #DOI = {10.5194/tc-9-1797-2015} #} def asi(tb85v, tb85h): """The asi ice concentration algorithm """ P0 = 47.0 P1 = 7.5 P = tb85v - tb85h """method coefficients:""" d3=1.64/100000.0 d2=-0.0016 d1=0.0192 d0=0.971 """concentrations calculation:""" ct = d3 * P**3.0 + d2 * P**2.0 + d1 * P + d0 return ct def bootstrap_f(tb18v, tb37v, tiepts): tw18v = tiepts[6] tw37v = tiepts[0] tfy18v = tiepts[8] tfy37v = tiepts[2] tmy18v = tiepts[7] tmy37v = tiepts[1] if (tb18v-tw18v)==0: cf=np.nan else: af = (tfy37v - tmy37v)/(tfy18v - tmy18v) bf = (tmy37v - af*tmy18v) qf = (tb37v - tw37v)/(tb18v - tw18v) wf = (tw37v - qf*tw18v) ti18vf = (bf - wf)/(qf - af) cf = (tb18v - tw18v)/(ti18vf - tw18v) return cf def bootstrap_p(tb37v, tb37h, tiepts): tw37h = tiepts[3] tw37v = tiepts[0] tfy37h = tiepts[5] tfy37v = tiepts[2] tmy37h = tiepts[4] tmy37v = tiepts[1] if (tb37h-tw37h)==0: cp=np.nan else: ap = (tfy37v - tmy37v) / (tfy37h - tmy37h) bp = (tmy37v - ap * tmy37h) qp = (tb37v - tw37v) / (tb37h - tw37h) wp = (tw37v - qp * tw37h) if (qp - ap)==0: cp=np.nan else: ti37hp = (bp - wp) / (qp - ap) ti37vp = ap * ti37hp + bp if (ti37vp - tw37v)==0: cp=np.nan else: cp = (tb37v - tw37v) / (ti37vp - tw37v) return cp def bristol(tb18v, tb37v, tb37h, tiepts): """Bristol ice concentration algorithm """ tw18v = tiepts[6] tw37h = tiepts[3] tw37v = tiepts[0] tfy18v = tiepts[8] tfy37h = tiepts[5] tfy37v = tiepts[2] tmy18v = tiepts[7] tmy37h = tiepts[4] tmy37v = tiepts[1] xa = tmy37v + (1.045*tmy37h) + (0.525*tmy18v) xd = tfy37v + (1.045*tfy37h) + (0.525*tfy18v) xh = tw37v + (1.045*tw37h) + (0.525*tw18v) xt = tb37v +(1.045*tb37h) + (0.525*tb18v) ya = (0.9164*tmy18v) - tmy37v + (0.4965*tmy37h) yd = (0.9164*tfy18v) - tfy37v + (0.4965*tfy37h) yh = (0.9164*tw18v) - tw37v + (0.4965*tw37h) yt = (0.9164*tb18v)- tb37v + (0.4965*tb37h) a_ht = (yt - yh)/(xt - xh) b_ht = yh - (a_ht*xh) a_da = (ya - yd)/(xa - xd) b_da = yd - (a_da*xd) xi = (b_da - b_ht)/(a_ht - a_da) cf = (xt - xh)/(xi - xh) c = cf return c def calval(tb37v,tb18v,tiepts): tw18v = tiepts[6] tw37v = tiepts[0] tfy18v = tiepts[8] tfy37v = tiepts[2] tmy18v = tiepts[7] tmy37v = tiepts[1] A=np.matrix([[tw37v, tw18v, 1.0],\ [tfy37v, tfy18v, 1.0],\ [tmy37v, tmy18v, 1.0]]) b=np.matrix([0.0, 1.0, 1.0]) d=A.I * b.T C=d[0]*tb37v+d[1]*tb18v+d[2] return C def nasa(tb18v, tb18h, tb37v, tiepts): """NASA-Team ice concetration algorithm """ ow18v = tiepts[6] ow18h = tiepts[9] ow37v = tiepts[0] fy18v = tiepts[8] fy18h = tiepts[11] fy37v = tiepts[2] my18v = tiepts[7] my18h = tiepts[10] my37v = tiepts[1] a0 = - ow18v + ow18h a1 = ow18v + ow18h a2 = my18v - my18h - ow18v + ow18h a3 = - my18v - my18h + ow18v + ow18h a4 = fy18v - fy18h - ow18v + ow18h a5 = - fy18v - fy18h + ow18v + ow18h b0 = - ow37v + ow18v b1 = ow37v + ow18v b2 = my37v - my18v - ow37v + ow18v b3 = - my37v - my18v + ow37v + ow18v b4 = fy37v - fy18v - ow37v + ow18v b5 = - fy37v - fy18v + ow37v + ow18v gr = (tb37v - tb18v)/(tb37v + tb18v) pr = (tb18v - tb18h)/(tb18v + tb18h) d0 = (-a2*b4) + (a4*b2) d1 = (-a3*b4) + (a5*b2) d2 = (-a2*b5) + (a4*b3) d3 = (-a3*b5) + (a5*b3) dd = d0 + d1*pr + d2*gr + d3*pr*gr f0 = (a0*b2) - (a2*b0) f1 = (a1*b2) - (a3*b0) f2 = (a0*b3) - (a2*b1) f3 = (a1*b3) - (a3*b1) m0 = (-a0*b4) + (a4*b0) m1 = (-a1*b4) + (a5*b0) m2 = (-a0*b5) + (a4*b1) m3 = (-a1*b5) + (a5*b1) cf = (f0 + f1*pr + f2*gr + f3*pr*gr)/dd cm = (m0 + m1*pr + m2*gr + m3*pr*gr)/dd cf = cf cm = cm ct = cm + cf return ct def nasa2(tb18v, tb18h, tb37v, tb85v, tb85h): """The NASA Team 2 ice concentration algorithm """ """NASA Team2 Model Data:""" tbmow = readtxt2matrix('InputNT2/tbmow.txt') tbmfy = readtxt2matrix('InputNT2/tbmfy.txt') tbmcc = readtxt2matrix('InputNT2/tbmcc.txt') tbmthin = readtxt2matrix('InputNT2/tbmthin.txt') gr3719=(tb37v-tb18v)/(tb37v+tb18v) """number of atmospheres (models of atmosphere):""" n_atm=12 """Rotation:""" """angle in radians between GR-axis and A-B line (FY-MY line) for the PR(19)-GR(37V19V) damain. Arctic:""" phi19=-0.18 """angle in radians between GR-axis and A-B line (FY-MY line) for the PR(85)-GR(37V19V) damain. Arctic:""" phi85=-0.06 """Allocate memory:""" LUT19=readtxt2matrix3D('InputNT2/LUT19_') LUT85=readtxt2matrix3D('InputNT2/LUT85_') LUT19thin=readtxt2matrix3D('InputNT2/LUT19thin_') LUT85thin=readtxt2matrix3D('InputNT2/LUT85thin_') LUTDGR=readtxt2matrix3D('InputNT2/LUTDGR_') LUTGR37=readtxt2matrix3D('InputNT2/LUTGR37_') camina=np.zeros((n_atm,1)) ccmina=np.zeros((n_atm,1)) dmina=np.zeros((n_atm,1)) """calculate ice concentrations:""" """weights:""" w19=1 w85=1 wgr=1 sinphi19=math.sin(phi19) sinphi85=math.sin(phi85) cosphi19=math.cos(phi19) cosphi85=math.cos(phi85) pr19=(tb18v-tb18h)/(tb18v+tb18h) pr85=(tb85v-tb85h)/(tb85v+tb85h) gr8519v=(tb85v-tb18v)/(tb85v+tb18v) gr8519h=(tb85h-tb18h)/(tb85h+tb18h) pr19r=-gr3719*sinphi19 + pr19*cosphi19 pr85r=-gr3719*sinphi85 + pr85*cosphi85 dgr=gr8519h-gr8519v dmin=10000 for k in range(0,n_atm-1): imin=5 jmin=5 ca=45 cc=45 while ((imin !=0) | (jmin != 0)): dmin=10000 for i in range(-1,1): for j in range(-1,1): cai=ca+i ccj=cc+j if ((cai<121) & (ccj<121) & (cai>=1) & (ccj>=1) & ((cai+ccj)>=0) & ((cai+ccj)<121)): if gr3719 > -0.01: dpr19=pr19r-LUT19thin[k,cai,ccj] dpr85=pr85r-LUT85thin[k,cai,ccj] ddgr=gr3719-LUTGR37[k,cai,ccj] else: dpr19=pr19r-LUT19[k,cai,ccj] dpr85=pr85r-LUT85[k,cai,ccj] ddgr=dgr-LUTDGR[k,cai,ccj] d=w19*dpr19*dpr19+w85*dpr85*dpr85+wgr*ddgr*ddgr if d < dmin: dmin=d imin=i jmin=j ca=ca+imin cc=cc+jmin camina[k]=ca ccmina[k]=cc dmina[k]=dmin bestk=20 dmin=1000 for k in range(0,n_atm-1): if dmina[k] < dmin: dmin=dmina[k] bestk=k CT=(camina[bestk]+ccmina[bestk])/100 return CT def near90(tb85v, tb85h, tiepts): tmy85v = tiepts[30] tfy85v = tiepts[31] tmy85h = tiepts[32] tfy85h = tiepts[33] tw85v = tiepts[34] tw85h = tiepts[35] P = tb85v - tb85h P0 = tw85v - tw85h P1 = tfy85v - tfy85h A=np.matrix([[P1**3.0, P1**2.0, P1, 1.0],\ [P0**3.0, P0**2.0, P0, 1.0],\ [3.0*P1**3.0, 2.0*P1**2.0, P1, 0.0],\ [3.0*P0**3.0, 2.0*P0**2.0, P0, 0.0]]) b=np.matrix([1.0, 0.0, -0.14, -1.14]) d=A.I * b.T #d=np.linalg.solve(A,b.T) C = d[0] * P**3 + d[1] * P**2 + d[2] * P + d[3] return np.float(C) def near90_linear(tb85v, tb85h): ct=1.22673-0.02652*(tb85v-tb85h) return ct def norsex(tb18v,tb37v,tiepts): SAT = 260.0 T_sa = 270.0 T_a = 250.0 To = 272.0 tau_sa19v = 0.0610 tau_sa37v = 0.1000 tau_a19v = 0.0440 tau_a37v = 0.0700 TB_w_19v = tiepts[6] TB_w_37v = tiepts[0] TB_fy_19v = tiepts[8] TB_fy_37v = tiepts[2] TB_my_19v = tiepts[7] TB_my_37v = tiepts[1] #the sea ice temperature T_ice = 0.4*SAT + 0.6*To #Constants to be used in computing ice concentrations: a11 = TB_fy_19v - TB_w_19v a21 = TB_fy_37v - TB_w_37v a12 = TB_my_19v - TB_w_19v a22 = TB_my_37v - TB_w_37v d_coef = a11 * a22 - a12 * a21 #Initialize atmospheric surface temperature: t_atm_surf=SAT #interpolate opacity between arctic and subarctic values: tau19v = tau_a19v + (t_atm_surf - T_a) * (tau_sa19v - tau_a19v) / (T_sa - T_a) tau37v = tau_a37v + (t_atm_surf - T_a) * (tau_sa37v - tau_a37v) / (T_sa - T_a) #find emitted brightness temperature at the surface by correcting for #atmospheric disturbances: TB_surf_19v = (tb18v - t_atm_surf * (2.0 * tau19v - tau19v**2.0 + 0.01)) / (1.0 - 2.0 * tau19v + tau19v**2.0 - 0.01) TB_surf_37v = (tb37v - t_atm_surf * (2.0 * tau37v - tau37v**2.0 + 0.01)) / (1.0 - 2.0 * tau37v + tau37v**2.0 - 0.01) #Find new atmospheric surface brightness temperature and mean surface #emissions by solving for first year and multi-year ice concentrations. c1 = TB_surf_19v - TB_w_19v c2 = TB_surf_37v - TB_w_37v Cmy = (a11 * c2 - a21 * c1) / d_coef Cfy = (a22 * c1 - a12 * c2) / d_coef CT = Cfy + Cmy t_atm_surf = To + (SAT - To) * CT #interpolate opacity between arctic and subarctic values: tau19v = tau_a19v + (t_atm_surf - T_a) * (tau_sa19v - tau_a19v) / (T_sa - T_a) tau37v = tau_a37v + (t_atm_surf - T_a) * (tau_sa37v - tau_a37v) / (T_sa
numeric_fields is not None: assert isinstance(numeric_fields, list) for col in numeric_fields: unlabeled_data[col] = unlabeled_data[col].apply(lambda x: x if x == "" else float(x)) if empty_str_to_none: for col in unlabeled_data.columns.tolist(): empty_str_bool = (unlabeled_data[col] == "") print("converting {} empty string values of column {} to None".format(empty_str_bool.sum(), col)) unlabeled_data.loc[empty_str_bool,col] = None # converting NaNs of numeric columns (NaNs introduced because of the previous line) to None if numeric_fields is not None: for col in numeric_fields: not_nan_bool = unlabeled_data[col].notnull() print("converting {} NaN values of column {} to None".format((~not_nan_bool).sum(), col)) unlabeled_data[col] = unlabeled_data[col].where((not_nan_bool), None) unlabeled_data = unlabeled_data.to_dict(orient = "index") return unlabeled_data def write_canonical_w_solo_unlabeled_data(canonicals_df, mapped_records_df, unlabeled_data, canonical_w_solo_unlabeled_filepath): # will be used for post cluster review, specifically on matching solos to clusters and merging clusters # those two steps are based on the cluster canonicals # remember to read in this written file using read_unlabeled_data_json later on canonical_w_solo_data = canonicals_df.set_index("cluster id")\ .to_dict(orient = "index") mapped_records_df = mapped_records_df.set_index("record id") solo_records = mapped_records_df.loc[mapped_records_df["cluster type"] == "solo",:]\ .index.tolist() for record_id in solo_records: record = unlabeled_data[record_id] cluster_id = mapped_records_df.loc[record_id,"cluster id"] canonical_w_solo_data[cluster_id] = record with open(canonical_w_solo_unlabeled_filepath, 'w') as outfile: json.dump(canonical_w_solo_data, outfile) def prepare_training_deduper(deduper, unlabeled_data, labeled_data_filepath, blocked_proportion = 0.5, sample_size = 15_000): # If we have training data saved from a previous run of dedupe, # look for it and load it in. # __Note:__ if you want to train from scratch, delete the labeled_data_filepath if os.path.exists(labeled_data_filepath): print('reading labeled examples from ', labeled_data_filepath) with open(labeled_data_filepath, 'rb') as labeled_data: deduper.prepare_training(data = unlabeled_data, training_file = labeled_data, blocked_proportion = blocked_proportion, sample_size = sample_size) else: deduper.prepare_training(data = unlabeled_data, blocked_proportion = blocked_proportion, sample_size = sample_size) def save_trained_deduper(deduper, labeled_data_filepath, settings_filepath): # When finished, save our training to disk with open(labeled_data_filepath, 'w') as tf: deduper.write_training(tf) # Save our weights and predicates to disk. If the settings file # exists, we will skip all the training and learning next time we run # this file. with open(settings_filepath, 'wb') as sf: deduper.write_settings(sf) def prepare_training_linker(linker, unlabeled_data_1, unlabeled_data_2, labeled_data_filepath, blocked_proportion = 0.5, sample_size = 15_000): # If we have training data saved from a previous run of linker, # look for it and load it in. # __Note:__ if you want to train from scratch, delete the labeled_data_filepath if os.path.exists(labeled_data_filepath): print('reading labeled examples from ', labeled_data_filepath) with open(labeled_data_filepath, 'rb') as labeled_data: linker.prepare_training(data_1 = unlabeled_data_1, data_2 = unlabeled_data_2, training_file = labeled_data, blocked_proportion = blocked_proportion, sample_size = sample_size) else: linker.prepare_training(data_1 = unlabeled_data_1, data_2 = unlabeled_data_2, blocked_proportion = blocked_proportion, sample_size = sample_size) def save_trained_linker(linker, labeled_data_filepath, settings_filepath): # When finished, save our training to disk with open(labeled_data_filepath, 'w') as tf: linker.write_training(tf) # Save our weights and predicates to disk. If the settings file # exists, we will skip all the training and learning next time we run # this file. with open(settings_filepath, 'wb') as sf: linker.write_settings(sf) def get_data_of_labeled_pairs(labeled_pairs_df, unlabeled_data): df = pd.DataFrame.from_dict(unlabeled_data, orient = "index") df_left = df.loc[labeled_pairs_df["record id 1"],:] df_left.columns = ["{}_1".format(col) for col in df_left.columns] df_left.index.name = "record id 1" df_left = df_left.reset_index() df_right = df.loc[labeled_pairs_df["record id 2"],:] df_right.columns = ["{}_2".format(col) for col in df_right.columns] df_right.index.name = "record id 2" df_right = df_right.reset_index() output = pd.concat([df_left, df_right], axis = 1, sort = False) # sort columns output = output.sort_index(axis = 1) output = output.set_index(["record id 1", "record id 2"]) label_df = labeled_pairs_df.set_index(["record id 1", "record id 2"]) output = pd.merge(left = label_df, right = output, left_index = True, right_index = True, how = "inner") return output def get_deduped_data(mapped_records_df, canonicals_df, unlabeled_data, none_to_empty_str = True): mapped_records_df = mapped_records_df.set_index("record id") solo_record_ids = mapped_records_df.loc[mapped_records_df["cluster type"] == "solo","cluster id"].to_dict() deduped_data = {cluster_id:unlabeled_data[record_id] for record_id,cluster_id in solo_record_ids.items()} deduped_data = pd.DataFrame.from_dict(deduped_data, orient = "index") deduped_data.index.name = "cluster id" canonicals_df = canonicals_df.set_index("cluster id") # appending the canonicalized cluster representations to the solo records deduped_data = deduped_data.append(canonicals_df) if none_to_empty_str: deduped_data = deduped_data.where((deduped_data.notnull()), "") return deduped_data def write_deduper_blocks(deduper, unlabeled_data, blocks_filepath): """ simplify blocks by not writing the record entries, only the ids """ blocks = deduper.pairs(unlabeled_data) with open(blocks_filepath, "w", newline = "") as csv_file: writer = csv.writer(csv_file, quoting = csv.QUOTE_ALL) header = ["block_id", "record_id"] writer.writerow(header) block_id = 1 for block in blocks: """ from dedupe source code: Each item in a block must be a sequence of record_id, record and the records also must be dictionaries but we're only keeping the record_id, not the record here """ for record in block: record_id, _, = record block_entry = [block_id, record_id] writer.writerow(block_entry) block_id += 1 def read_deduper_blocks(unlabeled_data, blocks_filepath): # assumes that the records are sorted by block number current_block_id = None block_records = [] """ from dedupe source code: Each item in a block must be a sequence of record_id, record, and the records also must be dictionaries """ with open(blocks_filepath, "r") as csv_file: reader = csv.DictReader(csv_file) for row in reader: block_id, record_id = row["block_id"], row["record_id"] if current_block_id == block_id: block_records.append((record_id, unlabeled_data[record_id])) else: if current_block_id is not None: yield block_records current_block_id = block_id block_records = [(record_id, unlabeled_data[record_id])] yield block_records def write_linker_blocks(linker, unlabeled_data_1, unlabeled_data_2, blocks_filepath): """ simplify blocks by not writing the record entries, only the ids """ blocks = linker.pairs(unlabeled_data_1, unlabeled_data_2) block_id = 1 with open(blocks_filepath, "w", newline = "") as csv_file: writer = csv.writer(csv_file, quoting = csv.QUOTE_ALL) header = ["record_set_num", "block_id", "record_id"] writer.writerow(header) for block in blocks: rec_1, rec_2 = block rec_1_id, _ = rec_1 block_entry = ["1", block_id, rec_1_id] writer.writerow(block_entry) rec_2_id, _ = rec_2 block_entry = ["2", block_id, rec_2_id] writer.writerow(block_entry) block_id += 1 def read_linker_blocks(unlabeled_data_1, unlabeled_data_2, blocks_filepath): # assumes that the records sorted by block number block_records = () block_set_1 = [] block_set_2 = [] current_block_id = None """ from dedupe source code: Each block must be a made up of two sequences, (base_sequence, target_sequence) """ with open(blocks_filepath, "r") as csv_file: reader = csv.DictReader(csv_file) for row in reader: record_set_num, block_id, record_id = row["record_set_num"], row["block_id"], row["record_id"] if current_block_id == block_id: if record_set_num == "1": block_set_1.append((record_id, unlabeled_data_1[record_id])) elif record_set_num == "2": block_set_2.append((record_id, unlabeled_data_2[record_id])) else: raise ValueError("record_set_num should only be 1 or 2, but got {}".format(record_set_num)) else: if current_block_id is not None: block_records = (block_set_1, block_set_2) yield block_records current_block_id = block_id if record_set_num == "1": block_set_1 = [(record_id, unlabeled_data_1[record_id])] block_set_2 = [] elif record_set_num == "2": block_set_1 = [] block_set_2 = [(record_id, unlabeled_data_2[record_id])] else: raise ValueError("record_set_num should only be 1 or 2, but got {}".format(record_set_num)) block_records = (block_set_1, block_set_2) yield block_records def get_blocked_pairs(deduper_or_linker, blocked_data): if isinstance(deduper_or_linker, dedupe.api.DedupeMatching): pairs = (combinations(sorted(block), 2) for block in blocked_data) elif isinstance(deduper_or_linker, dedupe.api.RecordLinkMatching): pairs = (product(base, target) for base, target in blocked_data) else: raise ValueError("Passed not of class DedupeMatching or of RecordLinkMatching!") return pairs def count_blocked_pairs(deduper_or_linker, blocked_data): candidate_records = itertools.chain.from_iterable(get_blocked_pairs(deduper_or_linker, blocked_data)) i = 0 for _ in candidate_records: i += 1 return i def write_training_set_from_pairs(labeled_pair_ids_df, labeled_data_filepath, unlabeled_data, unlabeled_data_2 = None): # create a labeled training set directly for dedupe's consumption labeled_data_train = {"distinct":[], "match":[]} for _, row in labeled_pair_ids_df.iterrows(): rec_id_1 = row["record id 1"] rec_id_2 = row["record id 2"] rec_data_1 = unlabeled_data[rec_id_1] if unlabeled_data_2 is None: rec_data_2 = unlabeled_data[rec_id_2] else: rec_data_2 = unlabeled_data_2[rec_id_2] label = row["label"] data_entry = { "__class__":"tuple", "__value__":[rec_data_1, rec_data_2] } labeled_data_train[label].append(data_entry) with open(labeled_data_filepath, "w") as json_file: simplejson.dump(labeled_data_train, json_file, default=dedupe.serializer._to_json, tuple_as_array=False, ensure_ascii=True) def get_deduped_data_for_rl(task_name, saved_files_path): # gets deduped dataset from respective deduping for rl dataset_name = task_name.split("-")[1] dataset_1_name, dataset_2_name = dataset_name.split("_") dedup_task_1 = "dedup-{}".format(dataset_1_name) dedup_task_2 = "dedup-{}".format(dataset_2_name) # get all filepaths unlabeled_data_1_filepath, unlabeled_data_2_filepath = dm_file_checker.get_proper_unlabeled_data_filepath(task_name, saved_files_path) numeric_fields_1, numeric_fields_2 = dm_file_checker.get_dataset_info(task_name, "numeric_fields", saved_files_path) print("Numeric fields 1 are {}".format(numeric_fields_1)) print("Numeric fields 2 are {}".format(numeric_fields_2)) canonicals_1_filepath = dm_file_checker.get_filepath(dedup_task_1, "cluster_canonical", saved_files_path) canonicals_2_filepath = dm_file_checker.get_filepath(dedup_task_2, "cluster_canonical", saved_files_path) mapped_records_1_filepath = dm_file_checker.get_filepath(dedup_task_1, "mapped_records", saved_files_path) mapped_records_2_filepath = dm_file_checker.get_filepath(dedup_task_2, "mapped_records", saved_files_path) # read in data from filepaths unlabeled_data_1 = read_unlabeled_data_json(unlabeled_data_1_filepath, empty_str_to_none = False, numeric_fields = numeric_fields_1) unlabeled_data_2 = read_unlabeled_data_json(unlabeled_data_2_filepath, empty_str_to_none = False, numeric_fields = numeric_fields_2) canonicals_1_df = pd.read_csv(canonicals_1_filepath, keep_default_na = False, low_memory = False) canonicals_2_df = pd.read_csv(canonicals_2_filepath, keep_default_na = False, low_memory = False) mapped_records_1_df = pd.read_csv(mapped_records_1_filepath, keep_default_na = False) mapped_records_2_df = pd.read_csv(mapped_records_2_filepath, keep_default_na = False) # get deduped data
= Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1237 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1238 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1239 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1240 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1241 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1242 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1243 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1244 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1245 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1246 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1247 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1248 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1249 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1250 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1251 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1252 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1253 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1254 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1255 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1256 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1257 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1258 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1259 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1260 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1261 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1262 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1263 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1264 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1265 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1266 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1267 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1268 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1269 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1270 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1271 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1272 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1273 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1274 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1275 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1276 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1277 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1278 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1279 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1280 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1281 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1282 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1283 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1284 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1285 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1286 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1287 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1288 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1289 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1290 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1291 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1292 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1293 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1294 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1295 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1296 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1297 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1298 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1299 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1300 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1301 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1302 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1303 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1304 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1305 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1306 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1307 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1308 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1309 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1310 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1311 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1312 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1313 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1314 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1315 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1316 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1317 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1318 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1319 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1320 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1321 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1322 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1323 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1324 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1325 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1326 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1327 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1328 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1329 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1330 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1331 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1332 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1333 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1334 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1335 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1336 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1337 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1338 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1339 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1340 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1341 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1342 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1343 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1344 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1345 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1346 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1347 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1348 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1349 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1350 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1351 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1352 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1353 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1354 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1355 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1356 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1357 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1358 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1359 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1360 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1361 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1362 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1363 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1364 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1365 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1366 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1367 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1368 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1369 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1370 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1371 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1372 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1373 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1374 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1375 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1376 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1377 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1378 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1379 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1380 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1381 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1382 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1383 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1384 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1385 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1386 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1387 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1388 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1389 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1390 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1391 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1392 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1393 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1394 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1395 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1396 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1397 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1398 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1399 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1400 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1401 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1402 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1403 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1404 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1405 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1406 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1407 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1408 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1409 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1410 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1411 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1412 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1413 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1414 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1415 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1416 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1417 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1418 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1419 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1420 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1421 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1422 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1423 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1424 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1425 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1426 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1427 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1428 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1429 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1430 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1431 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1432 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1433 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1434 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1435 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1436 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1437 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1438 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1439 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1440 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1441 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1442 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1443 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1444 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1445 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1446 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1447 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1448 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1449 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1450 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1451 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1452 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1453 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1454 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1455 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1456 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1457 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1458 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1459 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1460 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1461 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1462 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1463 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1464 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1465 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1466 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1467 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1468 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1469 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1470 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1471 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1472 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1473 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1474 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1475 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1476 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1477 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1478 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1479 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1480 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1481 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1482 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1483 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1484 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1485 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1486 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1487 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1488 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1489 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1490 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1491 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1492 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1493 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1494 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1495 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1496 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1497 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1498 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1499 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1500 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1501 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1502 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1503 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1504 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1505 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1506 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1507 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1508 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1509 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1510 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1511 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1512 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1513 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1514 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1515 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1516 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1517 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1518 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1519 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1520 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1521 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1522 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1523 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1524 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.x1525 = Var(within=Reals,bounds=(0,None),initialize=0.0016) m.obj = Objective(expr= 35*m.b751 + 44*m.b752 + 91*m.b753 + 62*m.b754 + 55*m.b755 + 85*m.b756 + 67*m.b757 + 15*m.b758 + 86*m.b759 + 84*m.b760 + 80*m.b761 + 31*m.b762 + 69*m.b763 + 2*m.b764 + 84*m.b765 + 31*m.b766 + 49*m.b767 + 5*m.b768 + 86*m.b769 + 75*m.b770 + 69*m.b771 + 95*m.b772 + 90*m.b773 + 68*m.b774 + 37*m.b775 + 18.317920140714*m.x776 + 50.5417406365265*m.x777 + 7.23887157420725*m.x778 + 31.7161164224096*m.x779 + 26.5982806962124*m.x780 + 25.2003558029458*m.x781 + 16.1299441008742*m.x782 + 22.7876212870155*m.x783 + 21.7074941364639*m.x784 + 8.84495909871991*m.x785 + 33.3904033811499*m.x786 + 19.068365922671*m.x787 + 23.4861371314648*m.x788 + 13.152021048086*m.x789 + 15.4995447875237*m.x790 + 28.6882286544541*m.x791 + 46.4069438310726*m.x792 + 34.2842869537236*m.x793 + 19.9377297916144*m.x794 + 23.189227663382*m.x795 + 52.881822931094*m.x796 + 28.1176792940909*m.x797 + 28.1262486001112*m.x798 + 25.9733765203171*m.x799 + 42.1823410885902*m.x800 + 43.5934045276037*m.x801 + 43.1951884028598*m.x802 + 42.7561031337705*m.x803 + 44.8830560021809*m.x804 + 31.384368926487*m.x805 + 26.0466833110394*m.x806 + 35.3519632097789*m.x807 + 27.3497467796216*m.x808 + 19.1823245949226*m.x809 + 32.6848959154934*m.x810 + 26.719611630368*m.x811 + 24.0750421497223*m.x812 + 37.4336455826642*m.x813 + 12.4870328861834*m.x814 + 29.9646734719363*m.x815 + 11.7061835222621*m.x816 + 33.1056699953261*m.x817 + 25.9535074865687*m.x818 + 35.5250910386477*m.x819 + 28.6790006328974*m.x820 + 43.4113232048431*m.x821 + 36.0099115783421*m.x822 + 29.5805680481105*m.x823 + 20.7315647903172*m.x824 + 6.99302006377018*m.x825 + 41.3707989442305*m.x826 + 10.5363720682363*m.x827 + 47.032100334195*m.x828 + 6.86209789221352*m.x829 + 33.0680131564835*m.x830 + 17.0130750735887*m.x831 + 31.1878929438216*m.x832 + 34.8635359311466*m.x833 + 40.1851022591442*m.x834 + 26.3902986450093*m.x835 + 13.8837995858511*m.x836 + 41.6939225602965*m.x837 + 17.4409085474614*m.x838 + 29.0296771941515*m.x839 + 11.8752598820801*m.x840 + 16.5741615556562*m.x841 + 15.8092041497997*m.x842 + 2.80664753095402*m.x843 + 27.4813510509779*m.x844 + 14.7582416896057*m.x845 + 36.3895741537047*m.x846 + 6.74790963786835*m.x847 + 16.0825941238826*m.x848 + 10.5347874027961*m.x849 + 11.4646478827216*m.x850 + 5.4227391605132*m.x851 + 34.9367214149104*m.x852 + 23.4836655133002*m.x853 + 19.4763652210318*m.x854 + 36.9309258006081*m.x855 + 40.6096260396591*m.x856 + 32.1633476146608*m.x857 + 7.23744928353258*m.x858 + 33.453992326267*m.x859 + 31.1386724856491*m.x860 + 46.8408059108518*m.x861 + 34.0499581478418*m.x862 + 30.5488224425645*m.x863 + 29.5795535259439*m.x864 + 22.803338404088*m.x865 + 22.8875142539559*m.x866 + 36.8206784185433*m.x867 + 23.1249554598248*m.x868 + 19.0827867125553*m.x869 + 30.2622260942462*m.x870 + 24.5429695902386*m.x871 + 20.6663863573018*m.x872 + 34.1782587461511*m.x873 + 9.87298237219923*m.x874 + 25.8240404618963*m.x875 + 13.4588903804112*m.x876 + 29.7256542744278*m.x877 + 23.5503024135801*m.x878 + 31.4958035760818*m.x879 + 25.1150231082704*m.x880 + 40.3372190068453*m.x881 + 36.5419890131661*m.x882 + 28.7169164625805*m.x883 + 17.9291685498324*m.x884 + 3.29974738568237*m.x885 + 42.2800435560718*m.x886 + 10.4374663473534*m.x887 + 43.5749166341251*m.x888 + 5.89299720874657*m.x889 + 33.2330261480484*m.x890 + 20.7305245448397*m.x891 + 31.8474409103857*m.x892 + 34.8731848638771*m.x893 + 39.8199091961854*m.x894 + 25.3467692173983*m.x895 + 17.6546249885179*m.x896 + 45.8634691771302*m.x897 + 19.2040532515657*m.x898 + 33.252440687394*m.x899 + 16.1261274037575*m.x900 + 20.8273789839396*m.x901 + 19.2728215031019*m.x902 + 7.07574699678281*m.x903 + 31.1124334317676*m.x904 + 16.2769000323456*m.x905 + 40.4312242074416*m.x906 + 10.4130328148869*m.x907 + 20.272267327817*m.x908 + 10.9489181155747*m.x909 + 14.6634100487518*m.x910 + 6.86093554987709*m.x911 + 38.9959581192207*m.x912 + 27.7114737275747*m.x913 + 23.3030465568468*m.x914 + 39.9827108936166*m.x915 + 44.5433042390447*m.x916 + 36.068863793294*m.x917 + 4.11665036759906*m.x918 + 37.1040975947365*m.x919 + 35.2679678998297*m.x920 + 50.9598284668476*m.x921 + 38.2539523316496*m.x922 + 34.6012307339498*m.x923 + 33.3060212423024*m.x924 + 27.0862654773137*m.x925 + 25.6052443166823*m.x926 + 47.0443448498989*m.x927 + 29.5918348175443*m.x928 + 38.4911586436211*m.x929 + 20.3082495689446*m.x930 + 26.2828698610113*m.x931 + 27.8579285191439*m.x932 + 14.3317490226775*m.x933 + 39.1373213233682*m.x934 + 26.7596985635397*m.x935 + 46.8244810814358*m.x936 + 18.8973194470275*m.x937 + 26.3918246309307*m.x938 + 21.6552560573349*m.x939 + 23.7537108329874*m.x940 + 8.23262031055656*m.x941 + 39.4837149241124*m.x942 + 30.3662715039752*m.x943 + 30.9209990751519*m.x944 + 49.1306132879028*m.x945 + 43.9933049626478*m.x946 + 43.1496905105332*m.x947 + 6.8790902811152*m.x948 + 45.0094539541684*m.x949 + 36.4756962216344*m.x950 + 56.7387445580221*m.x951 + 40.0652727267479*m.x952 + 35.2489022960904*m.x953 + 32.1776621377557*m.x954 + 30.96678226207*m.x955 + 19.870882380967*m.x956 + 52.5889674485449*m.x957 + 8.7434204425797*m.x958 + 33.9325153654472*m.x959 + 27.7464102493544*m.x960 + 26.8309304269913*m.x961 + 17.8907179731242*m.x962 + 23.1383351028176*m.x963 + 24.1560581141682*m.x964 + 9.62505798440892*m.x965 + 35.8625129258679*m.x966 + 19.766043163461*m.x967 + 25.1380056644321*m.x968 + 12.8836272863498*m.x969 + 16.6789220968229*m.x970 + 28.748756298533*m.x971 + 48.2366137143732*m.x972 + 36.0055434136457*m.x973 + 21.969810518488*m.x974 + 25.6765637031271*m.x975 + 54.6991940304609*m.x976 + 30.5823053936182*m.x977 + 27.6125923053998*m.x978 + 28.5047023818799*m.x979 + 44.0019065201746*m.x980 + 46.110154392053*m.x981 + 45.1627535811209*m.x982 + 44.4906667246016*m.x983 + 46.3664627758094*m.x984 + 33.2140886176102*m.x985 + 19.3645940233183*m.x986 + 42.9320869596726*m.x987 + 15.0766951711362*m.x988 + 23.6654563729363*m.x989 + 28.2588156447016*m.x990 + 23.7753120786892*m.x991 + 16.5709228659944*m.x992 + 29.3900310684354*m.x993 + 11.8564483451232*m.x994 + 18.0579714876375*m.x995 + 21.5078042747312*m.x996 + 24.7842292860034*m.x997 + 22.2806196631767*m.x998 + 23.9797192577055*m.x999 + 19.8792653889938*m.x1000 + 35.849413125637*m.x1001 + 40.9463961132668*m.x1002 + 30.7204630102472*m.x1003 + 16.4333834809736*m.x1004 + 8.13542761474758*m.x1005 + 47.1994833425915*m.x1006 + 16.8225578271661*m.x1007 + 37.766322028356*m.x1008 + 13.1391814356668*m.x1009 + 37.0796490134297*m.x1010 + 30.4135829605837*m.x1011 + 36.7145714238955*m.x1012 + 38.3224608368608*m.x1013 + 42.2553742537591*m.x1014 + 27.2613350412179*m.x1015 + 4.20325590793194*m.x1016 + 33.9400956302393*m.x1017 + 13.3761164516277*m.x1018 + 19.0959037988233*m.x1019 + 6.01836291817402*m.x1020 + 7.10231989386958*m.x1021 + 6.8761807377244*m.x1022 + 7.57054337966765*m.x1023 + 17.5944876872481*m.x1024 + 12.1813190530298*m.x1025 + 26.1376142248563*m.x1026 + 4.33105563371409*m.x1027 + 6.12779005580725*m.x1028 + 12.5065216975371*m.x1029 + 5.08481436235556*m.x1030 + 13.3401079050352*m.x1031 + 28.1376812292325*m.x1032 + 15.7830557867359*m.x1033 + 9.39580239114668*m.x1034 + 27.9516326242547*m.x1035 + 34.3780648407576*m.x1036 + 21.937689771261*m.x1037 + 17.455944192281*m.x1038 + 23.4852292982593*m.x1039 + 23.9858332454866*m.x1040 + 36.6413573127999*m.x1041 + 26.1656475252664*m.x1042 + 23.9747105433326*m.x1043 + 24.9064324222923*m.x1044 + 14.0374476512452*m.x1045 + 32.5307045343*m.x1046 + 8.81146853603199*m.x1047 + 43.5775086533129*m.x1048 + 22.150770730328*m.x1049 + 26.638603236471*m.x1050 + 25.550674451719*m.x1051 + 34.4447464461405*m.x1052 + 35.4498917358295*m.x1053 + 33.6935201909288*m.x1054 + 43.3611773285297*m.x1055 + 28.9110396135262*m.x1056 + 35.4469710715193*m.x1057 + 27.2094885127556*m.x1058 + 44.179811105689*m.x1059 + 36.2752777334068*m.x1060 + 35.8586575696604*m.x1061 + 4.54840044576581*m.x1062 + 16.3199203989194*m.x1063 + 30.9501009371959*m.x1064 + 44.0373106366546*m.x1065 + 2.90086496977747*m.x1066 + 30.6232717728236*m.x1067 + 42.3161996777378*m.x1068 + 35.1757794618538*m.x1069 + 8.49540953240994*m.x1070 + 31.5167441828445*m.x1071 + 9.25484597570439*m.x1072 + 7.84098304655692*m.x1073 + 8.94759564781253*m.x1074 + 19.2103928685291*m.x1075 + 13.25871089003*m.x1076 + 42.6898287611128*m.x1077 + 6.75836353868577*m.x1078 + 23.4906068361686*m.x1079 + 22.3929855321258*m.x1080 + 19.2416530181295*m.x1081 + 10.4685567913094*m.x1082 + 21.795462678466*m.x1083 + 12.9462175308779*m.x1084 + 9.73387162804679*m.x1085 + 24.5975119316798*m.x1086 + 17.2742323975676*m.x1087 + 17.5448157945333*m.x1088 + 15.6557519467861*m.x1089 + 12.4840418517587*m.x1090 + 28.2457567274807*m.x1091 + 39.2500628661265*m.x1092 + 27.6699109852302*m.x1093 + 12.6694629863682*m.x1094 + 15.7649075104085*m.x1095 + 45.7108329504802*m.x1096 + 19.3313262114147*m.x1097 + 29.6568685811216*m.x1098 + 17.2525688342231*m.x1099 +
<filename>MonkeyBusiness/elilik.py # -*- coding: utf-8 -*- # Form implementation generated from reading ui file 'm1.ui' # # Created by: PyQt5 UI code generator 5.9.2 # # WARNING! All changes made in this file will be lost! from PyQt5.QtGui import QImage, QPixmap, QPainter, QBrush, QColor from PyQt5.QtGui import QPalette, QFont, QFontMetrics, QStandardItem, QStandardItemModel from PyQt5.QtCore import Qt, QRect, QSize, QEvent, QCoreApplication, QMetaObject from PyQt5.QtCore import QPointF, QRectF, pyqtSignal, pyqtSlot, QUrl from PyQt5.QtWidgets import QWidget, QDialogButtonBox, QCheckBox, QDial from PyQt5.QtWidgets import QSizePolicy, QGridLayout, QFormLayout,QHBoxLayout, QVBoxLayout from PyQt5.QtWidgets import QLabel, QToolButton, QDoubleSpinBox, QLineEdit from PyQt5.QtWidgets import QComboBox, QStyledItemDelegate, qApp, QListView from PyQt5.QtWidgets import QGraphicsScene, QGraphicsView, QFileDialog, QMessageBox, QDialog from PyQt5.QtWidgets import QGraphicsItem, QGraphicsPixmapItem, QPushButton, QAbstractScrollArea from PyQt5.QtWidgets import QAction, QMenu, QMenuBar, QStatusBar from PyQt5.QtWebEngineWidgets import QWebEngineView from PyQt5.QtWidgets import QApplication, QMainWindow, QGroupBox, QFrame, QSlider from functools import partial import numpy as np import sys import cv2 import os from ElilikClasses import Ui_INI_Dialog, ColorMapsDialog, TransformScene, showText class Ui_MainWindow(object): def setupUi(self, MainWindow): MainWindow.setObjectName("MainWindow") MainWindow.resize(1871, 1200) self.centralwidget = QWidget(MainWindow) self.centralwidget.setObjectName("centralwidget") self.transformsGroupBox = QGroupBox(self.centralwidget) self.transformsGroupBox.setGeometry(QRect(1500, 170, 240, 500)) self.transformsGroupBox.setMaximumSize(QSize(240, 600)) font = QFont() font.setFamily("MS Shell Dlg 2") font.setPointSize(10) font.setBold(True) font.setWeight(75) self.transformsGroupBox.setFont(font) self.transformsGroupBox.setToolTip("") self.transformsGroupBox.setWhatsThis("") self.transformsGroupBox.setObjectName("transformsGroupBox") self.edgesButton = QPushButton(self.transformsGroupBox) self.edgesButton.setGeometry(QRect(110, 180, 120, 30)) self.edgesButton.setObjectName("edgesButton") self.brightnessButton = QPushButton(self.transformsGroupBox) self.brightnessButton.setGeometry(QRect(110, 20, 120, 30)) font = QFont() font.setPointSize(8) self.brightnessButton.setFont(font) self.brightnessButton.setObjectName("brightnessButton") self.getSizeButton = QPushButton(self.transformsGroupBox) self.getSizeButton.setGeometry(QRect(0, 470, 75, 23)) self.getSizeButton.setObjectName("getSizeButton") self.paramsGroupBox = QGroupBox(self.transformsGroupBox) self.paramsGroupBox.setGeometry(QRect(10, 29, 91, 321)) font = QFont() font.setPointSize(8) self.paramsGroupBox.setFont(font) self.paramsGroupBox.setObjectName("paramsGroupBox") self.leftSlider = QSlider(self.paramsGroupBox) self.leftSlider.setGeometry(QRect(10, 50, 20, 240)) sizePolicy = QSizePolicy(QSizePolicy.Fixed, QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.leftSlider.sizePolicy().hasHeightForWidth()) self.leftSlider.setSizePolicy(sizePolicy) self.leftSlider.setOrientation(Qt.Vertical) self.leftSlider.setTickPosition(QSlider.TicksAbove) self.leftSlider.setObjectName("leftSlider") self.rightSlider = QSlider(self.paramsGroupBox) self.rightSlider.setGeometry(QRect(50, 50, 20, 240)) sizePolicy = QSizePolicy(QSizePolicy.Fixed, QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.rightSlider.sizePolicy().hasHeightForWidth()) self.rightSlider.setSizePolicy(sizePolicy) self.rightSlider.setOrientation(Qt.Vertical) self.rightSlider.setTickPosition(QSlider.TicksAbove) self.rightSlider.setObjectName("rightSlider") self.leftLabel = QLabel(self.paramsGroupBox) self.leftLabel.setGeometry(QRect(10, 20, 20, 15)) self.leftLabel.setTextFormat(Qt.PlainText) self.leftLabel.setAlignment(Qt.AlignRight|Qt.AlignTrailing|Qt.AlignVCenter) self.leftLabel.setObjectName("leftLabel") self.rightLabel = QLabel(self.paramsGroupBox) self.rightLabel.setGeometry(QRect(50, 20, 20, 15)) self.rightLabel.setTextFormat(Qt.PlainText) self.rightLabel.setAlignment(Qt.AlignRight|Qt.AlignTrailing|Qt.AlignVCenter) self.rightLabel.setObjectName("rightLabel") self.adaptiveThresholdButton = QPushButton(self.transformsGroupBox) self.adaptiveThresholdButton.setGeometry(QRect(110, 140, 120, 30)) font = QFont() font.setPointSize(8) self.adaptiveThresholdButton.setFont(font) self.adaptiveThresholdButton.setObjectName("adaptiveThresholdButton") self.gray2colSelButton = QPushButton(self.transformsGroupBox) self.gray2colSelButton.setGeometry(QRect(110, 100, 120, 30)) font = QFont() font.setPointSize(8) self.gray2colSelButton.setFont(font) self.gray2colSelButton.setObjectName("gray2colSelButton") self.gray2colAllButton = QPushButton(self.transformsGroupBox) self.gray2colAllButton.setGeometry(QRect(110, 60, 120, 30)) font = QFont() font.setPointSize(8) self.gray2colAllButton.setFont(font) self.gray2colAllButton.setObjectName("gray2colAllButton") self.fftButton = QPushButton(self.transformsGroupBox) self.fftButton.setGeometry(QRect(110, 220, 120, 30)) self.fftButton.setObjectName("fftButton") self.dftButton = QPushButton(self.transformsGroupBox) self.dftButton.setGeometry(QRect(110, 260, 120, 30)) self.dftButton.setObjectName("dftButton") self.gaborButton = QPushButton(self.transformsGroupBox) self.gaborButton.setGeometry(QRect(110, 300, 120, 30)) self.gaborButton.setObjectName("gaborButton") self.differenceButton = QPushButton(self.transformsGroupBox) self.differenceButton.setGeometry(QRect(110, 340, 120, 30)) self.differenceButton.setObjectName("differenceButton") self.RGB2GrayButton = QPushButton(self.transformsGroupBox) self.RGB2GrayButton.setGeometry(QRect(110, 380, 120, 30)) self.RGB2GrayButton.setObjectName("RGB2GrayButton") self.invertedCheckBox = QCheckBox(self.transformsGroupBox) self.invertedCheckBox.setGeometry(QRect(110, 430, 121, 17)) self.invertedCheckBox.setObjectName("invertedCheckBox") self.angleDial = QDial(self.transformsGroupBox) self.angleDial.setGeometry(QRect(20, 360, 81, 64)) self.angleDial.setMinimum(1) self.angleDial.setMaximum(4) self.angleDial.setPageStep(1) self.angleDial.setSliderPosition(1) self.angleDial.setWrapping(False) self.angleDial.setNotchesVisible(True) self.angleDial.setObjectName("angleDial") self.groupButtonsBox = QGroupBox(self.centralwidget) self.groupButtonsBox.setGeometry(QRect(1500, 730, 241, 141)) self.groupButtonsBox.setMaximumSize(QSize(250, 600)) font = QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.groupButtonsBox.setFont(font) self.groupButtonsBox.setObjectName("groupButtonsBox") self.addImgButton = QPushButton(self.groupButtonsBox) self.addImgButton.setGeometry(QRect(50, 20, 150, 30)) palette = QPalette() brush = QBrush(QColor(180, 146, 66)) brush.setStyle(Qt.SolidPattern) palette.setBrush(QPalette.Active, QPalette.Button, brush) brush = QBrush(QColor(180, 146, 66)) brush.setStyle(Qt.SolidPattern) palette.setBrush(QPalette.Inactive, QPalette.Button, brush) brush = QBrush(QColor(180, 146, 66)) brush.setStyle(Qt.SolidPattern) palette.setBrush(QPalette.Disabled, QPalette.Button, brush) self.addImgButton.setPalette(palette) font = QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.addImgButton.setFont(font) self.addImgButton.setObjectName("addImgButton") self.saveSceneImgButton = QPushButton(self.groupButtonsBox) self.saveSceneImgButton.setGeometry(QRect(50, 60, 150, 30)) font = QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.saveSceneImgButton.setFont(font) self.saveSceneImgButton.setObjectName("saveSceneImgButton") self.saveImgButton = QPushButton(self.groupButtonsBox) self.saveImgButton.setGeometry(QRect(50, 100, 150, 30)) font = QFont() font.setPointSize(9) font.setBold(True) font.setWeight(75) self.saveImgButton.setFont(font) self.saveImgButton.setObjectName("saveImgButton") self.graphicsView = QGraphicsView(self.centralwidget) self.graphicsView.setGeometry(QRect(10, 15, 1471, 900)) self.graphicsView.setMaximumSize(QSize(4000, 3000)) self.graphicsView.setVerticalScrollBarPolicy(Qt.ScrollBarAsNeeded) self.graphicsView.setHorizontalScrollBarPolicy(Qt.ScrollBarAsNeeded) self.graphicsView.setSizeAdjustPolicy(QAbstractScrollArea.AdjustToContents) self.graphicsView.setObjectName("graphicsView") self.scene = TransformScene() self.graphicsView.setScene(self.scene) self.scaleEditLabel = QLabel(self.centralwidget) self.scaleEditLabel.setGeometry(QRect(1500, 100, 47, 13)) font = QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.scaleEditLabel.setFont(font) self.scaleEditLabel.setObjectName("scaleEditLabel") self.scaleBox = QDoubleSpinBox(self.centralwidget) self.scaleBox.setGeometry(QRect(1550, 100, 62, 22)) font = QFont() font.setBold(True) font.setWeight(75) self.scaleBox.setFont(font) self.scaleBox.setMinimum(0.1) self.scaleBox.setMaximum(10.0) self.scaleBox.setSingleStep(0.1) self.scaleBox.setProperty("value", 0.5) self.scaleBox.setObjectName("scaleBox") self.infoLabel = QLabel(self.centralwidget) self.infoLabel.setGeometry(QRect(1499, 130, 230, 20)) self.infoLabel.setFrameShape(QFrame.WinPanel) self.infoLabel.setText("") self.infoLabel.setAlignment(Qt.AlignCenter) self.infoLabel.setObjectName("infoLabel") self.infoLabel_2 = QLabel(self.centralwidget) self.infoLabel_2.setGeometry(QRect(1500, 20, 230, 20)) font = QFont() font.setBold(True) font.setItalic(True) font.setWeight(75) self.infoLabel_2.setFont(font) self.infoLabel_2.setFrameShape(QFrame.WinPanel) self.infoLabel_2.setText("") self.infoLabel_2.setAlignment(Qt.AlignCenter) self.infoLabel_2.setObjectName("infoLabel_2") self.infoLabel_3 = QLabel(self.centralwidget) self.infoLabel_3.setGeometry(QRect(1500, 60, 230, 20)) font = QFont() font.setBold(True) font.setItalic(True) font.setWeight(75) self.infoLabel_3.setFont(font) self.infoLabel_3.setFrameShape(QFrame.Box) self.infoLabel_3.setText("") self.infoLabel_3.setAlignment(Qt.AlignCenter) self.infoLabel_3.setObjectName("infoLabel_3") self.clearImgButton = QPushButton(self.centralwidget) self.clearImgButton.setGeometry(QRect(1550, 690, 150, 30)) font = QFont() font.setPointSize(10) font.setBold(True) font.setWeight(75) self.clearImgButton.setFont(font) self.clearImgButton.setObjectName("clearImgButton") MainWindow.setCentralWidget(self.centralwidget) self.menubar = QMenuBar(MainWindow) self.menubar.setGeometry(QRect(0, 0, 1871, 21)) self.menubar.setObjectName("menubar") self.menuHelp = QMenu(self.menubar) self.menuHelp.setObjectName("menuHelp") MainWindow.setMenuBar(self.menubar) self.statusbar = QStatusBar(MainWindow) self.statusbar.setObjectName("statusbar") MainWindow.setStatusBar(self.statusbar) self.actionExit = QAction(MainWindow) self.actionExit.setObjectName("actionExit") self.actionHelp = QAction(MainWindow) self.actionHelp.setObjectName("actionHelp") self.actionAbout = QAction(MainWindow) self.actionAbout.setObjectName("actionAbout") self.actionDefault_Values = QAction(MainWindow) self.actionDefault_Values.setObjectName("actionDefault_Values") self.menuHelp.addAction(self.actionHelp) self.menuHelp.addAction(self.actionAbout) self.menuHelp.addSeparator() self.menuHelp.addAction(self.actionDefault_Values) self.menubar.addAction(self.menuHelp.menuAction()) self.retranslateUi(MainWindow) QMetaObject.connectSlotsByName(MainWindow) self.scene.file_signal.connect(on_file_signal) self.scene.info_signal.connect(on_info_signal) self.scene.sliders_reset_signal.connect(on_sliders_reset_signal) def retranslateUi(self, MainWindow): _translate = QCoreApplication.translate MainWindow.setWindowTitle(_translate("MainWindow", "Green Monkey")) self.transformsGroupBox.setTitle(_translate("MainWindow", "Transformations")) self.edgesButton.setText(_translate("MainWindow", "Edges, Sobel")) self.brightnessButton.setToolTip(_translate("MainWindow", "You can change brightness with left slider and blur with rigt one.")) self.brightnessButton.setWhatsThis(_translate("MainWindow", "You can change brightness with left slider and blur with rigt one.")) self.brightnessButton.setText(_translate("MainWindow", "Brightness and Blur")) self.getSizeButton.setText(_translate("MainWindow", "get Size")) self.paramsGroupBox.setTitle(_translate("MainWindow", "Parameters")) self.leftSlider.setToolTip(_translate("MainWindow", "Adaptive Threshold\n" "blockSize – Size of a pixel neighborhood that is used to calculate a threshold value for the pixel: 3, 5, 7, and so on.")) self.leftSlider.setWhatsThis(_translate("MainWindow", "Adaptive Threshold\n" "blockSize – Size of a pixel neighborhood that is used to calculate a threshold value for the pixel: 3, 5, 7, and so on.")) self.rightSlider.setToolTip(_translate("MainWindow", "Adaptive Threshold\n" "C – Constant subtracted from the mean or weighted mean (see the details below). Normally, it is positive but may be zero or negative as well.")) self.rightSlider.setWhatsThis(_translate("MainWindow", "Adaptive Threshold\n" "C – Constant subtracted from the mean or weighted mean (see the details below). Normally, it is positive but may be zero or negative as well.")) self.leftLabel.setText(_translate("MainWindow", "0")) self.rightLabel.setText(_translate("MainWindow", "0")) self.adaptiveThresholdButton.setText(_translate("MainWindow", "Adaptive Threshold")) self.gray2colSelButton.setToolTip(_translate("MainWindow", "Gray scale 0..255 to color with selected method only.\n" "Image is converted to gray and finally to color.")) self.gray2colSelButton.setWhatsThis(_translate("MainWindow", "Gray scale 0..255 to color with selected method only.\n" "Image is converted to gray and and finally to color.")) self.gray2colSelButton.setText(_translate("MainWindow", "Gray2Color Sel.")) self.gray2colAllButton.setToolTip(_translate("MainWindow", "Gray scale 0..255 to color for all available methods.\n" "Image resized as per scale window and then is converted to gray and finally to color.")) self.gray2colAllButton.setWhatsThis(_translate("MainWindow", "Gray scale 0..255 to color for all available methods.\n" "Image resized as per scale window and then is converted to gray and finally to color.")) self.gray2colAllButton.setText(_translate("MainWindow", "Gray2Color All")) self.fftButton.setText(_translate("MainWindow", "FFT")) self.dftButton.setText(_translate("MainWindow", "DFT")) self.gaborButton.setToolTip(_translate("MainWindow", "Applies Gabor Filter")) self.gaborButton.setWhatsThis(_translate("MainWindow", "Applies Gabor Filter")) self.gaborButton.setText(_translate("MainWindow", "Gabor Filter")) self.differenceButton.setText(_translate("MainWindow", "Difference")) self.RGB2GrayButton.setText(_translate("MainWindow", "RGB to Gray")) self.invertedCheckBox.setText(_translate("MainWindow", "Inverted Image")) self.angleDial.setToolTip(_translate("MainWindow", "GABOR Filter - angle 1..4 ~ 1*np.pi/angle")) self.angleDial.setWhatsThis(_translate("MainWindow", "GABOR Filter - angle 1..4 ~ 1*np.pi/angle")) self.groupButtonsBox.setTitle(_translate("MainWindow", "Images")) self.addImgButton.setText(_translate("MainWindow", "Add Image(s)")) self.addImgButton.setShortcut(_translate("MainWindow", "Ctrl+A")) self.saveSceneImgButton.setText(_translate("MainWindow", "Save Scene as Image")) self.saveImgButton.setText(_translate("MainWindow", "Save Selected as Image")) self.scaleEditLabel.setText(_translate("MainWindow", "Scale:")) self.clearImgButton.setText(_translate("MainWindow", "Clear Image(s)")) self.menuHelp.setTitle(_translate("MainWindow", "Help")) self.actionExit.setText(_translate("MainWindow", "Exit")) self.actionHelp.setText(_translate("MainWindow", "Help")) self.actionAbout.setText(_translate("MainWindow", "About")) self.actionDefault_Values.setText(_translate("MainWindow", "Default Values")) self.actionHelp.setShortcut('F1') self.actionHelp.setStatusTip('Help') self.actionHelp.triggered.connect(self.showHelp) self.actionAbout.setStatusTip('About') self.actionAbout.triggered.connect(self.showAbout) self.actionDefault_Values.setStatusTip('Default folders and other values') self.actionDefault_Values.triggered.connect(self.updateINI) self.addImgButton.clicked.connect(partial(self.scene.addImg)) self.clearImgButton.clicked.connect(self.scene.dialogClearScene) self.saveSceneImgButton.clicked.connect(partial(self.scene.saveScene)) self.saveImgButton.clicked.connect(partial(self.scene.saveImg)) self.scaleBox.valueChanged.connect(self.onScaleBoxValueChanged) self.getSizeButton.clicked.connect(self.showSceneSize) self.brightnessButton.clicked.connect(self.startBrightnessAndBlur) self.gray2colAllButton.clicked.connect(self.startGray2colAllButton) self.gray2colSelButton.clicked.connect(self.startGray2colSelButton) self.adaptiveThresholdButton.clicked.connect(self.startAdaptiveThreshold) self.edgesButton.clicked.connect(self.startSobelXY) self.fftButton.clicked.connect(self.startFFT) self.dftButton.clicked.connect(self.startDFT) self.gaborButton.clicked.connect(self.startGabor) self.differenceButton.clicked.connect(self.startDifference) self.RGB2GrayButton.clicked.connect(self.starRGB2Gray) self.leftSlider.valueChanged['int'].connect(self. leftSliderChanged) self.rightSlider.valueChanged['int'].connect(self.rightSliderChanged) self.angleDial.valueChanged['int'].connect(self.angleDialChanged) def setStart(self): self.graphicsView.setAlignment(Qt.AlignLeft|Qt.AlignTop) self.scene.setSceneRect(0, 0, 0, 0) self.scene.imgScale = self.scaleBox.value() self.clearSliders() self.infoLabel.setText("") self.scene.cv2Images = {} self.transformsGroupBox.setEnabled(False) self.transformsGroupBox.setEnabled(False) self.invertedCheckBox.setChecked(False) def clearSliders(self): self.infoLabel_2.setText('') self.infoLabel_3.setText('') self.scene.currentTransform = 0 self.leftSlider.setEnabled(False) self.leftSlider.setToolTip("") self.leftSlider.setWhatsThis("") self.leftSlider.setMaximum(99) self.leftSlider.setMinimum(0) self.leftSlider.setTickInterval(10) self.leftSlider.setSingleStep(1) self.leftSlider.setTickPosition(11) self.rightSlider.setEnabled(False) self.rightSlider.setToolTip("") self.rightSlider.setWhatsThis("") self.rightSlider.setMaximum(99) self.rightSlider.setMinimum(0) self.rightSlider.setTickInterval(10) self.rightSlider.setSingleStep(1) self.rightSlider.setTickPosition(0) self.paramsGroupBox.setFlat(False) self.paramsGroupBox.setStyleSheet('QGroupBox * {color: black; font-weight: normal;}') self.angleDial.setEnabled(False) self.angleDial.setToolTip(" ") self.angleDial.setWhatsThis("") def invertCheckBoxEvent(self, checked): self.scene.inverted = checked def showSceneSize(self): x = self.scene.sceneRect().width() y = self.scene.sceneRect().height() self.infoLabel.setText(f'size: {x}x{y}, {self.scene.findSceneArea()}') def onScaleBoxValueChanged(self, val): self.scene.imgScale = val def startBrightnessAndBlur(self): self.scene.currentTransform = 1 self.infoLabel_2.setText('Adaptive Threshold') self.scene.currentBrightnessValue = 0 self.scene.currentBlurValue = 0 self.scene.transform1() self.infoLabel_2.setText('Brightness and Blur') self.scene.currentTransform = 1 self.leftSlider.setEnabled(True) self.rightSlider.setEnabled(True) self.leftSlider.setToolTip("Change Brightness -> 0 .. 99") self.leftSlider.setWhatsThis("Change Brightness -> 0 .. 99") self.rightSlider.setToolTip("Change Blur -> 0 .. 99") self.rightSlider.setWhatsThis("Change Blur -> 0 .. 99") self.leftSlider.setMaximum(99) self.leftSlider.setMinimum(0) self.leftSlider.setTickInterval(10) self.leftSlider.setSingleStep(1) self.leftSlider.setTickPosition(11) self.rightSlider.setMaximum(99) self.rightSlider.setMinimum(0) self.rightSlider.setTickInterval(10) self.rightSlider.setSingleStep(1) self.rightSlider.setTickPosition(0) self.paramsGroupBox.setFlat(True) self.paramsGroupBox.setStyleSheet('QGroupBox * {color: red; font-weight: bold;}') def startGray2colAllButton(self): self.infoLabel_2.setText('Gray to Color All Methods') self.scene.currentTransform = 2 self.scene.transform2(1, 1) def startGray2colSelButton(self): self.scene.currentTransform = 3 self.infoLabel_2.setText(' Gray to Color') self.scene.transform2(0, 1) def startSobelXY(self): self.scene.currentTransform = 4 self.infoLabel_2.setText('Edge Detection') self.scene.transform4() def startFFT(self): self.scene.currentTransform = 7 self.infoLabel_2.setText('FFT') self.scene.transform7() def startDFT(self): self.scene.currentTransform = 6 self.infoLabel_2.setText('DFT') self.scene.transform6() def startDenoising(self): self.scene.currentTransform = 8 self.infoLabel_2.setText('Denoising') self.scene.transform8() def startDifference(self): self.scene.currentTransform = 9 self.infoLabel_2.setText('Difference') self.scene.transform9() def starRGB2Gray(self): self.scene.currentTransform = 10 #txt = self.infoLabel_2.text() self.infoLabel_2.setText('RGB to Gray') self.scene.transform10() def startAdaptiveThreshold(self): self.scene.currentTransform = 5 self.infoLabel_2.setText('Adaptive Threshold') self.scene.currentBlockSizeValue = 11 self.scene.currentCValue = 5 self.scene.transform5() self.leftSlider.setEnabled(True) self.rightSlider.setEnabled(True) self.leftSlider.setToolTip("Adaptive Threshold\n" "blockSize – Size of a pixel neighborhood that is used to calculate a threshold value for the pixel: 3, 5, 7, and so on.") self.leftSlider.setWhatsThis("Adaptive Threshold\n" "blockSize – Size of a pixel neighborhood that is used to calculate a threshold value for the pixel: 3, 5, 7, and so on.") self.rightSlider.setToolTip("Adaptive
, "year_filter":"and h.year <= %s" % (year) , "gp_filter":150 , "grouping":"h.year, h.league, h.player_name" , "ordering":"year, league, score" , "ranking_bool":"@yr != year OR @lg != league" } , {"table_type": "historical_stats" , "year_rename": ", h.year_span as year" , "trophy_type_add":"_OverallLeader" , "league_type": ", '' as league" , "career_filter": "and h.group_type = 'full_season'" , "year_filter":"and h.year_span <= %s" % (year) , "gp_filter":150 , "grouping":"h.year_span, h.player_name" , "ordering":"year, score" , "ranking_bool":"@yr != year" } , {"table_type": "historical_stats" , "year_rename": ", h.year_span as year" , "trophy_type_add":"_AllTimeSingleSeason" , "league_type": ", '' as league" , "career_filter": "and h.group_type = 'full_season'" , "year_filter":"and h.year_span <= %s" % (year) , "gp_filter":150 , "grouping":"h.year_span, h.player_name" , "ordering":"score" , "ranking_bool":0 } , {"table_type": "historical_stats" , "year_rename": ", 0 as year" , "trophy_type_add":"_AllTimeCareer" , "league_type": ", '' as league" , "career_filter": "and h.group_type = 'full_career'" , "year_filter":"" , "gp_filter":1000 , "grouping":"h.player_name" , "ordering":"score" , "ranking_bool":0 } ] for t in query_details: for l in lg_details: print '\t\t', t['trophy_name'], l['trophy_type_add'] query = base_query % (t['trophy_name'] , t['trophy_type'] , l['trophy_type_add'] , l['ranking_bool'] , l['ranking_bool'] , l['league_type'] , l['year_rename'] , t['score_formula'] , l['table_type'] , t['player_type'] , t['rate'] , t['per_g'] , l['gp_filter'] , l['career_filter'] , l['year_filter'] , l['grouping'] , t['score_filter'] , l['ordering'] , t['sort_type'] ) for q in query.split(";"): if q.strip() != "": # raw_input(q) db.query(q) db.conn.commit() def outliers(): print '\tremoving old outliers' q = "delete from trophies where update_type = 'outliers'" # print q db.query(q) db.conn.commit() q_dict = {"Triple Crowns":"""insert into trophies select b.year , b.rank_set as `rank_id` , b.new_trophy_name as `trophy_name` , b.league , b.trophy_type , b.position , 1 as `rank` , 0 as `ties` , 0 as `score` , 'outliers' AS `update_type` , b.team_name , b.player_name from( select a.* , IF(@yr = a.year and @lg = a.league AND @tro = a.new_trophy_name, @row := @row+1, @row := 1) as rank_set , @yr := a.year as yr_set , @lg := a.league as lg_set , @tro := a.new_trophy_name AS tro_set from( select t.* , case when trophy_name like "%%HITTERS_%%" then 'HITTERS_tripleCrown' else 'PITCHERS_tripleCrown' end as new_trophy_name , group_concat( concat(t.trophy_name , ' (' , t.rank , if(t.ties > 0, CONCAT(' tied w/', t.ties, ' others'), '') , ' - ' , case when t.trophy_name = 'HITTERS_avg' then format(t.score, 3) when t.trophy_name = 'PITCHERS_era' then format(t.score, 2) else ROUND(t.score,0) end , ')' ) order by t.rank asc, t.ties asc, t.trophy_name asc separator '\n') as details , count(*) as dummy1 , count(IF(t.rank = 1, t.trophy_name, null)) as dummy2 , @row := 0 as row_init , @yr := 0 as yr_init , @lg := '' as lg_init , @tro := '' AS tro_init from trophies t where 1 and t.update_type = 'leaders' and t.trophy_type IN ('player_leagueLeader', 'player_overallLeader') and t.trophy_name IN ('HITTERS_avg', 'HITTERS_hr', 'HITTERS_rbi', 'PITCHERS_w', 'PITCHERS_era', 'PITCHERS_k') and t.rank <= 5 group by t.year, t.player_name, t.league, t.trophy_type having 1 and dummy1 = 3 and dummy2 = 3 order by year, trophy_name, league ) a ) b ;""" , "30-30 seasons": """insert into trophies select b.year , b.rank_set as `rank_id` , 'HITTERS_30/30' as `trophy_name` , '' AS `league` , 'player' AS `trophy_type` , '' AS `position` , 1 as `rank` , 0 as `ties` , 0 as `score` , 'outliers' AS `update_type` , NULL AS `team_name` , b.player_name from( select a.* , IF(@yr = a.year and @lg = a.league, @row := @row+1, @row := 1) as rank_set , @yr := a.year as yr_set , @lg := a.league as lg_set from( select t.year , t.player_name , t.league , GROUP_CONCAT( CONCAT(t.trophy_name , ' - ' , ROUND(t.score,0) ) order by t.trophy_name asc separator '\n') as details , count(*) as dummy1 , @row := 0 as row_init , @yr := 0 as yr_init , @lg := '' as lg_init from trophies t where 1 and t.update_type = 'leaders' and t.trophy_type = 'player_OverallLeader' and t.trophy_name IN ('HITTERS_sb', 'HITTERS_hr') and t.score >= 30 group by t.year, t.player_name, t.league having 1 and dummy1 = 2 ORDER BY year, SUM(t.score) DESC ) a ) b ;""" } print '\toutliers' for desc, query in q_dict.items(): print '\t\tadding', desc for q in query.split(";"): if q.strip() != "": # raw_input(q) db.query(q) db.conn.commit() def format_ties(year): print '\tformatting ties in trophies' q = """UPDATE trophies t JOIN(SELECT t1.* , COUNT(*) AS ties_update FROM trophies t1 JOIN trophies t2 ON (t1.trophy_name = t2.trophy_name AND t1.league = t2.league AND t1.trophy_type = t2.trophy_type AND t1.rank = t2.rank AND t1.score = t2.score AND CASE WHEN t1.trophy_type = 'player_LeagueLeader' THEN t1.player_name != t2.player_name AND t1.year = t2.year AND t1.league = t2.league WHEN t1.trophy_type = 'player_OverallLeader' THEN t1.player_name != t2.player_name AND t1.year = t2.year WHEN t1.trophy_type = 'player_AllTimeSingleSeason' THEN t1.player_name != t2.player_name OR t1.year != t2.year WHEN t1.trophy_type = 'player_AllTimeCareer' THEN t1.player_name != t2.player_name END ) WHERE 1 AND t1.update_type = 'leaders' AND t1.ties = 0 AND t1.year <= %s GROUP BY t1.year, t1.rank_id, t1.trophy_name, t1.league, t1.trophy_type, t1.position ) b USING (year, rank_id, trophy_name, league, trophy_type, position) SET t.ties = b.ties_update ;""" % (year) # print q db.query(q) db.conn.commit() def append_historical_stats(): print '\tadding trophies to historical_stats' db.query("SET SESSION group_concat_max_len = 1000000;") db.conn.commit() for hp in ('hitters', 'pitchers'): print '\t\t', hp print '\t\t\tremoving trophy/ink' q = "update historical_stats_%s set trophy_count = NULL, black_ink = NULL, gray_ink = NULL, trophy_details = NULL" % (hp) # print q db.query(q) db.conn.commit() print '\t\t\tadding seasonal trophies/ink' season_q = """update historical_stats_%s h join( select a.year , a.player_name , a.h_team , a.p_team , count(distinct if(a.new_trophy_type = 'award' and a.trophy_name != 'World Series' and a.update_type != 'outliers' and (a.rank = 1 or a.trophy_name = 'all star') , a.trophy_name, null)) as trophy_count , count(distinct if(a.trophy_type = 'player_leagueleader' and a.rank = 1, a.trophy_name, null)) as black_ink , count(distinct if(a.trophy_type = 'player_leagueleader' and a.rank <= 10, a.trophy_name, null)) as gray_ink , group_concat(concat('- ' , if(a.new_trophy_type != 'Award', concat(a.new_trophy_type, ' '), '') , if(a.update_type = 'outliers' or a.trophy_name in ('World Series', 'All Star', 'Gold Glove', 'Silver Slugger') or (a.new_trophy_type = 'award' and a.rank = 1 and a.ties = 0) , upper(a.new_trophy_name) , concat(if(a.new_trophy_type = 'award' and a.rank = 1, upper(a.new_trophy_name), a.new_trophy_name) , ' (' , if(a.ties > 0, 'T-', '') , a.rank , if(a.ties > 0, concat(' w/', a.ties, ' others'), '') , ')' ) ) ) order by if(a.trophy_name = 'World Series', 1, 0) desc , if(a.update_type = 'outliers', 1, 0) desc , if(a.trophy_name in ('All Star', 'Gold Glove', 'Silver Slugger'), 1, 0) desc , (case when a.trophy_type = 'player' then 0 when a.trophy_type = 'player_alltimesingleseason' then 1 when a.trophy_type = 'player_overallleader' then 2 when a.trophy_type = 'player_leagueleader' then 3 end) asc, a.rank asc, a.rank_id asc, a.new_trophy_name asc separator ' \n') as trophy_details from( select t.* , case when t.trophy_type = 'player' then 'Award' when t.trophy_type = 'player_alltimesingleseason' then 'All-Time Single Season' when t.trophy_type = 'player_overallleader' then 'Overall' when t.trophy_type = 'player_leagueleader' then t.league end as new_trophy_type , case when t.trophy_type = 'player' then (replace(replace(replace(replace(t.trophy_name, 'HITTERS_', ''), 'PITCHERS_', ''), '_plus', '+'), '_minus', '-')) else upper(replace(replace(replace(replace(t.trophy_name, 'HITTERS_', ''), 'PITCHERS_', ''), '_plus', '+'), '_minus', '-')) end as new_trophy_name , group_concat(distinct h.team) AS h_team , group_concat(distinct p.team) AS p_team from trophies t left join historical_stats_hitters h on (t.year = h.year_span and t.player_name = h.player_name and h.group_type = 'full_season' and if(t.trophy_type != 'player', LEFT(t.trophy_name,1) = 'H', 1) ) left join historical_stats_pitchers p on (t.year = p.year_span and t.player_name = p.player_name and p.group_type = 'full_season' and if(t.trophy_type != 'player', LEFT(t.trophy_name,1) = 'P', 1) ) where 1 and t.player_name is not null and t.trophy_type in ('player', 'player_alltimesingleseason', 'player_overallleader', 'player_leagueleader') and case when t.trophy_type = 'player_alltimesingleseason' then t.rank <= 20 when t.trophy_type = 'player_overallleader' then t.rank <= 10 when t.trophy_type = 'player_leagueleader' then t.rank <= 10 else 1 end group by t.year, t.trophy_name, t.league, t.trophy_type, t.rank, t.player_name ) a group by year, player_name, h_team, p_team order by trophy_count desc, black_ink desc, gray_ink desc, year desc ) t on (h.player_name = t.player_name and h.year_span = t.year and h.team = t.%s_team) set h.trophy_count
= np.asarray(node_status).reshape(-1) if np.prod(shape) != node_status.size: raise ValueError( "node status array does not match size of grid " "(%d != %d)" % (np.prod(shape), len(node_status)) ) # status_at_link_start = node_status.flat[node_id_at_link_start(shape)] # status_at_link_end = node_status.flat[node_id_at_link_end(shape)] # status_at_link = node_status[StructuredQuadGraphTopology(shape).nodes_at_link] return is_active_link(node_status[StructuredQuadGraphTopology(shape).nodes_at_link]) def vertical_active_link_ids(shape, active_ids, bad_index_value=-1): """ID of vertical active links. Parameters ---------- shape : tuple of int Shape of grid of nodes. active_ids : array of int Array of all active link ids bad_index_value: int, optional Value assigned to inactive indicies in the array. Returns ------- ndarray : Link IDs at the VERTICAL active links. Length of number_of_vertical_links. Examples -------- The following example uses this grid:: *---I-->*---I-->*---I-->*---I-->* ^ ^ ^ ^ ^ I I I I I | | | | | *---I-->o---H-->o---H-->o---I-->* ^ ^ ^ ^ ^ I 6 7 8 I | | | | | *---I-->o---H-->o---H-->o---I-->* ^ ^ ^ ^ ^ I I I I I | | | | | *---I-->*---I-->*---I-->*---I-->* .. note:: ``*`` indicates the nodes that are set to `NodeStatus.CLOSED` ``o`` indicates the nodes that are set to `NodeStatus.CORE` ``I`` indicates the links that are set to `LinkStatus.INACTIVE` ``H`` indicates horizontal active ids, which are ignored by this function Numeric values correspond to the vertical `LinkStatus.ACTIVE` IDs. >>> from landlab import RasterModelGrid >>> from landlab.components.overland_flow._links import (active_link_ids, ... vertical_active_link_ids) >>> rmg = RasterModelGrid((4, 5)) >>> active_ids = active_link_ids((4, 5), rmg.status_at_node) >>> active_ids # doctest: +NORMALIZE_WHITESPACE array([ 5, 6, 7, 9, 10, 11, 12, 14, 15, 16, 18, 19, 20, 21, 23, 24, 25]) >>> vertical_active_link_ids((4, 5), active_ids) ... # doctest: +NORMALIZE_WHITESPACE array([-1, 5, 6, 7, -1, -1, 14, 15, 16, -1, -1, 23, 24, 25, -1]) >>> rmg.set_closed_boundaries_at_grid_edges(True, True, True, True) >>> status = rmg.status_at_node >>> active_ids = active_link_ids((4, 5), status) >>> vertical_active_link_ids((4, 5), active_ids) ... # doctest: +NORMALIZE_WHITESPACE array([-1, -1, -1, -1, -1, -1, 14, 15, 16, -1, -1, -1, -1, -1, -1]) """ number_of_vertical_links = (shape[0] - 1) * shape[1] out = np.full(number_of_vertical_links, bad_index_value, dtype=int) vertical_ids = active_ids[np.where(is_vertical_link(shape, active_ids))] out[nth_vertical_link(shape, vertical_ids)] = vertical_ids return out def _number_of_links(shape): """Number of links in a structured quad grid. Parameters ---------- shape : tuple of int Shape of grid of nodes. Returns ------- int : Number of links in grid. Examples -------- >>> from landlab.components.overland_flow._links import _number_of_links >>> _number_of_links((3, 4)) 17 """ return (shape[0] - 1) * shape[1] + shape[0] * (shape[1] - 1) # return number_of_vertical_links(shape) + number_of_horizontal_links(shape) def number_of_vertical_links(shape): """Number of vertical links in a structured quad grid. Parameters ---------- shape : tuple of int Shape of grid of nodes. Returns ------- int : Number of vertical links in grid. Examples -------- >>> from landlab.components.overland_flow._links import number_of_vertical_links >>> number_of_vertical_links((3, 4)) 8 """ return (shape[0] - 1) * shape[1] def number_of_horizontal_links(shape): """Number of horizontal links in a structured quad grid. Parameters ---------- shape : tuple of int Shape of grid of nodes. Returns ------- int : Number of horizontal links in grid. Examples -------- >>> from landlab.components.overland_flow._links import number_of_horizontal_links >>> number_of_horizontal_links((3, 4)) 9 """ return shape[0] * (shape[1] - 1) def is_vertical_link(shape, links): """Test if links are vertical. Parameters ---------- shape : tuple of int Shape of grid of nodes. links : array of int Array of link ids to test. Returns ------- ndarray of bool `True` for links that are vertical. Examples -------- >>> from landlab.components.overland_flow._links import (is_vertical_link, ... _number_of_links) >>> import numpy as np >>> shape = (3, 4) >>> links = np.arange(_number_of_links(shape)) >>> is_vertical_link(shape, links) # doctest: +NORMALIZE_WHITESPACE array([False, False, False, True, True, True, True, False, False, False, True, True, True, True, False, False, False], dtype=bool) """ return ((links % (2 * shape[1] - 1)) >= shape[1] - 1) & ( links < _number_of_links(shape) ) def nth_vertical_link(shape, links): """Convert link ID to vertical link ID. Parameters ---------- shape : tuple of int Shape of grid of nodes. links : array of int Array of link ids to test. Returns ------- ndarray of int The link ID as the nth vertical links. Examples -------- >>> from landlab.components.overland_flow._links import nth_vertical_link >>> shape = (3, 4) >>> nth_vertical_link(shape, 4) 1 >>> nth_vertical_link(shape, (3, 4, 11)) array([0, 1, 5]) """ links = np.asarray(links, dtype=int) return as_id_array( (links // (2 * shape[1] - 1)) * shape[1] + links % (2 * shape[1] - 1) - (shape[1] - 1) ) def horizontal_active_link_ids(shape, active_ids, bad_index_value=-1): """ID of horizontal active links. Parameters ---------- shape : tuple of int Shape of grid of nodes. active_ids : array of int Array of all active link ids bad_index_value: int, optional Value assigned to inactive indicies in the array. Returns ------- ndarray : Link IDs at the HORIZONTAL active links. Length of number_of_horizontal_links. Examples -------- The following example uses this grid:: *---I-->*---I-->*---I-->*---I-->* ^ ^ ^ ^ ^ I I I I I | | | | | *---I-->o--24-->o--25-->o---I-->* ^ ^ ^ ^ ^ I V V V I | | | | | *---I-->o--20-->o--21-->o---I-->* ^ ^ ^ ^ ^ I I I I I | | | | | *---I-->*---I-->*---I-->*---I-->* .. note:: ``*`` indicates the nodes that are set to `NodeStatus.CLOSED` ``o`` indicates the nodes that are set to `NodeStatus.CORE` ``I`` indicates the links that are set to `LinkStatus.INACTIVE` ``V`` indicates vertical active ids, which are ignored by this function. Numeric values correspond to the horizontal `LinkStatus.ACTIVE` ID. >>> from landlab import RasterModelGrid >>> from landlab.components.overland_flow._links import (active_link_ids, ... horizontal_active_link_ids) >>> rmg = RasterModelGrid((4, 5)) >>> rmg.set_closed_boundaries_at_grid_edges(True, True, True, True) >>> status = rmg.status_at_node >>> status # doctest: +NORMALIZE_WHITESPACE array([4, 4, 4, 4, 4, 4, 0, 0, 0, 4, 4, 0, 0, 0, 4, 4, 4, 4, 4, 4], dtype=uint8) >>> active_ids = active_link_ids((4,5), status) >>> horizontal_active_link_ids((4,5), active_ids) ... # doctest: +NORMALIZE_WHITESPACE array([-1, -1, -1, -1, -1, 10, 11, -1, -1, 19, 20, -1, -1, -1, -1, -1]) """ number_of_horizontal_links = shape[0] * (shape[1] - 1) out = np.full(number_of_horizontal_links, bad_index_value, dtype=int) horizontal_ids = active_ids[np.where(~is_vertical_link(shape, active_ids))] out[nth_horizontal_link(shape, horizontal_ids)] = horizontal_ids return out def nth_horizontal_link(shape, links): """Convert link ID to horizontal link ID. Parameters ---------- shape : tuple of int Shape of grid of nodes. links : array of int Array of link ids to test. Returns ------- ndarray of int The link ID as the nth horizontal links. Examples -------- >>> from landlab.components.overland_flow._links import nth_horizontal_link >>> shape = (3, 4) >>> nth_horizontal_link(shape, 16) 8 >>> nth_horizontal_link(shape, (1, 7, 8)) array([1, 3, 4]) """ links = np.asarray(links, dtype=int) return as_id_array( (links // (2 * shape[1] - 1)) * (shape[1] - 1) + links % (2 * shape[1] - 1) ) def is_horizontal_link(shape, links): """Test if a link is horizontal. Parameters ---------- shape : tuple of int Shape of grid of nodes. links : array of int Array of link ids to test. Returns ------- ndarray of bool `True` for links that are horizontal. Examples -------- >>> from landlab.components.overland_flow._links import (is_horizontal_link, ... _number_of_links) >>> import numpy as np >>> shape = (3, 4) >>> links = np.arange(_number_of_links(shape)) >>> is_horizontal_link(shape, links) # doctest: +NORMALIZE_WHITESPACE array([ True, True, True, False, False, False, False, True, True, True, False, False, False, False, True, True, True], dtype=bool) """ return (~is_vertical_link(shape, links)) & (links < _number_of_links(shape)) def horizontal_west_link_neighbor(shape, horizontal_ids, bad_index_value=-1): """ID of west, horizontal link neighbor. Parameters ---------- shape : tuple of int Shape of grid of nodes. horizontal_ids : array of int Array of all horizontal link ids - *must be of len(horizontal_links)* bad_index_value: int, optional Value assigned to inactive indicies in the array. Returns ------- ndarray : Link IDs of west horizontal neighbor links. Length of number_of_horizontal_links. Examples -------- The following example uses this grid:: *--27-->*--28-->*--29-->*--30-->* *--18-->*--19-->*--20-->*--21-->* *---9-->*--10-->*--11-->*--12-->* *---0-->*---1-->*---2-->*---3-->* .. note:: Only horizontal links are shown. When no neighbor is found, bad_index_value is returned. ``*`` indicates nodes Numeric values correspond to the horizontal IDs. >>> from landlab import RasterModelGrid >>> from landlab.components.overland_flow._links import (horizontal_link_ids, ... horizontal_west_link_neighbor) >>> rmg = RasterModelGrid((4, 5)) >>> horizontal_links = horizontal_link_ids(rmg.shape).flatten() >>> horizontal_west_link_neighbor(rmg.shape, horizontal_links) array([-1, 0, 1, 2, -1,
"""This module contains the classes used for constructing and conducting an Experiment (most notably, :class:`CVExperiment`). Any class contained herein whose name starts with "Base" should not be used directly. :class:`CVExperiment` is the preferred means of conducting one-off experimentation Related ------- :mod:`hyperparameter_hunter.experiment_core` Defines :class:`ExperimentMeta`, an understanding of which is critical to being able to understand :mod:`experiments` :mod:`hyperparameter_hunter.metrics` Defines :class:`ScoringMixIn`, a parent of :class:`experiments.BaseExperiment` that enables scoring and evaluating models :mod:`hyperparameter_hunter.models` Used to instantiate the actual learning models, which are a single part of the entire experimentation workflow, albeit the most significant part Notes ----- As mentioned above, the inner workings of :mod:`experiments` will be very confusing without a grasp on whats going on in :mod:`experiment_core`, and its related modules""" ################################################## # Import Own Assets ################################################## # noinspection PyProtectedMember from hyperparameter_hunter import __version__ from hyperparameter_hunter.algorithm_handlers import ( identify_algorithm, identify_algorithm_hyperparameters, ) from hyperparameter_hunter.exceptions import ( EnvironmentInactiveError, EnvironmentInvalidError, RepeatedExperimentError, ) from hyperparameter_hunter.experiment_core import ExperimentMeta from hyperparameter_hunter.keys import HyperparameterKeyMaker from hyperparameter_hunter.metrics import ScoringMixIn, get_formatted_target_metric from hyperparameter_hunter.models import model_selector from hyperparameter_hunter.recorders import RecorderList from hyperparameter_hunter.settings import G # from hyperparameter_hunter.tracers import TranslateTrace # TODO: Add when tested with `Mirror` from hyperparameter_hunter.utils.file_utils import RetryMakeDirs from hyperparameter_hunter.utils.general_utils import Deprecated ################################################## # Import Miscellaneous Assets ################################################## from abc import abstractmethod from inspect import isclass import numpy as np import pandas as pd import random import shutil from sys import exc_info from uuid import uuid4 as uuid import warnings ################################################## # Import Learning Assets ################################################## from sklearn.model_selection import KFold, StratifiedKFold, RepeatedKFold, RepeatedStratifiedKFold import sklearn.utils as sklearn_utils pd.set_option("display.expand_frame_repr", False) warnings.simplefilter(action="ignore", category=FutureWarning) warnings.simplefilter(action="ignore", category=DeprecationWarning) warnings.simplefilter(action="ignore", category=sklearn_utils.DataConversionWarning) np.random.seed(32) class BaseExperiment(ScoringMixIn): # @TranslateTrace("model", ("model_initializer", "model_init_params")) # TODO: Add when tested with `Mirror` def __init__( # TODO: Make `model_init_params` an optional kwarg - If not given, algorithm defaults used self, # model=None, # model_initializer=None, # model_init_params=None, # TODO: Convert below 2 to above 3 lines for `TranslateTrace` model_initializer, model_init_params, model_extra_params=None, feature_engineer=None, feature_selector=None, notes=None, do_raise_repeated=False, auto_start=True, target_metric=None, ): # TODO: When `TranslateTrace` added document `model` below with expectation that if `model` # TODO: ... given, (`model_initializer`, `model_init_params`) should not be, and vice versa # TODO: `model` (Class instance, default=None); # TODO: `model_initializer`/`model_init_params` docstring types += "default=None" """Base class for :class:`BaseCVExperiment` Parameters ---------- model_initializer: Class, or functools.partial, or class instance The algorithm class being used to initialize a model model_init_params: Dict, or object The dictionary of arguments given when creating a model instance with `model_initializer` via the `__init__` method of :class:`models.Model`. Any kwargs that are considered valid by the `__init__` method of `model_initializer` are valid in `model_init_params` model_extra_params: Dict, or None, default=None A dictionary of extra parameters passed to :class:`models.Model`. This is used to provide parameters to models' non-initialization methods (like `fit`, `predict`, `predict_proba`, etc.), and for neural networks feature_engineer: `FeatureEngineer`, or None, default=None ... # TODO: Add documentation feature_selector: List of str, callable, list of booleans, default=None The value provided when splitting apart the input data for all provided DataFrames. `feature_selector` is provided as the second argument for calls to `pandas.DataFrame.loc` in :meth:`BaseExperiment._initial_preprocessing`. If None, `feature_selector` is set to all columns in :attr:`train_dataset`, less :attr:`target_column`, and :attr:`id_column` notes: String, or None, default=None Additional information about the Experiment that will be saved with the Experiment's description result file. This serves no purpose other than to facilitate saving Experiment details in a more readable format do_raise_repeated: Boolean, default=False If True and this Experiment locates a previous Experiment's results with matching Environment and Hyperparameter Keys, a RepeatedExperimentError will be raised. Else, a warning will be logged auto_start: Boolean, default=True If True, after the Experiment is initialized, it will automatically call :meth:`BaseExperiment.preparation_workflow`, followed by :meth:`BaseExperiment.experiment_workflow`, effectively completing all essential tasks without requiring additional method calls target_metric: Tuple, str, default=('oof', <:attr:`environment.Environment.metrics`[0]>) A path denoting the metric to be used to compare completed Experiments or to use for certain early stopping procedures in some model classes. The first value should be one of ['oof', 'holdout', 'in_fold']. The second value should be the name of a metric being recorded according to the values supplied in :attr:`environment.Environment.metrics_params`. See the documentation for :func:`metrics.get_formatted_target_metric` for more info. Any values returned by, or used as the `target_metric` input to this function are acceptable values for :attr:`BaseExperiment.target_metric`""" # self._model_original = model # TODO: Add for `TranslateTrace` self.model_initializer = model_initializer self.model_init_params = identify_algorithm_hyperparameters(self.model_initializer) try: self.model_init_params.update(model_init_params) except TypeError: self.model_init_params.update(dict(build_fn=model_init_params)) self.model_extra_params = model_extra_params if model_extra_params is not None else {} self.feature_engineer = feature_engineer if feature_engineer is not None else {} self.feature_selector = feature_selector if feature_selector is not None else [] self.notes = notes self.do_raise_repeated = do_raise_repeated self.auto_start = auto_start self.target_metric = target_metric #################### Attributes From Active Environment #################### G.Env.initialize_reporting() self._validate_environment() self.train_dataset = G.Env.train_dataset.copy() try: self.holdout_dataset = G.Env.holdout_dataset.copy() except AttributeError: self.holdout_dataset = G.Env.holdout_dataset try: self.test_dataset = G.Env.test_dataset.copy() except AttributeError: self.test_dataset = G.Env.test_dataset self.target_column = G.Env.target_column self.id_column = G.Env.id_column self.do_predict_proba = G.Env.do_predict_proba self.prediction_formatter = G.Env.prediction_formatter self.metrics_params = G.Env.metrics_params self.experiment_params = G.Env.cross_experiment_params self.cv_params = G.Env.cv_params self.result_paths = G.Env.result_paths self.cross_experiment_key = G.Env.cross_experiment_key #################### Instantiate Other Attributes #################### self.train_input_data = None self.train_target_data = None self.holdout_input_data = None self.holdout_target_data = None self.test_input_data = None self.model = None self.metrics = None # Set by :class:`metrics.ScoringMixIn` self.stat_aggregates = dict() self.result_description = None #################### Experiment Identification Attributes #################### self.experiment_id = None self.hyperparameter_key = None self.algorithm_name, self.module_name = identify_algorithm(self.model_initializer) ScoringMixIn.__init__(self, **self.metrics_params if self.metrics_params else {}) if self.auto_start is True: self.preparation_workflow() self.experiment_workflow() def __repr__(self): return '{}("{}", cross_experiment_key="{}", hyperparameter_key="{}")'.format( type(self).__name__, self.experiment_id, self.cross_experiment_key, self.hyperparameter_key, ) def __getattr__(self, attr): """If AttributeError thrown, check :attr:`settings.G.Env` for target attribute""" try: return getattr(G.Env, attr) except AttributeError: raise AttributeError( "Could not find '{}' in 'G.Env', or any of the following locations: {}".format( attr, [_.__name__ for _ in type(self).__mro__] ) ).with_traceback(exc_info()[2]) from None def experiment_workflow(self): """Define the actual experiment process, including execution, result saving, and cleanup""" if self.hyperparameter_key.exists is True: _ex = f"{self!r} has already been run" if self.do_raise_repeated is True: self._clean_up() raise RepeatedExperimentError(_ex) G.debug(_ex) G.warn("WARNING: Duplicate experiment!") self._initialize_random_seeds() self._initial_preprocessing() self.execute() #################### Save Experiment Results #################### recorders = RecorderList( file_blacklist=G.Env.file_blacklist, extra_recorders=G.Env.experiment_recorders ) recorders.format_result() G.log(f"Saving results for Experiment: '{self.experiment_id}'") recorders.save_result() self._clean_up() def preparation_workflow(self): """Execute all tasks that must take place before the experiment is actually started. Such tasks include (but are not limited to): Creating experiment IDs and hyperparameter keys, creating script backups, and validating parameters""" G.debug("Starting preparation_workflow...") self._generate_experiment_id() self._create_script_backup() self._validate_parameters() self._generate_hyperparameter_key() self._additional_preparation_steps() G.debug("Completed preparation_workflow") @abstractmethod def _additional_preparation_steps(self): """Perform extra preparation tasks prior to initializing random seeds and preprocessing""" @abstractmethod def execute(self): """Execute the fitting protocol for the Experiment, comprising the following: instantiation of learners for each run, preprocessing of data as appropriate, training learners, making predictions, and evaluating and aggregating those predictions and other stats/metrics for later use""" ################################################## # Data Preprocessing Methods: ################################################## def _initial_preprocessing(self): """Perform preprocessing steps prior to executing fitting protocol (usually cross-validation), consisting of: 1) Split train/holdout data into respective train/holdout input and target data attributes, 2) Execute `feature_engineer` to perform "pre_cv"-stage preprocessing, 3) Set datasets to their (modified) counterparts in `feature_engineer`""" self.train_input_data = self.train_dataset.copy().loc[:, self.feature_selector] self.train_target_data = self.train_dataset.copy().loc[:, self.target_column] if isinstance(self.holdout_dataset, pd.DataFrame): self.holdout_input_data = self.holdout_dataset.copy().loc[:, self.feature_selector] self.holdout_target_data = self.holdout_dataset.copy().loc[:, self.target_column] if isinstance(self.test_dataset, pd.DataFrame): self.test_input_data = self.test_dataset.copy().loc[:, self.feature_selector] if self.feature_engineer and callable(self.feature_engineer): self.feature_engineer( "pre_cv", train_inputs=self.train_input_data, train_targets=self.train_target_data, holdout_inputs=self.holdout_input_data, holdout_targets=self.holdout_target_data, test_inputs=self.test_input_data, ) self.train_input_data = self.feature_engineer.datasets["train_inputs"] self.train_target_data = self.feature_engineer.datasets["train_targets"] self.holdout_input_data = self.feature_engineer.datasets["holdout_inputs"] self.holdout_target_data = self.feature_engineer.datasets["holdout_targets"] self.test_input_data = self.feature_engineer.datasets["test_inputs"] G.log("Initial preprocessing stage complete", 4) ################################################## # Supporting Methods: ################################################## def _validate_parameters(self): """Ensure provided input parameters are properly formatted""" #################### target_metric #################### self.target_metric = get_formatted_target_metric(self.target_metric, self.metrics) #################### feature_selector #################### self.feature_selector = self.feature_selector or self.train_dataset.columns.values restricted_cols = [_ for _ in self.target_column + [self.id_column] if _ is not None] self.feature_selector = [_ for _ in self.feature_selector if _ not in restricted_cols] G.debug("Experiment parameters have been validated") def _validate_environment(self): """Ensure there is a currently active Environment instance that is not already occupied""" if G.Env is None: raise EnvironmentInactiveError("") if G.Env.current_task is None: G.Env.current_task = self G.log(f"Validated Environment: '{self.cross_experiment_key}'") else: raise EnvironmentInvalidError("Current experiment must finish before starting another") @staticmethod def _clean_up(): """Clean up after experiment to prepare for next experiment""" G.Env.current_task = None ################################################## # Key/ID Methods: ################################################## def _generate_experiment_id(self): """Set :attr:`experiment_id` to a UUID""" self.experiment_id = str(uuid()) G.log("Initialized Experiment: '{}'".format(self.experiment_id)) def _generate_hyperparameter_key(self): """Set :attr:`hyperparameter_key` to a key to describe the experiment's hyperparameters""" parameters = dict( model_initializer=self.model_initializer, model_init_params=self.model_init_params, model_extra_params=self.model_extra_params, feature_engineer=self.feature_engineer, feature_selector=self.feature_selector, # FLAG: Should probably add
# Copyright (c) 2016-present, <NAME> # All rights reserved. # # This software may be modified and distributed under the terms # of the BSD license. See the LICENSE file for details. """Python interface to the Zstandard (zstd) compression library.""" from __future__ import absolute_import, unicode_literals # This should match what the C extension exports. __all__ = [ #'BufferSegment', #'BufferSegments', #'BufferWithSegments', #'BufferWithSegmentsCollection', "CompressionParameters", "ZstdCompressionDict", "ZstdCompressionParameters", "ZstdCompressor", "ZstdError", "ZstdDecompressor", "FrameParameters", "estimate_decompression_context_size", "frame_content_size", "frame_header_size", "get_frame_parameters", "train_dictionary", # Constants. "FLUSH_BLOCK", "FLUSH_FRAME", "COMPRESSOBJ_FLUSH_FINISH", "COMPRESSOBJ_FLUSH_BLOCK", "ZSTD_VERSION", "FRAME_HEADER", "CONTENTSIZE_UNKNOWN", "CONTENTSIZE_ERROR", "MAX_COMPRESSION_LEVEL", "COMPRESSION_RECOMMENDED_INPUT_SIZE", "COMPRESSION_RECOMMENDED_OUTPUT_SIZE", "DECOMPRESSION_RECOMMENDED_INPUT_SIZE", "DECOMPRESSION_RECOMMENDED_OUTPUT_SIZE", "MAGIC_NUMBER", "BLOCKSIZELOG_MAX", "BLOCKSIZE_MAX", "WINDOWLOG_MIN", "WINDOWLOG_MAX", "CHAINLOG_MIN", "CHAINLOG_MAX", "HASHLOG_MIN", "HASHLOG_MAX", "HASHLOG3_MAX", "MINMATCH_MIN", "MINMATCH_MAX", "SEARCHLOG_MIN", "SEARCHLOG_MAX", "SEARCHLENGTH_MIN", "SEARCHLENGTH_MAX", "TARGETLENGTH_MIN", "TARGETLENGTH_MAX", "LDM_MINMATCH_MIN", "LDM_MINMATCH_MAX", "LDM_BUCKETSIZELOG_MAX", "STRATEGY_FAST", "STRATEGY_DFAST", "STRATEGY_GREEDY", "STRATEGY_LAZY", "STRATEGY_LAZY2", "STRATEGY_BTLAZY2", "STRATEGY_BTOPT", "STRATEGY_BTULTRA", "STRATEGY_BTULTRA2", "DICT_TYPE_AUTO", "DICT_TYPE_RAWCONTENT", "DICT_TYPE_FULLDICT", "FORMAT_ZSTD1", "FORMAT_ZSTD1_MAGICLESS", ] import io import os import sys from _zstd_cffi import ( ffi, lib, ) if sys.version_info[0] == 2: bytes_type = str int_type = long else: bytes_type = bytes int_type = int COMPRESSION_RECOMMENDED_INPUT_SIZE = lib.ZSTD_CStreamInSize() COMPRESSION_RECOMMENDED_OUTPUT_SIZE = lib.ZSTD_CStreamOutSize() DECOMPRESSION_RECOMMENDED_INPUT_SIZE = lib.ZSTD_DStreamInSize() DECOMPRESSION_RECOMMENDED_OUTPUT_SIZE = lib.ZSTD_DStreamOutSize() new_nonzero = ffi.new_allocator(should_clear_after_alloc=False) MAX_COMPRESSION_LEVEL = lib.ZSTD_maxCLevel() MAGIC_NUMBER = lib.ZSTD_MAGICNUMBER FRAME_HEADER = b"\x28\xb5\x2f\xfd" CONTENTSIZE_UNKNOWN = lib.ZSTD_CONTENTSIZE_UNKNOWN CONTENTSIZE_ERROR = lib.ZSTD_CONTENTSIZE_ERROR ZSTD_VERSION = ( lib.ZSTD_VERSION_MAJOR, lib.ZSTD_VERSION_MINOR, lib.ZSTD_VERSION_RELEASE, ) BLOCKSIZELOG_MAX = lib.ZSTD_BLOCKSIZELOG_MAX BLOCKSIZE_MAX = lib.ZSTD_BLOCKSIZE_MAX WINDOWLOG_MIN = lib.ZSTD_WINDOWLOG_MIN WINDOWLOG_MAX = lib.ZSTD_WINDOWLOG_MAX CHAINLOG_MIN = lib.ZSTD_CHAINLOG_MIN CHAINLOG_MAX = lib.ZSTD_CHAINLOG_MAX HASHLOG_MIN = lib.ZSTD_HASHLOG_MIN HASHLOG_MAX = lib.ZSTD_HASHLOG_MAX HASHLOG3_MAX = lib.ZSTD_HASHLOG3_MAX MINMATCH_MIN = lib.ZSTD_MINMATCH_MIN MINMATCH_MAX = lib.ZSTD_MINMATCH_MAX SEARCHLOG_MIN = lib.ZSTD_SEARCHLOG_MIN SEARCHLOG_MAX = lib.ZSTD_SEARCHLOG_MAX SEARCHLENGTH_MIN = lib.ZSTD_MINMATCH_MIN SEARCHLENGTH_MAX = lib.ZSTD_MINMATCH_MAX TARGETLENGTH_MIN = lib.ZSTD_TARGETLENGTH_MIN TARGETLENGTH_MAX = lib.ZSTD_TARGETLENGTH_MAX LDM_MINMATCH_MIN = lib.ZSTD_LDM_MINMATCH_MIN LDM_MINMATCH_MAX = lib.ZSTD_LDM_MINMATCH_MAX LDM_BUCKETSIZELOG_MAX = lib.ZSTD_LDM_BUCKETSIZELOG_MAX STRATEGY_FAST = lib.ZSTD_fast STRATEGY_DFAST = lib.ZSTD_dfast STRATEGY_GREEDY = lib.ZSTD_greedy STRATEGY_LAZY = lib.ZSTD_lazy STRATEGY_LAZY2 = lib.ZSTD_lazy2 STRATEGY_BTLAZY2 = lib.ZSTD_btlazy2 STRATEGY_BTOPT = lib.ZSTD_btopt STRATEGY_BTULTRA = lib.ZSTD_btultra STRATEGY_BTULTRA2 = lib.ZSTD_btultra2 DICT_TYPE_AUTO = lib.ZSTD_dct_auto DICT_TYPE_RAWCONTENT = lib.ZSTD_dct_rawContent DICT_TYPE_FULLDICT = lib.ZSTD_dct_fullDict FORMAT_ZSTD1 = lib.ZSTD_f_zstd1 FORMAT_ZSTD1_MAGICLESS = lib.ZSTD_f_zstd1_magicless FLUSH_BLOCK = 0 FLUSH_FRAME = 1 COMPRESSOBJ_FLUSH_FINISH = 0 COMPRESSOBJ_FLUSH_BLOCK = 1 def _cpu_count(): # os.cpu_count() was introducd in Python 3.4. try: return os.cpu_count() or 0 except AttributeError: pass # Linux. try: if sys.version_info[0] == 2: return os.sysconf(b"SC_NPROCESSORS_ONLN") else: return os.sysconf("SC_NPROCESSORS_ONLN") except (AttributeError, ValueError): pass # TODO implement on other platforms. return 0 class ZstdError(Exception): pass def _zstd_error(zresult): # Resolves to bytes on Python 2 and 3. We use the string for formatting # into error messages, which will be literal unicode. So convert it to # unicode. return ffi.string(lib.ZSTD_getErrorName(zresult)).decode("utf-8") def _make_cctx_params(params): res = lib.ZSTD_createCCtxParams() if res == ffi.NULL: raise MemoryError() res = ffi.gc(res, lib.ZSTD_freeCCtxParams) attrs = [ (lib.ZSTD_c_format, params.format), (lib.ZSTD_c_compressionLevel, params.compression_level), (lib.ZSTD_c_windowLog, params.window_log), (lib.ZSTD_c_hashLog, params.hash_log), (lib.ZSTD_c_chainLog, params.chain_log), (lib.ZSTD_c_searchLog, params.search_log), (lib.ZSTD_c_minMatch, params.min_match), (lib.ZSTD_c_targetLength, params.target_length), (lib.ZSTD_c_strategy, params.compression_strategy), (lib.ZSTD_c_contentSizeFlag, params.write_content_size), (lib.ZSTD_c_checksumFlag, params.write_checksum), (lib.ZSTD_c_dictIDFlag, params.write_dict_id), (lib.ZSTD_c_nbWorkers, params.threads), (lib.ZSTD_c_jobSize, params.job_size), (lib.ZSTD_c_overlapLog, params.overlap_log), (lib.ZSTD_c_forceMaxWindow, params.force_max_window), (lib.ZSTD_c_enableLongDistanceMatching, params.enable_ldm), (lib.ZSTD_c_ldmHashLog, params.ldm_hash_log), (lib.ZSTD_c_ldmMinMatch, params.ldm_min_match), (lib.ZSTD_c_ldmBucketSizeLog, params.ldm_bucket_size_log), (lib.ZSTD_c_ldmHashRateLog, params.ldm_hash_rate_log), ] for param, value in attrs: _set_compression_parameter(res, param, value) return res class ZstdCompressionParameters(object): @staticmethod def from_level(level, source_size=0, dict_size=0, **kwargs): params = lib.ZSTD_getCParams(level, source_size, dict_size) args = { "window_log": "windowLog", "chain_log": "chainLog", "hash_log": "hashLog", "search_log": "searchLog", "min_match": "minMatch", "target_length": "targetLength", "compression_strategy": "strategy", } for arg, attr in args.items(): if arg not in kwargs: kwargs[arg] = getattr(params, attr) return ZstdCompressionParameters(**kwargs) def __init__( self, format=0, compression_level=0, window_log=0, hash_log=0, chain_log=0, search_log=0, min_match=0, target_length=0, strategy=-1, compression_strategy=-1, write_content_size=1, write_checksum=0, write_dict_id=0, job_size=0, overlap_log=-1, overlap_size_log=-1, force_max_window=0, enable_ldm=0, ldm_hash_log=0, ldm_min_match=0, ldm_bucket_size_log=0, ldm_hash_rate_log=-1, ldm_hash_every_log=-1, threads=0, ): params = lib.ZSTD_createCCtxParams() if params == ffi.NULL: raise MemoryError() params = ffi.gc(params, lib.ZSTD_freeCCtxParams) self._params = params if threads < 0: threads = _cpu_count() # We need to set ZSTD_c_nbWorkers before ZSTD_c_jobSize and ZSTD_c_overlapLog # because setting ZSTD_c_nbWorkers resets the other parameters. _set_compression_parameter(params, lib.ZSTD_c_nbWorkers, threads) _set_compression_parameter(params, lib.ZSTD_c_format, format) _set_compression_parameter( params, lib.ZSTD_c_compressionLevel, compression_level ) _set_compression_parameter(params, lib.ZSTD_c_windowLog, window_log) _set_compression_parameter(params, lib.ZSTD_c_hashLog, hash_log) _set_compression_parameter(params, lib.ZSTD_c_chainLog, chain_log) _set_compression_parameter(params, lib.ZSTD_c_searchLog, search_log) _set_compression_parameter(params, lib.ZSTD_c_minMatch, min_match) _set_compression_parameter( params, lib.ZSTD_c_targetLength, target_length ) if strategy != -1 and compression_strategy != -1: raise ValueError( "cannot specify both compression_strategy and strategy" ) if compression_strategy != -1: strategy = compression_strategy elif strategy == -1: strategy = 0 _set_compression_parameter(params, lib.ZSTD_c_strategy, strategy) _set_compression_parameter( params, lib.ZSTD_c_contentSizeFlag, write_content_size ) _set_compression_parameter( params, lib.ZSTD_c_checksumFlag, write_checksum ) _set_compression_parameter(params, lib.ZSTD_c_dictIDFlag, write_dict_id) _set_compression_parameter(params, lib.ZSTD_c_jobSize, job_size) if overlap_log != -1 and overlap_size_log != -1: raise ValueError( "cannot specify both overlap_log and overlap_size_log" ) if overlap_size_log != -1: overlap_log = overlap_size_log elif overlap_log == -1: overlap_log = 0 _set_compression_parameter(params, lib.ZSTD_c_overlapLog, overlap_log) _set_compression_parameter( params, lib.ZSTD_c_forceMaxWindow, force_max_window ) _set_compression_parameter( params, lib.ZSTD_c_enableLongDistanceMatching, enable_ldm ) _set_compression_parameter(params, lib.ZSTD_c_ldmHashLog, ldm_hash_log) _set_compression_parameter( params, lib.ZSTD_c_ldmMinMatch, ldm_min_match ) _set_compression_parameter( params, lib.ZSTD_c_ldmBucketSizeLog, ldm_bucket_size_log ) if ldm_hash_rate_log != -1 and ldm_hash_every_log != -1: raise ValueError( "cannot specify both ldm_hash_rate_log and ldm_hash_every_log" ) if ldm_hash_every_log != -1: ldm_hash_rate_log = ldm_hash_every_log elif ldm_hash_rate_log == -1: ldm_hash_rate_log = 0 _set_compression_parameter( params, lib.ZSTD_c_ldmHashRateLog, ldm_hash_rate_log ) @property def format(self): return _get_compression_parameter(self._params, lib.ZSTD_c_format) @property def compression_level(self): return _get_compression_parameter( self._params, lib.ZSTD_c_compressionLevel ) @property def window_log(self): return _get_compression_parameter(self._params, lib.ZSTD_c_windowLog) @property def hash_log(self): return _get_compression_parameter(self._params, lib.ZSTD_c_hashLog) @property def chain_log(self): return _get_compression_parameter(self._params, lib.ZSTD_c_chainLog) @property def search_log(self): return _get_compression_parameter(self._params, lib.ZSTD_c_searchLog) @property def min_match(self): return _get_compression_parameter(self._params, lib.ZSTD_c_minMatch) @property def target_length(self): return _get_compression_parameter(self._params, lib.ZSTD_c_targetLength) @property def compression_strategy(self): return _get_compression_parameter(self._params, lib.ZSTD_c_strategy) @property def write_content_size(self): return _get_compression_parameter( self._params, lib.ZSTD_c_contentSizeFlag ) @property def write_checksum(self): return _get_compression_parameter(self._params, lib.ZSTD_c_checksumFlag) @property def write_dict_id(self): return _get_compression_parameter(self._params, lib.ZSTD_c_dictIDFlag) @property def job_size(self): return _get_compression_parameter(self._params, lib.ZSTD_c_jobSize) @property def overlap_log(self): return _get_compression_parameter(self._params, lib.ZSTD_c_overlapLog) @property def overlap_size_log(self): return self.overlap_log @property def force_max_window(self): return _get_compression_parameter( self._params, lib.ZSTD_c_forceMaxWindow ) @property def enable_ldm(self): return _get_compression_parameter( self._params, lib.ZSTD_c_enableLongDistanceMatching ) @property def ldm_hash_log(self): return _get_compression_parameter(self._params, lib.ZSTD_c_ldmHashLog) @property def ldm_min_match(self): return _get_compression_parameter(self._params, lib.ZSTD_c_ldmMinMatch) @property def ldm_bucket_size_log(self): return _get_compression_parameter( self._params, lib.ZSTD_c_ldmBucketSizeLog ) @property def ldm_hash_rate_log(self): return _get_compression_parameter( self._params, lib.ZSTD_c_ldmHashRateLog ) @property def ldm_hash_every_log(self): return self.ldm_hash_rate_log @property def threads(self): return _get_compression_parameter(self._params, lib.ZSTD_c_nbWorkers) def estimated_compression_context_size(self): return lib.ZSTD_estimateCCtxSize_usingCCtxParams(self._params) CompressionParameters = ZstdCompressionParameters def estimate_decompression_context_size(): return lib.ZSTD_estimateDCtxSize() def _set_compression_parameter(params, param, value): zresult = lib.ZSTD_CCtxParams_setParameter(params, param, value) if lib.ZSTD_isError(zresult): raise ZstdError( "unable to set compression context parameter: %s" % _zstd_error(zresult) ) def _get_compression_parameter(params, param): result = ffi.new("int *") zresult = lib.ZSTD_CCtxParams_getParameter(params, param, result) if lib.ZSTD_isError(zresult): raise ZstdError( "unable to get compression context parameter: %s" % _zstd_error(zresult) ) return result[0] class ZstdCompressionWriter(object): def __init__( self, compressor, writer, source_size, write_size, write_return_read ): self._compressor = compressor self._writer = writer self._write_size = write_size self._write_return_read = bool(write_return_read) self._entered = False self._closed = False self._bytes_compressed = 0 self._dst_buffer = ffi.new("char[]", write_size) self._out_buffer = ffi.new("ZSTD_outBuffer *") self._out_buffer.dst = self._dst_buffer self._out_buffer.size = len(self._dst_buffer) self._out_buffer.pos = 0 zresult = lib.ZSTD_CCtx_setPledgedSrcSize(compressor._cctx, source_size) if lib.ZSTD_isError(zresult): raise ZstdError( "error setting source size: %s" % _zstd_error(zresult) ) def __enter__(self): if self._closed: raise ValueError("stream is closed") if self._entered: raise ZstdError("cannot __enter__ multiple times") self._entered = True return self def __exit__(self, exc_type, exc_value, exc_tb): self._entered = False if not exc_type and not exc_value and not exc_tb: self.close() self._compressor = None return False def memory_size(self): return lib.ZSTD_sizeof_CCtx(self._compressor._cctx) def fileno(self): f = getattr(self._writer, "fileno", None) if f: return f() else: raise OSError("fileno not available on underlying writer") def close(self): if self._closed: return try: self.flush(FLUSH_FRAME) finally: self._closed = True # Call close() on underlying stream as well. f = getattr(self._writer, "close", None) if f: f() @property def closed(self): return self._closed def isatty(self): return False def readable(self): return False def readline(self, size=-1): raise io.UnsupportedOperation() def readlines(self, hint=-1): raise io.UnsupportedOperation() def seek(self, offset, whence=None): raise io.UnsupportedOperation() def seekable(self): return False def truncate(self, size=None): raise io.UnsupportedOperation() def writable(self): return True def writelines(self, lines): raise NotImplementedError("writelines() is not yet implemented") def read(self, size=-1): raise io.UnsupportedOperation() def readall(self): raise io.UnsupportedOperation() def readinto(self, b): raise io.UnsupportedOperation() def write(self, data): if self._closed: raise ValueError("stream is closed") total_write = 0 data_buffer = ffi.from_buffer(data) in_buffer = ffi.new("ZSTD_inBuffer *") in_buffer.src = data_buffer in_buffer.size = len(data_buffer) in_buffer.pos = 0 out_buffer = self._out_buffer out_buffer.pos = 0 while in_buffer.pos < in_buffer.size: zresult = lib.ZSTD_compressStream2( self._compressor._cctx, out_buffer, in_buffer, lib.ZSTD_e_continue, ) if lib.ZSTD_isError(zresult): raise ZstdError( "zstd compress error: %s" % _zstd_error(zresult) ) if out_buffer.pos: self._writer.write( ffi.buffer(out_buffer.dst, out_buffer.pos)[:] ) total_write += out_buffer.pos self._bytes_compressed += out_buffer.pos out_buffer.pos = 0 if self._write_return_read: return in_buffer.pos else: return total_write def flush(self, flush_mode=FLUSH_BLOCK): if flush_mode == FLUSH_BLOCK: flush = lib.ZSTD_e_flush elif flush_mode == FLUSH_FRAME: flush = lib.ZSTD_e_end else: raise ValueError("unknown flush_mode: %r" % flush_mode) if self._closed: raise ValueError("stream is closed") total_write = 0 out_buffer = self._out_buffer out_buffer.pos = 0 in_buffer = ffi.new("ZSTD_inBuffer *") in_buffer.src = ffi.NULL in_buffer.size = 0 in_buffer.pos = 0 while True: zresult = lib.ZSTD_compressStream2( self._compressor._cctx, out_buffer, in_buffer, flush ) if lib.ZSTD_isError(zresult): raise ZstdError( "zstd compress error: %s" % _zstd_error(zresult) ) if out_buffer.pos: self._writer.write( ffi.buffer(out_buffer.dst, out_buffer.pos)[:] ) total_write += out_buffer.pos self._bytes_compressed += out_buffer.pos out_buffer.pos = 0 if not zresult: break return total_write def tell(self): return self._bytes_compressed class ZstdCompressionObj(object): def
bbox_to_anchor=(0.5, 1.3), fontsize=12, frameon=False) ax1.text(6, -15, 'Chemical Shift (ppm)', fontsize=16) ax0.set_ylabel('Intensity', fontsize=16) ax1.set_ylabel('Intensity', fontsize=16) # add the relevant labels for species # butenedial: ax0.text(5.9, 60, r'\textbf{BD}', fontsize=10) ax0.text(6.2, 90, r'\textbf{BD}', fontsize=10) # pyrrolinone: ax1.text(6.7, 7, r'\textbf{PR, h}', fontsize=10) ax1.text(5.8, 20, 'PR, g', fontsize=10) ax1.plot([5.9, 5.8], [8, 19], lw=1, color='0.25') ax2.text(3.38, 25, 'PR,\nf', fontsize=10) ax2.vlines(3.37, 16, 23, lw=1, color='0.25') # butenedial-pyrrolinone dimer: ax1.text(5.67, 14, r'\textbf{BD-PR,}', fontsize=10) ax1.text(5.67, 11, r'\textbf{j}', fontsize=10) ax1.text(5.45, 9, 'k', fontsize=10) ax1.text(6.1, 18, 'BD-PR,', fontsize=10) ax1.text(6., 15, 'n', fontsize=10) ax1.text(6.08, 12, 'm', fontsize=10) ax1.text(6.45, 15, 'BD-PR,\nl', fontsize=10) ax1.vlines(6.3, 6, 16, lw=1, color='0.25') ax1.vlines(6.05, 5, 11, lw=1, color='0.25') ax1.vlines(5.97, 6, 14, lw=1, color='0.25') ax2.text(3.49, 16, 'BD-PR,\ni', fontsize=10) # add in the leftover molecules ax0.text(5.15, 100, 'HDO', fontsize=10) ax0.text(3.42, 100, 'DMS', fontsize=10) ax0.text(2.1, 45, 'HAc', fontsize=10) ax0.text(1.5, 15, 'MPA', fontsize=10) ax2.text(3.38, 48, 'MeOH', fontsize=10) fig_path = create_fig_path('bdnhx_nmr_spectrum') plt.savefig(fig_path, bbox_inches='tight', dpi=300, transparent=True) fns = ['20210126_bdohph11_5min.csv', '20210126_bdohph11_25min.csv', '20210126_bdohph11_hr.csv'] path = os.path.join(d, 'data_raw', 'nmrs', fns[0]) df_0 = pd.read_csv(path, sep='\t', header=None, names=['PPM', 'SIG', 'x']) df_0.drop(columns=['x'], inplace=True) path = os.path.join(d, 'data_raw', 'nmrs', fns[1]) df_1 = pd.read_csv(path, sep='\t', header=None, names=['PPM', 'SIG', 'x']) df_1.drop(columns=['x'], inplace=True) path = os.path.join(d, 'data_raw', 'nmrs', fns[2]) df_2 = pd.read_csv(path, sep='\t', header=None, names=['PPM', 'SIG', 'x']) df_2.drop(columns=['x'], inplace=True) dmso_sig_0 = df_0.loc[(df_0.PPM > 3) & (df_0.PPM < 3.2)].SIG.max() dmso_sig_1 = df_1.loc[(df_1.PPM > 3) & (df_1.PPM < 3.2)].SIG.max() dmso_sig_2 = df_2.loc[(df_2.PPM > 3) & (df_2.PPM < 3.2)].SIG.max() df_0 = scale_nmr(df_0, 'SIG', dmso_sig_0) df_1 = scale_nmr(df_1, 'SIG', dmso_sig_1) df_2 = scale_nmr(df_2, 'SIG', dmso_sig_2) fig = plt.figure(figsize=(10, 5)) plt.tight_layout() gs = GridSpec(2, 4) gs.update(hspace=0.3) gs.update(wspace=0.5) ax0 = plt.subplot(gs[0:2, 0:2]) ax1 = plt.subplot(gs[0, 2:4]) ax2 = plt.subplot(gs[1, 2:4]) axes = [ax0, ax1, ax2] xranges = [[8.1, 0.1], [4.6, 3.6], [6.3, 5.3]] xlims_for_ymax = [[5, 6.5], [4.6, 3.6], [5.5, 5]] for tick in range(3): ax = axes[tick] ax.plot(df_0.PPM, df_0.SIG, lw=2, color='blue', alpha=0.5, label='5 min reacted') ax.plot(df_1.PPM, df_1.SIG, lw=2, color='red', alpha=0.5, label='25 min reacted') ax.plot(df_2.PPM, df_2.SIG, lw=2, color='brown', alpha=0.5, label='2 hr reacted') ymax = choose_ymax_nmr_subplot(df_0, 'PPM', xlims_for_ymax[tick]) ax.set_xlim(xranges[tick][0], xranges[tick][1]) ax.set_ylim(bottom=ymax * -0.02, top=ymax) if tick > 0: rect = patches.Rectangle((xranges[tick][0], -0.02), xranges[tick][1] - xranges[tick][0], ymax*1.2, linewidth=1, edgecolor='0.25', facecolor='0.8', alpha=0.2) ax0.add_patch(rect) ax0.legend(loc='upper center', ncol=3, bbox_to_anchor=(1.1, 1.1), fontsize=12, frameon=False) ax0.set_ylabel('Intensity') # add the relevant labels for species # butenedial: ax0.text(6.05, 10, r'\textbf{BD, a}', fontsize=10) ax0.plot([6, 6], [6, 9], lw=1, color='0.25') ax0.text(7.1, 30, r'\textbf{BD, b}', fontsize=10) # products: # ax0.text(5.75, 4, 'accretion\nproducts', fontsize=10) # add in the leftover molecules ax0.text(5.6, 40, 'HDO', fontsize=10) ax0.text(3.05, 40, 'DMS', fontsize=10) ax0.text(2.15, 15, 'HAc', fontsize=10) ax0.text(4.2, 18, 'MeOH', fontsize=10) ax2.text(6.7, -1.3, 'Chemical Shift (ppm)', fontsize=16) ax0.set_ylabel('Intensity', fontsize=16) fig_path = create_fig_path('bdoh_nmr_spectrum') plt.savefig(fig_path, bbox_inches='tight', dpi=300, transparent=True) # comparative plot of bd/nhx and bd/oh fns = ['20200724_bd_as_nmr.csv', '20210126_bdohph11_5min.csv'] d = get_project_directory() path = os.path.join(d, 'data_raw', 'nmrs', fns[0]) df_0 = pd.read_csv(path, sep='\t', header=None, names=['PPM', 'SIG', 'x']) df_0.drop(columns=['x'], inplace=True) path = os.path.join(d, 'data_raw', 'nmrs', fns[1]) df_1 = pd.read_csv(path, sep='\t', header=None, names=['PPM', 'SIG', 'x']) df_1.drop(columns=['x'], inplace=True) dmso_sig_0 = df_0.loc[(df_0.PPM > 3) & (df_0.PPM < 3.2)].SIG.max() dmso_sig_1 = df_1.loc[(df_1.PPM > 3) & (df_1.PPM < 3.2)].SIG.max() df_0 = scale_nmr(df_0, 'SIG', dmso_sig_0) df_1 = scale_nmr(df_1, 'SIG', dmso_sig_1) fig = plt.figure(figsize=(10, 5)) plt.tight_layout() gs = GridSpec(2, 4) gs.update(hspace=0.5) gs.update(wspace=0.5) ax0 = plt.subplot(gs[0, :], ) ax1 = plt.subplot(gs[1, 0:3]) ax2 = plt.subplot(gs[1, 3:4]) axes = [ax0, ax1, ax2] xranges = [[8.1, 1.1], [7, 5], [3.5, 3.25]] xlims_for_ymax = [[3, 3.2], [3.2, 4.2], [5.5, 6]] for tick in range(3): ax = axes[tick] ax.plot(df_0.PPM, df_0.SIG, lw=2, color='blue', alpha=0.5, label='10 min reacted') ax.plot(df_1.PPM, df_1.SIG, lw=2, color='red', alpha=0.5, label='120 min reacted') ymax = choose_ymax_nmr_subplot(df_0, 'PPM', xlims_for_ymax[tick]) ax.set_xlim(xranges[tick][0], xranges[tick][1]) ax.set_ylim(bottom=ymax * -0.02, top=ymax) if tick > 0: rect = patches.Rectangle((min(xranges[tick]), ymax * -0.02), max(xranges[tick]) - min(xranges[tick]), ymax, linewidth=1, edgecolor='0.25', facecolor='0.8', alpha=0.2) ax0.add_patch(rect) ax0.legend(loc='upper center', ncol=2, bbox_to_anchor=(0.5, 1.3), fontsize=12, frameon=False) ax1.text(6, -15, 'Chemical Shift (ppm)', fontsize=16) ax0.set_ylabel('Intensity', fontsize=16) ax1.set_ylabel('Intensity', fontsize=16) # add the relevant labels for species # butenedial: ax0.text(5.9, 60, r'\textbf{BD}', fontsize=10) ax0.text(6.2, 90, r'\textbf{BD}', fontsize=10) # pyrrolinone: ax1.text(6.7, 7, r'\textbf{PR, h}', fontsize=10) ax1.text(5.8, 20, 'PR, g', fontsize=10) ax1.plot([5.9, 5.8], [8, 19], lw=1, color='0.25') ax2.text(3.38, 25, 'PR,\nf', fontsize=10) ax2.vlines(3.37, 16, 23, lw=1, color='0.25') # butenedial-pyrrolinone dimer: ax1.text(5.67, 14, r'\textbf{BD-PR,}', fontsize=10) ax1.text(5.67, 11, r'\textbf{j}', fontsize=10) ax1.text(5.45, 9, 'k', fontsize=10) ax1.text(6.1, 18, 'BD-PR,', fontsize=10) ax1.text(6., 15, 'n', fontsize=10) ax1.text(6.08, 12, 'm', fontsize=10) ax1.text(6.45, 15, 'BD-PR,\nl', fontsize=10) ax1.vlines(6.3, 6, 16, lw=1, color='0.25') ax1.vlines(6.05, 5, 11, lw=1, color='0.25') ax1.vlines(5.97, 6, 14, lw=1, color='0.25') ax2.text(3.49, 16, 'BD-PR,\ni', fontsize=10) # add in the leftover molecules ax0.text(5.15, 100, 'HDO', fontsize=10) ax0.text(3.42, 100, 'DMS', fontsize=10) ax0.text(2.1, 45, 'HAc', fontsize=10) ax0.text(1.5, 15, 'MPA', fontsize=10) ax2.text(3.38, 48, 'MeOH', fontsize=10) fig_path = create_fig_path('bdnhx_bdoh_nmr_spectrum') plt.savefig(fig_path, bbox_inches='tight', dpi=300, transparent=True) # 6: plots of the mass spec data # load the data project_dir = get_project_directory() solution_file_name = '20210126_solution.txt' background_file_name = '20210126_solution_background.txt' data_path = os.path.join(project_dir, 'data_raw', 'ms_files', solution_file_name) solution_df = pd.read_fwf(data_path, header=None) data_path = os.path.join(project_dir, 'data_raw', 'ms_files', background_file_name) background_df = pd.read_fwf(data_path, header=None) # do some small data treatment solution_df.columns = ['MZ', 'SIG'] background_df.columns = ['MZ', 'SIG'] solution_df.dropna(inplace=True) background_df.dropna(inplace=True) background_df.MZ = background_df.MZ.astype(float) solution_df.MZ = solution_df.MZ.astype(float) solution_df['BKGD_SUB_SIG'] = solution_df.SIG - background_df.SIG solution_df = solution_df.round(0) solution_df = solution_df.groupby(solution_df.MZ).sum().reset_index() # group by integer mz units peg6_fragments = [45, 89, 133, 151, 177, 195, 221, 239, 283, 301] # plot of total spectrum fig = plt.figure(figsize=(10, 5)) plt.tight_layout() gs = GridSpec(2, 6) gs.update(hspace=0.3) gs.update(wspace=1.2) ax = plt.subplot(gs[0, :], ) ax1 = plt.subplot(gs[1, 0:2]) ax2 = plt.subplot(gs[1, 2:5]) ax3 = plt.subplot(gs[1, 5:6]) axes = [ax, ax1, ax2, ax3] ax.stem(solution_df.MZ, solution_df.SIG, linefmt='0.8', markerfmt='None', use_line_collection=True, basefmt='k') ax.stem(solution_df.MZ, solution_df.BKGD_SUB_SIG, linefmt='0.3', markerfmt='None', use_line_collection=True, basefmt='k') ax.plot([-1, -1], [-5, -5], c='0.8', label='Raw signal') ax.plot([-1, -1], [-5, -5], c='0.3', label='Background subtracted signal') ax.set_xlim(20, 400) ax.set_ylim(-5000, 100000) ax.set_xticklabels(ax.get_xticks()) labels = [str(int(float(item.get_text()))) for item in ax.get_xticklabels()] ax.set_xticklabels(labels) ax.set_yticklabels(ax.get_yticks()) labels = [str(int(float(item.get_text()))) for item in ax.get_yticklabels()] ax.set_yticklabels(labels) ax.set_ylabel('Intensity') for peg6_fragment in peg6_fragments: if peg6_fragment is 283: ax.text(peg6_fragment - 3, 5000 + solution_df.SIG[solution_df.MZ == peg6_fragment], '* PEG-6', fontsize=14) else: ax.text(peg6_fragment - 3, 5000 + solution_df.SIG[solution_df.MZ == peg6_fragment], '*', fontsize=14) ax.text(78, 80000, '(a)', color='0.5', fontsize=16) ax.text(143, 80000, '(b)', color='0.5', fontsize=16) ax.text(163, 80000, '(c)', color='0.5', fontsize=16) ax.legend(loc='upper center', ncol=2, bbox_to_anchor=(0.5, 1.3), fontsize=12, frameon=False) ax1.stem(solution_df.MZ, solution_df.SIG, linefmt='0.8', markerfmt='None', use_line_collection=True, basefmt='k') ax1.stem(solution_df.MZ, solution_df.BKGD_SUB_SIG, linefmt='0.4', markerfmt='None', use_line_collection=True, basefmt='k') ax1.set_xlim(83.5, 85.5) ax1.set_ylim(-1000, 70000) ax1.set_yticklabels(ax1.get_yticks()) labels = [str(int(float(item.get_text()))) for item in ax1.get_yticklabels()] ax1.set_yticklabels(labels) ax1.set_xticklabels(ax1.get_xticks()) labels = [str(int(float(item.get_text()))) for item in ax1.get_xticklabels()] ax1.set_xticklabels(labels) ax1.text(84.15, 55000, 'PR', fontsize=14) ax1.text(84.9, 30000, 'BD', fontsize=14) ax1.text(83.6, 60000, '(a)', color='0.5', fontsize=16) ax1.set_ylabel('Intensity') ax2.stem(solution_df.MZ, solution_df.SIG, linefmt='0.8', markerfmt='None', use_line_collection=True, basefmt='k') ax2.stem(solution_df.MZ, solution_df.BKGD_SUB_SIG, linefmt='0.4', markerfmt='None', use_line_collection=True, basefmt='k') ax2.set_xlim(148.5, 151.5) ax2.set_ylim(-500, 20000) ax2.set_yticklabels(ax2.get_yticks()) labels = [str(int(float(item.get_text()))) for item in ax2.get_yticklabels()] ax2.set_yticklabels(labels) ax2.set_xticklabels(ax2.get_xticks()) labels = [str(int(float(item.get_text()))) for item in ax2.get_xticklabels()] ax2.set_xticklabels(labels) ax2.text(148.7, 5000, 'DZ', fontsize=14) ax2.text(149.7, 13000, 'BD-PR', fontsize=14) ax2.text(150.95, 10000, '*', fontsize=14) ax2.text(148.6, 17000, '(b)', color='0.5', fontsize=16) ax3.stem(solution_df.MZ, solution_df.SIG, linefmt='0.8', markerfmt='None', use_line_collection=True, basefmt='k') ax3.stem(solution_df.MZ, solution_df.BKGD_SUB_SIG, linefmt='0.4', markerfmt='None', use_line_collection=True, basefmt='k') ax3.set_xlim(167.5, 168.5) ax3.set_ylim(-500, 20000) ax3.set_yticklabels(ax3.get_yticks()) labels = [str(int(float(item.get_text()))) for item in ax3.get_yticklabels()] ax3.set_yticklabels(labels) ax3.xaxis.set_major_locator(ticker.MultipleLocator(base=1)) ax3.set_xticklabels(ax3.get_xticks()) labels = [str(int(float(item.get_text()))) for item in ax3.get_xticklabels()] ax3.set_xticklabels(labels) ax3.text(167.55, 6000, 'BD-PR', fontsize=14) ax3.text(167.6, 17000, '(c)', color='0.5', fontsize=16) ax2.text(148.3, -8000, 'mass-to-charge ratio') # xlabel fig_path = create_fig_path('solution_mass_spec') plt.savefig(fig_path, bbox_inches='tight', dpi=300, transparent=False) # 7: plots of the bd degradation data expt_labels = ['bdph8_nmr', 'bdph9_nmr', 'bdph10_nmr', 'bdph11_nmr'] fig, (ax0, ax1, ax2, ax3) = plt.subplots(1, 4, figsize=(9, 2.5)) axes = [ax0, ax1, ax2, ax3] plt.tight_layout() for tick in range(4): ax = axes[tick] expt_label = expt_labels[tick] fn = expts[expt_label]['paths']['processed_data'] df_processed = import_treated_csv_data(fn, expt_label) fn = expts[expt_label]['paths']['modeled_data'] df_modeled = import_treated_csv_data(fn, expt_label) df_model_params = import_treated_csv_data(expts[expt_label]['paths']['model_parameters_data'], expt_label) title = round(np.mean(df_processed.pH), 1) if title >= 10: title = 'pH ' + str(title)[:4] elif title < 10: title = 'pH ' + str(title)[:3] ax.plot(df_modeled['MINS_ELAPSED'], df_modeled['M_BUTENEDIAL'], color='0.25', lw=3, label='Model Fit') ax.fill_between(df_modeled['MINS_ELAPSED'], df_modeled['M_BUTENEDIAL_MIN'], df_modeled['M_BUTENEDIAL_MAX'], color='0.8', label='95\% Confidence Interval') ax.scatter(df_processed['MINS_ELAPSED'], df_processed['M_BUTENEDIAL'], color='0.25', s=30, label='Observation') k = 1000*df_model_params['k'][0]/60 # s ax.text(2, 0.02, 'k = ' + str(k)[0:4] + r'$\times$10$^{-3}$ s$^{-1}$', fontsize=10) ax.set_title(title) # formatting bottom, top = ax.get_ylim() ax.set_ylim(ymin=0, ymax=0.25) # increase ymax of all other plots ax.set_yticklabels(ax.get_yticks()) ylabels = [str(round(float(item.get_text()), 2)) for item in ax.get_yticklabels()] ax.set_yticklabels(ylabels) ax.set_xlabel('mins') # add xlabel only for the bottom plots ax.set_xlim(0, 30) ax.set_xticklabels(ax.get_xticks()) labels = [str(round(float(item.get_text()))) for item in ax.get_xticklabels()] ax.set_xticklabels(labels) ax0.set_ylabel('[BD] (M)') ax1.legend(fancybox=False, loc='upper center', ncol=3, bbox_to_anchor=(1.25, 1.5), fontsize=12) fig_path = create_fig_path('_'.join(expt_labels)) # save path plt.savefig(fig_path, bbox_inches='tight', dpi=300, transparent=False) ks_avg = [] phs_avg = [] for expt_label in expt_labels: # extract the fitted ks and phs from the experiments df_model_params = import_treated_csv_data(expts[expt_label]['paths']['model_parameters_data'], expt_label) df_processed = import_treated_csv_data(expts[expt_label]['paths']['processed_data'], expt_label) ks_avg.append(df_model_params.k[0] / 60) # convert to seconds phs_avg.append(df_processed['pH'].mean()) ohs_avg = [10 ** (-14 + x) for x in phs_avg] # convert from ph to [oh-] # produce the disproportionation empirical fitting (k = f(ph) from the modeled datasets def disproportionation(oh, ai, aii, aiii): """disproportionation rate law from Fratzke, 1986""" return (ai * oh + aii * oh * oh) / (1 + aiii * oh) a, acov = curve_fit(disproportionation, ohs_avg, ks_avg, p0=(1, 1, 1), bounds=([0, 0, 0], [10000, 1000, 100000000])) # 8: summary figure plot of butenedial sinks phs = np.linspace(3, 11.03, 300) nhxs = np.logspace(-4, 2, 300) x, y = np.meshgrid(nhxs, phs, sparse=True) pr_rates = np.empty([len(nhxs), len(phs)]) hca_rates = np.empty([len(nhxs), len(phs)]) dep_rates = np.empty([len(nhxs), len(phs)]) expt_label = 'bdnhph5_nmr' bdasnmr_params = import_treated_csv_data(expts[expt_label]['paths']['model_parameters_data'], expt_label) expt_label = 'bdph9_nmr' bdohnmr_params = import_treated_csv_data(expts[expt_label]['paths']['model_parameters_data'], expt_label) # obtain estimates of first-order loss terms for comparison, plot with rgb for tick in range(len(phs)): ph = phs[tick] hp = 10**-ph oh = 1e-14 / hp for tock in range(len(nhxs)): nhx = nhxs[tock] nh3 = nhx * (1 + hp / 10**(-9.25)) ** (-1) nh4 = nhx * (1 + 10**(-9.25) / hp) ** (-1) hca_rates[tick, tock] = disproportionation(oh, a[0], a[1], a[2]) * 60 pr_rates[tick, tock] = bdasnmr_params.k6[0] * nh3 dep_rates[tick, tock] = 1 / (7 * 24 *