input
stringlengths
2.65k
237k
output
stringclasses
1 value
in runs_where_y_has_same_sign_as_yaxis] elif self.xaxis_mode == 'log': for curve_name in self.curves.keys(): if self.curves[curve_name].yaxis == yaxis: where_xy_have_same_sign_as_axes = np.where(np.logical_and(self.curves[curve_name].data_x * self.xaxis_sign > 0., self.curves[curve_name].data_y * self.yaxes[yaxis].yaxis_sign > 0.))[0] runs_where_xy_have_same_sign_as_axes = np.split(where_xy_have_same_sign_as_axes, np.where(np.diff(where_xy_have_same_sign_as_axes) != 1)[0] + 1) self.curves[curve_name].points_x = [self.xaxis_sign * np.log10(self.xaxis_sign * self.curves[curve_name].data_x[run]) for run in runs_where_xy_have_same_sign_as_axes] self.curves[curve_name].points_y = [self.yaxes[yaxis].yaxis_sign * np.log10(self.yaxes[yaxis].yaxis_sign * self.curves[curve_name].data_y[run]) for run in runs_where_xy_have_same_sign_as_axes] if args[0][0] < args[0][1]: self.yaxes[yaxis].ylim[0] = self.yaxes[yaxis].yaxis_sign * math.log10(self.yaxes[yaxis].yaxis_sign * args[0][0]) self.yaxes[yaxis].ylim[1] = self.yaxes[yaxis].yaxis_sign * math.log10(self.yaxes[yaxis].yaxis_sign * args[0][1]) else: self.yaxes[yaxis].ylim[0] = self.yaxes[yaxis].yaxis_sign * math.log10(self.yaxes[yaxis].yaxis_sign * args[0][1]) self.yaxes[yaxis].ylim[1] = self.yaxes[yaxis].yaxis_sign * math.log10(self.yaxes[yaxis].yaxis_sign * args[0][0]) elif len(args[0]) < 2: raise IndexError('did not specify both a lower and an upper limit for the y-axis') else: raise IndexError('more than two limits were specified for the y-axis') else: raise ValueError("invalid y-limits specification; it must be 'auto', 'tight', or a list of limits") self.refresh_plot() def svg(self, filename): self.svg_backend() self.svg_file = codecs.open(filename, encoding = 'utf-8', mode = 'w') self.svg_file.write(u'<svg xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" width="{width!s}px" height="{height!s}px" viewBox="0 0 {width!s} {height!s}">\n'.format(width = self.canvas_width, height = self.canvas_height)) self.begin_group() self.draw_plot() self.end_group() self.svg_file.write(u'</svg>\n') self.svg_file.close() self.svg_file = None self.tk_backend() def zoom_to_fit(self, **kwargs): mode = kwargs.get('mode', 'auto') if mode not in ('auto', 'tight'): raise ValueError("if specified, mode must be 'auto' or 'tight'") yaxis = kwargs.get('yaxis', 'all') if (yaxis != 'all') and (yaxis not in self.yaxes.keys()): raise ValueError('specified y-axis does not exist') self.xlimits_mode = mode if yaxis == 'all': for yaxis in self.yaxes.keys(): self.yaxes[yaxis].ylimits_mode = mode else: self.yaxes[yaxis].ylimits_mode = mode self.refresh_plot() def zoom_in(self, **kwargs): factor = kwargs.get('factor', math.sqrt(2)) yaxis = kwargs.get('yaxis', 'all') if (yaxis != 'all') and (yaxis not in self.yaxes.keys()): raise ValueError('specified y-axis does not exist') cx = kwargs.get('cx', 0.5 * (self.axes_left + self.axes_right)) cy = kwargs.get('cy', 0.5 * (self.axes_top + self.axes_bottom)) x = self.from_canvas_x(cx) self.xlimits_mode = 'manual' self.xlim[0] = x - 0.5 * self.xrange / factor self.xlim[1] = x + 0.5 * self.xrange / factor if yaxis == 'all': for yaxis in self.yaxes.keys(): y = self.from_canvas_y(cy, yaxis) self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] = y - 0.5 * self.yaxes[yaxis].yrange / factor self.yaxes[yaxis].ylim[1] = y + 0.5 * self.yaxes[yaxis].yrange / factor else: y = self.from_canvas_y(cy, yaxis) self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] = y - 0.5 * self.yaxes[yaxis].yrange / factor self.yaxes[yaxis].ylim[1] = y + 0.5 * self.yaxes[yaxis].yrange / factor self.refresh_plot() def zoom_in_x(self, **kwargs): factor = kwargs.get('factor', math.sqrt(2)) cx = kwargs.get('cx', 0.5 * (self.axes_left + self.axes_right)) x = self.from_canvas_x(cx) self.xlimits_mode = 'manual' self.xlim[0] = x - 0.5 * self.xrange / factor self.xlim[1] = x + 0.5 * self.xrange / factor self.refresh_plot() def zoom_in_y(self, **kwargs): factor = kwargs.get('factor', math.sqrt(2)) yaxis = kwargs.get('yaxis', 'all') if (yaxis != 'all') and (yaxis not in self.yaxes.keys()): raise ValueError('specified y-axis does not exist') cy = kwargs.get('cy', 0.5 * (self.axes_top + self.axes_bottom)) if yaxis == 'all': for yaxis in self.yaxes.keys(): y = self.from_canvas_y(cy, yaxis) self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] = y - 0.5 * self.yaxes[yaxis].yrange / factor self.yaxes[yaxis].ylim[1] = y + 0.5 * self.yaxes[yaxis].yrange / factor else: y = self.from_canvas_y(cy, yaxis) self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] = y - 0.5 * self.yaxes[yaxis].yrange / factor self.yaxes[yaxis].ylim[1] = y + 0.5 * self.yaxes[yaxis].yrange / factor self.refresh_plot() def zoom_out(self, **kwargs): factor = kwargs.get('factor', math.sqrt(2)) yaxis = kwargs.get('yaxis', 'all') if (yaxis != 'all') and (yaxis not in self.yaxes.keys()): raise ValueError('specified y-axis does not exist') cx = kwargs.get('cx', 0.5 * (self.axes_left + self.axes_right)) cy = kwargs.get('cy', 0.5 * (self.axes_top + self.axes_bottom)) x = self.from_canvas_x(cx) self.xlimits_mode = 'manual' self.xlim[0] = x - 0.5 * self.xrange * factor self.xlim[1] = x + 0.5 * self.xrange * factor if yaxis == 'all': for yaxis in self.yaxes.keys(): y = self.from_canvas_y(cy, yaxis) self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] = y - 0.5 * self.yaxes[yaxis].yrange * factor self.yaxes[yaxis].ylim[1] = y + 0.5 * self.yaxes[yaxis].yrange * factor else: y = self.from_canvas_y(cy, yaxis) self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] = y - 0.5 * self.yaxes[yaxis].yrange * factor self.yaxes[yaxis].ylim[1] = y + 0.5 * self.yaxes[yaxis].yrange * factor self.refresh_plot() def zoom_out_x(self, **kwargs): factor = kwargs.get('factor', math.sqrt(2)) cx = kwargs.get('cx', 0.5 * (self.axes_left + self.axes_right)) x = self.from_canvas_x(cx) self.xlimits_mode = 'manual' self.xlim[0] = x - 0.5 * self.xrange * factor self.xlim[1] = x + 0.5 * self.xrange * factor self.refresh_plot() def zoom_out_y(self, **kwargs): factor = kwargs.get('factor', math.sqrt(2)) yaxis = kwargs.get('yaxis', 'all') if (yaxis != 'all') and (yaxis not in self.yaxes.keys()): raise ValueError('specified y-axis does not exist') cy = kwargs.get('cy', 0.5 * (self.axes_top + self.axes_bottom)) if yaxis == 'all': for yaxis in self.yaxes.keys(): y = self.from_canvas_y(cy, yaxis) self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] = y - 0.5 * self.yaxes[yaxis].yrange * factor self.yaxes[yaxis].ylim[1] = y + 0.5 * self.yaxes[yaxis].yrange * factor else: y = self.from_canvas_y(cy, yaxis) self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] = y - 0.5 * self.yaxes[yaxis].yrange * factor self.yaxes[yaxis].ylim[1] = y + 0.5 * self.yaxes[yaxis].yrange * factor self.refresh_plot() def zoom_rect(self, *args, **kwargs): left = kwargs.get('left', self.axes_left) right = kwargs.get('right', self.axes_right) top = kwargs.get('top', self.axes_top) bottom = kwargs.get('bottom', self.axes_bottom) yaxis = kwargs.get('yaxis', 'all') if (yaxis != 'all') and (yaxis not in self.yaxes.keys()): raise ValueError('specified y-axis does not exist') if len(args) == 1: if (type(args[0]) is list) and (len(args[0]) == 4): left = float(args[0][0]) right = float(args[0][2]) top = float(args[0][1]) bottom = float(args[0][3]) else: raise ValueError('if specified, the optional argument must be a four-element list specifying the left, top, right, and bottom coordinates of the zoom rectangle') elif len(args) > 1: raise IndexError('too many arguments supplied to zoom_rect') if (left < right) and (top < bottom): self.xlimits_mode = 'manual' self.xlim[0], self.xlim[1] = self.from_canvas_x(left), self.from_canvas_x(right) if yaxis == 'all': for yaxis in self.yaxes.keys(): self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0], self.yaxes[yaxis].ylim[1] = self.from_canvas_y(bottom, yaxis), self.from_canvas_y(top, yaxis) else: self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0], self.yaxes[yaxis].ylim[1] = self.from_canvas_y(bottom, yaxis), self.from_canvas_y(top, yaxis) self.refresh_plot() def pan_left(self, **kwargs): fraction = kwargs.get('fraction', 0.1) self.xlimits_mode = 'manual' self.xlim[0] -= fraction * self.xrange self.xlim[1] -= fraction * self.xrange self.refresh_plot() def pan_right(self, **kwargs): fraction = kwargs.get('fraction', 0.1) self.xlimits_mode = 'manual' self.xlim[0] += fraction * self.xrange self.xlim[1] += fraction * self.xrange self.refresh_plot() def pan_up(self, **kwargs): fraction = kwargs.get('fraction', 0.1) yaxis = kwargs.get('yaxis', 'all') if (yaxis != 'all') and (yaxis not in self.yaxes.keys()): raise ValueError('specified y-axis does not exist') if yaxis == 'all': for yaxis in self.yaxes.keys(): self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] += fraction * self.yaxes[yaxis].yrange self.yaxes[yaxis].ylim[1] += fraction * self.yaxes[yaxis].yrange else: self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] += fraction * self.yaxes[yaxis].yrange self.yaxes[yaxis].ylim[1] += fraction * self.yaxes[yaxis].yrange self.refresh_plot() def pan_down(self, **kwargs): fraction = kwargs.get('fraction', 0.1) yaxis = kwargs.get('yaxis', 'all') if (yaxis != 'all') and (yaxis not in self.yaxes.keys()): raise ValueError('specified y-axis does not exist') if yaxis == 'all': for yaxis in self.yaxes.keys(): self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] -= fraction * self.yaxes[yaxis].yrange self.yaxes[yaxis].ylim[1] -= fraction * self.yaxes[yaxis].yrange else: self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] -= fraction * self.yaxes[yaxis].yrange self.yaxes[yaxis].ylim[1] -= fraction * self.yaxes[yaxis].yrange self.refresh_plot() def pan(self, **kwargs): dx = kwargs.get('dx', 0.) dy = kwargs.get('dy', 0.) yaxis = kwargs.get('yaxis', 'all') if (yaxis != 'all') and (yaxis not in self.yaxes.keys()): raise ValueError('specified y-axis does not exist') if (dx != 0.) or (dy != 0.): self.xlimits_mode = 'manual' self.xlim[0] -= dx * self.x_epsilon self.xlim[1] -= dx * self.x_epsilon if yaxis == 'all': for yaxis in self.yaxes.keys(): self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] += dy * self.yaxes[yaxis].y_epsilon self.yaxes[yaxis].ylim[1] += dy * self.yaxes[yaxis].y_epsilon else: self.yaxes[yaxis].ylimits_mode = 'manual' self.yaxes[yaxis].ylim[0] += dy * self.yaxes[yaxis].y_epsilon self.yaxes[yaxis].ylim[1] += dy * self.yaxes[yaxis].y_epsilon self.refresh_plot() def delete_curve(self, name): if name in self.curves: del(self.curves[name]) else: raise NameError('no curve exists with name = {0!r}'.format(name)) self.refresh_plot() def configure_curve(self, name, **kwargs): style = kwargs.get('style', '') if name in self.curves: marker_color = kwargs.get('marker_color', self.curves[name].marker_color) marker = kwargs.get('marker', self.curves[name].marker) curve_color = kwargs.get('curve_color', self.curves[name].curve_color) curve_style = kwargs.get('curve_style', self.curves[name].curve_style) if style == '': self.curves[name].marker_color = marker_color self.curves[name].marker = marker self.curves[name].curve_color = curve_color self.curves[name].curve_style = curve_style else: [self.curves[name].marker_color, self.curves[name].marker, self.curves[name].curve_color, self.curves[name].curve_style] = self.parse_style(style) else: raise NameError('no curve exists with name = {0!r}'.format(name)) self.refresh_plot() def bindings(self): self.key_bindings() self.mouse_bindings() def key_bindings(self): self.canvas.bind('<Up>', lambda event: self.pan_up()) self.canvas.bind('<Down>', lambda event: self.pan_down()) self.canvas.bind('<Left>', lambda event: self.pan_left()) self.canvas.bind('<Right>', lambda event: self.pan_right()) self.canvas.bind('<Control-Up>', lambda event: self.pan_up(fraction = 0.5)) self.canvas.bind('<Control-Down>', lambda event: self.pan_down(fraction = 0.5)) self.canvas.bind('<Control-Left>', lambda event: self.pan_left(fraction = 0.5)) self.canvas.bind('<Control-Right>', lambda event: self.pan_right(fraction = 0.5)) self.canvas.bind('<Shift-Up>', lambda event: self.pan_up(fraction = 1. / self.axes_height))
properties for the resource. :type tags: dict[str, str] :param kind: Required. The kind of the environment.Constant filled by server. Possible values include: "Gen1", "Gen2". :type kind: str or ~azure.mgmt.timeseriesinsights.models.EnvironmentKind :param sku: Required. The sku determines the type of environment, either Gen1 (S1 or S2) or Gen2 (L1). For Gen1 environments the sku determines the capacity of the environment, the ingress rate, and the billing rate. :type sku: ~azure.mgmt.timeseriesinsights.models.Sku """ _validation = { 'location': {'required': True}, 'kind': {'required': True}, 'sku': {'required': True}, } _attribute_map = { 'location': {'key': 'location', 'type': 'str'}, 'tags': {'key': 'tags', 'type': '{str}'}, 'kind': {'key': 'kind', 'type': 'str'}, 'sku': {'key': 'sku', 'type': 'Sku'}, } _subtype_map = { 'kind': {'Gen1': 'Gen1EnvironmentCreateOrUpdateParameters', 'Gen2': 'Gen2EnvironmentCreateOrUpdateParameters'} } def __init__( self, *, location: str, sku: "Sku", tags: Optional[Dict[str, str]] = None, **kwargs ): super(EnvironmentCreateOrUpdateParameters, self).__init__(location=location, tags=tags, **kwargs) self.kind = 'EnvironmentCreateOrUpdateParameters' # type: str self.sku = sku class EnvironmentListResponse(msrest.serialization.Model): """The response of the List Environments operation. :param value: Result of the List Environments operation. :type value: list[~azure.mgmt.timeseriesinsights.models.EnvironmentResource] """ _attribute_map = { 'value': {'key': 'value', 'type': '[EnvironmentResource]'}, } def __init__( self, *, value: Optional[List["EnvironmentResource"]] = None, **kwargs ): super(EnvironmentListResponse, self).__init__(**kwargs) self.value = value class TrackedResource(Resource): """Time Series Insights resource that is tracked by Azure Resource Manager. Variables are only populated by the server, and will be ignored when sending a request. All required parameters must be populated in order to send to Azure. :ivar id: Resource Id. :vartype id: str :ivar name: Resource name. :vartype name: str :ivar type: Resource type. :vartype type: str :param location: Required. Resource location. :type location: str :param tags: A set of tags. Resource tags. :type tags: dict[str, str] """ _validation = { 'id': {'readonly': True}, 'name': {'readonly': True}, 'type': {'readonly': True}, 'location': {'required': True}, } _attribute_map = { 'id': {'key': 'id', 'type': 'str'}, 'name': {'key': 'name', 'type': 'str'}, 'type': {'key': 'type', 'type': 'str'}, 'location': {'key': 'location', 'type': 'str'}, 'tags': {'key': 'tags', 'type': '{str}'}, } def __init__( self, *, location: str, tags: Optional[Dict[str, str]] = None, **kwargs ): super(TrackedResource, self).__init__(**kwargs) self.location = location self.tags = tags class EnvironmentResource(TrackedResource): """An environment is a set of time-series data available for query, and is the top level Azure Time Series Insights resource. You probably want to use the sub-classes and not this class directly. Known sub-classes are: Gen1EnvironmentResource, Gen2EnvironmentResource. Variables are only populated by the server, and will be ignored when sending a request. All required parameters must be populated in order to send to Azure. :ivar id: Resource Id. :vartype id: str :ivar name: Resource name. :vartype name: str :ivar type: Resource type. :vartype type: str :param location: Required. Resource location. :type location: str :param tags: A set of tags. Resource tags. :type tags: dict[str, str] :param sku: Required. The sku determines the type of environment, either Gen1 (S1 or S2) or Gen2 (L1). For Gen1 environments the sku determines the capacity of the environment, the ingress rate, and the billing rate. :type sku: ~azure.mgmt.timeseriesinsights.models.Sku :param kind: Required. The kind of the environment.Constant filled by server. Possible values include: "Gen1", "Gen2". :type kind: str or ~azure.mgmt.timeseriesinsights.models.EnvironmentResourceKind """ _validation = { 'id': {'readonly': True}, 'name': {'readonly': True}, 'type': {'readonly': True}, 'location': {'required': True}, 'sku': {'required': True}, 'kind': {'required': True}, } _attribute_map = { 'id': {'key': 'id', 'type': 'str'}, 'name': {'key': 'name', 'type': 'str'}, 'type': {'key': 'type', 'type': 'str'}, 'location': {'key': 'location', 'type': 'str'}, 'tags': {'key': 'tags', 'type': '{str}'}, 'sku': {'key': 'sku', 'type': 'Sku'}, 'kind': {'key': 'kind', 'type': 'str'}, } _subtype_map = { 'kind': {'Gen1': 'Gen1EnvironmentResource', 'Gen2': 'Gen2EnvironmentResource'} } def __init__( self, *, location: str, sku: "Sku", tags: Optional[Dict[str, str]] = None, **kwargs ): super(EnvironmentResource, self).__init__(location=location, tags=tags, **kwargs) self.sku = sku self.kind = 'EnvironmentResource' # type: str class EnvironmentResourceProperties(ResourceProperties): """Properties of the environment. Variables are only populated by the server, and will be ignored when sending a request. :ivar provisioning_state: Provisioning state of the resource. Possible values include: "Accepted", "Creating", "Updating", "Succeeded", "Failed", "Deleting". :vartype provisioning_state: str or ~azure.mgmt.timeseriesinsights.models.ProvisioningState :ivar creation_time: The time the resource was created. :vartype creation_time: ~datetime.datetime :ivar data_access_id: An id used to access the environment data, e.g. to query the environment's events or upload reference data for the environment. :vartype data_access_id: str :ivar data_access_fqdn: The fully qualified domain name used to access the environment data, e.g. to query the environment's events or upload reference data for the environment. :vartype data_access_fqdn: str :ivar status: An object that represents the status of the environment, and its internal state in the Time Series Insights service. :vartype status: ~azure.mgmt.timeseriesinsights.models.EnvironmentStatus """ _validation = { 'provisioning_state': {'readonly': True}, 'creation_time': {'readonly': True}, 'data_access_id': {'readonly': True}, 'data_access_fqdn': {'readonly': True}, 'status': {'readonly': True}, } _attribute_map = { 'provisioning_state': {'key': 'provisioningState', 'type': 'str'}, 'creation_time': {'key': 'creationTime', 'type': 'iso-8601'}, 'data_access_id': {'key': 'dataAccessId', 'type': 'str'}, 'data_access_fqdn': {'key': 'dataAccessFqdn', 'type': 'str'}, 'status': {'key': 'status', 'type': 'EnvironmentStatus'}, } def __init__( self, **kwargs ): super(EnvironmentResourceProperties, self).__init__(**kwargs) self.data_access_id = None self.data_access_fqdn = None self.status = None class EnvironmentStateDetails(msrest.serialization.Model): """An object that contains the details about an environment's state. :param code: Contains the code that represents the reason of an environment being in a particular state. Can be used to programmatically handle specific cases. :type code: str :param message: A message that describes the state in detail. :type message: str """ _attribute_map = { 'code': {'key': 'code', 'type': 'str'}, 'message': {'key': 'message', 'type': 'str'}, } def __init__( self, *, code: Optional[str] = None, message: Optional[str] = None, **kwargs ): super(EnvironmentStateDetails, self).__init__(**kwargs) self.code = code self.message = message class EnvironmentStatus(msrest.serialization.Model): """An object that represents the status of the environment, and its internal state in the Time Series Insights service. Variables are only populated by the server, and will be ignored when sending a request. :ivar ingress: An object that represents the status of ingress on an environment. :vartype ingress: ~azure.mgmt.timeseriesinsights.models.IngressEnvironmentStatus :ivar warm_storage: An object that represents the status of warm storage on an environment. :vartype warm_storage: ~azure.mgmt.timeseriesinsights.models.WarmStorageEnvironmentStatus """ _validation = { 'ingress': {'readonly': True}, 'warm_storage': {'readonly': True}, } _attribute_map = { 'ingress': {'key': 'ingress', 'type': 'IngressEnvironmentStatus'}, 'warm_storage': {'key': 'warmStorage', 'type': 'WarmStorageEnvironmentStatus'}, } def __init__( self, **kwargs ): super(EnvironmentStatus, self).__init__(**kwargs) self.ingress = None self.warm_storage = None class EnvironmentUpdateParameters(msrest.serialization.Model): """Parameters supplied to the Update Environment operation. :param tags: A set of tags. Key-value pairs of additional properties for the environment. :type tags: dict[str, str] """ _attribute_map = { 'tags': {'key': 'tags', 'type': '{str}'}, } def __init__( self, *, tags: Optional[Dict[str, str]] = None, **kwargs ): super(EnvironmentUpdateParameters, self).__init__(**kwargs) self.tags = tags class EventHubEventSourceCommonProperties(AzureEventSourceProperties): """Properties of the EventHub event source. Variables are only populated by the server, and will be ignored when sending a request. All required parameters must be populated in order to send to Azure. :ivar provisioning_state: Provisioning state of the resource. Possible values include: "Accepted", "Creating", "Updating", "Succeeded", "Failed", "Deleting". :vartype provisioning_state: str or ~azure.mgmt.timeseriesinsights.models.ProvisioningState :ivar creation_time: The time the resource was created. :vartype creation_time: ~datetime.datetime :param timestamp_property_name: The event property that will be used as the event source's timestamp. If a value isn't specified for timestampPropertyName, or if null or empty-string is specified, the event creation time will be used. :type timestamp_property_name: str :param event_source_resource_id: Required. The resource id of the event source in Azure Resource Manager. :type event_source_resource_id: str :param service_bus_namespace: Required. The name of the service bus that contains the event hub. :type service_bus_namespace: str :param event_hub_name: Required. The name of the event hub. :type event_hub_name: str :param consumer_group_name: Required. The name of the event hub's consumer group that holds the partitions from which events will be read. :type consumer_group_name: str :param key_name: Required. The name of the SAS key that grants the Time Series Insights service access to the event hub. The shared access policies for this key must grant 'Listen' permissions to the event hub. :type key_name: str """ _validation = { 'provisioning_state': {'readonly': True}, 'creation_time': {'readonly': True}, 'event_source_resource_id': {'required': True}, 'service_bus_namespace': {'required': True}, 'event_hub_name': {'required': True}, 'consumer_group_name': {'required': True}, 'key_name': {'required':
""" <Program Name> repository_lib.py <Author> <NAME> <<EMAIL>> <Started> June 1, 2014 <Copyright> See LICENSE for licensing information. <Purpose> Provide a library for the repository tool that can create a TUF repository. The repository tool can be used with the Python interpreter in interactive mode, or imported directly into a Python module. See 'tuf/README' for the complete guide to using 'tuf.repository_tool.py'. """ # Help with Python 3 compatibility, where the print statement is a function, an # implicit relative import is invalid, and the '/' operator performs true # division. Example: print 'hello world' raises a 'SyntaxError' exception. from __future__ import print_function from __future__ import absolute_import from __future__ import division from __future__ import unicode_literals import os import errno import sys import time import datetime import getpass import logging import tempfile import shutil import json import gzip import random import tuf import tuf.formats import tuf.util import tuf.keydb import tuf.roledb import tuf.keys import tuf.sig import tuf.log import tuf.conf import tuf._vendor.iso8601 as iso8601 import tuf._vendor.six as six # See 'log.py' to learn how logging is handled in TUF. logger = logging.getLogger('tuf.repository_lib') # Recommended RSA key sizes: # http://www.emc.com/emc-plus/rsa-labs/historical/twirl-and-rsa-key-size.htm#table1 # According to the document above, revised May 6, 2003, RSA keys of # size 3072 provide security through 2031 and beyond. 2048-bit keys # are the recommended minimum and are good from the present through 2030. DEFAULT_RSA_KEY_BITS = 3072 # The extension of TUF metadata. METADATA_EXTENSION = '.json' # The targets and metadata directory names. Metadata files are written # to the staged metadata directory instead of the "live" one. METADATA_STAGED_DIRECTORY_NAME = 'metadata.staged' METADATA_DIRECTORY_NAME = 'metadata' TARGETS_DIRECTORY_NAME = 'targets' # The metadata filenames of the top-level roles. ROOT_FILENAME = 'root' + METADATA_EXTENSION TARGETS_FILENAME = 'targets' + METADATA_EXTENSION SNAPSHOT_FILENAME = 'snapshot' + METADATA_EXTENSION TIMESTAMP_FILENAME = 'timestamp' + METADATA_EXTENSION # Log warning when metadata expires in n days, or less. # root = 1 month, snapshot = 1 day, targets = 10 days, timestamp = 1 day. ROOT_EXPIRES_WARN_SECONDS = 2630000 SNAPSHOT_EXPIRES_WARN_SECONDS = 86400 TARGETS_EXPIRES_WARN_SECONDS = 864000 TIMESTAMP_EXPIRES_WARN_SECONDS = 86400 # Supported key types. SUPPORTED_KEY_TYPES = ['rsa', 'ed25519'] # The recognized compression extensions. SUPPORTED_COMPRESSION_EXTENSIONS = ['.gz'] # The full list of supported TUF metadata extensions. METADATA_EXTENSIONS = ['.json', '.json.gz'] def _generate_and_write_metadata(rolename, metadata_filename, write_partial, targets_directory, metadata_directory, consistent_snapshot=False, filenames=None): """ Non-public function that can generate and write the metadata of the specified top-level 'rolename'. It also increments version numbers if: 1. write_partial==True and the metadata is the first to be written. 2. write_partial=False (i.e., write()), the metadata was not loaded as partially written, and a write_partial is not needed. """ metadata = None # Retrieve the roleinfo of 'rolename' to extract the needed metadata # attributes, such as version number, expiration, etc. roleinfo = tuf.roledb.get_roleinfo(rolename) snapshot_compressions = tuf.roledb.get_roleinfo('snapshot')['compressions'] # Generate the appropriate role metadata for 'rolename'. if rolename == 'root': metadata = generate_root_metadata(roleinfo['version'], roleinfo['expires'], consistent_snapshot) _log_warning_if_expires_soon(ROOT_FILENAME, roleinfo['expires'], ROOT_EXPIRES_WARN_SECONDS) # Check for the Targets role, including delegated roles. elif rolename.startswith('targets'): metadata = generate_targets_metadata(targets_directory, roleinfo['paths'], roleinfo['version'], roleinfo['expires'], roleinfo['delegations'], consistent_snapshot) if rolename == 'targets': _log_warning_if_expires_soon(TARGETS_FILENAME, roleinfo['expires'], TARGETS_EXPIRES_WARN_SECONDS) elif rolename == 'snapshot': root_filename = filenames['root'] targets_filename = filenames['targets'] metadata = generate_snapshot_metadata(metadata_directory, roleinfo['version'], roleinfo['expires'], root_filename, targets_filename, consistent_snapshot) _log_warning_if_expires_soon(SNAPSHOT_FILENAME, roleinfo['expires'], SNAPSHOT_EXPIRES_WARN_SECONDS) elif rolename == 'timestamp': snapshot_filename = filenames['snapshot'] metadata = generate_timestamp_metadata(snapshot_filename, roleinfo['version'], roleinfo['expires'], snapshot_compressions) _log_warning_if_expires_soon(TIMESTAMP_FILENAME, roleinfo['expires'], TIMESTAMP_EXPIRES_WARN_SECONDS) signable = sign_metadata(metadata, roleinfo['signing_keyids'], metadata_filename) # Check if the version number of 'rolename' may be automatically incremented, # depending on whether if partial metadata is loaded or if the metadata is # written with write() / write_partial(). # Increment the version number if this is the first partial write. if write_partial: temp_signable = sign_metadata(metadata, [], metadata_filename) temp_signable['signatures'].extend(roleinfo['signatures']) status = tuf.sig.get_signature_status(temp_signable, rolename) if len(status['good_sigs']) == 0: metadata['version'] = metadata['version'] + 1 signable = sign_metadata(metadata, roleinfo['signing_keyids'], metadata_filename) # non-partial write() else: if tuf.sig.verify(signable, rolename) and not roleinfo['partial_loaded']: metadata['version'] = metadata['version'] + 1 signable = sign_metadata(metadata, roleinfo['signing_keyids'], metadata_filename) # Write the metadata to file if contains a threshold of signatures. signable['signatures'].extend(roleinfo['signatures']) if tuf.sig.verify(signable, rolename) or write_partial: _remove_invalid_and_duplicate_signatures(signable) compressions = roleinfo['compressions'] filename = write_metadata_file(signable, metadata_filename, compressions, consistent_snapshot) # The root and timestamp files should also be written without a digest if # 'consistent_snaptshots' is True. Client may request a timestamp and root # file without knowing its digest and file size. if rolename == 'root' or rolename == 'timestamp': write_metadata_file(signable, metadata_filename, compressions, consistent_snapshot=False) # 'signable' contains an invalid threshold of signatures. else: message = 'Not enough signatures for ' + repr(metadata_filename) raise tuf.UnsignedMetadataError(message, signable) return signable, filename def _prompt(message, result_type=str): """ Non-public function that prompts the user for input by loging 'message', converting the input to 'result_type', and returning the value to the caller. """ return result_type(six.moves.input(message)) def _get_password(prompt='Password: ', confirm=False): """ Non-public function that returns the password entered by the user. If 'confirm' is True, the user is asked to enter the previously entered password once again. If they match, the password is returned to the caller. """ while True: # getpass() prompts the user for a password without echoing # the user input. password = getpass.getpass(prompt, sys.stderr) if not confirm: return password password2 = getpass.getpass('Confirm: ', sys.stderr) if password == password2: return password else: print('Mismatch; try again.') def _metadata_is_partially_loaded(rolename, signable, roleinfo): """ Non-public function that determines whether 'rolename' is loaded with at least zero good signatures, but an insufficient threshold (which means 'rolename' was written to disk with repository.write_partial()). A repository maintainer may write partial metadata without including a valid signature. Howerver, the final repository.write() must include a threshold number of signatures. If 'rolename' is found to be partially loaded, mark it as partially loaded in its 'tuf.roledb' roleinfo. This function exists to assist in deciding whether a role's version number should be incremented when write() or write_parital() is called. Return True if 'rolename' was partially loaded, False otherwise. """ # The signature status lists the number of good signatures, including # bad, untrusted, unknown, etc. status = tuf.sig.get_signature_status(signable, rolename) if len(status['good_sigs']) < status['threshold'] and \ len(status['good_sigs']) >= 0: return True else: return False def _check_directory(directory): """ <Purpose> Non-public function that ensures 'directory' is valid and it exists. This is not a security check, but a way for the caller to determine the cause of an invalid directory provided by the user. If the directory argument is valid, it is returned normalized and as an absolute path. <Arguments> directory: The directory to check. <Exceptions> tuf.Error, if 'directory' could not be validated. tuf.FormatError, if 'directory' is not properly formatted. <Side Effects> None. <Returns> The normalized absolutized path of 'directory'. """ # Does 'directory' have the correct format? # Raise 'tuf.FormatError' if there is a mismatch. tuf.formats.PATH_SCHEMA.check_match(directory) # Check if the directory exists. if not os.path.isdir(directory): raise tuf.Error(repr(directory) + ' directory does not exist.') directory = os.path.abspath(directory) return directory def _check_role_keys(rolename): """ Non-public function that verifies the public and signing keys of 'rolename'. If either contain an invalid threshold of keys, raise an exception. 'rolename' is the full rolename (e.g., 'targets/unclaimed/django'). """ # Extract the total number of public and private keys of 'rolename' from its # roleinfo in 'tuf.roledb'. roleinfo = tuf.roledb.get_roleinfo(rolename) total_keyids = len(roleinfo['keyids']) threshold = roleinfo['threshold'] total_signatures = len(roleinfo['signatures']) total_signing_keys = len(roleinfo['signing_keyids']) # Raise an exception for an invalid threshold of public keys. if total_keyids < threshold: message = repr(rolename) + ' role contains ' + \ repr(total_keyids) + ' / ' + repr(threshold) + ' public keys.' raise tuf.InsufficientKeysError(message) # Raise an exception for an invalid threshold of signing keys. if total_signatures == 0 and total_signing_keys < threshold: message = repr(rolename) + ' role contains ' + \ repr(total_signing_keys) + ' / ' + repr(threshold) + ' signing keys.' raise tuf.InsufficientKeysError(message) def _remove_invalid_and_duplicate_signatures(signable): """ Non-public function that removes invalid signatures from 'signable'. 'signable' may contain signatures (invalid) from previous versions of the metadata that were loaded with load_repository(). Invalid, or duplicate signatures are removed from 'signable'. """ # Store the keyids of valid signatures. 'signature_keyids' is checked # for duplicates rather than comparing signature objects because PSS may # generate duplicate valid signatures of the same data, yet contain different # signatures. signature_keyids
codes, indices = ret else: codes, indices, values = ret self.update_self_loop_bonus(values) codes = self.unpack_x(codes, enc_len) indices = self.unpack_x(indices, enc_len) self._log_code_usage(indices, criterion) if self.needs_global_info: codes = (codes * fc) + bias if needs_transpose: codes = codes.transpose(-1, dim) indices = indices.transpose(-1, dim) kl = (torch .empty(indices.shape, device=codes.device) .fill_(torch.log(torch.tensor(self.embedding.weight.size(0), dtype=torch.float32)))) if self.log_input_norms: norms = torch.norm(codes.view(-1, codes.size(-1)).contiguous(), dim=1) logger.log_scalar('vq_input_norms_post_bottle/mean', torch.mean(norms)) logger.log_scalar('vq_input_norms_post_bottle/std', torch.std(norms)) if criterion != 'segmental': return codes, kl, {'indices': indices, 'embeddings': codes.detach(), 'pre_bn_acts': x.transpose(-1, dim)} else: return codes, kl, {'indices': indices, 'segmental_values': values, 'embeddings': codes.detach(), 'pre_bn_acts': x.transpose(-1, dim)} def _log_code_usage(self, indices, criterion): if not logger.is_currently_logging(): return num_tokens = self.embedding.weight.size(0) code_freqs = torch.histc( indices.float(), bins=num_tokens, min=-0.5, max=num_tokens - 0.5 ).float() count = np.prod(indices.size()) if criterion != 'sparse': assert code_freqs.sum().item() == count code_freqs /= count entropy = distributions.Categorical(code_freqs).entropy() logger.log_scalar("vq_code_usage_frac", entropy.item() / np.log(num_tokens)) def get_greedy_hmm_matrices(self): proto_weights = self.embedding.weight N = proto_weights.shape[0] neg_inf = -1e20 # Greedy matrix creation # state 0 is starting, state n + 1 refers to token N # each state has N outgoing edges states_mat = torch.arange( 0, N + 1, dtype=torch.int64).view(1, N + 1).repeat((N + 1, 1)).unsqueeze(0) ilabels_mat = (states_mat.transpose(1, 2) - 1).clamp(0, N) weights_mat = torch.zeros_like(states_mat, dtype=torch.float) weights_mat[0, 0, :] = neg_inf terminal_mat = torch.zeros((N + 1, 1), dtype=torch.float32).unsqueeze(0) terminal_mat[0, 0] = neg_inf return [ states_mat, ilabels_mat, weights_mat, terminal_mat ] def update_self_loop_bonus(self, values): self_loop_bonus = ( values[-1] - values[-self.self_loop_bonus_reestimation_num_merges - 1] ) / self.self_loop_bonus_reestimation_num_merges self.self_loop_bonus_estimate *= ( self.self_loop_bonus_reestimation_smoothing) self.self_loop_bonus_estimate += ( (1.0 - self.self_loop_bonus_reestimation_smoothing) * self_loop_bonus ) logger.log_scalar('self_loop_bonus', self_loop_bonus) logger.log_scalar('smooth_self_loop_bonus', self.self_loop_bonus_estimate) # print(f"SL_bonus: {self_loop_bonus} smooth: {self.self_loop_bonus_estimate}") def quantize_hmm_segmental(self, x, x_lens=None): from distsup.modules import fst_utils self.greedy_hmm_matrices = [m.to(x.device) for m in self.greedy_hmm_matrices] (states_mat, ilabels_mat, weights_mat, terminal_mat ) = self.greedy_hmm_matrices weights_mat_seg = weights_mat + torch.diag( torch.empty(weights_mat.size(-1), device=weights_mat.device ).fill_(self.self_loop_bonus_estimate)) seg_mats = [ states_mat, ilabels_mat, weights_mat_seg, terminal_mat ] proto_weights = self.embedding.weight log_probs = -torch.cdist(x.detach().reshape(-1, proto_weights.shape[1]), proto_weights) log_probs = log_probs.view(x.shape[:-1] + (-1,)).requires_grad_(True) if x_lens is None: x_lens = torch.empty( log_probs.shape[0], dtype=torch.int64).fill_(log_probs.shape[1]) with torch.enable_grad(): loss = fst_utils.path_reduction( log_probs, x_lens, seg_mats, red_kind='viterbi',) loss.sum().backward() _, seg_idx = torch.max(log_probs.grad, dim=-1) quantized = self.embedding(seg_idx) seg_idx.unsqueeze_(-1) num_segments = float((np.diff(seg_idx.view(seg_idx.shape[:2]).cpu().numpy(), axis=1) != 0).sum()) logger.log_scalar('hmm_segment_frac', num_segments / float(x_lens.sum())) print(f"HMM segmenter self loop bonus {self.self_loop_bonus_estimate} " f"num segments: {num_segments}, ratio {num_segments / float(x_lens.sum())}") return quantized, seg_idx class VQBottleneckSparse(VQBottleneck): def __init__(self, in_dim, latent_dim, num_tokens, dim=-1, commitment=0.25, criterion_kwargs={}, use_copy_through=False): super(VQBottleneckSparse, self).__init__(in_dim, latent_dim, num_tokens, dim=dim, commitment=commitment, criterion='sparse', criterion_kwargs=criterion_kwargs, use_copy_through=use_copy_through) class VQBottleneckSegmental(VQBottleneck): def __init__(self, in_dim, latent_dim, num_tokens, dim=-1, commitment=0.25, criterion_kwargs={}, use_copy_through=False): super(VQBottleneckSegmental, self).__init__(in_dim, latent_dim, num_tokens, dim=dim, commitment=commitment, criterion='segmental', criterion_kwargs=criterion_kwargs, use_copy_through=use_copy_through) class VQBottleneckNearest(VQBottleneck): def __init__(self, in_dim, latent_dim, num_tokens, dim=-1, commitment=0.25, use_copy_through=False): super(VQBottleneckNearest, self).__init__(in_dim, latent_dim, num_tokens, dim=dim, commitment=commitment, criterion='nearest', use_copy_through=use_copy_through) class IndicesComputation(object): @staticmethod def nearest(inputs, codebook, temperature=None): with torch.no_grad(): # inputs: NxD # codebook: KxD # NxK distances_matrix = torch.cdist(inputs, codebook) # Nx1 if temperature is None: indices = torch.min(distances_matrix, dim=-1)[1].unsqueeze(1) else: probs = F.softmax(-distances_matrix / temperature, dim=-1) m = torch.distributions.Categorical(probs) indices = m.sample() return indices @staticmethod def segmental(inputs, codebook, segment_frac=0.1, segment_threshold=None): from distsup.modules.segment import calc distances_matrix = torch.cdist(inputs, codebook) indices, values = calc(distances_matrix, inputs.shape[0] * segment_frac, threshold=segment_threshold) indices = torch.from_numpy(indices).to(device=inputs.device).unsqueeze(1) return indices, values class VectorQuantization(Function): @staticmethod def flatten(x): code_dim = x.size(-1) return x.view(-1, code_dim) @staticmethod def restore_shapes(codes, indices, target_shape): idx_shape = list(target_shape) idx_shape[-1] = 1 return codes.view(*target_shape), indices.view(*idx_shape) @staticmethod def forward(ctx, inputs, codebook, commitment=0.25, criterion='nearest', criterion_kwargs={}, use_copy_through=False): inputs_flat = VectorQuantization.flatten(inputs) compute_indices = getattr(IndicesComputation, criterion) indices = compute_indices(inputs_flat, codebook, **criterion_kwargs) if type(indices) is tuple: indices, values = indices codes = codebook[indices.view(-1), :] codes, indices = VectorQuantization.restore_shapes( codes, indices, inputs.shape) ctx.save_for_backward(codes, inputs, torch.FloatTensor([commitment]), codebook, indices, torch.tensor([use_copy_through])) ctx.mark_non_differentiable(indices) if criterion != 'segmental': return codes, indices else: return codes, indices, torch.tensor(values) @staticmethod def backward(ctx, straight_through, unused_indices, unused_values=None): (codes, inputs, beta, codebook, indices, use_copy_through ) = ctx.saved_tensors # TODO: figure out proper vq loss reduction vq_loss = F.mse_loss(inputs, codes).detach() logger.log_scalar('vqlayer_loss', vq_loss) # gradient of vq_loss diff = 2 * (inputs - codes) / inputs.numel() commitment = beta.item() * diff if use_copy_through.item(): code_disp = VectorQuantization.flatten(-diff + straight_through) else: code_disp = VectorQuantization.flatten(-diff) indices = VectorQuantization.flatten(indices) code_disp = (torch .zeros_like(codebook) .index_add_(0, indices.view(-1), code_disp)) return straight_through + commitment, code_disp, None, None, None, None quantize = VectorQuantization.apply class SparseVectorQuantization(Function): @staticmethod def sparse(x, K): vec_len = torch.norm(x, dim=-1) _, idx = torch.sort(vec_len, descending=True) ret = torch.zeros_like(vec_len) ret[idx[:K]] = 1.0 return ret, idx[K:], idx[:K] @staticmethod def restore_shapes(codes, indices, indices_weight, target_shape): idx_shape = list(target_shape) idx_shape[-1] = 1 return codes.view(*target_shape), indices.view(*idx_shape), indices_weight.view(*idx_shape) @staticmethod def forward(ctx, inputs, codebook, commitment=0.25, criterion_kwargs={}): ratio = criterion_kwargs.pop('sparse_ratio', 0.2) assert len(criterion_kwargs) == 0, ( f"unknown criterion_kwargs: {criterion_kwargs.keys()}") inputs_flat = VectorQuantization.flatten(inputs) indices = IndicesComputation.nearest(inputs_flat, codebook) K = int(inputs.numel() / inputs.size(-1) * ratio) indices_weight, removed_indices, remain_indices = SparseVectorQuantization.sparse(inputs_flat, K) codes = codebook[indices.view(-1), :] * indices_weight.unsqueeze(-1) codes, indices, indices_weight = SparseVectorQuantization.restore_shapes( codes, indices, indices_weight, inputs.shape) indices = indices * indices_weight.long() - (1 - indices_weight).long() ctx.save_for_backward(codes, inputs, torch.FloatTensor([commitment]), codebook, indices, indices_weight, remain_indices) ctx.mark_non_differentiable(indices) ctx.mark_non_differentiable(indices_weight) return codes, indices @staticmethod def backward(ctx, straight_through, unused_indices): codes, inputs, beta, codebook, indices, indices_weight, remain_indices = ctx.saved_tensors # TODO: figure out proper vq loss reduction vq_loss = F.mse_loss(inputs, codes).detach() logger.log_scalar('vqlayer_loss', vq_loss) #diff = 2 * (inputs * indices_weight - codes) / indices_weight.sum() / inputs.size(-1) diff = 2 * (inputs - codes) / inputs.numel() commitment = beta.item() * diff code_disp = VectorQuantization.flatten(-diff) indices = indices.view(-1)[remain_indices] code_disp = code_disp[remain_indices] code_disp = (torch .zeros_like(codebook) .index_add_(0, indices, code_disp)) #return straight_through * indices_weight + commitment, code_disp, None, None return straight_through + commitment, code_disp, None, None, None sparse_quantize = SparseVectorQuantization.apply class SOMBottleneck(nn.Module): def __init__(self, in_dim, latent_dim, num_tokens, dim=-1, commitment=0.32, som_loss_mult=1.2, prob_loss_mult=1.2, smoothness_loss_mult=1.4): super(SOMBottleneck, self).__init__() assert isinstance(num_tokens, list) # num_tokens is a list in this case of the form: [5, 5] self.num_tokens = num_tokens self.latent_dim = latent_dim # total number of embeddings (multiply elements of the token list) num_embeddings = np.prod(num_tokens) # The codebook self.embedding = nn.Embedding(num_embeddings, latent_dim) nn.init.xavier_uniform_(self.embedding.weight) # transition probabilities in the discrete space # p(z_q_t | z_q_t-1) self.trans = nn.Linear(self.latent_dim, num_embeddings) # Linear projection from encoder output to embedding space self.projection = nn.Linear(in_dim, latent_dim) self.dim = dim self.commitment = commitment self.som_loss_mutl = som_loss_mult self.smoothness_loss_mult = smoothness_loss_mult self.prob_loss_mult = prob_loss_mult def loss_z_prob(self, z_q, z_dist_flat): """Computes the smoothness loss for the transitions given their probabilities.""" # z_dist : bsz, time, .. # k: bsz, time # aggregate loss over all sequences bsz = z_q.size(0) time = z_q.size(1) z_q_old = torch.cat([z_q[:, 0:1], z_q[:, :-1]], dim=1) out_probabilities_old = F.softmax(self.trans(z_q_old), dim=-1).contiguous().view(bsz * time, -1) weighted_z_dist_prob = z_dist_flat * out_probabilities_old weighted_z_dist_prob = torch.mean(weighted_z_dist_prob) return weighted_z_dist_prob def loss_probabilities(self, z_q, k): # z_q: bsz*time, latent_dim z_q = z_q.contiguous().view(z_q.size(0), z_q.size(1), -1) z_q_old = torch.cat([z_q[:, 0:1], z_q[:, :-1]], dim=1) logits = self.trans(z_q_old) loss_p = F.cross_entropy(logits.contiguous().view(-1, logits.size(-1)), k.contiguous().view(-1)) return loss_p def z_q_ne(self, z_q, k, codebook): k_1 = k // self.num_tokens[1] k_2 = k % self.num_tokens[1] device = z_q.device.type batch_size = z_q.size(0) k1_not_top = torch.lt(k_1, self.num_tokens[0] - 1) k1_not_bottom = torch.gt(k_1, 0) k2_not_right = torch.lt(k_2, self.num_tokens[1] - 1) k2_not_left = torch.gt(k_2, 0) k1_up = torch.where(k1_not_top, torch.add(k_1, 1), k_1) k1_down = torch.where(k1_not_bottom, torch.sub(k_1, 1), k_1) k2_right = torch.where(k2_not_right, torch.add(k_2, 1), k_2) k2_left = torch.where(k2_not_left, torch.sub(k_2, 1), k_2) z_q_up = torch.where(k1_not_top.unsqueeze(-1), codebook[k1_up * self.num_tokens[1] + k_2], torch.zeros(batch_size, self.latent_dim).to(device)) z_q_down = torch.where(k1_not_bottom.unsqueeze(-1), codebook[k1_down * self.num_tokens[1] + k_2], torch.zeros(batch_size, self.latent_dim).to(device)) z_q_right = torch.where(k2_not_right.unsqueeze(-1), codebook[k_1 * self.num_tokens[1] + k2_right], torch.zeros(batch_size, self.latent_dim).to(device)) z_q_left = torch.where(k2_not_left.unsqueeze(-1), codebook[k_1 * self.num_tokens[1] + k2_left], torch.zeros(batch_size, self.latent_dim).to(device)) z_q_neighbors = torch.stack([z_q, z_q_up, z_q_down, z_q_right, z_q_left], dim=1) return z_q_neighbors def forward(self, x): inp_shape = x.shape[:-1] dim = self.dim needs_transpose = dim != -1 or dim != x.dim() - 1 if needs_transpose: x = x.transpose(-1, dim).contiguous() # flatten x x = x.contiguous().view(-1, x.size(-1)) # project to latent space z_e = self.projection(x) # compute distance between encodings and each of the embeddings # ze: N X D, codebook: K x D z_dist_flat = torch.cdist(z_e, self.embedding.weight) # z_dist_flat = torch.sum((z_e.unsqueeze(1) - self.embedding.weight.unsqueeze(0)).pow(2), dim=-1) # ---- Picks the index of the closest embedding for every encoding ---- k = torch.argmin(z_dist_flat, dim=-1) # ---- Aggregates the respective closest embedding for every encoding ---- z_q = self.embedding.weight[k] # ---- Get neighbours ---- z_q_ne = self.z_q_ne(z_q, k, self.embedding.weight) if needs_transpose: z_q = z_q.transpose(-1, dim) z_q_ne = z_q_ne.transpose(-1, dim) k = k.contiguous().view(*inp_shape) loss = self.loss(z_e,
Residues Colored Table for NON bonded################################ NH_templist4graph=[] NH_graphdic1={} if bool(Adenin_graphdicNH): for k,v in Adenin_graphdicNH.iteritems(): #print k for value in v: NH_templist4graph.append(value) samp=sorted(list(set(NH_templist4graph))) NH_graphdic1.setdefault('%s'%k,[]).append(', '.join(samp)) #print temlist #print samp NH_templist4graph=[] length_listofcompiledresidues=[] for key,value in NH_graphdic1.iteritems(): for i in value: valu=i.split(', ') #print valu #print len(valu) length_listofcompiledresidues.append(len(valu)) length_ofcell=max(length_listofcompiledresidues) #print "<br/>" print "<p style='font-size:20px; color:brown'> Physicochemical property based color-coding of amino acids: non-bonded contacts","</p>" print "<table border='1'>" print "<tr>" print "<th col width='60'>Ligand Atoms</th>" print "<th colspan='%d'>List of residues from analysed protein structures</th>"% length_ofcell print "</tr>" for key in sorted(NH_graphdic1.iterkeys()): print "<td align='center'>%s</td>" %key for g1 in NH_graphdic1[key]: dat1= g1.split(', ') for NH_k3 in dat1: print "<td align='center'>" #print k3 if NH_k3.startswith(('ALA','ILE','LEU','MET','MSE','VAL')): print "<b><font color='pink'>%s</font></b>"%NH_k3 if NH_k3.startswith(('PHE','TRP', 'TYR')): print " <b><font color='orange'>%s</font></b>"%NH_k3 if NH_k3.startswith(('LYS','ARG', 'HIS')): print " <b><font color='red'>%s</font></b>"%NH_k3 if NH_k3.startswith(('GLU','ASP')): print " <b><font color='green'>%s</font></b>"%NH_k3 if NH_k3.startswith(('ASN','GLN','SER','THR')): print " <b><font color='blue'>%s</font></b>"%NH_k3 if NH_k3.startswith(('GLY','PRO')): print " <b><font color='magenta'>%s</font></b>"%NH_k3 if NH_k3.startswith(('CYS','CME')): print " <b><font color='yellow'>%s</font></b>"%NH_k3 print "</td>" #print "<tr>" print "</tr>" print "</table>" else: print "<p style='font-size:20px; color:brown'> Physicochemical property based color-coding of amino acids: non-bonded contacts","</p>" print "No Interactions" print """ </div> </div> """#closing of col-2-3 and module print """ <div class="col-2-3"> <div class="module"> """ if bool(Adenin_CommonH_Lig_Resdict): print "<p style='font-size:20px; color:brown'>List of common residues: hydrogen bonds contacts" ,"</p>" df_Adenin_CommonH_Lig_Resdict=pd.DataFrame.from_dict(Adenin_CommonH_Lig_Resdict).fillna('NIL') print (df_Adenin_CommonH_Lig_Resdict.to_html(justify='center')) #print pd.DataFrame.from_dict(Adenin_CommonH_Lig_Resdict).to_html(justify='center')#for common ligand atoms - hydrogen bonded else: print "<p style='font-size:20px; color:brown'>List of common residues: hydrogen bonds contacts" ,"</p>" print "<p> No Common Interactions</p>" ####################Common Residues Colored Table for Adenin : H bonded################################ CommH_templist4graph=[] CommH_graphdic1={} if bool(Adenin_common_graphdicH): for k,v in Adenin_common_graphdicH.iteritems(): for value in v: CommH_templist4graph.append(value) samp=sorted(list(set(CommH_templist4graph))) CommH_graphdic1.setdefault('%s'%k,[]).append(', '.join(samp)) CommH_templist4graph=[] length_listofcompiled_Common_residues=[] for key,value in CommH_graphdic1.iteritems(): for i in value: valu=i.split(', ') length_listofcompiled_Common_residues.append(len(valu)) length_ofcell=max(length_listofcompiled_Common_residues) #print "<br/>" print "<p style='font-size:20px; color:brown'> Physicochemical property based color-coding of common amino acids: hydrogen bonds contacts ","</p>" print "<table border='1'>" print "<tr>" print "<th col width='60'>Ligand Atoms</th>" print "<th colspan='%d'>List of common residues from analysed protein structures</th>"% length_ofcell print "</tr>" for key in sorted(CommH_graphdic1.iterkeys()): print "<td align='center'>%s</td>" %key for g1 in CommH_graphdic1[key]: dat1= g1.split(', ') for H_k3 in dat1: print "<td align='center'>" #print k3 if H_k3.startswith(('ALA','ILE','LEU','MET','MSE','VAL')): print "<b><font color='pink'>%s</font></b>"%H_k3 if H_k3.startswith(('PHE','TRP', 'TYR')): print " <b><font color='orange'>%s</font></b>"%H_k3 if H_k3.startswith(('LYS','ARG', 'HIS')): print " <b><font color='red'>%s</font></b>"%H_k3 if H_k3.startswith(('GLU','ASP')): print " <b><font color='green'>%s</font></b>"%H_k3 if H_k3.startswith(('ASN','GLN','SER','THR')): print " <b><font color='blue'>%s</font></b>"%H_k3 if H_k3.startswith(('GLY','PRO')): print " <b><font color='magenta'>%s</font></b>"%H_k3 if H_k3.startswith(('CYS','CME')): print " <b><font color='yellow'>%s</font></b>"%H_k3 print "</td>" #print "<tr>" print "</tr>" print "</table>" else: print "<p style='font-size:20px; color:brown'> Physicochemical property based color-coding of common amino acids: hydrogen bonds contacts ","</p>" print "<p> No Common Atoms Identified</p>" if bool(Adenin_CommonNH_Lig_Resdict): print "<p style='font-size:20px; color:brown'>List of common residues: non-bonded contacts","</p>" df_Adenin_CommonNH_Lig_Resdict=pd.DataFrame.from_dict(Adenin_CommonNH_Lig_Resdict).fillna('NIL') print (df_Adenin_CommonNH_Lig_Resdict.to_html(justify='center')) #print pd.DataFrame.from_dict(Adenin_CommonNH_Lig_Resdict).to_html(justify='center')#for Common ligand atoms - Non hydrogen bonded else: print "<p style='font-size:20px; color:brown'>List of common residues: non-bonded contacts","</p>" print "No Interactions" ####################Common Residues Colored Table for Adenin: NON bonded################################ CommNH_templist4graph=[] CommNH_graphdic1={} if bool(Adenin_common_graphdicNH): for k,v in Adenin_common_graphdicNH.iteritems(): #print k for value in v: CommNH_templist4graph.append(value) samp=sorted(list(set(CommNH_templist4graph))) CommNH_graphdic1.setdefault('%s'%k,[]).append(', '.join(samp)) CommNH_templist4graph=[] length_listofcompile_Common_dresidues=[] for key,value in CommNH_graphdic1.iteritems(): for i in value: valu=i.split(', ') length_listofcompiled_Common_residues.append(len(valu)) length_ofcell=max(length_listofcompiled_Common_residues) print "<p style='font-size:20px; color:brown'> Physicochemical property based color-coding of common amino acids: non-bonded contacts","</p>" print "<table border='1'>" print "<tr>" print "<th col width='60'>Ligand Atoms</th>" print "<th colspan='%d'>List of common residues from analysed protein structures</th>"% length_ofcell print "</tr>" for key in sorted(CommNH_graphdic1.iterkeys()): print "<td align='center'>%s</td>" %key for g1 in CommNH_graphdic1[key]: dat1= g1.split(', ') for NH_k3 in dat1: print "<td align='center'>" #print k3 if NH_k3.startswith(('ALA','ILE','LEU','MET','MSE','VAL')): print "<b><font color='pink'>%s</font></b>"%NH_k3 if NH_k3.startswith(('PHE','TRP', 'TYR')): print " <b><font color='orange'>%s</font></b>"%NH_k3 if NH_k3.startswith(('LYS','ARG', 'HIS')): print " <b><font color='red'>%s</font></b>"%NH_k3 if NH_k3.startswith(('GLU','ASP')): print " <b><font color='green'>%s</font></b>"%NH_k3 if NH_k3.startswith(('ASN','GLN','SER','THR')): print " <b><font color='blue'>%s</font></b>"%NH_k3 if NH_k3.startswith(('GLY','PRO')): print " <b><font color='magenta'>%s</font></b>"%NH_k3 if NH_k3.startswith(('CYS','CME')): print " <b><font color='yellow'>%s</font></b>"%NH_k3 print "</td>" #print "<tr>" print "</tr>" print "</table>" else: print "<p style='font-size:20px; color:brown'> Physicochemical property based color-coding of common amino acids: non-bonded contacts","</p>" print "No Interactions" print """ </div> </div> """# closinf of column and module divi ###############Web logo for Common Residues Section: H bonding####################### print """ <div class="col-2-3"> <div class="module"> """ Adenin_graph_filename = str(uuid.uuid4()) Weblogo_dict_H={} Weblogo_dict_H1={} if bool(CommH_graphdic1): for key in sorted(CommH_graphdic1): for i in CommH_graphdic1[key]: tems=i.split(', ') for items in tems: se=re.split('([0-9])' , items) Weblogo_dict_H.setdefault('%s'%key,[]).append(se[0]) for m,n in Weblogo_dict_H.iteritems(): counted=dict(Counter(n)) Weblogo_dict_H1.setdefault('%s'%m,{}).update(counted) zipfilename='tmp/'+Adenin_graph_filename+'_Hbonding'+'.zip' Adenin_aminoacid_singlecode={} aminoacid_code={'CYS': 'C', 'ASP': 'D', 'SER': 'S', 'GLN': 'Q', 'LYS': 'K', 'ILE': 'I', 'PRO': 'P', 'THR': 'T', 'PHE': 'F', 'ASN': 'N', 'GLY': 'G', 'HIS': 'H', 'LEU': 'L', 'ARG': 'R', 'TRP': 'W', 'ALA': 'A', 'VAL':'V', 'GLU': 'E', 'TYR': 'Y', 'MET': 'M'} recoded={} for Adenin_ligand_key, Adenin_amino_frequency in Weblogo_dict_H1.iteritems(): #print ligand_key for i in Adenin_ligand_key: for Adenin_amino,Adenin_frequency in Adenin_amino_frequency.iteritems(): for Adenin_amino_3letter,Adenin_code_frequency in aminoacid_code.iteritems(): if Adenin_amino == Adenin_amino_3letter: recoded[Adenin_code_frequency]=Adenin_frequency Adenin_aminoacid_singlecode.setdefault('%s'%Adenin_ligand_key,{}).update(recoded) recoded={} Adenin_Frequency=1 instances=[] Adenin_weblogo_collection=[] for Adenin_ligand_key1, amino_frequency1 in Adenin_aminoacid_singlecode.iteritems(): for Adenin_Amino1, Adenin_number in amino_frequency1.iteritems(): Adenin_Frequency=1 while Adenin_Frequency <= Adenin_number: instances.append(Seq(Adenin_Amino1, IUPAC.protein)) Adenin_Frequency=Adenin_Frequency+1 Adenin_motif = motifs.create(instances) Adenin_mymotif ='tmp/'+ Adenin_graph_filename+ '_H_'+ Adenin_ligand_key1 +'.svg' Adenin_motif.weblogo('%s'%Adenin_mymotif,format='SVG',xaxis_label= '%s' %Adenin_ligand_key1,show_errorbars= False, color_scheme= 'color_chemistry') Adenin_weblogo_collection.append(Adenin_mymotif) instances=[] weblogo_images=' '.join(str(x) for x in Adenin_weblogo_collection) print "<p style='font-size:20px; color:brown'> Weblogo showing the frequency of residues binding to ligand atoms for the selected structures:</p>" print "<div class='weblogo_row'>" for Adenin_image in sorted(Adenin_weblogo_collection): print "<div class='weblogo_column'>" print "<embed src='%s#page=1&view=FitH ' />" %Adenin_image #print "<iframe src='%s#page=1&view=FitH ' width='200' height='100' border='0'></iframe>"%Adenin_image print "</div>" print "</div>" ####zip file with ZipFile('%s'%zipfilename, 'w') as Adenin_myzip: for Adenin_Images in Adenin_weblogo_collection: Adenin_myzip.write(Adenin_Images) else: print "<p style='font-size:20px; color:brown'> Weblogo for Common bonded Interactions:</p>" print "No Interactions" ###############Web logo for Common Residues Section: NON bonding####################### Weblogo_dict_NH={} Weblogo_dict_NH1={} if bool(CommNH_graphdic1): for key in sorted(CommNH_graphdic1): for i in CommNH_graphdic1[key]: tems=i.split(', ') for items in tems: se=re.split('([0-9])' , items) Weblogo_dict_NH.setdefault('%s'%key,[]).append(se[0]) for m,n in Weblogo_dict_NH.iteritems(): counted=dict(Counter(n)) Weblogo_dict_NH1.setdefault('%s'%m,{}).update(counted) zipfilename='tmp/'+Adenin_graph_filename+'_NHbonding'+'.zip' Adenin_aminoacid_singlecode={} recoded={} for Adenin_ligand_key, Adenin_amino_frequency in Weblogo_dict_NH1.iteritems(): #print ligand_key for i in Adenin_ligand_key: for Adenin_amino,Adenin_frequency in Adenin_amino_frequency.iteritems(): for Adenin_amino_3letter,Adenin_code_frequency in aminoacid_code.iteritems(): if Adenin_amino == Adenin_amino_3letter: recoded[Adenin_code_frequency]=Adenin_frequency Adenin_aminoacid_singlecode.setdefault('%s'%Adenin_ligand_key,{}).update(recoded) recoded={} Adenin_Frequency=1 instances=[] Adenin_weblogo_collection=[] for Adenin_ligand_key1, amino_frequency1 in Adenin_aminoacid_singlecode.iteritems(): for Adenin_Amino1, Adenin_number in amino_frequency1.iteritems(): Adenin_Frequency=1 while Adenin_Frequency <= Adenin_number: instances.append(Seq(Adenin_Amino1, IUPAC.protein)) Adenin_Frequency=Adenin_Frequency+1 Adenin_motif = motifs.create(instances) Adenin_mymotif ='tmp/'+ Adenin_graph_filename+ '_NH_'+ Adenin_ligand_key1 +'.svg' Adenin_motif.weblogo('%s'%Adenin_mymotif,format='SVG',xaxis_label= '%s' %Adenin_ligand_key1,show_errorbars= False, color_scheme= 'color_chemistry') Adenin_weblogo_collection.append(Adenin_mymotif) instances=[] weblogo_images=' '.join(str(x) for x in Adenin_weblogo_collection) print "<p style='font-size:20px; color:brown'> Weblogo showing the frequency of residues binding to ligand atoms for the selected structures:</p>" print "<div class='weblogo_row'>" #initiation of weblog_row for Adenin_image in sorted(Adenin_weblogo_collection): print "<div class='weblogo_column'>" #initiation of weblog_column print "<embed src='%s#page=1&view=FitH ' />" %Adenin_image #print "<iframe src='%s#page=1&view=FitH ' width='200' height='200' border='0'></iframe>"%Adenin_image print "</div>"#closing of weblog_column print "</div>"#closing of weblog_row ####zip file with ZipFile('%s'%zipfilename, 'w') as Adenin_myzip: for Adenin_Images in Adenin_weblogo_collection: Adenin_myzip.write(Adenin_Images) else: print "<p style='font-size:20px; color:brown'> Weblogo for Common Nonbonded Interactions:</p>" print "No Interactions" print """ </div> </div> </div> """ # closing of Adenin section ##################################################### print "<p align='center'>################################################################","</p>" print "<p style='font-size:20px; color:blue' align='center'>Ribose sub group structure","</p>" print '<p style=text-align:center>Download: <a href=%s download>All Bonded,</a>' % Ribose_allH print ' <a href=%s download>All Non-bonded,</a>' % Ribose_allNH print ' <a href=%s download>Common Bonded,</a>' % Ribose_CommonH print ' <a href=%s download>Common Non-bonded,</a>' % Ribose_CommonNH ,'</p>' print "<p align='center'>################################################################" ,"</p>" print "<button class='collapsible'>I. All bonded interactions - Click to read basic statistical information</button>"#Start of click drop down print "<div class='contentsection'>" print "<p style='font-size:20px; color:black' align='center'>" print " Number of Ligand atoms:", len(Ribose), "<br/>" print " Number of PDB IDs:", len(Ribose_allNH_Lig_Resdict.keys()), "<br/>" print "<div class='row'>"# spliting into two columns print "<div class='column'>"# spliting into two columns if bool(Ribose_allH_Lig_Resdict): print "Statistics of Bonded Intercations" print percentage(Ribose_allH_Lig_Resdict,Ribose) if bool(Ribose_allH_Lig_Resdict_distance): print distance_calc(Ribose_allH_Lig_Resdict_distance) print "</div>"# closing of first columns print "<div class='column'>" if bool(Ribose_allNH_Lig_Resdict): print "Statistics of Non-Bonded Intercations", "<br/>" print percentage(Ribose_allNH_Lig_Resdict,Ribose) if bool(Ribose_allNH_Lig_Resdict_distance): print distance_calc(Ribose_allNH_Lig_Resdict_distance) print "</div>"# closing of second columns print "</div>"#closing of row print "</div>"#End of click drop down print "<br/>" print """ <div
"north pole" or the # "south pole" (after the central lon/lat have been taken into # account). if n_parallels == 1: plat = 90 if standard_parallels[0] > 0 else -90 else: # Which pole are the parallels closest to? That is the direction # that the cone converges. if abs(standard_parallels[0]) > abs(standard_parallels[1]): poliest_sec = standard_parallels[0] else: poliest_sec = standard_parallels[1] plat = 90 if poliest_sec > 0 else -90 self.cutoff = cutoff n = 91 lons = np.empty(n + 2) lats = np.full(n + 2, float(cutoff)) lons[0] = lons[-1] = 0 lats[0] = lats[-1] = plat if plat == 90: # Ensure clockwise lons[1:-1] = np.linspace(central_longitude + 180 - 0.001, central_longitude - 180 + 0.001, n) else: lons[1:-1] = np.linspace(central_longitude - 180 + 0.001, central_longitude + 180 - 0.001, n) points = self.transform_points(PlateCarree(), lons, lats) self._boundary = sgeom.LinearRing(points) mins = np.min(points, axis=0) maxs = np.max(points, axis=0) self._x_limits = mins[0], maxs[0] self._y_limits = mins[1], maxs[1] def __eq__(self, other): res = super(LambertConformal, self).__eq__(other) if hasattr(other, "cutoff"): res = res and self.cutoff == other.cutoff return res def __ne__(self, other): return not self == other def __hash__(self): return hash((self.proj4_init, self.cutoff)) @property def boundary(self): return self._boundary @property def threshold(self): return 1e5 @property def x_limits(self): return self._x_limits @property def y_limits(self): return self._y_limits class LambertAzimuthalEqualArea(Projection): """ A Lambert Azimuthal Equal-Area projection. """ def __init__(self, central_longitude=0.0, central_latitude=0.0, false_easting=0.0, false_northing=0.0, globe=None): """ Parameters ---------- central_longitude: optional The central longitude. Defaults to 0. central_latitude: optional The central latitude. Defaults to 0. false_easting: optional X offset from planar origin in metres. Defaults to 0. false_northing: optional Y offset from planar origin in metres. Defaults to 0. globe: optional A :class:`cartopy.crs.Globe`. If omitted, a default globe is created. """ proj4_params = [('proj', 'laea'), ('lon_0', central_longitude), ('lat_0', central_latitude), ('x_0', false_easting), ('y_0', false_northing)] super(LambertAzimuthalEqualArea, self).__init__(proj4_params, globe=globe) a = np.float(self.globe.semimajor_axis or WGS84_SEMIMAJOR_AXIS) # Find the antipode, and shift it a small amount in latitude to # approximate the extent of the projection: lon = central_longitude + 180 sign = np.sign(central_latitude) or 1 lat = -central_latitude + sign * 0.01 x, max_y = self.transform_point(lon, lat, PlateCarree()) coords = _ellipse_boundary(a * 1.9999, max_y - false_northing, false_easting, false_northing, 61) self._boundary = sgeom.polygon.LinearRing(coords.T) mins = np.min(coords, axis=1) maxs = np.max(coords, axis=1) self._x_limits = mins[0], maxs[0] self._y_limits = mins[1], maxs[1] self._threshold = np.diff(self._x_limits)[0] * 1e-3 @property def boundary(self): return self._boundary @property def threshold(self): return self._threshold @property def x_limits(self): return self._x_limits @property def y_limits(self): return self._y_limits class Miller(_RectangularProjection): _handles_ellipses = False def __init__(self, central_longitude=0.0, globe=None): if globe is None: globe = Globe(semimajor_axis=math.degrees(1), ellipse=None) # TODO: Let the globe return the semimajor axis always. a = np.float(globe.semimajor_axis or WGS84_SEMIMAJOR_AXIS) proj4_params = [('proj', 'mill'), ('lon_0', central_longitude)] # See Snyder, 1987. Eqs (11-1) and (11-2) substituting maximums of # (lambda-lambda0)=180 and phi=90 to get limits. super(Miller, self).__init__(proj4_params, a * np.pi, a * 2.303412543376391, globe=globe) @property def threshold(self): return 0.5 class RotatedPole(_CylindricalProjection): """ A rotated latitude/longitude projected coordinate system with cylindrical topology and projected distance. Coordinates are measured in projection metres. The class uses proj to perform an ob_tran operation, using the pole_longitude to set a lon_0 then performing two rotations based on pole_latitude and central_rotated_longitude. This is equivalent to setting the new pole to a location defined by the pole_latitude and pole_longitude values in the GeogCRS defined by globe, then rotating this new CRS about it's pole using the central_rotated_longitude value. """ def __init__(self, pole_longitude=0.0, pole_latitude=90.0, central_rotated_longitude=0.0, globe=None): """ Parameters ---------- pole_longitude: optional Pole longitude position, in unrotated degrees. Defaults to 0. pole_latitude: optional Pole latitude position, in unrotated degrees. Defaults to 0. central_rotated_longitude: optional Longitude rotation about the new pole, in degrees. Defaults to 0. globe: optional An optional :class:`cartopy.crs.Globe`. Defaults to a "WGS84" datum. """ proj4_params = [('proj', 'ob_tran'), ('o_proj', 'latlon'), ('o_lon_p', central_rotated_longitude), ('o_lat_p', pole_latitude), ('lon_0', 180 + pole_longitude), ('to_meter', math.radians(1))] super(RotatedPole, self).__init__(proj4_params, 180, 90, globe=globe) @property def threshold(self): return 0.5 class Gnomonic(Projection): _handles_ellipses = False def __init__(self, central_latitude=0.0, central_longitude=0.0, globe=None): proj4_params = [('proj', 'gnom'), ('lat_0', central_latitude), ('lon_0', central_longitude)] super(Gnomonic, self).__init__(proj4_params, globe=globe) self._max = 5e7 @property def boundary(self): return sgeom.Point(0, 0).buffer(self._max).exterior @property def threshold(self): return 1e5 @property def x_limits(self): return (-self._max, self._max) @property def y_limits(self): return (-self._max, self._max) class Stereographic(Projection): def __init__(self, central_latitude=0.0, central_longitude=0.0, false_easting=0.0, false_northing=0.0, true_scale_latitude=None, scale_factor=None, globe=None): # Warn when using Stereographic with proj < 5.0.0 due to # incorrect transformation with lon_0=0 (see # https://github.com/OSGeo/proj.4/issues/194). if central_latitude == 0: if PROJ4_VERSION != (): if PROJ4_VERSION < (5, 0, 0): warnings.warn( 'The Stereographic projection in Proj older than ' '5.0.0 incorrectly transforms points when ' 'central_latitude=0. Use this projection with ' 'caution.', stacklevel=2) else: warnings.warn( 'Cannot determine Proj version. The Stereographic ' 'projection may be unreliable and should be used with ' 'caution.', stacklevel=2) proj4_params = [('proj', 'stere'), ('lat_0', central_latitude), ('lon_0', central_longitude), ('x_0', false_easting), ('y_0', false_northing)] if true_scale_latitude is not None: if central_latitude not in (-90., 90.): warnings.warn('"true_scale_latitude" parameter is only used ' 'for polar stereographic projections. Consider ' 'the use of "scale_factor" instead.', stacklevel=2) proj4_params.append(('lat_ts', true_scale_latitude)) if scale_factor is not None: if true_scale_latitude is not None: raise ValueError('It does not make sense to provide both ' '"scale_factor" and "true_scale_latitude". ' 'Ignoring "scale_factor".') else: proj4_params.append(('k_0', scale_factor)) super(Stereographic, self).__init__(proj4_params, globe=globe) # TODO: Let the globe return the semimajor axis always. a = np.float(self.globe.semimajor_axis or WGS84_SEMIMAJOR_AXIS) b = np.float(self.globe.semiminor_axis or WGS84_SEMIMINOR_AXIS) # Note: The magic number has been picked to maintain consistent # behaviour with a wgs84 globe. There is no guarantee that the scaling # should even be linear. x_axis_offset = 5e7 / WGS84_SEMIMAJOR_AXIS y_axis_offset = 5e7 / WGS84_SEMIMINOR_AXIS self._x_limits = (-a * x_axis_offset + false_easting, a * x_axis_offset + false_easting) self._y_limits = (-b * y_axis_offset + false_northing, b * y_axis_offset + false_northing) coords = _ellipse_boundary(self._x_limits[1], self._y_limits[1], false_easting, false_northing, 91) self._boundary = sgeom.LinearRing(coords.T) self._threshold = np.diff(self._x_limits)[0] * 1e-3 @property def boundary(self): return self._boundary @property def threshold(self): return self._threshold @property def x_limits(self): return self._x_limits @property def y_limits(self): return self._y_limits class NorthPolarStereo(Stereographic): def __init__(self, central_longitude=0.0, true_scale_latitude=None, globe=None): super(NorthPolarStereo, self).__init__( central_latitude=90, central_longitude=central_longitude, true_scale_latitude=true_scale_latitude, # None is +90 globe=globe) class SouthPolarStereo(Stereographic): def __init__(self, central_longitude=0.0, true_scale_latitude=None, globe=None): super(SouthPolarStereo, self).__init__( central_latitude=-90, central_longitude=central_longitude, true_scale_latitude=true_scale_latitude, # None is -90 globe=globe) class Orthographic(Projection): _handles_ellipses = False def __init__(self, central_longitude=0.0, central_latitude=0.0, globe=None): if PROJ4_VERSION != (): if (5, 0, 0) <= PROJ4_VERSION < (5, 1, 0): warnings.warn( 'The Orthographic projection in the v5.0.x series of Proj ' 'incorrectly transforms points. Use this projection with ' 'caution.', stacklevel=2) else: warnings.warn( 'Cannot determine Proj version. The Orthographic projection ' 'may be unreliable and should be used with caution.', stacklevel=2) proj4_params = [('proj', 'ortho'), ('lon_0', central_longitude), ('lat_0', central_latitude)] super(Orthographic, self).__init__(proj4_params, globe=globe) # TODO: Let the globe return the semimajor axis always. a = np.float(self.globe.semimajor_axis or WGS84_SEMIMAJOR_AXIS) # To stabilise the projection of geometries, we reduce the boundary by # a tiny fraction at the cost of the extreme edges. coords = _ellipse_boundary(a * 0.99999, a * 0.99999, n=61) self._boundary = sgeom.polygon.LinearRing(coords.T) mins = np.min(coords, axis=1) maxs = np.max(coords, axis=1) self._x_limits = mins[0], maxs[0] self._y_limits = mins[1], maxs[1] self._threshold = np.diff(self._x_limits)[0] * 0.02 @property def boundary(self): return self._boundary @property def threshold(self): return self._threshold @property def x_limits(self): return self._x_limits @property def y_limits(self): return self._y_limits class _WarpedRectangularProjection(six.with_metaclass(ABCMeta, Projection)): def __init__(self, proj4_params, central_longitude, false_easting=None, false_northing=None, globe=None): if false_easting is not None: proj4_params += [('x_0', false_easting)] if false_northing is not None: proj4_params += [('y_0', false_northing)] super(_WarpedRectangularProjection, self).__init__(proj4_params, globe=globe) # Obtain boundary points minlon, maxlon = self._determine_longitude_bounds(central_longitude) n = 91 lon = np.empty(2 * n + 1) lat = np.empty(2 * n + 1) lon[:n] = minlon lat[:n] = np.linspace(-90, 90, n) lon[n:2 * n] = maxlon lat[n:2 * n] = np.linspace(90, -90, n) lon[-1] = minlon lat[-1] = -90 points = self.transform_points(self.as_geodetic(), lon, lat) self._boundary = sgeom.LinearRing(points) mins = np.min(points, axis=0) maxs = np.max(points, axis=0) self._x_limits = mins[0], maxs[0] self._y_limits = mins[1], maxs[1] @property def boundary(self): return self._boundary @property def x_limits(self): return self._x_limits @property def y_limits(self): return self._y_limits class _Eckert(six.with_metaclass(ABCMeta, _WarpedRectangularProjection)): """ An Eckert projection. This class implements all the
REMOTE ) cmdComplete = runAndCheckCommandComplete(cmd) """ Check for files with extensions (i.e. .1, .2, ...) """ """ First, get a list of all files in the base directory """ fixupFileExtsList = [] baseDir = seg.primary_data_directory + "/base" primaryTempFile = seg.primaryTempDir + '/tempfilesindir' + str(seg.mirror_dbid) cmdComplete = False while cmdComplete == False: fdCmd = FilesInDir( name = "gpupgrademirror files in dir %s:%s" % (seg.primary_host, baseDir) , filePattern = baseDir , ctxt = REMOTE , remoteHost = seg.primary_host , remoteTempFile = primaryTempFile ) cmdComplete = runAndCheckCommandComplete(fdCmd) fdCmd.validate() allBaseList = fdCmd.get_result_list(localTempFile = options.info_data_directory + "/tempallbase" + str(seg.mirror_dbid)) allBaseList.sort() """ Searh the base directory list for all fixup files that have dots (i.e. 123.1, 123.2) """ dotFiles = [] for file in self.fixupFileList: fullPathFile = seg.primary_data_directory + '/' + file tempList = findRelFileDotNodes(fullPathFile, allBaseList) for suffix in tempList: dotFiles.append(file + "." + suffix) allFixupFileList = self.fixupFileList + dotFiles sph = SpecialFileHandling( sourceList = allFixupFileList , seg = seg ) sph.createLinks() cmdComplete = False while cmdComplete == False: fdlCmd = FileDirectoryList( name = "gpupgrademirror find all dirs and files for %s:%s " % (seg.primary_host, sph.fullPathLinkDir) , filePattern = sph.fullPathLinkDir , ctxt = REMOTE , remoteHost = seg.primary_host ) cmdComplete = runAndCheckCommandComplete(fdlCmd) fdlCmd.validate() linkDirList = fdlCmd.get_result_list() copyList = [] for element in self.specialDirectoryList: elementList = element.split("/") if len(elementList) > 1: elementPrefix = "/" + "/".join(elementList[:-1]) else: elementPrefix = "" copyList.append([seg.primary_data_directory + "/" + element, seg.mirror_data_directory + elementPrefix ]) for element in linkDirList: copyList.append([sph.fullPathLinkDir + "/" + element, seg.mirror_data_directory]) for copyElement in copyList: cmdComplete = False while cmdComplete == False: rcCmd = RemoteCopyPreserve( name = 'gpupgrademirror phase 2 fixup copy : %s:%s to %s:%s' % (seg.primary_host, copyElement[0], seg.mirror_host, copyElement[1]) , srcDirectory = copyElement[0] , dstHost = seg.mirror_host , dstDirectory = copyElement[1] , ctxt = REMOTE , remoteHost = seg.primary_host ) cmdComplete = runAndCheckCommandComplete(rcCmd) rcCmd.validate() return #------------------------------------------------------------------------------- def run(self): self.startedRun = True try: i = 0 for seg in self.mirrorSegmentList: self.logger.debug("started run for Phase 2 for seg mirror: %s" % str(seg.mirror_dbid)) status = self.statusList[i] currentStatus = status.get_current_status() if status.compare_status('START_PHASE2') <= 0: status.set_status('START_PHASE2') ''' Copy catalog tables to mirror ''' self.newMirrorSpecialFileFixup(seg) if status.compare_status('PHASE2_DONE') <= 0: status.set_status('PHASE2_DONE') i = i + 1 self.shutdown() except Exception, e: self.logger.error('ERROR in processing mirror: %s Exception: %s' % (self.nodeName, str(e))) self.logger.error('gpupgradmirror exiting') traceback.print_exc() sys.exit("The gpupgrademirror log information can be found in " + str(get_logfile()) + "\n") #------------------------------------------------------------------------------- def shutdown(self): for seg in self.mirrorSegmentList: cmdComplete = False while cmdComplete == False: rmCmd = RemoveFiles( name = 'gpupgrademirror remove temp dir: %s:%s' % (seg.primary_host, seg.primaryTempDir) , directory = seg.primaryTempDir , ctxt = REMOTE , remoteHost = seg.primary_host ) ###print "rmCmd = " ###print str(rmCmd) cmdComplete = runAndCheckCommandComplete(rmCmd) rmCmd.validate() # #------------------------------------------------------------------------------- #--------------------------------- Main ---------------------------------------- #------------------------------------------------------------------------------- """ This the the main body of code for gpupgrademirror. gpupgradmirror has two phases (phase 1 and phase 2) and two modes (safe and unsafe). """ dburl = None conn = None remove_pid = True p1MirrorInfo = None phase2gparray = None MirrorNodeList = [] MirrorInfoList = [] phase2MirrorList = [] minionList = [] coverage = GpCoverage() coverage.start() try: # setup signal handlers so we can clean up correctly signal.signal(signal.SIGTERM, sig_handler) signal.signal(signal.SIGHUP, sig_handler) """ If we are a minion, we need to do a lookup of our seg id to properly setup the log file name. """ minionSegdbid = "" argPrevious = "" for arg in sys.argv: if argPrevious == "-i": segdbidList = arg.split(":") minionSegdbid = segdbidList[0] break else: argPrevious = arg logger = get_default_logger() applicationNameWithExt = EXECNAME + str(minionSegdbid) setup_tool_logging( appName = applicationNameWithExt , hostname = getLocalHostname() , userName = getUserName() ) options, args = parseargs() if len(options.ids) > 0: options.ids = options.ids.split(':') if options.verbose: enable_verbose_logging() if is_gpupgrademirror_running(options.info_data_directory): logger.error('gpupgrademirror is already running. Only one instance') logger.error('of gpupgrademirror is allowed at a time.') remove_pid = False sys.exit("The gpupgrademirror log information can be found in " + str(get_logfile()) + "\n") else: create_pid_file(options.info_data_directory) if options.phase2 == True: phase = 2 else: phase = 1 overallStatus = GpUpgradeMirrorStatus( logger = logger , info_data_directory = options.info_data_directory , segment_dbid = 0 , phase = phase , overall = True ) if options.continue_upgrade == True and \ len(options.ids) == 0 and \ overallStatus.get_current_status() == (None, None): """ If there is no status, then we haven't gotten anywhere. Reset options.continue_upgrade to False""" logger.warning("Although continue was specified, the upgrade are not far enough elong to continue. gpupgrademirror will attempt to restart this phase of upgrade") options.continue_upgrade = False """ We will start the database in master only mode unless we are in phase 1 and we are rolling back or continuing. If we are in phase 1 and are rolling back or continuing, we will get the information we need from a flat file we created on the first phase 1 attempt. """ dbUrl = dbconn.DbURL(dbname = 'template1') phase1gpstartStatus = None if options.rollback == True: """ Never start the database in rollback mode. """ pass elif options.phase2 == False and overallStatus.compare_status("END_PHASE1_SETUP") >= 0: """ If we are past getting all the information we need, then don't start the database. """ pass elif len(options.ids) == 0: if options.phase2 == True: GpStart.local('gpupgrademirror start database', masterOnly = True) logging.debug('started database master only with GpStart') else: """ We are running in a 4.0 environment, but need to start like we are in a 3.3.x environment. """ env = SetupEnv(options.gphome) Startup(env = env, utility = True) logging.debug('started database master only with Startup') phase1gpstartStatus = "STARTUP_MASTER" if options.rollback == True and options.phase2 == False: ''' setup for rollback ''' if overallStatus.get_current_status() == (None, None): logging.warning('There is no upgrade mirror in progress') rmCmd = RemoveFiles( name = 'gpupgrademirror remove info directory: %s' % (options.info_data_directory) , directory = options.info_data_directory , ctxt = LOCAL , remoteHost = None ) rmCmd.run(validateAfter = False) exit(0) elif overallStatus.compare_status("END_PHASE1_SETUP") < 0: """ We have not gotten past the setup phase, so remove the gpugprademirr info directory and exit. """ rmCmd = RemoveFiles( name = 'gpupgrademirror remove info directory: %s' % (options.info_data_directory) , directory = options.info_data_directory , ctxt = LOCAL , remoteHost = None ) rmCmd.run(validateAfter = False) exit(0) elif options.continue_upgrade == True: pass elif options.phase2 == False: if (overallStatus.get_current_status() != (None, None)): logging.error("Upgrade mirrors already started.") logging.error("You must either rollback or continue mirror upgrade") raise ValidationError("Unable to continue") else: """ We are in normal phase 1 mode """ overallStatus.create_status_file() elif options.phase2 == True: pass if options.phase2 == True: """ Phase 2 of upgrade mirrors There are a number of special files that we need to copy from the primary in phase 2. Most of these files are catalog files. """ databaseList = [] if options.rollback == True: raise ValidationError('Rollback is not possible in phase 2 mirror upgrade.') conn = dbconn.connect( dburl = dbUrl , utility = True ) ''' Get a list of databases. ''' databaseCursor = dbconn.execSQL(conn, DatabaseRow.query()) for row in databaseCursor: dbrow = DatabaseRow(row) databaseList.append(dbrow) conn.close() ''' Setup gparray object. ''' try: phase2gparray = GpArray.initFromCatalog(dbUrl, utility = True) except Exception, e: logger.warning('Unable to obtain gparray information: ' + str(e)) logger.warning('gpupgradmirror exiting') exit(1) ''' Setup mirror info object. ''' try: p2MirrorInfo = Phase1and2MirrorInfo(dbUrl) except Exception, e: logger.warning('Unable to obtain mirror information: ' + str(e)) logger.warning('gpupgradmirror exiting') exit(1) ''' Start all the primary segments ''' StartupPrimaries(phase2gparray) ''' Get list of all segments ''' allSegMirrorInfo = p2MirrorInfo.getAllMirrorInfoList() ''' Go to each segment''' for mirrorInfo in allSegMirrorInfo: ''' Connect to each segment's database, and make a list of files we will use ''' fileList = [] specialDirList = [] ''' always copy the global directory ''' specialDirList.append('global') ''' always copy the pg_xlog directory ''' specialDirList.append('pg_xlog') for db in databaseList: if str(db.databaseName) == str("template0"): ''' Special case where we copy the entire database ''' specialDirList.append('base/' + str(db.databaseDirectory)) continue connectURL = dbconn.DbURL(dbname = db.databaseName, hostname = mirrorInfo.primary_host, port = mirrorInfo.primary_host_port) connectForDB =
<filename>persia/ctx.py<gh_stars>1-10 import os import io import socket from enum import Enum from queue import Queue from typing import List, Tuple, Optional, Union import torch import persia.env as env from persia.logger import get_default_logger from persia.embedding.optim import Optimizer from persia.embedding import EmbeddingConfig, get_default_embedding_config from persia.embedding.data import PersiaBatch from persia.prelude import ( PersiaCommonContext, PersiaTrainingBatch, Tensor, ) from persia.distributed import DistributedBaseOption, get_default_distributed_option _CURRENT_CXT = None _logger = get_default_logger() def _check_finite(tensors: List[torch.Tensor]) -> bool: """Check if all tensors in the input list contain only finite elements. Arguments: tensors (List[torch.Tensor]): List of tensor to be checked. Returns: bool: ``True`` if all elements in ``tensors`` are finite or None. """ return all([torch.isfinite(t).all() if t is not None else True for t in tensors]) def _cast_dlpack2torch_tensor( tensor: Tensor, requires_grad: bool = False ) -> torch.Tensor: """Convert the DLPack PythonCapsule to torch tensor. Arguments: Tensor (Tensor): Tensor wrapper that contains dlpack information. requires_grad (bool, optional): Whether current tensor requires grad or not. Returns: pytorch tensor """ import torch.utils.dlpack as dlpack tensor = dlpack.from_dlpack(tensor.dlpack) tensor.requires_grad = requires_grad return tensor class PreprocessMode(Enum): r"""Mode of preprocessing. Used by ``EmbeddingCtx.prepare_features`` to generate features of different datatypes. When set to ``TRAIN``, ``prepare_features`` will return a torch tensor with ``requires_grad`` attribute set to ``True``. When set to ``EVAL``, ``prepare_features`` will return a torch tensor with ``requires_grad`` attribute set to ``False``. ``INFERENCE`` behaves almost identical to ``PreprocessMode.EVAL``, except that ``INFERENCE`` allows ""EmbeddingCtx`` to process the ``PersiaTrainingBatch`` without a target tensor. """ TRAIN = 1 EVAL = 2 INFERENCE = 3 class BaseCtx: r"""Initializes a common context for other persia context, e.g. `DataCtx`, `EmbeddingCtx` and `TrainCtx`. This class should not be instantiated directly. """ def __init__( self, threadpool_worker_size: int = 10, device_id: Optional[int] = None ): """ Arguments: threadpool_worker_size (int): Rpc threadpool worker size. device_id (int, optional): The CUDA device to use for this process. """ self.origin_context = None if device_id is not None and device_id >= 0: assert torch.cuda.is_available() and ( 0 <= device_id < torch.cuda.device_count() ), f"device_id: {device_id} invalid!" torch.cuda.set_device(device_id) else: device_id = None self.device_id = device_id # PersiaCommonContext initialize with the rank and world size if # it can retrive corresponding information if env.get_rank() is not None: replica_index = env.get_rank() replica_size = env.get_world_size() else: replica_index = env.get_replica_index() replica_size = env.get_replica_size() self.common_context = PersiaCommonContext( threadpool_worker_size, replica_index, replica_size, device_id ) _logger.info( f"init persia context, replica_size: {replica_size} replica_index: {replica_index}" ) def _enter(self): """Hook when enter the context""" ... def _exit(self): """Hook when exit the context""" ... def __enter__(self): self._enter() global _CURRENT_CXT self.origin_context = _CURRENT_CXT _CURRENT_CXT = self return self def __exit__(self, exc_type, value, trace): self._exit() global _CURRENT_CXT _CURRENT_CXT = self.origin_context if exc_type: import traceback _logger.error("\n" + traceback.format_exc()) class DataCtx(BaseCtx): r"""This data context provides communication functionality to data generator component. Used for sending a PersiaBatch to the nn worker and embedding worker. Example: >>> import numpy as np >>> ... >>> from persia.embedding.data import PersiaBatch, IDTypeFeature >>> ... >>> def make_simple_loader(): >>> yield IDTypeFeature("empty_id_type_feature", [np.array([], np.uint64)]) >>> loader = make_simple_loader() >>> def fn >>> with DataCtx() as ctx: >>> for id_type_feature in loader: >>> batch_data = PersiaBatch([id_type_feature], requires_grad=False) >>> ctx.send_data(batch_data) """ def __init__( self, *args, **kwargs, ): super(DataCtx, self).__init__(*args, **kwargs) self.prepare() _logger.info("Data ctx prepare done.") def prepare(self): """Do some preparation to init `DataCtx`.""" self.common_context.init_nats_publisher(None) self.common_context.wait_servers_ready() def send_data(self, persia_batch: PersiaBatch): """Send PersiaBatch from data loader to nn worker and embedding worker side. Arguments: persia_batch (PersiaBatch): PersiaBatch that haven't been processed. """ self.common_context.send_id_type_features_to_embedding_worker(persia_batch.data) self.common_context.send_non_id_type_features_to_nn_worker(persia_batch.data) class EmbeddingCtx(BaseCtx): r"""Provides the embedding-related functionality. EmbeddingCtx can run offline test or online inference depending on different preprocess_mode. The simplest way to get this context is by using ``persia.ctx.eval_ctx()`` to get the ``EmbeddingCtx`` instance. Example: >>> import torch >>> import numpy as np >>> ... >>> from persia.prelude import PersiaBatch >>> ... >>> model = torch.nn.Linear(128, 64) >>> loader = make_dataloader() >>> embedding_config = EmbeddingConfig() >>> with EmbeddingCtx( ... model=model, ... PreprocessMode.EVAL, ... embedding_config ... ) as ctx: >>> for (non_id_type_feature, id_type_features, label) in loader: >>> persia_batch = PersiaBatch(id_type_features) >>> persia_batch.add_non_id_type_feature(non_id_type_feature) >>> persia_batch.add_label(label) >>> persia_training_batch = ctx.get_embedding_from_data(persia_batch) >>> (output, label) = ctx.forward(persia_training_batch) """ def __init__( self, preprocess_mode: PreprocessMode, model: Optional[torch.nn.Module] = None, embedding_config: Optional[EmbeddingConfig] = None, *args, **kwargs, ): """ Arguments: preprocess_mode (PreprocessMode): Different preprocess mode effect the behavior of ``prepare_features``. model (torch.nn.Module): Torch model matched with embeddings in this context. embedding_config (EmbeddingConfig, optional): The embedding configuration that will be sent to the embedding server. """ super(EmbeddingCtx, self).__init__(*args, **kwargs) self.preprocess_mode = preprocess_mode self.model = model self.embedding_config = embedding_config or get_default_embedding_config() self.current_batch = None def _enter(self): if self.embedding_config is not None: self.configure_embedding_parameter_servers(self.embedding_config) def configure_embedding_parameter_servers( self, embedding_config: EmbeddingConfig, ): """Apply Embedding config to embedding servers. Arguments: embedding_config (EmbeddingConfig): The embedding configuration that will be sent to the embedding server. """ self.common_context.configure_embedding_parameter_servers( embedding_config.emb_initialization[0], embedding_config.emb_initialization[1], embedding_config.admit_probability, embedding_config.weight_bound > 0, embedding_config.weight_bound, ) def forward( self, batch: PersiaTrainingBatch ) -> Tuple[torch.Tensor, Optional[torch.Tensor]]: """Call `prepare_features` and then do a forward step of the model in context. Arguments: batch (PersiaTrainingBatch): Training data provided by PersiaML upstream including non_id_type_features ,labels, id_type_feature_embeddings and meta info. Returns: the tuple of output data and target data. """ assert self.model is not None, "model not found, please init context with model" non_id_type_tensors, embedding_tensors, labels = self.prepare_features(batch) output = self.model(non_id_type_tensors, embedding_tensors) return (output, labels) def prepare_features( self, batch: PersiaTrainingBatch ) -> Tuple[List[torch.Tensor], List[torch.Tensor], Optional[List[torch.Tensor]]]: r"""This function convert the data in `PersiaTrainingBatch' to `torch.Tensor`. `PersiaTrainingBatch' contains non_id_type_features, id_type_feature_embeddings and labels.But they can't use directly in training before convert the `persia.Tensor` to `torch.Tensor`. Arguments: batch (PersiaTrainingBatch): Training data provided by PersiaML upstream including non_id_type_features, labels, id_type_feature_embeddings and meta info. Returns: the tuple of non_id_type_features, id_type_feature_embeddings and labels. """ if self.preprocess_mode == PreprocessMode.INFERENCE: batch.label_torch_tensors = None else: # pytype: disable=attribute-error batch.label_tensors = batch.consume_all_label_tensors() # pytype: enable=attribute-error batch.label_torch_tensors = [ _cast_dlpack2torch_tensor(label_tensor) for label_tensor in batch.label_tensors ] is_training = self.preprocess_mode == PreprocessMode.TRAIN # cache property # pytype: disable=attribute-error batch.non_id_type_feature_tensors = ( batch.consume_all_non_id_type_feature_tensors() ) # pytype: enable=attribute-error batch.non_id_type_feature_torch_tensors = [ _cast_dlpack2torch_tensor(non_id_type_feature_tensor) for non_id_type_feature_tensor in batch.non_id_type_feature_tensors ] # pytype: disable=attribute-error batch.id_type_feature_embedding_tensors = ( batch.consume_all_id_type_feature_embedding_tensors() ) # pytype: enable=attribute-error batch.emb_slots = [] # cache embedding to prevent tensor expired id_type_feature_embedding_cache_torch_tensors = ( [] ) # cache origin embedding for later backward procedure id_type_feature_embedding_torch_tensors = ( [] ) # id type tensos for later forward procedure for id_type_feature_embedding_tensor in batch.id_type_feature_embedding_tensors: if id_type_feature_embedding_tensor.is_raw_embedding(): # no duplicate id in raw_id_tensor ( raw_embedding, index, non_empty_index, sample_id_num, ) = id_type_feature_embedding_tensor.get_raw_embedding() batch.emb_slots.append([raw_embedding, index, non_empty_index]) distinct_id_tensor = _cast_dlpack2torch_tensor(raw_embedding) index_tensor = _cast_dlpack2torch_tensor( index ) # tensor shape (1, batch_size * sample_fixed_size) max_index = index_tensor.max() size_of_distinct_id_tensor = distinct_id_tensor.shape[0] assert ( max_index < size_of_distinct_id_tensor ), "raw embedding select index larger than tensor" non_empty_index_tensor = _cast_dlpack2torch_tensor( non_empty_index ) # tensor shape (-1), variable length batch_size = len(sample_id_num) dim = distinct_id_tensor.shape[-1] sample_fixed_size = index_tensor.shape[-1] // batch_size index_select_raw_tensor = distinct_id_tensor.index_select( 0, index_tensor.view(-1) ) index_select_raw_tensor.requires_grad = is_training raw_fixed_size_tensor = index_select_raw_tensor.view( -1, sample_fixed_size, dim ) mask = ( index_tensor.view(batch_size, sample_fixed_size, 1) != 0 ).half() # generate mask raw_fixed_size_tensor_with_mask = torch.cat( [raw_fixed_size_tensor, mask], dim=2 ) id_type_feature_embedding_cache_torch_tensors.append( ( raw_embedding.name, distinct_id_tensor, index_tensor, non_empty_index_tensor, index_select_raw_tensor, ) ) id_type_feature_embedding_torch_tensors.append( raw_fixed_size_tensor_with_mask ) else: embedding = id_type_feature_embedding_tensor.get_sum_embedding() batch.emb_slots.append([embedding]) attention_sum_tensor = _cast_dlpack2torch_tensor( embedding, requires_grad=is_training ) id_type_feature_embedding_torch_tensors.append(attention_sum_tensor) id_type_feature_embedding_cache_torch_tensors.append( (embedding.name, None, None, None, attention_sum_tensor) ) batch.id_type_feature_embedding_torch_tensors = ( id_type_feature_embedding_torch_tensors ) batch.id_type_feature_embedding_cache_torch_tensors = ( id_type_feature_embedding_cache_torch_tensors ) self.current_batch = batch return ( batch.non_id_type_feature_torch_tensors, batch.id_type_feature_embedding_torch_tensors, batch.label_torch_tensors, ) def dump_checkpoint( self, dst_dir: str, dense_filename: str = "dense.pt", jit_dense_filename: str = "jit_dense.pt", blocking: bool = True, with_jit_model: bool = False, ): """Dump the dense and embedding checkpoint to destination directory. Arguments: dst_dir (str): Destination directory. dense_filename (str, optional): Dense checkpoint filename. jit_dense_filename (str, optional): Jit dense checkpoint filename. blocking (bool, optional): Dump embedding checkpoint in blocking mode or not. with_jit_model (bool, optional): Dump jit script dense checkpoint or not. """ assert self.model is not None, "model not found, please init context with model" if with_jit_model: self.dump_torch_state_dict(self.model, dst_dir, jit_dense_filename, True) self.dump_torch_state_dict(self.model, dst_dir, dense_filename) self.dump_embedding(dst_dir, blocking=blocking) def load_checkpoint( self, src_dir: str, map_location: Optional[str] = None, dense_filename: str = "dense.pt", blocking: bool = True, ): """Load the dense and embedding checkpoint from source directory. Arguments: src_dir (str): Source directory. map_location (str, optional): Load the dense
is available immediately, then this function blocks until a message is ready. If the remote endpoint closes the connection, then the caller can still get messages sent prior to closing. Once all pending messages have been retrieved, additional calls to this method will raise ``ConnectionClosed``. If the local endpoint closes the connection, then pending messages are discarded and calls to this method will immediately raise ``ConnectionClosed``. :rtype: str or bytes :raises ConnectionClosed: if the connection is closed. ''' try: message = await self._recv_channel.receive() except (trio.ClosedResourceError, trio.EndOfChannel): raise ConnectionClosed(self._close_reason) from None return message async def ping(self, payload=None): ''' Send WebSocket ping to remote endpoint and wait for a correspoding pong. Each in-flight ping must include a unique payload. This function sends the ping and then waits for a corresponding pong from the remote endpoint. *Note: If the remote endpoint recieves multiple pings, it is allowed to send a single pong. Therefore, the order of calls to ``ping()`` is tracked, and a pong will wake up its corresponding ping as well as all previous in-flight pings.* :param payload: The payload to send. If ``None`` then a random 32-bit payload is created. :type payload: bytes or None :raises ConnectionClosed: if connection is closed. :raises ValueError: if ``payload`` is identical to another in-flight ping. ''' if self._close_reason: raise ConnectionClosed(self._close_reason) if payload in self._pings: raise ValueError('Payload value {} is already in flight.'. format(payload)) if payload is None: payload = struct.pack('!I', random.getrandbits(32)) event = trio.Event() self._pings[payload] = event self._wsproto.ping(payload) await self._write_pending() await event.wait() async def pong(self, payload=None): ''' Send an unsolicted pong. :param payload: The pong's payload. If ``None``, then no payload is sent. :type payload: bytes or None :raises ConnectionClosed: if connection is closed ''' if self._close_reason: raise ConnectionClosed(self._close_reason) self._wsproto.ping(payload) await self._write_pending() async def send_message(self, message): ''' Send a WebSocket message. :param message: The message to send. :type message: str or bytes :raises ConnectionClosed: if connection is already closed. ''' if self._close_reason: raise ConnectionClosed(self._close_reason) self._wsproto.send_data(message) await self._write_pending() def __str__(self): ''' Connection ID and type. ''' type_ = 'client' if self.is_client else 'server' return '{}-{}'.format(type_, self._id) async def _abort_web_socket(self): ''' If a stream is closed outside of this class, e.g. due to network conditions or because some other code closed our stream object, then we cannot perform the close handshake. We just need to clean up internal state. ''' close_reason = wsframeproto.CloseReason.ABNORMAL_CLOSURE if not self._wsproto.closed: self._wsproto.close(close_reason) if self._close_reason is None: await self._close_web_socket(close_reason) self._reader_running = False # We didn't really handshake, but we want any task waiting on this event # (e.g. self.aclose()) to resume. self._close_handshake.set() async def _accept(self, proposal): ''' Accept a given proposal. This finishes the server-side handshake with the given proposal attributes and return the connection instance. :rtype: WebSocketConnection ''' self._subprotocol = proposal.subprotocol self._path = proposal.url.path self._wsproto.accept(proposal._event, self._subprotocol) await self._write_pending() self._open_handshake.set() return self async def _close_stream(self): ''' Close the TCP connection. ''' self._reader_running = False try: await self._stream.aclose() except trio.BrokenResourceError: # This means the TCP connection is already dead. pass async def _close_web_socket(self, code, reason=None): ''' Mark the WebSocket as closed. Close the message channel so that if any tasks are suspended in get_message(), they will wake up with a ConnectionClosed exception. ''' self._close_reason = CloseReason(code, reason) exc = ConnectionClosed(self._close_reason) logger.debug('%s websocket closed %r', self, exc) await self._send_channel.aclose() async def _get_request(self): ''' Return a proposal for a WebSocket handshake. This method can only be called on server connections and it may only be called one time. :rtype: WebSocketRequest ''' if not self.is_server: raise Exception('This method is only valid for server connections.') if self._connection_proposal is None: raise Exception('No proposal available. Did you call this method' ' multiple times or at the wrong time?') proposal = await self._connection_proposal.wait_value() self._connection_proposal = None return proposal async def _handle_connection_requested_event(self, event): ''' Handle a ConnectionRequested event. This method is async even though it never awaits, because the event dispatch requires an async function. :param event: ''' proposal = WebSocketRequest(self._accept, event) self._connection_proposal.set_value(proposal) async def _handle_connection_established_event(self, event): ''' Handle a ConnectionEstablished event. :param event: ''' self._subprotocol = event.subprotocol self._open_handshake.set() async def _handle_connection_closed_event(self, event): ''' Handle a ConnectionClosed event. :param event: ''' await self._write_pending() await self._close_web_socket(event.code, event.reason or None) self._close_handshake.set() async def _handle_connection_failed_event(self, event): ''' Handle a ConnectionFailed event. :param event: ''' await self._write_pending() await self._close_web_socket(event.code, event.reason or None) await self._close_stream() self._open_handshake.set() self._close_handshake.set() async def _handle_data_received_event(self, event): ''' Handle a BytesReceived or TextReceived event. :param event: ''' self._message_size += len(event.data) self._message_parts.append(event.data) if self._message_size > self._max_message_size: err = 'Exceeded maximum message size: {} bytes'.format( self._max_message_size) self._message_size = 0 self._message_parts = [] self._close_reason = CloseReason(1009, err) self._wsproto.close(code=1009, reason=err) await self._write_pending() await self._recv_channel.aclose() self._reader_running = False elif event.message_finished: msg = (b'' if isinstance(event, BytesReceived) else '') \ .join(self._message_parts) self._message_size = 0 self._message_parts = [] try: await self._send_channel.send(msg) except trio.BrokenResourceError: # The receive channel is closed, probably because somebody # called ``aclose()``. We don't want to abort the reader task, # and there's no useful cleanup that we can do here. pass async def _handle_ping_received_event(self, event): ''' Handle a PingReceived event. Wsproto queues a pong frame automatically, so this handler just needs to send it. :param event: ''' logger.debug('%s ping %r', self, event.payload) await self._write_pending() async def _handle_pong_received_event(self, event): ''' Handle a PongReceived event. When a pong is received, check if we have any ping requests waiting for this pong response. If the remote endpoint skipped any earlier pings, then we wake up those skipped pings, too. This function is async even though it never awaits, because the other event handlers are async, too, and event dispatch would be more complicated if some handlers were sync. :param event: ''' payload = bytes(event.payload) try: event = self._pings[payload] except KeyError: # We received a pong that doesn't match any in-flight pongs. Nothing # we can do with it, so ignore it. return while self._pings: key, event = self._pings.popitem(0) skipped = ' [skipped] ' if payload != key else ' ' logger.debug('%s pong%s%r', self, skipped, key) event.set() if payload == key: break async def _reader_task(self): ''' A background task that reads network data and generates events. ''' handlers = { 'ConnectionRequested': self._handle_connection_requested_event, 'ConnectionFailed': self._handle_connection_failed_event, 'ConnectionEstablished': self._handle_connection_established_event, 'ConnectionClosed': self._handle_connection_closed_event, 'BytesReceived': self._handle_data_received_event, 'TextReceived': self._handle_data_received_event, 'PingReceived': self._handle_ping_received_event, 'PongReceived': self._handle_pong_received_event, } if self.is_client: # Clients need to initiate the negotiation: await self._write_pending() while self._reader_running: # Process events. for event in self._wsproto.events(): event_type = type(event).__name__ try: handler = handlers[event_type] logger.debug('%s received event: %s', self, event_type) await handler(event) except KeyError: logger.warning('%s received unknown event type: "%s"', self, event_type) # Get network data. try: data = await self._stream.receive_some(RECEIVE_BYTES) except (trio.BrokenResourceError, trio.ClosedResourceError): await self._abort_web_socket() break if len(data) == 0: logger.debug('%s received zero bytes (connection closed)', self) # If TCP closed before WebSocket, then record it as an abnormal # closure. if not self._wsproto.closed: await self._abort_web_socket() break else: logger.debug('%s received %d bytes', self, len(data)) if not self._wsproto.closed: self._wsproto.receive_bytes(data) logger.debug('%s reader task finished', self) async def _write_pending(self): ''' Write any pending protocol data to the network socket. ''' data = self._wsproto.bytes_to_send() if len(data) > 0: # The reader task and one or more writers might try to send messages # at the same time, so we need to synchronize access to this stream. async with self._stream_lock: logger.debug('%s sending %d bytes', self, len(data)) try: await self._stream.send_all(data) except (trio.BrokenResourceError, trio.ClosedResourceError): await self._abort_web_socket() raise ConnectionClosed(self._close_reason) from None else: logger.debug('%s no pending data to send', self) class ListenPort: ''' Represents a listener on a given address and port. ''' def __init__(self, address, port, is_ssl): self.address = ip_address(address) self.port = port self.is_ssl = is_ssl def __str__(self): ''' Return a compact representation, like 127.0.0.1:80 or [::1]:80. ''' scheme = 'wss' if self.is_ssl else 'ws' if self.address.version == 4: return '{}://{}:{}'.format(scheme, self.address, self.port) else: return '{}://[{}]:{}'.format(scheme, self.address, self.port) class WebSocketServer: ''' WebSocket server. The server class handles incoming connections on one or more ``Listener`` objects. For each incoming connection, it creates a ``WebSocketConnection`` instance and starts some background tasks,
'fast_component_update', callbacks=[config.INSTALLATION_CONFIG.IsAlternateReleaseChannel]) class _SectionTest(_Section): """Contains the properties for the 'test' section.""" def __init__(self): super(_SectionTest, self).__init__('test') class _SectionDevshell(_Section): """Contains the properties for the 'devshell' section.""" def __init__(self): super(_SectionDevshell, self).__init__('devshell') self.image = self._Add( 'image', hidden=True, callbacks=[lambda: const_lib.DEFAULT_DEVSHELL_IMAGE]) self.metadata_image = self._Add( 'metadata_image', hidden=True, callbacks=[lambda: const_lib.METADATA_IMAGE]) class _SectionEndpoints(_Section): """Contains the properties for the 'endpoints' section.""" def _AddEndpointFor(self, api_name): setattr(self, api_name, self._Add(api_name, hidden=True)) def __init__(self): super(_SectionEndpoints, self).__init__('endpoints') self._AddEndpointFor('compute') self._AddEndpointFor('container') self._AddEndpointFor('dataflow') self._AddEndpointFor('dns') self._AddEndpointFor('testing') self._AddEndpointFor('toolresults') class _Property(object): """An individual property that can be gotten from the properties file. Attributes: section: str, The name of the section the property appears in in the file. name: str, The name of the property. hidden: bool, True to hide this property from display. callbacks: [func], A list of functions to be called, in order, if no value is found elsewhere. validator: func(str), A function that is called on the value when .Set()'d or .Get()'d. For valid values, the function should do nothing. For invalid values, it should raise InvalidValueError with an explanation of why it was invalid. """ def __init__(self, section, name, hidden=False, callbacks=None, validator=None): self.__section = section self.__name = name self.__hidden = hidden self.__callbacks = callbacks or [] self.__validator = validator @property def section(self): return self.__section @property def name(self): return self.__name @property def is_hidden(self): return self.__hidden @property def callbacks(self): return self.__callbacks def Get(self, required=False, validate=True): """Gets the value for this property. Looks first in the environment, then in the workspace config, then in the global config, and finally at callbacks. Args: required: bool, True to raise an exception if the property is not set. validate: bool, Whether or not to run the fetched value through the validation function. Returns: str, The value for this property. """ value = _GetProperty(self, _PropertiesFile.Load(), required) if validate: self.Validate(value) return value def Validate(self, value): """Test to see if the value is valid for this property. Args: value: str, The value of the property to be validated. Raises: InvalidValueError: If the value was invalid according to the property's validator. """ if self.__validator: self.__validator(value) def GetBool(self, required=False, validate=True): """Gets the boolean value for this property. Looks first in the environment, then in the workspace config, then in the global config, and finally at callbacks. Args: required: bool, True to raise an exception if the property is not set. validate: bool, Whether or not to run the fetched value through the validation function. Returns: bool, The boolean value for this property, or None if it is not set. """ value = _GetBoolProperty(self, _PropertiesFile.Load(), required) if validate: self.Validate(value) return value def GetInt(self, required=False, validate=True): """Gets the integer value for this property. Looks first in the environment, then in the workspace config, then in the global config, and finally at callbacks. Args: required: bool, True to raise an exception if the property is not set. validate: bool, Whether or not to run the fetched value through the validation function. Returns: int, The integer value for this property. """ value = _GetIntProperty(self, _PropertiesFile.Load(), required) if validate: self.Validate(value) return value def Set(self, value): """Sets the value for this property as an environment variable. Args: value: str/bool, The proposed value for this property. If None, it is removed from the environment. """ self.Validate(value) if value is not None: os.environ[self.EnvironmentName()] = str(value) elif self.EnvironmentName() in os.environ: del os.environ[self.EnvironmentName()] def EnvironmentName(self): """Get the name of the environment variable for this property. Returns: str, The name of the correct environment variable. """ return 'CLOUDSDK_{section}_{name}'.format( section=self.__section.upper(), name=self.__name.upper(), ) VALUES = _Sections() class Scope(object): """An enum class for the different types of property files that can be used. """ _SCOPE_TUPLE = collections.namedtuple('_ScopeTuple', ['id', 'description', 'get_file']) INSTALLATION = _SCOPE_TUPLE( id='installation', description='The installation based configuration file applies to all ' 'users on the system that use this version of the Cloud SDK. If the SDK ' 'was installed by an administrator, you will need administrator rights ' 'to make changes to this file.', get_file=lambda: config.Paths().installation_properties_path) USER = _SCOPE_TUPLE( id='user', description='The user based configuration file applies only to the ' 'current user of the system. It will override any values from the ' 'installation configuration.', get_file=lambda: config.Paths().user_properties_path) WORKSPACE = _SCOPE_TUPLE( id='workspace', description='The workspace based configuration file is based on your ' 'current working directory. You can set project specific configuration ' 'here that will only take effect when working within that project\'s ' 'directory. You cannot set this value if you are not currently within a ' 'gcloud workspace. This will override all values from any other ' 'configuration files.', get_file=lambda: config.Paths().workspace_properties_path) _ALL = [WORKSPACE, USER, INSTALLATION] _ALL_SCOPE_NAMES = [s.id for s in _ALL] @staticmethod def AllValues(): """Gets all possible enum values. Returns: [Scope], All the enum values. """ return list(Scope._ALL) @staticmethod def AllScopeNames(): return list(Scope._ALL_SCOPE_NAMES) @staticmethod def FromId(scope_id): """Gets the enum corresponding to the given scope id. Args: scope_id: str, The scope id to parse. Raises: InvalidScopeValueError: If the given value cannot be parsed. Returns: OperatingSystemTuple, One of the OperatingSystem constants or None if the input is None. """ if not scope_id: return None for scope in Scope._ALL: if scope.id == scope_id: return scope raise InvalidScopeValueError(scope_id) @staticmethod def GetHelpString(): return '\n\n'.join(['*{0}*::: {1}'.format(s.id, s.description) for s in Scope.AllValues()]) def PersistProperty(prop, value, scope=None, properties_file=None): """Sets the given property in the properties file. This function should not generally be used as part of normal program execution. The property files are user editable config files that they should control. This is mostly for initial setup of properties that get set during SDK installation. Args: prop: properties.Property, The property to set. value: str, The value to set for the property. If None, the property is removed. scope: Scope, The config location to set the property in. If given, only this location will be udpated and it is an error if that location does not exist. If not given, it will attempt to update the property in first the workspace config (if it exists) but then fall back to user level config. It will never fall back to installation properties; you must use that scope explicitly to set that value. properties_file: str, Path to an explicit properties file to use (instead of one of the known locations). It is an error to specify a scope and an explicit file. Raises: ValueError: If you give both a scope and a properties file. MissingConfigLocationError: If there is not file for the given scope. """ prop.Validate(value) if scope and properties_file: raise ValueError('You cannot provide both a scope and a specific properties' ' file.') if not properties_file: if scope: if scope == Scope.INSTALLATION: config.EnsureSDKWriteAccess() properties_file = scope.get_file() if not properties_file: raise MissingConfigLocationError(scope) else: properties_file = Scope.WORKSPACE.get_file() if not properties_file: properties_file = Scope.USER.get_file() if not properties_file: raise MissingConfigLocationError(Scope.USER) parsed_config = ConfigParser.ConfigParser() parsed_config.read(properties_file) if not parsed_config.has_section(prop.section): if value is None: return parsed_config.add_section(prop.section) if value is None: parsed_config.remove_option(prop.section, prop.name) else: parsed_config.set(prop.section, prop.name, str(value)) properties_dir, unused_name = os.path.split(properties_file) files.MakeDir(properties_dir) with open(properties_file, 'w') as fp: parsed_config.write(fp) _PropertiesFile.Invalidate() def _GetProperty(prop, properties_file, required): """Gets the given property. If the property has a designated command line argument and args is provided, check args for the value first. If the corresponding environment variable is set, use that second. If still nothing, use the callbacks. Args: prop: properties.Property, The property to get. properties_file: _PropertiesFile, An already loaded properties files to use. required: bool, True to raise an exception if the property is not set. Raises: RequiredPropertyError: If the property was required but unset. Returns: str, The value of the property, or None if it is not set. """ flag_to_use = None invocation_stack = VALUES.GetInvocationStack() if len(invocation_stack) > 1: # First item is the blank stack entry, second is from the user command args. first_invocation = invocation_stack[1] if prop in first_invocation: flag_to_use = first_invocation.get(prop).flag value = _GetPropertyWithoutCallback(prop, properties_file) if value is not None: return str(value) # Still nothing, fall back to the callbacks. for callback in prop.callbacks: value = callback() if value is not None: return str(value) # Not
<filename>kubelet/datadog_checks/kubelet/kubelet.py # (C) Datadog, Inc. 2016-2017 # All rights reserved # Licensed under Simplified BSD License (see LICENSE) # stdlib import logging import re from urlparse import urljoin # 3p import requests # project from datadog_checks.checks import AgentCheck from datadog_checks.errors import CheckException from datadog_checks.checks.prometheus import PrometheusCheck from kubeutil import get_connection_info from tagger import get_tags METRIC_TYPES = ['counter', 'gauge', 'summary'] # container-specific metrics should have all these labels CONTAINER_LABELS = ['container_name', 'namespace', 'pod_name', 'name', 'image', 'id'] KUBELET_HEALTH_PATH = '/healthz' NODE_SPEC_PATH = '/spec' POD_LIST_PATH = '/pods/' CADVISOR_METRICS_PATH = '/metrics/cadvisor' # Suffixes per # https://github.com/kubernetes/kubernetes/blob/8fd414537b5143ab039cb910590237cabf4af783/pkg/api/resource/suffix.go#L108 FACTORS = { 'n': float(1)/(1000*1000*1000), 'u': float(1)/(1000*1000), 'm': float(1)/1000, 'k': 1000, 'M': 1000*1000, 'G': 1000*1000*1000, 'T': 1000*1000*1000*1000, 'P': 1000*1000*1000*1000*1000, 'E': 1000*1000*1000*1000*1000*1000, 'Ki': 1024, 'Mi': 1024*1024, 'Gi': 1024*1024*1024, 'Ti': 1024*1024*1024*1024, 'Pi': 1024*1024*1024*1024*1024, 'Ei': 1024*1024*1024*1024*1024*1024, } log = logging.getLogger('collector') class KubeletCheck(PrometheusCheck): """ Collect container metrics from Kubelet. """ def __init__(self, name, init_config, agentConfig, instances=None): super(KubeletCheck, self).__init__(name, init_config, agentConfig, instances) self.NAMESPACE = 'kubernetes' if instances is not None and len(instances) > 1: raise Exception('Kubelet check only supports one configured instance.') inst = instances[0] if instances else None self.kube_node_labels = inst.get('node_labels_to_host_tags', {}) self.metrics_mapper = { 'kubelet_runtime_operations_errors': 'kubelet.runtime.errors', } self.ignore_metrics = [ 'container_cpu_cfs_periods_total', 'container_cpu_cfs_throttled_periods_total', 'container_cpu_cfs_throttled_seconds_total', 'container_cpu_load_average_10s', 'container_cpu_system_seconds_total', 'container_cpu_user_seconds_total', 'container_fs_inodes_free', 'container_fs_inodes_total', 'container_fs_io_current', 'container_fs_io_time_seconds_total', 'container_fs_io_time_weighted_seconds_total', 'container_fs_read_seconds_total', 'container_fs_reads_merged_total', 'container_fs_reads_total', 'container_fs_sector_reads_total', 'container_fs_sector_writes_total', 'container_fs_write_seconds_total', 'container_fs_writes_merged_total', 'container_fs_writes_total', 'container_last_seen', 'container_start_time_seconds', 'container_spec_memory_swap_limit_bytes', 'container_scrape_error' ] # these are filled by container_<metric-name>_usage_<metric-unit> # and container_<metric-name>_limit_<metric-unit> reads it to compute <metric-name>usage_pct self.fs_usage_bytes = {} self.mem_usage_bytes = {} def check(self, instance): self.kubelet_conn_info = get_connection_info() endpoint = self.kubelet_conn_info.get('url') if endpoint is None: raise CheckException("Unable to find metrics_endpoint in config " "file or detect the kubelet URL automatically.") self.metrics_url = instance.get('metrics_endpoint') or urljoin(endpoint, CADVISOR_METRICS_PATH) self.kube_health_url = urljoin(endpoint, KUBELET_HEALTH_PATH) self.node_spec_url = urljoin(endpoint, NODE_SPEC_PATH) self.pod_list_url = urljoin(endpoint, POD_LIST_PATH) # By default we send the buckets. send_buckets = instance.get('send_histograms_buckets', True) if send_buckets is not None and str(send_buckets).lower() == 'false': send_buckets = False else: send_buckets = True try: self.pod_list = self.retrieve_pod_list() except Exception: self.pod_list = None instance_tags = instance.get('tags', []) self._perform_kubelet_check(instance_tags) self._report_node_metrics(instance_tags) self._report_pods_running(self.pod_list, instance_tags) self._report_container_spec_metrics(self.pod_list, instance_tags) self.process(self.metrics_url, send_histograms_buckets=send_buckets, instance=instance) def perform_kubelet_query(self, url, verbose=True, timeout=10): """ Perform and return a GET request against kubelet. Support auth and TLS validation. """ headers = None cert = (self.kubelet_conn_info.get('client_crt'), self.kubelet_conn_info.get('client_key')) if not cert[0] or not cert[1]: cert = None else: self.ssl_cert = cert # prometheus check setting if self.kubelet_conn_info.get('verify_tls') == 'false': verify = False else: verify = self.kubelet_conn_info.get('ca_cert') self.ssl_ca_cert = verify # prometheus check setting # if cert-based auth is enabled, don't use the token. if not cert and url.lower().startswith('https') and 'token' in self.kubelet_conn_info: headers = {'Authorization': 'Bearer {}'.format(self.kubelet_conn_info['token'])} self.extra_headers = headers # prometheus check setting return requests.get(url, timeout=timeout, verify=verify, cert=cert, headers=headers, params={'verbose': verbose}) def retrieve_pod_list(self): return self.perform_kubelet_query(self.pod_list_url).json() def retrieve_node_spec(self): """ Retrieve node spec from kubelet. """ node_spec = self.perform_kubelet_query(self.node_spec_url).json() # TODO: report allocatable for cpu, mem, and pod capacity # if we can get it locally or thru the DCA instead of the /nodes endpoint directly return node_spec def _report_node_metrics(self, instance_tags): node_spec = self.retrieve_node_spec() num_cores = node_spec.get('num_cores', 0) memory_capacity = node_spec.get('memory_capacity', 0) tags = instance_tags self.gauge(self.NAMESPACE + '.cpu.capacity', float(num_cores), tags) self.gauge(self.NAMESPACE + '.memory.capacity', float(memory_capacity), tags) def _perform_kubelet_check(self, instance_tags): """Runs local service checks""" service_check_base = self.NAMESPACE + '.kubelet.check' is_ok = True url = self.kube_health_url try: req = self.perform_kubelet_query(url) for line in req.iter_lines(): # avoid noise; this check is expected to fail since we override the container hostname if line.find('hostname') != -1: continue matches = re.match(r'\[(.)\]([^\s]+) (.*)?', line) if not matches or len(matches.groups()) < 2: continue service_check_name = service_check_base + '.' + matches.group(2) status = matches.group(1) if status == '+': self.service_check(service_check_name, AgentCheck.OK, tags=instance_tags) else: self.service_check(service_check_name, AgentCheck.CRITICAL, tags=instance_tags) is_ok = False except Exception as e: self.log.warning('kubelet check %s failed: %s' % (url, str(e))) self.service_check(service_check_base, AgentCheck.CRITICAL, message='Kubelet check %s failed: %s' % (url, str(e)), tags=instance_tags) else: if is_ok: self.service_check(service_check_base, AgentCheck.OK, tags=instance_tags) else: self.service_check(service_check_base, AgentCheck.CRITICAL, tags=instance_tags) def _report_pods_running(self, pods, instance_tags): """ Reports the number of running pods on this node tagged by service and creator. """ tag_counter = {} for pod in pods['items']: pod_id = pod.get('metadata', {}).get('uid') tags = get_tags('kubernetes_pod://%s' % pod_id, False) or None if not tags: continue hash_tags = tuple(sorted(tags)) if hash_tags in tag_counter.keys(): tag_counter[hash_tags] += 1 else: tag_counter[hash_tags] = 1 for tags, count in tag_counter.iteritems(): self.gauge(self.NAMESPACE + '.pods.running', count, list(tags)) def _report_container_spec_metrics(self, pod_list, instance_tags): """Reports pod requests & limits by looking at pod specs.""" for pod in pod_list['items']: pod_name = pod.get('metadata', {}).get('name') if not pod_name: continue for ctr in pod['spec']['containers']: if not ctr.get('resources'): continue c_name = ctr.get('name', '') cid = None for ctr_status in pod['status'].get('containerStatuses', []): if ctr_status.get('name') == c_name: # it is already prefixed with 'docker://' cid = ctr_status.get('containerID') break if not cid: continue tags = get_tags('%s' % cid, True) try: for resource, value_str in ctr.get('resources', {}).get('requests', {}).iteritems(): value = self.parse_quantity(value_str) self.gauge('{}.{}.requests'.format(self.NAMESPACE, resource), value, tags) except (KeyError, AttributeError) as e: self.log.debug("Unable to retrieve container requests for %s: %s", c_name, e) try: for resource, value_str in ctr.get('resources', {}).get('limits', {}).iteritems(): value = self.parse_quantity(value_str) self.gauge('{}.{}.limits'.format(self.NAMESPACE, resource), value, tags) except (KeyError, AttributeError) as e: self.log.debug("Unable to retrieve container limits for %s: %s", c_name, e) @staticmethod def parse_quantity(s): number = '' unit = '' for c in s: if c.isdigit() or c == '.': number += c else: unit += c return float(number) * FACTORS.get(unit, 1) def _is_container_metric(self, metric): """ Return whether a metric is about a container or not. It can be about pods, or even higher levels in the cgroup hierarchy and we don't want to report on that. """ for lbl in CONTAINER_LABELS: if lbl == 'container_name': for ml in metric.label: if ml.name == lbl: if ml.value == '' or ml.value == 'POD': return False if lbl not in [ml.name for ml in metric.label]: return False return True def _is_pod_metric(self, metric): """ Return whether a metric is about a pod or not. It can be about containers, pods, or higher levels in the cgroup hierarchy and we don't want to report on that. """ for ml in metric.label: if ml.name == 'container_name' and ml.value == 'POD': return True # container_cpu_usage_seconds_total has an id label that is a cgroup path # eg: /kubepods/burstable/pod531c80d9-9fc4-11e7-ba8b-42010af002bb # FIXME: this was needed because of a bug: # https://github.com/kubernetes/kubernetes/pull/51473 # starting from k8s 1.8 we can remove this elif ml.name == 'id' and ml.value.split('/')[-1].startswith('pod'): return True return False def _get_container_label(self, labels, l_name): for label in labels: if label.name == l_name: return label.value def _get_container_id(self, labels): """ Should only be called on a container-scoped metric as it doesn't do any validation of the container id. It simply returns the last part of the cgroup hierarchy. """ for label in labels: if label.name == 'id': return label.value.split('/')[-1] @staticmethod def _get_pod_uid(labels): for label in labels: if label.name == 'id': for part in label.value.split('/'): if part.startswith('pod'): return part[3:] def _is_pod_host_networked(self, pod_uid): for pod in self.pod_list['items']: if pod.get('metadata', {}).get('uid', '') == pod_uid: return pod.get('spec', {}).get('hostNetwork', False) return False def _get_pod_by_metric_label(self, labels): """ :param labels: metric labels: iterable :return: """ pod_uid = self._get_pod_uid(labels) for pod in self.pod_list["items"]: try: if pod["metadata"]["uid"] == pod_uid: return pod except KeyError: continue return None @staticmethod def _is_static_pending_pod(pod): """ Return if the pod is a static pending pod See https://github.com/kubernetes/kubernetes/pull/57106 :param pod: dict :return: bool """ try: if pod["metadata"]["annotations"]["kubernetes.io/config.source"] == "api": return False pod_status = pod["status"] if pod_status["phase"] != "Pending": return False return "containerStatuses" not in pod_status except KeyError: return False @staticmethod def _get_tags_from_labels(labels): """ Get extra tags from metric labels label { name: "container_name" value: "kube-proxy" } :param labels: metric labels: iterable :return: list """ tags = [] for label in labels: if label.name == "container_name": tags.append("kube_container_name:%s" % label.value) return tags return tags def _process_container_rate(self, metric_name, message): """Takes a simple metric about a container, reports it as a rate.""" if message.type >= len(METRIC_TYPES): self.log.error("Metric type %s unsupported for metric %s" % (message.type, message.name)) return for metric in message.metric: if self._is_container_metric(metric): c_id = self._get_container_id(metric.label) tags = get_tags('docker://%s' % c_id, True) # FIXME we are forced to do that because the Kubelet PodList isn't updated # for static pods, see https://github.com/kubernetes/kubernetes/pull/59948 pod = self._get_pod_by_metric_label(metric.label) if pod is not None and self._is_static_pending_pod(pod): tags += get_tags('kubernetes_pod://%s'
<gh_stars>0 #!/usr/bin/env python # Copyright (c) 2014 Johns Hopkins University # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions # are met: # # - Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # - Redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the # distribution. # - Neither the name of the copyright holders nor the names of # its contributors may be used to endorse or promote products derived # from this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS # FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL # THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, # INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES # (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR # SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) # HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, # STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) # ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED # OF THE POSSIBILITY OF SUCH DAMAGE. import matplotlib.pyplot as plt import networkx as nx import sqlite3 import sys import random from math import log import pdb class TestbedMap(object): def __init__(self, nsluFile='config/nslu_locations.txt', nodeFile='config/node_map.txt', mapFile='static/floorplan.50.png', scriptDir=None): """Set up a floorplan map of testbed nodes""" if not scriptDir: scriptDir='/'.join(sys.argv[0].split('/')[:-1]) scriptDir = scriptDir+'/' #add background image self.im = plt.imread(scriptDir+mapFile) #read NSLU locations f = open(scriptDir+nsluFile) nslus={} for l in f.readlines(): if not l.startswith("#"): [nslu, port, x, y] = [int(v) for v in l.split()] if nslu not in nslus: nslus[nslu] = {} nslus[nslu][port] = (x,y) #read node-nslu mapping and get node locations nodes = {} f = open(scriptDir+nodeFile) for l in f.readlines(): if not l.startswith("#"): [nslu, port, nodeId] = [int(v) for v in l.split()] if nslu in nslus: nodes[nodeId] = {'pos':nslus[nslu][port], 'nslu':nslu} else: #TODO: log missing node error pass self.G = nx.DiGraph() self.G.add_nodes_from([(n, nodes[n]) for n in nodes]) self.labelMap = None def drawCMapNodes(self, node_size, palette): """ Draw nodes, color according to palette/colorMap""" #pdb.set_trace() circleNodes = [ n for (n, m) in self.G.nodes(data=True) if m.get('shape','circle') == 'circle'] boxNodes = [ n for (n, m) in self.G.nodes(data=True) if m.get('shape','circle') == 'box'] starNodes = [ n for (n, m) in self.G.nodes(data=True) if m.get('shape','circle') == 'star'] if circleNodes: nx.draw_networkx_nodes(self.G, pos=nx.get_node_attributes(self.G, 'pos'), node_size=node_size, nodelist = [n for n in reversed(circleNodes)] , node_color=[self.G.node[n][self.colAttr] for n in reversed(circleNodes)] , cmap = palette , linewidths = [self.G.node[n].get('linewidth', 1.0) for n in reversed(circleNodes)] ) if boxNodes: nx.draw_networkx_nodes(self.G, pos=nx.get_node_attributes(self.G, 'pos'), node_size=2*node_size, nodelist = [n for n in reversed(boxNodes)] , node_color=[self.G.node[n][self.colAttr] for n in reversed(boxNodes)] , cmap = palette , linewidths = [self.G.node[n].get('linewidth', 1.0) for n in reversed(boxNodes)] , node_shape='s' ) if starNodes: nx.draw_networkx_nodes(self.G, pos=nx.get_node_attributes(self.G, 'pos'), node_size=2*node_size, nodelist = [n for n in reversed(starNodes)] , node_color=[self.G.node[n][self.colAttr] for n in reversed(starNodes)] , cmap = palette , linewidths = [self.G.node[n].get('linewidth', 1.0) for n in reversed(starNodes)] , node_shape=(5,1) ) def drawEdges(self, alpha=0.2): """Draw a set of edges on the graph.""" nx.draw_networkx_edges(self.G, pos = nx.get_node_attributes(self.G, 'pos'), edgelist=self.G.edges(), arrows=False, alpha=0.2) def drawLabels(self, labelAll=True): """Draw labels on nodes in graph (nodeId by default)""" # circleNodes = [ n for (n, m) in self.G.nodes(data=True) if m.get('shape','circle') == 'circle'] # pdb.set_trace() if labelAll: nx.draw_networkx_labels(self.G, pos=nx.get_node_attributes(self.G, 'pos'), font_size=10, labels=self.labelMap) else: # boxNodes = [ n for (n, m) in self.G.nodes(data=True) if m.get('shape','circle') == 'box'] # lm = {} # for n in boxNodes: # lm[n]=self.labelMap[n] # nx.draw_networkx_labels(self.G, # pos=nx.get_node_attributes(self.G, 'pos'), # font_size=10, # labels=lm) emptyNodes = [ n for (n,m) in self.G.nodes(data=True) if m.get('shape','circle') == 'empty'] if emptyNodes: lm = {} for n in emptyNodes: lm[n]=self.labelMap[n] nx.draw_networkx_labels(self.G, pos=nx.get_node_attributes(self.G, 'pos'), font_size=10, labels=lm) def setAttr(self, attr, attrMap, defaultVal=None): #ugly: we want to have a way to enforce that every node has a # value in this map. if defaultVal is not None: for n in self.G.nodes(): if n not in attrMap: attrMap[n] = defaultVal nx.set_node_attributes(self.G, attr, attrMap) def setColAttr(self, colAttr): self.colAttr = colAttr def setLabels(self, labelMap): self.labelMap = labelMap def addOutlined(self, nodeId, width): self.G.node[nodeId]['linewidth'] = width def draw(self, outFile=None, node_size=200, palette=plt.cm.jet, labelAll= True, bgImage=True): if bgImage: implot = plt.imshow(self.im) self.drawCMapNodes(node_size, palette) self.drawEdges() self.drawLabels(labelAll) self.postDraw() if not outFile: plt.show() else: format = outFile.split('.')[-1] F = plt.gcf() plt.ylim(0, 1000) plt.xlim(0, 1000) F.set_size_inches([8, 8]) plt.savefig(outFile, format=format) pass def postDraw(self): pass def textOutput(self): print 'node,%s'%self.colAttr for n in self.G.nodes(): print '%d,%f'%(n, self.G.node[n][self.colAttr]) class SingleTXDepth(TestbedMap): def __init__(self, root, dbFile, sr, txp, packetLen, prr_threshold=0.0, rssi_threshold=-100, distanceLabels = False, addKey=True, **kwargs): print root, dbFile, sr, txp, packetLen, prr_threshold, rssi_threshold, distanceLabels super(SingleTXDepth, self).__init__(**kwargs) self.loadPrrEdges(dbFile, sr, txp, packetLen, prr_threshold, rssi_threshold) self.distances = self.computeSPs(root) self.distances[root]=1 self.G.node[root]['shape']='star' if addKey: key = {} key[70] = {'pos': (25, 30), 'shape':'box'} key[71] = {'pos': (25, 80), 'shape':'box'} key[72] = {'pos': (25, 130), 'shape':'box'} key[73] = {'pos': (25, 180), 'shape':'box'} key[74] = {'pos': (25, 230), 'shape':'box'} self.distances[70] = 1 self.distances[71] = 2 self.distances[72] = 3 self.distances[73] = 4 self.distances[74] = 5 key[80] = {'pos': (65, 30), 'shape':'empty'} key[81] = {'pos': (65, 80), 'shape':'empty'} key[82] = {'pos': (65, 130), 'shape':'empty'} key[83] = {'pos': (65, 180), 'shape':'empty'} key[84] = {'pos': (65, 230), 'shape':'empty'} self.distances[80] = 1 self.distances[81] = 2 self.distances[82] = 3 self.distances[83] = 4 self.distances[84] = 5 self.G.add_nodes_from([(k, key[k]) for k in key]) self.setAttr('distance', self.distances) self.setColAttr('distance') self.addOutlined(root, 2) if distanceLabels: self.setLabels(self.distances) def loadPrrEdges(self, dbFile, sr, txp, packetLen, prr_threshold, rssi_threshold): c = sqlite3.connect(dbFile) links = c.execute('SELECT src, dest, prr FROM link WHERE sr=? AND txPower=? AND len=? AND prr >=? and avgRssi >=?', (sr, txp, packetLen, prr_threshold, rssi_threshold)).fetchall() for (src, dest, prr) in links: self.G.add_edge(src, dest, prr=prr) def computeSPs(self, root, unreachableVal=0): """Compute length of shortest paths from root to each other node""" p = nx.single_source_shortest_path_length(self.G, root) #fill in unreachable node values maxDepth= max([v for v in p.values()]) for nodeId in self.G.nodes(): if nodeId not in p: p[nodeId] = maxDepth return p class Degree(TestbedMap): def __init__(self, dbFile, sr, txp, packetLen, prr_threshold=0.0, degreeLabels = False, **kwargs): super(Degree, self).__init__(**kwargs) self.loadPrrEdges(dbFile, sr, txp, packetLen, prr_threshold) self.degrees = self.computeDegrees() self.setAttr('degree', self.degrees) self.setColAttr('degree') if degreeLabels: self.setLabels(self.degrees) def loadPrrEdges(self, dbFile, sr, txp, packetLen, prr_threshold): c = sqlite3.connect(dbFile) links = c.execute('SELECT src, dest, prr FROM link WHERE sr=? AND txPower=? AND len=? AND prr >=?', (sr, txp, packetLen, prr_threshold)).fetchall() for (src, dest, prr) in links: self.G.add_edge(src, dest, prr=prr) def computeDegrees(self): return self.G.in_degree() class CXDistance(TestbedMap): def __init__(self, dbFile, node, distanceFrom, **kwargs): super(CXDistance, self).__init__(**kwargs) self.loadDistances(node, distanceFrom, dbFile) self.loadErrors(dbFile) self.setAttr('distance', self.distances, 0) self.setColAttr('distance') self.addOutlined(node, 10) for nodeId in self.errors: self.addOutlined(nodeId, 3) rounded = dict( [ (k, "%.1f"%self.distances[k]) for k in self.distances]) self.setLabels(rounded) def loadDistances(self, node, distanceFrom, dbFile): c = sqlite3.connect(dbFile) if distanceFrom: self.distances = dict(c.execute('SELECT dest, avgDepth FROM agg_depth WHERE src=?', (node,))) else: self.distances = dict(c.execute('SELECT src, avgDepth FROM agg_depth WHERE dest=?', (node,))) self.distances[node] = 0 c.close() def loadErrors(self, dbFile): c = sqlite3.connect(dbFile) self.errors = [ nodeId for (nodeId,) in c.execute('SELECT node from error_events')] class CXForwarders(TestbedMap): def __init__(self, src, dest, dbFile, outlineErrors=False, addKey=True, **kwargs): super(CXForwarders, self).__init__(**kwargs) self.loadForwarders(src, dest, dbFile) self.loadErrors(dbFile) self.fwdRatio[src]=1.0 self.fwdRatio[dest]=1.0 self.G.node[src]['shape']='star' self.G.node[dest]['shape']='star' self.addOutlined(src, 2) self.addOutlined(dest, 2) for n in self.errors: self.G.node[n]['shape'] = 'none' if addKey: self.addKeyToFigure() self.setAttr('fwdRatio', self.fwdRatio, 0) self.setColAttr('fwdRatio') if outlineErrors: for nodeId in self.errors: self.addOutlined(nodeId, 3) rounded = dict([ (k, "%.2f"%self.fwdRatio[k]) for k in self.fwdRatio]) self.setLabels(rounded) def addKeyToFigure(self): key = {} key[70] = {'pos': (25, 30), 'shape':'box'} key[71] = {'pos': (25, 80), 'shape':'box'} key[72] = {'pos': (25, 130), 'shape':'box'} key[73] = {'pos': (25, 180), 'shape':'box'} key[74] = {'pos': (25, 230), 'shape':'box'} self.fwdRatio[70] = 0 self.fwdRatio[71] = 0.25 self.fwdRatio[72] = 0.50 self.fwdRatio[73] = 0.75 self.fwdRatio[74] = 1.0 key[80] = {'pos': (75, 30), 'shape':'empty'} key[81] = {'pos': (75, 80), 'shape':'empty'} key[82] = {'pos': (75, 130), 'shape':'empty'}
obj._deserialize(item) self.SelectedTables.append(obj) memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if len(memeber_set) > 0: warnings.warn("%s fileds are useless." % ",".join(memeber_set)) class DeleteSnapshotsResponse(AbstractModel): """DeleteSnapshots返回参数结构体 """ def __init__(self): r""" :param TotalCount: 批量删除的快照数量 :type TotalCount: int :param TableResults: 批量删除的快照结果 :type TableResults: list of SnapshotResult :param RequestId: 唯一请求 ID,每次请求都会返回。定位问题时需要提供该次请求的 RequestId。 :type RequestId: str """ self.TotalCount = None self.TableResults = None self.RequestId = None def _deserialize(self, params): self.TotalCount = params.get("TotalCount") if params.get("TableResults") is not None: self.TableResults = [] for item in params.get("TableResults"): obj = SnapshotResult() obj._deserialize(item) self.TableResults.append(obj) self.RequestId = params.get("RequestId") class DeleteTableDataFlowRequest(AbstractModel): """DeleteTableDataFlow请求参数结构体 """ def __init__(self): r""" :param ClusterId: 表格所属集群实例ID :type ClusterId: str :param SelectedTables: 待删除分布式索引的表格列表 :type SelectedTables: list of SelectedTableInfoNew """ self.ClusterId = None self.SelectedTables = None def _deserialize(self, params): self.ClusterId = params.get("ClusterId") if params.get("SelectedTables") is not None: self.SelectedTables = [] for item in params.get("SelectedTables"): obj = SelectedTableInfoNew() obj._deserialize(item) self.SelectedTables.append(obj) memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if len(memeber_set) > 0: warnings.warn("%s fileds are useless." % ",".join(memeber_set)) class DeleteTableDataFlowResponse(AbstractModel): """DeleteTableDataFlow返回参数结构体 """ def __init__(self): r""" :param TotalCount: 删除表格分布式索引结果数量 :type TotalCount: int :param TableResults: 删除表格分布式索引结果列表 :type TableResults: list of TableResultNew :param RequestId: 唯一请求 ID,每次请求都会返回。定位问题时需要提供该次请求的 RequestId。 :type RequestId: str """ self.TotalCount = None self.TableResults = None self.RequestId = None def _deserialize(self, params): self.TotalCount = params.get("TotalCount") if params.get("TableResults") is not None: self.TableResults = [] for item in params.get("TableResults"): obj = TableResultNew() obj._deserialize(item) self.TableResults.append(obj) self.RequestId = params.get("RequestId") class DeleteTableGroupRequest(AbstractModel): """DeleteTableGroup请求参数结构体 """ def __init__(self): r""" :param ClusterId: 表格组所属的集群ID :type ClusterId: str :param TableGroupId: 表格组ID :type TableGroupId: str """ self.ClusterId = None self.TableGroupId = None def _deserialize(self, params): self.ClusterId = params.get("ClusterId") self.TableGroupId = params.get("TableGroupId") memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if len(memeber_set) > 0: warnings.warn("%s fileds are useless." % ",".join(memeber_set)) class DeleteTableGroupResponse(AbstractModel): """DeleteTableGroup返回参数结构体 """ def __init__(self): r""" :param TaskId: 删除表格组所创建的任务ID :type TaskId: str :param RequestId: 唯一请求 ID,每次请求都会返回。定位问题时需要提供该次请求的 RequestId。 :type RequestId: str """ self.TaskId = None self.RequestId = None def _deserialize(self, params): self.TaskId = params.get("TaskId") self.RequestId = params.get("RequestId") class DeleteTableIndexRequest(AbstractModel): """DeleteTableIndex请求参数结构体 """ def __init__(self): r""" :param ClusterId: 表格所属集群实例ID :type ClusterId: str :param SelectedTables: 待删除分布式索引的表格列表 :type SelectedTables: list of SelectedTableInfoNew """ self.ClusterId = None self.SelectedTables = None def _deserialize(self, params): self.ClusterId = params.get("ClusterId") if params.get("SelectedTables") is not None: self.SelectedTables = [] for item in params.get("SelectedTables"): obj = SelectedTableInfoNew() obj._deserialize(item) self.SelectedTables.append(obj) memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if len(memeber_set) > 0: warnings.warn("%s fileds are useless." % ",".join(memeber_set)) class DeleteTableIndexResponse(AbstractModel): """DeleteTableIndex返回参数结构体 """ def __init__(self): r""" :param TotalCount: 删除表格分布式索引结果数量 :type TotalCount: int :param TableResults: 删除表格分布式索引结果列表 :type TableResults: list of TableResultNew :param RequestId: 唯一请求 ID,每次请求都会返回。定位问题时需要提供该次请求的 RequestId。 :type RequestId: str """ self.TotalCount = None self.TableResults = None self.RequestId = None def _deserialize(self, params): self.TotalCount = params.get("TotalCount") if params.get("TableResults") is not None: self.TableResults = [] for item in params.get("TableResults"): obj = TableResultNew() obj._deserialize(item) self.TableResults.append(obj) self.RequestId = params.get("RequestId") class DeleteTablesRequest(AbstractModel): """DeleteTables请求参数结构体 """ def __init__(self): r""" :param ClusterId: 待删除表所在集群ID :type ClusterId: str :param SelectedTables: 待删除表信息列表 :type SelectedTables: list of SelectedTableInfoNew """ self.ClusterId = None self.SelectedTables = None def _deserialize(self, params): self.ClusterId = params.get("ClusterId") if params.get("SelectedTables") is not None: self.SelectedTables = [] for item in params.get("SelectedTables"): obj = SelectedTableInfoNew() obj._deserialize(item) self.SelectedTables.append(obj) memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if len(memeber_set) > 0: warnings.warn("%s fileds are useless." % ",".join(memeber_set)) class DeleteTablesResponse(AbstractModel): """DeleteTables返回参数结构体 """ def __init__(self): r""" :param TotalCount: 删除表结果数量 :type TotalCount: int :param TableResults: 删除表结果详情列表 :type TableResults: list of TableResultNew :param RequestId: 唯一请求 ID,每次请求都会返回。定位问题时需要提供该次请求的 RequestId。 :type RequestId: str """ self.TotalCount = None self.TableResults = None self.RequestId = None def _deserialize(self, params): self.TotalCount = params.get("TotalCount") if params.get("TableResults") is not None: self.TableResults = [] for item in params.get("TableResults"): obj = TableResultNew() obj._deserialize(item) self.TableResults.append(obj) self.RequestId = params.get("RequestId") class DescribeApplicationsRequest(AbstractModel): """DescribeApplications请求参数结构体 """ def __init__(self): r""" :param ClusterId: 集群ID,用于获取指定集群的单据 :type ClusterId: str :param Limit: 分页 :type Limit: int :param Offset: 分页 :type Offset: int :param CensorStatus: 申请单状态,用于过滤 :type CensorStatus: int :param TableGroupId: 表格组id,用于过滤 :type TableGroupId: str :param TableName: 表格名,用于过滤 :type TableName: str :param Applicant: 申请人uin,用于过滤 :type Applicant: str :param ApplyType: 申请类型,用于过滤 :type ApplyType: int """ self.ClusterId = None self.Limit = None self.Offset = None self.CensorStatus = None self.TableGroupId = None self.TableName = None self.Applicant = None self.ApplyType = None def _deserialize(self, params): self.ClusterId = params.get("ClusterId") self.Limit = params.get("Limit") self.Offset = params.get("Offset") self.CensorStatus = params.get("CensorStatus") self.TableGroupId = params.get("TableGroupId") self.TableName = params.get("TableName") self.Applicant = params.get("Applicant") self.ApplyType = params.get("ApplyType") memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if len(memeber_set) > 0: warnings.warn("%s fileds are useless." % ",".join(memeber_set)) class DescribeApplicationsResponse(AbstractModel): """DescribeApplications返回参数结构体 """ def __init__(self): r""" :param Applications: 申请单列表 :type Applications: list of Application :param TotalCount: 申请单个数 :type TotalCount: int :param RequestId: 唯一请求 ID,每次请求都会返回。定位问题时需要提供该次请求的 RequestId。 :type RequestId: str """ self.Applications = None self.TotalCount = None self.RequestId = None def _deserialize(self, params): if params.get("Applications") is not None: self.Applications = [] for item in params.get("Applications"): obj = Application() obj._deserialize(item) self.Applications.append(obj) self.TotalCount = params.get("TotalCount") self.RequestId = params.get("RequestId") class DescribeClusterTagsRequest(AbstractModel): """DescribeClusterTags请求参数结构体 """ def __init__(self): r""" :param ClusterIds: 集群ID列表 :type ClusterIds: list of str """ self.ClusterIds = None def _deserialize(self, params): self.ClusterIds = params.get("ClusterIds") memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if len(memeber_set) > 0: warnings.warn("%s fileds are useless." % ",".join(memeber_set)) class DescribeClusterTagsResponse(AbstractModel): """DescribeClusterTags返回参数结构体 """ def __init__(self): r""" :param Rows: 集群标签信息列表 注意:此字段可能返回 null,表示取不到有效值。 :type Rows: list of TagsInfoOfCluster :param TotalCount: 返回结果个数 注意:此字段可能返回 null,表示取不到有效值。 :type TotalCount: int :param RequestId: 唯一请求 ID,每次请求都会返回。定位问题时需要提供该次请求的 RequestId。 :type RequestId: str """ self.Rows = None self.TotalCount = None self.RequestId = None def _deserialize(self, params): if params.get("Rows") is not None: self.Rows = [] for item in params.get("Rows"): obj = TagsInfoOfCluster() obj._deserialize(item) self.Rows.append(obj) self.TotalCount = params.get("TotalCount") self.RequestId = params.get("RequestId") class DescribeClustersRequest(AbstractModel): """DescribeClusters请求参数结构体 """ def __init__(self): r""" :param ClusterIds: 指定查询的集群ID列表 :type ClusterIds: list of str :param Filters: 查询过滤条件 :type Filters: list of Filter :param Offset: 查询列表偏移量 :type Offset: int :param Limit: 查询列表返回记录数,默认值20 :type Limit: int :param Ipv6Enable: 是否启用Ipv6 :type Ipv6Enable: int """ self.ClusterIds = None self.Filters = None self.Offset = None self.Limit = None self.Ipv6Enable = None def _deserialize(self, params): self.ClusterIds = params.get("ClusterIds") if params.get("Filters") is not None: self.Filters = [] for item in params.get("Filters"): obj = Filter() obj._deserialize(item) self.Filters.append(obj) self.Offset = params.get("Offset") self.Limit = params.get("Limit") self.Ipv6Enable = params.get("Ipv6Enable") memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if len(memeber_set) > 0: warnings.warn("%s fileds are useless." % ",".join(memeber_set)) class DescribeClustersResponse(AbstractModel): """DescribeClusters返回参数结构体 """ def __init__(self): r""" :param TotalCount: 集群实例数 :type TotalCount: int :param Clusters: 集群实例列表 :type Clusters: list of ClusterInfo :param RequestId: 唯一请求 ID,每次请求都会返回。定位问题时需要提供该次请求的 RequestId。 :type RequestId: str """ self.TotalCount = None self.Clusters = None self.RequestId = None def _deserialize(self, params): self.TotalCount = params.get("TotalCount") if params.get("Clusters") is not None: self.Clusters = [] for item in params.get("Clusters"): obj = ClusterInfo() obj._deserialize(item) self.Clusters.append(obj) self.RequestId = params.get("RequestId") class DescribeIdlFileInfosRequest(AbstractModel): """DescribeIdlFileInfos请求参数结构体 """ def __init__(self): r""" :param ClusterId: 文件所属集群ID :type ClusterId: str :param TableGroupIds: 文件所属表格组ID :type TableGroupIds: list of str :param IdlFileIds: 指定文件ID列表 :type IdlFileIds: list of str :param Offset: 查询列表偏移量 :type Offset: int :param Limit: 查询列表返回记录数 :type Limit: int """ self.ClusterId = None self.TableGroupIds = None self.IdlFileIds = None self.Offset = None self.Limit = None def _deserialize(self, params): self.ClusterId = params.get("ClusterId") self.TableGroupIds = params.get("TableGroupIds") self.IdlFileIds = params.get("IdlFileIds") self.Offset = params.get("Offset") self.Limit = params.get("Limit") memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if len(memeber_set) > 0: warnings.warn("%s fileds are useless." % ",".join(memeber_set)) class DescribeIdlFileInfosResponse(AbstractModel): """DescribeIdlFileInfos返回参数结构体 """ def __init__(self): r""" :param TotalCount: 文件数量 :type TotalCount: int :param IdlFileInfos: 文件详情列表 :type IdlFileInfos: list of IdlFileInfo :param RequestId: 唯一请求 ID,每次请求都会返回。定位问题时需要提供该次请求的 RequestId。 :type RequestId: str """ self.TotalCount = None self.IdlFileInfos = None self.RequestId = None def _deserialize(self, params): self.TotalCount = params.get("TotalCount") if params.get("IdlFileInfos") is not None: self.IdlFileInfos = [] for item in params.get("IdlFileInfos"): obj = IdlFileInfo() obj._deserialize(item) self.IdlFileInfos.append(obj) self.RequestId = params.get("RequestId") class DescribeMachineRequest(AbstractModel): """DescribeMachine请求参数结构体 """ def __init__(self): r""" :param Ipv6Enable: 不为0,表示查询支持ipv6的机器 :type Ipv6Enable: int """ self.Ipv6Enable = None def _deserialize(self, params): self.Ipv6Enable = params.get("Ipv6Enable") memeber_set = set(params.keys()) for name, value in vars(self).items(): if name in memeber_set: memeber_set.remove(name) if
nbar.x_index {sort}, nbar.y_index {sort} """.format(sort=sort.value) params = {"tile_type": [TILE_TYPE.value], "tile_class": [tile_class.value for tile_class in TILE_CLASSES], "satellite": [satellite.value for satellite in satellites], "geom": bytearray(wkb), "acq_min": acq_min, "acq_max": acq_max, "level_nbar": ProcessingLevel.NBAR.value} if DatasetType.PQ25 in dataset_types: params["level_pqa"] = ProcessingLevel.PQA.value if DatasetType.FC25 in dataset_types: params["level_fc"] = ProcessingLevel.FC.value if DatasetType.DSM in dataset_types: params["level_dsm"] = ProcessingLevel.DSM.value if DatasetType.DEM in dataset_types: params["level_dem"] = ProcessingLevel.DEM.value if DatasetType.DEM_HYDROLOGICALLY_ENFORCED in dataset_types: params["level_dem_h"] = ProcessingLevel.DEM_H.value if DatasetType.DEM_SMOOTHED in dataset_types: params["level_dem_s"] = ProcessingLevel.DEM_S.value return sql, params # TODO - disabling this for now as I don't think the queries perform very well and nothing is currently using them # as the AOI filtering is done at the CELL level rather than the TILE level. # I'll do some work on the queries shortly! # # TILE # # def list_tiles_vector_file(vector_file, vector_layer, vector_feature, satellites, acq_min, acq_max, dataset_types, sort=SortType.ASC, config=None): # # """ # Return a list of tiles matching the criteria as a SINGLE-USE generator # # .. warning:: # Deprecated: use either datacube.api.query.list_tiles_wkb_as_list() or datacube.api.query.list_tiles_wkb_as_generator() # # :param vector_file: Vector (ESRI Shapefile, KML, ...) file containing the shape # :type vector_file: str # :param vector_layer: Layer (0 based index) within the vector file # :type vector_layer: int # :param vector_feature: Feature (0 based index) within the layer # :type vector_feature: int # :param satellites: Satellites # :type satellites: list[datacube.api.model.Satellite] # :param acq_min: Acquisition date range # :type acq_min: datetime.datetime # :param acq_max: Acquisition date range # :type acq_max: datetime.datetime # :param dataset_types: Dataset types # :type dataset_types: list[datacube.api.model.DatasetType] # :param sort: Sort order # :type sort: datacube.api.query.SortType # :param config: Config # :type config: datacube.config.Config # # :return: List of tiles # :rtype: list[datacube.api.model.Tile] # """ # return list_tiles_vector_file_as_generator(vector_file, vector_layer, vector_feature, satellites, acq_min, acq_max, dataset_types, sort, config) # # # def list_tiles_vector_file_as_list(vector_file, vector_layer, vector_feature, satellites, acq_min, acq_max, dataset_types, sort=SortType.ASC, config=None): # # """ # Return a list of tiles matching the criteria AS A REUSABLE LIST rather than as a one-use-generator # # :param vector_file: Vector (ESRI Shapefile, KML, ...) file containing the shape # :type vector_file: str # :param vector_layer: Layer (0 based index) within the vector file # :type vector_layer: int # :param vector_feature: Feature (0 based index) within the layer # :type vector_feature: int # :param satellites: Satellites # :type satellites: list[datacube.api.model.Satellite] # :param acq_min: Acquisition date range # :type acq_min: datetime.datetime # :param acq_max: Acquisition date range # :type acq_max: datetime.datetime # :param dataset_types: Dataset types # :type dataset_types: list[datacube.api.model.DatasetType] # :param sort: Sort order # :type sort: datacube.api.query.SortType # :param config: Config # :type config: datacube.config.Config # # :return: List of tiles # :rtype: list[datacube.api.model.Tile] # """ # return list(list_tiles_vector_file_as_generator(vector_file, vector_layer, vector_feature, satellites, acq_min, acq_max, dataset_types, sort, config)) # # # def list_tiles_vector_file_as_generator(vector_file, vector_layer, vector_feature, satellites, acq_min, acq_max, dataset_types, sort=SortType.ASC, config=None): # # """ # Return a list of cells matching the criteria AS A REUSABLE LIST rather than as a one-use-generator # # :param vector_file: Vector (ESRI Shapefile, KML, ...) file containing the shape # :type vector_file: str # :param vector_layer: Layer (0 based index) within the vector file # :type vector_layer: int # :param vector_feature: Feature (0 based index) within the layer # :type vector_feature: int # :param satellites: Satellites # :type satellites: list[datacube.api.model.Satellite] # :param acq_min: Acquisition date range # :type acq_min: datetime.datetime # :param acq_max: Acquisition date range # :type acq_max: datetime.datetime # :param dataset_types: Dataset types # :type dataset_types: list[datacube.api.model.DatasetType] # :param sort: Sort order # :type sort: datacube.api.query.SortType # :param config: Config # :type config: datacube.config.Config # # :return: List of tiles # :rtype: list[datacube.api.model.Tile] # """ # # return list_tiles_wkb_as_generator(extract_feature_geometry_wkb(vector_file, vector_layer, vector_feature), # satellites, acq_min, acq_max, dataset_types, sort, config) # # # def list_tiles_wkb(wkb, satellites, acq_min, acq_max, dataset_types, sort=SortType.ASC, config=None): # # """ # Return a list of tiles matching the criteria as a SINGLE-USE generator # # .. warning:: # Deprecated: use either datacube.api.query.list_tiles_as_list() or datacube.api.query.list_tiles_as_generator() # # :param wkb: Shape as WKB format # :type wkb: WKB # :param satellites: Satellites # :type satellites: list[datacube.api.model.Satellite] # :param acq_min: Acquisition date range # :type acq_min: datetime.datetime # :param acq_max: Acquisition date range # :type acq_max: datetime.datetime # :param dataset_types: Dataset types # :type dataset_types: list[datacube.api.model.DatasetType] # :param sort: Sort order # :type sort: datacube.api.query.SortType # :param config: Config # :type config: datacube.config.Config # # :return: List of tiles # :rtype: list[datacube.api.model.Tile] # """ # return list_tiles_wkb_as_generator(wkb, satellites, acq_min, acq_max, dataset_types, sort, config) # # # def list_tiles_wkb_as_list(wkb, satellites, acq_min, acq_max, dataset_types, sort=SortType.ASC, config=None): # # """ # Return a list of cells matching the criteria AS A REUSABLE LIST rather than as a one-use-generator # # :param wkb: Shape as WKB format # :type wkb: WKB # :param satellites: Satellites # :type satellites: list[datacube.api.model.Satellite] # :param acq_min: Acquisition date range # :type acq_min: datetime.datetime # :param acq_max: Acquisition date range # :type acq_max: datetime.datetime # :param dataset_types: Dataset types # :type dataset_types: list[datacube.api.model.DatasetType] # :param sort: Sort order # :type sort: datacube.api.query.SortType # :param config: Config # :type config: datacube.config.Config # # :return: List of tiles # :rtype: list[datacube.api.model.Tile] # """ # return list(list_tiles_wkb_as_generator(wkb, satellites, acq_min, acq_max, dataset_types, sort)) # # # def list_tiles_wkb_as_generator(wkb, satellites, acq_min, acq_max, dataset_types, sort=SortType.ASC, config=None): # # """ # Return a list of tiles matching the criteria as a SINGLE-USE generator # # :param wkb: Shape as WKB format # :type wkb: WKB # :param satellites: Satellites # :type satellites: list[datacube.api.model.Satellite] # :param acq_min: Acquisition date range # :type acq_min: datetime.datetime # :param acq_max: Acquisition date range # :type acq_max: datetime.datetime # :param dataset_types: Dataset types # :type dataset_types: list[datacube.api.model.DatasetType] # :param sort: Sort order # :type sort: datacube.api.query.SortType # :param config: Config # :type config: datacube.config.Config # # :return: List of tiles # :rtype: list[datacube.api.model.Tile] # """ # # conn, cursor = None, None # # try: # # connect to database # # conn, cursor = connect_to_db(config=config) # # sql, params = build_list_tiles_wkb_sql_and_params(wkb, satellites, acq_min, acq_max, dataset_types, sort) # # _log.debug(cursor.mogrify(sql, params)) # # cursor.execute(sql, params) # # for record in result_generator(cursor): # _log.debug(record) # yield Tile.from_db_record(record) # # except Exception as e: # # _log.error("Caught exception %s", e) # conn.rollback() # raise # # finally: # # conn = cursor = None # # # def list_tiles_wkb_to_file(wkb, satellites, acq_min, acq_max, dataset_types, filename, sort=SortType.ASC, config=None): # # """ # Write the list of tiles matching the criteria to the specified file # # :param wkb: Shape as WKB format # :type wkb: WKB # :param satellites: Satellites # :type satellites: list[datacube.api.model.Satellite] # :param acq_min: Acquisition date range # :type acq_min: datetime.datetime # :param acq_max: Acquisition date range # :type acq_max: datetime.datetime # :param dataset_types: Dataset types # :type dataset_types: list[datacube.api.model.DatasetType] # :param filename: The output file # :type filename: str # :param sort: Sort order # :type sort: datacube.api.query.SortType # :param config: Config # :type config: datacube.config.Config # """ # # conn = cursor = None # # try: # # connect to database # # conn, cursor = connect_to_db(config=config) # # sql, params = build_list_tiles_wkb_sql_and_params(wkb, satellites, acq_min, acq_max, dataset_types, sort) # # sql = to_file_ify_sql(sql) # # if filename: # with open(filename, "w") as f: # cursor.copy_expert(cursor.mogrify(sql, params), f) # else: # cursor.copy_expert(cursor.mogrify(sql, params), sys.stdout) # # except Exception as e: # # _log.error("Caught exception %s", e) # conn.rollback() # raise # # finally: # # conn = cursor = None # # # def build_list_tiles_wkb_sql_and_params(wkb, satellites, acq_min, acq_max, dataset_types, sort=SortType.ASC): # # """ # Build the SQL query string and parameters required to return the tiles matching the criteria # # :param wkb: Shape as WKB format # :type wkb: WKB # :param satellites: Satellites # :type satellites: list[datacube.api.model.Satellite] # :param acq_min: Acquisition date range # :type acq_min: datetime.datetime # :param acq_max: Acquisition date range # :type acq_max: datetime.datetime # :param dataset_types: Dataset types # :type dataset_types: list[datacube.api.model.DatasetType] # :param sort: Sort order # :type sort: datacube.api.query.SortType # # :return: The SQL query and params # :rtype: (str, dict) # """ # # sql = """ # select # acquisition.acquisition_id, satellite_tag as satellite, start_datetime, end_datetime, # extract(year from end_datetime) as end_datetime_year, extract(month from end_datetime) as end_datetime_month, # nbar.x_index, nbar.y_index, point(nbar.x_index, nbar.y_index) as xy, # """ # # sql += """ # ARRAY[ # """ # # sql += """ # ['ARG25', nbar.tile_pathname] # """ # # if DatasetType.PQ25 in dataset_types: # sql += """ # ,['PQ25', pqa.tile_pathname] # """ # # if DatasetType.FC25 in dataset_types: # sql += """ # ,['FC25', fc.tile_pathname] # """ # # if DatasetType.NDVI in dataset_types: # sql += """ # ,['NDVI', nbar.tile_pathname] # """ # # if DatasetType.EVI in dataset_types: # sql += """ # ,['EVI', nbar.tile_pathname] # """ # # if DatasetType.NBR in dataset_types: # sql += """ # ,['NBR', nbar.tile_pathname] # """ # # if DatasetType.TCI in dataset_types: # sql += """ # ,['TCI', nbar.tile_pathname] # """ # # if DatasetType.DSM in dataset_types: # sql += """ # ,['DSM', dsm.tile_pathname] # """ # # if DatasetType.DEM in dataset_types: # sql += """ # ,['DEM', dem.tile_pathname] # """ # # if DatasetType.DEM_HYDROLOGICALLY_ENFORCED in dataset_types: # sql += """ # ,['DEM_HYDROLOGICALLY_ENFORCED', dem_h.tile_pathname] # """ # # if DatasetType.DEM_SMOOTHED in dataset_types: # sql += """ # ,['DEM_SMOOTHED', dem_s.tile_pathname] # """ # # sql += """ # ] as datasets # """ # # sql += """ # from acquisition # join satellite on satellite.satellite_id=acquisition.satellite_id # """ # # sql += """ # join # ( # select # dataset.acquisition_id, tile.dataset_id, tile.x_index, tile.y_index, tile.tile_pathname, tile.tile_type_id, tile.tile_class_id # from tile # join dataset on dataset.dataset_id=tile.dataset_id # where dataset.level_id = %(level_nbar)s # ) as nbar on nbar.acquisition_id=acquisition.acquisition_id # """ # # sql += """ # join tile_footprint on tile_footprint.x_index=nbar.x_index and tile_footprint.y_index=nbar.y_index # """ # # if DatasetType.PQ25 in dataset_types: # sql += """ # join # ( # select # dataset.acquisition_id, tile.dataset_id, tile.x_index, tile.y_index, tile.tile_pathname, tile.tile_type_id, tile.tile_class_id # from tile # join dataset on dataset.dataset_id=tile.dataset_id # where dataset.level_id = %(level_pqa)s # ) as pqa on # pqa.acquisition_id=acquisition.acquisition_id # and pqa.x_index=nbar.x_index and pqa.y_index=nbar.y_index # and pqa.tile_type_id=nbar.tile_type_id and pqa.tile_class_id=nbar.tile_class_id # # """ # # if DatasetType.FC25 in dataset_types: # sql += """ # join # ( # select # dataset.acquisition_id, tile.dataset_id, tile.x_index,
them Nlon=dict() N_tot= Nlon['N_total'] =float(D.longitude.size) all_CD_rep=dict() all_CD_bud=dict() for kk in seg_dict.keys(): CD_storage_rep=dict() CD_storage_bud=dict() lon_seg=seg_dict[kk] print(kk) Dsurface_segment = Dsurface.sel(longitude=lon_seg) #ps_zm_seg = ps.sel(longitude=lon_seg).mean('longitude').compute() BATA_seg = BATA.sel(longitude=lon_seg) #BATA_zm_seg = BATA_seg.mean('longitude').compute() BATA_01_zm_seg = BATA_01.sel(longitude=lon_seg).mean('longitude').compute() Nlon[kk] = float(Dsurface_segment.longitude.size) N_weight = Nlon[kk]/N_tot # a) surface tourque #sp_dlambda_seg = ddlambda_spherical(Dsurface_segment.sp, None, r_e, lon, lat ) #gph_sp_dlambda_seg= Dsurface_segment.z * sp_dlambda_seg / 9.81 #better copy from above and select gph_sp_dlambda_seg= gph_sp_dlambda.sel(longitude=lon_seg) # take zonal mean, at this point treat it as a surface variable gph_sp_dlambda_zm_rep_seg = (gph_sp_dlambda_seg).mean('longitude') gph_sp_dlambda_zm_rep_seg.name='zonal mean surface mountain torque' gph_sp_dlambda_zm_rep_seg.attrs['units']='N m**-2' gph_sp_dlambda_zm_budget_seg = gph_sp_dlambda_zm_rep_seg * ps_zm gph_sp_dlambda_zm_budget_seg.attrs['units']='N**2 m**-4' CD_storage_rep['torque_srf_zm']= gph_sp_dlambda_zm_rep_seg * N_weight CD_storage_bud['torque_srf_zm']= gph_sp_dlambda_zm_budget_seg * N_weight # b) GPh level a =gph_bata_div.sel(longitude=lon_seg) a_zm_rep = (a * BATA_seg).mean('longitude') / BATA_zm a_zm_conventional = a.mean('longitude') # apply devinition of representative mean a_zm_rep = a_zm_rep.where(BATA_zm != 0, a_zm_conventional) a_zm_budget = a_zm_rep * BATA_zm #(data * BATA).mean('longitude') CD_storage_rep['torque_lev_zm']= (a_zm_rep * N_weight) CD_storage_bud['torque_lev_zm']= (a_zm_budget * N_weight) # c) gravity wave drag F_gravity_zm_data_seg =(Dsurface_segment['megwss']* Dsurface_segment.sp).mean('longitude')/ ps_zm F_gravity_zm_rep_seg = xr.DataArray(data=F_gravity_zm_data_seg, name='Zonal mean zonal gravity wave stress', attrs= gravity_drag.attrs) F_gravity_zm_rep_seg.attrs['units']='N m**-2' F_gravity_zm_budget_seg = F_gravity_zm_rep_seg * ps_zm F_gravity_zm_budget_seg.attrs['units']='N**2 m**-4' CD_storage_rep['F_gwave_zm']= (F_gravity_zm_rep_seg * N_weight) CD_storage_bud['F_gwave_zm']= (F_gravity_zm_budget_seg * N_weight) # d) save CD_storage_rep = xr.Dataset(CD_storage_rep) G_CD_int =vertical_integal_Hbeta(CD_storage_rep,BATA_01_zm_seg ).compute() G_CD_int.attrs['long_name'], G_CD_int.attrs['units'] = 'Continental Surface Drag as Representetive Mean', 'Pa' CD_storage_bud = xr.Dataset(CD_storage_bud) GB_CD_int =vertical_integal_Hbeta(CD_storage_bud, BATA_01_zm_seg).compute() GB_CD_int.attrs['long_name'], GB_CD_int.attrs['units'] = 'Continental Surface Drag as Budget Mean', 'Pa**2' save_path_local = save_path + '/drag_on_continents_zm/repres/' M.mkdirs_r(save_path_local) G_CD_int.to_netcdf(save_path_local + key_name + 'repres_'+ kk+ '_'+ date_str + '.nc') save_path_local = save_path + '/drag_on_continents_zm/budget/' M.mkdirs_r(save_path_local) GB_CD_int.to_netcdf(save_path_local + key_name + 'budget_'+ kk+ '_'+ date_str + '.nc') all_CD_rep[kk]=G_CD_int #all_CD_bud[kk]=GB_CD_int if plot_cont is False: del all_CD_rep del all_CD_bud del GB_CD_int del G_CD_int del Dsurface_segment del BATA_seg del BATA_01_zm_seg del CD_storage_rep del CD_storage_bud del a_zm_rep del a_zm_budget del a_zm_conventional tend=time.time() hist = logger(hist, 'continental sepeparatio time: ' + str(tend-tstart) ) tstart=time.time() """ end of continental excurse """ # %% 2. c) finish up global mean of surface vars. compute and store them # 2. c) 1 surface tourque repres['torque_srf_zm']= gph_sp_dlambda_zm_rep.compute() budget['torque_srf_zm']= gph_sp_dlambda_zm_budget.compute() del gph_sp_dlambda_zm_rep del gph_sp_dlambda_zm_budget del sp_dlambda del gph_sp_dlambda # 2. c) 2. gph level repres['torque_lev_zm']= gph_bata_div_zm_rep.compute() budget['torque_lev_zm']= gph_bata_div_zm_budget.compute() del gph_bata_div del gph_bata_div_zm_conventional del gph_bata_div_zm_rep del gph_bata_div_zm_budget tend=time.time() hist = logger(hist, 'store and compute global surface tourque part II : ' + str(tend-tstart) ) tstart=time.time() # %% 3 . global surface drag terms # %% a) surface var: 1. turbulent stress F_srf_zm_data =(fluxes* ps).mean('longitude')/ ps_zm F_srf_zm_rep = xr.DataArray(data=F_srf_zm_data, name='Zonal mean zonal Surface Stress', attrs= fluxes.attrs) F_srf_zm_rep.attrs['units']='N m**-2' F_srf_zm_budget = F_srf_zm_rep * ps_zm F_srf_zm_budget.attrs['units']='N**2 m**-4' repres['F_tur_zm'] = F_srf_zm_rep budget['F_tur_zm'] = F_srf_zm_budget BATAD['ps_zm'] = ps_zm # %% b) surface var: 2. gravity drag F_gravity_zm_data =(gravity_drag* ps).mean('longitude')/ ps_zm F_gravity_zm_rep = xr.DataArray(data=F_gravity_zm_data, name='Zonal mean zonal gravity wave stress', attrs= gravity_drag.attrs) F_gravity_zm_rep.attrs['units']='N m**-2' F_gravity_zm_budget = F_gravity_zm_rep * ps_zm F_gravity_zm_budget.attrs['units']='N**2 m**-4' repres['F_gwave_zm'] = F_gravity_zm_rep budget['F_gwave_zm'] = F_gravity_zm_budget # %% 4 . representative average data_zm_rep = (data * BATA).mean('longitude') / BATA_zm data_zm_conventional = data.mean('longitude') #levmask =data.level < 0.1e5 #data_zm_conventional = data.sel(level=~levmask).mean('longitude') #data.sel(level=levmask)*np.nan # apply devinition of representative mean data_zm_rep = data_zm_rep.where(BATA_zm != 0, data_zm_conventional).compute() data_zm_budget = (data_zm_rep * BATA_zm).compute() #(data * BATA).mean('longitude') # store in dict repres['data_zm'] = data_zm_rep budget['data_zm'] = data_zm_budget tend=time.time() hist = logger(hist, 'Surface stresses and representative means: ' + str(tend-tstart) ) tstart=time.time() # %% eddy terms # a) mean flow: uzm_vzm_rep = data_zm_rep.u * data_zm_rep.v uzm_vzm_budget = BATA_zm * uzm_vzm_rep # b) eddies data_p =data - data_zm_rep # test if primes are 0 , see Boer eq. sec. 4b. #(data_p * BATA).mean() upvp_zm_budget = (data_p.u * data_p.v * BATA_zm).mean('longitude').compute() upvp_zm_conventional = (data_p.u * data_p.v).mean('longitude') # apply devinition of representative mean upvp_zm_rep = (upvp_zm_budget / BATA_zm) upvp_zm_rep =upvp_zm_rep.where(BATA_zm != 0 , upvp_zm_conventional).compute() #upvp_zm_rep # store in dict repres['uzm_vzm'] = uzm_vzm_rep repres['uprime_vprime_zm'] = upvp_zm_rep budget['uzm_vzm'] = uzm_vzm_budget budget['uprime_vprime_zm'] = upvp_zm_budget tend=time.time() hist = logger(hist, 'eddy terms compute: ' + str(tend-tstart) ) tstart=time.time() # %% # 2. zonal derivative # define constants repres['uzm_vzm_div'] = ddphi_spherical_zm(uzm_vzm_rep ,ps_zm, r_e, lat ).where(lat !=-90, 0).where(lat !=90, 0).compute() repres['uprime_vprime_zm_div'] = ddphi_spherical_zm(upvp_zm_rep ,ps_zm, r_e, lat ).where(lat !=-90, 0).where(lat !=90, 0).compute() budget['uzm_vzm_div'] = ddphi_spherical_zm(uzm_vzm_budget ,ps_zm, r_e, lat ).where(lat !=-90, 0).where(lat !=90, 0).compute() budget['uprime_vprime_zm_div'] = ddphi_spherical_zm(upvp_zm_budget ,ps_zm, r_e, lat ).where(lat !=-90, 0).where(lat !=90, 0).compute() tend=time.time() hist = logger(hist, 'phi gradients compute: ' + str(tend-tstart) ) tstart=time.time() # 3. tendency term repres['dudt'] = data_zm_rep.u.differentiate('time', edge_order=2, datetime_unit='s').compute() budget['dudt'] = data_zm_budget.u.differentiate('time', edge_order=2, datetime_unit='s').compute() del data_zm_rep del data_zm_budget del data tend=time.time() hist = logger(hist, 'tendency term compute: ' + str(tend-tstart) ) tstart=time.time() # %% 4. also process gph Phi_zm_rep = (Phi * BATA).mean('longitude') / BATA_zm repres['phi_zm'] = Phi_zm_rep.where(BATA_zm != 0, Phi.mean('longitude')) repres['phi_zm'].attrs =Phi.attrs budget['phi_zm'] = Phi_zm_rep * BATA_zm #(data * BATA).mean('longitude') budget['phi_zm'].attrs =Phi.attrs tend=time.time() hist = logger(hist, 'Phi single var compute time: ' + str(tend-tstart) ) tstart=time.time() # %% 4. merge data to xr.DataSets print('Repack data and Cal data') # a) representetive means G = repres['dudt'] G.name , G.attrs['long_name'], G.attrs['units'] = 'dudt' , 'Zonal Mean Tendency', '(m s**-2)' G =repres['dudt'].to_dataset() G.attrs['long_name'], G.attrs['units'] = 'Terms for Representative Zonal Mean Momentum Budget', 'm s**-2 (fields var) or N m**-2 (surface var)' key= 'uzm_vzm' repres[key].name , repres[key].attrs['long_name'], repres[key].attrs['units'] = 'uzm_vzm' , 'Zonal Mean mean-momentum flux', '(m**2 s**-2)' G['uzm_vzm']=repres[key] key= 'uprime_vprime_zm' repres[key].name , repres[key].attrs['long_name'], repres[key].attrs['units'] = 'uprime_vprime_zm' , 'Zonal Mean eddy-moemntum flux', '(m**2 s**-2)' G['uprime_vprime_zm']=repres[key] key= '<KEY>' repres[key].name , repres[key].attrs['long_name'], repres[key].attrs['units'] = 'uzm_vzm_div' , 'Zonal Mean mean-flux divergence', '(m s**-2)' G['uzm_vzm_div']=repres[key] key= 'uprime_vprime_zm_div' repres[key].name , repres[key].attrs['long_name'], repres[key].attrs['units'] = 'uprime_vprime_zm_div' , 'Zonal Mean eddy-flux divergence', '(m s**-2)' G['uprime_vprime_zm_div']=repres[key] key= 'torque_lev_zm' repres[key].name , repres[key].attrs['long_name'], repres[key].attrs['units'] = 'torque_lev_zm' , 'Zonal Mean Geopotential Height Torque', '(m s**-2)' G['torque_lev_zm']=repres[key].T key= 'torque_srf_zm' repres[key].name , repres[key].attrs['long_name'], repres[key].attrs['units'] = 'torque_srf_zm' , 'Zonal Mean Surface Torque', '(m s**-2)' G['torque_srf_zm']=repres[key] key= 'F_tur_zm' repres[key].name , repres[key].attrs['long_name'] = 'F_tur_zm' , 'Zonal Mean Turbulent Surface Stress' G['F_tur_zm']=repres[key] key= 'F_gwave_zm' repres[key].name , repres[key].attrs['long_name'] = 'F_gwave_zm' , 'Zonal Mean Zonal Gravity Wave Stress' G['F_gwave_zm']=repres[key] key= 'data_zm' tempv =repres[key].v * f tempv.name , tempv.attrs['long_name'], tempv.attrs['units'] = 'Zonal Mean Advection of Planetary Momentum' , 'Zonal Mean Advection of Planetary Momentum', '(m s**-2)' G['v_f_zm']=tempv # save also zonal mean winds and GPH G_others = repres['data_zm'].u G_others.name , G_others.attrs['long_name'], G_others.attrs['units'] = 'u_repres' , 'Representative Zonal Mean Zonal Wind' , '(m s**-1)' G_others = G_others.to_dataset() key='v_repres' G_others[key]=repres['data_zm'].v G_others[key].name , G_others[key].attrs['long_name'], G_others[key].attrs['units'] = key , 'Representative Zonal Mean Meridional Wind' , '(m s**-1)' key= 'phi_repres' G_others[key]=repres['phi_zm'].compute() G_others[key].name , G_others[key].attrs['long_name'], G_others[key].attrs['units'] = key , 'Representative Zonal Mean Geopotential Height' , '(m**2 s**-2)' # b) budget means GB = budget['dudt'] GB.name , GB.attrs['long_name'], GB.attrs['units'] = 'dudt' , 'Zonal Mean Tendency', '(Pa m * s**-2)' GB =budget['dudt'].to_dataset() GB.attrs['long_name'], GB.attrs['units'] = 'Terms for Zonal Mean Momentum Budget', '(Pa m * s**-2)' key= 'uzm_vzm' budget[key].name , budget[key].attrs['long_name'], budget[key].attrs['units'] = 'uzm_vzm' , 'Zonal Mean mean-flux', '(Pa m**2 s**-2)' GB['uzm_vzm']=budget[key] key= 'uprime_vprime_zm' budget[key].name , budget[key].attrs['long_name'], budget[key].attrs['units'] = 'uprime_vprime_zm' , 'Zonal Mean eddy-flux', '(Pa m**2 s**-2)' GB['uprime_vprime_zm']=budget[key] key= '<KEY>' budget[key].name , budget[key].attrs['long_name'], budget[key].attrs['units'] = 'uzm_vzm_div' , 'Zonal Mean mean-flux divergence', '(Pa m s**-2)' GB['uzm_vzm_div']=budget[key] key= 'uprime_vprime_zm_div' budget[key].name , budget[key].attrs['long_name'], budget[key].attrs['units'] = 'uprime_vprime_zm_div' , 'Zonal Mean Eddy-flux divergence', '(Pa m s**-2)' GB['uprime_vprime_zm_div']=budget[key] key= 'torque_lev_zm' budget[key].name , budget[key].attrs['long_name'], budget[key].attrs['units'] = 'torque_lev_zm' , 'Zonal Mean Geopotential Height Torque', '(Pa m s**-2)' GB['torque_lev_zm']=budget[key].T key= 'torque_srf_zm' budget[key].name , budget[key].attrs['long_name'], budget[key].attrs['units'] = 'torque_srf_zm' , 'Zonal Mean Surface Torque', '(Pa m s**-2)' GB['torque_srf_zm']=budget[key] key= 'F_tur_zm' budget[key].name , budget[key].attrs['long_name'] = 'F_tur_zm' , 'Zonal Mean Turbulent Surface Stress' GB['F_tur_zm']=budget[key] key= 'F_gwave_zm' budget[key].name , budget[key].attrs['long_name'] = 'F_gwave_zm' , 'Zonal Mean Zonal Gravity Wave Stress' GB['F_gwave_zm']=budget[key] key= 'data_zm' tempv =budget[key].v * f tempv.name , tempv.attrs['long_name'], tempv.attrs['units'] = 'Zonal Mean Advection of Planetary Momentum' , 'Zonal Mean Advection of Planetary Momentum', '(Pa m s**-2)' GB['v_f_zm']=tempv # save also zonal mean winds and GPH key='u_budget' G_others[key]=budget['data_zm'].u G_others[key].name , G_others[key].attrs['long_name'], G_others[key].attrs['units'] = key , 'Budget Zonal Mean Zonal Wind' , '(Pa m s**-1)' key='v_budget' G_others[key]=budget['data_zm'].v G_others[key].name , G_others[key].attrs['long_name'], G_others[key].attrs['units'] = key , 'Budget Zonal Mean Meridional Wind' , '(Pa m s**-1)' key= 'phi_budget' G_others[key]=budget['phi_zm'].compute() G_others[key].name , G_others[key].attrs['long_name'], G_others[key].attrs['units'] = key , 'Budget Zonal Mean Geopotential Height' , '(Pa m**2 s**-2)' # close original files Dsurface.close() D.close() tend=time.time() print('define and zm process time :' + str(tend- tstart)) hist = logger(hist, 'define and zm process time :'+ str(tend- tstart)) tstart=time.time() # %% 5. Vertical integrals print('5. Vertical integrals') G_int =vertical_integal_Hbeta(G, BATA_01_zm) # bata not computed jet. G_int.attrs['long_name'], G_int.attrs['units'] = 'Momentum Budget in the Representetive Mean', 'Pa' GB_int =vertical_integal_Hbeta(GB, BATA_01_zm) GB_int.attrs['long_name'], GB_int.attrs['units'] = 'Momentum Budget in the Budget Mean', 'Pa**2' level_vars = list(G.keys()) flux_vars=['uprime_vprime_zm','uzm_vzm' ] #level_vars.remove('F_tur_zm') #level_vars.remove('F_gwave_zm') for k in flux_vars: level_vars.remove(k) for k in level_vars: G_int[k].attrs = G[k].attrs G_int[k].attrs['units'] = 'Pa' GB_int[k].attrs = GB[k].attrs GB_int[k].attrs['units'] = 'Pa**2' for k in flux_vars: G_int[k].attrs = G[k].attrs G_int[k].attrs['units'] = 'Pa m' GB_int[k].attrs = GB[k].attrs GB_int[k].attrs['units'] = 'Pa**2 m' # %% 5.b optional plotting of the continenal seperation if plot_cont: F =plot_continent_seperation(all_CD_rep, G_int) F.save(name='exmpl_repres_'+ date_str, path=plot_path+'contitent_separ/') del all_CD_rep del all_CD_bud del GB_CD_int del G_CD_int # %% 5.b save zonal mean data date_str save_path_local = save_path + '/instantanious_zm/repres/' os.makedirs(save_path_local, exist_ok = True) G.to_netcdf(save_path_local + key_name +'repres_zm_'+ date_str + '.nc') save_path_local = save_path + '/instantanious_zm/budget/' os.makedirs(save_path_local, exist_ok = True) GB.to_netcdf(save_path_local + key_name +'budget_zm_'+ date_str + '.nc') save_path_local = save_path + '/instantanious_eulerian_zm/' os.makedirs(save_path_local, exist_ok = True) G_others.to_netcdf(save_path_local + key_name +'zm_others_'+ date_str + '.nc') G_bata = xr.Dataset(BATAD) key='BATA_zm' G_bata[key].name , G_bata[key].attrs['long_name'], G_bata[key].attrs['units'] = 'BATA_zm' , 'Zonal mean rho_beta', 'Pa' key='BATA_zm_01' G_bata[key].name , G_bata[key].attrs['long_name'], G_bata[key].attrs['units'] = 'BATA_zm_01' , 'Zonal mean H_beta', 'binary' key='ps_zm' G_bata[key].name , G_bata[key].attrs['long_name'], G_bata[key].attrs['units'] = 'ps_zm' , 'Zonal mean surface pressure', 'Pa' save_path_local = save_path + '/instantanious_bata/' os.makedirs(save_path_local, exist_ok = True) G_bata.to_netcdf(save_path_local +
is fixed. if not aggressive: return self._export_capsule(repository, includes_dependencies=includes_dependencies) else: try: return self._export_capsule(repository, includes_dependencies=includes_dependencies) except Exception: # Empirically this fails occasionally, we don't know # why however. time.sleep(1) return self._export_capsule( repository, includes_dependencies=includes_dependencies) def _export_capsule( self, repository, includes_dependencies=None ): url = '/repository/export?repository_id=%s&changeset_revision=%s' % \ ( self.security.encode_id( repository.id ), self.get_repository_tip( repository ) ) self.visit_url( url ) log.info( "Visited url %s looking for export capsule button" % url ) self.check_page_for_string( "Repository '" ) self.check_page_for_string( "Export" ) # Explicit check for True/False since None means we don't know if this # includes dependencies and so we skip both checks... if includes_dependencies is True: self.check_page_for_string( "Export repository dependencies?" ) elif includes_dependencies is False: self.check_page_for_string( "No repository dependencies are defined for revision" ) self.submit_form( 'export_repository', 'export_repository_button' ) fd, capsule_filename = tempfile.mkstemp() os.close( fd ) with open( capsule_filename, 'w' ) as f: f.write( self.last_page() ) return capsule_filename def fetch_repository_metadata( self, repository, strings_displayed=None, strings_not_displayed=None ): url = '/api/repositories/%s/metadata' % self.security.encode_id( repository.id ) self.visit_url( url ) self.check_for_strings( strings_displayed, strings_not_displayed ) def fill_review_form( self, review_contents_dict, strings_displayed=None, strings_not_displayed=None ): kwd = dict() changed = False for label, contents in review_contents_dict.items(): if contents: changed = True kwd[ '%s__ESEP__comment' % label ] = contents[ 'comment' ] kwd[ '%s__ESEP__rating' % label ] = contents[ 'rating' ] if 'private' in contents: kwd[ '%s__ESEP__private' % label ] = contents[ 'private' ] kwd[ '%s__ESEP__approved' % label ] = contents[ 'approved' ] else: kwd[ '%s__ESEP__approved' % label ] = 'not_applicable' self.check_for_strings( strings_displayed, strings_not_displayed ) self.submit_form( 1, 'Workflows__ESEP__review_button', **kwd ) if changed: strings_displayed.append( 'Reviews were saved' ) self.check_for_strings( strings_displayed, strings_not_displayed ) def galaxy_login( self, email='<EMAIL>', password='<PASSWORD>', username='admin-user', redirect='', logout_first=True ): if logout_first: self.galaxy_logout() previously_created, username_taken, invalid_username = \ self.create_user_in_galaxy( email=email, password=password, username=username, redirect=redirect ) if previously_created: self.visit_galaxy_url( "/user/login?use_panels=False" ) self.submit_form( '1', 'login_button', login=email, redirect=redirect, password=password ) def galaxy_logout( self ): self.visit_galaxy_url( "/user/logout" ) self.check_page_for_string( "You have been logged out" ) tc.browser.cj.clear() def generate_complex_dependency_xml( self, filename, filepath, repository_tuples, package, version ): file_path = os.path.join( filepath, filename ) dependency_entries = [] template = string.Template( common.new_repository_dependencies_line ) for toolshed_url, name, owner, changeset_revision in repository_tuples: dependency_entries.append( template.safe_substitute( toolshed_url=toolshed_url, owner=owner, repository_name=name, changeset_revision=changeset_revision, prior_installation_required='' ) ) if not os.path.exists( filepath ): os.makedirs( filepath ) dependency_template = string.Template( common.complex_repository_dependency_template ) repository_dependency_xml = dependency_template.safe_substitute( package=package, version=version, dependency_lines='\n'.join( dependency_entries ) ) # Save the generated xml to the specified location. open( file_path, 'w' ).write( repository_dependency_xml ) def generate_simple_dependency_xml( self, repository_tuples, filename, filepath, dependency_description='', complex=False, package=None, version=None, prior_installation_required=False ): if not os.path.exists( filepath ): os.makedirs( filepath ) dependency_entries = [] if prior_installation_required: prior_installation_value = ' prior_installation_required="True"' else: prior_installation_value = '' for toolshed_url, name, owner, changeset_revision in repository_tuples: template = string.Template( common.new_repository_dependencies_line ) dependency_entries.append( template.safe_substitute( toolshed_url=toolshed_url, owner=owner, repository_name=name, changeset_revision=changeset_revision, prior_installation_required=prior_installation_value ) ) if dependency_description: description = ' description="%s"' % dependency_description else: description = dependency_description template_parser = string.Template( common.new_repository_dependencies_xml ) repository_dependency_xml = template_parser.safe_substitute( description=description, dependency_lines='\n'.join( dependency_entries ) ) # Save the generated xml to the specified location. full_path = os.path.join( filepath, filename ) open( full_path, 'w' ).write( repository_dependency_xml ) def generate_temp_path( self, test_script_path, additional_paths=[] ): temp_path = os.path.join( self.tool_shed_test_tmp_dir, test_script_path, os.sep.join( additional_paths ) ) if not os.path.exists( temp_path ): os.makedirs( temp_path ) return temp_path def get_datatypes_count( self ): url = '/api/datatypes?upload_only=false' self.visit_galaxy_url( url ) html = self.last_page() datatypes = loads( html ) return len( datatypes ) def get_env_sh_path( self, tool_dependency_name, tool_dependency_version, repository ): '''Return the absolute path to an installed repository's env.sh file.''' env_sh_path = os.path.join( self.get_tool_dependency_path( tool_dependency_name, tool_dependency_version, repository ), 'env.sh' ) return env_sh_path def get_filename( self, filename, filepath=None ): if filepath is not None: return os.path.abspath( os.path.join( filepath, filename ) ) else: return os.path.abspath( os.path.join( self.file_dir, filename ) ) def get_hg_repo( self, path ): return hg.repository( ui.ui(), path ) def get_last_reviewed_revision_by_user( self, user, repository ): changelog_tuples = self.get_repository_changelog_tuples( repository ) reviews = test_db_util.get_reviews_ordered_by_changeset_revision( repository.id, changelog_tuples, reviewer_user_id=user.id ) if reviews: last_review = reviews[ -1 ] else: last_review = None return last_review def get_repositories_category_api( self, categories, strings_displayed=None, strings_not_displayed=None ): for category in categories: url = '/api/categories/%s/repositories' % self.security.encode_id( category.id ) self.visit_url( url ) self.check_for_strings( strings_displayed, strings_not_displayed ) def get_tool_dependency_path( self, tool_dependency_name, tool_dependency_version, repository ): '''Return the absolute path for an installed tool dependency.''' return os.path.join( self.galaxy_tool_dependency_dir, tool_dependency_name, tool_dependency_version, repository.owner, repository.name, repository.installed_changeset_revision ) def get_or_create_repository( self, owner=None, strings_displayed=None, strings_not_displayed=None, **kwd ): # If not checking for a specific string, it should be safe to assume that # we expect repository creation to be successful. if strings_displayed is None: strings_displayed = [ 'Repository', kwd[ 'name' ], 'has been created' ] if strings_not_displayed is None: strings_not_displayed = [] repository = test_db_util.get_repository_by_name_and_owner( kwd[ 'name' ], owner ) if repository is None: self.visit_url( '/repository/create_repository' ) self.submit_form( 1, 'create_repository_button', **kwd ) self.check_for_strings( strings_displayed, strings_not_displayed ) repository = test_db_util.get_repository_by_name_and_owner( kwd[ 'name' ], owner ) return repository def get_repo_path( self, repository ): # An entry in the hgweb.config file looks something like: repos/test/mira_assembler = database/community_files/000/repo_123 lhs = "repos/%s/%s" % ( repository.user.username, repository.name ) try: return self.hgweb_config_manager.get_entry( lhs ) except: raise Exception( "Entry for repository %s missing in hgweb config file %s." % ( lhs, self.hgweb_config_manager.hgweb_config ) ) def get_repository_changelog_tuples( self, repository ): repo = self.get_hg_repo( self.get_repo_path( repository ) ) changelog_tuples = [] for changeset in repo.changelog: ctx = repo.changectx( changeset ) changelog_tuples.append( ( ctx.rev(), repo.changectx( changeset ) ) ) return changelog_tuples def get_repository_datatypes_count( self, repository ): metadata = self.get_repository_metadata( repository )[0].metadata if 'datatypes' not in metadata: return 0 else: return len( metadata[ 'datatypes' ] ) def get_repository_file_list( self, repository, base_path, current_path=None ): '''Recursively load repository folder contents and append them to a list. Similar to os.walk but via /repository/open_folder.''' if current_path is None: request_param_path = base_path else: request_param_path = os.path.join( base_path, current_path ) # Get the current folder's contents. params = dict( folder_path=request_param_path, repository_id=self.security.encode_id( repository.id ) ) url = '/repository/open_folder' self.visit_url( url, params=params ) file_list = loads( self.last_page() ) returned_file_list = [] if current_path is not None: returned_file_list.append( current_path ) # Loop through the json dict returned by /repository/open_folder. for file_dict in file_list: if file_dict[ 'isFolder' ]: # This is a folder. Get the contents of the folder and append it to the list, # prefixed with the path relative to the repository root, if any. if current_path is None: returned_file_list.extend( self.get_repository_file_list( repository=repository, base_path=base_path, current_path=file_dict[ 'title' ] ) ) else: sub_path = os.path.join( current_path, file_dict[ 'title' ] ) returned_file_list.extend( self.get_repository_file_list( repository=repository, base_path=base_path, current_path=sub_path ) ) else: # This is a regular file, prefix the filename with the current path and append it to the list. if current_path is not None: returned_file_list.append( os.path.join( current_path, file_dict[ 'title' ] ) ) else: returned_file_list.append( file_dict[ 'title' ] ) return returned_file_list def get_repository_metadata( self, repository ): return [ metadata_revision for metadata_revision in repository.metadata_revisions ] def get_repository_metadata_by_changeset_revision( self, repository, changeset_revision ): return test_db_util.get_repository_metadata_for_changeset_revision( repository.id, changeset_revision ) def get_repository_metadata_revisions( self, repository ): return [ str( repository_metadata.changeset_revision ) for repository_metadata in repository.metadata_revisions ] def get_repository_tip( self, repository ): repo = self.get_hg_repo( self.get_repo_path( repository ) ) return str( repo.changectx( repo.changelog.tip() ) ) def get_sniffers_count( self ): url = '/api/datatypes/sniffers' self.visit_galaxy_url( url ) html = self.last_page() sniffers = loads( html ) return len( sniffers ) def get_tools_from_repository_metadata( self, repository, include_invalid=False ): '''Get a list of valid and (optionally) invalid tool dicts from the repository metadata.''' valid_tools = [] invalid_tools = [] for repository_metadata in repository.metadata_revisions: if 'tools' in repository_metadata.metadata: valid_tools.append( dict( tools=repository_metadata.metadata[ 'tools' ], changeset_revision=repository_metadata.changeset_revision ) ) if include_invalid and 'invalid_tools' in repository_metadata.metadata: invalid_tools.append( dict( tools=repository_metadata.metadata[ 'invalid_tools' ], changeset_revision=repository_metadata.changeset_revision ) ) return valid_tools, invalid_tools def get_tool_panel_section_from_api( self, metadata ): tool_metadata = metadata[ 'tools' ] tool_guid = quote_plus( tool_metadata[ 0 ][ 'guid' ], safe='' ) api_url = '/%s' % '/'.join( [ 'api', 'tools', tool_guid ] ) self.visit_galaxy_url( api_url ) tool_dict = loads( self.last_page() ) tool_panel_section = tool_dict[ 'panel_section_name' ] return tool_panel_section def get_tool_panel_section_from_repository_metadata( self, metadata ): tool_metadata = metadata[ 'tools' ] tool_guid = tool_metadata[ 0 ][ 'guid' ] assert 'tool_panel_section' in metadata, 'Tool panel section not found in metadata: %s' % metadata tool_panel_section_metadata = metadata[ 'tool_panel_section' ] # tool_section_dict = dict(
list_extensions(self, **_params): """Fetch a list of all extensions on server side.""" return self.get(self.extensions_path, params=_params) def show_extension(self, ext_alias, **_params): """Fetches information of a certain extension.""" return self.get(self.extension_path % ext_alias, params=_params) def list_ports(self, retrieve_all=True, **_params): """Fetches a list of all ports for a project.""" # Pass filters in "params" argument to do_request return self.list('ports', self.ports_path, retrieve_all, **_params) def show_port(self, port, **_params): """Fetches information of a certain port.""" return self.get(self.port_path % (port), params=_params) def create_port(self, body=None): """Creates a new port.""" return self.post(self.ports_path, body=body) def update_port(self, port, body=None): """Updates a port.""" return self.put(self.port_path % (port), body=body) def delete_port(self, port): """Deletes the specified port.""" return self.delete(self.port_path % (port)) def list_networks(self, retrieve_all=True, **_params): """Fetches a list of all networks for a project.""" # Pass filters in "params" argument to do_request return self.list('networks', self.networks_path, retrieve_all, **_params) def show_network(self, network, **_params): """Fetches information of a certain network.""" return self.get(self.network_path % (network), params=_params) def create_network(self, body=None): """Creates a new network.""" return self.post(self.networks_path, body=body) def update_network(self, network, body=None): """Updates a network.""" return self.put(self.network_path % (network), body=body) def delete_network(self, network): """Deletes the specified network.""" return self.delete(self.network_path % (network)) def list_subnets(self, retrieve_all=True, **_params): """Fetches a list of all subnets for a project.""" return self.list('subnets', self.subnets_path, retrieve_all, **_params) def show_subnet(self, subnet, **_params): """Fetches information of a certain subnet.""" return self.get(self.subnet_path % (subnet), params=_params) def create_subnet(self, body=None): """Creates a new subnet.""" return self.post(self.subnets_path, body=body) def update_subnet(self, subnet, body=None): """Updates a subnet.""" return self.put(self.subnet_path % (subnet), body=body) def delete_subnet(self, subnet): """Deletes the specified subnet.""" return self.delete(self.subnet_path % (subnet)) def list_subnetpools(self, retrieve_all=True, **_params): """Fetches a list of all subnetpools for a project.""" return self.list('subnetpools', self.subnetpools_path, retrieve_all, **_params) def show_subnetpool(self, subnetpool, **_params): """Fetches information of a certain subnetpool.""" return self.get(self.subnetpool_path % (subnetpool), params=_params) def create_subnetpool(self, body=None): """Creates a new subnetpool.""" return self.post(self.subnetpools_path, body=body) def update_subnetpool(self, subnetpool, body=None): """Updates a subnetpool.""" return self.put(self.subnetpool_path % (subnetpool), body=body) def delete_subnetpool(self, subnetpool): """Deletes the specified subnetpool.""" return self.delete(self.subnetpool_path % (subnetpool)) def list_routers(self, retrieve_all=True, **_params): """Fetches a list of all routers for a project.""" # Pass filters in "params" argument to do_request return self.list('routers', self.routers_path, retrieve_all, **_params) def show_router(self, router, **_params): """Fetches information of a certain router.""" return self.get(self.router_path % (router), params=_params) def create_router(self, body=None): """Creates a new router.""" return self.post(self.routers_path, body=body) def update_router(self, router, body=None): """Updates a router.""" return self.put(self.router_path % (router), body=body) def delete_router(self, router): """Deletes the specified router.""" return self.delete(self.router_path % (router)) def list_address_scopes(self, retrieve_all=True, **_params): """Fetches a list of all address scopes for a project.""" return self.list('address_scopes', self.address_scopes_path, retrieve_all, **_params) def show_address_scope(self, address_scope, **_params): """Fetches information of a certain address scope.""" return self.get(self.address_scope_path % (address_scope), params=_params) def create_address_scope(self, body=None): """Creates a new address scope.""" return self.post(self.address_scopes_path, body=body) def update_address_scope(self, address_scope, body=None): """Updates a address scope.""" return self.put(self.address_scope_path % (address_scope), body=body) def delete_address_scope(self, address_scope): """Deletes the specified address scope.""" return self.delete(self.address_scope_path % (address_scope)) def add_interface_router(self, router, body=None): """Adds an internal network interface to the specified router.""" return self.put((self.router_path % router) + "/add_router_interface", body=body) def remove_interface_router(self, router, body=None): """Removes an internal network interface from the specified router.""" return self.put((self.router_path % router) + "/remove_router_interface", body=body) def add_gateway_router(self, router, body=None): """Adds an external network gateway to the specified router.""" return self.put((self.router_path % router), body={'router': {'external_gateway_info': body}}) def remove_gateway_router(self, router): """Removes an external network gateway from the specified router.""" return self.put((self.router_path % router), body={'router': {'external_gateway_info': {}}}) def list_floatingips(self, retrieve_all=True, **_params): """Fetches a list of all floatingips for a project.""" # Pass filters in "params" argument to do_request return self.list('floatingips', self.floatingips_path, retrieve_all, **_params) def show_floatingip(self, floatingip, **_params): """Fetches information of a certain floatingip.""" return self.get(self.floatingip_path % (floatingip), params=_params) def create_floatingip(self, body=None): """Creates a new floatingip.""" return self.post(self.floatingips_path, body=body) def update_floatingip(self, floatingip, body=None): """Updates a floatingip.""" return self.put(self.floatingip_path % (floatingip), body=body) def delete_floatingip(self, floatingip): """Deletes the specified floatingip.""" return self.delete(self.floatingip_path % (floatingip)) def create_security_group(self, body=None): """Creates a new security group.""" return self.post(self.security_groups_path, body=body) def update_security_group(self, security_group, body=None): """Updates a security group.""" return self.put(self.security_group_path % security_group, body=body) def list_security_groups(self, retrieve_all=True, **_params): """Fetches a list of all security groups for a project.""" return self.list('security_groups', self.security_groups_path, retrieve_all, **_params) def show_security_group(self, security_group, **_params): """Fetches information of a certain security group.""" return self.get(self.security_group_path % (security_group), params=_params) def delete_security_group(self, security_group): """Deletes the specified security group.""" return self.delete(self.security_group_path % (security_group)) def create_security_group_rule(self, body=None): """Creates a new security group rule.""" return self.post(self.security_group_rules_path, body=body) def delete_security_group_rule(self, security_group_rule): """Deletes the specified security group rule.""" return self.delete(self.security_group_rule_path % (security_group_rule)) def list_security_group_rules(self, retrieve_all=True, **_params): """Fetches a list of all security group rules for a project.""" return self.list('security_group_rules', self.security_group_rules_path, retrieve_all, **_params) def show_security_group_rule(self, security_group_rule, **_params): """Fetches information of a certain security group rule.""" return self.get(self.security_group_rule_path % (security_group_rule), params=_params) def list_endpoint_groups(self, retrieve_all=True, **_params): """Fetches a list of all VPN endpoint groups for a project.""" return self.list('endpoint_groups', self.endpoint_groups_path, retrieve_all, **_params) def show_endpoint_group(self, endpointgroup, **_params): """Fetches information for a specific VPN endpoint group.""" return self.get(self.endpoint_group_path % endpointgroup, params=_params) def create_endpoint_group(self, body=None): """Creates a new VPN endpoint group.""" return self.post(self.endpoint_groups_path, body=body) def update_endpoint_group(self, endpoint_group, body=None): """Updates a VPN endpoint group.""" return self.put(self.endpoint_group_path % endpoint_group, body=body) def delete_endpoint_group(self, endpoint_group): """Deletes the specified VPN endpoint group.""" return self.delete(self.endpoint_group_path % endpoint_group) def list_vpnservices(self, retrieve_all=True, **_params): """Fetches a list of all configured VPN services for a project.""" return self.list('vpnservices', self.vpnservices_path, retrieve_all, **_params) def show_vpnservice(self, vpnservice, **_params): """Fetches information of a specific VPN service.""" return self.get(self.vpnservice_path % (vpnservice), params=_params) def create_vpnservice(self, body=None): """Creates a new VPN service.""" return self.post(self.vpnservices_path, body=body) def update_vpnservice(self, vpnservice, body=None): """Updates a VPN service.""" return self.put(self.vpnservice_path % (vpnservice), body=body) def delete_vpnservice(self, vpnservice): """Deletes the specified VPN service.""" return self.delete(self.vpnservice_path % (vpnservice)) def list_ipsec_site_connections(self, retrieve_all=True, **_params): """Fetches all configured IPsecSiteConnections for a project.""" return self.list('ipsec_site_connections', self.ipsec_site_connections_path, retrieve_all, **_params) def show_ipsec_site_connection(self, ipsecsite_conn, **_params): """Fetches information of a specific IPsecSiteConnection.""" return self.get( self.ipsec_site_connection_path % (ipsecsite_conn), params=_params ) def create_ipsec_site_connection(self, body=None): """Creates a new IPsecSiteConnection.""" return self.post(self.ipsec_site_connections_path, body=body) def update_ipsec_site_connection(self, ipsecsite_conn, body=None): """Updates an IPsecSiteConnection.""" return self.put( self.ipsec_site_connection_path % (ipsecsite_conn), body=body ) def delete_ipsec_site_connection(self, ipsecsite_conn): """Deletes the specified IPsecSiteConnection.""" return self.delete(self.ipsec_site_connection_path % (ipsecsite_conn)) def list_ikepolicies(self, retrieve_all=True, **_params): """Fetches a list of all configured IKEPolicies for a project.""" return self.list('ikepolicies', self.ikepolicies_path, retrieve_all, **_params) def show_ikepolicy(self, ikepolicy, **_params): """Fetches information of a specific IKEPolicy.""" return self.get(self.ikepolicy_path % (ikepolicy), params=_params) def create_ikepolicy(self, body=None): """Creates a new IKEPolicy.""" return self.post(self.ikepolicies_path, body=body) def update_ikepolicy(self, ikepolicy, body=None): """Updates an IKEPolicy.""" return self.put(self.ikepolicy_path % (ikepolicy), body=body) def delete_ikepolicy(self, ikepolicy): """Deletes the specified IKEPolicy.""" return self.delete(self.ikepolicy_path % (ikepolicy)) def list_ipsecpolicies(self, retrieve_all=True, **_params): """Fetches a list of all configured IPsecPolicies for a project.""" return self.list('ipsecpolicies', self.ipsecpolicies_path, retrieve_all, **_params) def show_ipsecpolicy(self, ipsecpolicy, **_params): """Fetches information of a specific IPsecPolicy.""" return self.get(self.ipsecpolicy_path % (ipsecpolicy), params=_params) def create_ipsecpolicy(self, body=None): """Creates a new IPsecPolicy.""" return self.post(self.ipsecpolicies_path, body=body) def update_ipsecpolicy(self, ipsecpolicy, body=None): """Updates an IPsecPolicy.""" return self.put(self.ipsecpolicy_path % (ipsecpolicy), body=body) def delete_ipsecpolicy(self, ipsecpolicy): """Deletes the specified IPsecPolicy.""" return self.delete(self.ipsecpolicy_path % (ipsecpolicy)) def list_loadbalancers(self, retrieve_all=True, **_params): """Fetches a list of all loadbalancers for a project.""" return self.list('loadbalancers', self.lbaas_loadbalancers_path, retrieve_all, **_params) def show_loadbalancer(self, lbaas_loadbalancer, **_params): """Fetches information for a load balancer.""" return self.get(self.lbaas_loadbalancer_path % (lbaas_loadbalancer), params=_params) def create_loadbalancer(self, body=None): """Creates a new load balancer.""" return self.post(self.lbaas_loadbalancers_path, body=body) def update_loadbalancer(self, lbaas_loadbalancer, body=None): """Updates a load balancer.""" return self.put(self.lbaas_loadbalancer_path % (lbaas_loadbalancer), body=body) def delete_loadbalancer(self, lbaas_loadbalancer): """Deletes the specified load balancer.""" return self.delete(self.lbaas_loadbalancer_path % (lbaas_loadbalancer)) def retrieve_loadbalancer_stats(self, loadbalancer, **_params): """Retrieves stats for a certain load balancer.""" return self.get(self.lbaas_loadbalancer_path_stats % (loadbalancer), params=_params) def retrieve_loadbalancer_status(self, loadbalancer, **_params): """Retrieves status for a certain load balancer.""" return self.get(self.lbaas_loadbalancer_path_status % (loadbalancer), params=_params) def list_listeners(self, retrieve_all=True, **_params): """Fetches a list of all lbaas_listeners for a project.""" return self.list('listeners', self.lbaas_listeners_path, retrieve_all, **_params) def show_listener(self, lbaas_listener, **_params): """Fetches information for a lbaas_listener.""" return self.get(self.lbaas_listener_path % (lbaas_listener), params=_params) def create_listener(self, body=None): """Creates a new lbaas_listener.""" return self.post(self.lbaas_listeners_path, body=body) def update_listener(self, lbaas_listener, body=None): """Updates a lbaas_listener.""" return self.put(self.lbaas_listener_path % (lbaas_listener), body=body) def delete_listener(self, lbaas_listener): """Deletes the specified lbaas_listener.""" return self.delete(self.lbaas_listener_path % (lbaas_listener)) def list_lbaas_l7policies(self, retrieve_all=True, **_params): """Fetches a list of all L7 policies for a listener.""" return self.list('l7policies', self.lbaas_l7policies_path, retrieve_all, **_params) def show_lbaas_l7policy(self, l7policy, **_params): """Fetches
18, 11), r.period_end) elif (r.groupby == {'resource_metadata.instance_type': '83'} and r.period_start == datetime.datetime(2013, 8, 1, 10, 11)): self.assertEqual(1, r.count) self.assertEqual('s', r.unit) self.assertEqual(4, r.min) self.assertEqual(4, r.max) self.assertEqual(4, r.sum) self.assertEqual(4, r.avg) self.assertEqual(0, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 11, 22), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 11, 22), r.duration_end) self.assertEqual(7200, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 12, 11), r.period_end) elif (r.groupby == {'resource_metadata.instance_type': '83'} and r.period_start == datetime.datetime(2013, 8, 1, 14, 11)): self.assertEqual(1, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(2, r.max) self.assertEqual(2, r.sum) self.assertEqual(2, r.avg) self.assertEqual(0, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 15, 37), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 15, 37), r.duration_end) self.assertEqual(7200, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 16, 11), r.period_end) elif (r.groupby == {'resource_metadata.instance_type': '84'} and r.period_start == datetime.datetime(2013, 8, 1, 14, 11)): self.assertEqual(2, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(2, r.max) self.assertEqual(4, r.sum) self.assertEqual(2, r.avg) self.assertEqual(4260, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 14, 59), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 16, 10), r.duration_end) self.assertEqual(7200, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 16, 11), r.period_end) else: self.assertNotEqual([{'resource_metadata.instance_type': '82'}, datetime.datetime(2013, 8, 1, 14, 11)], [r.groupby, r.period_start]) self.assertNotEqual([{'resource_metadata.instance_type': '83'}, datetime.datetime(2013, 8, 1, 16, 11)], [r.groupby, r.period_start]) self.assertNotEqual([{'resource_metadata.instance_type': '84'}, datetime.datetime(2013, 8, 1, 10, 11)], [r.groupby, r.period_start]) self.assertNotEqual([{'resource_metadata.instance_type': '84'}, datetime.datetime(2013, 8, 1, 16, 11)], [r.groupby, r.period_start]) def test_group_by_with_query_filter_and_period(self): f = storage.SampleFilter( meter='instance', source='source-1', ) results = list(self.conn.get_meter_statistics(f, period=7200, groupby=['project_id'])) self.assertEqual(3, len(results)) groupby_list = [r.groupby for r in results] groupby_keys_set = set(x for sub_dict in groupby_list for x in sub_dict.keys()) groupby_vals_set = set(x for sub_dict in groupby_list for x in sub_dict.values()) self.assertEqual(set(['project_id']), groupby_keys_set) self.assertEqual(set(['project-1', 'project-2']), groupby_vals_set) period_start_set = set([r.period_start for r in results]) period_start_valid = set([datetime.datetime(2013, 8, 1, 10, 11), datetime.datetime(2013, 8, 1, 14, 11), datetime.datetime(2013, 8, 1, 16, 11)]) self.assertEqual(period_start_valid, period_start_set) for r in results: if (r.groupby == {'project_id': 'project-1'} and r.period_start == datetime.datetime(2013, 8, 1, 10, 11)): self.assertEqual(2, r.count) self.assertEqual('s', r.unit) self.assertEqual(1, r.min) self.assertEqual(1, r.max) self.assertEqual(2, r.sum) self.assertEqual(1, r.avg) self.assertEqual(1740, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 10, 11), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 10, 40), r.duration_end) self.assertEqual(7200, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 12, 11), r.period_end) elif (r.groupby == {'project_id': 'project-1'} and r.period_start == datetime.datetime(2013, 8, 1, 14, 11)): self.assertEqual(1, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(2, r.max) self.assertEqual(2, r.sum) self.assertEqual(2, r.avg) self.assertEqual(0, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 14, 59), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 14, 59), r.duration_end) self.assertEqual(7200, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 16, 11), r.period_end) elif (r.groupby == {'project_id': 'project-2'} and r.period_start == datetime.datetime(2013, 8, 1, 16, 11)): self.assertEqual(1, r.count) self.assertEqual('s', r.unit) self.assertEqual(4, r.min) self.assertEqual(4, r.max) self.assertEqual(4, r.sum) self.assertEqual(4, r.avg) self.assertEqual(0, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 17, 28), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 17, 28), r.duration_end) self.assertEqual(7200, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 18, 11), r.period_end) else: self.assertNotEqual([{'project_id': 'project-1'}, datetime.datetime(2013, 8, 1, 16, 11)], [r.groupby, r.period_start]) self.assertNotEqual([{'project_id': 'project-2'}, datetime.datetime(2013, 8, 1, 10, 11)], [r.groupby, r.period_start]) def test_group_by_metadata_with_query_filter_and_period(self): # This test checks grouping with metadata fields in combination # with a query filter and period grouping. f = storage.SampleFilter( meter='instance', project='project-1', ) results = list( self.conn.get_meter_statistics( f, period=7200, groupby=['resource_metadata.instance_type'])) self.assertEqual(3, len(results)) groupby_list = [r.groupby for r in results] groupby_keys_set = set(x for sub_dict in groupby_list for x in sub_dict.keys()) groupby_vals_set = set(x for sub_dict in groupby_list for x in sub_dict.values()) self.assertEqual(set(['resource_metadata.instance_type']), groupby_keys_set) self.assertEqual(set(['82', '83', '84']), groupby_vals_set) period_start_set = set([r.period_start for r in results]) period_start_valid = set([datetime.datetime(2013, 8, 1, 10, 11), datetime.datetime(2013, 8, 1, 14, 11)]) self.assertEqual(period_start_valid, period_start_set) for r in results: if (r.groupby == {'resource_metadata.instance_type': '82'} and r.period_start == datetime.datetime(2013, 8, 1, 10, 11)): self.assertEqual(2, r.count) self.assertEqual('s', r.unit) self.assertEqual(1, r.min) self.assertEqual(1, r.max) self.assertEqual(2, r.sum) self.assertEqual(1, r.avg) self.assertEqual(1740, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 10, 11), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 10, 40), r.duration_end) self.assertEqual(7200, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 12, 11), r.period_end) elif (r.groupby == {'resource_metadata.instance_type': '83'} and r.period_start == datetime.datetime(2013, 8, 1, 10, 11)): self.assertEqual(1, r.count) self.assertEqual('s', r.unit) self.assertEqual(4, r.min) self.assertEqual(4, r.max) self.assertEqual(4, r.sum) self.assertEqual(4, r.avg) self.assertEqual(0, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 11, 22), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 11, 22), r.duration_end) self.assertEqual(7200, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 12, 11), r.period_end) elif (r.groupby == {'resource_metadata.instance_type': '84'} and r.period_start == datetime.datetime(2013, 8, 1, 14, 11)): self.assertEqual(2, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(2, r.max) self.assertEqual(4, r.sum) self.assertEqual(2, r.avg) self.assertEqual(4260, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 14, 59), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 16, 10), r.duration_end) self.assertEqual(7200, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 16, 11), r.period_end) else: self.assertNotEqual([{'resource_metadata.instance_type': '82'}, datetime.datetime(2013, 8, 1, 14, 11)], [r.groupby, r.period_start]) self.assertNotEqual([{'resource_metadata.instance_type': '83'}, datetime.datetime(2013, 8, 1, 14, 11)], [r.groupby, r.period_start]) self.assertNotEqual([{'resource_metadata.instance_type': '84'}, datetime.datetime(2013, 8, 1, 10, 11)], [r.groupby, r.period_start]) def test_group_by_start_timestamp_after(self): f = storage.SampleFilter( meter='instance', start_timestamp=datetime.datetime(2013, 8, 1, 17, 28, 1), ) results = list(self.conn.get_meter_statistics(f, groupby=['project_id'])) self.assertEqual([], results) def test_group_by_end_timestamp_before(self): f = storage.SampleFilter( meter='instance', end_timestamp=datetime.datetime(2013, 8, 1, 10, 10, 59), ) results = list(self.conn.get_meter_statistics(f, groupby=['project_id'])) self.assertEqual([], results) def test_group_by_start_timestamp(self): f = storage.SampleFilter( meter='instance', start_timestamp=datetime.datetime(2013, 8, 1, 14, 58), ) results = list(self.conn.get_meter_statistics(f, groupby=['project_id'])) self.assertEqual(2, len(results)) groupby_list = [r.groupby for r in results] groupby_keys_set = set(x for sub_dict in groupby_list for x in sub_dict.keys()) groupby_vals_set = set(x for sub_dict in groupby_list for x in sub_dict.values()) self.assertEqual(set(['project_id']), groupby_keys_set) self.assertEqual(set(['project-1', 'project-2']), groupby_vals_set) for r in results: if r.groupby == {'project_id': 'project-1'}: self.assertEqual(2, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(2, r.max) self.assertEqual(4, r.sum) self.assertEqual(2, r.avg) elif r.groupby == {'project_id': 'project-2'}: self.assertEqual(2, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(4, r.max) self.assertEqual(6, r.sum) self.assertEqual(3, r.avg) def test_group_by_end_timestamp(self): f = storage.SampleFilter( meter='instance', end_timestamp=datetime.datetime(2013, 8, 1, 11, 45), ) results = list(self.conn.get_meter_statistics(f, groupby=['project_id'])) self.assertEqual(1, len(results)) groupby_list = [r.groupby for r in results] groupby_keys_set = set(x for sub_dict in groupby_list for x in sub_dict.keys()) groupby_vals_set = set(x for sub_dict in groupby_list for x in sub_dict.values()) self.assertEqual(set(['project_id']), groupby_keys_set) self.assertEqual(set(['project-1']), groupby_vals_set) for r in results: if r.groupby == {'project_id': 'project-1'}: self.assertEqual(3, r.count) self.assertEqual('s', r.unit) self.assertEqual(1, r.min) self.assertEqual(4, r.max) self.assertEqual(6, r.sum) self.assertEqual(2, r.avg) def test_group_by_start_end_timestamp(self): f = storage.SampleFilter( meter='instance', start_timestamp=datetime.datetime(2013, 8, 1, 8, 17, 3), end_timestamp=datetime.datetime(2013, 8, 1, 23, 59, 59), ) results = list(self.conn.get_meter_statistics(f, groupby=['project_id'])) self.assertEqual(2, len(results)) groupby_list = [r.groupby for r in results] groupby_keys_set = set(x for sub_dict in groupby_list for x in sub_dict.keys()) groupby_vals_set = set(x for sub_dict in groupby_list for x in sub_dict.values()) self.assertEqual(set(['project_id']), groupby_keys_set) self.assertEqual(set(['project-1', 'project-2']), groupby_vals_set) for r in results: if r.groupby == {'project_id': 'project-1'}: self.assertEqual(5, r.count) self.assertEqual('s', r.unit) self.assertEqual(1, r.min) self.assertEqual(4, r.max) self.assertEqual(10, r.sum) self.assertEqual(2, r.avg) elif r.groupby == {'project_id': 'project-2'}: self.assertEqual(2, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(4, r.max) self.assertEqual(6, r.sum) self.assertEqual(3, r.avg) def test_group_by_start_end_timestamp_with_query_filter(self): f = storage.SampleFilter( meter='instance', project='project-1', start_timestamp=datetime.datetime(2013, 8, 1, 11, 1), end_timestamp=datetime.datetime(2013, 8, 1, 20, 0), ) results = list(self.conn.get_meter_statistics(f, groupby=['resource_id'])) groupby_list = [r.groupby for r in results] groupby_keys_set = set(x for sub_dict in groupby_list for x in sub_dict.keys()) groupby_vals_set = set(x for sub_dict in groupby_list for x in sub_dict.values()) self.assertEqual(set(['resource_id']), groupby_keys_set) self.assertEqual(set(['resource-1', 'resource-3']), groupby_vals_set) for r in results: if r.groupby == {'resource_id': 'resource-1'}: self.assertEqual(2, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(2, r.max) self.assertEqual(4, r.sum) self.assertEqual(2, r.avg) elif r.groupby == {'resource_id': 'resource-3'}: self.assertEqual(1, r.count) self.assertEqual('s', r.unit) self.assertEqual(4, r.min) self.assertEqual(4, r.max) self.assertEqual(4, r.sum) self.assertEqual(4, r.avg) def test_group_by_start_end_timestamp_with_period(self): f = storage.SampleFilter( meter='instance', start_timestamp=datetime.datetime(2013, 8, 1, 14, 0), end_timestamp=datetime.datetime(2013, 8, 1, 17, 0), ) results = list(self.conn.get_meter_statistics(f, period=3600, groupby=['project_id'])) self.assertEqual(3, len(results)) groupby_list = [r.groupby for r in results] groupby_keys_set = set(x for sub_dict in groupby_list for x in sub_dict.keys()) groupby_vals_set = set(x for sub_dict in groupby_list for x in sub_dict.values()) self.assertEqual(set(['project_id']), groupby_keys_set) self.assertEqual(set(['project-1', 'project-2']), groupby_vals_set) period_start_set = set([r.period_start for r in results]) period_start_valid = set([datetime.datetime(2013, 8, 1, 14, 0), datetime.datetime(2013, 8, 1, 15, 0), datetime.datetime(2013, 8, 1, 16, 0)]) self.assertEqual(period_start_valid, period_start_set) for r in results: if (r.groupby == {'project_id': 'project-1'} and r.period_start == datetime.datetime(2013, 8, 1, 14, 0)): self.assertEqual(1, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(2, r.max) self.assertEqual(2, r.sum) self.assertEqual(2, r.avg) self.assertEqual(0, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 14, 59), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 14, 59), r.duration_end) self.assertEqual(3600, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 15, 0), r.period_end) elif (r.groupby == {'project_id': 'project-1'} and r.period_start == datetime.datetime(2013, 8, 1, 16, 0)): self.assertEqual(1, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(2, r.max) self.assertEqual(2, r.sum) self.assertEqual(2, r.avg) self.assertEqual(0, r.duration) self.assertEqual(datetime.datetime(2013, 8, 1, 16, 10), r.duration_start) self.assertEqual(datetime.datetime(2013, 8, 1, 16, 10), r.duration_end) self.assertEqual(3600, r.period) self.assertEqual(datetime.datetime(2013, 8, 1, 17, 0), r.period_end) elif (r.groupby == {'project_id': 'project-2'} and r.period_start == datetime.datetime(2013, 8, 1, 15, 0)): self.assertEqual(1, r.count) self.assertEqual('s', r.unit) self.assertEqual(2, r.min) self.assertEqual(2, r.max) self.assertEqual(2, r.sum)
# Copyright (c) 2020 The Foundry Visionmongers Ltd. # # Licensed under the Apache License, Version 2.0 (the "Apache License") # with the following modification; you may not use this file except in # compliance with the Apache License and the following modification to it: # Section 6. Trademarks. is deleted and replaced with: # # 6. Trademarks. This License does not grant permission to use the trade # names, trademarks, service marks, or product names of the Licensor # and its affiliates, except as required to comply with Section 4(c) of # the License and to reproduce the content of the NOTICE file. # # You may obtain a copy of the Apache License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the Apache License with the above modification is # distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the Apache License for the specific # language governing permissions and limitations under the Apache License. import logging import time from Katana import NodegraphAPI, Utils import LookFileBakeAPI from LookFileBakeAPI import LookFileBaker from Nodes3DAPI import LookFileBaking log = logging.getLogger("UsdMaterialBake.Node") __all__ = ['UsdMaterialBakeNode'] class UsdMaterialBakeNode(NodegraphAPI.SuperTool): """ UsdMaterialBake node, with extra methods to allow for baking features and ability to change and re-order inputs driven by the Editor UI, or by calling these directly. Used for baking USD data using the UsdExport OutputFormat plug-in. """ MIN_PORTS = 1 def __init__(self): try: Utils.UndoStack.DisableCapture() try: self.setName("UsdMaterialBake") self.setType("UsdMaterialBake") networkVersion = "1.0" parameters_XML = _parameters_XML.format( networkVersion=networkVersion) self.getParameters().parseXML(parameters_XML) self.addInputPort("orig") self.addInputPort("default") self.addOutputPort("out") dot = NodegraphAPI.CreateNode('Dot', self) dot.getInputPortByIndex(0).connect(self.getSendPort("orig")) dot.getOutputPortByIndex(0).connect(self.getReturnPort("out")) NodegraphAPI.SetNodePosition(dot, (0, 200)) NodegraphAPI.SetNodeShapeAttr(self, 'basicDisplay', 1) NodegraphAPI.SetNodeShapeAttr(self, 'iconName', '') finally: Utils.UndoStack.EnableCapture() except Exception: log.exception("CREATE UsdMaterialBake FAILED.") raise self.__timer = None self.__interruptWidget = None # --- Public node API ------------------------------------------- def addVariantInput(self, variantName): """ Adds a new input port for a new variant name. @type variantName: C{str} @param variantName: New name to give to the new port. """ self.addInputPort(variantName) def deleteVariantInput(self, index): """ Deletes the existing variant from the index provided. @type index: C{int} @param index: Index of the input port to delete. """ if index < self.MIN_PORTS or index >= self.getNumInputPorts(): return portName = self.getInputPortByIndex(index).getName() self.removeInputPort(portName) def reorderInput(self, index, newIndex): """ Reorders two input variants by Deleting the old port and recreating it in the new index. @type index: C{int} @type newIndex: C{int} @param index: Index of the input port to reposition. @param newIndex: New position of the input port. Assuming that the current index does not exist. """ if index < self.MIN_PORTS or index >= self.getNumInputPorts(): return if newIndex < self.MIN_PORTS or newIndex >= self.getNumInputPorts(): return oldPort = self.getInputPortByIndex(index) connections = oldPort.getConnectedPorts() self.removeInputPort(oldPort.getName()) oldPortName = oldPort.getName() del oldPort newPort = self.addInputPortAtIndex(oldPortName, newIndex) for i in connections: newPort.connect(i) def renameVariantInput(self, index, newName): """ Renames an existing input. Does not change the input order. @type index: C{int} @type newName: C{str} @param index: Index of the input to rename. @param newName: New name to change the port to. """ if index < self.MIN_PORTS or index >= self.getNumInputPorts(): return oldPort = self.getInputPortByIndex(index) if newName == oldPort.getName(): return connections = oldPort.getConnectedPorts() self.removeInputPort(oldPort.getName()) del oldPort newPort = self.addInputPortAtIndex(newName, index) for i in connections: newPort.connect(i) def addParameterHints(self, attrName, inputDict): """ Adds parameter hints to the given dictionary of hints for a GenericAssign parameter that shows the value of an attribute from the incoming scene. @type attrName: C{str} @type inputDict: C{dict} @param attrName: The name of the scene graph attribute from the incoming scene for which to add parameter hints. @param inputDict: The dictionary to which to add parameter hints. """ inputDict.update(_ExtraHints.get(attrName, {})) def require3DInput(self, portName, graphState): """ A Method from C{Node3D} used inside the look file bake code to gather the input port given the port name and graph state. @type portName: C{str} @type graphState: C{NodegraphAPI.GraphState} @param portName: Port name to read the 3dInput from. @param graphState: Graph state used to get the input source. @raise TypeError: If C{graphState} provided is not valid. @raise RuntimeError: If the port related to the C{portName} does not point to a valid node. @return: Tuple of the source Node, port and graphState. """ # Required for the current iteration of LookFileBakeAPI, it expects # the node it is owrking on to be able to provide the 3dInput from Nodes3DAPI import Node3D if not isinstance(graphState, NodegraphAPI.GraphState): raise TypeError('Node3D.require3DInput(): Given graphState object ' 'is not a NodegraphAPI.GraphState instance: %s' % repr(graphState)) sourcePort, sourceGraphState = self.getInputSource(portName, graphState) sourceNode = None if sourcePort is not None: sourceNode = sourcePort.getNode() if not isinstance(sourceNode, Node3D): sourceNode = None if sourceNode is None: raise RuntimeError('The required input "%s" was not connected on ' 'the node "%s".' % (portName, self.getName())) return (sourceNode, sourcePort, sourceGraphState) def bake(self, parentWidget=None): """ Performs the bake based on the settings of this current node parameter settings. If a parentWidget is provided, we create a progress widget and setup callbacks to update it. If no parentWidget is provided we can run this without calling any UI code. @type parentWidget: C{QtWidgets.QWidget} @param parentWidget: Parent for the progress widget. If set to None, the progress callback is not produced. """ graphState = NodegraphAPI.GetCurrentGraphState() frameTime = graphState.getTime() node = self inputPorts = node.getInputPorts() numPorts = len(inputPorts) if numPorts < 2: log.error("Requires at least two input ports to bake a USD Look") variantSetName = node.getParameter( "variantSetName").getValue(frameTime) rootPrimName = node.getParameter("rootPrimName").getValue(frameTime) alwaysCreateVariantSet = bool(node.getParameter( "alwaysCreateVariantSet").getValue(frameTime) == "Yes") looksFilename = node.getParameter("looksFilename").getValue(frameTime) looksFileFormat = node.getParameter("looksFileFormat").getValue( frameTime) createCompleteUsdAssemblyFile = bool(node.getParameter( "createCompleteUsdAssemblyFile").getValue(frameTime)) assemblyFilename = node.getParameter("assemblyFilename").getValue( frameTime) payloadFilename = node.getParameter("payloadFilename").getValue( frameTime) createVariantSet = alwaysCreateVariantSet or (len(inputPorts) > 2) additionalSettings = { "variantSetName": variantSetName, "rootPrimName": rootPrimName, "createVariantSet": createVariantSet, "looksFileFormat": looksFileFormat, "looksFilename": looksFilename, "createCompleteUsdAssemblyFile": createCompleteUsdAssemblyFile, "assemblyFilename": assemblyFilename, "payloadFilename": payloadFilename, } # Ensure the interruptWidget is only created in a UI session if parentWidget: import UI4 self.__timer = time.time() self.__interruptWidget = UI4.Widgets.ModalProcessInterruptWidget( self.__interruptCallback, minWidth=512) else: self.__interruptWidget = None self.__timer = None assetId = node.getParameter("saveTo").getValue(frameTime) rootLocationsParam = node.getParameter("rootLocations") rootLocations = [x.getValue(frameTime) for x in rootLocationsParam.getChildren()] # Retrieve the Ops for each of the inputs referenceOp, passNamesAndOps = self.__getBakerOps( self._getPassInputPortNames(), graphState) sourceFile = NodegraphAPI.GetOriginalSourceFile() if not sourceFile: # Use legacy API call in case this file was created in a very old # version of Katana (1.6.11 or earlier) sourceFile = NodegraphAPI.GetSourceFile() sourceAsset = NodegraphAPI.GetKatanaSceneName() #When updating to the later version of the LookFileBakeAPI, dont # forget to update require3DInput from the Node.py baker = LookFileBaker("UsdExport") baker.progressCallback = self.__progressCallback baker.additionalSettings = additionalSettings baker.sourceAsset = sourceAsset baker.sourceFile = sourceFile if self.__interruptWidget: self.__interruptWidget.show() self.__interruptWidget.update("Saving Materials To %s" % assetId, True) try: baker.bakeAndPublish( referenceOp, passNamesAndOps, rootLocations, assetId) finally: if self.__interruptWidget: self.__interruptWidget.close() self.__interruptWidget.setParent(None) self.__interruptWidget.deleteLater() self.__interruptWidget = None def __progressCallback(self, message=None): """ The Callback for displaying progess in the interruptWidget whilst in UI mode. This is passed to the look file bake functionality code which handles passing back the text to write. @type message: C{str} @param message: The message to display in the progress bar. """ if not self.__interruptWidget or self.__timer: return tick = False if (time.time() - self.__timer) > 0.1: # Ensure we import QtWidgets if we know we have the interrupt # widget, which means we must be in a UI session. from Katana import QtWidgets QtWidgets.QApplication.processEvents() self.__timer = time.time() tick = True return self.__interruptWidget.update(message, tick) def __interruptCallback(self): class InterruptionException(Exception): pass raise InterruptionException() def _getReferenceInputPort(self): return self.getInputPortByIndex(0) def _getPassInputPorts(self): return self.getInputPorts()[1:] def _getReferenceInputPortName(self): return self._getReferenceInputPort().getName() def _getPassInputPortNames(self): return [port.getName() for port in self._getPassInputPorts()] def __getBakerOps(self, passInputPortNames, graphState): ops = LookFileBaking.GetLookFileBakeOps( self, [self._getReferenceInputPortName()] + passInputPortNames, graphState) referenceOp = ops[0] passNamesAndOps = zip(passInputPortNames, ops[1:]) return (referenceOp, passNamesAndOps) _parameters_XML = """ <group_parameter> <string_parameter name="__nodePanel" value="UsdMaterialBake"/> <number_parameter name="__networkVersion" value="{networkVersion}"/> <stringarray_parameter name="rootLocations" size="1" tupleSize="1"> <string_parameter name="i0" value="/root/world"/> </stringarray_parameter> <string_parameter name="saveTo"/> <string_parameter name="looksFilename" value="shadingVariants"/> <string_parameter name="looksFileFormat" value="usd"/> <number_parameter name="createCompleteUsdAssemblyFile" value="0"/> <string_parameter name="assemblyFilename" value="assembly"/> <string_parameter name="payloadFilename" value=""/> <string_parameter name="rootPrimName" value="/root"/> <string_parameter name="variantSetName" value="shadingVariants"/> <string_parameter name="alwaysCreateVariantSet" value="No"/> <stringarray_parameter name="variants" size="0" tupleSize="1"/> </group_parameter> """ _ExtraHints = { "UsdMaterialBake": { }, "UsdMaterialBake.rootLocations": { "widget": "scenegraphLocationArray", "help": """ Specify the rootLocations from which to read the scene graph difference from. """ }, "UsdMaterialBake.variants": {
<reponame>yohanesnuwara/seismic-deeplearning # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. # commitHash: c76bf579a0d5090ebd32426907d051d499f3e847 # url: https://github.com/olivesgatech/facies_classification_benchmark """Script to generate train and validation sets for Netherlands F3 dataset """ import itertools import logging import logging.config import math import warnings from os import path, mkdir import fire import numpy as np from sklearn.model_selection import train_test_split def _write_split_files(splits_path, train_list, val_list, loader_type): if not path.isdir(splits_path): mkdir(splits_path) file_object = open(path.join(splits_path, loader_type + "_train_val.txt"), "w") file_object.write("\n".join(train_list + val_list)) file_object.close() file_object = open(path.join(splits_path, loader_type + "_train.txt"), "w") file_object.write("\n".join(train_list)) file_object.close() file_object = open(path.join(splits_path, loader_type + "_val.txt"), "w") file_object.write("\n".join(val_list)) file_object.close() def _get_aline_range(aline, per_val, slice_steps): try: if slice_steps < 1: raise ValueError('slice_steps cannot be zero or a negative number') # Inline and Crossline sections val_aline = math.floor(aline * per_val / 2) val_aline_range = itertools.chain(range(0, val_aline), range(aline - val_aline, aline)) train_aline_range = range(val_aline, aline - val_aline, slice_steps) print("aline: ", aline) print("val_aline: ", val_aline) return train_aline_range, val_aline_range except (Exception, ValueError): raise def split_section_train_val(data_dir, output_dir, label_file, per_val=0.2, log_config=None, slice_steps=1): """Generate train and validation files for Netherlands F3 dataset. Args: data_dir (str): data directory path output_dir (str): directory under data_dir to store the split files label_file (str): npy files with labels. Stored in data_dir per_val (float, optional): the fraction of the volume to use for validation. Defaults to 0.2. log_config (str): path to log configurations slice_steps (int): increment to the slices count. If slice_steps > 1 the function will skip: slice_steps - 1 slice. Defaults to 1, do not skip any slice. """ if log_config is not None: logging.config.fileConfig(log_config) logger = logging.getLogger(__name__) logger.info("Splitting data into sections .... ") logger.info(f"Reading data from {data_dir}") logger.info(f"Loading {label_file}") labels = np.load(label_file) logger.debug(f"Data shape [iline|xline|depth] {labels.shape}") iline, xline, _ = labels.shape # Inline sections train_iline_range, val_iline_range = _get_aline_range(iline, per_val, slice_steps) train_i_list = ["i_" + str(i) for i in train_iline_range] val_i_list = ["i_" + str(i) for i in val_iline_range] # Xline sections train_xline_range, val_xline_range = _get_aline_range(xline, per_val, slice_steps) train_x_list = ["x_" + str(x) for x in train_xline_range] val_x_list = ["x_" + str(x) for x in val_xline_range] train_list = train_x_list + train_i_list val_list = val_x_list + val_i_list # write to files to disk logger.info(f"Writing {output_dir}") _write_split_files(output_dir, train_list, val_list, "section") def split_patch_train_val(data_dir, output_dir, label_file, stride, patch_size, slice_steps=1, per_val=0.2, log_config=None): """Generate train and validation files for Netherlands F3 dataset. Args: data_dir (str): data directory path output_dir (str): directory under data_dir to store the split files label_file (str): npy files with labels. Stored in data_dir stride (int): stride to use when sectioning of the volume patch_size (int): size of patch to extract per_val (float, optional): the fraction of the volume to use for validation. Defaults to 0.2. log_config (str): path to log configurations slice_steps (int): increment to the slices count. If slice_steps > 1 the function will skip: slice_steps - 1 slice. Defaults to 1, do not skip any slice. """ if log_config is not None: logging.config.fileConfig(log_config) logger = logging.getLogger(__name__) logger.info("Splitting data into patches .... ") logger.info(f"Reading data from {data_dir}") logger.info(f"Loading {label_file}") labels = np.load(label_file) logger.debug(f"Data shape [iline|xline|depth] {labels.shape}") iline, xline, depth = labels.shape # Inline sections train_iline_range, val_iline_range = _get_aline_range(iline, per_val, slice_steps) # Xline sections train_xline_range, val_xline_range = _get_aline_range(xline, per_val, slice_steps) # Generate patches from sections # Vertical locations is common to all patches processed vert_locations = range(0, depth - patch_size, patch_size) logger.debug(vert_locations) # Process inlines def _i_extract_patches(iline_range, horz_locations, vert_locations): for i in iline_range: locations = ([j, k] for j in horz_locations for k in vert_locations) for j, k in locations: yield "i_" + str(i) + "_" + str(j) + "_" + str(k) # Process inlines - train logger.debug("Generating Inline patches") logger.debug("Generating Inline patches - Train") # iline = xline x depth val_iline = math.floor(xline * per_val / 2) logger.debug(val_iline) # Process ilines - train horz_locations_train = range(val_iline, xline - val_iline, max(1,patch_size)) logger.debug(horz_locations_train) train_i_list = list(_i_extract_patches(train_iline_range, horz_locations_train, vert_locations)) # val_iline - define size of the validation set for the fist part val_iline_range = list(val_iline_range) # Process inlines - validation horz_locations_val = itertools.chain(range(0, val_iline, max(1,patch_size)), range(xline - val_iline, xline, max(1,patch_size))) val_iline_range = list(val_iline_range) val_i_list = list(_i_extract_patches(val_iline_range, horz_locations_val, vert_locations)) logger.debug(train_iline_range) logger.debug(val_iline_range) # Process crosslines def _x_extract_patches(xline_range, horz_locations, vert_locations): for j in xline_range: locations = ([i, k] for i in horz_locations for k in vert_locations) for i, k in locations: yield "x_" + str(i) + "_" + str(j) + "_" + str(k) logger.debug("Generating Crossline patches") logger.debug("Generating Crossline patches - Train") # xline = iline x depth val_xline = math.floor(iline * per_val / 2) logger.debug(val_xline) # Process xlines - train horz_locations_train = range(val_xline, iline - val_xline, max(1,patch_size)) logger.debug(horz_locations_train) train_x_list = list(_x_extract_patches(train_xline_range, horz_locations_train, vert_locations)) # val_xline - define size of the validation set for the fist part val_xline_range = list(val_xline_range) # Process xlines - validation horz_locations_val = itertools.chain(range(0, val_xline, max(1,patch_size)), range(iline - val_xline, iline, max(1,patch_size))) val_xline_range = list(val_xline_range) val_x_list = list(_x_extract_patches(val_xline_range, horz_locations_val, vert_locations)) logger.debug(train_xline_range) logger.debug(val_xline_range) train_list = train_x_list + train_i_list val_list = val_x_list + val_i_list logger.debug(train_list) logger.debug(val_list) # write to files to disk: # NOTE: This isn't quite right we should calculate the patches # again for the whole volume logger.info(f"Writing {output_dir}") _write_split_files(output_dir, train_list, val_list, "patch") _LOADER_TYPES = {"section": split_section_train_val, "patch": split_patch_train_val} def get_split_function(loader_type): return _LOADER_TYPES.get(loader_type, split_patch_train_val) def run_split_func(loader_type, *args, **kwargs): split_func = get_split_function(loader_type) split_func(*args, **kwargs) def split_alaudah_et_al_19(data_dir, stride, patch_size, fraction_validation=0.2, loader_type="patch", log_config=None): """Generate train and validation files (with overlap) for Netherlands F3 dataset. The original split method from https://github.com/olivesgatech/facies_classification_benchmark DON'T USE, SEE NOTES BELOW Args: data_dir (str): data directory path stride (int): stride to use when sectioning of the volume patch_size (int): size of patch to extract fraction_validation (float, optional): the fraction of the volume to use for validation. Defaults to 0.2. loader_type (str, optional): type of data loader, can be "patch" or "section". Defaults to "patch". log_config (str, optional): path to log config. Defaults to None. Notes: Only kept for reproducibility. It generates overlapping train and val which makes validation results unreliable. """ if log_config is not None: logging.config.fileConfig(log_config) warnings.warn("THIS CREATES OVERLAPPING TRAINING AND VALIDATION SETS") assert loader_type in [ "section", "patch", ], f"Loader type {loader_type} is not valid. \ Please specify either 'section' or 'patch' for loader_type" # create inline and crossline pacthes for training and validation: logger = logging.getLogger(__name__) logger.info("Reading data from {data_dir}") labels_path = _get_labels_path(data_dir) logger.info("Loading {labels_path}") labels = np.load(labels_path) iline, xline, depth = labels.shape logger.debug(f"Data shape [iline|xline|depth] {labels.shape}") if loader_type == "section": i_list = ["i_" + str(i) for i in range(iline)] x_list = ["x_" + str(x) for x in range(xline)] elif loader_type == "patch": i_list = [] horz_locations = range(0, xline - patch_size + 1, stride) vert_locations = range(0, depth - patch_size + 1, stride) logger.debug("Generating Inline patches") logger.debug(horz_locations) logger.debug(vert_locations) for i in range(iline): # for every inline: # images are references by top-left corner: locations = [[j, k] for j in horz_locations for k in vert_locations] patches_list = ["i_" + str(i) + "_" + str(j) + "_" + str(k) for j, k in locations] i_list.append(patches_list) # flatten the list i_list = list(itertools.chain(*i_list)) x_list = [] horz_locations = range(0, iline - patch_size + 1, stride) vert_locations = range(0, depth - patch_size + 1, stride) for j in range(xline): # for every xline: # images are references by top-left corner: locations = [[i, k] for i in horz_locations for k in vert_locations] patches_list = ["x_" + str(i) + "_" + str(j) + "_" + str(k) for i, k in locations] x_list.append(patches_list) # flatten the list x_list = list(itertools.chain(*x_list)) list_train_val = i_list + x_list # create train and validation splits: train_list, val_list = train_test_split(list_train_val, val_size=fraction_validation, shuffle=True) # write to files to disk: splits_path = _get_splits_path(data_dir) _write_split_files(splits_path, train_list, val_list, loader_type) # TODO: Try https://github.com/Chilipp/docrep for doscstring reuse class SplitTrainValCLI(object): def section(self, data_dir, label_file, per_val=0.2, log_config="logging.conf", output_dir=None, slice_steps=1): """Generate section based train and validation files for Netherlands F3 dataset. Args: data_dir (str): data directory path output_dir (str): directory under data_dir to store the split files label_file (str): npy files with labels. Stored in data_dir per_val (float, optional): the fraction of the volume to use for validation. Defaults to 0.2. log_config (str): path to log configurations slice_steps
False == false_res.json()['enable'] req['build_index_resources'] = -3.222 requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) res = requests.get(base_url + 'config/gpu_resources') assert false_res.json() == res.json() def test_put_gpu_resources_build_index_resources_16(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = False res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) false_res = requests.get(base_url + 'config/gpu_resources') assert False == false_res.json()['enable'] req['build_index_resources'] = ' ' requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) res = requests.get(base_url + 'config/gpu_resources') assert false_res.json() == res.json() def test_put_gpu_resources_build_index_resources_17(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = False res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) false_res = requests.get(base_url + 'config/gpu_resources') assert False == false_res.json()['enable'] req['build_index_resources'] = '汉子' requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) res = requests.get(base_url + 'config/gpu_resources') assert false_res.json() == res.json() def test_put_gpu_resources_build_index_resources_18(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = False res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) false_res = requests.get(base_url + 'config/gpu_resources') assert False == false_res.json()['enable'] req['build_index_resources'] = '\t' requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) res = requests.get(base_url + 'config/gpu_resources') assert false_res.json() == res.json() def test_put_gpu_resources_build_index_resources_19(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources#') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = False res = requests.put(base_url + 'config/gpu_resources#', data=json.dumps(req)) false_res = requests.get(base_url + 'config/gpu_resources#') assert False == false_res.json()['enable'] requests.put(base_url + 'config/gpu_resources#', data=json.dumps(req)) res = requests.get(base_url + 'config/gpu_resources#') assert false_res.json() == res.json() def test_put_gpu_resources_build_index_resources_20(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources?') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = False res = requests.put(base_url + 'config/gpu_resources?', data=json.dumps(req)) false_res = requests.get(base_url + 'config/gpu_resources?') assert False == false_res.json()['enable'] requests.put(base_url + 'config/gpu_resources?', data=json.dumps(req)) res = requests.get(base_url + 'config/gpu_resources?') assert false_res.json() == res.json() def test_put_gpu_resources_build_index_resources_21(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources/') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = False res = requests.put(base_url + 'config/gpu_resources/', data=json.dumps(req)) false_res = requests.get(base_url + 'config/gpu_resources/') assert False == false_res.json()['enable'] requests.put(base_url + 'config/gpu_resources/', data=json.dumps(req)) res = requests.get(base_url + 'config/gpu_resources/') assert false_res.json() == res.json() def test_put_gpu_resources_build_index_resources_22(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = True res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) true_res = requests.get(base_url + 'config/gpu_resources') assert True == true_res.json()['enable'] logging.getLogger().info(true_res.json()) req = copy.deepcopy(original_req) req['build_index_resources'] = 0 requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) res = requests.get(base_url + 'config/gpu_resources') logging.getLogger().info(res.json()) def test_put_gpu_resources_build_index_resources_23(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = True res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) true_res = requests.get(base_url + 'config/gpu_resources') assert True == true_res.json()['enable'] req['build_index_resources'] = 5 res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) assert 500 == res.status_code assert 'Internal Server Error' in res.text res = requests.get(base_url + 'config/gpu_resources') assert true_res.json() == res.json() def test_put_gpu_resources_build_index_resources_24(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = True res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) true_res = requests.get(base_url + 'config/gpu_resources') assert True == true_res.json()['enable'] req['build_index_resources'] = 2147386 res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) assert 500 == res.status_code assert 'Internal Server Error' in res.text res = requests.get(base_url + 'config/gpu_resources') assert true_res.json() == res.json() def test_put_gpu_resources_build_index_resources_25(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = True res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) true_res = requests.get(base_url + 'config/gpu_resources') assert True == true_res.json()['enable'] req['build_index_resources'] = -10 res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) assert 500 == res.status_code assert 'Internal Server Error' in res.text res = requests.get(base_url + 'config/gpu_resources') assert true_res.json() == res.json() def test_put_gpu_resources_build_index_resources_26(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = True res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) true_res = requests.get(base_url + 'config/gpu_resources') assert True == true_res.json()['enable'] req['build_index_resources'] = 5 res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) assert 500 == res.status_code assert 'Internal Server Error' in res.text res = requests.get(base_url + 'config/gpu_resources') assert true_res.json() == res.json() def test_put_gpu_resources_build_index_resources_27(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = True res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) true_res = requests.get(base_url + 'config/gpu_resources') assert True == true_res.json()['enable'] req['build_index_resources'] = 0.0 res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) assert 500 == res.status_code assert 'Internal Server Error' in res.text res = requests.get(base_url + 'config/gpu_resources') assert true_res.json() == res.json() def test_put_gpu_resources_build_index_resources_28(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = True res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) true_res = requests.get(base_url + 'config/gpu_resources') assert True == true_res.json()['enable'] req['build_index_resources'] = '' res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) assert 500 == res.status_code assert 'Internal Server Error' in res.text res = requests.get(base_url + 'config/gpu_resources') assert true_res.json() == res.json() def test_put_gpu_resources_build_index_resources_29(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = True res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) true_res = requests.get(base_url + 'config/gpu_resources') assert True == true_res.json()['enable'] req['build_index_resources'] = 'xxxx' res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) assert res.status_code == 500 assert 'Internal Server Error' in res.text res = requests.get(base_url + 'config/gpu_resources') assert true_res.json() == res.json() def test_put_gpu_resources_build_index_resources_30(self, args): if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') if self.get_mode(args) == 'CPU': pytest.skip('this API do not support CPU version') base_url = 'http://%s:%s/' % (args['ip'], args['port']) res = requests.get(base_url + 'config/gpu_resources') original_req = res.json() req = copy.deepcopy(original_req) req['enable'] = True res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) true_res = requests.get(base_url + 'config/gpu_resources') assert True == true_res.json()['enable'] req['build_index_resources'] = '_%20' res = requests.put(base_url + 'config/gpu_resources', data=json.dumps(req)) assert res.status_code == 500 assert 'Internal Server Error' in res.text res = requests.get(base_url + 'config/gpu_resources') assert req['build_index_resources'] != res.json()['build_index_resources'] assert true_res.json() == res.json() def test_put_gpu_resources_build_index_resources_31(self, args): if self.get_mode(args) ==
from pollination_dsl.alias import OutputAlias from queenbee.io.common import IOAliasHandler """Alias for daylight factor recipe output.""" daylight_factor_results = [ OutputAlias.any( name='results', description='Daylight factor values. These can be plugged into the "LB ' 'Spatial Heatmap" component along with meshes of the sensor grids to ' 'visualize results.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_df_from_folder' ) ] ), # Revit alias OutputAlias.any( name='results', description='Daylight factor values.', platform=['revit'], handler=[ IOAliasHandler( language='csharp', module='Pollination.RevitHandlers', function='ReadDaylightFactorResultsFromFolder' ), IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_df_from_folder' ) ] ), # Rhino alias OutputAlias.linked( name='results', platform=['rhino'], handler=[ # Preload results IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_df_from_folder' ), # load preloaded outputs to Rhino with following method IOAliasHandler( language='csharp', module='Pollination.RhinoHandlers', function='LoadMeshBasedResultsToRhino' ) ] ) ] """Alias for sky view recipe output.""" sky_view_results = [ OutputAlias.any( name='results', description='Numbers for the sky view or sky exposure at each sensor. These ' 'can be plugged into the "LB Spatial Heatmap" component along with meshes of ' 'the sensor grids to visualize results. Values are in percent (between 0 ' 'and 100).', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_df_from_folder' ) ] ) ] """Point-in-time grid-based results.""" point_in_time_grid_results = [ OutputAlias.any( name='results', description='Numbers for the point-in-time value at each sensor. These can be ' 'plugged into the "LB Spatial Heatmap" component along with meshes of the ' 'sensor grids to visualize results. Values are in the standard SI ' 'units of the requested input metric.\n* illuminance = lux' '\n* irradiance = W/m2\n* luminance = cd/m2\n* radiance = W/m2-sr', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_pit_from_folder' ) ] ) ] """Point-in-time view-based results.""" point_in_time_view_results = [ OutputAlias.any( name='results', description='High Dynamic Range (HDR) images for each View in the model. These ' 'can be plugged into the Ladybug "Image Viewer" component to preview the image. ' 'They can also be plugged into the "HB False Color" component to convert ' 'the image into a false color version. Lastly, it can be connected to ' 'the "HB HDR to GIF" component to get a GIF image that is more portable ' 'and easily previewed by different software. Pixel values are ' 'in the standard SI units of the requested input metric.\n* illuminance = lux' '\n* irradiance = W/m2\n* luminance = cd/m2\n* radiance = W/m2-sr', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_images_from_folder' ) ] ) ] """Cumulative sun hours output from the direct sun hours recipe.""" cumulative_sun_hour_results = [ OutputAlias.any( name='hours', description='The cumulative number of timesteps that each sensor sees the sun. ' 'If the input wea timestep is 1 (the default), then this is the number of ' 'direct sun hours for each sensor. These can be plugged into the "LB ' 'Spatial Heatmap" component along with meshes of the sensor grids to ' 'visualize results.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_hours_from_folder' ) ] ) ] """Direct sun hours recipe output.""" direct_sun_hours_results = [ OutputAlias.any( name='results', description='Raw result files (.ill) that contain the number of timesteps ' 'that each sensor is exposed to sun. The units are the timestep of ' 'input wea file. For an hourly wea, each value corresponds to an hour ' 'of direct sun.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='sort_ill_from_folder' ) ] ) ] """Annual daylight recipe output.""" annual_daylight_results = [ OutputAlias.any( name='results', description='Raw result files (.ill) that contain illuminance matrices.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='sort_ill_from_folder' ) ] ) ] daylight_autonomy_results = [ OutputAlias.any( name='DA', description='Daylight autonomy values for each sensor. These can be plugged ' 'into the "LB Spatial Heatmap" component along with meshes of the sensor ' 'grids to visualize results.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_da_from_folder' ) ] ), # Rhino alias OutputAlias.linked( name='DA Results', platform=['rhino'], handler=[ # Preload results IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_da_from_folder' ), # load preloaded outputs to Rhino with following method IOAliasHandler( language='csharp', module='Pollination.RhinoHandlers', function='LoadMeshBasedResultsToRhino' ) ] ) ] continuous_daylight_autonomy_results = [ OutputAlias.any( name='cDA', description='Continuous daylight autonomy values for each sensor. These can ' 'be plugged into the "LB Spatial Heatmap" component along with meshes of ' 'the sensor grids to visualize results.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_cda_from_folder' ) ] ), # Rhino alias OutputAlias.linked( name='cDA Results', platform=['rhino'], handler=[ # Preload results IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_cda_from_folder' ), # load preloaded outputs to Rhino with following method IOAliasHandler( language='csharp', module='Pollination.RhinoHandlers', function='LoadMeshBasedResultsToRhino' ) ] ) ] udi_results = [ OutputAlias.any( name='UDI', description='Useful daylight autonomy values for each sensor. These can be ' 'plugged into the "LB Spatial Heatmap" component along with meshes of the ' 'sensor grids to visualize results.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_udi_from_folder' ) ] ), # Rhino alias OutputAlias.linked( name='UDI Results', platform=['rhino'], handler=[ # Preload results IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_udi_from_folder' ), # load preloaded outputs to Rhino with following method IOAliasHandler( language='csharp', module='Pollination.RhinoHandlers', function='LoadMeshBasedResultsToRhino' ) ] ) ] udi_lower_results = [ OutputAlias.any( name='UDI_low', description='Values for the percent of time that is below the lower threshold ' 'of useful daylight illuminance. These can be plugged into the "LB ' 'Spatial Heatmap" component along with meshes of the sensor grids to ' 'visualize results.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_udi_from_folder' ) ] ), # Rhino alias OutputAlias.linked( name='UDI low Results', platform=['rhino'], handler=[ # Preload results IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_udi_from_folder' ), # load preloaded outputs to Rhino with following method IOAliasHandler( language='csharp', module='Pollination.RhinoHandlers', function='LoadMeshBasedResultsToRhino' ) ] ) ] udi_upper_results = [ OutputAlias.any( name='UDI_up', description='Values for the percent of time that is above the upper threshold ' 'of useful daylight illuminance. These can be plugged into the "LB ' 'Spatial Heatmap" component along with meshes of the sensor grids to ' 'visualize results.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_udi_from_folder' ) ] ), # Rhino alias OutputAlias.linked( name='UDI up Results', platform=['rhino'], handler=[ # Preload results IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_udi_from_folder' ), # load preloaded outputs to Rhino with following method IOAliasHandler( language='csharp', module='Pollination.RhinoHandlers', function='LoadMeshBasedResultsToRhino' ) ] ) ] """Total Irradiance results from the Annual Irradiance recipe.""" total_radiation_results = [ OutputAlias.any( name='results', description='Raw result files (.ill) that contain irradiance matrices ' 'for the total radiation at each sensor and timestep.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='sort_ill_from_folder' ) ] ) ] """Direct Irradiance results from the Annual Irradiance recipe.""" direct_radiation_results = [ OutputAlias.any( name='direct', description='Raw result files (.ill) that contain irradiance matrices ' 'for the direct radiation at each sensor and timestep.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='sort_ill_from_folder' ) ] ) ] """Average Irradiance from the Annual Irradiance recipe.""" average_irradiance_results = [ OutputAlias.any( name='avg_irr', description='The average irradiance in W/m2 for each sensor over the Wea ' 'time period.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_pit_from_folder' ) ] ) ] """Peak Irradiance from the Annual Irradiance recipe.""" peak_irradiance_results = [ OutputAlias.any( name='peak_irr', description='The highest irradiance value in W/m2 during the Wea time period. ' 'This is suitable for assessing the worst-case solar load of clear skies on ' 'cooling design days. It can also be used to determine the highest radiant ' 'temperatures that occupants might experience in over the time period of ' 'the Wea.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_pit_from_folder' ) ] ) ] """Peak Irradiance from the Annual Irradiance recipe.""" cumulative_radiation_results = [ OutputAlias.any( name='radiation', description='The cumulative radiation in kWh/m2 over the Wea time period.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_pit_from_folder' ) ] ) ] """LEED Daylight Illuminance 9AM recipe output.""" illuminance_9am_results = [ OutputAlias.any( name='ill_9am', description='Illuminance results for the 9AM simulation in lux.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_pit_from_folder' ) ] ) ] """LEED Daylight Illuminance 3PM recipe output.""" illuminance_3pm_results = [ OutputAlias.any( name='ill_3pm', description='Illuminance results for the 3PM simulation in lux.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_pit_from_folder' ) ] ) ] """LEED Daylight Pass/Fail 9AM recipe output.""" pass_fail_9am_results = [ OutputAlias.any( name='passing_9am', description='Pass/Fail results for the 9AM simulation as one/zero values.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_pit_from_folder' ) ] ) ] """LEED Daylight Pass/Fail 9AM recipe output.""" pass_fail_3pm_results = [ OutputAlias.any( name='passing_3pm', description='Pass/Fail results for the 3PM simulation as one/zero values.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_pit_from_folder' ) ] ) ] """LEED Daylight Pass/Fail combined recipe output.""" pass_fail_comb_results = [ OutputAlias.any( name='passing_comb', description='Pass/Fail results for the combined simulation as one/zero values.', platform=['grasshopper'], handler=[ IOAliasHandler( language='python', module='pollination_handlers.outputs.daylight', function='read_pit_from_folder' ) ] ) ] """LEED daylight illuminance credit summary output. The result is a JSON with a summary of the credits achieved. """ leed_ill_credit_summary_results = [ OutputAlias.any( name='credits', description='The number of LEED daylight
158, 157.949316, False), 'Lu-159': Iso('Lu-159', 'lutetium-159', 71, 159, 158.946636, False), 'Lu-160': Iso('Lu-160', 'lutetium-160', 71, 160, 159.946033, False), 'Lu-161': Iso('Lu-161', 'lutetium-161', 71, 161, 160.943572, False), 'Lu-162': Iso('Lu-162', 'lutetium-162', 71, 162, 161.943283, False), 'Lu-163': Iso('Lu-163', 'lutetium-163', 71, 163, 162.941179, False), 'Lu-164': Iso('Lu-164', 'lutetium-164', 71, 164, 163.941339, False), 'Lu-165': Iso('Lu-165', 'lutetium-165', 71, 165, 164.939407, False), 'Lu-166': Iso('Lu-166', 'lutetium-166', 71, 166, 165.939859, False), 'Lu-167': Iso('Lu-167', 'lutetium-167', 71, 167, 166.938270, False), 'Lu-168': Iso('Lu-168', 'lutetium-168', 71, 168, 167.938736, False), 'Lu-169': Iso('Lu-169', 'lutetium-169', 71, 169, 168.9376441, False), 'Lu-170': Iso('Lu-170', 'lutetium-170', 71, 170, 169.938478, False), 'Lu-171': Iso('Lu-171', 'lutetium-171', 71, 171, 170.9379170, False), 'Lu-172': Iso('Lu-172', 'lutetium-172', 71, 172, 171.9390891, False), 'Lu-173': Iso('Lu-173', 'lutetium-173', 71, 173, 172.9389340, False), 'Lu-174': Iso('Lu-174', 'lutetium-174', 71, 174, 173.9403409, False), 'Lu-175': Iso('Lu-175', 'lutetium-175', 71, 175, 174.9407752, True, isotopic_abundance=0.97401), 'Lu-176': Iso('Lu-176', 'lutetium-176', 71, 176, 175.9426897, False, isotopic_abundance=0.02599), 'Lu-177': Iso('Lu-177', 'lutetium-177', 71, 177, 176.9437615, False, half_life=573696.0), 'Lu-178': Iso('Lu-178', 'lutetium-178', 71, 178, 177.9459580, False), 'Lu-179': Iso('Lu-179', 'lutetium-179', 71, 179, 178.9473309, False), 'Lu-180': Iso('Lu-180', 'lutetium-180', 71, 180, 179.949888, False), 'Lu-181': Iso('Lu-181', 'lutetium-181', 71, 181, 180.95191, False), 'Lu-182': Iso('Lu-182', 'lutetium-182', 71, 182, 181.95504, False), 'Lu-183': Iso('Lu-183', 'lutetium-183', 71, 183, 182.957363, False), 'Lu-184': Iso('Lu-184', 'lutetium-184', 71, 184, 183.96091, False), 'Lu-185': Iso('Lu-185', 'lutetium-185', 71, 185, 184.96362, False), 'Hf-153': Iso('Hf-153', 'hafnium-153', 72, 153, 152.97069, False), 'Hf-154': Iso('Hf-154', 'hafnium-154', 72, 154, 153.96486, False), 'Hf-155': Iso('Hf-155', 'hafnium-155', 72, 155, 154.96311, False), 'Hf-156': Iso('Hf-156', 'hafnium-156', 72, 156, 155.95935, False), 'Hf-157': Iso('Hf-157', 'hafnium-157', 72, 157, 156.95824, False), 'Hf-158': Iso('Hf-158', 'hafnium-158', 72, 158, 157.954801, False), 'Hf-159': Iso('Hf-159', 'hafnium-159', 72, 159, 158.953996, False), 'Hf-160': Iso('Hf-160', 'hafnium-160', 72, 160, 159.950691, False), 'Hf-161': Iso('Hf-161', 'hafnium-161', 72, 161, 160.950278, False), 'Hf-162': Iso('Hf-162', 'hafnium-162', 72, 162, 161.9472148, False), 'Hf-163': Iso('Hf-163', 'hafnium-163', 72, 163, 162.947113, False), 'Hf-164': Iso('Hf-164', 'hafnium-164', 72, 164, 163.944371, False), 'Hf-165': Iso('Hf-165', 'hafnium-165', 72, 165, 164.944567, False), 'Hf-166': Iso('Hf-166', 'hafnium-166', 72, 166, 165.942180, False), 'Hf-167': Iso('Hf-167', 'hafnium-167', 72, 167, 166.942600, False), 'Hf-168': Iso('Hf-168', 'hafnium-168', 72, 168, 167.940568, False), 'Hf-169': Iso('Hf-169', 'hafnium-169', 72, 169, 168.941259, False), 'Hf-170': Iso('Hf-170', 'hafnium-170', 72, 170, 169.939609, False), 'Hf-171': Iso('Hf-171', 'hafnium-171', 72, 171, 170.940492, False), 'Hf-172': Iso('Hf-172', 'hafnium-172', 72, 172, 171.939450, False), 'Hf-173': Iso('Hf-173', 'hafnium-173', 72, 173, 172.940513, False), 'Hf-174': Iso('Hf-174', 'hafnium-174', 72, 174, 173.9400461, False, isotopic_abundance=0.0016), 'Hf-175': Iso('Hf-175', 'hafnium-175', 72, 175, 174.9415092, False), 'Hf-176': Iso('Hf-176', 'hafnium-176', 72, 176, 175.9414076, True, isotopic_abundance=0.0526), 'Hf-177': Iso('Hf-177', 'hafnium-177', 72, 177, 176.9432277, True, isotopic_abundance=0.1860), 'Hf-178': Iso('Hf-178', 'hafnium-178', 72, 178, 177.9437058, True, isotopic_abundance=0.2728), 'Hf-179': Iso('Hf-179', 'hafnium-179', 72, 179, 178.9458232, True, isotopic_abundance=0.1362), 'Hf-180': Iso('Hf-180', 'hafnium-180', 72, 180, 179.9465570, True, isotopic_abundance=0.3508), 'Hf-181': Iso('Hf-181', 'hafnium-181', 72, 181, 180.9491083, False), 'Hf-182': Iso('Hf-182', 'hafnium-182', 72, 182, 181.9505612, False), 'Hf-183': Iso('Hf-183', 'hafnium-183', 72, 183, 182.953530, False), 'Hf-184': Iso('Hf-184', 'hafnium-184', 72, 184, 183.955446, False), 'Hf-185': Iso('Hf-185', 'hafnium-185', 72, 185, 184.958862, False), 'Hf-186': Iso('Hf-186', 'hafnium-186', 72, 186, 185.960897, False), 'Hf-187': Iso('Hf-187', 'hafnium-187', 72, 187, 186.96477, False), 'Hf-188': Iso('Hf-188', 'hafnium-188', 72, 188, 187.96685, False), 'Hf-189': Iso('Hf-189', 'hafnium-189', 72, 189, 188.97084, False), 'Ta-155': Iso('Ta-155', 'tantalum-155', 73, 155, 154.97424, False), 'Ta-156': Iso('Ta-156', 'tantalum-156', 73, 156, 155.97203, False), 'Ta-157': Iso('Ta-157', 'tantalum-157', 73, 157, 156.96818, False), 'Ta-158': Iso('Ta-158', 'tantalum-158', 73, 158, 157.96654, False), 'Ta-159': Iso('Ta-159', 'tantalum-159', 73, 159, 158.963023, False), 'Ta-160': Iso('Ta-160', 'tantalum-160', 73, 160, 159.961488, False), 'Ta-161': Iso('Ta-161', 'tantalum-161', 73, 161, 160.958452, False), 'Ta-162': Iso('Ta-162', 'tantalum-162', 73, 162, 161.957294, False), 'Ta-163': Iso('Ta-163', 'tantalum-163', 73, 163, 162.954337, False), 'Ta-164': Iso('Ta-164', 'tantalum-164', 73, 164, 163.953534, False), 'Ta-165': Iso('Ta-165', 'tantalum-165', 73, 165, 164.950781, False), 'Ta-166': Iso('Ta-166', 'tantalum-166', 73, 166, 165.950512, False), 'Ta-167': Iso('Ta-167', 'tantalum-167', 73, 167, 166.948093, False), 'Ta-168': Iso('Ta-168', 'tantalum-168', 73, 168, 167.948047, False), 'Ta-169': Iso('Ta-169', 'tantalum-169', 73, 169, 168.946011, False), 'Ta-170': Iso('Ta-170', 'tantalum-170', 73, 170, 169.946175, False), 'Ta-171': Iso('Ta-171', 'tantalum-171', 73, 171, 170.944476, False), 'Ta-172': Iso('Ta-172', 'tantalum-172', 73, 172, 171.944895, False), 'Ta-173': Iso('Ta-173', 'tantalum-173', 73, 173, 172.943750, False), 'Ta-174': Iso('Ta-174', 'tantalum-174', 73, 174, 173.944454, False), 'Ta-175': Iso('Ta-175', 'tantalum-175', 73, 175, 174.943737, False), 'Ta-176': Iso('Ta-176', 'tantalum-176', 73, 176, 175.944857, False), 'Ta-177': Iso('Ta-177', 'tantalum-177', 73, 177, 176.9444795, False), 'Ta-178': Iso('Ta-178', 'tantalum-178', 73, 178, 177.945678, False), 'Ta-179': Iso('Ta-179', 'tantalum-179', 73, 179, 178.9459366, False), 'Ta-180': Iso('Ta-180', 'tantalum-180', 73, 180, 179.9474648, True, isotopic_abundance=0.0001201), 'Ta-181': Iso('Ta-181', 'tantalum-181', 73, 181, 180.9479958, True, isotopic_abundance=0.9998799), 'Ta-182': Iso('Ta-182', 'tantalum-182', 73, 182, 181.9501519, False), 'Ta-183': Iso('Ta-183', 'tantalum-183', 73, 183, 182.9513726, False), 'Ta-184': Iso('Ta-184', 'tantalum-184', 73, 184, 183.954008, False), 'Ta-185': Iso('Ta-185', 'tantalum-185', 73, 185, 184.955559, False), 'Ta-186': Iso('Ta-186', 'tantalum-186', 73, 186, 185.958551, False), 'Ta-187': Iso('Ta-187', 'tantalum-187', 73, 187, 186.960386, False), 'Ta-188': Iso('Ta-188', 'tantalum-188', 73, 188, 187.963916, False), 'Ta-189': Iso('Ta-189', 'tantalum-189', 73, 189, 188.96583, False), 'Ta-190': Iso('Ta-190', 'tantalum-190', 73, 190, 189.96939, False), 'Ta-191': Iso('Ta-191', 'tantalum-191', 73, 191, 190.97156, False), 'Ta-192': Iso('Ta-192', 'tantalum-192', 73, 192, 191.97514, False), 'W-157': Iso('W-157', 'tungsten-157', 74, 157, 156.97884, False), 'W-158': Iso('W-158', 'tungsten-158', 74, 158, 157.97456, False), 'W-159': Iso('W-159', 'tungsten-159', 74, 159, 158.97264, False), 'W-160': Iso('W-160', 'tungsten-160', 74, 160, 159.96846, False), 'W-161': Iso('W-161', 'tungsten-161', 74, 161, 160.96720, False), 'W-162': Iso('W-162', 'tungsten-162', 74, 162, 161.963499, False), 'W-163': Iso('W-163', 'tungsten-163', 74, 163, 162.962524, False), 'W-164': Iso('W-164', 'tungsten-164', 74, 164, 163.958961, False), 'W-165': Iso('W-165', 'tungsten-165', 74, 165, 164.958281, False), 'W-166': Iso('W-166', 'tungsten-166', 74, 166, 165.955031, False), 'W-167': Iso('W-167', 'tungsten-167', 74, 167, 166.954805, False), 'W-168': Iso('W-168', 'tungsten-168', 74, 168, 167.951806, False), 'W-169': Iso('W-169', 'tungsten-169', 74, 169, 168.951779, False), 'W-170': Iso('W-170', 'tungsten-170', 74, 170, 169.949232, False), 'W-171': Iso('W-171', 'tungsten-171', 74, 171, 170.949451, False), 'W-172': Iso('W-172', 'tungsten-172', 74, 172, 171.947292, False), 'W-173': Iso('W-173', 'tungsten-173', 74, 173, 172.947689, False), 'W-174': Iso('W-174', 'tungsten-174', 74, 174, 173.946079, False), 'W-175': Iso('W-175', 'tungsten-175', 74, 175, 174.946717, False), 'W-176': Iso('W-176', 'tungsten-176', 74, 176, 175.945634, False), 'W-177': Iso('W-177', 'tungsten-177', 74, 177, 176.946643, False), 'W-178': Iso('W-178', 'tungsten-178', 74, 178, 177.945883, False), 'W-179': Iso('W-179', 'tungsten-179', 74, 179, 178.947077, False), 'W-180': Iso('W-180', 'tungsten-180', 74, 180, 179.9467108, False, isotopic_abundance=0.0012), 'W-181': Iso('W-181', 'tungsten-181', 74, 181, 180.9481978, False, half_life=10462608.0), 'W-182': Iso('W-182', 'tungsten-182', 74, 182, 181.94820394, True, isotopic_abundance=0.2650), 'W-183': Iso('W-183', 'tungsten-183', 74, 183, 182.95022275, True, isotopic_abundance=0.1431), 'W-184': Iso('W-184', 'tungsten-184', 74, 184, 183.95093092, True, isotopic_abundance=0.3064), 'W-185': Iso('W-185', 'tungsten-185', 74, 185, 184.95341897, False), 'W-186': Iso('W-186', 'tungsten-186', 74, 186, 185.9543628, True, isotopic_abundance=0.2843), 'W-187': Iso('W-187', 'tungsten-187', 74, 187, 186.9571588, False), 'W-188': Iso('W-188', 'tungsten-188', 74, 188, 187.9584862, False, half_life=6029251.2), 'W-189': Iso('W-189', 'tungsten-189', 74, 189, 188.961763, False), 'W-190': Iso('W-190', 'tungsten-190', 74, 190, 189.963091, False), 'W-191': Iso('W-191', 'tungsten-191', 74, 191, 190.966531, False), 'W-192': Iso('W-192', 'tungsten-192', 74, 192, 191.96817, False), 'W-193': Iso('W-193', 'tungsten-193', 74, 193, 192.97178, False), 'W-194': Iso('W-194', 'tungsten-194', 74, 194, 193.97367, False), 'Re-159': Iso('Re-159', 'rhenium-159', 75, 159, 158.98418, False), 'Re-160': Iso('Re-160', 'rhenium-160', 75, 160, 159.98182, False), 'Re-161': Iso('Re-161', 'rhenium-161', 75, 161, 160.97757, False), 'Re-162': Iso('Re-162', 'rhenium-162', 75, 162, 161.97584, False), 'Re-163': Iso('Re-163', 'rhenium-163', 75, 163, 162.972080, False), 'Re-164': Iso('Re-164', 'rhenium-164', 75, 164, 163.970453, False), 'Re-165': Iso('Re-165', 'rhenium-165', 75, 165, 164.967103, False), 'Re-166': Iso('Re-166', 'rhenium-166', 75, 166, 165.965761, False), 'Re-167': Iso('Re-167', 'rhenium-167', 75, 167, 166.962595, False), 'Re-168': Iso('Re-168', 'rhenium-168', 75, 168, 167.961573, False), 'Re-169': Iso('Re-169', 'rhenium-169', 75, 169, 168.958766, False), 'Re-170': Iso('Re-170', 'rhenium-170', 75, 170, 169.958220, False), 'Re-171': Iso('Re-171', 'rhenium-171', 75, 171, 170.955716, False), 'Re-172': Iso('Re-172', 'rhenium-172', 75, 172, 171.955420, False), 'Re-173': Iso('Re-173', 'rhenium-173', 75, 173, 172.953243, False), 'Re-174': Iso('Re-174', 'rhenium-174', 75, 174, 173.953115, False), 'Re-175': Iso('Re-175', 'rhenium-175', 75, 175, 174.951381, False), 'Re-176': Iso('Re-176', 'rhenium-176', 75, 176, 175.951623, False), 'Re-177': Iso('Re-177', 'rhenium-177', 75, 177, 176.950328, False), 'Re-178': Iso('Re-178', 'rhenium-178', 75, 178, 177.950989, False), 'Re-179': Iso('Re-179', 'rhenium-179', 75, 179, 178.949989, False), 'Re-180': Iso('Re-180', 'rhenium-180', 75, 180, 179.950792, False), 'Re-181': Iso('Re-181', 'rhenium-181', 75, 181, 180.950058, False), 'Re-182': Iso('Re-182', 'rhenium-182', 75, 182, 181.95121, False), 'Re-183': Iso('Re-183', 'rhenium-183', 75, 183, 182.9508196, False), 'Re-184': Iso('Re-184', 'rhenium-184', 75, 184, 183.9525228, False), 'Re-185': Iso('Re-185', 'rhenium-185', 75, 185, 184.9529545, True, isotopic_abundance=0.3740), 'Re-186': Iso('Re-186', 'rhenium-186', 75, 186, 185.9549856, False, half_life=321292.8), 'Re-187': Iso('Re-187', 'rhenium-187', 75, 187, 186.9557501, False, isotopic_abundance=0.6260), 'Re-188': Iso('Re-188', 'rhenium-188', 75, 188, 187.9581115, False, half_life=61203.600000000006), 'Re-189': Iso('Re-189', 'rhenium-189', 75, 189, 188.9592260, False), 'Re-190': Iso('Re-190', 'rhenium-190', 75, 190, 189.961744, False), 'Re-191': Iso('Re-191', 'rhenium-191', 75, 191, 190.963122, False), 'Re-192': Iso('Re-192', 'rhenium-192', 75, 192, 191.966088, False), 'Re-193': Iso('Re-193', 'rhenium-193', 75, 193, 192.967541, False), 'Re-194': Iso('Re-194', 'rhenium-194', 75, 194, 193.97076, False), 'Re-195': Iso('Re-195', 'rhenium-195', 75, 195, 194.97254, False), 'Re-196': Iso('Re-196', 'rhenium-196', 75, 196, 195.97580, False), 'Re-197': Iso('Re-197', 'rhenium-197', 75, 197, 196.97799, False), 'Re-198': Iso('Re-198',
self.splitter_5_pop.setOrientation(QtCore.Qt.Vertical) self.splitter_5_pop.setObjectName("splitter_5_pop") self.layoutWidget_6 = QtWidgets.QWidget(self.splitter_5_pop) self.layoutWidget_6.setObjectName("layoutWidget_6") self.horizontalLayout_ExampleImgs_pop = QtWidgets.QHBoxLayout(self.layoutWidget_6) self.horizontalLayout_ExampleImgs_pop.setContentsMargins(0, 0, 0, 0) self.horizontalLayout_ExampleImgs_pop.setObjectName("horizontalLayout_ExampleImgs_pop") self.comboBox_ShowTrainOrValid_pop = QtWidgets.QComboBox(self.layoutWidget_6) self.comboBox_ShowTrainOrValid_pop.setObjectName("comboBox_ShowTrainOrValid_pop") self.horizontalLayout_ExampleImgs_pop.addWidget(self.comboBox_ShowTrainOrValid_pop) self.comboBox_ShowWOrWoAug_pop = QtWidgets.QComboBox(self.layoutWidget_6) self.comboBox_ShowWOrWoAug_pop.setObjectName("comboBox_ShowWOrWoAug_pop") self.horizontalLayout_ExampleImgs_pop.addWidget(self.comboBox_ShowWOrWoAug_pop) self.label_ShowIndex_pop = QtWidgets.QLabel(self.layoutWidget_6) self.label_ShowIndex_pop.setObjectName("label_ShowIndex_pop") self.label_ShowIndex_pop.setAlignment(QtCore.Qt.AlignRight | QtCore.Qt.AlignVCenter) self.horizontalLayout_ExampleImgs_pop.addWidget(self.label_ShowIndex_pop) self.spinBox_ShowIndex_pop = QtWidgets.QSpinBox(self.layoutWidget_6) self.spinBox_ShowIndex_pop.setObjectName("spinBox_ShowIndex_pop") self.horizontalLayout_ExampleImgs_pop.addWidget(self.spinBox_ShowIndex_pop) self.pushButton_ShowExamleImgs_pop = QtWidgets.QPushButton(self.layoutWidget_6) self.pushButton_ShowExamleImgs_pop.setObjectName("pushButton_ShowExamleImgs_pop") self.horizontalLayout_ExampleImgs_pop.addWidget(self.pushButton_ShowExamleImgs_pop) self.widget_ViewImages_pop = QtWidgets.QWidget(self.splitter_5_pop) self.widget_ViewImages_pop.setObjectName("widget_ViewImages_pop") self.gridLayout_18.addWidget(self.splitter_5_pop, 0, 0, 1, 1) self.tabWidget_DefineModel_pop.addTab(self.tab_ExampleImgs_pop, "") self.tab_expertMode_pop = QtWidgets.QWidget() #self.tab_expertMode_pop.setEnabled(True) self.tab_expertMode_pop.setObjectName("tab_expertMode_pop") self.gridLayout_2 = QtWidgets.QGridLayout(self.tab_expertMode_pop) self.gridLayout_2.setObjectName("gridLayout_2") self.groupBox_expertMode_pop = QtWidgets.QGroupBox(self.tab_expertMode_pop) self.groupBox_expertMode_pop.setEnabled(True) self.groupBox_expertMode_pop.setCheckable(True) self.groupBox_expertMode_pop.setChecked(True) self.groupBox_expertMode_pop.setObjectName("groupBox_expertMode_pop") self.gridLayout_3 = QtWidgets.QGridLayout(self.groupBox_expertMode_pop) self.gridLayout_3.setObjectName("gridLayout_3") self.scrollArea_expertMode_pop = QtWidgets.QScrollArea(self.groupBox_expertMode_pop) self.scrollArea_expertMode_pop.setEnabled(True) self.scrollArea_expertMode_pop.setWidgetResizable(True) self.scrollArea_expertMode_pop.setObjectName("scrollArea_expertMode_pop") self.scrollAreaWidgetContents_pop = QtWidgets.QWidget() self.scrollAreaWidgetContents_pop.setGeometry(QtCore.QRect(0, -186, 697, 505)) self.scrollAreaWidgetContents_pop.setObjectName("scrollAreaWidgetContents_pop") self.gridLayout_4 = QtWidgets.QGridLayout(self.scrollAreaWidgetContents_pop) self.gridLayout_4.setObjectName("gridLayout_4") self.groupBox_modelKerasFit_pop = QtWidgets.QGroupBox(self.scrollAreaWidgetContents_pop) self.groupBox_modelKerasFit_pop.setObjectName("groupBox_modelKerasFit_pop") self.gridLayout_11 = QtWidgets.QGridLayout(self.groupBox_modelKerasFit_pop) self.gridLayout_11.setObjectName("gridLayout_11") self.label_batchSize_pop = QtWidgets.QLabel(self.groupBox_modelKerasFit_pop) self.label_batchSize_pop.setAlignment(QtCore.Qt.AlignRight|QtCore.Qt.AlignTrailing|QtCore.Qt.AlignVCenter) self.label_batchSize_pop.setObjectName("label_batchSize_pop") self.gridLayout_11.addWidget(self.label_batchSize_pop, 0, 0, 1, 1) self.spinBox_batchSize = QtWidgets.QSpinBox(self.groupBox_modelKerasFit_pop) self.spinBox_batchSize.setMinimum(1) self.spinBox_batchSize.setMaximum(999999999) self.spinBox_batchSize.setProperty("value", 32) self.spinBox_batchSize.setObjectName("spinBox_batchSize") self.gridLayout_11.addWidget(self.spinBox_batchSize, 0, 1, 1, 1) self.label_epochs_pop = QtWidgets.QLabel(self.groupBox_modelKerasFit_pop) self.label_epochs_pop.setAlignment(QtCore.Qt.AlignRight|QtCore.Qt.AlignTrailing|QtCore.Qt.AlignVCenter) self.label_epochs_pop.setObjectName("label_epochs_pop") self.gridLayout_11.addWidget(self.label_epochs_pop, 0, 2, 1, 1) self.spinBox_epochs = QtWidgets.QSpinBox(self.groupBox_modelKerasFit_pop) self.spinBox_epochs.setMinimum(1) self.spinBox_epochs.setMaximum(999999999) self.spinBox_epochs.setObjectName("spinBox_epochs") self.gridLayout_11.addWidget(self.spinBox_epochs, 0, 3, 1, 1) self.gridLayout_4.addWidget(self.groupBox_modelKerasFit_pop, 0, 0, 1, 1) self.groupBox_regularization_pop = QtWidgets.QGroupBox(self.scrollAreaWidgetContents_pop) self.groupBox_regularization_pop.setObjectName("groupBox_regularization_pop") self.gridLayout_12 = QtWidgets.QGridLayout(self.groupBox_regularization_pop) self.gridLayout_12.setObjectName("gridLayout_12") self.horizontalLayout_43_pop = QtWidgets.QHBoxLayout() self.horizontalLayout_43_pop.setObjectName("horizontalLayout_43_pop") self.checkBox_trainLastNOnly_pop = QtWidgets.QCheckBox(self.groupBox_regularization_pop) self.checkBox_trainLastNOnly_pop.setLayoutDirection(QtCore.Qt.LeftToRight) self.checkBox_trainLastNOnly_pop.setCheckable(True) self.checkBox_trainLastNOnly_pop.setObjectName("checkBox_trainLastNOnly_pop") self.horizontalLayout_43_pop.addWidget(self.checkBox_trainLastNOnly_pop) self.spinBox_trainLastNOnly_pop = QtWidgets.QSpinBox(self.groupBox_regularization_pop) self.spinBox_trainLastNOnly_pop.setEnabled(False) self.spinBox_trainLastNOnly_pop.setMaximum(9999) self.spinBox_trainLastNOnly_pop.setObjectName("spinBox_trainLastNOnly_pop") self.horizontalLayout_43_pop.addWidget(self.spinBox_trainLastNOnly_pop) self.checkBox_trainDenseOnly_pop = QtWidgets.QCheckBox(self.groupBox_regularization_pop) self.checkBox_trainDenseOnly_pop.setObjectName("checkBox_trainDenseOnly_pop") self.horizontalLayout_43_pop.addWidget(self.checkBox_trainDenseOnly_pop) self.gridLayout_12.addLayout(self.horizontalLayout_43_pop, 0, 0, 1, 1) self.horizontalLayout_3_pop = QtWidgets.QHBoxLayout() self.horizontalLayout_3_pop.setObjectName("horizontalLayout_3_pop") self.checkBox_dropout_pop = QtWidgets.QCheckBox(self.groupBox_regularization_pop) self.checkBox_dropout_pop.setObjectName("checkBox_dropout_pop") self.horizontalLayout_3_pop.addWidget(self.checkBox_dropout_pop) self.lineEdit_dropout_pop = QtWidgets.QLineEdit(self.groupBox_regularization_pop) self.lineEdit_dropout_pop.setEnabled(False) self.lineEdit_dropout_pop.setObjectName("lineEdit_dropout_pop") self.horizontalLayout_3_pop.addWidget(self.lineEdit_dropout_pop) self.gridLayout_12.addLayout(self.horizontalLayout_3_pop, 1, 0, 1, 1) self.horizontalLayout_pTr_pop = QtWidgets.QHBoxLayout() self.horizontalLayout_pTr_pop.setObjectName("horizontalLayout_pTr_pop") # self.checkBox_pTr_pop = QtWidgets.QCheckBox(self.groupBox_regularization_pop) # self.checkBox_pTr_pop.setObjectName("checkBox_pTr_pop") # self.horizontalLayout_pTr_pop.addWidget(self.checkBox_pTr_pop) # self.lineEdit_pTr_pop = QtWidgets.QLineEdit(self.groupBox_regularization_pop) # self.lineEdit_pTr_pop.setEnabled(False) # self.lineEdit_pTr_pop.setObjectName("lineEdit_pTr_pop") # self.horizontalLayout_pTr_pop.addWidget(self.lineEdit_pTr_pop) # self.pushButton_pTr_pop = QtWidgets.QPushButton(self.groupBox_regularization_pop) # self.pushButton_pTr_pop.setEnabled(False) # self.pushButton_pTr_pop.setMaximumSize(QtCore.QSize(40, 16777215)) # self.pushButton_pTr_pop.setObjectName("pushButton_pTr_pop") # self.horizontalLayout_pTr_pop.addWidget(self.pushButton_pTr_pop) self.gridLayout_12.addLayout(self.horizontalLayout_pTr_pop, 2, 0, 1, 1) self.gridLayout_4.addWidget(self.groupBox_regularization_pop, 3, 0, 1, 1) self.groupBox_lossOptimizer = QtWidgets.QGroupBox(self.scrollAreaWidgetContents_pop) self.groupBox_lossOptimizer.setObjectName("groupBox_lossOptimizer") self.gridLayout_14 = QtWidgets.QGridLayout(self.groupBox_lossOptimizer) self.gridLayout_14.setObjectName("gridLayout_14") self.pushButton_optimizer_pop = QtWidgets.QPushButton(self.groupBox_lossOptimizer) self.pushButton_optimizer_pop.setEnabled(False) self.pushButton_optimizer_pop.setMaximumSize(QtCore.QSize(40, 16777215)) self.pushButton_optimizer_pop.setObjectName("pushButton_optimizer_pop") self.gridLayout_14.addWidget(self.pushButton_optimizer_pop, 0, 4, 1, 1) self.checkBox_lossW = QtWidgets.QCheckBox(self.groupBox_lossOptimizer) self.checkBox_lossW.setLayoutDirection(QtCore.Qt.RightToLeft) self.checkBox_lossW.setObjectName("checkBox_lossW") self.gridLayout_14.addWidget(self.checkBox_lossW, 1, 0, 1, 1) self.checkBox_expt_loss_pop = QtWidgets.QCheckBox(self.groupBox_lossOptimizer) self.checkBox_expt_loss_pop.setLayoutDirection(QtCore.Qt.RightToLeft) self.checkBox_expt_loss_pop.setObjectName("checkBox_expt_loss_pop") self.gridLayout_14.addWidget(self.checkBox_expt_loss_pop, 0, 0, 1, 1) self.comboBox_expt_loss_pop = QtWidgets.QComboBox(self.groupBox_lossOptimizer) self.comboBox_expt_loss_pop.setEnabled(False) self.comboBox_expt_loss_pop.setObjectName("comboBox_expt_loss_pop") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.comboBox_expt_loss_pop.addItem("") self.gridLayout_14.addWidget(self.comboBox_expt_loss_pop, 0, 1, 1, 1) self.checkBox_optimizer_pop = QtWidgets.QCheckBox(self.groupBox_lossOptimizer) self.checkBox_optimizer_pop.setLayoutDirection(QtCore.Qt.RightToLeft) self.checkBox_optimizer_pop.setObjectName("checkBox_optimizer_pop") self.gridLayout_14.addWidget(self.checkBox_optimizer_pop, 0, 2, 1, 1) self.comboBox_optimizer = QtWidgets.QComboBox(self.groupBox_lossOptimizer) self.comboBox_optimizer.setEnabled(False) self.comboBox_optimizer.setObjectName("comboBox_optimizer") self.comboBox_optimizer.addItem("") self.comboBox_optimizer.addItem("") self.comboBox_optimizer.addItem("") self.comboBox_optimizer.addItem("") self.comboBox_optimizer.addItem("") self.comboBox_optimizer.addItem("") self.comboBox_optimizer.addItem("") self.gridLayout_14.addWidget(self.comboBox_optimizer, 0, 3, 1, 1) self.lineEdit_lossW = QtWidgets.QLineEdit(self.groupBox_lossOptimizer) self.lineEdit_lossW.setEnabled(False) self.lineEdit_lossW.setObjectName("lineEdit_lossW") self.gridLayout_14.addWidget(self.lineEdit_lossW, 1, 1, 1, 3) self.pushButton_lossW = QtWidgets.QPushButton(self.groupBox_lossOptimizer) self.pushButton_lossW.setEnabled(False) self.pushButton_lossW.setMaximumSize(QtCore.QSize(40, 16777215)) self.pushButton_lossW.setObjectName("pushButton_lossW") self.gridLayout_14.addWidget(self.pushButton_lossW, 1, 4, 1, 1) self.gridLayout_4.addWidget(self.groupBox_lossOptimizer, 1, 0, 1, 1) self.groupBox_learningRate_pop = QtWidgets.QGroupBox(self.scrollAreaWidgetContents_pop) self.groupBox_learningRate_pop.setEnabled(True) self.groupBox_learningRate_pop.setCheckable(True) self.groupBox_learningRate_pop.setChecked(False) self.groupBox_learningRate_pop.setObjectName("groupBox_learningRate_pop") self.gridLayout_16 = QtWidgets.QGridLayout(self.groupBox_learningRate_pop) self.gridLayout_16.setObjectName("gridLayout_16") self.radioButton_LrConst = QtWidgets.QRadioButton(self.groupBox_learningRate_pop) self.radioButton_LrConst.setChecked(True) self.radioButton_LrConst.setObjectName("radioButton_LrConst") self.gridLayout_16.addWidget(self.radioButton_LrConst, 0, 0, 1, 1) self.label_LrConst_pop = QtWidgets.QLabel(self.groupBox_learningRate_pop) self.label_LrConst_pop.setAlignment(QtCore.Qt.AlignRight|QtCore.Qt.AlignTrailing|QtCore.Qt.AlignVCenter) self.label_LrConst_pop.setObjectName("label_LrConst_pop") self.gridLayout_16.addWidget(self.label_LrConst_pop, 0, 1, 1, 1) self.doubleSpinBox_learningRate = QtWidgets.QDoubleSpinBox(self.groupBox_learningRate_pop) self.doubleSpinBox_learningRate.setEnabled(False) self.doubleSpinBox_learningRate.setMaximumSize(QtCore.QSize(16777215, 16777215)) self.doubleSpinBox_learningRate.setDecimals(6) self.doubleSpinBox_learningRate.setMaximum(999.0) self.doubleSpinBox_learningRate.setSingleStep(0.0001) self.doubleSpinBox_learningRate.setProperty("value", 0.001) self.doubleSpinBox_learningRate.setObjectName("doubleSpinBox_learningRate") self.gridLayout_16.addWidget(self.doubleSpinBox_learningRate, 0, 2, 1, 1) self.radioButton_LrCycl = QtWidgets.QRadioButton(self.groupBox_learningRate_pop) self.radioButton_LrCycl.setObjectName("radioButton_LrCycl") self.gridLayout_16.addWidget(self.radioButton_LrCycl, 1, 0, 1, 1) self.label_cycLrMin = QtWidgets.QLabel(self.groupBox_learningRate_pop) self.label_cycLrMin.setAlignment(QtCore.Qt.AlignRight|QtCore.Qt.AlignTrailing|QtCore.Qt.AlignVCenter) self.label_cycLrMin.setObjectName("label_cycLrMin") self.gridLayout_16.addWidget(self.label_cycLrMin, 1, 1, 1, 1) self.lineEdit_cycLrMin = QtWidgets.QLineEdit(self.groupBox_learningRate_pop) self.lineEdit_cycLrMin.setObjectName("lineEdit_cycLrMin") self.lineEdit_cycLrMin.setEnabled(False) validator = QtGui.QRegExpValidator(QtCore.QRegExp("^[0-9 . , e -]+$")) #validator allows numbers, dots, commas, e and - self.lineEdit_cycLrMin.setValidator(validator) self.gridLayout_16.addWidget(self.lineEdit_cycLrMin, 1, 2, 1, 1) self.lineEdit_cycLrMax = QtWidgets.QLineEdit(self.groupBox_learningRate_pop) self.lineEdit_cycLrMax.setObjectName("lineEdit_cycLrMax") self.lineEdit_cycLrMax.setEnabled(False) self.lineEdit_cycLrMax.setValidator(validator) self.gridLayout_16.addWidget(self.lineEdit_cycLrMax, 1, 3, 1, 1) self.label_cycLrMethod = QtWidgets.QLabel(self.groupBox_learningRate_pop) self.label_cycLrMethod.setObjectName("label_cycLrMethod") self.label_cycLrMethod.setAlignment(QtCore.Qt.AlignRight|QtCore.Qt.AlignTrailing|QtCore.Qt.AlignVCenter) self.gridLayout_16.addWidget(self.label_cycLrMethod, 1, 4, 1, 1) self.comboBox_cycLrMethod = QtWidgets.QComboBox(self.groupBox_learningRate_pop) self.comboBox_cycLrMethod.setEnabled(False) self.comboBox_cycLrMethod.setMinimumSize(QtCore.QSize(80, 0)) self.comboBox_cycLrMethod.setObjectName("comboBox_cycLrMethod") self.comboBox_cycLrMethod.addItem("") self.comboBox_cycLrMethod.addItem("") self.comboBox_cycLrMethod.addItem("") self.gridLayout_16.addWidget(self.comboBox_cycLrMethod, 1, 6, 1, 1) self.pushButton_cycLrPopup = QtWidgets.QPushButton(self.groupBox_learningRate_pop) self.pushButton_cycLrPopup.setEnabled(False) self.pushButton_cycLrPopup.setMaximumSize(QtCore.QSize(50, 16777215)) self.pushButton_cycLrPopup.setObjectName("pushButton_cycLrPopup") self.gridLayout_16.addWidget(self.pushButton_cycLrPopup, 1, 7, 1, 1) self.radioButton_LrExpo = QtWidgets.QRadioButton(self.groupBox_learningRate_pop) self.radioButton_LrExpo.setObjectName("radioButton_LrExpo") self.gridLayout_16.addWidget(self.radioButton_LrExpo, 2, 0, 2, 1) self.label_expDecInitLr = QtWidgets.QLabel(self.groupBox_learningRate_pop) self.label_expDecInitLr.setAlignment(QtCore.Qt.AlignRight|QtCore.Qt.AlignTrailing|QtCore.Qt.AlignVCenter) self.label_expDecInitLr.setObjectName("label_expDecInitLr") self.gridLayout_16.addWidget(self.label_expDecInitLr, 2, 1, 1, 1) self.doubleSpinBox_expDecInitLr = QtWidgets.QDoubleSpinBox(self.groupBox_learningRate_pop) self.doubleSpinBox_expDecInitLr.setEnabled(False) self.doubleSpinBox_expDecInitLr.setMaximumSize(QtCore.QSize(63, 16777215)) self.doubleSpinBox_expDecInitLr.setDecimals(6) self.doubleSpinBox_expDecInitLr.setSingleStep(0.0001) self.doubleSpinBox_expDecInitLr.setProperty("value", 0.001) self.doubleSpinBox_expDecInitLr.setObjectName("doubleSpinBox_expDecInitLr") self.gridLayout_16.addWidget(self.doubleSpinBox_expDecInitLr, 2, 2, 2, 1) self.label_expDecSteps = QtWidgets.QLabel(self.groupBox_learningRate_pop) self.label_expDecSteps.setAlignment(QtCore.Qt.AlignRight|QtCore.Qt.AlignTrailing|QtCore.Qt.AlignVCenter) self.label_expDecSteps.setObjectName("label_expDecSteps") self.gridLayout_16.addWidget(self.label_expDecSteps, 2, 3, 1, 1) self.spinBox_expDecSteps = QtWidgets.QSpinBox(self.groupBox_learningRate_pop) self.spinBox_expDecSteps.setEnabled(False) self.spinBox_expDecSteps.setMaximumSize(QtCore.QSize(63, 16777215)) self.spinBox_expDecSteps.setMaximum(999999999) self.spinBox_expDecSteps.setObjectName("spinBox_expDecSteps") self.gridLayout_16.addWidget(self.spinBox_expDecSteps, 2, 4, 2, 2) self.label_expDecRate = QtWidgets.QLabel(self.groupBox_learningRate_pop) self.label_expDecRate.setAlignment(QtCore.Qt.AlignRight|QtCore.Qt.AlignTrailing|QtCore.Qt.AlignVCenter) self.label_expDecRate.setObjectName("label_expDecRate") self.gridLayout_16.addWidget(self.label_expDecRate, 2, 6, 1, 1) self.doubleSpinBox_expDecRate = QtWidgets.QDoubleSpinBox(self.groupBox_learningRate_pop) self.doubleSpinBox_expDecRate.setEnabled(False) self.doubleSpinBox_expDecRate.setMaximumSize(QtCore.QSize(63, 16777215)) self.doubleSpinBox_expDecRate.setDecimals(6) self.doubleSpinBox_expDecRate.setMaximum(1.0) self.doubleSpinBox_expDecRate.setSingleStep(0.01) self.doubleSpinBox_expDecRate.setProperty("value", 0.96) self.doubleSpinBox_expDecRate.setObjectName("doubleSpinBox_expDecRate") self.gridLayout_16.addWidget(self.doubleSpinBox_expDecRate, 2, 7, 1, 1) self.line = QtWidgets.QFrame(self.groupBox_learningRate_pop) self.line.setLayoutDirection(QtCore.Qt.RightToLeft) self.line.setFrameShape(QtWidgets.QFrame.VLine) self.line.setFrameShadow(QtWidgets.QFrame.Sunken) self.line.setObjectName("line") self.gridLayout_16.addWidget(self.line, 4, 5, 1, 1) self.pushButton_LR_finder = QtWidgets.QPushButton(self.groupBox_learningRate_pop) self.pushButton_LR_finder.setObjectName("pushButton_LR_finder") self.gridLayout_16.addWidget(self.pushButton_LR_finder, 4, 6, 1, 1) self.pushButton_LR_plot = QtWidgets.QPushButton(self.groupBox_learningRate_pop) self.pushButton_LR_plot.setObjectName("pushButton_LR_plot") self.gridLayout_16.addWidget(self.pushButton_LR_plot, 4, 7, 1, 1) self.gridLayout_4.addWidget(self.groupBox_learningRate_pop, 2, 0, 1, 1) self.scrollArea_expertMode_pop.setWidget(self.scrollAreaWidgetContents_pop) self.gridLayout_3.addWidget(self.scrollArea_expertMode_pop, 0, 0, 1, 1) self.gridLayout_2.addWidget(self.groupBox_expertMode_pop, 0, 0, 1, 1) self.tabWidget_DefineModel_pop.addTab(self.tab_expertMode_pop, "") self.gridLayout_3_pop.addWidget(self.tabWidget_DefineModel_pop, 1, 0, 1, 1) self.verticalLayout_3_pop.addWidget(self.splitter_pop) self.verticalLayout_4_pop.addLayout(self.verticalLayout_3_pop) self.gridLayout_slider_pop.addLayout(self.verticalLayout_4_pop, 0, 0, 1, 1) ######################ICONS############################################ os.path.join(dir_root,"art",Default_dict["Icon theme"],"color_mode.png") self.label_colorModeIcon_pop.setPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"color_mode.png"))) self.label_NormalizationIcon_pop.setPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"normalization.png"))) self.label_Crop_NrEpochsIcon_pop.setPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"nr_epochs.png"))) self.label_zoomIcon.setPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"zoom_order.png"))) self.label_ModelGeomIcon_pop.setPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"model_architecture.png"))) self.label_padIcon_pop.setPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"padding.png"))) self.label_CropIcon_pop.setPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"cropping.png"))) self.label_Crop_pop.setAlignment(QtCore.Qt.AlignRight | QtCore.Qt.AlignVCenter) icon = QtGui.QIcon() icon.addPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"gpu.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.radioButton_gpu_pop.setIcon(icon) icon1 = QtGui.QIcon() icon1.addPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"cpu.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.radioButton_cpu_pop.setIcon(icon1) self.checkBox_ApplyNextEpoch.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"thumb.png"))) self.checkBox_saveEpoch_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"save_epoch.png"))) self.pushButton_Pause_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"pause.png"))) self.pushButton_Stop_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"stop.png"))) self.checkBox_HorizFlip_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"horizontal_flip.png"))) self.checkBox_VertFlip_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"vertical_flip.png"))) self.label_Rotation_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"rotation.png"))) self.label_Rotation_pop.setChecked(True) self.label_Rotation_pop.stateChanged.connect(self.keras_changed_rotation_pop) self.label_width_shift_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"width_shift.png"))) self.label_width_shift_pop.setChecked(True) self.label_width_shift_pop.stateChanged.connect(self.keras_changed_width_shift_pop) self.label_height_shift_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"height_shift.png"))) self.label_height_shift_pop.setChecked(True) self.label_height_shift_pop.stateChanged.connect(self.keras_changed_height_shift_pop) self.label_zoom_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"zoom.png"))) self.label_zoom_pop.setChecked(True) self.label_zoom_pop.stateChanged.connect(self.keras_changed_zoom_pop) self.label_shear_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"shear.png"))) self.label_shear_pop.setChecked(True) self.label_shear_pop.stateChanged.connect(self.keras_changed_shear_pop) self.label_Plus_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"brightness_plus.png"))) self.label_Plus_pop.setChecked(True) self.label_Plus_pop.stateChanged.connect(self.keras_changed_brightplus_pop) self.label_Mult_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"brightness_mult.png"))) self.label_Mult_pop.setChecked(True) self.label_Mult_pop.stateChanged.connect(self.keras_changed_brightmult_pop) self.label_GaussianNoiseMean_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"gaussian_noise_mean.png"))) self.label_GaussianNoiseMean_pop.setChecked(True) self.label_GaussianNoiseMean_pop.stateChanged.connect(self.keras_changed_noiseMean_pop) self.label_GaussianNoiseScale_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"gaussian_noise_scale.png"))) self.label_GaussianNoiseScale_pop.setChecked(True) self.label_GaussianNoiseScale_pop.stateChanged.connect(self.keras_changed_noiseScale_pop) self.checkBox_contrast_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"contrast.png"))) self.checkBox_contrast_pop.stateChanged.connect(self.keras_changed_contrast_pop) self.checkBox_saturation_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"saturation.png"))) self.checkBox_saturation_pop.stateChanged.connect(self.keras_changed_saturation_pop) self.checkBox_hue_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"hue.png"))) self.checkBox_hue_pop.stateChanged.connect(self.keras_changed_hue_pop) self.checkBox_avgBlur_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"average_blur.png"))) #self.checkBox_avgBlur_pop.stateChanged.connect(self.changed_averageBlur_pop) self.checkBox_gaussBlur_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"gaussian_blur.png"))) #self.checkBox_gaussBlur_pop.stateChanged.connect(self.changed_gaussBlur_pop) self.checkBox_motionBlur_pop.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"motion_blur.png"))) #self.checkBox_motionBlur_pop.stateChanged.connect(self.changed_motionBlur_pop) validator = QtGui.QRegExpValidator(QtCore.QRegExp("^[0-9 . ,]+$")) #validator allows numbers, dots and commas #aternatively, I could use "^[0-9 . , \[ \] ]+$" - this would also allow the user to put the brackets. But why? I just do it in the program self.lineEdit_dropout_pop.setValidator(validator) ############Icons Expert tab######## #self.pushButton_LR_finder.setIcon(QtGui.QIcon(os.path.join(dir_root,"art",Default_dict["Icon theme"],"lr_screen.png"))) icon = QtGui.QIcon() icon.addPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"lr_screen.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.pushButton_LR_finder.setIcon(icon) icon = QtGui.QIcon() icon.addPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"lr_plot.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.pushButton_LR_plot.setIcon(icon) icon = QtGui.QIcon() icon.addPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"lr_const.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.radioButton_LrConst.setIcon(icon) icon = QtGui.QIcon() icon.addPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"lr_cycle.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.radioButton_LrCycl.setIcon(icon) icon = QtGui.QIcon() icon.addPixmap(QtGui.QPixmap(os.path.join(dir_root,"art",Default_dict["Icon theme"],"lr_exponential.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.radioButton_LrExpo.setIcon(icon) #####################Some manual settings############################## ####################################################################### ###########################Variables################################### self.Histories = [] #List container for the fitting histories, that are produced by the keras.fit function that is controlled by this popup self.RealTime_Acc,self.RealTime_ValAcc,self.RealTime_Loss,self.RealTime_ValLoss = [],[],[],[] self.RealTime_OtherMetrics = {} #provide dictionary where AID can save all other metrics in case there are some (like precision...) self.X_batch_aug = []#list for storing augmented image, created by some parallel processes self.threadpool_quad = QtCore.QThreadPool()#Threadpool for image augmentation self.threadpool_quad.setMaxThreadCount(4)#Maximum 4 threads self.threadpool_quad_count = 0 #count nr. of threads in queue; self.clr_settings = {} #variable to store step_size and gamma, will be filled with information when starting to fit self.optimizer_settings = {} #dict to store advanced optimizer settings self.epoch_counter = 0 #Counts the nr. of epochs self.tableWidget_HistoryInfo_pop.setMinimumSize(QtCore.QSize(0, 100)) self.tableWidget_HistoryInfo_pop.setMaximumSize(QtCore.QSize(16777215, 140)) self.tableWidget_HistoryInfo_pop.setColumnCount(7) self.tableWidget_HistoryInfo_pop.setRowCount(0) self.spinBox_imagecrop_pop.setMinimum(1) self.spinBox_imagecrop_pop.setMaximum(9E8) #self.comboBox_colorMode_pop.setAlignment(QtCore.Qt.AlignLeft | QtCore.Qt.AlignVCenter) self.label_Normalization_pop.setAlignment(QtCore.Qt.AlignRight | QtCore.Qt.AlignVCenter) self.label_Crop_NrEpochs_pop.setAlignment(QtCore.Qt.AlignRight | QtCore.Qt.AlignVCenter) self.spinBox_RefreshAfterEpochs_pop.setMinimum(1) self.spinBox_RefreshAfterEpochs_pop.setMaximum(9E8) self.spinBox_RefreshAfterNrEpochs_pop.setMinimum(1) self.spinBox_RefreshAfterNrEpochs_pop.setMaximum(9E8) self.spinBox_PlusLower_pop.setMinimum(-255) self.spinBox_PlusLower_pop.setMaximum(255) self.spinBox_PlusLower_pop.setSingleStep(1) self.spinBox_PlusUpper_pop.setMinimum(-255) self.spinBox_PlusUpper_pop.setMaximum(255) self.spinBox_PlusUpper_pop.setSingleStep(1) self.doubleSpinBox_MultLower_pop.setMinimum(0) self.doubleSpinBox_MultLower_pop.setMaximum(10) self.doubleSpinBox_MultLower_pop.setSingleStep(0.1) self.doubleSpinBox_MultUpper_pop.setMinimum(0) self.doubleSpinBox_MultUpper_pop.setMaximum(10) self.doubleSpinBox_MultUpper_pop.setSingleStep(0.1) self.doubleSpinBox_GaussianNoiseMean_pop.setMinimum(-255) self.doubleSpinBox_GaussianNoiseMean_pop.setMaximum(255) self.doubleSpinBox_GaussianNoiseMean_pop.setSingleStep(0.1) self.doubleSpinBox_GaussianNoiseScale_pop.setMinimum(0) self.doubleSpinBox_GaussianNoiseScale_pop.setMaximum(99.9) self.doubleSpinBox_GaussianNoiseScale_pop.setSingleStep(0.1) self.spinBox_avgBlurMin_pop.setMinimum(0) self.spinBox_avgBlurMin_pop.setMaximum(255) self.spinBox_avgBlurMax_pop.setMinimum(0) self.spinBox_avgBlurMax_pop.setMaximum(255) self.spinBox_gaussBlurMin_pop.setMinimum(0) self.spinBox_gaussBlurMin_pop.setMaximum(255) self.spinBox_gaussBlurMax_pop.setMinimum(0) self.spinBox_gaussBlurMax_pop.setMaximum(255) self.comboBox_ShowTrainOrValid_pop.addItems(["Training","Validation"]) self.comboBox_ShowWOrWoAug_pop.addItems(["With Augmentation","Original image"]) # self.groupBox_expertMode_pop.setEnabled(True) # self.groupBox_expertMode_pop.setCheckable(True) # self.groupBox_expertMode_pop.setChecked(False) # self.scrollArea_expertMode_pop.setWidgetResizable(True) #Adjust some QObjects manually self.spinBox_batchSize.setMinimum(1) self.spinBox_batchSize.setMaximum(1E6) self.spinBox_batchSize.setValue(32) self.spinBox_epochs.setMinimum(1) self.spinBox_epochs.setMaximum(1E6) self.spinBox_epochs.setValue(1) self.doubleSpinBox_learningRate.setDecimals(9) self.doubleSpinBox_learningRate.setMinimum(0.0) self.doubleSpinBox_learningRate.setMaximum(1E6) self.doubleSpinBox_learningRate.setValue(0.001) self.doubleSpinBox_learningRate.setSingleStep(0.0001) self.spinBox_trainLastNOnly_pop.setMinimum(0) self.spinBox_trainLastNOnly_pop.setMaximum(1E6) self.spinBox_trainLastNOnly_pop.setValue(0) self.checkBox_trainDenseOnly_pop.setChecked(False) self.spinBox_NrEpochs.setMinimum(1) self.spinBox_NrEpochs.setMaximum(9E8) self.spinBox_realTimeEpochs.setSingleStep(1) self.spinBox_realTimeEpochs.setMinimum(1) self.spinBox_realTimeEpochs.setMaximum(9999999) self.spinBox_realTimeEpochs.setValue(250) self.pushButton_Pause_pop.setMinimumSize(QtCore.QSize(60, 30)) self.pushButton_Pause_pop.setMaximumSize(QtCore.QSize(60, 30)) self.pushButton_Stop_pop.setMinimumSize(QtCore.QSize(60, 30)) self.pushButton_Stop_pop.setMaximumSize(QtCore.QSize(60, 30)) ####################################################################### ######################Connections###################################### self.doubleSpinBox_learningRate.setEnabled(False) self.spinBox_trainLastNOnly_pop.setEnabled(False) self.lineEdit_dropout_pop.setEnabled(False) self.pushButton_LR_finder.setEnabled(False) #self.pushButton_LR_plot.setEnabled(False) self.radioButton_LrConst.toggled['bool'].connect(self.doubleSpinBox_learningRate.setEnabled) self.radioButton_LrCycl.toggled['bool'].connect(self.lineEdit_cycLrMin.setEnabled) self.radioButton_LrCycl.toggled['bool'].connect(self.lineEdit_cycLrMax.setEnabled) self.radioButton_LrCycl.toggled['bool'].connect(self.comboBox_cycLrMethod.setEnabled) self.radioButton_LrCycl.toggled['bool'].connect(self.pushButton_cycLrPopup.setEnabled) self.radioButton_LrExpo.toggled['bool'].connect(self.doubleSpinBox_expDecInitLr.setEnabled) self.radioButton_LrExpo.toggled['bool'].connect(self.spinBox_expDecSteps.setEnabled) self.radioButton_LrExpo.toggled['bool'].connect(self.doubleSpinBox_expDecRate.setEnabled) self.groupBox_learningRate_pop.toggled['bool'].connect(self.doubleSpinBox_learningRate.setEnabled) self.checkBox_expt_loss_pop.toggled['bool'].connect(self.comboBox_expt_loss_pop.setEnabled) self.checkBox_optimizer_pop.toggled['bool'].connect(self.comboBox_optimizer.setEnabled) self.checkBox_optimizer_pop.toggled['bool'].connect(self.pushButton_optimizer_pop.setEnabled) self.checkBox_trainLastNOnly_pop.toggled['bool'].connect(self.spinBox_trainLastNOnly_pop.setEnabled) self.checkBox_dropout_pop.toggled['bool'].connect(self.lineEdit_dropout_pop.setEnabled) self.checkBox_avgBlur_pop.clicked['bool'].connect(self.spinBox_avgBlurMin_pop.setEnabled) self.checkBox_avgBlur_pop.clicked['bool'].connect(self.spinBox_avgBlurMax_pop.setEnabled) self.checkBox_gaussBlur_pop.clicked['bool'].connect(self.spinBox_gaussBlurMin_pop.setEnabled) self.checkBox_gaussBlur_pop.clicked['bool'].connect(self.spinBox_gaussBlurMax_pop.setEnabled) self.checkBox_motionBlur_pop.clicked['bool'].connect(self.label_motionBlurKernel_pop.setEnabled) self.checkBox_motionBlur_pop.clicked['bool'].connect(self.lineEdit_motionBlurKernel_pop.setEnabled) self.checkBox_motionBlur_pop.clicked['bool'].connect(self.label_motionBlurAngle_pop.setEnabled) self.checkBox_motionBlur_pop.clicked['bool'].connect(self.lineEdit_motionBlurAngle_pop.setEnabled) self.checkBox_gaussBlur_pop.clicked['bool'].connect(self.label_gaussBlurMin_pop.setEnabled) self.checkBox_gaussBlur_pop.clicked['bool'].connect(self.label_gaussBlurMax_pop.setEnabled) self.checkBox_avgBlur_pop.clicked['bool'].connect(self.label_avgBlurMin_pop.setEnabled) self.checkBox_avgBlur_pop.clicked['bool'].connect(self.label_avgBlurMax_pop.setEnabled) self.checkBox_optimizer_pop.toggled['bool'].connect(self.comboBox_optimizer.setEnabled) self.checkBox_expt_loss_pop.toggled['bool'].connect(self.comboBox_expt_loss_pop.setEnabled) #self.comboBox_optimizer.currentTextChanged.connect(lambda: self.expert_optimizer_changed()) self.checkBox_optimizer_pop.stateChanged.connect(self.expert_optimizer_off_pop) self.groupBox_learningRate_pop.toggled.connect(self.expert_learningrate_off_pop) self.checkBox_expt_loss_pop.stateChanged.connect(self.expert_loss_off_pop) self.groupBox_expertMode_pop.toggled.connect(self.expert_mode_off_pop) self.retranslateUi(Form) self.tabWidget_DefineModel_pop.setCurrentIndex(0) QtCore.QMetaObject.connectSlotsByName(Form) def retranslateUi(self, Form): Form.setWindowTitle(_translate("Form", "Form", None)) self.pushButton_UpdatePlot_pop.setText(_translate("Form", "Update Plot", None)) self.checkBox_realTimePlotting_pop.setToolTip(_translate("Form", tooltips["checkBox_realTimePlotting_pop"], None)) self.checkBox_realTimePlotting_pop.setText(_translate("Form", "Real-time plotting", None)) self.label_realTimeEpochs_pop.setText(_translate("Form", "Nr. of epochs for RT", None)) self.label_realTimeEpochs_pop.setToolTip(_translate("Form",tooltips["label_realTimeEpochs_pop"] , None)) self.spinBox_realTimeEpochs.setToolTip(_translate("Form", tooltips["label_realTimeEpochs_pop"], None)) self.groupBox_FittingInfo_pop.setTitle(_translate("Form", "Fitting Info", None)) self.pushButton_saveTextWindow_pop.setText(_translate("Form", "Save text ", None)) self.pushButton_clearTextWindow_pop.setToolTip(_translate("Form",tooltips["pushButton_clearTextWindow_pop"] , None)) self.pushButton_clearTextWindow_pop.setText(_translate("Form", "Clear text", None)) self.groupBox_ChangeModel_pop.setTitle(_translate("Form", "Change fitting parameters", None)) self.label_ModelGeom_pop.setText(_translate("Form", "Model Architecture", None)) self.label_ModelGeom_pop.setToolTip(_translate("Form", tooltips["comboBox_ModelSelection"], None)) self.label_ModelGeomIcon_pop.setToolTip(_translate("Form", tooltips["comboBox_ModelSelection"], None)) self.comboBox_ModelSelection_pop.setToolTip(_translate("Form", tooltips["comboBox_ModelSelection"], None)) self.label_colorMode_pop.setToolTip(_translate("Form", "Color mode used for this model", None)) self.label_colorMode_pop.setText(_translate("Form", "Color Mode", None)) self.label_colorModeIcon_pop.setToolTip(_translate("Form", "Color mode used for this model", None)) self.comboBox_colorMode_pop.setToolTip(_translate("Form", "Color mode used for this model", None)) self.label_Normalization_pop.setToolTip(_translate("Form", tooltips["label_Normalization"], None)) self.label_Normalization_pop.setText(_translate("Form", "Normalization", None)) self.label_NormalizationIcon_pop.setToolTip(_translate("Form", tooltips["label_Normalization"], None)) self.comboBox_Normalization_pop.setToolTip(_translate("Form", tooltips["label_Normalization"], None)) self.label_zoomOrder.setText(_translate("Form", "Zoom order", None)) self.label_Crop_pop.setToolTip(_translate("Form", tooltips["label_Crop"], None)) self.label_Crop_pop.setText(_translate("Form", "Input image size", None)) self.label_CropIcon_pop.setToolTip(_translate("Form", tooltips["label_Crop"], None)) self.groupBox_system_pop.setTitle(_translate("Form", "Training", None)) self.label_padIcon_pop.setToolTip(_translate("Form", tooltips["label_paddingMode"], None)) self.comboBox_paddingMode_pop.setToolTip(_translate("Form", tooltips["label_paddingMode"], None)) self.label_paddingMode_pop.setToolTip(_translate("Form", tooltips["label_paddingMode"], None)) self.spinBox_imagecrop_pop.setToolTip(_translate("Form", tooltips["label_Crop"], None)) self.label_Crop_NrEpochs_pop.setToolTip(_translate("Form", "Total number of training iterations", None)) self.label_Crop_NrEpochs_pop.setText(_translate("Form", "Nr. epochs", None)) self.spinBox_NrEpochs.setToolTip(_translate("Form", "Total number of training iterations", None)) self.label_Crop_NrEpochsIcon_pop.setToolTip(_translate("Form", "Total
<gh_stars>10-100 """ A container for all information about the field: geometry and labels, as well as convenient API. """ import os import re from glob import glob from difflib import get_close_matches from concurrent.futures import ThreadPoolExecutor import numpy as np from ...batchflow.notifier import Notifier from .visualization import VisualizationMixin from ..geometry import SeismicGeometry from ..labels import Horizon, Fault from ..metrics import FaciesMetrics from ..utils import AugmentedList class Field(VisualizationMixin): """ A common container for all information about the field: cube geometry and various labels. To initialize, one must provide: - geometry-like entity, which can be a path to a seismic cube or instance of `:class:SeismicGeometry`; additional parameters of geometry instantiation can be passed via `geometry_kwargs` parameters. - optionally, `labels` in one of the following formats: - dictionary with keys defining attribute to store loaded labels in and values as sequences of label-like entities (path to a label or instance of label class) - sequence with label-like entities. This way, labels will be stored in `labels` attribute - string to define path(s) to labels (same as those paths wrapped in a list) - None as a signal that no labels are provided for a field. - `labels_class` defines the class to use for loading and can be supplied in one of the following formats: - dictionary with same keys as in `labels`. Values are either string (e.g. `horizon`) or the type to initialize label itself (e.g. `:class:.Horizon`) - a single string or type to use for all of the labels - if not provided, we try to infer the class from name of the attribute to store the labels in. The guess is based on a similarity between passed name and a list of pre-defined label types. For example, `horizons` will be threated as `horizon` and loaded as such. >>> {'horizons': 'path/to/horizons/*'} would be loaded as instances of `:class:.Horizon`. - `labels_kwargs` are passed for instantiation of every label. Examples -------- Initialize field with only geometry: >>> Field(geometry='path/to/cube.qblosc') >>> Field(geometry=SeismicGeometry(...)) The most complete labels definition: >>> Field(geometry=..., labels={'horizons': ['path/to/horizon', Horizon(...)], 'fans': 'paths/to/fans/*', 'faults': ['path/to/fault1', 'path/to/fault2', ], 'lift_geometry': 'path/to/geometry_target.hdf5'}) Use a `labels_class` instead; this way, all of the labels are stored as `labels` attribute, no matter the class: >>> Field(geometry=..., labels='paths/*', labels_class='horizon') >>> Field(geometry=..., labels=['paths/1', 'paths/2', 'paths/3'], labels_class='fault') """ #pylint: disable=redefined-builtin def __init__(self, geometry, labels=None, labels_class=None, geometry_kwargs=None, labels_kwargs=None, **kwargs): # Attributes self.labels = [] self.horizons, self.facies, self.fans, self.channels, self.faults = [], [], [], [], [] self.loaded_labels = [] # Geometry: description and convenient API to a seismic cube if isinstance(geometry, str): geometry_kwargs = geometry_kwargs or {} geometry = SeismicGeometry(geometry, **{**kwargs, **geometry_kwargs}) self.geometry = geometry # Labels: objects on a field if labels: labels_kwargs = labels_kwargs or {} self.load_labels(labels, labels_class, **{**kwargs, **labels_kwargs}) # Label initialization inner workings METHOD_TO_NAMES = { '_load_horizons': ['horizon', 'facies', 'fans', 'channels', Horizon], '_load_faults': ['fault', Fault], '_load_geometries': ['geometries', 'geometry', SeismicGeometry], } NAME_TO_METHOD = {name: method for method, names in METHOD_TO_NAMES.items() for name in names} def load_labels(self, labels=None, labels_class=None, **labels_kwargs): """ Load labels and store them in the instance. Refer to the class documentation for details. """ if isinstance(labels, str): labels = self.make_path(labels, makedirs=False) labels = glob(labels) if isinstance(labels, (tuple, list)): labels = {'labels': labels} if not isinstance(labels, dict): raise TypeError(f'Labels type should be `str`, `sequence` or `dict`, got {type(labels)} instead!') # Labels class: make a dictionary if labels_class is None: labels_class_dict = {label_dst : None for label_dst in labels.keys()} if isinstance(labels_class, (type, str)): labels_class_dict = {label_dst : labels_class for label_dst in labels.keys()} if isinstance(labels_class, dict): labels_class_dict = labels_class for label_dst, label_src in labels.items(): # Try getting provided `labels_class`, else fallback on NAME_TO_METHOD closest match label_class = labels_class_dict.get(label_dst) if label_class is None: # Roughly equivalent to ``label_class = self.NAME_TO_METHOD.get(label_dst)`` str_names = [name for name in (self.NAME_TO_METHOD.keys()) if isinstance(name, str)] matched = get_close_matches(label_dst, str_names, n=1) if matched: label_class = matched[0] if label_class is None: raise TypeError(f"Can't determine the label class for `{label_dst}`!") # Process paths: get rid of service files if isinstance(label_src, str): label_src = self.make_path(label_src, makedirs=False) label_src = glob(label_src) if not isinstance(label_src, (tuple, list)): label_src = [label_src] label_src = self._filter_paths(label_src) # Load desired labels, based on class method_name = self.NAME_TO_METHOD[label_class] method = getattr(self, method_name) result = method(label_src, **labels_kwargs) setattr(self, label_dst, result) self.loaded_labels.append(label_dst) if 'labels' not in labels and not self.labels: setattr(self, 'labels', result) @staticmethod def _filter_paths(paths): """ Remove paths fors service files. """ return [path for path in paths if not isinstance(path, str) or \ not any(ext in path for ext in ['.dvc', '.gitignore', '.meta'])] def _load_horizons(self, paths, max_workers=4, filter=True, interpolate=False, sort=True, **kwargs): """ Load horizons from paths or re-use already created ones. """ # Separate paths from ready-to-use instances horizons, paths_to_load = [], [] for item in paths: if isinstance(item, str): paths_ = self._filter_paths(glob(item)) paths_to_load.extend(paths_) elif isinstance(item, Horizon): item.field = self horizons.append(item) # Load from paths in multiple threads with ThreadPoolExecutor(max_workers=min(max_workers, len(paths_to_load) or 1)) as executor: function = lambda path: self._load_horizon(path, filter=filter, interpolate=interpolate, **kwargs) loaded = list(executor.map(function, paths_to_load)) horizons.extend(loaded) if sort: sort = sort if isinstance(sort, str) else 'h_mean' horizons.sort(key=lambda label: getattr(label, sort)) return horizons def _load_horizon(self, path, filter=True, interpolate=False, **kwargs): """ Load a single horizon from path. """ horizon = Horizon(path, field=self, **kwargs) if filter: horizon.filter() if interpolate: horizon.interpolate() return horizon def _load_faults(self, paths, max_workers=4, pbar=True, filter=True, fix=True, **kwargs): """ Load faults from paths. """ with ThreadPoolExecutor(max_workers=min(max_workers, len(paths) or 1)) as executor: function = lambda path: self._load_fault(path, filter=filter, fix=fix, **kwargs) loaded = list(Notifier(pbar, total=len(paths))(executor.map(function, paths))) faults = [fault for fault in loaded if len(fault) > 0] return faults def _load_fault(self, path, filter=True, fix=True, **kwargs): """ Load a single fault from path. """ fault = Fault(path, field=self, fix=fix, **kwargs) if filter and fault.format != 'file-npz': fault.filter() return fault def _load_geometries(self, paths, **kwargs): if isinstance(paths, str): path = paths if isinstance(paths, (tuple, list)): if len(paths) > 1: raise ValueError(f'Path for Geometry loading is non-unique!, {paths}') path = paths[0] return SeismicGeometry(path, **kwargs) # Other methods of initialization @classmethod def from_horizon(cls, horizon): """ Create a field from a single horizon. """ return cls(geometry=horizon.geometry, labels={'horizons': horizon}) @classmethod def from_dvc(cls, tag, dvc_path=''): """ Create a field from a dvc tag. """ # Inner workings def __getattr__(self, key): """ Redirect calls for missing attributes, properties and methods to `geometry`. """ if hasattr(self.geometry, key): return getattr(self.geometry, key) raise AttributeError(f'Attribute `{key}` does not exist in either Field or associated Geometry!') def __getattribute__(self, key): """ Wrap every accessed list with `AugmentedList`. The wrapped attribute is re-stored in the instance, so that we return the same object as in the instance. """ result = super().__getattribute__(key) if isinstance(result, list) and not isinstance(result, AugmentedList): result = AugmentedList(result) if not (key in vars(self.__class__) and isinstance(getattr(self.__class__, key), property)): setattr(self, key, result) return result # Public methods. Usually, used by Batch class def load_seismic(self, location, native_slicing=False, src='geometry', **kwargs): """ Load data from cube. Parameters ---------- location : sequence A triplet of slices to define exact location in the cube. native_slicing : bool if True, crop will be loaded as a slice of geometry. Prefered for 3D crops to speed up loading. If False, use `load_crop` method to load crops. src : str Attribute with desired geometry. """ geometry = getattr(self, src) if native_slicing: seismic_crop = geometry[tuple(location)] else: seismic_crop = geometry.load_crop(location, **kwargs) return seismic_crop def make_mask(self, location, axis=None, indices='all', width=3, src='labels', **kwargs): """ Create masks from labels. Parameters ---------- location : int or sequence If integer, then location along specified `axis`. Otherwise, a triplet of slices to define exact location in the cube. axis : int or str Axis identifier. must be provided if `location` is integer. indices : str, int or sequence of ints Which labels to use in mask creation. If 'all', then use all labels. If 'single' or `random`, then use one random label. If int or array-like, then element(s) are interpreted as indices of desired labels. width : int Width of the resulting label. src : str Attribute with desired labels. """ # Parse parameters if isinstance(location, (int, np.integer)): location
# C2SMART Lab, NYU # NCHRP 03-137 # @file TTCD_Calculation_Online.py # @author <NAME> # @author <NAME> # @date 2020-10-18 import pandas as pd import numpy as np from shapely.geometry import Polygon import math import time import multiprocessing as mp from itertools import repeat from scipy import spatial import sys def frange(start, stop=None, step=None): """Returns the range by float numbers.""" if stop == None: stop = start + 0.0 start = 0.0 if step == None: step = 1.0 while True: if step > 0 and start >= stop: break elif step < 0 and start <= stop: break yield ("%g" % start) # return float number start = start + step def dist(x1, y1, x2, y2): """ Returns the euclidean distance. Keyword arguments: >>> x1: float value for X for first point (ft.) >>> y1: float value for Y for first point (ft.) >>> x2: float value for X for 2nd point (ft.) >>> y2: float value for Y for 2nd point (ft.) RETURN: The euclidean distance (float, ft.). """ return float("{:.6f}".format(math.sqrt((x2-x1) ** 2 + (y2 - y1) ** 2))) def get_heading(x1, y1, x2, y2): """ Returns the Heading based on two points Keyword arguments: >>> x1: Float value for X for first point >>> y1: Float value for Y for first point >>> x2: Float value for X for 2nd point >>> y2: Float value for Y for 2nd point RETURN: The new heading value(float). """ heading = 0 dx = x2 - x1 dy = y2 - y1 if dx != 0: heading = float("{:.6f}".format((90 - math.degrees(math.atan2(dy, dx)) + 360) % 360)) elif dy > 0: heading = 0 elif dy < 0: heading = 180 return heading def ttc_location(data_check, distance, start_time): """ Returns TTCmax Location (Please see the document for the detailed definition). Keyword arguments: >>> data_check: The working data frame selected from the main data frame. >>> distance: The projecting distance based on the current speed (ft.). >>> start_time: The time stamp of the processing step. RETURN: TTCmax point X, TTCmax point Y, the nearest time stamp before the TTCmax location projected, heading of the vehicle at the TTCmax point. """ dist1 = distance Start_X = data_check.at[0, 'X'] Start_Y = data_check.at[0, 'Y'] TTC_X = np.NaN TTC_Y = np.NaN Heading = np.NaN for i in range(len(data_check)-1): Check_X = data_check.at[i + 1, 'X'] Check_Y = data_check.at[i + 1, 'Y'] dist2 = dist(Start_X, Start_Y, Check_X, Check_Y) if dist2 <= dist1: dist1 = dist1 - dist2 Start_X = Check_X Start_Y = Check_Y start_time = float("{:.1f}".format(start_time + 0.1)) pass else: Heading = get_heading(Start_X, Start_Y, Check_X, Check_Y) rad = math.pi / 2 - math.radians(Heading) TTC_X = Start_X + dist1 * math.cos(rad) TTC_Y = Start_Y + dist1 * math.sin(rad) start_time = float("{:.1f}".format(start_time + 0.1)) break return [TTC_X, TTC_Y, float("{:.1f}".format(start_time - 0.1)), Heading] def ttc_location_online(data_check, distance, start_time): """ Returns TTCmax Location (Please see the document for the detailed definition) without projections potential trajectory. This is the online version, can be used for single step length updating process. Replace all the function [ttc_location] for the online version. Keyword arguments: >>> data_check: The working data frame selected from the main data frame. >>> distance: The projecting distance based on the current speed (ft.). >>> start_time: The time stamp of the processing step. RETURN: TTCmax point X, TTCmax point Y, the nearest time stamp before the TTCmax location projected, heading of the vehicle at the TTCmax point. """ dist1 = distance Start_X = data_check.at[0, 'X'] Start_Y = data_check.at[0, 'Y'] Check_X = data_check.at[1, 'X'] Check_Y = data_check.at[1, 'Y'] Heading = get_heading(Start_X, Start_Y, Check_X, Check_Y) rad = math.pi / 2 - math.radians(Heading) TTC_X = Start_X + dist1 * math.cos(rad) TTC_Y = Start_Y + dist1 * math.sin(rad) start_time = float("{:.1f}".format(start_time + 0.1)) return [TTC_X, TTC_Y, float("{:.1f}".format(start_time - 0.1)), Heading] def next_location(data_check, point, X_now, Y_now, speed_now, accel, heading): """Returns next time step's location of the target vehicle. Keyword arguments: >>> data_check: The working data frame selected from the main dataframe. >>> point: The index of the target vehicle's trajectory in the working data frame. >>> X_now: Current X of the target vehicle (ft.). >>> Y_now: Current Y of the target vehicle (ft.). >>> speed_now: Current speed of the target vehicle (ft/s). >>> accel: Acceleration of the target vehicel (fpss). >>> heading: Current heading angle of the target vehicle. RETURN: Next X, Next Y, Next heading, Next speed, the index of the reference trajectory for next time stamp. """ if len(data_check) <= 1: return (X_now, Y_now, heading, speed_now, point) else: Start_X = X_now Start_Y = Y_now Check_X = data_check.at[point, 'X'] Check_Y = data_check.at[point, 'Y'] count = 0 dist1 = float("{:.6f}".format(speed_now * 0.1 + 0.5 * accel * 0.01)) speed_next = float("{:.6f}".format(speed_now + 0.5 * accel * 0.1)) dist2 = dist(Start_X, Start_Y, Check_X, Check_Y) if accel < 0: time0 = float("{:.6f}".format(-2 * speed_now / accel)) dist0 = float("{:.6f}".format(speed_now * time0 + 0.5 * accel * time0 * time0)) if (time0 < 0.1) and (dist0 <= dist2): Heading = heading rad = math.pi / 2 - math.radians(Heading) Des_X = Start_X + dist0 * math.cos(rad) Des_Y = Start_Y + dist0 * math.sin(rad) return (Des_X, Des_Y, Heading, 0, point) elif (time0 < 0.1) and (dist0 > dist2): while (dist0 > dist2): count += 1 if point + count < len(data_check): dist0 = dist0 - dist2 Start_X = Check_X Start_Y = Check_Y Check_X = data_check.at[point + count, 'X'] Check_Y = data_check.at[point + count, 'Y'] dist2 = dist(Start_X, Start_Y, Check_X, Check_Y) else: break Heading = get_heading(Start_X, Start_Y, Check_X, Check_Y) rad = math.pi / 2 - math.radians(Heading) Des_X = Start_X + dist0 * math.cos(rad) Des_Y = Start_Y + dist0 * math.sin(rad) return (Des_X, Des_Y, Heading, 0, point + count) else: while (dist1 > dist2): count += 1 if point + count < len(data_check): dist1 = dist1 - dist2 # dist0 = dist0 - dist2 Start_X = Check_X Start_Y = Check_Y Check_X = data_check.at[point + count, 'X'] Check_Y = data_check.at[point + count, 'Y'] dist2 = dist(Start_X, Start_Y, Check_X, Check_Y) speed_next = float("{:.6f}".format(speed_next + 0.5 * accel * 0.1)) else: break Heading = get_heading(Start_X, Start_Y, Check_X, Check_Y) rad = math.pi / 2 - math.radians(Heading) Des_X = Start_X + dist1 * math.cos(rad) Des_Y = Start_Y + dist1 * math.sin(rad) return (Des_X, Des_Y, Heading, speed_next, point + count) elif (accel == 0) & (speed_now == 0): return (Start_X, Start_Y, heading, speed_now, point) else: while (dist1 > dist2): count += 1 if point + count < len(data_check): dist1 = dist1 - dist2 Start_X = Check_X Start_Y = Check_Y #print ("LengthCheck",point, count, len(data_check)) Check_X = data_check.at[point + count, 'X'] Check_Y = data_check.at[point + count, 'Y'] dist2 = dist(Start_X, Start_Y, Check_X, Check_Y) speed_next = float("{:.6f}".format(speed_next + 0.5 * accel * 0.1)) else: break Heading = get_heading(Start_X, Start_Y, Check_X, Check_Y) rad = math.pi / 2 - math.radians(Heading) Des_X = Start_X + dist1 * math.cos(rad) Des_Y = Start_Y + dist1 * math.sin(rad) return (Des_X, Des_Y, Heading, speed_next, point + count) def next_location_online(data_check, point, X_now, Y_now, speed_now, accel, heading): """Returns next time step's location of the target vehicle without projections potential trajectory. This is the online version, can be used for single step length updating process. Replace all the function [next_location] for the online version. Keyword arguments: >>> data_check: The working data frame selected from the main dataframe. >>> point: The index of the target vehicle's trajectory in the working data frame. >>> X_now: Current X of the target vehicle (ft.). >>> Y_now: Current Y of the target vehicle (ft.). >>> speed_now: Current speed of the target vehicle (ft/s). >>> accel: Acceleration of the target vehicel (fpss). >>> heading: Current heading angle of the target vehicle. RETURN: Next X, Next Y, Next heading, Next speed, the index of the reference trajectory for next time stamp. """ Start_X = X_now Start_Y = Y_now dist1 = float("{:.6f}".format(speed_now * 0.1 + 0.5 * accel * 0.01)) speed_next = float("{:.6f}".format(speed_now + 0.5 * accel * 0.1)) if (accel == 0) &
#Adventure Game #<NAME>, <NAME>, <NAME> (C)2010 #This program is free software: you can redistribute it and/or modify #it under the terms of the GNU General Public License as published by #the Free Software Foundation, either version 3 of the License, or #(at your option) any later version. #This program is distributed in the hope that it will be useful, #but WITHOUT ANY WARRANTY; without even the implied warranty of #MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the #GNU General Public License for more details. #You should have received a copy of the GNU General Public License #along with this program. If not, see <http://www.gnu.org/licenses/>. import textwrap def pprint(text): print textwrap.fill(text, 80) pprint('''Welcome to the Adventure Game, here you will embark on a dangerous journey to defeat the evil Dragon named Kibbles, and rescue Princess Catherine, You're story begins in the small town of Jersey, type the commands north, south, east, and west in order to navigate,type the command use followed by the item name to use an item, type the command inventory to look at the items in your posession, type the command look to look around you, type the command search followed by a target to search for people or items, type the command commands to repeat these directions. Good luck''') items=[] place=1 town=2 forest=3 mine=4 lair=5 dead=6 game=0 on=90 win=91 game=on place=town lose=92 while game==on: while place==town: direction=raw_input("What would you like to do?\n") if direction=="west": if "iron ore" and "wood" and "3 Gold Pieces" in items: pprint("the blacksmith greets you, and you tell him that you have the items and money he requires, you also give him the saw to make up for some of the difference, he then forges you a battleaxe and wishes you luck on the rest of your quest") items.remove ("saw") items.remove ("3 Gold Pieces") items.remove ("iron ore") items.remove ("wood") items.append ("battleaxe") else: pprint('''You are at the blacksmith shop, many different kinds of weapons decorate the walls, the blacksmith is a tall, hairy man who smiles as you enter the door. You tell him that you need a weapon to kill Kibbles the Evil Dragon. He laughs and says 'Mah boy! Killing Kibbles is what all true warriors strive for! But you can't do it with any of my weapons, you need Atari, the magic sword that lies in the cave east of the forest. Many have tried to get it, but all have failed as it is guarded by the evil wizard Gwonam! If you're looking to fight Gwonam, I can make you an axe, but you need to bring me iron ore, wood, and some gold for my troubles.' You then decide to head into the forest to seek out the materials for the blacksmith''') elif direction=="north": pprint('''You walk up the gates of the king's castle, the guards stop and ask you to state your business, you tell them that you want to rescue <NAME>. They laugh and tell you that you should probably obtain a weapon first, you head back to the center of town''') elif direction=="east": print "You head into the residential district of town, a few huts line the streets, but there isn't much else of note here, you decide to head back to the center of town" elif direction=="south": print "You head deep into the forest" place=forest elif direction=="commands": print "type the commands north, south, east, and west in order to navigate,type the command use followed by the item name to use an item, type the command inventory to look at the items in your posession, type the command look to look around you, type the command search followed by a target to search for people or items, type the command commands to repeat these directions" elif direction=="inventory": print items elif direction=="look": print "You're located in the small town of Jersey, here you see a blacksmith shop to the west, the king's castle to the north, houses to the east, and the town's exit to the forest to your south" elif "use" in direction: print "You have nothing to use" elif "search" in direction: print "There's nothing of importance to search" else: print "Please type a command" while place==forest: direction=raw_input("What would you like to do?\n") if direction=="west": print "You head into the mine" place=mine elif direction=="south": print "The mountains look too treacherous to try and pass through. It might not hurt to try and look for that man though." elif direction=="east": if "battleaxe" in items: print "You head into Gwonam's Lair" place=lair else: print "it's not a good idea to go to Gwonam's lair unprotected" elif direction=="north": print "You head back to Jersey" place=town elif direction=="look": print "You are at the center of a vast forest, surrounded by many tall trees, you could defintiely obtain some wood from some of them, but you would need the proper tools. To your west lies a mine, to your south a group of impassable mountains, but you can hear a person in the distance, to your east lies the evil gwonam's lair, and to the north lies Jersey" elif "use" in direction: if "pickaxe" in direction: if "iron ore" in items: if "man" or "person" in direction: print "The man looks at the pickaxe with sorrow and tells you that this was his brothers pickaxe, he offers you his saw for it and you accept." items.append ("saw") items.remove ("pickaxe") if "saw" in direction: if "saw" in items: if "tree" in direction: print "you use the saw to cut some wood off of a nearby tree" items.append ("wood") else: print "you can't use that" elif direction=="inventory": print items elif "search" in direction: if direction== "search person": print "You find the man, he appears to be a lumberjack and is carrying a large saw. You tell him about your quest and the items you are looking for. He directs you to the mine for the iron ore and tells you that he's always wanted to be a miner like his brother. He tells you that his brother is in the mines right now if you should need any help." else: print "You can't search for that" elif direction=="commands": print "type the commands north, south, east, and west in order to navigate,type the command use followed by the item name to use an item, type the command inventory to look at the items in your posession, type the command look to look around you, type the command search followed by a target to search for people or items, type the command commands to repeat these directions" while place==mine: direction=raw_input("What would you like to do?\n") if direction=="west": print "The cavern is too dark to travel down, you head back to the center of the mine" elif direction=="east": print "You head back to the forest" place=forest elif direction=="south": print "You are at a desposit of rich iron, this is perfect for the blacksmith, the only problem is you don't have a way to mine it" elif direction=="north": print "You are in a small cavern with a dead body on the floor, you are not sure how he died. You see a pickaxe underneath him and a bag around his waist" elif direction=="look": print "You find yourself in the center of a large mine. To your east lies the exit back to the forest, to your north lies a cavern with a dead body, to your south lies an iron deposit, and to your west lies a very dark cavern." elif "search" in direction: if "body" in direction: if "pickaxe" not in items: print "You take the pickaxe and the bag which contained 3 Gold Pieces" items.append ("pickaxe") items.append ("3 Gold Pieces") else: print "You cannot search that" elif "use" in direction: if "pickaxe" in direction: if "pickaxe" in items: if "iron" in direction: print "You use the pickaxe to mine the iron ore" items.append ("iron ore") else:
A.B") temp_buck_distr_B_virt_err_self = temp_buck_distr_B_self + self.virtual_error temp_buck_distr_B_virt_err_pb = temp_buck_distr_B_pb + pb.virtual_error temp_virtual_error = self.convolve_same(temp_buck_distr_B_virt_err_self, temp_buck_distr_B_virt_err_pb) - temp_buck_distr_B_convolved self.logger.info(" Compute virtual_error A.B_under") temp_virtual_error_under = self.convolve_full(temp_buck_distr_B_virt_err_self[0:self.one_index+1], temp_buck_distr_B_virt_err_pb[0:pb.one_index+1]) temp_virtual_error_under = np.sum(temp_virtual_error_under[0:self.one_index+1]) temp_virtual_error[0] = max(0, temp_virtual_error_under) self.virtual_error = temp_virtual_error self.u = self.u + pb.u # decrease reference counters del temp_buck_distr_B_self del temp_buck_distr_B_pb del temp_buck_distr_B_convolved del temp_buck_distr_B_virt_err_self del temp_buck_distr_B_virt_err_pb del temp_virtual_error_under # overwrites self.bucket_distribution = temp_bucket_distribution self.infty_bucket = delta_infty_bucket # clean up del temp_over del temp_under gc.collect() return pb @classmethod def load_state(cls, state_directory): params = pickle.load(open(os.path.join(state_directory, "non_ndarray"),'rb')) # If you search bugs with incomplete loaded states, look here. # The "instance.__init__()" method is *NOT* called when loading! instance = cls.__new__(cls) instance.__dict__.update(params) instance.logger_setup(instance.logging_level) instance.bucket_distribution = np.fromfile(os.path.join(state_directory, "bucket_distribution"), dtype=np.float64) if instance.error_correction: instance.real_error = np.fromfile(os.path.join(state_directory, "real_error"), dtype=np.float64) instance.virtual_error = np.fromfile(os.path.join(state_directory, "virtual_error"), dtype=np.float64) return instance def save_state(self, state_directory): self.mkdir_p(state_directory) excluded_attributes = ['logger', 'bucket_distribution', 'real_error', 'virtual_error'] # excluding np arrays from dumping in "non_ndarray" without copying large arrays: save_dict = {} for key in self.__dict__.keys(): if key not in excluded_attributes: save_dict[key] = self.__dict__[key] pickle.dump(save_dict, open(os.path.join(state_directory, "non_ndarray"),'wb')) self.bucket_distribution.tofile(open(os.path.join(state_directory, "bucket_distribution"), 'w')) if self.error_correction: self.real_error.tofile(open(os.path.join(state_directory, "real_error"), 'w')) self.virtual_error.tofile(open(os.path.join(state_directory, "virtual_error"), 'w')) def compose(self, nr_of_compositions): if not self.caching_directory: self.logger.critical("This method requires caching. Abort") return None state_filepath_base = os.path.join(self.caching_directory, "compositions-") get_state_filepath = lambda needed_exp: state_filepath_base + str(int(2**needed_exp)) target_state_filepath = state_filepath_base + str(nr_of_compositions) if os.path.isdir(target_state_filepath): self.logger.info("Target state is cached. Loading it") return self.load_state(target_state_filepath) # wich compositions do we need target_exp = int( np.log2(nr_of_compositions) ) needed_compositions = [ x if (nr_of_compositions & (2**x) != 0) else -1 for x in range(target_exp + 1)] needed_compositions = list(filter(lambda a: a != -1, needed_compositions)) self.logger.info("Needed compositions: " + ", ".join(map(str, needed_compositions))) # start with a copy of the current state previous_state = self.copy() avoided_self_composition = False # which compositions already exist? Generate? for needed_exp in range(target_exp + 1): state_filepath = get_state_filepath(needed_exp) if not os.path.isdir(state_filepath): self.logger.info("[*] State 2**" + str(needed_exp) + " does not exist. Creating it.") if not needed_exp == 0: if avoided_self_composition: # only load from disk when it differs from current state previous_state_filepath = get_state_filepath(needed_exp - 1) previous_state = self.load_state(previous_state_filepath) avoided_self_composition = False previous_state.compose_with(previous_state) previous_state.print_state() # previous_state.print_state() previous_state.save_state(state_filepath) gc.collect() else: avoided_self_composition = True self.logger.info("[*] All intermediate states up to 2**" + str(target_exp) + " exist now") previous_state = self.load_state( get_state_filepath(needed_compositions[0]) ) self.logger.info("[*] Loaded state 2**" + str(needed_compositions[0])) # compose to the desired state for i in needed_compositions[1:]: self.logger.info("[*] Compose with state 2**{}".format(i)) current_state = self.load_state(get_state_filepath(i)) # while the factor of previous state and current state is not same while(current_state.factor != previous_state.factor): self.logger.info("factors are unequal ( {} != {} ), squaring".format(current_state.factor, previous_state.factor)) if current_state.factor > previous_state.factor: previous_state.squaring() else: current_state.squaring() # now the factor should be the same previous_state.compose_with(current_state) previous_state.print_state() previous_state.save_state(target_state_filepath) # caching.. return previous_state def print_state(self): """ prints some information about the current state """ sum_of_bucket_distr = np.sum(self.bucket_distribution) summary = ( 'Summary:\n' ' caching_directoy : {}\n' ' number_of_buckets : {}\n' ' factor : {}\n' ' infty_bucket : {} (max 1.0, numerical error, should be < {:g})\n' ' disting_events : {} (max 1.0)\n' ' minus-n-bucket : {}\n' ' sum bucket_distr : {:.30f}\n' ' sum of all buckets : {:.30f} (should be 1.000000)\n' ' delta_upper(eps=0) : {}' .format( self.caching_directory, self.number_of_buckets, self.factor, self.infty_bucket, _infty_bucket_warning_bound, self.distinguishing_events, self.bucket_distribution[0], sum_of_bucket_distr, sum_of_bucket_distr + self.infty_bucket + self.distinguishing_events, self.delta_of_eps_upper_bound(0), )) if self.error_correction: summary += ('\n' ' delta_lower(eps=0) : {}\n' ' sum(virtual_error) : {} (max 1.0, should be < {:g})\n' ' sum(real_error) : {} (max 1.0, should be < {:g})\n' ' the u : {}' .format( self.delta_of_eps_lower_bound(0), np.sum(self.virtual_error), _virtual_error_warning_bound, np.sum(self.real_error), _virtual_error_warning_bound, self.u, )) self.logger.info(summary) def convolve_same(self, x, y): return np.convolve(x, y, mode = 'same') def convolve_full(self, x, y): return np.convolve(x, y, mode = 'full') def delta_PDP(self, eps): """ Returns upper bound for tight delta for probabilistic differential privacy. Error correction not supported. """ if self.error_correction: self.logger.warning("Error correction for PDP delta not supported. Omit error correction.") k = int(np.floor(eps / self.log_factor)) if k > self.number_of_buckets // 2: # eps is above of bucket_distribution range return self.infty_bucket + self.distinguishing_events if k < -self.number_of_buckets // 2: # eps is below of bucket_distribution range k = -self.number_of_buckets // 2 return np.sum(self.bucket_distribution[self.one_index + k + 1:]) + self.infty_bucket + self.distinguishing_events def _g_func(self, l): return (1 - self.factor**-l) def delta_ADP(self, eps): """ Returns an upper bound for tight delta for approximate differntial privacy. Error correction is supported.""" return self.delta_ADP_upper_bound(eps) def delta_ADP_upper_bound(self, eps): # Use np.floor to guarantee an upper bound for the delta(eps) graph k = int(np.floor(eps / self.log_factor)) if k > self.number_of_buckets // 2: # eps is above of bucket_distribution range return self.infty_bucket + self.distinguishing_events if k < -self.number_of_buckets // 2: # eps is below of bucket_distribution range k = -self.number_of_buckets // 2 ret = np.sum(self._g_func(np.arange(1, self.one_index - k + 1)) * self.bucket_distribution[self.one_index + k + 1:]) if self.error_correction: ret -= np.exp(eps) * np.sum( self.real_error[ min(self.one_index + k + self.u, self.number_of_buckets): ] ) # check: # a = np.sum(self._g_func(np.arange( self.one_index - k)) * self.bucket_distribution[self.one_index + k + 1:][self.u-1:]) # a -= np.exp(eps) * np.sum( self.real_error[ min(self.one_index + k + self.u, self.number_of_buckets): ] ) # assert np.all( a >= 0) return ret + self.infty_bucket + self.distinguishing_events def delta_ADP_lower_bound(self, eps): if not self.error_correction: self.logger.error("Error correction required for lower bound") return None # Use np.ceil to garantee an lower bound for the delta(eps) graph k = int(np.ceil(eps / self.log_factor)) if k > self.number_of_buckets // 2: # eps is above of bucket_distribution range return self.distinguishing_events if k <= -self.number_of_buckets // 2: # eps is below of bucket_distribution range k = -self.number_of_buckets // 2 + 1 vals = self._g_func(np.arange(1, self.one_index - k + 1)) * self.bucket_distribution[self.one_index + k + 1:] vals -= np.exp(eps) * self.virtual_error[self.one_index + k + 1:] vals[vals < 0] = 0 # = max(0, vals) return np.sum(vals) + self.distinguishing_events def eps_ADP_upper_bound(self, delta): """ Returns an upper bound of epsilon for a target delta. Throws descriptive errors if it cannot satisfy the conditions. Without error correction, the optimizer might not converge properly. """ if not self.error_correction: self.logger.warning("Error-correction disabled, optimizer might not converge properly.") # The maximal epsilon we can serve. For any epsilons larger, self.delta_ADP_upper_bound will return the # delta of the infinity bucket+dist_events only, rendering upper-bound-epsilon=np.inf max_eps = (self.number_of_buckets // 2 ) * self.log_factor try: root = optimize.bisect(lambda eps: self.delta_ADP_upper_bound(eps) - delta, 0, max_eps) except ValueError as e: if self.delta_ADP_upper_bound(eps=max_eps) > delta: raise ValueError("Required target-delta is smaller than self.delta_ADP_upper_bound(max_eps) can serve. " "For an instant remedy, increase number_of_buckets, or increase factor.") elif self.delta_ADP_upper_bound(eps=0.0) < delta: self.logger.warning("Returning over-approximation eps=0. " "(self.delta_ADP_upper_bound(eps=0) < target-delta)") return 0.0 raise e return root def renyi_divergence_upper_bound(self, alpha): """ returns a upper bound on the alpha renyi-divergence for a given alpha >= 1 R(aplha) = 1/(alpha - 1) * log_e E_{x~B} (A/B)^(alpha) if alpha > 1 R(aplha) = E_{x~B} log_e (A/B)^(alpha) if alpha == 1 """ assert self.distinguishing_events == 0 and self.infty_bucket == 0, \ "Nonzero infty bucket or distingushing events not supported" # if alpha == 1, the divergence is reduced to KL-divergence if alpha == 1: return self.KL_divergence() # else, compute the renyi-divergence lam = alpha - 1 # the alpha renyi moments are the alpha-1 moments of the exponentiated bucket_distribution. Informal, # i.e. R(alpha) = 1/lam * ln E_{y~buckets} exp(y*lam) # # for additional details, see Lemma 8 in # Sommer et al. "Privacy loss classes: The central limit theorem in differential privacy." PoPETS 2019.2 # to provide a upper bound, we assume that all content of a specific bucket manifests at the position # with the highest leakage (most right) summands = np.exp((np.arange(self.number_of_buckets) - self.one_index)*self.log_factor*lam) expectation_value = np.sum(self.bucket_distribution*summands) renyi_div = np.log(expectation_value) / lam return renyi_div def KL_divergence(self): return np.sum(self.bucket_distribution * ((np.arange(self.number_of_buckets) - self.one_index)*self.log_factor)) # needed for pickle (and deepcopy) def __getstate__(self): d = self.__dict__.copy() # copy the dict since we change it del d['logger'] # remove logger instance entry return d def __setstate__(self, dict): if not hasattr(self, 'logger'): self.logger_setup(dict['logging_level']) self.__dict__.update(dict) # utility functions def copy(self): # I hope this is
'pressure' var_list[5].name = 'conductivity' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[5].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'degC' var_list[2].units = 'unitless' var_list[3].units = 'kg/m3' var_list[4].units = 'dbar' var_list[5].units = 'S/m' elif platform_name == 'CE07SHSM' and node == 'NSIF' and instrument_class == 'CTD' and method == 'RecoveredHost': uframe_dataset_name = 'CE07SHSM/RID27/03-CTDBPC000/recovered_host/ctdbp_cdef_dcl_instrument_recovered' var_list[0].name = 'time' var_list[1].name = 'temp' var_list[2].name = 'practical_salinity' var_list[3].name = 'density' var_list[4].name = 'pressure' var_list[5].name = 'conductivity' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[5].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'degC' var_list[2].units = 'unitless' var_list[3].units = 'kg/m3' var_list[4].units = 'dbar' var_list[5].units = 'S/m' elif platform_name == 'CE04OSSM' and node == 'NSIF' and instrument_class == 'CTD' and method == 'RecoveredHost': uframe_dataset_name = 'CE04OSSM/RID27/03-CTDBPC000/recovered_host/ctdbp_cdef_dcl_instrument_recovered' var_list[0].name = 'time' var_list[1].name = 'temp' var_list[2].name = 'practical_salinity' var_list[3].name = 'density' var_list[4].name = 'pressure' var_list[5].name = 'conductivity' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[5].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'degC' var_list[2].units = 'unitless' var_list[3].units = 'kg/m3' var_list[4].units = 'dbar' var_list[5].units = 'S/m' elif platform_name == 'CE09OSSM' and node == 'NSIF' and instrument_class == 'CTD' and method == 'RecoveredHost': uframe_dataset_name = 'CE09OSSM/RID27/03-CTDBPC000/recovered_host/ctdbp_cdef_dcl_instrument_recovered' var_list[0].name = 'time' var_list[1].name = 'temp' var_list[2].name = 'practical_salinity' var_list[3].name = 'density' var_list[4].name = 'pressure' var_list[5].name = 'conductivity' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[5].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'degC' var_list[2].units = 'unitless' var_list[3].units = 'kg/m3' var_list[4].units = 'dbar' var_list[5].units = 'S/m' elif platform_name == 'CE07SHSM' and node == 'MFN' and instrument_class == 'CTD' and method == 'RecoveredHost': uframe_dataset_name = 'CE07SHSM/MFD37/03-CTDBPC000/recovered_host/ctdbp_cdef_dcl_instrument_recovered' var_list[0].name = 'time' var_list[1].name = 'temp' var_list[2].name = 'practical_salinity' var_list[3].name = 'density' var_list[4].name = 'pressure' var_list[5].name = 'conductivity' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[5].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'degC' var_list[2].units = 'unitless' var_list[3].units = 'kg/m3' var_list[4].units = 'dbar' var_list[5].units = 'S/m' elif platform_name == 'CE09OSSM' and node == 'MFN' and instrument_class == 'CTD' and method == 'RecoveredHost': uframe_dataset_name = 'CE09OSSM/MFD37/03-CTDBPE000/recovered_host/ctdbp_cdef_dcl_instrument_recovered' var_list[0].name = 'time' var_list[1].name = 'temp' var_list[2].name = 'practical_salinity' var_list[3].name = 'density' var_list[4].name = 'pressure' var_list[5].name = 'conductivity' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[5].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'degC' var_list[2].units = 'unitless' var_list[3].units = 'kg/m3' var_list[4].units = 'dbar' var_list[5].units = 'S/m' #VEL3D elif platform_name == 'CE01ISSM' and node == 'MFN' and instrument_class == 'VEL3D' and method == 'RecoveredHost': uframe_dataset_name = 'CE01ISSM/MFD35/01-VEL3DD000/recovered_host/vel3d_cd_dcl_velocity_data_recovered' var_list[0].name = 'time' var_list[1].name = 'vel3d_c_eastward_turbulent_velocity' var_list[2].name = 'vel3d_c_northward_turbulent_velocity' var_list[3].name = 'vel3d_c_upward_turbulent_velocity' var_list[4].name = 'seawater_pressure_mbar' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'm/s' var_list[2].units = 'm/s' var_list[3].units = 'm/s' var_list[4].units = '0.001dbar' elif platform_name == 'CE06ISSM' and node == 'MFN' and instrument_class == 'VEL3D' and method == 'RecoveredHost': uframe_dataset_name = 'CE06ISSM/MFD35/01-VEL3DD000/recovered_host/vel3d_cd_dcl_velocity_data_recovered' var_list[0].name = 'time' var_list[1].name = 'vel3d_c_eastward_turbulent_velocity' var_list[2].name = 'vel3d_c_northward_turbulent_velocity' var_list[3].name = 'vel3d_c_upward_turbulent_velocity' var_list[4].name = 'seawater_pressure_mbar' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'm/s' var_list[2].units = 'm/s' var_list[3].units = 'm/s' var_list[4].units = '0.001dbar' elif platform_name == 'CE07SHSM' and node == 'MFN' and instrument_class == 'VEL3D' and method == 'RecoveredHost': uframe_dataset_name = 'CE07SHSM/MFD35/01-VEL3DD000/recovered_host/vel3d_cd_dcl_velocity_data_recovered' var_list[0].name = 'time' var_list[1].name = 'vel3d_c_eastward_turbulent_velocity' var_list[2].name = 'vel3d_c_northward_turbulent_velocity' var_list[3].name = 'vel3d_c_upward_turbulent_velocity' var_list[4].name = 'seawater_pressure_mbar' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'm/s' var_list[2].units = 'm/s' var_list[3].units = 'm/s' var_list[4].units = '0.001dbar' elif platform_name == 'CE09OSSM' and node == 'MFN' and instrument_class == 'VEL3D' and method == 'RecoveredHost': uframe_dataset_name = 'CE09OSSM/MFD35/01-VEL3DD000/recovered_host/vel3d_cd_dcl_velocity_data_recovered' var_list[0].name = 'time' var_list[1].name = 'vel3d_c_eastward_turbulent_velocity' var_list[2].name = 'vel3d_c_northward_turbulent_velocity' var_list[3].name = 'vel3d_c_upward_turbulent_velocity' var_list[4].name = 'seawater_pressure_mbar' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[4].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'm/s' var_list[2].units = 'm/s' var_list[3].units = 'm/s' var_list[4].units = '0.001dbar' #PCO2A elif platform_name == 'CE02SHSM' and node == 'BUOY' and instrument_class == 'PCO2A' and method == 'RecoveredHost': uframe_dataset_name = 'CE02SHSM/SBD12/04-PCO2AA000/recovered_host/pco2a_a_dcl_instrument_water_recovered' var_list[0].name = 'time' var_list[1].name = 'partial_pressure_co2_ssw' var_list[2].name = 'partial_pressure_co2_atm' var_list[3].name = 'pco2_co2flux' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'uatm' var_list[2].units = 'uatm' var_list[3].units = 'mol m-2 s-1' elif platform_name == 'CE04OSSM' and node == 'BUOY' and instrument_class == 'PCO2A' and method == 'RecoveredHost': uframe_dataset_name = 'CE04OSSM/SBD12/04-PCO2AA000/recovered_host/pco2a_a_dcl_instrument_water_recovered' var_list[0].name = 'time' var_list[1].name = 'partial_pressure_co2_ssw' var_list[2].name = 'partial_pressure_co2_atm' var_list[3].name = 'pco2_co2flux' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'uatm' var_list[2].units = 'uatm' var_list[3].units = 'mol m-2 s-1' elif platform_name == 'CE07SHSM' and node == 'BUOY' and instrument_class == 'PCO2A' and method == 'RecoveredHost': uframe_dataset_name = 'CE07SHSM/SBD12/04-PCO2AA000/recovered_host/pco2a_a_dcl_instrument_water_recovered' var_list[0].name = 'time' var_list[1].name = 'partial_pressure_co2_ssw' var_list[2].name = 'partial_pressure_co2_atm' var_list[3].name = 'pco2_co2flux' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'uatm' var_list[2].units = 'uatm' var_list[3].units = 'mol m-2 s-1' elif platform_name == 'CE09OSSM' and node == 'BUOY' and instrument_class == 'PCO2A' and method == 'RecoveredHost': uframe_dataset_name = 'CE09OSSM/SBD12/04-PCO2AA000/recovered_host/pco2a_a_dcl_instrument_water_recovered' var_list[0].name = 'time' var_list[1].name = 'partial_pressure_co2_ssw' var_list[2].name = 'partial_pressure_co2_atm' var_list[3].name = 'pco2_co2flux' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[3].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'uatm' var_list[2].units = 'uatm' var_list[3].units = 'mol m-2 s-1' #OPTAA elif platform_name == 'CE01ISSM' and node == 'NSIF' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE01ISSM/RID16/01-OPTAAD000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' elif platform_name == 'CE02SHSM' and node == 'NSIF' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE02SHSM/RID27/01-OPTAAD000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' elif platform_name == 'CE04OSSM' and node == 'NSIF' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE04OSSM/RID27/01-OPTAAD000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' elif platform_name == 'CE06ISSM' and node == 'NSIF' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE06ISSM/RID16/01-OPTAAD000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' elif platform_name == 'CE07SHSM' and node == 'NSIF' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE07SHSM/RID27/01-OPTAAD000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' elif platform_name == 'CE09OSSM' and node == 'NSIF' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE09OSSM/RID27/01-OPTAAD000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' elif platform_name == 'CE01ISSM' and node == 'MFN' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE01ISSM/MFD37/01-OPTAAD000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' elif platform_name == 'CE06ISSM' and node == 'MFN' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE06ISSM/MFD37/01-OPTAAD000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' elif platform_name == 'CE07SHSM' and node == 'MFN' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE07SHSM/MFD37/01-OPTAAD000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' elif platform_name == 'CE09OSSM' and node == 'MFN' and instrument_class == 'OPTAA' and method == 'RecoveredHost': uframe_dataset_name = 'CE09OSSM/MFD37/01-OPTAAC000/recovered_host/optaa_dj_dcl_instrument_recovered' var_list[0].name = 'time' var_list[0].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' #NUTNR elif platform_name == 'CE01ISSM' and node == 'NSIF' and instrument_class == 'NUTNR' and method == 'RecoveredHost': uframe_dataset_name = 'CE01ISSM/RID16/07-NUTNRB000/recovered_host/suna_dcl_recovered' var_list[0].name = 'time' var_list[1].name = 'nitrate_concentration' var_list[2].name = 'salinity_corrected_nitrate' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data = np.array([]) var_list[0].units = 'seconds since 1900-01-01' var_list[1].units = 'umol/L' var_list[2].units = 'umol/L' elif platform_name == 'CE02SHSM' and node == 'NSIF' and instrument_class == 'NUTNR' and method == 'RecoveredHost': uframe_dataset_name = 'CE02SHSM/RID26/07-NUTNRB000/recovered_host/suna_dcl_recovered' var_list[0].name = 'time' var_list[1].name = 'nitrate_concentration' var_list[2].name = 'salinity_corrected_nitrate' var_list[0].data = np.array([]) var_list[1].data = np.array([]) var_list[2].data =
<gh_stars>1-10 #! /usr/bin/python3 r'''############################################################################### ################################################################################### # # # Tegridy MIDI X Module (TMIDI X / tee-midi eks) # Version 1.0 # # NOTE: TMIDI X Module starts after the partial MIDI.py module @ line 1342 # # Based upon MIDI.py module v.6.7. by <NAME> / pjb.com.au # # Project Los Angeles # # Tegridy Code 2021 # # https://github.com/Tegridy-Code/Project-Los-Angeles # # ################################################################################### ################################################################################### # Copyright 2021 Project Los Angeles / Tegridy Code # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ################################################################################### ################################################################################### # # PARTIAL MIDI.py Module v.6.7. by <NAME> # Please see TMIDI 2.3/tegridy-tools repo for full MIDI.py module code # # Or you can always download the latest full version from: # https://pjb.com.au/ # # Copyright 2020 <NAME> # ################################################################################### ###################################################################################''' import sys, struct, copy Version = '6.7' VersionDate = '20201120' _previous_warning = '' # 5.4 _previous_times = 0 # 5.4 #------------------------------- Encoding stuff -------------------------- def opus2midi(opus=[], text_encoding='ISO-8859-1'): r'''The argument is a list: the first item in the list is the "ticks" parameter, the others are the tracks. Each track is a list of midi-events, and each event is itself a list; see above. opus2midi() returns a bytestring of the MIDI, which can then be written either to a file opened in binary mode (mode='wb'), or to stdout by means of: sys.stdout.buffer.write() my_opus = [ 96, [ # track 0: ['patch_change', 0, 1, 8], # and these are the events... ['note_on', 5, 1, 25, 96], ['note_off', 96, 1, 25, 0], ['note_on', 0, 1, 29, 96], ['note_off', 96, 1, 29, 0], ], # end of track 0 ] my_midi = opus2midi(my_opus) sys.stdout.buffer.write(my_midi) ''' if len(opus) < 2: opus=[1000, [],] tracks = copy.deepcopy(opus) ticks = int(tracks.pop(0)) ntracks = len(tracks) if ntracks == 1: format = 0 else: format = 1 my_midi = b"MThd\x00\x00\x00\x06"+struct.pack('>HHH',format,ntracks,ticks) for track in tracks: events = _encode(track, text_encoding=text_encoding) my_midi += b'MTrk' + struct.pack('>I',len(events)) + events _clean_up_warnings() return my_midi def score2opus(score=None, text_encoding='ISO-8859-1'): r''' The argument is a list: the first item in the list is the "ticks" parameter, the others are the tracks. Each track is a list of score-events, and each event is itself a list. A score-event is similar to an opus-event (see above), except that in a score: 1) the times are expressed as an absolute number of ticks from the track's start time 2) the pairs of 'note_on' and 'note_off' events in an "opus" are abstracted into a single 'note' event in a "score": ['note', start_time, duration, channel, pitch, velocity] score2opus() returns a list specifying the equivalent "opus". my_score = [ 96, [ # track 0: ['patch_change', 0, 1, 8], ['note', 5, 96, 1, 25, 96], ['note', 101, 96, 1, 29, 96] ], # end of track 0 ] my_opus = score2opus(my_score) ''' if len(score) < 2: score=[1000, [],] tracks = copy.deepcopy(score) ticks = int(tracks.pop(0)) opus_tracks = [] for scoretrack in tracks: time2events = dict([]) for scoreevent in scoretrack: if scoreevent[0] == 'note': note_on_event = ['note_on',scoreevent[1], scoreevent[3],scoreevent[4],scoreevent[5]] note_off_event = ['note_off',scoreevent[1]+scoreevent[2], scoreevent[3],scoreevent[4],scoreevent[5]] if time2events.get(note_on_event[1]): time2events[note_on_event[1]].append(note_on_event) else: time2events[note_on_event[1]] = [note_on_event,] if time2events.get(note_off_event[1]): time2events[note_off_event[1]].append(note_off_event) else: time2events[note_off_event[1]] = [note_off_event,] continue if time2events.get(scoreevent[1]): time2events[scoreevent[1]].append(scoreevent) else: time2events[scoreevent[1]] = [scoreevent,] sorted_times = [] # list of keys for k in time2events.keys(): sorted_times.append(k) sorted_times.sort() sorted_events = [] # once-flattened list of values sorted by key for time in sorted_times: sorted_events.extend(time2events[time]) abs_time = 0 for event in sorted_events: # convert abs times => delta times delta_time = event[1] - abs_time abs_time = event[1] event[1] = delta_time opus_tracks.append(sorted_events) opus_tracks.insert(0,ticks) _clean_up_warnings() return opus_tracks def score2midi(score=None, text_encoding='ISO-8859-1'): r''' Translates a "score" into MIDI, using score2opus() then opus2midi() ''' return opus2midi(score2opus(score, text_encoding), text_encoding) #--------------------------- Decoding stuff ------------------------ def midi2opus(midi=b''): r'''Translates MIDI into a "opus". For a description of the "opus" format, see opus2midi() ''' my_midi=bytearray(midi) if len(my_midi) < 4: _clean_up_warnings() return [1000,[],] id = bytes(my_midi[0:4]) if id != b'MThd': _warn("midi2opus: midi starts with "+str(id)+" instead of 'MThd'") _clean_up_warnings() return [1000,[],] [length, format, tracks_expected, ticks] = struct.unpack( '>IHHH', bytes(my_midi[4:14])) if length != 6: _warn("midi2opus: midi header length was "+str(length)+" instead of 6") _clean_up_warnings() return [1000,[],] my_opus = [ticks,] my_midi = my_midi[14:] track_num = 1 # 5.1 while len(my_midi) >= 8: track_type = bytes(my_midi[0:4]) if track_type != b'MTrk': #_warn('midi2opus: Warning: track #'+str(track_num)+' type is '+str(track_type)+" instead of b'MTrk'") pass [track_length] = struct.unpack('>I', my_midi[4:8]) my_midi = my_midi[8:] if track_length > len(my_midi): _warn('midi2opus: track #'+str(track_num)+' length '+str(track_length)+' is too large') _clean_up_warnings() return my_opus # 5.0 my_midi_track = my_midi[0:track_length] my_track = _decode(my_midi_track) my_opus.append(my_track) my_midi = my_midi[track_length:] track_num += 1 # 5.1 _clean_up_warnings() return my_opus def opus2score(opus=[]): r'''For a description of the "opus" and "score" formats, see opus2midi() and score2opus(). ''' if len(opus) < 2: _clean_up_warnings() return [1000,[],] tracks = copy.deepcopy(opus) # couple of slices probably quicker... ticks = int(tracks.pop(0)) score = [ticks,] for opus_track in tracks: ticks_so_far = 0 score_track = [] chapitch2note_on_events = dict([]) # 4.0 for opus_event in opus_track: ticks_so_far += opus_event[1] if opus_event[0] == 'note_off' or (opus_event[0] == 'note_on' and opus_event[4] == 0): # 4.8 cha = opus_event[2] pitch = opus_event[3] key = cha*128 + pitch if chapitch2note_on_events.get(key): new_event = chapitch2note_on_events[key].pop(0) new_event[2] = ticks_so_far - new_event[1] score_track.append(new_event) elif pitch > 127: pass #_warn('opus2score: note_off with no note_on, bad pitch='+str(pitch)) else: pass #_warn('opus2score: note_off with no note_on cha='+str(cha)+' pitch='+str(pitch)) elif opus_event[0] == 'note_on': cha = opus_event[2] pitch = opus_event[3] key = cha*128 + pitch new_event = ['note',ticks_so_far,0,cha,pitch, opus_event[4]] if chapitch2note_on_events.get(key): chapitch2note_on_events[key].append(new_event) else: chapitch2note_on_events[key] = [new_event,] else: opus_event[1] = ticks_so_far score_track.append(opus_event) # check for unterminated notes (Oisín) -- 5.2 for chapitch in chapitch2note_on_events: note_on_events = chapitch2note_on_events[chapitch] for new_e in note_on_events: new_e[2] = ticks_so_far - new_e[1] score_track.append(new_e) pass #_warn("opus2score: note_on with no note_off cha="+str(new_e[3])+' pitch='+str(new_e[4])+'; adding note_off at end') score.append(score_track) _clean_up_warnings() return score def midi2score(midi=b''): r''' Translates MIDI into a "score", using midi2opus() then opus2score() ''' return opus2score(midi2opus(midi)) def midi2ms_score(midi=b''): r''' Translates MIDI into a "score" with one beat per second and one tick per millisecond, using midi2opus() then to_millisecs() then opus2score() ''' return opus2score(to_millisecs(midi2opus(midi))) #------------------------ Other Transformations --------------------- def to_millisecs(old_opus=None, desired_time_in_ms=1): r'''Recallibrates all the times in an "opus" to use one beat per second and one tick per millisecond. This makes it hard to retrieve any information about beats or barlines, but it does make it easy to mix different scores together. ''' if old_opus == None: return [1000 * desired_time_in_ms,[],] try: old_tpq = int(old_opus[0]) except IndexError: # 5.0 _warn('to_millisecs: the opus '+str(type(old_opus))+' has no elements') return [1000 * desired_time_in_ms,[],] new_opus = [1000 * desired_time_in_ms,] # 6.7 first go through building a table of set_tempos by absolute-tick ticks2tempo = {} itrack = 1 while itrack < len(old_opus): ticks_so_far = 0 for old_event in old_opus[itrack]: if old_event[0] == 'note': raise TypeError('to_millisecs needs an opus, not a score') ticks_so_far += old_event[1] if old_event[0] == 'set_tempo': ticks2tempo[ticks_so_far] = old_event[2] itrack += 1 # then get the sorted-array of their keys tempo_ticks = [] # list of keys for k in ticks2tempo.keys(): tempo_ticks.append(k) tempo_ticks.sort() # then go through converting to millisec, testing if the next # set_tempo lies before the next track-event, and using it if so. itrack = 1 while itrack < len(old_opus): ms_per_old_tick = 400 / old_tpq # float: will round later 6.3 i_tempo_ticks = 0 ticks_so_far = 0 ms_so_far = 0.0 previous_ms_so_far = 0.0 new_track = [['set_tempo',0,1000000 * desired_time_in_ms],] # new "crochet" is 1 sec for old_event in old_opus[itrack]: # detect if ticks2tempo has something before this event # 20160702 if ticks2tempo is at the same time, leave it event_delta_ticks = old_event[1] * desired_time_in_ms if (i_tempo_ticks < len(tempo_ticks) and tempo_ticks[i_tempo_ticks] < (ticks_so_far + old_event[1]) * desired_time_in_ms): delta_ticks = tempo_ticks[i_tempo_ticks] - ticks_so_far ms_so_far += (ms_per_old_tick * delta_ticks * desired_time_in_ms) ticks_so_far = tempo_ticks[i_tempo_ticks] ms_per_old_tick = ticks2tempo[ticks_so_far] / (1000.0*old_tpq * desired_time_in_ms) i_tempo_ticks += 1 event_delta_ticks -= delta_ticks new_event = copy.deepcopy(old_event) # now handle the new event ms_so_far += (ms_per_old_tick * old_event[1] * desired_time_in_ms) new_event[1] = round(ms_so_far - previous_ms_so_far) if old_event[0] != 'set_tempo': previous_ms_so_far = ms_so_far new_track.append(new_event) ticks_so_far += event_delta_ticks new_opus.append(new_track) itrack += 1 _clean_up_warnings() return new_opus def event2alsaseq(event=None): # 5.5 r'''Converts an event into the format needed by
<gh_stars>1-10 # Program to program a Science of Cambridge MK14 with a 7Bot # An MK14 is a very old micro-computer from what became Sinclair Research # A 7Bot is a 7 degrees of freedom robot arm which orignated here: # More information on this project is here: http://robdobson.com/2016/10/mk14-meets-7bot/ from __future__ import print_function import serial import numpy as np import time import threading import sys import tkinter # Name of the program to "send" to the MK14 (entered physically by robot arm) programToRun = "Duck Shoot" # Setup of the 7Bot position and speed in relation to the MK14 normalSpeeds = [80, 80, 80, 150, 100, 100, 100] homePositionAngles = [10, 150, 75, 83, 121, 89.64, 56] readyPositionAngles = [7, 115, 65, 83, 121, 89.64, 56] keyboardClearAngles = [7, 107, 90, 90, 118, 89.64, 56] # Distance to move between hovering over a key and pressing it # the three values are azimuth (0 means no change), shoulder position (+ve value) and # elbow position (-ve value) keyPunchDownAngleDeltas = [0, 5, -5] # Enter a sequence here to override sending the MK14 a program and instead just press keys testKeySequence = [] #testKeySequence = ["0","1","2","3","4","5","6","7","8","9","A","B","C","D","E","F","TRM","MEM","ABT","GO"] # Positions of keys on the MK14 keypad keyPositions = { "0": [12, 103-2, 102+2, 90, 115.56, 89.64, 56], "1": [7.92, 94+2, 103.52-2, 84.06, 116.1, 89.46, 56], "2": [12.6, 95, 101.52, 83.52, 116.64, 89.46, 56], "3": [18.2, 95, 102, 90, 114.3, 89.46, 56], "4": [7.2, 89, 101-0.5, 81.0, 117.9, 89.46, 56], "5": [11.7, 87+1.5, 102-1.5, 79.92, 118.8, 89.46, 56], "6": [15.5, 86+1, 102-1, 79.92, 120.42, 89.46, 56], "7": [9, 84, 101, 90, 114, 90, 56], "8": [13, 81, 100, 90, 121.86, 89.46, 56], "9": [16.8, 80+.5, 100-.5, 90, 122.22, 89.64, 57], "A": [24, 77-1, 92+5.5, 82.98, 124.2, 89.64, 56], "B": [27.72, 77-2.5, 95+1.5, 86.94, 127.44, 89.64, 56], "C": [30+1.5, 75-4, 95+1, 87.48, 126.18, 89.46, 56], "D": [25.56, 86-3.5, 98+2.5, 87.48, 122.04, 89.28, 56], "E": [28+1.5, 84-4, 98+2.5, 87.48, 121.5, 89.64, 56], "F": [33, 81.0-3.5, 98+1.5, 87.84, 121.14, 89.64, 56], "ABT": [27, 88, 103.34, 90, 117.9, 89.64, 56], "TRM": [30.5, 86-1, 103, 90, 117.9, 89.64, 56], "MEM": [28.62, 94, 105-1, 90.0, 117.72, 89.46, 56], "GO": [33, 92, 105.14, 90, 115.74, 89.46, 56], } # Programs to be sent to the MK14 programs = { "Duck Shoot": { "execAddr": "0F12", "hexLines": [ ":180F1200C40D35C40031C401C8F4C410C8F1C400C8EEC40801C0E71EB2", ":180F2A00C8E49404C4619002C400C9808F01C0D89C0EC180E4FF980811", ":160F4200C8CEC0CAE480C8C64003FC0194D6B8BF98C8C40790CEDD" ] }, "Moon Landing": { "execAddr": "0F52", "hexLines": [ ":180F14000850009980009998000258003EC8E3C40135C8DFC40B31C877", ":180F2C00DBC0D702D40F01C180CF01C4008F04C0C91C1C1C1C010603EA", ":180F440094EDC400CF01C0BB35C0B93190CEC40F35C41431C40F36C4EA", ":180F5C002032C40CCAE4C10BCDFFBAE49CF8C40C37C4FF33C401CAE473", ":180F7400C5069404C5049032C402CAE302C5FFE902C900BAE39CF6C19A", ":180F8C00029402C499EDFFC900BAE494E3C50CAAE303C5FFF9FEC900A9", ":180FA40008BAE394F50694029004C400C9FFC1FF03EC94C9FDC499ECF9", ":180FBC0000C9FCC1003EC1F9940AC49903F9FA03EC009002C1FA3EC173", ":180FD400F73EC7FFC5F63EC40ACAE4C7FF940AE4DF9A31BAE49CF492E3", ":0A0FEC0049C109980333C90992496D" ] } } # Servo info NUM_SERVOS = 7 isAllConverge = False measuredForces = [0] * NUM_SERVOS measuredRotationDegs = [0] * NUM_SERVOS # Abort flag globalAbortFlag = False # Read data from 7bot - this is done in a separate thread and global variables are altered as the means # of communication between the thread and the main program - ugly ! def botPortRead(ser): global isAllConverge, measuredRotationDegs, measuredForces, NUM_SERVOS global serialIsClosing rxBuf = [0] * (NUM_SERVOS * 2 + 1) beginFlag = False instruction = 0 cnt = 0 while True: # Handle closing down if serialIsClosing or not ser.isOpen(): break # Get a char if there is one val = ser.read(1) if len(val) == 0: continue # print("Rx", "%02X " % ord(val)) if not beginFlag: beginFlag = (ord(val) == 0xFE) if not beginFlag: if (ord(val) < 0x20 or ord(val) > 0x7e) and ord(val) != 0x0d and ord(val) != 0x0a: print("<%02X>" % ord(val)) sys.stdout.flush() else: print(val.decode("utf-8"), end="") sys.stdout.flush() instruction = 0 cnt = 0 elif instruction == 0: instruction = ord(val) - 240 elif instruction == 6: forceStatus = ord(val) print("<== ForceStatus", forceStatus) beginFlag = False instruction = 0 cnt = 0 elif instruction == 9: rxBuf[cnt] = ord(val) cnt += 1 if cnt >= NUM_SERVOS * 2 + 1: beginFlag = False instruction = 0 cnt = 0 for i in range(NUM_SERVOS): posCode = rxBuf[i*2] * 128 + rxBuf[i*2+1] measuredForces[i] = posCode % 16384 / 1024 if posCode / 16384 > 0: measuredForces[i] = -measuredForces[i] # Convert 0-1000 code to 0-180 deg measuredRotationDegs[i] = (posCode % 1024) * 9 / 50 isAllConverge = (rxBuf[(NUM_SERVOS-1)*2+2] == 1) # print("Forces:", measuredForces, ",Angles:", measuredRotationDegs, isAllConverge) else: beginFlag = False # Utility functions def appendTwoByteVal(buf, val): buf.append((int(val) // 128) & 0x7F) buf.append(int(val) & 0x7F) def appendVecToSend(buf, vec): for el in vec: val = int(abs(el)) + (0 if el >= 0 else 1024) appendTwoByteVal(buf, val) # Called while waiting for the robot arm to reach its destination # Also allows the TKINTER UI to have some time to operate def waitAndFlush(timeInSecs): for tii in range(int(timeInSecs * 1000)): sys.stdout.flush() masterTk.update_idletasks() masterTk.update() time.sleep(0.001) # Limit value between two thresholds def constrain(val, valMin, valMax): if val < valMin: return valMin if val > valMax: return valMax return val # Set Servo angles def setServoAngles(servoAngles): global isAllConverge isAllConverge = False # 1- Process Data sendData = bytearray([0xFE, 0xF9]) for servoAngle in servoAngles: val = servoAngle*50//9 appendTwoByteVal(sendData, val) # 2- Send Data botPort.write(sendData) # set motor force status: 0-forceless, 1-normal servo, 2-protection def setForceStatus(status): data = bytearray([0xFE, 0xF5, status]) botPort.write(data) # get servo angles def getForceStatus(): data = bytearray([0xFE, 0xF6, 0x00]) botPort.write(data) # set motion fluency & speeds (0~250 ---> 0~25) def setSpeed(fluentEnables, speeds): # 1- Process Data sendData = bytearray([0xFE, 0xF7]) servoIdx = 0 for speed in speeds: sendData.append(constrain(speed, 0, 250)//10) if fluentEnables[servoIdx]: sendData[len(sendData)-1] += 64 servoIdx += 1 # 2- Send Data # Byte 1 (Beginning Flag) 0xFE # Byte 2 (Instruction Type) 0xF7 # Byte 3 (motor 0 data) # Byte 4 (motor 1 data) # Byte 5 (motor 2 data) # Byte 6 (motor 3 data) # Byte 7 (motor 4 data) # Byte 8 (motor 5 data) # Byte 9 (motor 6 data) # For each of bytes 3..9 # bit 6: 0-disable fluency, 1-enable fluency; # bit 5~0: speed value(range:0~25, 10 means 100 degrees per second) botPort.write(sendData) # IK6(6 angles) # j6:mm(-500~500), vec:(-1.0~1.0)--->(-500~500), theta:Degrees def setIK6(j6, vec56, vec67, theta6): global isAllConverge isAllConverge = False # 1- Process Data j6_c = np.array([constrain(j6[0], -500, 500), constrain(j6[1], -500, 500), constrain(j6[2], -500, 500)]) vec56_c = np.copy(vec56) vec56_c /= np.linalg.norm(vec56_c) vec56_c *= 500 vec67_c = np.copy(vec67) vec67_c /= np.linalg.norm(vec67_c) vec67_c *= 500 sendData = bytearray([0xFE, 0xFA]) appendVecToSend(sendData, j6_c) appendVecToSend(sendData, vec56_c) appendVecToSend(sendData, vec67_c) appendTwoByteVal(sendData, int((theta6*50/9))) # 2- Send Data # for dat in sendData: # print("%02X " % dat, end = "") botPort.write(sendData) # Move to a specific azimuth - the 7Bot standard firmware doesn't seem to do this in one go even though it # can tell that the arm has not reached the desired position - not sure why this is but this is a fix which # iterates towards the correct point by requesting positions greater or lesser than actually required until # the arm gets near enough to the desired point def moveToAzimuth(anglesDown): azimAngles = keyboardClearAngles[:] azimAngles[0] = anglesDown[0] implAngles = azimAngles[:] for i in range(5): setServoAngles(implAngles) while not isAllConverge and not globalAbortFlag: waitAndFlush(0.1) waitAndFlush(0.1) if globalAbortFlag: break angleErrs = calcAngleError(azimAngles) print("Azimuth attempt", i) dispAngleError(azimAngles) if abs(angleErrs[0]) < 1: break implAngles[0] += 1 if (angleErrs[0] > 0) else -1 return implAngles[0] # Send the robot arm to predefined locations def goToHome(): setServoAngles(homePositionAngles) while not isAllConverge and not globalAbortFlag: waitAndFlush(0.1) waitAndFlush(0.1) def goToReady(): setServoAngles(readyPositionAngles) while not isAllConverge and not globalAbortFlag: waitAndFlush(0.1) waitAndFlush(0.1) def punchDownOnKey(armAngles, tryAdjustments): # Check for abort if globalAbortFlag: return print(" hovering ", formatAngles(armAngles), "TryAdjust", tryAdjustments) # Initially go to a hover position above the key acceptedErrorDegs = [1, 1, 1, 1, 1] anglesToTry = armAngles[:] for i in range(len(keyPunchDownAngleDeltas)): anglesToTry[i] += keyPunchDownAngleDeltas[i] # Try several adjustments to get where we want to be setServoAngles(anglesToTry) while not isAllConverge and not globalAbortFlag: waitAndFlush(0.1) waitAndFlush(0.1) if globalAbortFlag: return print(" punchDown ") setServoAngles(armAngles) while not isAllConverge and not globalAbortFlag: waitAndFlush(0.1) waitAndFlush(0.1) if globalAbortFlag: return dispAngleError(armAngles) print(" pullUp ") setServoAngles(anglesToTry) while not isAllConverge and not globalAbortFlag: waitAndFlush(0.1) waitAndFlush(0.1) if globalAbortFlag: return # Press a single key def pressKey(key): print("pressKey", key, "...................") # Get the key position anglesDown = keyPositions[key] okAzimuth = moveToAzimuth(anglesDown) keyAngles = anglesDown[:] keyAngles[0] = okAzimuth punchDownOnKey(keyAngles, False) # Send a sequence of keys (in a list) def sendKeySequence(keys): for key in keys: if globalAbortFlag: return # Press the key pressKey(key) # Set address on MK14 def setAddress(addr, forExec=False): print("Setting address
<reponame>CrankySupertoon01/Toontown-2 # File: D (Python 2.4) from direct.distributed.DistributedNodeAI import DistributedNodeAI from direct.distributed.ClockDelta import * from direct.fsm import ClassicFSM, State from direct.fsm import State from direct.fsm import StateData from direct.distributed.ClockDelta import * from direct.interval.IntervalGlobal import * class DistributedFindFourAI(DistributedNodeAI): def __init__(self, air, parent, name, x, y, z, h, p, r): DistributedNodeAI.__init__(self, air) self.name = name self.air = air self.setPos(x, y, z) self.setHpr(h, p, r) self.myPos = (x, y, z) self.myHpr = (h, p, r) self.board = [ [ 0, 0, 0, 0, 0, 0, 0], [ 0, 0, 0, 0, 0, 0, 0], [ 0, 0, 0, 0, 0, 0, 0], [ 0, 0, 0, 0, 0, 0, 0], [ 0, 0, 0, 0, 0, 0, 0], [ 0, 0, 0, 0, 0, 0, 0]] self.parent = self.air.doId2do[parent] self.parentDo = parent self.wantStart = [] self.playersPlaying = [] self.playersSitting = 0 self.playersTurn = 1 self.movesMade = 0 self.playerNum = 1 self.winDirection = None self.playersGamePos = [ None, None] self.wantTimer = True self.timerEnd = 0 self.turnEnd = 0 self.playersObserving = [] self.winLaffPoints = 20 self.movesRequiredToWin = 10 self.zoneId = self.air.allocateZone() self.generateOtpObject(air.districtId, self.zoneId, optionalFields = [ 'setX', 'setY', 'setZ', 'setH', 'setP', 'setR']) self.parent.setCheckersZoneId(self.zoneId) self.timerStart = None self.fsm = ClassicFSM.ClassicFSM('Checkers', [ State.State('waitingToBegin', self.enterWaitingToBegin, self.exitWaitingToBegin, [ 'playing']), State.State('playing', self.enterPlaying, self.exitPlaying, [ 'gameOver']), State.State('gameOver', self.enterGameOver, self.exitGameOver, [ 'waitingToBegin'])], 'waitingToBegin', 'waitingToBegin') self.fsm.enterInitialState() def announceGenerate(self): self.parent.setGameDoId(self.doId) def getTableDoId(self): return self.parentDo def delete(self): self.fsm.requestFinalState() self.parent = None self.parentDo = None del self.board del self.fsm DistributedNodeAI.delete(self) def informGameOfPlayer(self): self.playersSitting += 1 if self.playersSitting < 2: self.timerEnd = 0 elif self.playersSitting == 2: self.timerEnd = globalClock.getRealTime() + 20 self.parent.isAccepting = False self.parent.sendUpdate('setIsPlaying', [ 1]) elif self.playersSitting > 2: pass self.sendUpdate('setTimer', [ globalClockDelta.localToNetworkTime(self.timerEnd)]) def informGameOfPlayerLeave(self): self.playersSitting -= 1 if self.playersSitting < 2 and self.fsm.getCurrentState().getName() == 'waitingToBegin': self.timerEnd = 0 self.parent.isAccepting = True self.parent.sendUpdate('setIsPlaying', [ 0]) if self.playersSitting > 2 and self.fsm.getCurrentState().getName() == 'waitingToBegin': pass 1 self.timerEnd = 0 if self.timerEnd != 0: self.sendUpdate('setTimer', [ globalClockDelta.localToNetworkTime(self.timerEnd)]) else: self.sendUpdate('setTimer', [ 0]) def setGameCountdownTime(self): self.timerEnd = globalClock.getRealTime() + 10 def setTurnCountdownTime(self): self.turnEnd = globalClock.getRealTime() + 25 def getTimer(self): if self.timerEnd != 0: return 0 else: return 0 def getTurnTimer(self): return globalClockDelta.localToNetworkTime(self.turnEnd) def requestTimer(self): avId = self.air.getAvatarIdFromSender() self.sendUpdateToAvatarId(avId, 'setTimer', [ globalClockDelta.localToNetworkTime(self.timerEnd)]) def handlePlayerExit(self, avId): if avId in self.wantStart: self.wantStart.remove(avId) if self.fsm.getCurrentState().getName() == 'playing': gamePos = self.playersGamePos.index(avId) self.playersGamePos[gamePos] = None self.fsm.request('gameOver') def handleEmptyGame(self): self.movesMade = 0 self.playersPlaying = [] self.playersTurn = 1 self.playerNum = 1 self.fsm.request('waitingToBegin') self.parent.isAccepting = True def requestWin(self, pieceNum): avId = self.air.getAvatarIdFromSender() playerNum = self.playersGamePos.index(avId) + 1 x = pieceNum[0] y = pieceNum[1] if self.checkWin(x, y, playerNum) == True: self.sendUpdate('announceWinnerPosition', [ x, y, self.winDirection, playerNum]) winnersSequence = Sequence(Wait(5.0), Func(self.fsm.request, 'gameOver'), Func(self.parent.announceWinner, 'Find Four', avId)) winnersSequence.start() else: self.sendUpdateToAvatarId(avId, 'illegalMove', []) def distributeLaffPoints(self): for x in self.parent.seats: if x != None: av = self.air.doId2do.get(x) av.toonUp(self.winLaffPoints) continue def enterWaitingToBegin(self): self.setGameCountdownTime() self.parent.isAccepting = True def exitWaitingToBegin(self): self.turnEnd = 0 def enterPlaying(self): self.parent.isAccepting = False for x in self.playersGamePos: if x != None: self.playersTurn = self.playersGamePos.index(x) self.d_sendTurn(self.playersTurn + 1) break continue self.setTurnCountdownTime() self.sendUpdate('setTurnTimer', [ globalClockDelta.localToNetworkTime(self.turnEnd)]) def exitPlaying(self): pass def enterGameOver(self): self.timerEnd = 0 isAccepting = True self.parent.handleGameOver() self.playersObserving = [] self.playersTurn = 1 self.playerNum = 1 self.playersPlaying = [] self.movesMade = 0 self.playersGamePos = [ None, None] self.parent.isAccepting = True self.fsm.request('waitingToBegin') def exitGameOver(self): pass def requestBegin(self): avId = self.air.getAvatarIdFromSender() if avId not in self.wantStart: self.wantStart.append(avId) numPlayers = 0 for x in self.parent.seats: if x != None: numPlayers = numPlayers + 1 continue if len(self.wantStart) == numPlayers and numPlayers >= 2: self.d_gameStart(avId) self.parent.sendIsPlaying() def d_gameStart(self, avId): for x in self.playersObserving: self.sendUpdateToAvatarId(x, 'gameStart', [ 255]) zz = 0 numPlayers = 0 for x in self.parent.seats: if x != None: numPlayers += 1 self.playersPlaying.append(x) continue if numPlayers == 2: player1 = self.playersPlaying[0] self.sendUpdateToAvatarId(player1, 'gameStart', [ 1]) self.playersGamePos[0] = player1 player2 = self.playersPlaying[1] self.sendUpdateToAvatarId(player2, 'gameStart', [ 2]) self.playersGamePos[1] = player2 self.wantStart = [] self.fsm.request('playing') self.parent.getTableState() def d_sendTurn(self, playersTurn): self.sendUpdate('sendTurn', [ playersTurn]) def advancePlayerTurn(self): if self.playersTurn == 0: self.playersTurn = 1 self.playerNum = 2 else: self.playerNum = 1 self.playersTurn = 0 def requestMove(self, moveColumn): avId = self.air.getAvatarIdFromSender() turn = self.playersTurn if avId in self.playersGamePos: if self.playersGamePos.index(avId) != self.playersTurn: pass if self.board[0][moveColumn] != 0: self.sendUpdateToAvatarId(avId, 'illegalMove', []) for x in xrange(6): if self.board[x][moveColumn] == 0: movePos = x continue self.board[movePos][moveColumn] = self.playersTurn + 1 if self.checkForTie() == True: self.sendUpdate('setGameState', [ self.board, moveColumn, movePos, turn]) self.sendUpdate('tie', []) winnersSequence = Sequence(Wait(8.0), Func(self.fsm.request, 'gameOver')) winnersSequence.start() return None self.movesMade += 1 self.advancePlayerTurn() self.setTurnCountdownTime() self.sendUpdate('setTurnTimer', [ globalClockDelta.localToNetworkTime(self.turnEnd)]) self.d_sendTurn(self.playersTurn + 1) self.sendUpdate('setGameState', [ self.board, moveColumn, movePos, turn]) def checkForTie(self): for x in xrange(7): if self.board[0][x] == 0: return False continue return True def getState(self): return self.fsm.getCurrentState().getName() def getName(self): return self.name def getGameState(self): return [ self.board, 0, 0, 0] def clearBoard(self): for x in self.board.squareList: x.setState(0) def getPosHpr(self): return self.posHpr def tempSetBoardState(self): self.board = [ [ 0, 0, 0, 0, 0, 0, 0], [ 1, 2, 1, 2, 2, 2, 1], [ 2, 2, 1, 2, 1, 2, 1], [ 2, 1, 1, 2, 2, 1, 2], [ 1, 2, 2, 1, 2, 1, 1], [ 1, 2, 1, 2, 1, 2, 1]] self.sendUpdate('setGameState', [ self.board, 0, 0, 1]) def checkWin(self, rVal, cVal, playerNum): if self.checkHorizontal(rVal, cVal, playerNum) == True: self.winDirection = 0 return True elif self.checkVertical(rVal, cVal, playerNum) == True: self.winDirection = 1 return True elif self.checkDiagonal(rVal, cVal, playerNum) == True: self.winDirection = 2 return True else: self.winDirection = None return False def checkHorizontal(self, rVal, cVal, playerNum): if cVal == 3: for x in xrange(1, 4): if self.board[rVal][cVal - x] != playerNum: break if self.board[rVal][cVal - x] == playerNum and x == 3: return True continue for x in xrange(1, 4): if self.board[rVal][cVal + x] != playerNum: break if self.board[rVal][cVal + x] == playerNum and x == 3: return True continue return False elif cVal == 2: for x in xrange(1, 4): if self.board[rVal][cVal + x] != playerNum: break if self.board[rVal][cVal + x] == playerNum and x == 3: return True continue return False elif cVal == 4: for x in xrange(1, 4): if self.board[rVal][cVal - x] != playerNum: break if self.board[rVal][cVal - x] == playerNum and x == 3: return True continue return False else: return False def checkVertical(self, rVal, cVal, playerNum): if rVal == 2: for x in xrange(1, 4): if self.board[rVal + x][cVal] != playerNum: break if self.board[rVal + x][cVal] == playerNum and x == 3: return True continue return False elif rVal == 3: for x in xrange(1, 4): if self.board[rVal - x][cVal] != playerNum: break if self.board[rVal - x][cVal] == playerNum and x == 3: return True continue return False else: return False def checkDiagonal(self, rVal, cVal, playerNum): if cVal <= 2: if rVal == 2: for x in xrange(1, 4): if self.board[rVal + x][cVal + x] != playerNum: break if self.board[rVal + x][cVal + x] == playerNum and x == 3: return True continue return False elif rVal == 3: for x in xrange(1, 4): if self.board[rVal - x][cVal + x] != playerNum: break if self.board[rVal - x][cVal + x] == playerNum and x == 3: return True continue return False elif cVal >= 4: if rVal == 2: for x in xrange(1, 4): if self.board[rVal + x][cVal - x] != playerNum: break if self.board[rVal + x][cVal - x] == playerNum and x == 3: return True continue return False elif rVal == 3: for x in xrange(1, 4): if self.board[rVal - x][cVal - x] != playerNum: break if self.board[rVal - x][cVal - x] == playerNum and x == 3: return True continue return False elif rVal == 3 and rVal == 4 or rVal == 5: for x in xrange(1, 4): if self.board[rVal - x][cVal - x] != playerNum: break if self.board[rVal - x][cVal - x] == playerNum and x == 3: return True continue for x in xrange(1, 4): if self.board[rVal + x][cVal - x] != playerNum: break if self.board[rVal + x][cVal - x] == playerNum and x == 3: return True continue return
<reponame>MosHumanoid/bitbots_thmos_meta<gh_stars>0 #!/usr/bin/env python3 import cv2 import rospy import tf2_ros import numpy as np import sensor_msgs.point_cloud2 as pc2 from cv_bridge import CvBridge from sensor_msgs.msg import Image, CameraInfo, PointCloud2 from geometry_msgs.msg import Point, PolygonStamped from tf2_geometry_msgs import PointStamped from tf2_sensor_msgs.tf2_sensor_msgs import do_transform_cloud from humanoid_league_msgs.msg import LineInformationInImage, LineInformationRelative, \ LineSegmentRelative, LineIntersectionRelative, \ ObstacleInImageArray, ObstacleRelativeArray, ObstacleRelative, \ PoseWithCertainty, PoseWithCertaintyArray, GoalPostInImageArray, BallInImageArray class Transformer(object): def __init__(self): rospy.init_node("humanoid_league_transformer") self._tf_buffer = tf2_ros.Buffer(cache_time=rospy.Duration(10.0)) self._tf_listener = tf2_ros.TransformListener(self._tf_buffer) self._cv_bridge = CvBridge() # Parameters self._ball_height = rospy.get_param("~ball/ball_radius", 0.075) self._bar_height = rospy.get_param("~goalposts/bar_height", 2.0) self._publish_frame = rospy.get_param("~publish_frame", "base_footprint") self._base_footprint_frame = rospy.get_param("~base_footprint_frame", "base_footprint") self._goalpost_footpoint_out_of_image_threshold = \ rospy.get_param("~goalposts/footpoint_out_of_image_threshold", 30) camera_info_topic = rospy.get_param("~camera_info/camera_info_topic", "camera/camera_info") ball_in_image_array_topic = rospy.get_param("~ball/ball_topic", "balls_in_image") lines_in_image_topic = rospy.get_param("~lines/lines_topic", "line_in_image") goalposts_in_image_topic = rospy.get_param("~goalposts/goalposts_topic", "goalposts_in_image") obstacles_in_image_topic = rospy.get_param("~obstacles/obstacles_topic", "obstacles_in_image") field_boundary_in_image_topic = rospy.get_param("~field_boundary/field_boundary_topic", "field_boundary_in_image") line_mask_in_image_topic = rospy.get_param("~masks/line_mask/topic", "line_mask_in_image") line_mask_scaling = rospy.get_param("~masks/line_mask/scale", 1.0) publish_lines_as_lines_relative = rospy.get_param("~lines/lines_relative", True) publish_lines_as_pointcloud = rospy.get_param("~lines/pointcloud", False) self._camera_info = None rospy.Subscriber(camera_info_topic, CameraInfo, self._callback_camera_info, queue_size=1) # Wait for Camera info cam_info_counter = 0 while self._camera_info is None: rospy.sleep(0.1) cam_info_counter += 1 if cam_info_counter > 100: rospy.logerr_throttle(5, rospy.get_name() + ": Camera Info not received on topic '" + camera_info_topic + "'") if rospy.is_shutdown(): return # Wait up to 5 seconds for transforms to become available, then print an error and try again # rospy.Time(0) gets the most recent transform while not self._tf_buffer.can_transform(self._publish_frame, self._camera_info.header.frame_id, rospy.Time(0), timeout=rospy.Duration(5)): rospy.logerr(rospy.get_name() + ": Could not get transformation from " + self._publish_frame + "to " + self._camera_info.header.frame_id) # Also check if we can transform from optical frame to base_footprint while not self._tf_buffer.can_transform(self._base_footprint_frame, self._camera_info.header.frame_id, rospy.Time(0), timeout=rospy.Duration(5)): rospy.logerr(rospy.get_name() + ": Could not get transformation from " + self._base_footprint_frame + " to " + self._camera_info.header.frame_id) # Publishers TODO make topics configurable self._balls_relative_pub = rospy.Publisher("balls_relative", PoseWithCertaintyArray, queue_size=1) if publish_lines_as_lines_relative: self._line_relative_pub = rospy.Publisher("line_relative", LineInformationRelative, queue_size=1) if publish_lines_as_pointcloud: self._line_relative_pc_pub = rospy.Publisher("line_relative_pc", PointCloud2, queue_size=1) self._line_mask_relative_pc_pub = rospy.Publisher("line_mask_relative_pc", PointCloud2, queue_size=1) self._goalposts_relative = rospy.Publisher("goal_posts_relative", PoseWithCertaintyArray, queue_size=1) self._obstacle_relative_pub = rospy.Publisher("obstacles_relative", ObstacleRelativeArray, queue_size=1) self._field_boundary_pub = rospy.Publisher("field_boundary_relative", PolygonStamped, queue_size=1) # Subscribers rospy.Subscriber(ball_in_image_array_topic, BallInImageArray, self._callback_ball, queue_size=1) if publish_lines_as_lines_relative: rospy.Subscriber(lines_in_image_topic, LineInformationInImage, self._callback_lines, queue_size=1) if publish_lines_as_pointcloud: rospy.Subscriber(lines_in_image_topic, LineInformationInImage, self._callback_lines_pc, queue_size=1) rospy.Subscriber(goalposts_in_image_topic, GoalPostInImageArray, self._callback_goalposts, queue_size=1) rospy.Subscriber(obstacles_in_image_topic, ObstacleInImageArray, self._callback_obstacles, queue_size=1) rospy.Subscriber(field_boundary_in_image_topic, PolygonStamped, self._callback_field_boundary, queue_size=1) rospy.Subscriber(line_mask_in_image_topic, Image, lambda msg: self._callback_masks( msg, self._line_mask_relative_pc_pub, scale=line_mask_scaling), queue_size=1) rospy.spin() def _callback_camera_info(self, camera_info): if camera_info.K[0] == 0: rospy.logerr_throttle(5.0, rospy.get_name() + ": Invalid CameraInfo received. Check your camera settings.") self._camera_info = camera_info def _callback_ball(self, msg): field = self.get_plane(msg.header.stamp, self._ball_height) if field is None: return balls = [] for ball in msg.candidates: transformed_ball = self._transform_point(ball.center, field, msg.header.stamp) if transformed_ball is not None: ball_relative = PoseWithCertainty() ball_relative.pose.pose.position = transformed_ball ball_relative.confidence = ball.confidence balls.append(ball_relative) balls_relative = PoseWithCertaintyArray() balls_relative.header.stamp = msg.header.stamp balls_relative.header.frame_id = self._publish_frame balls_relative.poses = balls self._balls_relative_pub.publish(balls_relative) def _callback_lines(self, msg): field = self.get_plane(msg.header.stamp, 0.0) if field is None: return line = LineInformationRelative() line.header.stamp = msg.header.stamp line.header.frame_id = self._publish_frame for seg in msg.segments: rel_seg = LineSegmentRelative() rel_seg.pose.position.start = self._transform_point(seg.start, field, msg.header.stamp) rel_seg.pose.position.end = self._transform_point(seg.end, field, msg.header.stamp) rel_seg.confidence = seg.confidence # only proceed if all transformations were successful if rel_seg.start is not None and rel_seg.end is not None: line.segments.append(rel_seg) for intersection in msg.intersections: rel_inter = LineIntersectionRelative() rel_inter_pos = self._transform_point(intersection.point, field, msg.header.stamp) if rel_inter_pos is not None: rel_inter.type = intersection.type rel_inter.pose.confidence = intersection.confidence rel_inter.pose.pose.pose.position = rel_inter_pos line.intersections.append(rel_inter) if line.segments or line.intersections: self._line_relative_pub.publish(line) else: rospy.logwarn_throttle(5.0, rospy.get_name() + ": Could not transform any segments or intersections" + " in LineInformationInImage message.") def _callback_lines_pc(self, msg): field = self.get_plane(msg.header.stamp, 0) if field is None: return points = np.zeros((len(msg.segments), 3)) num_transformed_correctly = 0 for i in range(len(msg.segments)): transformed = self._transform_point(msg.segments[i].start, field, msg.header.stamp) if transformed is not None: points[i] = np.array([transformed.x, transformed.y, transformed.z]) num_transformed_correctly += 1 if num_transformed_correctly == 0: rospy.logwarn_throttle(5.0, rospy.get_name() + ": No line points could be transformed") pc_header = msg.header pc_header.frame_id = self._publish_frame self._line_relative_pc_pub.publish(pc2.create_cloud_xyz32(pc_header, points[:num_transformed_correctly])) def _callback_goalposts(self, msg: GoalPostInImageArray): field = self.get_plane(msg.header.stamp, 0.0) if field is None: return bar_plane = self.get_plane(msg.header.stamp, self._bar_height) if bar_plane is None: return # Create new message goalposts_relative_msg = PoseWithCertaintyArray() goalposts_relative_msg.header.stamp = msg.header.stamp goalposts_relative_msg.header.frame_id = self._publish_frame # Transform goal posts for goal_post_in_image in msg.posts: # Check if footpoint is not in the bottom area of the image, to filter out goal posts without visible footpoint image_vertical_resolution = self._camera_info.height / max(self._camera_info.binning_y, 1) if goal_post_in_image.foot_point.y < image_vertical_resolution - self._goalpost_footpoint_out_of_image_threshold: # Transform footpoint relative_foot_point = self._transform_point(goal_post_in_image.foot_point, field, msg.header.stamp) if relative_foot_point is None: rospy.logwarn_throttle(5.0, rospy.get_name() + ": Got a post with foot point ({},{}) I could not transform.".format( goal_post_in_image.foot_point.x, goal_post_in_image.foot_point.y)) else: post_relative = PoseWithCertainty() post_relative.pose.pose.position = relative_foot_point post_relative.confidence = goal_post_in_image.confidence goalposts_relative_msg.poses.append(post_relative) self._goalposts_relative.publish(goalposts_relative_msg) def _callback_obstacles(self, msg: ObstacleInImageArray): field = self.get_plane(msg.header.stamp, 0.0) if field is None: return obstacles = ObstacleRelativeArray() obstacles.header = msg.header obstacles.header.frame_id = self._publish_frame for o in msg.obstacles: obstacle = ObstacleRelative() obstacle.playerNumber = o.playerNumber obstacle.pose.confidence = o.confidence obstacle.type = o.type point = Point() point.x = o.top_left.x + o.width/2 point.y = o.top_left.y + o.height position = self._transform_point(point, field, msg.header.stamp) if position is not None: obstacle.pose.pose.pose.position = position obstacles.obstacles.append(obstacle) else: rospy.logwarn_throttle(5.0, rospy.get_name() + ": Got an obstacle I could not transform") self._obstacle_relative_pub.publish(obstacles) def _callback_field_boundary(self, msg): field = self.get_plane(msg.header.stamp, 0.0) if field is None: return field_boundary = PolygonStamped() field_boundary.header = msg.header field_boundary.header.frame_id = self._publish_frame for p in msg.polygon.points: p_relative = self._transform_point(p, field, msg.header.stamp) if p_relative is not None: field_boundary.polygon.points.append(p_relative) else: rospy.logwarn_throttle(5.0, rospy.get_name() + ": At least one point of the Field Boundary could not be transformed," + " dropping message") return self._field_boundary_pub.publish(field_boundary) def _callback_masks(self, msg: Image, publisher: rospy.Publisher, encoding='8UC1', scale: float = 1.0): """ Projects a mask from the input image as a pointcloud on the field plane. """ # Get field plane field = self.get_plane(msg.header.stamp, 0.0) if field is None: return # Convert subsampled image image = cv2.resize( self._cv_bridge.imgmsg_to_cv2(msg, encoding), (0,0), fx=scale, fy=scale, interpolation=cv2.INTER_NEAREST) # Get indices for all non 0 pixels (the pixels which should be displayed in the pointcloud) point_idx_tuple = np.where(image != 0) # Restructure index tuple to a array point_idx_array = np.empty((point_idx_tuple[0].shape[0], 3)) point_idx_array[:, 0] = point_idx_tuple[1] point_idx_array[:, 1] = point_idx_tuple[0] # Project the pixels onto the field plane points_on_plane_from_cam = self._get_field_intersection_for_pixels( point_idx_array, field, scale=scale) # Make a pointcloud2 out of them pc_in_image_frame = pc2.create_cloud_xyz32(msg.header, points_on_plane_from_cam) # Lookup the transform from the camera to the field plane try: trans = self._tf_buffer.lookup_transform( self._publish_frame, self._camera_info.header.frame_id, msg.header.stamp) except tf2_ros.LookupException as ex: rospy.logwarn_throttle(5.0, rospy.get_name() + ": " + str(ex)) return except tf2_ros.ExtrapolationException as ex: rospy.logwarn_throttle(5.0, rospy.get_name() + ": " + str(ex)) return # Transform the whole point cloud accordingly pc_relative = do_transform_cloud(pc_in_image_frame, trans) # Publish point cloud publisher.publish(pc_relative) def get_plane(self, stamp, object_height): """ returns a plane which an object is believed to be on as a tuple of a point on this plane and a normal""" base_frame = self._base_footprint_frame field_normal = PointStamped() field_normal.header.frame_id = base_frame field_normal.header.stamp = stamp field_normal.point.x = 0.0 field_normal.point.y = 0.0 field_normal.point.z = 1.0 try: field_normal = self._tf_buffer.transform(field_normal, self._camera_info.header.frame_id, timeout=rospy.Duration(0.2)) except tf2_ros.LookupException as ex: rospy.logwarn_throttle(5.0, rospy.get_name() + ": " + str(ex)) return None except tf2_ros.ExtrapolationException as ex: rospy.logwarn_throttle(5.0, rospy.get_name() + ": " + str(ex)) return None field_point = PointStamped() field_point.header.frame_id = base_frame field_point.header.stamp = stamp field_point.point.x = 0.0 field_point.point.y = 0.0 field_point.point.z = object_height try: field_point = self._tf_buffer.transform(field_point, self._camera_info.header.frame_id) except tf2_ros.LookupException as ex: rospy.logwarn_throttle(5.0, rospy.get_name() + ": " + str(ex)) return None except tf2_ros.ExtrapolationException as ex: rospy.logwarn_throttle(5.0, rospy.get_name() + ": " + str(ex)) return None field_normal = np.array([field_normal.point.x, field_normal.point.y, field_normal.point.z]) field_point = np.array([field_point.point.x, field_point.point.y, field_point.point.z]) # field normal is a vector! so it stats at field point and goes up in z direction field_normal = field_point - field_normal return field_normal, field_point def _get_field_intersection_for_pixels(self, points, field, scale=1.0): """ Projects an numpy array of points to the correspoding places on the field plane (in the camera frame). """ camera_projection_matrix = self._camera_info.K binning_x = max(self._camera_info.binning_x, 1) / scale binning_y = max(self._camera_info.binning_y, 1) / scale points[:, 0] = (points[:, 0] - (camera_projection_matrix[2] / binning_x)) / (camera_projection_matrix[0] / binning_x) points[:, 1] = (points[:, 1] - (camera_projection_matrix[5] / binning_y)) / (camera_projection_matrix[4] / binning_y) points[:, 2] = 1 intersections = self._line_plane_intersections(field[0], field[1], points) return intersections def _transform_point(self, point: Point, field, stamp) -> Point: np_point = self._get_field_intersection_for_pixels(np.array([[point.x, point.y, point.z]]), field)[0] if np.isnan(np_point).any(): return None intersection_stamped = PointStamped() intersection_stamped.point.x = np_point[0] intersection_stamped.point.y = np_point[1] intersection_stamped.point.z
<filename>lightautoml/transformers/text.py """Text features transformers.""" import gc import os import pickle from copy import deepcopy, copy from typing import Optional, Union, List, Dict, Any import gensim import numpy as np import pandas as pd import torch from log_calls import record_history from sklearn.feature_extraction.text import TfidfVectorizer from sklearn.linear_model import SGDRegressor, SGDClassifier from .base import LAMLTransformer from ..dataset.base import LAMLDataset from ..dataset.np_pd_dataset import PandasDataset, NumpyDataset, CSRSparseDataset from ..dataset.roles import NumericRole, TextRole from ..text.dl_transformers import RandomLSTM, BOREP, BertEmbedder, DLTransformer from ..text.embed_dataset import EmbedDataset, BertDataset from ..text.tokenizer import BaseTokenizer, SimpleEnTokenizer from ..text.utils import get_textarr_hash from ..text.weighted_average_transformer import WeightedAverageTransformer from ..utils.logging import get_logger logger = get_logger(__name__) NumpyOrPandas = Union[NumpyDataset, PandasDataset] NumpyOrSparse = Union[NumpyDataset, CSRSparseDataset] model_by_name = {'random_lstm': {'model': RandomLSTM, 'model_params': {'embed_size': 300, 'hidden_size': 256, 'pooling': 'mean', 'num_layers': 1}, 'dataset': EmbedDataset, 'dataset_params': {'embedding_model': None, 'max_length': 200, 'embed_size': 300}, 'loader_params': {'batch_size': 1024, 'shuffle': False, 'num_workers': 4}, 'embedding_model_params': {} }, 'random_lstm_bert': {'model': RandomLSTM, 'model_params': {'embed_size': 768, 'hidden_size': 256, 'pooling': 'mean', 'num_layers': 1}, 'dataset': BertDataset, 'dataset_params': {'max_length': 256, 'model_name': 'bert-base-cased'}, 'loader_params': {'batch_size': 320, 'shuffle': False, 'num_workers': 4}, 'embedding_model': BertEmbedder, 'embedding_model_params': {'model_name': 'bert-base-cased', 'pooling': 'none'} }, 'borep': {'model': BOREP, 'model_params': {'embed_size': 300, 'proj_size': 300, 'pooling': 'mean', 'max_length': 200, 'init': 'orthogonal', 'pos_encoding': False}, 'dataset': EmbedDataset, 'dataset_params': {'embedding_model': None, 'max_length': 200, 'embed_size': 300}, 'loader_params': {'batch_size': 1024, 'shuffle': False, 'num_workers': 4}, 'embedding_model_params': {} }, 'pooled_bert': {'model': BertEmbedder, 'model_params': {'model_name': 'bert-base-cased', 'pooling': 'mean'}, 'dataset': BertDataset, 'dataset_params': {'max_length': 256, 'model_name': 'bert-base-cased'}, 'loader_params': {'batch_size': 320, 'shuffle': False, 'num_workers': 4}, 'embedding_model_params': {} }, 'wat': {'embedding_model': None, 'embed_size': 300, 'weight_type': 'idf', 'use_svd': True} } @record_history(enabled=False) def oof_task_check(dataset: LAMLDataset): """Check if task is binary or regression. Args: dataset: Dataset to check. """ task = dataset.task assert task.name in ['binary', 'reg'], 'Only binary and regression tasks supported in this transformer' @record_history(enabled=False) def text_check(dataset: LAMLDataset): """Check if all passed vars are text. Args: dataset: LAMLDataset to check. Raises: AssertionError: If non-text features are present. """ roles = dataset.roles features = dataset.features for f in features: assert roles[f].name == 'Text', 'Only text accepted in this transformer' # TODO: combine TunableTransformer with LAMLTransformer class? @record_history(enabled=False) class TunableTransformer(LAMLTransformer): """Base class for ML transformers. Assume that parameters my set before training. """ _default_params: dict = {} _params: dict = None @property def params(self) -> dict: """Parameters. Returns: Dict. """ if self._params is None: self._params = copy(self.default_params) return self._params @params.setter def params(self, new_params: dict): assert isinstance(new_params, dict) self._params = {**self.params, **new_params} def init_params_on_input(self, dataset: NumpyOrPandas) -> dict: """Init params depending on input data. Returns: Dict with model hyperparameters. """ return self.params def __init__(self, default_params: Optional[dict] = None, freeze_defaults: bool = True): """ Args: default_params: algo hyperparams. freeze_defaults: - ``True`` : params may be rewritten depending on dataset. - ``False``: params may be changed only manually or with tuning. """ self.task = None self.freeze_defaults = freeze_defaults if default_params is None: default_params = {} self.default_params = {**self._default_params, **default_params} @record_history(enabled=False) class TfidfTextTransformer(TunableTransformer): """Simple Tfidf vectorizer.""" _fit_checks = (text_check,) _transform_checks = () _fname_prefix = 'tfidf' _default_params = {'min_df': 5, 'max_df': 1.0, 'max_features': 30_000, 'ngram_range': (1, 1), 'analyzer': 'word', 'dtype': np.float32} @property def features(self) -> List[str]: """Features list.""" return self._features def __init__(self, default_params: Optional[dict] = None, freeze_defaults: bool = True, subs: Optional[int] = None, random_state: int = 42): """ Args: default_params: algo hyperparams. freeze_defaults: Flag. subs: Subsample to calculate freqs. If ``None`` - full data. random_state: Random state to take subsample. Note: The behaviour of `freeze_defaults`: - ``True`` : params may be rewritten depending on dataset. - ``False``: params may be changed only manually or with tuning. """ super().__init__(default_params, freeze_defaults) self.subs = subs self.random_state = random_state self.vect = TfidfVectorizer self.dicts = {} def init_params_on_input(self, dataset: NumpyOrPandas) -> dict: """Get transformer parameters depending on dataset parameters. Args: dataset: Dataset used for model parmaeters initialization. Returns: Parameters of model. """ # TODO: use features_num suggested_params = copy(self.default_params) if self.freeze_defaults: # if user change defaults manually - keep it return suggested_params rows_num = len(dataset.data) if rows_num > 50_000: suggested_params['min_df'] = 25 return suggested_params def fit(self, dataset: NumpyOrPandas): """Fit tfidf vectorizer. Args: dataset: Pandas or Numpy dataset of text features. Returns: self. """ # set transformer names and add checks for check_func in self._fit_checks: check_func(dataset) # set transformer features # convert to accepted dtype and get attributes if self._params is None: self.params = self.init_params_on_input(dataset) dataset = dataset.to_pandas() df = dataset.data # fit ... if self.subs is not None and df.shape[0] >= self.subs: subs = df.sample(n=self.subs, random_state=self.random_state) else: subs = df feats = [] for n, i in enumerate(subs.columns): vect = self.vect(**self.params) vect.fit(subs[i].fillna('').astype(str)) features = list( np.char.array([self._fname_prefix + '_']) + np.arange(len(vect.vocabulary_)).astype(str) + np.char.array( ['__' + i])) self.dicts[i] = {'vect': vect, 'feats': features} feats.extend(features) self._features = feats return self def transform(self, dataset: NumpyOrPandas) -> CSRSparseDataset: """Transform text dataset to sparse tfidf representation. Args: dataset: Pandas or Numpy dataset of text features. Returns: Sparse dataset with encoded text. """ # checks here super().transform(dataset) # convert to accepted dtype and get attributes dataset = dataset.to_pandas() df = dataset.data # transform roles = NumericRole() outputs = [] for n, i in enumerate(df.columns): new_arr = self.dicts[i]['vect'].transform(df[i].fillna('').astype(str)) output = dataset.empty().to_numpy().to_csr() output.set_data(new_arr, self.dicts[i]['feats'], roles) outputs.append(output) # create resulted return dataset.empty().to_numpy().to_csr().concat(outputs) @record_history(enabled=False) class TokenizerTransformer(LAMLTransformer): """Simple tokenizer transformer.""" _fit_checks = (text_check,) _transform_checks = () _fname_prefix = 'tokenized' def __init__(self, tokenizer: BaseTokenizer = SimpleEnTokenizer()): """ Args: tokenizer: text tokenizer. """ self.tokenizer = tokenizer def transform(self, dataset: NumpyOrPandas) -> PandasDataset: """Transform text dataset to tokenized text dataset. Args: dataset: Pandas or Numpy dataset of text features. Returns: Pandas dataset with tokenized text. """ # checks here super().transform(dataset) # convert to accepted dtype and get attributes dataset = dataset.to_pandas() df = dataset.data # transform roles = TextRole() outputs = [] for n, i in enumerate(df.columns): pred = np.array(self.tokenizer.tokenize(df[i].fillna('').astype(str).tolist())) new_df = pd.DataFrame(pred, columns=[self._fname_prefix + '__' + i]) outputs.append(new_df) # create resulted output = dataset.empty().to_pandas() output.set_data(pd.concat(outputs, axis=1), None, {feat: roles for feat in self.features}) return output @record_history(enabled=False) class OneToOneTransformer(TunableTransformer): """Out-of-fold sgd model prediction to reduce dimension of encoded text data.""" _fit_checks = (oof_task_check,) _transform_checks = () _fname_prefix = 'sgd_oof' _default_params = {'alpha': 0.0001, 'max_iter': 1, 'loss': 'log'} @property def features(self) -> List[str]: """Features list.""" return self._features def init_params_on_input(self, dataset: NumpyOrPandas) -> dict: """Get model parameters depending on dataset parameters. Args: dataset: NumpyOrPandas. Returns: Parameters of model. """ # TODO: use features_num suggested_params = copy(self.default_params) self.task = dataset.task.name if self.task != 'binary': suggested_params['loss'] = 'squared_loss' algo = SGDRegressor else: algo = SGDClassifier self.algo = algo return suggested_params def __init__(self, default_params: Optional[int] = None, freeze_defaults: bool = False): super().__init__(default_params, freeze_defaults) """ Args: default_params: Algo hyperparams. freeze_defaults: - ``True`` : params may be rewritten depending on dataset. - ``False``: params may be changed only manually or with tuning. subs: Subsample to calculate freqs. If None - full data. """ def fit(self, dataset: NumpyOrPandas): """Apply fit transform. Args: dataset: Pandas or Numpy dataset of encoded text features. """ for check_func in self._fit_checks: check_func(dataset) self.fit(dataset) for check_func in self._transform_checks: check_func(dataset) return self.transform(dataset) def fit_transform(self, dataset: NumpyOrPandas) -> NumpyDataset: """Fit and predict out-of-fold sgd model. Args: dataset: Pandas or Numpy dataset of encoded text features. Returns: Numpy dataset with out-of-fold model prediction. """ # set transformer names and add checks for check_func in self._fit_checks: check_func(dataset) if self._params is None: self.params = self.init_params_on_input(dataset) dataset = dataset.to_numpy() data = dataset.data target = dataset.target.astype(np.int32) folds = dataset.folds n_folds = folds.max() + 1 self.models = [] oof_feats = np.zeros(len(data), dtype=np.float32) for n in range(n_folds): algo = self.algo(**self.params) algo.fit(data[folds != n], target[folds != n]) if self.task == 'binary': pred = algo.predict_proba(data[folds == n])[:, 1] else: pred = algo.predict(data[folds == n]) oof_feats[folds == n] = pred self.models.append(deepcopy(algo)) orig_name = dataset.features[0].split('__')[-1] self._features = [self._fname_prefix + '__' + orig_name] output = dataset.empty() self.output_role = NumericRole(np.float32, prob=output.task.name == 'binary') output.set_data(oof_feats[:, np.newaxis], self.features, self.output_role) return output def transform(self, dataset: NumpyOrPandas) -> NumpyDataset: """Transform dataset to out-of-fold model-based encoding. Args: dataset: Pandas or Numpy dataset of encoded text features. Returns: Numpy dataset with out-of-fold model prediction. """ # checks here super().transform(dataset) # convert to accepted dtype and get attributes dataset = dataset.to_numpy() data = dataset.data # transform out = np.zeros(len(data), dtype=np.float32) for n, model in enumerate(self.models): if self.task == 'binary': pred = model.predict_proba(data)[:, 1] else: pred = model.predict(data) out
"people") def test_no_empty_strings(self): input_chunks = ["soylent", "green", "is", "people"] si = utils.Spliterator(input_chunks) outputs = (list(si.take(7)) # starts and ends on chunk boundary + list(si.take(2)) # spans two chunks + list(si.take(3)) # begins but does not end chunk + list(si.take(2)) # ends but does not begin chunk + list(si.take(6))) # whole chunk + EOF self.assertNotIn('', outputs) def test_running_out(self): input_chunks = ["not much"] si = utils.Spliterator(input_chunks) self.assertEqual(''.join(si.take(4)), "not ") self.assertEqual(''.join(si.take(99)), "much") # short self.assertEqual(''.join(si.take(4)), "") self.assertEqual(''.join(si.take(4)), "") def test_overlap(self): input_chunks = ["one fish", "two fish", "red fish", "blue fish"] si = utils.Spliterator(input_chunks) t1 = si.take(20) # longer than first chunk self.assertLess(len(next(t1)), 20) # it's not exhausted t2 = si.take(20) self.assertRaises(ValueError, next, t2) def test_closing(self): input_chunks = ["abcd", "efg", "hij"] si = utils.Spliterator(input_chunks) it = si.take(3) # shorter than first chunk self.assertEqual(next(it), 'abc') it.close() self.assertEqual(list(si.take(20)), ['d', 'efg', 'hij']) si = utils.Spliterator(input_chunks) self.assertEqual(list(si.take(1)), ['a']) it = si.take(1) # still shorter than first chunk self.assertEqual(next(it), 'b') it.close() self.assertEqual(list(si.take(20)), ['cd', 'efg', 'hij']) si = utils.Spliterator(input_chunks) it = si.take(6) # longer than first chunk, shorter than first + second self.assertEqual(next(it), 'abcd') self.assertEqual(next(it), 'ef') it.close() self.assertEqual(list(si.take(20)), ['g', 'hij']) si = utils.Spliterator(input_chunks) self.assertEqual(list(si.take(2)), ['ab']) it = si.take(3) # longer than rest of chunk self.assertEqual(next(it), 'cd') it.close() self.assertEqual(list(si.take(20)), ['efg', 'hij']) class TestParseContentRange(unittest.TestCase): def test_good(self): start, end, total = utils.parse_content_range("bytes 100-200/300") self.assertEqual(start, 100) self.assertEqual(end, 200) self.assertEqual(total, 300) def test_bad(self): self.assertRaises(ValueError, utils.parse_content_range, "100-300/500") self.assertRaises(ValueError, utils.parse_content_range, "bytes 100-200/aardvark") self.assertRaises(ValueError, utils.parse_content_range, "bytes bulbous-bouffant/4994801") class TestParseContentDisposition(unittest.TestCase): def test_basic_content_type(self): name, attrs = utils.parse_content_disposition('text/plain') self.assertEqual(name, 'text/plain') self.assertEqual(attrs, {}) def test_content_type_with_charset(self): name, attrs = utils.parse_content_disposition( 'text/plain; charset=UTF8') self.assertEqual(name, 'text/plain') self.assertEqual(attrs, {'charset': 'UTF8'}) def test_content_disposition(self): name, attrs = utils.parse_content_disposition( 'form-data; name="somefile"; filename="test.html"') self.assertEqual(name, 'form-data') self.assertEqual(attrs, {'name': 'somefile', 'filename': 'test.html'}) def test_content_disposition_without_white_space(self): name, attrs = utils.parse_content_disposition( 'form-data;name="somefile";filename="test.html"') self.assertEqual(name, 'form-data') self.assertEqual(attrs, {'name': 'somefile', 'filename': 'test.html'}) class TestIterMultipartMimeDocuments(unittest.TestCase): def test_bad_start(self): it = utils.iter_multipart_mime_documents(BytesIO(b'blah'), b'unique') exc = None try: next(it) except MimeInvalid as err: exc = err self.assertTrue('invalid starting boundary' in str(exc)) self.assertTrue('--unique' in str(exc)) def test_empty(self): it = utils.iter_multipart_mime_documents(BytesIO(b'--unique'), b'unique') fp = next(it) self.assertEqual(fp.read(), b'') self.assertRaises(StopIteration, next, it) def test_basic(self): it = utils.iter_multipart_mime_documents( BytesIO(b'--unique\r\nabcdefg\r\n--unique--'), b'unique') fp = next(it) self.assertEqual(fp.read(), b'abcdefg') self.assertRaises(StopIteration, next, it) def test_basic2(self): it = utils.iter_multipart_mime_documents( BytesIO(b'--unique\r\nabcdefg\r\n--unique\r\nhijkl\r\n--unique--'), b'unique') fp = next(it) self.assertEqual(fp.read(), b'abcdefg') fp = next(it) self.assertEqual(fp.read(), b'hijkl') self.assertRaises(StopIteration, next, it) def test_tiny_reads(self): it = utils.iter_multipart_mime_documents( BytesIO(b'--unique\r\nabcdefg\r\n--unique\r\nhijkl\r\n--unique--'), b'unique') fp = next(it) self.assertEqual(fp.read(2), b'ab') self.assertEqual(fp.read(2), b'cd') self.assertEqual(fp.read(2), b'ef') self.assertEqual(fp.read(2), b'g') self.assertEqual(fp.read(2), b'') fp = next(it) self.assertEqual(fp.read(), b'hijkl') self.assertRaises(StopIteration, next, it) def test_big_reads(self): it = utils.iter_multipart_mime_documents( BytesIO(b'--unique\r\nabcdefg\r\n--unique\r\nhijkl\r\n--unique--'), b'unique') fp = next(it) self.assertEqual(fp.read(65536), b'abcdefg') self.assertEqual(fp.read(), b'') fp = next(it) self.assertEqual(fp.read(), b'hijkl') self.assertRaises(StopIteration, next, it) def test_leading_crlfs(self): it = utils.iter_multipart_mime_documents( BytesIO(b'\r\n\r\n\r\n--unique\r\nabcdefg\r\n' b'--unique\r\nhijkl\r\n--unique--'), b'unique') fp = next(it) self.assertEqual(fp.read(65536), b'abcdefg') self.assertEqual(fp.read(), b'') fp = next(it) self.assertEqual(fp.read(), b'hijkl') self.assertRaises(StopIteration, next, it) def test_broken_mid_stream(self): # We go ahead and accept whatever is sent instead of rejecting the # whole request, in case the partial form is still useful. it = utils.iter_multipart_mime_documents( BytesIO(b'--unique\r\nabc'), b'unique') fp = next(it) self.assertEqual(fp.read(), b'abc') self.assertRaises(StopIteration, next, it) def test_readline(self): it = utils.iter_multipart_mime_documents( BytesIO(b'--unique\r\nab\r\ncd\ref\ng\r\n--unique\r\nhi\r\n\r\n' b'jkl\r\n\r\n--unique--'), b'unique') fp = next(it) self.assertEqual(fp.readline(), b'ab\r\n') self.assertEqual(fp.readline(), b'cd\ref\ng') self.assertEqual(fp.readline(), b'') fp = next(it) self.assertEqual(fp.readline(), b'hi\r\n') self.assertEqual(fp.readline(), b'\r\n') self.assertEqual(fp.readline(), b'jkl\r\n') self.assertRaises(StopIteration, next, it) def test_readline_with_tiny_chunks(self): it = utils.iter_multipart_mime_documents( BytesIO(b'--unique\r\nab\r\ncd\ref\ng\r\n--unique\r\nhi\r\n' b'\r\njkl\r\n\r\n--unique--'), b'unique', read_chunk_size=2) fp = next(it) self.assertEqual(fp.readline(), b'ab\r\n') self.assertEqual(fp.readline(), b'cd\ref\ng') self.assertEqual(fp.readline(), b'') fp = next(it) self.assertEqual(fp.readline(), b'hi\r\n') self.assertEqual(fp.readline(), b'\r\n') self.assertEqual(fp.readline(), b'jkl\r\n') self.assertRaises(StopIteration, next, it) class TestParseMimeHeaders(unittest.TestCase): def test_parse_mime_headers(self): doc_file = BytesIO(b"""Content-Disposition: form-data; name="file_size" Foo: Bar NOT-title-cAsED: quux Connexion: =?iso8859-1?q?r=E9initialis=E9e_par_l=27homologue?= Status: =?utf-8?b?5byA5aeL6YCa6L+H5a+56LGh5aSN5Yi2?= Latin-1: Resincronizaci\xf3n realizada con \xe9xito Utf-8: \xd0\xba\xd0\xbe\xd0\xbd\xd1\x82\xd0\xb5\xd0\xb9\xd0\xbd\xd0\xb5\xd1\x80 This is the body """) headers = utils.parse_mime_headers(doc_file) utf8 = u'\u043a\u043e\u043d\u0442\u0435\u0439\u043d\u0435\u0440' if six.PY2: utf8 = utf8.encode('utf-8') expected_headers = { 'Content-Disposition': 'form-data; name="file_size"', 'Foo': "Bar", 'Not-Title-Cased': "quux", # Encoded-word or non-ASCII values are treated just like any other # bytestring (at least for now) 'Connexion': "=?iso8859-1?q?r=E9initialis=E9e_par_l=27homologue?=", 'Status': "=?utf-8?b?5byA5aeL6YCa6L+H5a+56LGh5aSN5Yi2?=", 'Latin-1': "Resincronizaci\xf3n realizada con \xe9xito", 'Utf-8': utf8, } self.assertEqual(expected_headers, headers) self.assertEqual(b"This is the body\n", doc_file.read()) class FakeResponse(object): def __init__(self, status, headers, body): self.status = status self.headers = HeaderKeyDict(headers) self.body = StringIO(body) def getheader(self, header_name): return str(self.headers.get(header_name, '')) def getheaders(self): return self.headers.items() def read(self, length=None): return self.body.read(length) def readline(self, length=None): return self.body.readline(length) class TestDocumentItersToHTTPResponseBody(unittest.TestCase): def test_no_parts(self): body = utils.document_iters_to_http_response_body( iter([]), 'dontcare', multipart=False, logger=FakeLogger()) self.assertEqual(body, '') def test_single_part(self): body = "time flies like an arrow; fruit flies like a banana" doc_iters = [{'part_iter': iter(StringIO(body).read, '')}] resp_body = ''.join( utils.document_iters_to_http_response_body( iter(doc_iters), 'dontcare', multipart=False, logger=FakeLogger())) self.assertEqual(resp_body, body) def test_multiple_parts(self): part1 = "two peanuts were walking down a railroad track" part2 = "and one was a salted. ... peanut." doc_iters = [{ 'start_byte': 88, 'end_byte': 133, 'content_type': 'application/peanut', 'entity_length': 1024, 'part_iter': iter(StringIO(part1).read, ''), }, { 'start_byte': 500, 'end_byte': 532, 'content_type': 'application/salted', 'entity_length': 1024, 'part_iter': iter(StringIO(part2).read, ''), }] resp_body = ''.join( utils.document_iters_to_http_response_body( iter(doc_iters), 'boundaryboundary', multipart=True, logger=FakeLogger())) self.assertEqual(resp_body, ( "--boundaryboundary\r\n" + # This is a little too strict; we don't actually care that the # headers are in this order, but the test is much more legible # this way. "Content-Type: application/peanut\r\n" + "Content-Range: bytes 88-133/1024\r\n" + "\r\n" + part1 + "\r\n" + "--boundaryboundary\r\n" "Content-Type: application/salted\r\n" + "Content-Range: bytes 500-532/1024\r\n" + "\r\n" + part2 + "\r\n" + "--boundaryboundary--")) def test_closed_part_iterator(self): print('test') useful_iter_mock = mock.MagicMock() useful_iter_mock.__iter__.return_value = [''] body_iter = utils.document_iters_to_http_response_body( iter([{'part_iter': useful_iter_mock}]), 'dontcare', multipart=False, logger=FakeLogger()) body = '' for s in body_iter: body += s self.assertEqual(body, '') useful_iter_mock.close.assert_called_once_with() # Calling "close" on the mock will now raise an AttributeError del useful_iter_mock.close body_iter = utils.document_iters_to_http_response_body( iter([{'part_iter': useful_iter_mock}]), 'dontcare', multipart=False, logger=FakeLogger()) body = '' for s in body_iter: body += s class TestPairs(unittest.TestCase): def test_pairs(self): items = [10, 20, 30, 40, 50, 60] got_pairs = set(utils.pairs(items)) self.assertEqual(got_pairs, set([(10, 20), (10, 30), (10, 40), (10, 50), (10, 60), (20, 30), (20, 40), (20, 50), (20, 60), (30, 40), (30, 50), (30, 60), (40, 50), (40, 60), (50, 60)])) class TestSocketStringParser(unittest.TestCase): def test_socket_string_parser(self): default = 1337 addrs = [('1.2.3.4', '1.2.3.4', default), ('1.2.3.4:5000', '1.2.3.4', 5000), ('[dead:beef::1]', 'fd00:a516:7c1b:17cd:6d81:2137:bd2a:2c5b', default), ('[dead:fdf8:f53e:61e4::18]:5000', 'fd00:a516:7c1b:17cd:6d81:2137:bd2a:2c5b', 5000), ('example.com', 'example.com', default), ('example.com:5000', 'example.com', 5000), ('foo.1-2-3.bar.com:5000', 'foo.1-2-3.bar.com', 5000), ('1.2.3.4:10:20', None, None), ('fd00:a516:7c1b:17cd:6d81:2137:bd2a:2c5b:5000', None, None)] for addr, expected_host, expected_port in addrs: if expected_host: host, port = utils.parse_socket_string(addr, default) self.assertEqual(expected_host, host) self.assertEqual(expected_port, int(port)) else: with self.assertRaises(ValueError): utils.parse_socket_string(addr, default) class TestHashForFileFunction(unittest.TestCase): def setUp(self): self.tempfilename = tempfile.mktemp() def tearDown(self): try: os.unlink(self.tempfilename) except OSError: pass def test_hash_for_file_smallish(self): stub_data = b'some data' with open(self.tempfilename, 'wb') as fd: fd.write(stub_data) with mock.patch('swift.common.utils.md5') as mock_md5: mock_hasher = mock_md5.return_value rv = utils.md5_hash_for_file(self.tempfilename) self.assertTrue(mock_hasher.hexdigest.called) self.assertEqual(rv, mock_hasher.hexdigest.return_value) self.assertEqual([mock.call(stub_data)], mock_hasher.update.call_args_list) def test_hash_for_file_big(self): num_blocks = 10 block_size = utils.MD5_BLOCK_READ_BYTES truncate = 523 start_char = ord('a') expected_blocks = [chr(i).encode('utf8') * block_size for i in range(start_char, start_char + num_blocks)] full_data = b''.join(expected_blocks) trimmed_data = full_data[:-truncate] # sanity self.assertEqual(len(trimmed_data), block_size * num_blocks - truncate) with open(self.tempfilename, 'wb') as fd: fd.write(trimmed_data) with mock.patch('swift.common.utils.md5') as mock_md5: mock_hasher = mock_md5.return_value rv = utils.md5_hash_for_file(self.tempfilename) self.assertTrue(mock_hasher.hexdigest.called) self.assertEqual(rv, mock_hasher.hexdigest.return_value) self.assertEqual(num_blocks, len(mock_hasher.update.call_args_list)) found_blocks = [] for i, (expected_block, call) in enumerate(zip( expected_blocks, mock_hasher.update.call_args_list)): args, kwargs = call self.assertEqual(kwargs, {}) self.assertEqual(1, len(args)) block = args[0] if i < num_blocks - 1: self.assertEqual(block, expected_block) else: self.assertEqual(block, expected_block[:-truncate]) found_blocks.append(block) self.assertEqual(b''.join(found_blocks), trimmed_data) def test_hash_for_file_empty(self): with open(self.tempfilename, 'wb'): pass with mock.patch('swift.common.utils.md5') as mock_md5: mock_hasher = mock_md5.return_value rv = utils.md5_hash_for_file(self.tempfilename) self.assertTrue(mock_hasher.hexdigest.called) self.assertIs(rv, mock_hasher.hexdigest.return_value) self.assertEqual([], mock_hasher.update.call_args_list) def test_hash_for_file_brittle(self): data_to_expected_hash = { b'': 'd41d8cd98f00b204e9800998ecf8427e', b'some data': '1e50210a0202497fb79bc38b6ade6c34', (b'a' * 4096 * 10)[:-523]: '06a41551609656c85f14f659055dc6d3', } # unlike some other places where the concrete implementation really # matters for backwards compatibility these brittle tests are probably # not needed or justified, if a future maintainer rips them out later # they're probably doing the right thing failures = [] for stub_data, expected_hash in data_to_expected_hash.items(): with open(self.tempfilename, 'wb') as fd: fd.write(stub_data) rv = utils.md5_hash_for_file(self.tempfilename) try: self.assertEqual(expected_hash, rv) except AssertionError: trim_cap = 80 if len(stub_data) > trim_cap: stub_data = '%s...<truncated>' % stub_data[:trim_cap] failures.append('hash for %r was %s instead of expected %s' % ( stub_data, rv, expected_hash)) if failures: self.fail('Some data did not compute expected hash:\n' + '\n'.join(failures)) class TestSetSwiftDir(unittest.TestCase): def setUp(self): self.swift_dir = tempfile.mkdtemp() self.swift_conf = os.path.join(self.swift_dir, 'swift.conf') self.policy_name = ''.join(random.sample(string.ascii_letters, 20)) with open(self.swift_conf, "wt") as sc: sc.write(''' [swift-hash] swift_hash_path_suffix = changeme [storage-policy:0] name = default default = yes [storage-policy:1] name = %s ''' % self.policy_name) def tearDown(self): shutil.rmtree(self.swift_dir, ignore_errors=True) def test_set_swift_dir(self): set_swift_dir(None) reload_storage_policies() self.assertIsNone(POLICIES.get_by_name(self.policy_name)) set_swift_dir(self.swift_dir) reload_storage_policies() self.assertIsNotNone(POLICIES.get_by_name(self.policy_name)) class TestPipeMutex(unittest.TestCase):
<reponame>pagabuc/FirmAE<gh_stars>1-10 #!/usr/bin/env python3 import sys import getopt import re import struct import socket import stat import os import time import subprocess debug = 0 SCRATCHDIR = '' SCRIPTDIR = '' QEMUCMDTEMPLATE = """#!/bin/bash set -e set -u ARCHEND=%(ARCHEND)s IID=%(IID)i if [ -e ./firmae.config ]; then source ./firmae.config elif [ -e ../firmae.config ]; then source ../firmae.config elif [ -e ../../firmae.config ]; then source ../../firmae.config else echo "Error: Could not find 'firmae.config'!" exit 1 fi RUN_MODE=`basename ${0}` IMAGE=`get_fs ${IID}` if (echo ${ARCHEND} | grep -q "mips" && echo ${RUN_MODE} | grep -q "debug"); then KERNEL=`get_kernel ${ARCHEND} true` else KERNEL=`get_kernel ${ARCHEND} false` fi if (echo ${RUN_MODE} | grep -q "analyze"); then QEMU_DEBUG="user_debug=31 firmadyne.syscall=32" else QEMU_DEBUG="user_debug=0 firmadyne.syscall=1" fi QEMU=`get_qemu ${ARCHEND}` QEMU_MACHINE=`get_qemu_machine ${ARCHEND}` QEMU_ROOTFS=`get_qemu_disk ${ARCHEND}` WORK_DIR=`get_scratch ${IID}` DEVICE=`add_partition "${WORK_DIR}/image.raw"` mount ${DEVICE} ${WORK_DIR}/image > /dev/null echo "%(NETWORK_TYPE)s" > ${WORK_DIR}/image/firmadyne/network_type echo "%(NET_BRIDGE)s" > ${WORK_DIR}/image/firmadyne/net_bridge echo "%(NET_INTERFACE)s" > ${WORK_DIR}/image/firmadyne/net_interface sleep 1 sync umount ${WORK_DIR}/image > /dev/null del_partition ${DEVICE:0:$((${#DEVICE}-2))} %(START_NET)s echo -n "Starting emulation of firmware... " %(QEMU_ENV_VARS)s ${QEMU} -m 1024 -M ${QEMU_MACHINE} -kernel ${KERNEL} \\ %(QEMU_DISK)s -append "root=${QEMU_ROOTFS} console=ttyS0 nandsim.parts=64,64,64,64,64,64,64,64,64,64 %(QEMU_INIT)s rw debug ignore_loglevel print-fatal-signals=1 FIRMAE_NETWORK=${FIRMAE_NETWORK} FIRMAE_NVRAM=${FIRMAE_NVRAM} FIRMAE_KERNEL=${FIRMAE_KERNEL} FIRMAE_ETC=${FIRMAE_ETC} ${QEMU_DEBUG}" \\ -serial file:${WORK_DIR}/qemu.final.serial.log \\ -serial unix:/tmp/qemu.${IID}.S1,server,nowait \\ -monitor unix:/tmp/qemu.${IID},server,nowait \\ -display none \\ %(QEMU_NETWORK)s | true %(STOP_NET)s echo "Done!" """ def mountImage(targetDir): loopFile = subprocess.check_output(['bash', '-c', 'source firmae.config && add_partition %s/image.raw' % targetDir]).decode().strip() os.system('mount %s %s/image > /dev/null' % (loopFile, targetDir)) time.sleep(1) return loopFile def umountImage(targetDir, loopFile): os.system('umount %s/image > /dev/null' % targetDir) subprocess.check_output(['bash', '-c', 'source firmae.config && del_partition %s' % loopFile.rsplit('p', 1)[0]]) def checkVariable(key): if os.environ[key] == 'true': return True else: return False def stripTimestamps(data): lines = data.split(b"\n") #throw out the timestamps prog = re.compile(b"^\[[^\]]*\] firmadyne: ") lines = [prog.sub(b"", l) for l in lines] return lines def findMacChanges(data, endianness): lines = stripTimestamps(data) candidates = filter(lambda l: l.startswith(b"ioctl_SIOCSIFHWADDR"), lines) if debug: print("Mac Changes %r" % candidates) result = [] if endianness == "eb": fmt = ">I" elif endianness == "el": fmt = "<I" prog = re.compile(b"^ioctl_SIOCSIFHWADDR\[[^\]]+\]: dev:([^ ]+) mac:0x([0-9a-f]+) 0x([0-9a-f]+)") for c in candidates: g = prog.match(c) if g: (iface, mac0, mac1) = g.groups() iface = iface.decode('utf-8') m0 = struct.pack(fmt, int(mac0, 16))[2:] m1 = struct.pack(fmt, int(mac1, 16)) mac = "%02x:%02x:%02x:%02x:%02x:%02x" % struct.unpack("BBBBBB", m0+m1) result.append((iface, mac)) return result def findPorts(data, endianness): lines = stripTimestamps(data) candidates = filter(lambda l: l.startswith(b"inet_bind"), lines) # logs for the inconfig process result = [] if endianness == "eb": fmt = ">I" elif endianness == "el": fmt = "<I" prog = re.compile(b"^inet_bind\[[^\]]+\]: proto:SOCK_(DGRAM|STREAM), ip:port: 0x([0-9a-f]+):([0-9]+)") portSet = {} for c in candidates: g = prog.match(c) if g: (proto, addr, port) = g.groups() proto = "tcp" if proto == b"STREAM" else "udp" addr = socket.inet_ntoa(struct.pack(fmt, int(addr, 16))) port = int(port.decode()) if port not in portSet: result.append((proto, addr, port)) portSet[port] = True return result # Get the netwokr interfaces in the router, except 127.0.0.1 def findNonLoInterfaces(data, endianness): lines = stripTimestamps(data) candidates = filter(lambda l: l.startswith(b"__inet_insert_ifa"), lines) # logs for the inconfig process if debug: print("Candidate ifaces: %r" % candidates) result = [] if endianness == "eb": fmt = ">I" elif endianness == "el": fmt = "<I" prog = re.compile(b"^__inet_insert_ifa\[[^\]]+\]: device:([^ ]+) ifa:0x([0-9a-f]+)") for c in candidates: g = prog.match(c) if g: (iface, addr) = g.groups() iface = iface.decode('utf-8') addr = socket.inet_ntoa(struct.pack(fmt, int(addr, 16))) if addr != "127.0.0.1" and addr != "0.0.0.0": result.append((iface, addr)) return result def findIfacesForBridge(data, brif): lines = stripTimestamps(data) result = [] candidates = filter(lambda l: l.startswith(b"br_dev_ioctl") or l.startswith(b"br_add_if"), lines) progs = [re.compile(p % brif.encode()) for p in [b"^br_dev_ioctl\[[^\]]+\]: br:%s dev:(.*)", b"^br_add_if\[[^\]]+\]: br:%s dev:(.*)"]] for c in candidates: for p in progs: g = p.match(c) if g: iface = g.group(1) iface = iface.decode('utf-8') #we only add it if the interface is not the bridge itself #there are images that call brctl addif br0 br0 (e.g., 5152) if iface != brif: result.append(iface.strip()) return result def findVlanInfoForDev(data, dev): lines = stripTimestamps(data) results = [] candidates = filter(lambda l: l.startswith(b"register_vlan_dev"), lines) prog = re.compile(b"register_vlan_dev\[[^\]]+\]: dev:%s vlan_id:([0-9]+)" % dev.encode()) for c in candidates: g = prog.match(c) if g: results.append(int(g.group(1))) return results def ifaceNo(dev): g = re.match(r"[^0-9]+([0-9]+)", dev) return int(g.group(1)) if g else -1 def isDhcpIp(ip): # normal dhcp client ip if ip.startswith("10.0.2."): return True # netgear armel R6900 series elif ip.endswith(".190"): return True return False def qemuArchNetworkConfig(i, tap_num, arch, n, isUserNetwork, ports): if arch == "arm": device = "virtio-net-device" else: device = "e1000" if not n: return "-device %(DEVICE)s,netdev=net%(I)i -netdev socket,id=net%(I)i,listen=:200%(I)i" % {'DEVICE': device, 'I': i} else: (ip, dev, vlan, mac, brif) = n vlan_id = vlan if vlan else i mac_str = "" if not mac else ",macaddr=%s" % mac if isUserNetwork: # user network dhcp server # TODO: get port list (inet_bind) # TODO: maybe need reverse ping checker #portfwd = ",hostfwd=udp::67-:67" #portfwd += ",hostfwd=udp::68-:68" # icmp port cannot foward portfwd = "hostfwd=tcp::80-:80,hostfwd=tcp::443-:443," for (proto, ip, port) in ports: if port in [80, 443]: continue portfwd += "hostfwd=%(TYPE)s::%(PORT)i-:%(PORT)i," % {"TYPE" : proto, "PORT" : port} return "-device %(DEVICE)s,netdev=net%(I)i -netdev user,id=net%(I)i,%(FWD)s" % {'DEVICE': device, 'I': i, "FWD": portfwd[:-1]} else: return "-device %(DEVICE)s,netdev=net%(I)i -netdev tap,id=net%(I)i,ifname=${TAPDEV_%(TAP_NUM)i},script=no" % { 'I' : i, 'DEVICE' : device, 'TAP_NUM' : tap_num} def qemuNetworkConfig(arch, network, isUserNetwork, ports): output = [] assigned = [] interfaceNum = 4 if arch == "arm" and checkVariable("FIRMAE_NETWORK"): interfaceNum = 1 for i in range(0, interfaceNum): for j, n in enumerate(network): # need to connect the jth emulated network interface to the corresponding host interface if i == ifaceNo(n[1]): output.append(qemuArchNetworkConfig(i, j, arch, n, isUserNetwork, ports)) assigned.append(n) break # otherwise, put placeholder socket connection if len(output) <= i: output.append(qemuArchNetworkConfig(i, i, arch, None, isUserNetwork, ports)) # find unassigned interfaces for j, n in enumerate(network[:interfaceNum]): if n not in assigned: # guess assignment print("Warning: Unmatched interface: %s" % (n,)) output[j] = qemuArchNetworkConfig(j, j, arch, n, isUserNetwork, ports) assigned.append(n) return ' '.join(output) def buildConfig(brif, iface, vlans, macs): #there should be only one ip ip = brif[1] br = brif[0] #strip vlanid from interface name (e.g., eth2.2 -> eth2) dev = iface.split(".")[0] #check whether there is a different mac set mac = None d = dict(macs) if br in d: mac = d[br] elif dev in d: mac = d[dev] vlan_id = None if len(vlans): vlan_id = vlans[0] return (ip, dev, vlan_id, mac, br) def convertToHostIp(ip): tups = [int(x) for x in ip.split(".")] if tups[3] > 1: # sometimes it can has 0 asus FW_RT_AC3100_300438432738 tups[3] -= 1 else: tups[3] += 1 return ".".join([str(x) for x in tups]) # iterating the networks def startNetwork(network): template_1 = """ TAPDEV_%(I)i=tap${IID}_%(I)i HOSTNETDEV_%(I)i=${TAPDEV_%(I)i} echo "Creating TAP device ${TAPDEV_%(I)i}..." sudo tunctl -t ${TAPDEV_%(I)i} -u ${USER} """ if checkVariable("FIRMAE_NETWORK"): template_vlan = """ echo "Initializing VLAN..." HOSTNETDEV_%(I)i=${TAPDEV_%(I)i}.%(VLANID)i sudo ip link add link ${TAPDEV_%(I)i} name ${HOSTNETDEV_%(I)i} type vlan id %(VLANID)i sudo ip link set ${TAPDEV_%(I)i} up """ template_2 = """ echo "Bringing up TAP device..." sudo ip link set ${HOSTNETDEV_%(I)i} up sudo ip addr add %(HOSTIP)s/24 dev ${HOSTNETDEV_%(I)i} """ else: template_vlan = """ echo "Initializing VLAN..." HOSTNETDEV_%(I)i=${TAPDEV_%(I)i}.%(VLANID)i sudo ip link add link ${TAPDEV_%(I)i} name ${HOSTNETDEV_%(I)i} type vlan id %(VLANID)i sudo ip link set ${HOSTNETDEV_%(I)i} up """ template_2 = """ echo "Bringing up TAP device..." sudo ip link set ${HOSTNETDEV_%(I)i} up sudo ip addr add %(HOSTIP)s/24 dev ${HOSTNETDEV_%(I)i} echo "Adding route to %(GUESTIP)s..." sudo ip route add %(GUESTIP)s via %(GUESTIP)s dev ${HOSTNETDEV_%(I)i} """ output = [] for i, (ip, dev, vlan, mac, brif) in enumerate(network): output.append(template_1 % {'I' : i}) if vlan != None: output.append(template_vlan % {'I' : i, 'VLANID' : vlan}) output.append(template_2 % {'I' : i, 'HOSTIP' : convertToHostIp(ip), 'GUESTIP': ip}) return '\n'.join(output) def stopNetwork(network): template_1 = """ echo "Bringing down TAP device..." sudo ip link set ${TAPDEV_%(I)i} down """ template_vlan = """ echo "Removing VLAN..." sudo ip link delete ${HOSTNETDEV_%(I)i} """ template_2 = """ echo "Deleting TAP device ${TAPDEV_%(I)i}..." sudo tunctl -d ${TAPDEV_%(I)i} """ output = [] for i, (ip, dev, vlan, mac, brif) in enumerate(network): output.append(template_1 % {'I' : i}) if vlan != None: output.append(template_vlan % {'I' : i}) output.append(template_2 % {'I' : i}) return '\n'.join(output) def qemuCmd(iid, network, ports, network_type, arch, endianness, qemuInitValue, isUserNetwork): network_bridge = "" network_iface = "" if arch == "mips": qemuEnvVars = "" qemuDisk = "-drive if=ide,format=raw,file=${IMAGE}" if endianness != "eb" and endianness != "el": raise Exception("You didn't specify a valid endianness") elif arch == "arm": qemuDisk = "-drive if=none,file=${IMAGE},format=raw,id=rootfs -device virtio-blk-device,drive=rootfs" if endianness == "el": qemuEnvVars = "QEMU_AUDIO_DRV=none" elif endianness == "eb": raise Exception("armeb currently not supported") else: raise Exception("You didn't specify a valid endianness") else: raise Exception("Unsupported architecture") for (ip, dev, vlan, mac, brif) in network: network_bridge =
<gh_stars>0 # # Copyright (C) 2012 - 2018 <NAME> <<EMAIL>> # License: MIT # # pylint: disable=unused-import,import-error,invalid-name r"""Public APIs of anyconfig module. .. versionadded:: 0.9.8 - Added new API load_plugins to [re-]load plugins .. versionadded:: 0.9.5 - Added pathlib support. Now all of load and dump APIs can process pathlib.Path object basically. - 'ignore_missing' keyword option for load APIs are now marked as deprecated and will be removed soon. - Allow to load data other than mapping objects for some backends such as JSON and YAML. .. versionadded:: 0.8.3 - Added ac_dict keyword option to pass dict factory (any callable like function or class) to make dict-like object in backend parsers. - Added ac_query keyword option to query data with JMESPath expression. - Added experimental query api to query data with JMESPath expression. - Removed ac_namedtuple keyword option. - Export :func:`merge`. - Stop exporting :func:`to_container` which was deprecated and removed. .. versionadded:: 0.8.2 - Added new API, version to provide version information. .. versionadded:: 0.8.0 - Removed set_loglevel API as it does not help much. - Added :func:`open` API to open files with appropriate open mode. - Added custom exception classes, :class:`UnknownProcessorTypeError` and :class:`UnknownFileTypeError` to express specific errors. - Change behavior of the API :func:`find_loader` and others to make them fail firt and raise exceptions (ValueError, UnknownProcessorTypeError or UnknownFileTypeError) as much as possible if wrong parser type for uknown file type was given. .. versionadded:: 0.5.0 - Most keyword arguments passed to APIs are now position independent. - Added ac_namedtuple parameter to \*load and \*dump APIs. .. versionchanged:: 0.3 - Replaced `forced_type` optional argument of some public APIs with `ac_parser` to allow skip of config parser search by passing parser object previously found and instantiated. Also removed some optional arguments, `ignore_missing`, `merge` and `marker`, from definitions of some public APIs as these may not be changed from default in common use cases. .. versionchanged:: 0.2 - Now APIs :func:`find_loader`, :func:`single_load`, :func:`multi_load`, :func:`load` and :func:`dump` can process a file/file-like object or a list of file/file-like objects instead of a file path or a list of file paths. .. versionadded:: 0.2 - Export factory method (create) of anyconfig.mergeabledict.MergeableDict """ from __future__ import absolute_import import os.path import warnings # Import some global constants will be re-exported: from anyconfig.globals import ( LOGGER, IOI_PATH_OBJ, UnknownProcessorTypeError, UnknownFileTypeError ) import anyconfig.query import anyconfig.globals import anyconfig.dicts import anyconfig.ioinfo import anyconfig.template import anyconfig.utils from anyconfig.dicts import ( MS_REPLACE, MS_NO_REPLACE, MS_DICTS, MS_DICTS_AND_LISTS, MERGE_STRATEGIES, get, set_, merge # flake8: noqa ) from anyconfig.backends import Parsers from anyconfig.schema import validate, gen_schema def version(): """ :return: A tuple of version info, (major, minor, release), e.g. (0, 8, 2) """ return anyconfig.globals.VERSION.split('.') def load_plugins(): """[Re-]Load pluggable parsers. """ Parsers().load_plugins() def list_types(): return Parsers().list_types() def _try_validate(cnf, schema, **options): """ :param cnf: Mapping object represents configuration data :param schema: JSON schema object :param options: Keyword options passed to :func:`~jsonschema.validate` :return: Given `cnf` as it is if validation succeeds else None """ valid = True if schema: (valid, msg) = validate(cnf, schema, **options) if msg: LOGGER.warning(msg) if valid: return cnf return None def find_loader(path, parser_or_type=None): """ Find out parser object appropriate to load configuration from a file of given path or file or file-like object. :param path: Configuration file path or file or file-like object or pathlib.Path object if it's available :param parser_or_type: Forced configuration parser type or parser object itself :return: An instance of a class inherits :class:`~anyconfig.backend.base.Parser` or None """ try: return Parsers().find(path, forced_type=parser_or_type) except (ValueError, UnknownProcessorTypeError, UnknownFileTypeError): raise def _maybe_schema(**options): """ :param options: Optional keyword arguments such as - ac_template: Assume configuration file may be a template file and try to compile it AAR if True - ac_context: Mapping object presents context to instantiate template - ac_schema: JSON schema file path to validate configuration files :return: Mapping object or None means some errors """ ac_schema = options.get("ac_schema", None) if ac_schema is not None: # Try to detect the appropriate parser to load the schema data as it # may be different from the original config file's format, perhaps. options["ac_parser"] = None options["ac_schema"] = None # Avoid infinite loop. LOGGER.info("Loading schema: %s", ac_schema) return load(ac_schema, **options) return None # pylint: disable=redefined-builtin def open(path, mode=None, ac_parser=None, **options): """ Open given configuration file with appropriate open flag. :param path: Configuration file path :param mode: Can be 'r' and 'rb' for reading (default) or 'w', 'wb' for writing. Please note that even if you specify 'r' or 'w', it will be changed to 'rb' or 'wb' if selected backend, xml and configobj for example, for given config file prefer that. :param options: Optional keyword arguments passed to the internal file opening APIs of each backends such like 'buffering' optional parameter passed to builtin 'open' function. :return: A file object or None on any errors :raises: ValueError, UnknownProcessorTypeError, UnknownFileTypeError """ psr = Parsers().find(path, forced_type=ac_parser) if mode is not None and mode.startswith('w'): return psr.wopen(path, **options) return psr.ropen(path, **options) def _single_load(input_, ac_parser=None, ac_template=False, ac_context=None, **options): """ :param input_: File path or file or file-like object or pathlib.Path object represents the file or a namedtuple `~anyconfig.globals.IOInfo` object represents some input to load some data from :param ac_parser: Forced parser type or parser object itself :param ac_template: Assume configuration file may be a template file and try to compile it AAR if True :param ac_context: A dict presents context to instantiate template :param options: Optional keyword arguments :func:`single_load` supports except for ac_schema and ac_query :return: Mapping object :raises: ValueError, UnknownProcessorTypeError, UnknownFileTypeError """ ioi = anyconfig.ioinfo.make(input_, forced_type=ac_parser) psr = Parsers().find(ioi, forced_type=ac_parser) filepath = ioi.path # .. note:: # This will be kept for backward compatibility until 'ignore_missing' # option is deprecated and removed completely. if "ignore_missing" in options: warnings.warn("keyword option 'ignore_missing' is deprecated, use " "'ac_ignore_missing' instead", DeprecationWarning) options["ac_ignore_missing"] = options["ignore_missing"] LOGGER.info("Loading: %s", filepath) if ac_template and filepath is not None: content = anyconfig.template.try_render(filepath=filepath, ctx=ac_context, **options) if content is not None: return psr.loads(content, **options) return psr.load(ioi, **options) def single_load(input_, ac_parser=None, ac_template=False, ac_context=None, **options): """ Load single configuration file. .. note:: :func:`load` is a preferable alternative and this API should be used only if there is a need to emphasize given input `input_` is single one. :param input_: File path or file or file-like object or pathlib.Path object represents the file or a namedtuple `~anyconfig.globals.IOInfo` object represents some input to load some data from :param ac_parser: Forced parser type or parser object itself :param ac_template: Assume configuration file may be a template file and try to compile it AAR if True :param ac_context: A dict presents context to instantiate template :param options: Optional keyword arguments such as: - Options common in :func:`single_load`, :func:`multi_load`, :func:`load` and :func:`loads`: - ac_dict: callable (function or class) to make mapping objects from loaded data if the selected backend can customize that such as JSON which supports that with 'object_pairs_hook' option, or None. If this option was not given or None, dict or :class:`OrderedDict` will be used to make result as mapping object depends on if ac_ordered (see below) is True and selected backend can keep the order of items loaded. See also :meth:`_container_factory` of :class:`~anyconfig.backend.base.Parser` for more implementation details. - ac_ordered: True if you want to keep resuls ordered. Please note that order of items may be lost depends on the selected backend. - ac_schema: JSON schema file path to validate given config file - ac_query: JMESPath expression to query data - Common backend options: - ac_ignore_missing: Ignore and just return empty result if given file ``input_`` does not exist actually. - Backend specific options such as {"indent": 2} for JSON backend :return: Mapping object :raises: ValueError, UnknownProcessorTypeError, UnknownFileTypeError """ cnf = _single_load(input_, ac_parser=ac_parser, ac_template=ac_template, ac_context=ac_context, **options) schema = _maybe_schema(ac_template=ac_template, ac_context=ac_context, **options) cnf = _try_validate(cnf, schema, **options) return anyconfig.query.query(cnf, **options) def multi_load(inputs, ac_parser=None, ac_template=False, ac_context=None, **options): r""" Load multiple config files. .. note:: :func:`load` is a preferable alternative and this API should be used only if there is a need to emphasize given inputs are multiple ones. The first argument `inputs` may be a list of a file paths or a glob pattern
f_result = directions.ParaclinicResult(issledovaniye=i, field=gi, value="") else: f_result = directions.ParaclinicResult.objects.filter(issledovaniye=i, field=gi)[0] if f_result.value != content: f_result.value = content f_result.save() if i.doc_save != doc or i.time_save != date or i.doc_confirmation != doc or i.time_confirmation != date: i.doc_save = doc i.time_save = date i.doc_confirmation = doc i.time_confirmation = date if i.napravleniye: i.napravleniye.qr_check_token = None i.napravleniye.save(update_fields=['qr_check_token']) i.save() if not i.napravleniye.visit_who_mark or not i.napravleniye.visit_date: i.napravleniye.visit_who_mark = doc i.napravleniye.visit_date = date i.napravleniye.save() slog.Log(key=dpk, type=13, body=json.dumps({"content": content, "doc_f": doc_f}), user=None).save() return JsonResponse({"ok": ok}) def search_template(request): result = [] q = request.GET.get('q', '') if q != '': for r in users.AssignmentTemplates.objects.filter(title__istartswith=q, global_template=False).order_by('title')[:10]: result.append({"pk": r.pk, "title": r.title, "researches": [x.research.pk for x in users.AssignmentResearches.objects.filter(template=r, research__hide=False)]}) return JsonResponse({"result": result, "q": q}) def load_templates(request): result = [] t = request.GET.get('type', '1') for r in users.AssignmentTemplates.objects.filter(global_template=t == '1').order_by('title'): result.append({"pk": r.pk, "title": r.title, "researches": [x.research.pk for x in users.AssignmentResearches.objects.filter(template=r, research__hide=False)]}) return JsonResponse({"result": result}) def get_template(request): title = '' researches = [] global_template = False pk = request.GET.get('pk') if pk: t = users.AssignmentTemplates.objects.get(pk=pk) title = t.title researches = [x.research_id for x in users.AssignmentResearches.objects.filter(template=t, research__hide=False)] global_template = t.global_template return JsonResponse({"title": title, "researches": researches, "global_template": global_template}) @login_required @group_required("Конструктор: Настройка шаблонов") def update_template(request): response = {"ok": False} request_data = json.loads(request.body) pk = request_data.get("pk", -2) if pk > -2: title = request_data.get("title").strip() researches = request_data["researches"] global_template = request_data["global_template"] if len(title) > 0 and len(researches) > 0: t = None if pk == -1: t = users.AssignmentTemplates(title=title, global_template=global_template) t.save() pk = t.pk if users.AssignmentTemplates.objects.filter(pk=pk).exists(): t = users.AssignmentTemplates.objects.get(pk=pk) t.title = title t.global_template = global_template t.save() if t: users.AssignmentResearches.objects.filter(template=t).exclude(research__pk__in=researches).delete() to_add = [x for x in researches if not users.AssignmentResearches.objects.filter(template=t, research__pk=x).exists()] for ta in to_add: if DResearches.objects.filter(pk=ta).exists(): users.AssignmentResearches(template=t, research=DResearches.objects.get(pk=ta)).save() response["ok"] = True return JsonResponse(response) def modules_view(request): return JsonResponse({"l2_cards": SettingManager.get("l2_cards_module", default='false', default_type='b')}) def autocomplete(request): t = request.GET.get("type") v = request.GET.get("value", "") limit = int(request.GET.get("limit", 10)) data = [] if v != "" and limit > 0: if t == "harmful": p = Card.objects.filter(harmful_factor__istartswith=v).distinct('harmful_factor')[:limit] if p.exists(): data = [x.harmful_factor for x in p] elif t == "fias": data = fias.suggest(v) elif t == "fias-extended": data = fias.suggest(v, count=limit, detalized=True) elif t == "name": p = Individual.objects.filter(name__istartswith=v).distinct('name')[:limit] if p.exists(): data = [x.name for x in p] elif t == "family": p = Individual.objects.filter(family__istartswith=v).distinct('family')[:limit] if p.exists(): data = [x.family for x in p] elif t == "patronymic": p = Individual.objects.filter(patronymic__istartswith=v).distinct('patronymic')[:limit] if p.exists(): data = [x.patronymic for x in p] elif t == "work_place": p = Card.objects.filter(work_place__istartswith=v).distinct('work_place')[:limit] if p.exists(): data = [x.work_place for x in p] elif t == "main_diagnosis": p = Card.objects.filter(main_diagnosis__istartswith=v).distinct('main_diagnosis')[:limit] if p.exists(): data = [x.main_diagnosis for x in p] elif t == "work_position": p = Card.objects.filter(work_position__istartswith=v).distinct('work_position')[:limit] if p.exists(): data = [x.work_position for x in p] elif "who_give:" in t: tpk = t.split(":")[1] p = Document.objects.filter(document_type__pk=tpk, who_give__istartswith=v).distinct('who_give')[:limit] if p.exists(): data = [x.who_give for x in p] elif t == "fsli": if v == "HGB": p = FsliRefbookTest.objects.filter( Q(code_fsli__startswith=v) | Q(title__icontains=v) | Q(english_title__icontains=v) | Q(short_title__icontains=v) | Q(synonym__istartswith=v) | Q(synonym='Hb') ) else: p = FsliRefbookTest.objects.filter( Q(code_fsli__startswith=v) | Q(title__icontains=v) | Q(english_title__icontains=v) | Q(short_title__icontains=v) | Q(synonym__istartswith=v) ) p = p.filter(active=True).distinct('code_fsli').order_by('code_fsli', 'ordering')[:limit] if p.exists(): data = [{"code_fsli": x.code_fsli, "short_title": x.short_title, "title": x.title, "sample": x.sample, "synonym": x.synonym, "nmu": x.code_nmu} for x in p] elif t == "drugs": data = [ { "title": str(x), "pk": x.pk, } for x in Drugs.objects.filter(Q(mnn__istartswith=v) | Q(trade_name__istartswith=v)).order_by('mnn', 'trade_name').distinct('mnn', 'trade_name')[:limit] ] return JsonResponse({"data": data}) def laborants(request): data = [] if SettingManager.l2('results_laborants'): data = [{"pk": '-1', "fio": 'Не выбрано'}] for d in users.DoctorProfile.objects.filter(user__groups__name="Лаборант", podrazdeleniye__p_type=users.Podrazdeleniya.LABORATORY).order_by('fio'): data.append({"pk": str(d.pk), "fio": d.get_full_fio()}) return JsonResponse({"data": data, "doc": request.user.doctorprofile.has_group("Врач-лаборант")}) @login_required def load_docprofile_by_group(request): request_data = json.loads(request.body) if request_data['group'] == '*': users = users_all(request.user.doctorprofile.get_hospital_id()) else: users = users_by_group(request_data['group'], request.user.doctorprofile.get_hospital_id()) users_grouped = {} for row in users: if row[2] not in users_grouped: users_grouped[row[2]] = {'id': f"pord-{row[2]}", 'label': row[4] or row[3], 'children': []} users_grouped[row[2]]['children'].append({'id': str(row[0]), 'label': row[1], 'podr': row[4] or row[3]}) return JsonResponse({"users": list(users_grouped.values())}) @login_required @group_required("Создание и редактирование пользователей") def users_view(request): request_data = json.loads(request.body) user_hospital_pk = request.user.doctorprofile.get_hospital_id() hospital_pk = request_data.get('selected_hospital', user_hospital_pk) can_edit = request.user.is_superuser or request.user.doctorprofile.all_hospitals_users_control or hospital_pk == user_hospital_pk data = [] if can_edit: podr = Podrazdeleniya.objects.filter(Q(hospital_id=hospital_pk) | Q(hospital__isnull=True)).exclude(p_type=Podrazdeleniya.HIDDEN, hospital__isnull=True).order_by("title") for x in podr: otd = {"pk": x.pk, "title": x.title, "users": []} docs = users.DoctorProfile.objects.filter(podrazdeleniye=x, hospital_id=hospital_pk).order_by('fio') if not request.user.is_superuser: docs = docs.filter(user__is_superuser=False) for y in docs: otd["users"].append({"pk": y.pk, "fio": y.get_fio(), "username": y.user.username}) data.append(otd) spec = users.Speciality.objects.all().order_by("title") spec_data = [] for s in spec: spec_data.append({"pk": s.pk, "title": s.title}) return JsonResponse({"departments": data, "specialities": spec_data}) @login_required @group_required("Создание и редактирование пользователей") def user_view(request): request_data = json.loads(request.body) pk = request_data["pk"] if pk == -1: data = { "family": '', "name": '', "patronymic": '', "username": '', "department": '', "groups": [], "restricted_to_direct": [], "users_services": [], "groups_list": [{"pk": x.pk, "title": x.name} for x in Group.objects.all()], "password": '', "rmis_location": '', "rmis_login": '', "rmis_password": '', "rmis_resource_id": '', "doc_pk": -1, "doc_code": -1, "rmis_employee_id": '', "rmis_service_id_time_table": '', } else: doc = users.DoctorProfile.objects.get(pk=pk) fio_parts = doc.get_fio_parts() data = { "family": fio_parts[0], "name": fio_parts[1], "patronymic": fio_parts[2], "username": doc.user.username, "department": doc.podrazdeleniye_id, "groups": [x.pk for x in doc.user.groups.all()], "restricted_to_direct": [x.pk for x in doc.restricted_to_direct.all()], "users_services": [x.pk for x in doc.users_services.all()], "groups_list": [{"pk": x.pk, "title": x.name} for x in Group.objects.all()], "password": '', "rmis_location": doc.rmis_location or '', "rmis_login": doc.rmis_login or '', "rmis_resource_id": doc.rmis_resource_id or '', "rmis_password": '', "doc_pk": doc.user.pk, "personal_code": doc.personal_code, "speciality": doc.specialities_id, "rmis_employee_id": doc.rmis_employee_id, "rmis_service_id_time_table": doc.rmis_service_id_time_table, } return JsonResponse({"user": data}) @login_required @group_required("Создание и редактирование пользователей") def user_save_view(request): request_data = json.loads(request.body) pk = request_data["pk"] ok = True message = "" ud = request_data["user_data"] username = ud["username"] rmis_location = str(ud["rmis_location"]).strip() or None rmis_employee_id = str(ud["rmis_employee_id"]).strip() or None rmis_service_id_time_table = str(ud["rmis_service_id_time_table"]).strip() or None rmis_login = ud["rmis_login"].strip() or None rmis_password = ud["rmis_password"].strip() or None personal_code = ud.get("personal_code", 0) rmis_resource_id = ud["rmis_resource_id"].strip() or None user_hospital_pk = request.user.doctorprofile.get_hospital_id() hospital_pk = request_data.get('hospital_pk', user_hospital_pk) can_edit = request.user.is_superuser or request.user.doctorprofile.all_hospitals_users_control or hospital_pk == user_hospital_pk if not can_edit: return JsonResponse({"ok": False}) npk = pk if pk == -1: if not User.objects.filter(username=username).exists(): user = User.objects.create_user(username) user.is_active = True user.save() doc = users.DoctorProfile(user=user, fio=f'{ud["family"]} {ud["name"]} {ud["patronymic"]}') doc.save() doc.get_fio_parts() npk = doc.pk else: ok = False message = "Имя пользователя уже занято" doc = None else: doc = users.DoctorProfile.objects.get(pk=pk) if pk and doc and (not doc.user.is_superuser or request.user.is_superuser): if ud["password"] != '': doc.user.set_password(ud["password"]) doc.user.save() if pk != -1 and doc.user.username != ud['username']: if not User.objects.filter(username=username).exists(): doc.user.username = username doc.user.save() else: ok = False message = "Имя пользователя уже занято" if ok: doc.user.groups.clear() for g in ud["groups"]: group = Group.objects.get(pk=g) doc.user.groups.add(group) doc.user.save() doc.restricted_to_direct.clear() for r in ud["restricted_to_direct"]: doc.restricted_to_direct.add(DResearches.objects.get(pk=r)) doc.users_services.clear() for r in ud["users_services"]: doc.users_services.add(DResearches.objects.get(pk=r)) doc.podrazdeleniye_id = ud['department'] doc.specialities_id = ud.get('speciality', None) doc.family = ud["family"] doc.name = ud["name"] doc.patronymic = ud["patronymic"] doc.fio = f'{ud["family"]} {ud["name"]} {ud["patronymic"]}' doc.rmis_location = rmis_location doc.rmis_employee_id = rmis_employee_id doc.rmis_service_id_time_table = rmis_service_id_time_table doc.personal_code = personal_code doc.rmis_resource_id = rmis_resource_id doc.hospital_id = hospital_pk if rmis_login: doc.rmis_login = rmis_login if rmis_password: doc.rmis_password = rmis_password else: doc.rmis_login = None doc.rmis_password = None doc.save() return JsonResponse({"ok": ok, "npk": npk, "message": message}) def slot_status(x): s = 0 pk = None n = directions.Napravleniya.objects.filter(rmis_slot_id=x["slot"]).first() if n: pk = n.pk s = 1 if n.is_all_confirm(): s = 2 return {"code": s, "direction": pk} @login_required def user_location(request): request_data = json.loads(request.body) date = request_data["date"] d = {} rl = request.user.doctorprofile.rmis_location if rl and SettingManager.get("l2_rmis_queue", default='false', default_type='b'): if rl == 1337 and request.user.is_superuser: from rmis_integration.client import Patients d = Patients.get_fake_reserves() else: from rmis_integration.client import Client c = Client(modules=['patients']) d = c.patients.get_reserves(date, rl) d = list(map(lambda x: {**x, "status": slot_status(x)}, d)) return JsonResponse({"data": d}) @login_required def user_get_reserve(request): request_data = json.loads(request.body) pk = request_data["pk"] patient_uid = request_data["patient"] rl = request.user.doctorprofile.rmis_location if rl: if rl == 1337 and request.user.is_superuser: from rmis_integration.client import Patients d = Patients.get_fake_slot() else: from rmis_integration.client import Client c = Client(modules=['patients']) d = c.patients.get_slot(pk) n = directions.Napravleniya.objects.filter(rmis_slot_id=pk).first() d["direction"] = n.pk if n else None ds = directions.Issledovaniya.objects.filter(napravleniye=n, napravleniye__isnull=False).first() d['direction_service'] = ds.research_id if ds else -1 if d: return JsonResponse({**d, "datetime": d["datetime"].strftime('%d.%m.%Y %H:%M'), "patient_uid": patient_uid, "pk": int(str(pk)[1:]) if str(pk).isdigit() else str(pk)}) return JsonResponse({}) @login_required def user_fill_slot(request): slot = json.loads(request.body).get('slot', {}) slot_data = slot.get('data', {}) if directions.Napravleniya.objects.filter(rmis_slot_id=slot["id"]).exists(): direction = directions.Napravleniya.objects.filter(rmis_slot_id=slot["id"])[0].pk else: result = directions.Napravleniya.gen_napravleniya_by_issledovaniya( slot["card_pk"], "", "ОМС", "", None, request.user.doctorprofile, {-1: [slot_data["direction_service"]]}, {}, False, {}, vich_code="", count=1, discount=0, parent_iss=None, rmis_slot=slot["id"], ) direction = result["list_id"][0] return JsonResponse({"direction": direction}) @login_required def
not found! return None def get_color(self, type_category, type_name): color = self.get_representation(type_category, type_name, 'color') if color != None: return ' #%s' % color else: return '' def get_label(self, type_category, node_name, type_name): icon = self.get_representation(type_category, type_name, 'icon') if icon != None: return '<img:%s>\\n%s' % (icon, node_name) else: return '%s: %s' % (node_name, short_type_name(type_name)) def generate_UML2_component_diagram(self, topology_template, with_relationships): self.generate('@startuml') self.generate('skinparam componentStyle uml2') if with_relationships: self.generate('skinparam component {') self.generate(' backgroundColor<<relationship>> White') self.generate('}') self.generate() substitution_mappings = topology_template.get(SUBSTITUTION_MAPPINGS) if substitution_mappings: substitution_mappings_uml_id = SUBSTITUTION_MAPPINGS substitution_mappings_node_type = substitution_mappings.get(NODE_TYPE) merged_substitution_mappings_type = self.type_system.merge_node_type(substitution_mappings_node_type) for capability_name, capability_yaml in get_dict(merged_substitution_mappings_type, CAPABILITIES).items(): capability_uml_id = substitution_mappings_uml_id + '_' + normalize_name(capability_name) # Declare an UML interface for the substitution_mappings capability. self.generate('interface "', capability_name, '" as ', capability_uml_id, sep='') self.generate('component ": ', substitution_mappings_node_type, '" <<node>> as ', substitution_mappings_uml_id, self.get_color('node', substitution_mappings_node_type), ' {', sep='') relationship_templates = get_dict(topology_template, RELATIONSHIP_TEMPLATES) already_generated_interfaces = {} # Iterate over all node templates. node_templates = get_dict(topology_template, NODE_TEMPLATES) for node_template_name, node_template_yaml in node_templates.items(): node_template_type = node_template_yaml.get(TYPE) merged_node_template_type = self.type_system.merge_node_type(node_template_type) node_template_uml_id = 'node_' + normalize_name(node_template_name) # Declare an UML component for the node template. icon = self.get_representation('node', node_template_type, 'icon') if icon is not None: self.generate('component "<img:', icon, '>" <<node>> as ', node_template_uml_id, self.get_color('node', node_template_type), ' {', sep='') self.generate('label "**', node_template_name, '**" as ', node_template_uml_id, '_label', sep='') self.generate('}') else: self.generate('component "', self.get_label('node', node_template_name, node_template_type), '" <<node>> as ', node_template_uml_id, self.get_color('node', node_template_type), sep='') # Iterate over all capabilities of the node template. for capability_name, capability_yaml in get_dict(merged_node_template_type, CAPABILITIES).items(): if type(capability_yaml) == dict: capability_occurrences = capability_yaml.get(OCCURRENCES) else: capability_occurrences = None if with_relationships or (capability_occurrences and capability_occurrences[0] > 0): capability_uml_id = node_template_uml_id + '_' + normalize_name(capability_name) # Declare an UML interface for the node template capability. self.generate('interface "', capability_name, '" as ', capability_uml_id, sep='') # Connect the capability UML interface to the node template UML component. self.generate(capability_uml_id, '--', node_template_uml_id) already_generated_interfaces[capability_uml_id] = capability_uml_id if with_relationships: # Iterate over all requirements of the node template. index = 0 for requirement in get_list(node_template_yaml, REQUIREMENTS): for requirement_name, requirement_yaml in requirement.items(): requirement_uml_id = node_template_uml_id + '_' + normalize_name(requirement_name) + '_relationship' + str(index) index = index + 1 requirement_node = get_requirement_node_template(requirement_yaml) if requirement_node == None: continue relationship_component_name = '' # No name. relationship_component_type = None if type(requirement_yaml) == dict: requirement_relationship = syntax.get_requirement_relationship(requirement_yaml) if type(requirement_relationship) == dict: relationship_component_type = syntax.get_relationship_type(requirement_relationship) else: relationship_template = relationship_templates.get(requirement_relationship) if relationship_template: relationship_component_name = requirement_relationship relationship_component_type = relationship_template.get(TYPE) else: relationship_component_type = requirement_relationship if relationship_component_type == None: requirement = get_dict(merged_node_template_type, REQUIREMENTS).get(requirement_name, {}) tmp = syntax.get_requirement_relationship(requirement) relationship_component_type = syntax.get_relationship_type(tmp) if relationship_component_type == None: continue # Declare an UML component for the node template requirement relationship. self.generate('component "', relationship_component_name, ': ', short_type_name(relationship_component_type), '" <<relationship>> as ', requirement_uml_id, sep='') # Declare an UML interface for the node template requirement relationship. self.generate('interface " " as ', requirement_uml_id, '_source', sep='') # Connect the UML interface to the relationship UML component. self.generate(requirement_uml_id, '_source', ' -- ', requirement_uml_id, sep='') # Connect the node template UML component to the relationship UML component. self.generate(node_template_uml_id, ' --( ', requirement_uml_id, '_source', ' : ', requirement_name, sep='') self.generate() # Iterate over all node templates. for node_template_name, node_template_yaml in node_templates.items(): node_template_uml_id = 'node_' + normalize_name(node_template_name) node_template_type = node_template_yaml.get(TYPE) merged_node_template_type = self.type_system.merge_node_type(node_template_type) # Iterate over all requirements of the node template. index = 0 for requirement in get_list(node_template_yaml, REQUIREMENTS): for requirement_name, requirement_yaml in requirement.items(): source_uml_id = node_template_uml_id if with_relationships: source_uml_id = source_uml_id + '_' + normalize_name(requirement_name) + '_relationship' + str(index) index = index + 1 requirement_node = get_requirement_node_template(requirement_yaml) if requirement_node == None: continue requirement_node_template = node_templates.get(requirement_node) if requirement_node_template == None: continue requirement_node_type_name = requirement_node_template.get(TYPE) if requirement_node_type_name == None: continue requirement_capability = syntax.get_requirement_capability(get_dict(merged_node_template_type, REQUIREMENTS).get(requirement_name)) capability_found = False for ( capability_name, capability_yaml ) in get_dict(self.type_system.merge_node_type(requirement_node_type_name), CAPABILITIES).items(): if self.type_system.is_derived_from(syntax.get_capability_type(capability_yaml), requirement_capability): capability_found = True break if capability_found: target_node_uml_id = 'node_' + normalize_name(requirement_node) target_capability_uml_id = target_node_uml_id + '_' + normalize_name(capability_name) if with_relationships: self.generate(source_uml_id, ' --( ', target_capability_uml_id, sep='') else: if already_generated_interfaces.get(target_capability_uml_id) == None: self.generate('interface "', capability_name, '" as ', target_capability_uml_id, sep='') # Connect the capability UML interface to the node template UML component. self.generate(target_capability_uml_id, '--', target_node_uml_id) already_generated_interfaces[target_capability_uml_id] = target_capability_uml_id self.generate(source_uml_id, ' "' + requirement_name + '" --( ', target_capability_uml_id, sep='') # generate UML representation for TOSCA policies for policy in topology_template.get(POLICIES, []): for policy_name, policy_yaml in policy.items(): policy_type = policy_yaml.get(TYPE) policy_uml_id = 'policy_' + normalize_name(policy_name) self.generate('agent %s <<policy>> #AliceBlue [' % policy_uml_id) if policy_type in [ 'tosca.policies.nfv.VnfIndicator' ]: self.generate(policy_name, ': ', short_type_name(policy_type), sep='') else: self.generate(short_type_name(policy_type), sep='') self.generate('---') properties = policy_yaml.get('properties', {}) if len(properties) > 0: self.generate('.. properties ..') for prop_name, prop_value in properties.items(): self.generate(prop_name, '=', self.stringify_value(prop_value)) triggers = policy_yaml.get('triggers', {}) if len(triggers) > 0: self.generate('.. triggers ..') for trigger_name, trigger in triggers.items(): filename = self.get_filename(self.tosca_service_template) filename = filename[:filename.rfind('.')] + '-' + policy_name + '-' + trigger_name + '-sequence-diagram.svg' self.generate('[[%s %s]]' % (filename, trigger_name)) self.generate(']') for target in policy_yaml.get(TARGETS, []): if node_templates.get(target) != None: target_uml_id = 'node_' + normalize_name(target) self.generate(policy_uml_id, ' -up-> ', target_uml_id, sep='') else: target_group = topology_template.get(GROUPS, {}).get(target) if target_group is None: self.error(target + " - undefined node template or group") continue for member in target_group.get(MEMBERS, []): member_uml_id = 'node_' + normalize_name(member) self.generate(policy_uml_id, ' -up-> ', member_uml_id, sep='') if substitution_mappings: capabilities = get_dict(substitution_mappings, CAPABILITIES) for capability_name, capability_yaml in get_dict(merged_substitution_mappings_type, CAPABILITIES).items(): capability = capabilities.get(capability_name) if capability != None: if type(capability) != list: continue # TODO when capability is not a list target_node_uml_id = 'node_' + normalize_name(capability[0]) target_uml_id = target_node_uml_id + '_' + normalize_name(capability[1]) if already_generated_interfaces.get(target_uml_id) == None: self.generate('interface "', normalize_name(capability[1]), '" as ', target_uml_id, sep='') # Connect the capability UML interface to the node template UML component. self.generate(target_uml_id, '--', target_node_uml_id) already_generated_interfaces[target_uml_id] = target_uml_id self.generate('}') for capability_name, capability_yaml in get_dict(merged_substitution_mappings_type, CAPABILITIES).items(): capability_uml_id = substitution_mappings_uml_id + '_' + normalize_name(capability_name) # Connect the capability UML interface to the node template UML component. capability = capabilities.get(capability_name) if capability != None: if type(capability) != list: continue # TODO when capability is not a list target_node_uml_id = 'node_' + normalize_name(capability[0]) target_uml_id = target_node_uml_id + '_' + normalize_name(capability[1]) self.generate(capability_uml_id, '--(', target_uml_id) else: self.generate(capability_uml_id, '--', substitution_mappings_uml_id) index = 0 requirements = syntax.get_substitution_mappings_requirements(substitution_mappings) for requirement_name, requirement_def in merged_substitution_mappings_type.get(REQUIREMENTS, {}).items(): interface_uml_id = substitution_mappings_uml_id + '_' + normalize_name(requirement_name) + str(index) index = index + 1 self.generate('interface "', requirement_name, '" as ', interface_uml_id) requirement_yaml = requirements.get(requirement_name) if requirement_yaml: source_uml_id = 'node_' + normalize_name(requirement_yaml[0]) self.generate(source_uml_id, ' "' + requirement_yaml[1] + '" --( ', interface_uml_id, sep='') else: self.generate(substitution_mappings_uml_id, ' --( ', interface_uml_id) self.generate('@enduml') def generate_UML2_deployment_diagram(self, topology_template): self.generate('@startuml') self.generate('skinparam componentStyle uml2') self.generate('allowmixing') self.generate() node_templates = get_dict(topology_template, NODE_TEMPLATES) non_containeds = list(node_templates.keys()) containers = {} contained_containers = [] # Iterate over all node templates to find containers. for node_template_name, node_template_yaml in node_templates.items(): merged_node_template_type = self.type_system.merge_node_type(node_template_yaml.get(TYPE)) # Iterate over all capabilities of the node template type. for capability_name, capability_yaml in get_dict(merged_node_template_type, CAPABILITIES).items(): capability_type = get_capability_type(capability_yaml) if self.type_system.is_derived_from(capability_type, 'tosca.capabilities.Container'): containers[node_template_name] = containers.get(node_template_name, dict()) try: non_containeds.remove(node_template_name) except ValueError: pass # Iterate over all node templates to find containeds. for node_template_name, node_template_yaml in node_templates.items(): merged_node_template_type = self.type_system.merge_node_type(node_template_yaml.get(TYPE)) # Iterate over all requirements of the node template. for requirement in get_list(node_template_yaml, REQUIREMENTS): for requirement_name, requirement_yaml in requirement.items(): requirement_definition = get_dict(merged_node_template_type, REQUIREMENTS).get(requirement_name) requirement_relationship = syntax.get_requirement_relationship(requirement_definition) requirement_relationship_type = syntax.get_relationship_type(requirement_relationship) if self.type_system.is_derived_from(requirement_relationship_type, 'tosca.relationships.HostedOn'): requirement_node = get_requirement_node_template(requirement_yaml) if requirement_node != None: try: containers[requirement_node][node_template_name] = containers.get(node_template_name, dict()) except KeyError as e: self.error(e) contained_containers.append(node_template_name) try: non_containeds.remove(node_template_name) except ValueError: pass # TODO: Remove containers contained by other containers. for contained_container_name in contained_containers: if containers.get(contained_container_name) != None: del containers[contained_container_name] # Iterate over all containers. def get_uml2_kind(tosca_type): uml2_kind = 'component' for tt, kind in self.configuration.get(UML2, 'kinds').items(): if self.type_system.is_derived_from(tosca_type, tt): uml2_kind = kind break return uml2_kind def generate_container(self, container_name, containeds): node_template = node_templates.get(container_name) node_template_type = node_template.get(TYPE) uml2_kind = get_uml2_kind(node_template_type) node_template_artifacts = get_dict(node_template, ARTIFACTS) properties = self.get_representation('node', node_template_type, 'properties') if len(containeds) == 0 and len(node_template_artifacts) == 0 and properties is None: icon = self.get_representation('node', node_template_type, 'icon') if icon is not None: self.generate(uml2_kind, ' "<img:', icon, '>" as node_', normalize_name(container_name), self.get_color('node', node_template_type), ' {', sep='') self.generate('label "**', container_name, '**" as ', normalize_name(container_name), '_label', sep='') self.generate('}') else: self.generate(uml2_kind, ' "', self.get_label('node', container_name, node_template_type), '" as node_', normalize_name(container_name),
-2, -3, -3, -2, -3, -3] victimization -2.3 0.78102 [-1, -3, -3, -2, -3, -1, -3, -2, -3, -2] victimizations -1.5 1.85742 [-2, -3, -3, -1, -2, 2, 2, -2, -3, -3] victimize -2.5 0.67082 [-3, -2, -4, -2, -2, -2, -2, -3, -3, -2] victimized -1.8 1.53623 [-2, -1, -3, -3, -3, 1, 1, -2, -3, -3] victimizer -1.8 1.72047 [-3, -2, -3, -3, -2, 2, 1, -2, -3, -3] victimizers -1.6 1.68523 [-3, -2, -3, 1, -3, -1, -2, 2, -2, -3] victimizes -1.5 1.9105 [-2, -1, -4, -3, -2, 2, 2, -2, -3, -2] victimizing -2.6 0.4899 [-2, -3, -3, -3, -2, -3, -2, -3, -2, -3] victimless 0.6 0.4899 [0, 1, 0, 1, 1, 0, 0, 1, 1, 1] victimologies -0.6 1.35647 [-2, 0, -2, -1, 0, 2, 1, 0, -2, -2] victimologist -0.5 0.67082 [0, -1, -1, 0, 0, 0, 0, -1, -2, 0] victimologists -0.4 0.91652 [0, 1, 0, -2, -2, 0, 0, 0, -1, 0] victimology 0.3 1.00499 [0, 0, 0, -1, 0, 1, 0, 0, 3, 0] victims -1.3 2.05183 [-3, -1, -3, -3, -3, 2, 1, -2, 2, -3] vigilant 0.7 0.9 [0, 2, 0, 2, 0, -1, 1, 1, 1, 1] vigor 1.1 1.37477 [0, 3, 2, 1, 2, 2, 0, 1, -2, 2] vigorish -0.4 1.2 [0, -3, -1, -1, 0, -1, 0, 0, 2, 0] vigorishes 0.4 1.56205 [0, 0, 2, 1, 2, 0, -2, -2, 0, 3] vigoroso 1.5 0.67082 [2, 0, 1, 2, 2, 1, 2, 1, 2, 2] vigorously 0.5 0.92195 [0, 0, 0, 1, 2, 0, 2, -1, 1, 0] vigorousness 0.4 1.11355 [0, 3, 0, -1, -1, 0, 0, 1, 1, 1] vigors 1.0 1.0 [0, 1, 0, 1, 0, 0, 1, 3, 2, 2] vigour 0.9 0.9434 [0, 2, 2, 2, 1, 1, 0, 1, -1, 1] vigours 0.4 1.68523 [-4, 1, 1, 1, -1, 1, 2, 2, 0, 1] vile -3.1 0.83066 [-4, -2, -4, -4, -2, -3, -3, -3, -2, -4] villain -2.6 0.4899 [-3, -2, -2, -3, -2, -2, -3, -3, -3, -3] villainess -2.9 0.53852 [-3, -2, -3, -4, -3, -2, -3, -3, -3, -3] villainesses -2.0 1.18322 [-2, -3, -2, -2, -2, -3, 1, -3, -1, -3] villainies -2.3 1.00499 [-3, -2, -3, -3, -3, -1, -3, -2, -3, 0] villainous -2.0 0.63246 [-3, -2, -1, -2, -2, -2, -2, -1, -2, -3] villainously -2.9 0.53852 [-3, -3, -3, -3, -3, -4, -2, -3, -2, -3] villainousness -2.7 0.9 [-4, -3, -4, -3, -1, -3, -2, -2, -2, -3] villains -3.4 0.91652 [-4, -3, -4, -3, -4, -3, -4, -4, -1, -4] villainy -2.6 0.4899 [-3, -2, -3, -3, -2, -2, -2, -3, -3, -3] vindicate 0.3 1.95192 [2, -1, -2, -3, -1, 3, 0, 3, 1, 1] vindicated 1.8 1.16619 [1, 3, -1, 2, 2, 1, 3, 2, 2, 3] vindicates 1.6 0.66332 [2, 3, 2, 2, 2, 1, 1, 1, 1, 1] vindicating -1.1 1.97231 [-3, -2, 2, -3, -2, 1, 1, 1, -3, -3] violate -2.2 0.6 [-3, -3, -2, -3, -2, -2, -1, -2, -2, -2] violated -2.4 0.66332 [-3, -3, -3, -3, -2, -3, -1, -2, -2, -2] violater -2.6 0.91652 [-3, -3, -4, -4, -2, -3, -2, -2, -2, -1] violaters -2.4 0.8 [-1, -3, -1, -2, -3, -3, -3, -2, -3, -3] violates -2.3 0.9 [-3, -2, -4, -3, -2, -3, -2, -2, -1, -1] violating -2.5 0.92195 [-2, -3, -3, -1, -3, -2, -4, -1, -3, -3] violation -2.2 0.9798 [-3, -1, -1, -3, -3, -2, -1, -2, -2, -4] violations -2.4 0.66332 [-2, -2, -2, -3, -2, -4, -2, -2, -2, -3] violative -2.4 0.66332 [-2, -3, -3, -3, -1, -3, -2, -2, -2, -3] violator -2.4 1.0198 [-1, -4, -3, -2, -3, -2, -2, -1, -4, -2] violators -1.9 1.51327 [-2, 2, -3, -4, -1, -2, -3, -2, -2, -2] violence -3.1 0.53852 [-2, -3, -3, -3, -3, -4, -4, -3, -3, -3] violent -2.9 0.53852 [-3, -3, -3, -3, -3, -4, -3, -2, -2, -3] violently -2.8 0.74833 [-3, -3, -2, -3, -3, -3, -4, -1, -3, -3] virtue 1.8 0.74833 [1, 2, 3, 2, 2, 2, 3, 1, 1, 1] virtueless -1.4 1.0198 [-2, 0, -2, -3, -1, -3, -1, -1, -1, 0] virtues 1.5 0.80623 [2, 2, 2, 1, 0, 1, 3, 1, 2, 1] virtuosa 1.7 1.48661 [0, 4, 2, 3, 2, 3, 0, 2, -1, 2] virtuosas 1.8 0.87178 [2, 3, 1, 2, 1, 0, 3, 2, 2, 2] virtuose 1.0 1.41421 [2, 1, 0, 2, 1, -1, 1, 1, -1, 4] virtuosi 0.9 1.37477 [2, 0, 0, 2, 1, 0, 0, 1, -1, 4] virtuosic 2.2 1.07703 [2, 2, 4, 1, 0, 3, 3, 2, 2, 3] virtuosity 2.1 0.83066 [3, 3, 3, 2, 1, 3, 2, 2, 1, 1] virtuoso 2.0 1.0 [2, 2, 3, 2, 1, 0, 3, 3, 3, 1] virtuosos 1.8 1.16619 [2, 3, 1, -1, 2, 1, 3, 3, 2, 2] virtuous 2.4 1.2 [0, 3, 2, 1, 3, 4, 2, 2, 4, 3] virtuously 1.8 1.16619 [3, 2, 3, 1, 3, 1, -1, 2, 2, 2] virtuousness 2.0 1.09545 [3, 4, 2, 2, 0, 1, 2, 3, 2, 1] virulent -2.7 0.64031 [-3, -2, -4, -2, -3, -3, -2, -3, -2, -3] vision 1.0 1.0 [0, 0, 0, 2, 1, 3, 2, 1, 1, 0] visionary 2.4 1.0198 [1, 3, 1, 2, 4, 1, 3, 3, 3, 3] visioning 1.1 0.9434 [1, 2, 0, 0, 3, 0, 1, 1, 2, 1] visions 0.9 0.9434 [2, 0, 0, 0, 0, 1, 2, 2, 0, 2] vital 1.2 1.46969 [-3, 2, 1, 1, 2, 2, 1, 2, 2, 2] vitalise 1.1 0.9434 [1, 2, 0, 2, 2, 0, 2, 0, 2, 0] vitalised 0.6 1.49666 [1, -2, 2, 0, 2, 1, -2, 2, 0, 2] vitalises 1.1 1.3 [1, 2, 2, 0, 2, 2, -2, 2, 0, 2] vitalising 2.1 0.53852 [2, 2, 3, 2, 3, 2, 2, 1, 2, 2] vitalism 0.2 0.6 [0, 0, 0, 0, 0, 0, 0, 0, 2, 0] vitalist 0.3 0.64031 [0, 0, 0, 0, 0, 0, 1, 0, 2, 0] vitalists 0.3 1.34536 [2, -3, 1, 0, 0, 0, 1, 0, 2, 0] vitalities 1.2 0.87178 [2, 1, 3, 1, 1, 0, 2, 1, 0, 1] vitality 1.3 0.9 [3, 2, 0, 1, 1, 1, 2, 0, 2, 1] vitalization 1.6 0.91652 [2, 3, 3, 1, 2, 1, 0, 2, 1, 1] vitalizations 0.8 0.74833 [0, 1, 1, 2, 0, 0, 0, 2, 1, 1] vitalize 1.6 0.66332 [3, 2, 2, 1, 2, 1, 1, 1, 2, 1] vitalized 1.5 0.67082 [1, 1, 2, 2, 0, 2, 1, 2, 2, 2] vitalizes 1.4 0.4899 [2, 1, 1, 2, 1, 2, 1, 2, 1, 1] vitalizing 1.3 0.9 [3, 1, 0, 0, 1, 1, 2, 2, 2, 1] vitally 1.1 0.53852 [0, 2, 1, 1, 1, 1, 2, 1, 1, 1] vitals 1.1 0.7 [1, 0, 1, 2, 2, 0, 2, 1, 1, 1] vitamin 1.2 0.87178 [3, 1, 0, 0, 1, 2, 1, 2, 1, 1] vitriolic -2.1 0.83066 [-2, -2, -2, -4, -3, -2, -1, -1, -2, -2] vivacious 1.8 0.9798 [0, 1, 3, 3, 3, 2, 2, 2, 1, 1] vociferous -0.8 0.9798 [1, -2, -1, -2, -1, -1, 1, -1, -1, -1] vulnerabilities -0.6 1.49666 [0, -3, -1, -1, -1, 2, -2, 2, -1, -1] vulnerability -0.9 1.75784 [1, -1, -1, -2, 1, -3, -1, 2, -4, -1] vulnerable -0.9 1.37477 [-2, -2, 2, -1, -3, -1, 1, -1, -1, -1] vulnerableness -1.1 1.04403 [-1, -1, -2, -3, -1, 1, 0, -2, -1, -1] vulnerably -1.2 1.46969 [-2, -2, 2, -1, -2, -3, 1, -1, -2, -2] vulture -2.0 0.89443 [-2, -3, -1, -2, -1, -1, -1, -3, -3, -3] vultures -1.3 1.55242 [-2, -3, -2, 2, -2, -2, -3, -1, -1, 1] w00t 2.2 1.32665 [3, 2, 3, 2, 0, 4, 0, 4, 2, 2] walkout -1.3 0.9 [-1, -2, -2, -1, -1, -2, -1, 1, -2, -2] walkouts -0.7 1.00499 [-2, -2, -1, 0, -1, -1, -1, 1, -1, 1] wanker -2.5 0.67082 [-2, -3, -3, -2, -3, -3, -2, -1, -3, -3] want 0.3 1.18743 [0, -2, 0, 1, 2, -1, 2, 1, 0, 0] war -2.9 1.13578 [-1, -3, -4, -4, -3, -1, -2, -3, -4, -4] warfare -1.2 1.16619 [-2, 0, -1, -2, 0, -3, 1, -2, -2, -1] warfares -1.8 0.87178 [-2, -1, -2, -2, -3, -1, -3, 0, -2, -2] warm 0.9 0.7 [1, 0, 0, 1, 1, 2, 1, 2, 1, 0] warmblooded 0.2 0.6 [0, 0, 2, 0, 0, 0, 0, 0, 0, 0] warmed 1.1 0.53852 [2, 0, 1, 1, 1, 2, 1, 1, 1, 1] warmer 1.2 0.9798 [2, 2, 2, 1, -1, 0, 2, 1, 1, 2] warmers 1.0 0.44721 [1, 1, 1, 2, 1, 1, 1, 0, 1, 1] warmest 1.7 1.34536 [3, 2, 1, 2, 3, 2, 2, 2, -2, 2] warmhearted 1.8 0.6 [3, 2, 2, 2, 2, 1, 2, 1, 1, 2] warmheartedness 2.7 0.64031 [2, 4, 3, 2, 3, 3, 3, 2, 2, 3] warming 0.6 0.8 [0, 0, 2, 2, 1, 1, 0, 0, 0, 0] warmish 1.4 0.66332 [1, 3, 2, 1, 1, 1, 1, 2, 1, 1] warmly 1.7 0.64031 [2, 1, 2, 1, 2, 1, 2, 1, 2, 3] warmness 1.5 0.92195 [3, 1, 2, 1, 0, 1, 3, 2, 1, 1] warmonger -2.9 1.13578 [-3, 0, -4, -4, -2, -3, -4, -3, -3, -3] warmongering -2.5 0.67082 [-2, -3, -3, -1, -2, -3, -3, -2, -3, -3] warmongers -2.8 0.87178 [-2, -3, -4, -4, -3, -1, -2, -3, -3, -3] warmouth 0.4 0.66332 [0, 0, 2, 0, 0, 0, 0, 1, 1, 0] warmouths -0.8 1.32665 [-1, -1, -2, -1, -2, -2, 0, 2, 1, -2] warms 1.1 0.7 [2, 2, 1, 2, 1, 0, 1, 1, 0, 1] warmth 2.0 0.44721 [2, 2, 2, 2, 1, 2, 2, 3, 2, 2] warmup 0.4 0.66332 [0, 2, 0, 1, 1, 0, 0, 0, 0, 0] warmups 0.8 0.9798 [0, 2, 0, 0, 0, 2, 2, 0, 2, 0] warn -0.4 1.35647 [0, -1, 0, -2, -1, 2, 1, -2, 1, -2] warned -1.1 0.53852 [-1, -1, -2, 0, -1, -1, -1, -2, -1, -1] warning -1.4 1.0198 [-2, -1, -1, -1, -2, 0, -4, -1, -1, -1] warnings -1.2 0.9798 [-2, -1, 0, -1, -2, 0, 0, -1, -3, -2] warns -0.4 1.0198 [1, -1, -1, 1, -1, -1, -2, 1, 0, -1] warred -2.4 0.8 [-2, -2, -4, -1, -3, -2, -3, -2, -3, -2] warring -1.9 1.04403 [-3, -3, 0, -1, -2, -2, -3, -1, -1, -3] wars -2.6 0.8 [-2, -3, -1, -3, -2, -4, -3, -3, -2, -3] warsaw -0.1 0.3 [0, -1, 0, 0, 0, 0, 0, 0, 0, 0] warsaws -0.2 0.4 [0, 0, 0, -1, 0, 0, 0, 0, -1, 0] warship -0.7 0.9 [0, 0, 0, 0, 0, -2, -1, 0, -2, -2] warships -0.5 0.80623 [0, -1, 0, 0, -2, 0, 0, -2, 0, 0] warstle 0.1 0.7 [0, 0, 0, 0, 0, 0,
data_newref_mask, table_trans['X_POS'], table_trans['Y_POS'], psffit=psffit, moffat=moffat, gauss=gauss, psfex_bintable_ref=fits_ref_psf, header_new=header_new, header_ref=header_ref, Scorr_peak=table_trans['SCORR_PEAK'], log=log) return results # determine optimal flux in D, directly added as columns to table_trans colnames = ['E_FLUX_OPT_D', 'E_FLUXERR_OPT_D'] table_trans.add_columns(help_psffit_D (False, False, False), names=colnames) # PSF fit to D, directly added as columns to table_trans colnames = ['E_FLUX_OPT_D_alt1', 'E_FLUXERR_OPT_D_alt1', 'E_FLUX_PSF_D', 'E_FLUXERR_PSF_D', 'X_PSF_D', 'Y_PSF_D', 'CHI2_PSF_D', 'XERR_PSF_D', 'YERR_PSF_D'] table_trans.add_columns(help_psffit_D (True, False, False), names=colnames) log.info ('[get_trans] time after PSF fit to D: {}'.format(time.time()-t)) # filter on CHI2_PSF_D # ==================== if get_par(set_zogy.make_plots,tel): ds9_rad += 2 result = prep_ds9regions( '{}_ds9regions_trans_filt3_elong.txt'.format(base), table_trans['X_POS'], table_trans['Y_POS'], radius=ds9_rad, width=2, color='blue', value=table_trans['CHI2_PSF_D']) # filter out transient candidates with high chi2 and non-finite values chi2_max = get_par(set_zogy.chi2_max,tel) mask_keep = (table_trans['CHI2_PSF_D'] <= chi2_max) # discard rows where fit values are infinite or NaN for col in colnames: mask_finite = np.isfinite(table_trans[col]) nbad = np.sum(~mask_finite) if nbad > 0: mask_keep &= mask_finite log.warning ('column {} contains {} infinite or NaN values for image ' '{}; discarding the corresponding row(s)' .format(col, nbad, new_fits)) # filter table_trans = table_trans[mask_keep] log.info('ntrans after PSF_D fit chi2 filter: {}'.format(len(table_trans))) # filter on S/N_PSF_D # =================== # check S/N of E_FLUX_PSF_D s2n_psfD = np.copy(table_trans['E_FLUX_PSF_D']) mask_nonzero = (table_trans['E_FLUXERR_PSF_D'] != 0) s2n_psfD[mask_nonzero] /= table_trans['E_FLUXERR_PSF_D'][mask_nonzero] if get_par(set_zogy.make_plots,tel): ds9_rad += 2 result = prep_ds9regions( '{}_ds9regions_trans_filt4_chi2_PSF_D.txt'.format(base), table_trans['X_POS'], table_trans['Y_POS'], radius=ds9_rad, width=2, color='yellow', value=s2n_psfD) mask_keep = (np.abs(s2n_psfD) >= get_par(set_zogy.transient_nsigma,tel)) table_trans = table_trans[mask_keep] log.info('ntrans after PSF_D fit S/N filter: {}'.format(len(table_trans))) # Gauss fit to D # ============== # Gauss fit to D, directly added as columns to table_trans colnames = ['E_FLUX_OPT_D_alt3', 'E_FLUXERR_OPT_D_alt3', 'X_GAUSS_D', 'XERR_GAUSS_D', 'Y_GAUSS_D', 'YERR_GAUSS_D', 'FWHM_GAUSS_D', 'ELONG_GAUSS_D', 'CHI2_GAUSS_D'] table_trans.add_columns(help_psffit_D (False, False, True), names=colnames) log.info ('[get_trans] time after Gauss fit to D: {}'.format(time.time()-t)) if get_par(set_zogy.make_plots,tel): ds9_rad += 2 result = prep_ds9regions( '{}_ds9regions_trans_filt5_s2n_PSF_D.txt'.format(base), table_trans['X_POS'], table_trans['Y_POS'], radius=ds9_rad, width=2, color='blue', value=table_trans['CHI2_GAUSS_D']) # filter out transient candidates with high chi2 values mask_keep = (table_trans['CHI2_GAUSS_D'] <= chi2_max) # discard rows where fit values are infinite or NaN for col in colnames: mask_finite = np.isfinite(table_trans[col]) nbad = np.sum(~mask_finite) if nbad > 0: mask_keep &= mask_finite log.warning ('column {} contains {} infinite or NaN values for image ' '{}; discarding the corresponding row(s)' .format(col, nbad, new_fits)) # filter # switch off for the moment; CHECK!!! if False: table_trans = table_trans[mask_keep] log.info('ntrans after Gauss fit chi2 filter: {}'.format(len(table_trans))) if get_par(set_zogy.make_plots,tel): ds9_rad += 2 result = prep_ds9regions( '{}_ds9regions_trans_filt6_chi2_GAUSS.txt'.format(base), table_trans['X_POS'], table_trans['Y_POS'], radius=ds9_rad, width=2, color='green') # determine RAs and DECs wcs_new = WCS(header_new) wcs_ref = WCS(header_ref) ra_peak, dec_peak = wcs_new.all_pix2world(table_trans['X_PEAK'], table_trans['Y_PEAK'], 1) # determine RA and DEC corresponding to x_psf_D and y_psf_D ra_psf_D, dec_psf_D = wcs_new.all_pix2world(table_trans['X_PSF_D'], table_trans['Y_PSF_D'], 1) if False: # determine RA and DEC corresponding to x_moffat and y_moffat ra_moffat, dec_moffat = wcs_new.all_pix2world(table_trans['X_MOFFAT_D'], table_trans['Y_MOFFAT_D'], 1) # determine RA and DEC corresponding to x_moffat and y_moffat ra_gauss, dec_gauss = wcs_new.all_pix2world(table_trans['X_GAUSS_D'], table_trans['Y_GAUSS_D'], 1) # determine RA and DEC corresponding to x_moffat and y_moffat ra_D, dec_D = wcs_new.all_pix2world(table_trans['X_POS'], table_trans['Y_POS'], 1) # adding RAs and DECs to table table_trans.add_columns([ra_peak, dec_peak, ra_psf_D, dec_psf_D, #ra_moffat, dec_moffat, ra_gauss, dec_gauss, ra_D, dec_D], names=['RA_PEAK', 'DEC_PEAK', 'RA_PSF_D', 'DEC_PSF_D', #'RA_MOFFAT_D','DEC_MOFFAT_D', 'RA_GAUSS_D', 'DEC_GAUSS_D', 'RA_SCORR', 'DEC_SCORR']) # need to convert psf fluxes to magnitudes by applying the zeropoint keywords = ['exptime', 'filter', 'obsdate'] exptime, filt, obsdate = read_header (header_new, keywords, log=log) # get zeropoint from [header_new] if 'PC-ZP' in header_new: zp = header_new['PC-ZP'] else: zp = get_par(set_zogy.zp_default,tel)[filt] # get airmass from [header_new] if 'AIRMASSC' in header_new: airmass = header_new['AIRMASSC'] elif 'PC-AIRM' in header_new: airmass = header_new['PC-AIRM'] # determine individual airmasses of transients to be able to # determine their magnitudes accurately also at high airmass lat = get_par(set_zogy.obs_lat,tel) lon = get_par(set_zogy.obs_lon,tel) height = get_par(set_zogy.obs_height,tel) airmass_trans = get_airmass(table_trans['RA_PEAK'], table_trans['DEC_PEAK'], obsdate, lat, lon, height, log=log) # get magnitudes corresponding to absolute fluxes; fluxes, which # can be negative for e.g. an object detected in the reference # image but not in the new image, are first converted to positive # fluxes. That it was a negative flux object is still clear from # the sign of Scorr_peak. data_Fpsf = read_hdulist (fits_Fpsf) data_Fpsferr = read_hdulist (fits_Fpsferr) # read off fluxes and errors at X_PEAK and Y_PEAK indices flux_peak = data_Fpsf[table_trans['Y_PEAK']-1, table_trans['X_PEAK']-1] fluxerr_peak = data_Fpsferr[table_trans['Y_PEAK']-1, table_trans['X_PEAK']-1] del data_Fpsf, data_Fpsferr mag_peak, magerr_peak = apply_zp ( np.abs(flux_peak), zp, airmass_trans, exptime, filt, log, zp_std=None, fluxerr=np.abs(fluxerr_peak)) mag_psf_D, magerr_psf_D = apply_zp ( np.abs(table_trans['E_FLUX_PSF_D']), zp, airmass_trans, exptime, filt, log, fluxerr=np.abs(table_trans['E_FLUXERR_PSF_D']), zp_std=None) mag_opt_D, magerr_opt_D = apply_zp ( np.abs(table_trans['E_FLUX_OPT_D']), zp, airmass_trans, exptime, filt, log, fluxerr=np.abs(table_trans['E_FLUXERR_OPT_D']), zp_std=None) log.info ('[get_trans] time after converting flux to mag: {}'.format(time.time()-t)) # adding magnitudes and also flux_peak to table table_trans.add_columns([flux_peak, fluxerr_peak, mag_peak, magerr_peak, mag_psf_D, magerr_psf_D, mag_opt_D, magerr_opt_D], names=['E_FLUX_PEAK', 'E_FLUXERR_PEAK', 'MAG_PEAK', 'MAGERR_PEAK', 'MAG_PSF_D', 'MAGERR_PSF_D', 'MAG_OPT_D', 'MAGERR_OPT_D']) # change some of the column names colnames_new = {'X_POS': 'X_POS_SCORR', 'Y_POS': 'Y_POS_SCORR', 'XVAR_POS': 'XVAR_POS_SCORR', 'YVAR_POS': 'YVAR_POS_SCORR', 'XYCOV_POS': 'XYCOV_POS_SCORR', 'ELONGATION': 'ELONG_SCORR', 'FLAGS': 'FLAGS_SCORR', 'FLAGS_MASK': 'FLAGS_MASK_SCORR'} for key in colnames_new.keys(): if key in table_trans.colnames: table_trans.rename_column (key, colnames_new[key]) table_trans['NUMBER'] = np.arange(len(table_trans))+1 ntrans = len(table_trans) # create output fits catalog; final table definition is determined # in [format_cat] table_trans.write('{}.transcat'.format(base_newref), format='fits', overwrite=True) # extract the thumbnail images corresponding to the transients in # case either thumbnail data is being saved or MeerCRAB # probabilities need to be calculated for ML/BG if (get_par(set_zogy.save_thumbnails,tel) or (get_par(set_zogy.ML_calc_prob,tel) and tel in ['ML1', 'BG2', 'BG3', 'BG4'])): data_full_list = [data_new, data_ref, data_D, data_Scorr] keys_thumbnails = ['THUMBNAIL_RED', 'THUMBNAIL_REF', 'THUMBNAIL_D', 'THUMBNAIL_SCORR'] n_thumbnails = len(keys_thumbnails) # coordinates to loop xcoords = table_trans['X_PEAK'] ycoords = table_trans['Y_PEAK'] ncoords = len(xcoords) # thumbnail size size_thumbnails = get_par(set_zogy.size_thumbnails,tel) # initialise output thumbnail columns data_thumbnails = np.zeros((n_thumbnails, ncoords, size_thumbnails, size_thumbnails)) # size of full input images; assuming they have identical shapes ysize, xsize = data_full_list[0].shape # loop x,y coordinates for i_pos in range(ncoords): # get index around x,y position using function [get_index_around_xy] index_full, index_tn = (get_index_around_xy( ysize, xsize, ycoords[i_pos], xcoords[i_pos], size_thumbnails)) # loop thumbnails and record pixels from full image to # data_thumbnails for i_tn, key in enumerate(keys_thumbnails): try: data_thumbnails[i_tn][i_pos][index_tn] = ( data_full_list[i_tn][index_full]) # if [orient_thumbnails] is switched on, # orient the thumbnails in North-up, East left # orientation if get_par(set_zogy.orient_thumbnails,tel): # input reference data is the remapped # reference image and its orientation is # the same as that of the new, D and Scorr # images, and so the same header # (header_toadd=header_newzogy) should be # used rather than the reference image # header header_ref #data_thumbnails[i_tn, i_pos] = orient_data ( # data_thumbnails[i_tn, i_pos], header_new, # MLBG_rot90_flip=True, tel=tel, log=log) data_thumbnails[i_tn][i_pos] = orient_data ( data_thumbnails[i_tn][i_pos], header_new, MLBG_rot90_flip=True, tel=tel, log=log) except Exception as e: if log is not None: log.info('skipping remapping of thumbnail at x,y: ' '{:.0f},{:.0f} due to exception: {}'. format(xcoords[i_pos], ycoords[i_pos], e)) else: data_thumbnails = None if get_par(set_zogy.timing,tel): log_timing_memory (t0=t, label='get_trans_alt', log=log) return table_trans, data_thumbnails ################################################################################ def get_trans (data_new, data_ref, data_D, data_Scorr, data_Fpsf, data_Fpsferr, data_new_mask, data_ref_mask, data_new_bkg_std, data_ref_bkg_std, header_new, header_ref, header_trans, psfex_bintable_new, psfex_bintable_ref, fits_cat_new, fits_cat_ref, log): """Function that selects transient candidates from the significance array (data_Scorr), and determines all regions with peak Scorr values above the set threshold, and down to where the region wings reaches the 2 sigma isochrone. Regions are discarded if they: - are too big or too small - contain both negatively and positively significant Scorr values (at 5 sigma level) within the same region - contain both negatively and positively significant Scorr values (at 5 sigma level) in this region and region at a pixel position that is due to the shift between the new and reference image (e.g. an artefact that is present in both the new and reference image will create transients with opposite significance at pixel positions equal to the shift between the images) - contain more flagged pixels than the maximum indicated in [set_zogy.transient_mask_max] Futhermore, a PSF fit to the D image is performed at the location of the filtered transients, using combination of the PSFs of the new and ref image, i.e. P_D in ZOGY-speak. This results
<filename>src/ecs_tasks_ops_qt5/qt5_ecs.py """Qt5 Tree Model for ecs.""" from PyQt5 import QtCore from PyQt5 import QtWidgets from ecs_tasks_ops import ecs_conf from ecs_tasks_ops import ecs_data from ecs_tasks_ops import ecs_facade from ecs_tasks_ops import ecs_ssh from ecs_tasks_ops import pretty_json class ECSTreeItem(QtWidgets.QTreeWidgetItem): """Tree Widgets Item for ECS elements.""" def __init__(self, name, identifier, detail_type, detail, parent=None): """Initialization of basic ECS element, with name, arn_id, type and json data.""" super(ECSTreeItem, self).__init__(parent, [name, identifier]) self.name = name self.identifier = identifier self.detail_type = detail_type self.detail = detail def refresh_children(self): """Refresh list of children elements.""" pass def get_attributes(self): """Get a list of basic attributes for detail view.""" return [ ("Name", self.name), ("Identifier", self.identifier), ("Detail Type", self.detail_type), ] def clear_children(self): """Clear list of children elements.""" for i in reversed(range(self.childCount())): self.removeChild(self.child(i)) def get_context_menu(self, menu): """Get basic context menu with mouse right-button.""" menu.addSeparator() menu.addAction("Refresh Children", self.refresh_children) menu.addAction("Show Detail", self.command_show_detail) def command_show_detail(self): """Update detail view with this elements.""" self.treeWidget().command_show_detail(self) class ECSClusterTreeItem(ECSTreeItem): """Tree Widgets Item for Clusters elements.""" def __init__(self, detail, parent=None): """Initialize Cluster item.""" super(ECSClusterTreeItem, self).__init__( name=detail["clusterName"], identifier=detail["clusterArn"], detail_type="cluster", detail=detail, parent=parent, ) def refresh_children(self): """Refresh cluster children with available options.""" self.clear_children() self.addChild(ECSListTasksClusterTreeItem(self.detail, self)) self.addChild(ECSListServicesClusterTreeItem(self.detail, self)) self.addChild(ECSListContainersClusterTreeItem(self.detail, self)) def get_attributes(self): """Get a list of basic attributes for cluters.""" return [ ("Name", self.name), ("Identifier", self.identifier), ("Detail Type", self.detail_type), ("Status", self.detail["status"]), ("Active Services", self.detail["activeServicesCount"]), ("Running Tasks", self.detail["runningTasksCount"]), ("Pending Tasks", self.detail["pendingTasksCount"]), ("Containers", self.detail["registeredContainerInstancesCount"]), ] class ECSListServicesClusterTreeItem(ECSTreeItem): """Tree Widgets Item for List of Services of a cluster.""" def __init__(self, detail, parent=None): """Initilize info to get a list of services for a cluster.""" super(ECSListServicesClusterTreeItem, self).__init__( name=f"Services on '{detail['clusterName']}'", identifier=detail["clusterName"], detail_type="list_services", detail=detail, parent=parent, ) def refresh_children(self): """Get a list of services for a cluster.""" self.clear_children() for service in ecs_data.get_services(self.identifier): self.addChild(ECSServiceTreeItem(service, self)) class ECSListTasksClusterTreeItem(ECSTreeItem): """Tree Widgets Item for List of Tasks of a cluster.""" def __init__(self, detail, parent=None): """Initialize info to get a list of tasks for a cluster.""" super(ECSListTasksClusterTreeItem, self).__init__( name=f"Tasks on '{detail['clusterName']}'", identifier=detail["clusterName"], detail_type="list_services", detail=detail, parent=parent, ) def refresh_children(self): """Get a list of tasks for a cluster.""" self.clear_children() for task in ecs_data.get_tasks_cluster(self.identifier): self.addChild(ECSTaskTreeItem(task, self)) class ECSListContainersClusterTreeItem(ECSTreeItem): """Tree Widgets Item for List of Containers Instances of a cluster.""" def __init__(self, detail, parent=None): """Initialize info to get a list of container instances for a cluster.""" super(ECSListContainersClusterTreeItem, self).__init__( name=f"Containers on '{detail['clusterName']}'", identifier=detail["clusterName"], detail_type="list_services", detail=detail, parent=parent, ) def refresh_children(self): """Get a list of container instances for a cluster.""" self.clear_children() for container in ecs_data.get_containers_instances(self.identifier): self.addChild(ECSContainerTreeItem(container, self.identifier, self)) class ECSServiceTreeItem(ECSTreeItem): """Tree Widgets Item for Services elements.""" def __init__(self, detail, parent=None): """Contains information about a service.""" super(ECSServiceTreeItem, self).__init__( name=detail["serviceName"], identifier=detail["serviceArn"], detail_type="service", detail=detail, parent=parent, ) self.cluster_identifier = detail["clusterArn"] def refresh_children(self): """Get a list of tasks for this service.""" self.clear_children() for task in ecs_data.get_tasks_service( self.cluster_identifier, self.identifier ): self.addChild(ECSTaskTreeItem(task, self)) def get_attributes(self): """Detail attributes view for this service.""" deployment_config = self.detail["deploymentConfiguration"] min_bracket = deployment_config["minimumHealthyPercent"] max_bracket = deployment_config["maximumPercent"] return [ ("Name", self.name), ("Identifier", self.identifier), ("Detail Type", self.detail_type), ("Status", self.detail["status"]), ("Task Definition", self.detail["taskDefinition"]), ("Running", self.detail["runningCount"]), ("Pending", self.detail["pendingCount"]), ("Desired", self.detail["desiredCount"]), ( "Redeployment bracket", "Min: " + str(min_bracket) + "%, Max: " + str(max_bracket) + "%", ), ] def get_context_menu(self, menu): """Context menu for a service item.""" menu.addAction("Show Events", self.command_service_show_events) menu.addAction("Force Restart Service", self.command_service_restart) super(ECSServiceTreeItem, self).get_context_menu(menu) def command_service_restart(self): """Send a restart command for this service.""" self.treeWidget().command_service_restart(self) def command_service_show_events(self): """Open a list of events produced in this services.""" self.treeWidget().command_service_show_events(self) class ECSTaskTreeItem(ECSTreeItem): """Tree Widgets Item for Tasks elements.""" def __init__(self, detail, parent=None): """Contains information about a task.""" super(ECSTaskTreeItem, self).__init__( name=detail["name"], identifier=detail["taskArn"], detail_type="task", detail=detail, parent=parent, ) self.cluster_identifier = self.detail["clusterArn"] def refresh_children(self): """Get a list of docker containers of this task.""" self.clear_children() for task in ecs_data.get_containers_tasks( self.cluster_identifier, self.identifier ): self.addChild( ECSDockerContainerTreeItem( task, self.identifier, self.cluster_identifier, self ) ) def get_attributes(self): """Get a list of attributes for detail view.""" return [ ("Name", self.name), ("Identifier", self.identifier), ("Detail Type", self.detail_type), ("Cluster Arn", self.detail["clusterArn"]), ("Status", self.detail["lastStatus"]), ("Desired Status", self.detail["desiredStatus"]), ("EC2 Instance", self.detail["ec2InstanceId"]), ("Availability Zone", self.detail["availabilityZone"]), ("Connectivity", self.detail.get("connectivity", "")), ("Task Definition", self.detail["taskDefinitionArn"]), ( "Container Instance ID", self.detail["containerInstanceArn"].split("/", 1)[1], ), ("N. Docker images", len(self.detail["containers"])), ("Networks", "\n".join(self.detail["networks"])), ("Connectivity Time", self.detail["connectivityAt"]), ] def get_context_menu(self, menu): """Context menu for this task item.""" menu.addAction("Stop Task", self.command_task_stop) menu.addAction("SSH Instance Container", self.command_container_ssh) menu.addAction("Docker Log (First Task)", self.command_task_log) super(ECSTaskTreeItem, self).get_context_menu(menu) def command_task_stop(self): """Send stop command to ECS for this task.""" self.treeWidget().command_task_stop(self) def command_container_ssh(self): """Access to the continer instance of this tasks through ssh.""" self.treeWidget().command_container_ssh(self) def command_task_log(self): """Show log info for the first docker container of this tasks.""" self.treeWidget().command_task_log(self) class ECSContainerTreeItem(ECSTreeItem): """Tree Widgets Item for Container Instances elements.""" def __init__(self, detail, cluster_identifier, parent=None): """Contains information about container instances.""" super(ECSContainerTreeItem, self).__init__( name=detail["ec2InstanceId"], identifier=detail["containerInstanceArn"], detail_type="container", detail=detail, parent=parent, ) self.cluster_identifier = cluster_identifier def refresh_children(self): """Get a list of tasks of this container instance.""" self.clear_children() for task in ecs_data.get_tasks_container_instance( self.cluster_identifier, self.identifier ): self.addChild(ECSTaskTreeItem(task, self)) def get_attributes(self): """Get a list of attributes for detail view.""" return [ ("Name", self.name), ("Identifier", self.identifier), ("Detail Type", self.detail_type), ("Status", self.detail["status"]), ("EC2 Instance Id", self.detail["ec2InstanceId"]), ("Running Tasks", self.detail["runningTasksCount"]), ("Pending Tasks", self.detail["pendingTasksCount"]), ("AMI Id", self.detail["ami_id"]), ("Instance Type", self.detail["instance_type"]), ("Availability Zone", self.detail["availability_zone"]), ( "Memory", "Available: " + str(self.detail["available_memory"]) + " Total: " + str(self.detail["total_memory"]), ), ( "CPU", "Available: " + str(self.detail["available_cpu"]) + " Total: " + str(self.detail["total_cpu"]), ), ("Taken ports", self.detail["taken_ports"]), ] def get_context_menu(self, menu): """Context menu for container instances.""" menu.addAction("SSH Instance Container", self.command_container_ssh) super(ECSContainerTreeItem, self).get_context_menu(menu) def command_container_ssh(self): """Access to this container instance through ssh.""" self.treeWidget().command_container_ssh(self) class ECSDockerContainerTreeItem(ECSTreeItem): """Tree Widgets Item for Docker Containers elements.""" def __init__(self, detail, task_identifier, cluster_identifier, parent=None): """Contains information about docker container.""" super(ECSDockerContainerTreeItem, self).__init__( name=detail["name"], identifier=detail["containerArn"], detail_type="docker_container", detail=detail, parent=parent, ) self.cluster_identifier = cluster_identifier self.task_identifier = task_identifier # def refresh_children(self): # self.clear_children() # for task in ecs_data.get_tasks_container_instance(self.cluster_identifier, self.identifier): # self.addChild(ECSTaskTreeItem(task, self)) def get_attributes(self): """Get a list of attributes for detail view.""" return [ ("Name", self.name), ("Identifier", self.identifier), ("Detail Type", self.detail_type), ("Container Arn", self.detail["containerArn"]), ("Status", self.detail["lastStatus"]), ("Health Status", self.detail["healthStatus"]), ("Docker id", self.detail["runtimeId"]), ("Docker Image", self.detail["image"]), ("CPU", self.detail["cpu"]), # ('Memory Reservation', self.detail['memoryReservation']), ("Instance ID", self.detail["ec2InstanceId"]), ("Networks", self.detail["networks"]), ] def get_context_menu(self, menu): """Context menu for docker containers.""" menu.addAction("SSH Instance Container", self.command_container_ssh) menu.addAction("Docker log", self.command_docker_log) menu.addAction("Docker exec", self.command_docker_exec) super(ECSDockerContainerTreeItem, self).get_context_menu(menu) def command_container_ssh(self): """Access to container instances server which contains this docker container.""" self.treeWidget().command_container_ssh(self) def command_docker_log(self): """Show log information of this docker container.""" self.treeWidget().command_docker_log(self) def command_docker_exec(self): """Exec a command on this docker container.""" self.treeWidget().command_docker_exec(self) class ECSElementsTreeWidget(QtWidgets.QTreeWidget): """Tree Widgets for all ECS elements.""" sig_status_changed = QtCore.pyqtSignal(str) sig_command_show_detail = QtCore.pyqtSignal(QtWidgets.QTreeWidgetItem) sig_command_service_restart = QtCore.pyqtSignal(QtWidgets.QTreeWidgetItem) sig_command_service_show_events = QtCore.pyqtSignal(QtWidgets.QTreeWidgetItem) sig_command_task_stop = QtCore.pyqtSignal(QtWidgets.QTreeWidgetItem) sig_command_task_log = QtCore.pyqtSignal(QtWidgets.QTreeWidgetItem) sig_command_container_ssh = QtCore.pyqtSignal(QtWidgets.QTreeWidgetItem) sig_command_docker_log = QtCore.pyqtSignal(QtWidgets.QTreeWidgetItem) sig_command_docker_exec = QtCore.pyqtSignal(QtWidgets.QTreeWidgetItem) def __init__(self, parent=None): """Initialize tree widgets.""" super(ECSElementsTreeWidget, self).__init__(parent) self.reload_cluster_info() self.currentItemChanged.connect( lambda item: self.show_status_on_selection(item) ) self.itemActivated.connect(lambda item: item.refresh_children()) self.itemDoubleClicked.connect(lambda item: item.refresh_children()) def contextMenuEvent(self, event): """Open context menu depends on item options.""" item = self.itemAt(event.pos()) if item: menu = QtWidgets.QMenu(self) item.get_context_menu(menu) menu.exec_(event.globalPos()) else: super(ECSElementsTreeWidget, self).contextMenuEvent(event) def keyPressEvent(self, e): """Process key pressed on this widget.""" # if e.key() == QtCore.Qt.Key_Escape: # self.close() super(ECSElementsTreeWidget, self).keyPressEvent(e) @QtCore.pyqtSlot() def reload_cluster_info(self): """Reload a list of clusters.""" self.clear() for cluster in ecs_data.get_clusters(): self.addTopLevelItem(ECSClusterTreeItem(cluster)) def show_status_on_selection(self, item): """Update status bar with item info.""" if item: self.sig_status_changed.emit(f"Selecting {item.name}: {item.identifier}") def command_show_detail(self, item): """Show attributes on detail view widget.""" if item and isinstance(item, ECSTreeItem): self.sig_status_changed.emit( f"Show details for {item.name}: {item.identifier}" ) self.sig_command_show_detail.emit(item) def command_service_restart(self, item): """Restart a service command.""" if item and isinstance(item, ECSTreeItem): self.sig_status_changed.emit( f"Restarting service {item.name}: {item.identifier}" ) self.sig_command_service_restart.emit(item) def command_task_stop(self, item): """Stop a task command.""" if item and isinstance(item, ECSTreeItem): self.sig_status_changed.emit( f"Stopping task {item.name}: {item.identifier}" ) self.sig_command_task_stop.emit(item) def command_task_log(self, item): """Show log of a task.""" if item and isinstance(item, ECSTreeItem): self.sig_status_changed.emit(f"Log for task {item.name}: {item.identifier}") self.sig_command_task_log.emit(item) def command_container_ssh(self, item): """Access to container instance.""" if item and isinstance(item, ECSTreeItem): self.sig_status_changed.emit( f"Access to ssh for {item.name}: {item.identifier}" ) self.sig_command_container_ssh.emit(item) def command_docker_log(self, item): """Show log of docker container.""" if item and isinstance(item, ECSTreeItem): self.sig_status_changed.emit( f"Docker log for {item.name}: {item.identifier}" ) self.sig_command_docker_log.emit(item) def command_docker_exec(self, item): """Execute command on docker container.""" if item and isinstance(item, ECSTreeItem): self.sig_status_changed.emit( f"Docker exec for {item.name}: {item.identifier}" ) self.sig_command_docker_exec.emit(item) def command_service_show_events(self, item): """Show events of a service.""" if item and isinstance(item, ECSTreeItem): self.sig_status_changed.emit( f"Show Events for {item.name}: {item.identifier}" ) self.sig_command_service_show_events.emit(item) # @QtCore.pyqtSignal(str) # def operation_status(self, message): # self.emit class ECSAttributesTreeWidget(QtWidgets.QTreeWidget): """Widget to show item attributes.""" sig_status_changed = QtCore.pyqtSignal(str) def __init__(self, parent=None): """Initialize attributes view.""" super(ECSAttributesTreeWidget, self).__init__(parent)
from tkinter import * import time, mysql.connector,csv,os,subprocess from PIL import Image from ast import literal_eval from mysql.connector import errorcode from tkinter import messagebox from tkinter.filedialog import asksaveasfilename class window(Tk): def __init__(self): super().__init__() # create sql connection obeject and testing connection try: with open("dbconn.csv") as csv_file: csv_reader = csv.reader(csv_file, delimiter=',') for row in csv_reader: self.username=str(row[0]) self.password=str(row[1]) self.host=str(row[2]) self.database=str(row[3]) self.tablename="medicalbill" break except: messagebox.showerror("Error","Please configure database connection. Goto- Options->DB Connection") try: self.cnx = mysql.connector.connect(user=self.username, password=self.password, host=self.host, database=self.database) except mysql.connector.Error as err: if err.errno == errorcode.ER_ACCESS_DENIED_ERROR: messagebox.showerror(title="Error",message="Invalid user name or Password") print("Something is wrong with your user name or password. Goto: Options->DB Connection to setup connection") elif err.errno == errorcode.ER_BAD_DB_ERROR: messagebox.showerror(title="Error",message="Database does not exsit. Goto: Options->DB Connection to setup connection") print("Database does not exist") else: messagebox.showerror(title="Error",message="Connection Error. Goto: Options->DB Connection to setup connection") print(err) # else: # self.cursor=self.cnx.cursor() # self.cnx.close() # initializing window self.geometry("852x600+0+0") self.minsize(852,600) self.title("Medical Billing System") self.config(bg="powder blue") try: self.iconbitmap("icon.ico") except: pass def commit_db(self,query): self.cnx.database = self.database cursor=self.cnx.cursor() cursor.execute(query) self.cnx.commit() def statusbar(self): ''' To show status at buttom of GUI ''' self.status=StringVar() self.status.set("Ready") self.sbar=Label(self,textvariable=self.status,relief=SUNKEN,anchor="w") self.sbar.pack(side=BOTTOM,fill=X) def update_status(self,state="Ready",freeze=0): ''' To update status of GUI ''' self.status.set(state) self.sbar.update() if freeze>0: time.sleep(freeze) def create_button(self,master=None,btntxt="Button",bg="sky blue",relief=RAISED,bd=6,funcname=None,side=None,padx=3,pady=3,anchor=None,ipadx=10,ipady=None,**kwargs): ''' To Create a button ''' kargs={} for key,value in kwargs.items(): kargs.__setitem__(key,value) btn=Button(master,text=btntxt,command=funcname,bg=bg,relief=relief,bd=bd,**kargs) btn.pack(side=side,padx=padx,pady=pady,anchor=anchor,ipadx=ipadx,ipady=ipady) def create_grid_label(self,master=None,text="unknown",bg=None,relief=SUNKEN,bd=None,padx=None,pady=None,ipady=None,ipadx=None,column=None,row=None,columnspan=None,rowspan=None,**kwargs): ''' To Create a label ''' kargs={} for key,value in kwargs.items(): kargs.__setitem__(key,value) label=Label(master,text=text,bg=bg,relief=relief,bd=bd,**kargs) label.grid(ipadx=ipadx,ipady=ipady,columnspan=columnspan,rowspan=rowspan,row=row,column=column) def create_grid_entry(self,master=None,bg=None,variable=None,relief=SUNKEN,bd=None,padx=None,pady=None,ipady=None,ipadx=None,column=None,row=None,columnspan=None,rowspan=None,**kwargs): ''' To Create a entry ''' kargs={} for key,value in kwargs.items(): kargs.__setitem__(key,value) entry=Entry(master,bg=bg,relief=relief,bd=bd,textvariable=variable,**kargs) entry.grid(ipadx=ipadx,ipady=ipady,padx=padx,pady=pady,columnspan=columnspan,rowspan=rowspan,row=row,column=column) def exit(self): self.cnx.close() # Closing the connection before exit self.destroy() class conn_window(Frame): def __init__(self): Frame.__init__(self) window1=Toplevel(self) window1.title("Database connection wizard") window1.geometry("500x150+100+100") try: window1.iconbitmap("dbconn.ico") except: pass # methods def updateconnfile(username,password,host,database): with open("dbconn.csv","w") as csv_file: file=csv.writer(csv_file, delimiter=',', quotechar='"', quoting=csv.QUOTE_MINIMAL) file.writerow([username,password,host,database]) def updateConnectionData(): user=username.get() passwd=password.get() hst=host.get() db=database.get() try: cnx = mysql.connector.connect(user=user, password=<PASSWORD>, host=hst, database=db) except mysql.connector.Error as err: if err.errno == errorcode.ER_ACCESS_DENIED_ERROR: Label(frame1,text="Invalid user name or Password", bg="red").pack(side=TOP,pady=3) elif err.errno == errorcode.ER_BAD_DB_ERROR: Label(frame1,text="Database doesnot exit. Creating Database...",bg="red").pack(side=TOP,pady=3) # intializing connection cnx = mysql.connector.connect(user=user, password=<PASSWORD>, host=hst) # creating cursor cursor = cnx.cursor() cursor.execute(f"CREATE DATABASE IF NOT EXISTS {db} DEFAULT CHARACTER SET 'utf8'") # updating database details cnx.database = db Label(frame1,text=f"Success!!! Please restart the program to continue...",bg="green").pack(side=TOP,pady=3) # initialing table cursor.execute(f"CREATE TABLE `{db}`.`medicalbill` ( `srl_no` INT NOT NULL AUTO_INCREMENT,`invoice_no` INT NOT NULL , `customer` VARCHAR(50) NOT NULL , `address` VARCHAR(150) NOT NULL , `city` VARCHAR(50) NOT NULL , `state` VARCHAR(50) NOT NULL , `doctor` VARCHAR(50) NOT NULL , `purchage_data` TEXT NOT NULL , PRIMARY KEY (`srl_no`)) ENGINE = InnoDB") # Intializing invoice number from 1001 # cursor.execute(f"ALTER TABLE medicalbill AUTO_INCREMENT=1001;") cursor.close() cnx.close() else: Label(frame1,text=f"Error{err}", bg="red").pack(side=TOP,pady=3) else: Label(frame1,text="Success!!! Restart the program.",bg="green").pack(side=TOP) cnx.close() updateconnfile(username=user,password=<PASSWORD>,host=hst,database=db) username=StringVar() password=StringVar() host=StringVar() database=StringVar() try: with open("dbconn.csv") as csv_file: csv_reader = csv.reader(csv_file, delimiter=',') for row in csv_reader: username.set(str(row[0])) password.set(str(row[1])) host.set(str(row[2])) database.set(str(row[3])) break except: messagebox.showinfo("Info","please enter appropriate details to continue") with open("dbconn.csv","w") as csv_file: file=csv.writer(csv_file, delimiter=',', quotechar='"', quoting=csv.QUOTE_MINIMAL) file.writerow(["lipun","1234","127.0.0.1","invoice"]) window1.destroy() new=conn_window() frame=Frame(window1) frame.pack(anchor="w",padx=10,pady=10) Label(frame,text="User Name",font=font1).grid(row=0,column=0,padx=2,sticky="w") Entry(frame,textvariable=username).grid(row=0,column=1,padx=2) Label(frame,text="Password",font=font1).grid(row=1,column=0,padx=2,sticky="w") Entry(frame,textvariable=password).grid(row=1,column=1,padx=2) Label(frame,text="Host",font=font1).grid(row=0,column=2,padx=2,sticky="w") Entry(frame,textvariable=host).grid(row=0,column=3,padx=2) Label(frame,text="Database Name",font=font1).grid(row=1,column=2,padx=2,sticky="w") Entry(frame,textvariable=database).grid(row=1,column=3,padx=2) frame1=Frame(window1) frame1.pack(anchor="w",padx=10,pady=10) Button(frame1,text="update",font=font1,bg="skyblue",command=updateConnectionData).pack(padx=10,pady=5,side=LEFT) Button(frame1,text="close",font=font1,bg="skyblue",command=window1.destroy).pack(side=LEFT,padx=10) class print_window(Frame): def __init__(self): Frame.__init__(self) window1=Toplevel(self) # definations def savedata(): if check_duplicate_invoice(invoice=inv_no.get()): response=messagebox.askquestion("Question","Do you want to save DUPLICATE INVOICE?") if response == "yes": savePDF() clear_entries() else: savePDF() push_invoice() def savePDF(): try: self.canvas.postscript(file="tmp.ps",colormode='color') file=asksaveasfilename(initialfile=f"{inv_no.get()}.pdf",defaultextension=".pdf",filetypes=[("All Files","*.*"),("PDF Documents","*.pdf")]) process = subprocess.Popen(["ps2pdf", "tmp.ps", file], shell=True) process.wait() except: messagebox.showerror("Error","Install Ghost Script and add it's bin and lib file to system envronment.") def printdata(): try: self.canvas.postscript(file="tmp.ps",colormode='color') img=Image.open("tmp.ps") img.save("tmp.png") os.startfile("tmp.png","print") except: messagebox.showerror("Error","Install Ghost Script and add it's bin and lib file to system envronment.") def checkprintdata(): if check_duplicate_invoice(invoice=inv_no.get()): response=messagebox.askquestion("Question","Do you want to print DUPLICATE INVOICE?") if response == "yes": printdata() clear_entries() else: push_invoice() printdata() # Initializing Window window1.geometry("650x620+100+20") window1.minsize(650,600) window1.configure(bg="gray20") window1.title("Print") # Trying to set icon try: window1.iconbitmap("print.ico") except: pass # variables invoice=inv_no.get() customer=customer_name.get() c_address= local_add.get() c_city= city.get() c_state= state.get() doc= doctor.get() purchage_data= get_table() total= totalInvoiceValue() # FONTS fontlabel="Eras 9 bold" fontinvoice= "Lucida 13 bold" fontdata= "Lucida 13 normal" fontdata1= "Lucida 8 bold" fontdata2= "Lucida 8 normal" # Creatting frame for displaying preview frame1=Frame(window1) frame1.pack(fill=BOTH) # Frame for buttons frame2=Frame(window1,bg="gray30") frame2.pack(side=BOTTOM,fill=X) Button(frame2,text="Print",font=font2,bd=3,relief=RAISED,command=checkprintdata).pack(side=LEFT,padx=10,pady=5) Button(frame2,text="Save As PDF",font=font2,bd=3,relief=RAISED,command=savedata).pack(side=LEFT,padx=10,pady=5) Button(frame2,text="Cancel",font=font2,bd=3,relief=RAISED, command=window1.destroy).pack(side=LEFT,padx=10,pady=5) # creating casvas and ploting data self.canvaswidth=600 self.canvasheight=550 self.canvas=Canvas(window1,height=self.canvasheight,width=self.canvaswidth,bd=1,relief=GROOVE) self.canvas.create_text(300,25,font="Rockwell 17 bold",text="PAYMENT RECEIPT") self.canvas.create_line(0,45,600,45,dash=(200,1)) self.canvas.create_text(10,70,font=fontlabel,text="INVOICE NUMBER:",anchor="w") self.canvas.create_text(120,70,font=fontinvoice,text=invoice,anchor="w") self.canvas.create_text(10,100,font=fontlabel,text="CUSTOMER NAME:",anchor="w") self.canvas.create_text(120,100,font=fontdata,text=customer,anchor="w") self.canvas.create_text(10,130,font=fontlabel,text="ADDRESS:",anchor="w") self.canvas.create_text(73,130,font=fontdata,text=c_address,anchor="w") self.canvas.create_text(392,130,font=fontlabel,text="CITY:",anchor="w") self.canvas.create_text(425,130,font=fontdata,text=c_city,anchor="w") self.canvas.create_text(380,160,font=fontlabel,text="STATE:",anchor="w") self.canvas.create_text(425,160,font=fontdata,text=c_state,anchor="w") self.canvas.create_text(10,160,font=fontlabel,text="REFERRED BY:",anchor="w") self.canvas.create_text(93,160,font=fontdata,text=doc,anchor="w") self.canvas.create_line(10,200,590,200) #table upper line self.canvas.create_line(10,400,590,400) #table bottom line self.canvas.create_line(10,200,10,400) #table left line self.canvas.create_line(590,200,590,400)#table right line self.canvas.create_line(50,200,50,400,dash=(4,1))#table column1 self.canvas.create_line(340,200,340,400,dash=(4,1))#table column2 self.canvas.create_line(415,200,415,400,dash=(4,1))#table column3 self.canvas.create_line(490,200,490,400,dash=(4,1))#table column4 #self.canvas.create_line(10,230,590,230,dash=(4,1)) #table row1 ycord=230 a=0 while a<10: self.canvas.create_line(10,ycord,590,ycord,dash=(4,1)) ycord+=17 a+=1 self.canvas.create_text(20,210,font=fontdata1,text="Srl.",anchor="w") self.canvas.create_text(70,210,font=fontdata1,text="MEDICINE NAME",anchor="w") self.canvas.create_text(365,210,font=fontdata1,text="QTY",anchor="w") self.canvas.create_text(425,210,font=fontdata1,text="UNIT PRICE",anchor="w") self.canvas.create_text(505,210,font=fontdata1,text="TOTAL PRICE",anchor="w") self.canvas.create_text(370,415,font=fontdata,text="GRAND TOTAL:",anchor="w") self.canvas.create_text(500,415,font=fontdata,text="₹"+total,anchor="w") # self.canvas.create_text(25,233,font=fontdata1,text="1",anchor="w") ycord=238 srl=1 for srl in range(1,11): self.canvas.create_text(25,ycord,font=fontdata1,text=str(srl),anchor="w") ycord+=17 srl+=1 ycord=238 xcord=[60,345,420,500] for row in range(10): for column in range(4): self.canvas.create_text(xcord[column],ycord,font=fontdata2,text=purchage_data[row][column],anchor="w") ycord+=17 self.canvas.create_text(450,460,font=fontlabel,text="SIGNATURE",anchor="w") self.canvas.create_line(400,450,570,450) self.canvas.create_text(300,490,font="Bookman 14 bold",text="JENA MEDICAL STORE") self.canvas.create_text(300,510,font="Arial 11 normal",text="25/10 New market (Near SBI ATM), Choota Govindpur, Jamshedpur, pin-831010") self.canvas.create_text(300,525,font="Arial 8 normal",text="Busniess timing: 8AM - 8PM (online delivery abailabe on phone. Call 999999999 for enquiry)") self.canvas.create_text(300,542,font="Arial 8 normal",text="Tel- 0657 669 6652 Mobile- 999999999 / 88888888888") self.canvas.pack(padx=10,pady=10) # Gui Variables for setting widets font1="Arial 12 normal" font2="Arial 13 normal" theme="powder blue" labelwidth=15 # Main Program if __name__ == "__main__": # Definations here def totalInvoiceValue(): '''Retuns total invoice value''' table=get_table() total="0" for row in range(10): for column in range(3,4): # total+=int(table[row][column]) val=table[row][column] if val=="": total+="+0" else: total+="+"+val # Evaluating concatinated string data eg. "1+2+3+4" will be evaluated as 10. total=eval(total) return str(total) def calTotal(event): '''Multiply qty with price and return value''' # Requsting Table table= get_table() # Extracting qty and unit price information from table # Making list of tupples (qty,price) format data=[] for val in range(10): data.append((table[val][1],table[val][2])) # calculating total total=[] for qty,price in data: if qty=="" or price=="": total.append("") else: total.append(float(qty)*float(price)) # Displaying total on screen for row in range(1,11): for column in range(4,5): index=(row,column) entry[index].delete(0,END) entry[index].insert(0,str(total[row-1])) def clear_entries(row=10,column=4): '''Clear Previous entries''' rows=row+1 columns=column+1 customer_name.set("") local_add.set("") doctor.set("Dr. ") for row in range(1,rows): for column in range(1,columns): index = (row, column) entry[index].delete(0,'end') def encodeList(list): '''Encoding algorith of list for database entry''' string=str(list) prepared_data="" for char in string: if char=="\'": prepared_data += "\\'" elif char==",": prepared_data += "\\," else: prepared_data += char return prepared_data def decodeList(str): '''decoding algorithm for encoded list''' list=str.replace("\\","") list=literal_eval(list) #convering string to list return list def plot_invoice(): '''Recreate invoice from invoice number. It connect to data base and fetch respective data from database.''' try: inv=inv_no.get() cursor= root.cnx.cursor() query=f"SELECT * FROM `medicalbill` where invoice_no={inv}" cursor.execute(query) row=cursor.fetchall() if row: clear_entries() cursor.execute(query) for(srl_no,invoice_no,customer,address,cty,ste,doc,purchage_data) in cursor: customer_name.set(customer) local_add.set(address) city.set(cty) state.set(ste) doctor.set(doc) decoded_list=decodeList(purchage_data) set_table(decoded_list) cursor.close() else: messagebox.showerror("Error","No Entry Found on database!!!") cursor.close() except: messagebox.showerror("Error","Please Enter a Value. If value entered, Please check database connection.") def set_invoice_no(): inv=get_invoice_no() inv_no.set(str(inv)) frame1.update() def get_invoice_no(): '''It coonect to database then fetch the last invoice number and return next invoice number''' try: cursor= root.cnx.cursor() query="SELECT * FROM `medicalbill` ORDER BY `invoice_no` DESC" cursor.execute(query) list= cursor.fetchall() #retuns a list of tupples(each result in a tuple). if not list: lastinv="1001" else: l=1 for row in list: if l==1: inv=row[1] l+=1 else: continue lastinv=inv+1 cursor.close() except: cursor.close() messagebox.showerror("Error","Internal Error") return lastinv def create_invoice(): '''Create a invoice without printing''' try: push_invoice() except: messagebox.showerror("error","Internal Error") else: set_invoice_no() def check_duplicate_invoice(invoice): cursor= root.cnx.cursor() query=f"SELECT * FROM `medicalbill` WHERE invoice_no={invoice}" cursor.execute(query) row= cursor.fetchall() cursor.close() if row: return True #duplicate exist else: return False def validate_form(): '''Form Validation''' invoice= inv_no.get() customer=customer_name.get() table= get_table() count=1 if invoice=="": messagebox.showwarning("Information","Invoice Number Required!") return False elif customer=="": messagebox.showwarning("Information","Customer Name Required!") return False elif table[0][0]=="": messagebox.showwarning("Information","Atleast 1 Item Required!") return False elif count==1: rowcount=1 for row in table: if row[0] != "": if row[1]=="" or row[2]=="" or row[3]=="": messagebox.showwarning("Information",f"Fill all details in Row No-{rowcount}") return False rowcount+=1 return True def push_invoice(): '''It push invoice data entered by user to database''' root.update_status("Pushing data to database...") invoice= get_invoice_no() if check_duplicate_invoice(invoice): messagebox.showerror("Error","Duplicate Entry Found") elif validate_form(): customer=customer_name.get() purchage_data= get_table() c_address= local_add.get() c_city= city.get() c_state= state.get() doc= doctor.get() #encoding list data to insert into db prepared_data= encodeList(purchage_data) try: root.commit_db(query=f"INSERT INTO `{root.database}`.`{root.tablename}` (`invoice_no`,`customer`, `address`, `city`, `state`, `doctor`, `purchage_data`) VALUES ('{invoice}','{customer}', '{c_address}', '{c_city}', '{c_state}', '{doc}', '{prepared_data}')") messagebox.showinfo("Information","Invoice Created") except: messagebox.showerror("Error","Error
<filename>AnalyzeControl.py #!/usr/bin/env python """ Tencent is pleased to support the open source community by making HaboMalHunter available. Copyright (C) 2017 THL A29 Limited, a Tencent company. All rights reserved. Licensed under the MIT License (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://opensource.org/licenses/MIT Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ """ Author: Date: August 08, 2016 Description: Linux Malware Analysis System """ """ usage: AnalyzeControl.py [-h] [-v] [-t] [-z] [-i TIME_LIMIT_DYNAMIC] [-s] [-c] [-e CONFIG_PATH] -l TARGET Linux Malware Analysis System optional arguments: -h, --help show this help message and exit -v, --verbose Display debug messages -t, --test Only init and output Tag files -z, --zip Indicate the target is a compressed package -i TIME_LIMIT_DYNAMIC, --time_limit_dynamic TIME_LIMIT_DYNAMIC Set the timeout limitation (seconds) for dynamic analysis -s, --static_only Only static analysis -c, --clean Clean the workspace -e CONFIG_PATH, --config_path CONFIG_PATH Set the configuration path -l TARGET, --target TARGET Set the absolute path of the target """ import sys import os import stat import hashlib import subprocess import argparse import ConfigParser import logging import logging.handlers import shutil import tempfile import json # Customised Package import static import dynamic import metrics import base TIME_LIMIT_DYNAMIC_DEF = 60 # 60 seconds for dynamic analysis timeout PROJECT_DIR = os.path.dirname(os.path.abspath(__file__)) # current_file dir BASE_HOME = PROJECT_DIR SECTION_DEF = 'main' CONFIG_PATH_DEF = os.path.join(PROJECT_DIR, 'config.ini') ENV_PREFIX = 'HABO_' LOG_FMT = "%(asctime)s [%(filename)s:%(lineno)d %(funcName)s] %(levelname)s: %(message)s" # global variables log = logging.getLogger() class Config_OBJ: def __init__(self, **entries): self.__dict__.update(entries) def strTobool(value): true_list = ["yes", "y", "true", "t", "1"] false_list = ["no", "n", "false", "f", "0", "0.0", "", "none"] v = str(value).lower() if v in true_list: return True if v in false_list: return False return False def init_cfg(cfg_path, args): """ The priority level: define > args > env > ini """ cfg = {} # file conf_parser = ConfigParser.ConfigParser() if os.path.exists(cfg_path): conf_parser.read(cfg_path) #print(conf_parser.items('main')) for k,v in conf_parser.items(SECTION_DEF): cfg[k]=v # env for k,v in os.environ.items(): if k.startswith(ENV_PREFIX): cfg_key = k[len(ENV_PREFIX):] cfg[cfg_key]=v # args args_dict = vars(args) for k,v in args_dict.iteritems(): cfg[k]=v # define cfg["BASE_HOME"] = BASE_HOME # adjustment file_log_dir = os.path.join(BASE_HOME, cfg["log_dir"]) cfg["file_log_dir"] = file_log_dir cfg["static_finished_fname"] = os.path.join(file_log_dir,cfg["static_finished_fname"]) cfg["dynamic_finished_fname"] = os.path.join(file_log_dir,cfg["dynamic_finished_fname"]) # in order to using like cfg.log_dir cfg = Config_OBJ(**cfg) # force verbose cfg.verbose=True # convert string to int cfg.time_limit_dynamic = int(cfg.time_limit_dynamic) cfg.strings_limit = int(cfg.strings_limit) cfg.decompress_limit = int(cfg.decompress_limit) cfg.tcpdump_limit = int(cfg.tcpdump_limit) cfg.sysdig_limit = int(cfg.sysdig_limit) cfg.trace_limit = int(cfg.trace_limit) # convert string to bool cfg.is_inplace = strTobool(cfg.is_inplace) cfg.enable_inetsim = strTobool(cfg.enable_inetsim) cfg.enable_prefix_remove = strTobool(cfg.enable_prefix_remove) cfg.enable_mem_analysis = strTobool(cfg.enable_mem_analysis) return cfg def init_arguments(argv): parser = argparse.ArgumentParser(description='Linux Malware Analysis System') parser.add_argument('-v', '--verbose', help='Display debug messages', action='store_true', required=False) parser.add_argument('-t', '--test', help='Only init and output Tag files', action='store_true', required=False) parser.add_argument('-z', '--zip', help='Indicate the target is a compressed package', action='store_true', required=False) #please config time out in ini file #parser.add_argument('-i', '--time_limit_dynamic', help='Set the timeout limitation (seconds) for dynamic analysis', type=int, default=TIME_LIMIT_DYNAMIC_DEF, required=False) parser.add_argument('-s', '--static_only', help='Only static analysis', action='store_true', required=False) parser.add_argument('-c', '--clean', help='Clean the workspace', action='store_true', required=False) parser.add_argument('-e', '--config_path', help='Set the configuration path', type=str, default=CONFIG_PATH_DEF, required=False) # required arg parser.add_argument('-l', '--target', help='Set the absolute path of the target', type=str, required=True) args = parser.parse_args() # cd into base_home os.chdir(BASE_HOME) # configuration init # I need change dir before pasering the configuration. cfg = init_cfg(args.config_path,args) return cfg def init_log(cfg): # dir file_log_dir = cfg.file_log_dir if not os.path.exists(file_log_dir): os.mkdir(file_log_dir) fmt = logging.Formatter(LOG_FMT) # file file_log_path = os.path.join(BASE_HOME, cfg.log_dir, cfg.file_log) file_handler = logging.handlers.WatchedFileHandler(file_log_path) file_handler.setFormatter(fmt) log.addHandler(file_handler) # Console console_handler = logging.StreamHandler() console_handler.setFormatter(fmt) log.addHandler(console_handler) if cfg.verbose: log.setLevel(logging.DEBUG) else: log.setLevel(logging.ERROR) log.info("Linux Malware Analysis System. version:%s", cfg.version) log.debug("Configuration: ") log.debug(vars(cfg)) # LD_DEBUG cfg.ld_debug_log_abs = os.path.join(file_log_dir, cfg.ld_debug_log) # inetsim dir if not os.path.exists(cfg.inetsim_log_dir): os.mkdir(cfg.inetsim_log_dir) if not os.path.exists(cfg.inetsim_log_report_dir): os.mkdir(cfg.inetsim_log_report_dir) def init_workspace_inplace(cfg): workspace_dir = os.path.dirname(cfg.target) workspace_dir = os.path.abspath(workspace_dir) cfg.workspace_dir = workspace_dir if os.path.exists(cfg.target): target_abs_path = os.path.abspath(cfg.target) cfg.target_abs_path = target_abs_path os.chmod(target_abs_path, stat.S_IRUSR) else: log.critical("%s dose not exist.", cfg.target) os._exit(1) log.info("Target absolute path: %s", cfg.target_abs_path) def init_workspace(cfg, is_inplace=False): log.info("init workspace is_inplace:%r",is_inplace) if is_inplace: init_workspace_inplace(cfg) else: # create a clean workspace workspace_dir = os.path.join(BASE_HOME,cfg.exec_home) if not os.path.exists(workspace_dir): os.mkdir(workspace_dir) else: shutil.rmtree(workspace_dir) os.mkdir(workspace_dir) cfg.workspace_dir = workspace_dir # copy target file into workspace if os.path.exists(cfg.target): shutil.copy(cfg.target, workspace_dir) target_abs_path = os.path.join(workspace_dir, os.path.basename(cfg.target)) cfg.target_abs_path = target_abs_path os.chmod(target_abs_path, stat.S_IRUSR) else: log.critical("%s dose not exist.", cfg.target) os._exit(1) log.info("Target absolute path: %s", cfg.target_abs_path) # I can not change dir at here, the dir will be changed everytime when analyzer starts. def get_filetype(file_path): if os.path.exists(file_path): output = subprocess.check_output(['/usr/bin/file', file_path]) parts = output.split(":") file_type = "UNKNOWN" full_info = "" if len(parts) > 1: full_info = parts[1].strip() detailed_parts = parts[1].split() if len(detailed_parts) > 1: file_type = detailed_parts[0].strip() log.debug("file_type: %s, full_info: %s",file_type, full_info) return (file_type, full_info) else: log.critical("%s dose not exist.", file_path) return ("UNKNOWN","") def is_compressed(file_path): (file_type, full_info) = get_filetype(file_path) compressed_type_list = ['7-zip', 'bzip2', 'gzip', 'XZ', 'Zip'] ret = False if file_type in compressed_type_list: ret = True elif -1 != full_info.find("tar"): ret = True log.info("file %s compressed: %r",file_path,ret) return ret def is_executable(file_path): (file_type, full_info) = get_filetype(file_path) # until now, ELF is only supported. exec_type_list = ['ELF'] ret = False if file_type in exec_type_list: if -1 != full_info.find("executable"): ret = True log.info("file %s executable: %r",file_path, ret) return ret def do_work(cfg, do_static, do_dynamic): # since dynamic analyzer needs info from static analyzer if do_dynamic: do_static = True log.info("set do_static True, since dynamic analyzer needs info from static analyzer") if do_static: # static analysis log.info("will do_static analysis") static_analyzer = static.StaticAnalyzer(cfg) static_analyzer.start() static_analyzer.output('json') static_analyzer.end() if (cfg.target == cfg.main_target): cfg.main_target_md5 = static_analyzer.info["hash_md5"] log.info("main target md5: %s", cfg.main_target_md5) # dynamic analysis # check whether executable if do_dynamic: if is_executable(cfg.target): cfg.is_executable = True else: cfg.is_executable = False log.info("The target %s is not executable. do_dynamic: %r",cfg.target,do_dynamic) dynamic_analyzer = dynamic.DynamicAnalyzer(cfg) # dynamic analyzer will need info from static analyzer, such as md5 dynamic_analyzer.info = static_analyzer.info dynamic_analyzer.start() dynamic_analyzer.output('json') dynamic_analyzer.end() else: log.info("skip dynamic analysis since do_dynamic is False") def de_compress_top_lev(file_path): """ 1. create dir with the format {file_path}_7zdump. 2. only decompress the top level. """ bfs_list = [file_path] temp_list = [] head = file_path if is_compressed(head): tmp_dir = head+"_7zdump" if not os.path.exists(tmp_dir): os.mkdir(tmp_dir) log.info("top_lev decompress dir: %s",tmp_dir) temp_list.append(tmp_dir) output = "" try: cmd_list = ["/usr/bin/7z","x","-y","-o"+tmp_dir,head] log.info("call 7z command: %s",str(cmd_list)) output = subprocess.check_output(cmd_list) except subprocess.CalledProcessError as e: log.error("CalledProcessError: %s",str(e)) output = e.output for root, dirs, files in os.walk(tmp_dir): for item in files: f = os.path.join(root,item) f = os.path.abspath(f) # make sure any file will be enqueue only once if (not f in bfs_list): #log.debug("en queue f: %s, queue:%s",f,str(queue)) bfs_list.append(f) return (bfs_list, temp_list) def de_compress(file_path, is_inplace=False, decompress_limit=100): """ It will decompress the target as bfs order. """ queue = [file_path] bfs_list = [] temp_list = [] pop_cnt=0 while len(queue): head = queue.pop(0) bfs_list.append(head) pop_cnt=pop_cnt+1 if pop_cnt >= decompress_limit: log.info("pop_cnt:%d, limit:%d ,break",pop_cnt,decompress_limit) break if is_compressed(head): if is_inplace: tmp_dir = os.path.dirname(head) tmp_dir = os.path.abspath(tmp_dir) else: tmp_dir = tempfile.mkdtemp() log.info("is_inplace %r decompress dir: %s",is_inplace,tmp_dir) temp_list.append(tmp_dir) output = "" try: cmd_list = ["/usr/bin/7z","x","-y","-o"+tmp_dir,head] log.info("call 7z command: %s",str(cmd_list)) output = subprocess.check_output(cmd_list) except subprocess.CalledProcessError as e: log.error("CalledProcessError: %s",str(e)) output = e.output for root, dirs, files in os.walk(tmp_dir): for item in files: f = os.path.join(root,item) f = os.path.abspath(f) # make sure any file will be enqueue only once if (not os.path.samefile(head,f)) and (not f in queue) and (not f in bfs_list): #log.debug("en queue f: %s, queue:%s",f,str(queue)) queue.append(f) return (bfs_list, temp_list) def clean_temp(temp_list): for d in temp_list: log.info("clean dir: %s",d) shutil.rmtree(d, True) def init_target_loader(cfg): file_path_32 = cfg.target_loader+".32.elf"; file_path_64 = cfg.target_loader+".64.elf"; if os.path.exists(file_path_32) and os.path.exists(file_path_64): log.info("target loader: %s, %s",file_path_32,file_path_64) # chmod 0777 targeT_loader os.chmod(file_path_64, stat.S_IRWXU|stat.S_IRWXG|stat.S_IRWXO) os.chmod(file_path_32, stat.S_IRWXU|stat.S_IRWXG|stat.S_IRWXO) cfg.target_loader_64 = file_path_64 cfg.target_loader_32 = file_path_32 else: log.critical("failed to locate target loader: %s,%s",file_path_32,file_path_64) os._exit(2) def generate_tag_file(cfg, do_static, do_dynamic): if do_static: base.BaseAnalyzer.touchFile(cfg.static_finished_fname) log.info("static tag file: %s is generated.", cfg.static_finished_fname) if do_dynamic: base.BaseAnalyzer.touchFile(cfg.dynamic_finished_fname) log.info("dynamic tag file: %s is generated.", cfg.dynamic_finished_fname) def combine_static_perfile(cfg): main_log_path = os.path.join(cfg.file_log_dir,cfg.main_target_md5+".static") log_dir = cfg.file_log_dir if os.path.exists(main_log_path): fi = open(main_log_path,"rb") main_info = json.load(fi) fi.close() main_info["SubBaseInfo"]=[] for item in cfg.bfs_list: if os.path.isfile(item): file_md5 = base.BaseAnalyzer.get_md5_by_fname(item) node = os.path.join(cfg.file_log_dir,file_md5+".static") log.info("combine %s, md5:%s, node:%s",item, file_md5, node) if os.path.exists(node) and node!=main_log_path: sub_f = open(node,"rb") sub_info = json.load(sub_f) sub_f.close() if len(sub_info["BaseInfo"])>0: node = sub_info["BaseInfo"][0] # fix Name info if cfg.enable_prefix_remove: node["Name"] = base.BaseAnalyzer.prefix_remove(item) else: node["Name"] = item # fix "__full_path" node["__full_path"] = item node["ID"] = metrics.S_ID_SUB_BASE_INFO main_info["SubBaseInfo"].append(sub_info["BaseInfo"][0]) fo = open(main_log_path,"wb") json.dump(main_info, fo, indent=4, sort_keys=False) fo.close() log.info("main static log updated %s",main_log_path) else: log.error("main log file: %s is missing",main_log_path) def combine_static_log(cfg): main_log_path = os.path.join(cfg.file_log_dir,cfg.main_target_md5+".static") log_dir = cfg.file_log_dir if os.path.exists(main_log_path): fi = open(main_log_path,"rb") main_info = json.load(fi) fi.close() main_info["SubBaseInfo"]=[] for root, dirs, files in os.walk(log_dir): for item in files: node = os.path.join(root,item) if node.endswith(".static") and node!=main_log_path: log.info("combine %s",node) sub_f = open(node,"rb") sub_info = json.load(sub_f) sub_f.close() if len(sub_info["BaseInfo"])>0: node = sub_info["BaseInfo"][0] node["ID"] = metrics.S_ID_SUB_BASE_INFO main_info["SubBaseInfo"].append(sub_info["BaseInfo"][0]) fo = open(main_log_path,"wb") json.dump(main_info, fo, indent=4, sort_keys=False) fo.close() log.info("main static log updated %s",main_log_path) else: log.error("main log file: %s is missing",main_log_path) def exratc_file_size(main_info, node_md5): sub_info_list = main_info["SubBaseInfo"] for item in sub_info_list: if item["MD5"] == node_md5: return item["SizeInfo"] return 0 def pick_largest_elf(cfg): """ Pick the largest in file size """ main_static = os.path.join(cfg.file_log_dir,cfg.main_target_md5+".static") log_dir = cfg.file_log_dir if os.path.exists(main_static): fi = open(main_static,"rb") main_info = json.load(fi) fi.close() max_size = 0 target_md5 = "" target_path = "" sub_info_list = main_info["SubBaseInfo"] for item in sub_info_list: full_path = item["__full_path"] if item["FileType"].startswith("ELF") and is_executable(full_path): node_md5 = item["MD5"] file_size = item["SizeInfo"] log.debug("file %s size: %d",node_md5, file_size) if max_size < file_size: max_size = file_size target_md5 = node_md5 target_path = full_path if len(target_md5)>0: log.info("found ELF %s, md5 %s with file size: %d",target_path,target_md5,max_size) else: if len(sub_info_list)>0: item = sub_info_list[0] full_path = item["__full_path"] node_md5 = item["MD5"] file_size = item["SizeInfo"] max_size = file_size target_md5 = node_md5 target_path = full_path log.info("Failed to find a ELF, pick first one: %s",target_path) else: log.info("Failed to pick any file.") return (target_md5,target_path) def generate_main_dyn_log(cfg,target_md5): main_dynamic = os.path.join(cfg.file_log_dir,cfg.main_target_md5+".dynamic") if len(target_md5)>0: src_file = os.path.join(cfg.file_log_dir, target_md5+".dynamic") if os.path.exists(src_file): log.info("found dynamic log: %s",src_file) dest_file = main_dynamic if src_file!=dest_file: shutil.copyfile(src_file, dest_file) log.info("copy file from %s to %s",src_file, dest_file) log.info("main dynamic log updated %s", main_dynamic) else: log.error("dynamic log %s can not be found.",src_file) #discard def pick_dynamic_log(cfg): """ Pick the largest in file size """ #main_dynamic = os.path.join(cfg.file_log_dir,cfg.main_target_md5+".dynamic") main_static = os.path.join(cfg.file_log_dir,cfg.main_target_md5+".static") log_dir = cfg.file_log_dir if os.path.exists(main_static): fi = open(main_static,"rb") main_info = json.load(fi) fi.close() max_size = 0 target_md5 = "" for root, dirs, files in os.walk(log_dir): for item in files: node = os.path.join(root,item) if node.endswith(".static"): #log.debug("node name %s",os.path.basename(node)) node_md5 = os.path.basename(node)[0:32] file_size = exratc_file_size(main_info,node_md5) log.debug("file %s size: %d",node_md5, file_size) if max_size < file_size: max_size = file_size target_md5 = node_md5 if len(target_md5)>0: log.info("found dynamic log %s with file size: %d",target_md5,max_size) src_file = os.path.join(cfg.file_log_dir, target_md5+".dynamic") dest_file = main_dynamic # TODO why they are the same if src_file!=dest_file: shutil.copyfile(src_file, dest_file) log.info("main dynamic log updated %s", main_dynamic) def generate_output_log(cfg, do_static, do_dynamic): """ generate output log as: output.static output.dynamic """ if do_static: main_static = os.path.join(cfg.file_log_dir,cfg.main_target_md5+".static") output_static = os.path.join(cfg.file_log_dir, cfg.static_log) if os.path.exists(main_static): shutil.copyfile(main_static, output_static) log.info("output static logs %s have been generated", output_static) if do_dynamic: main_dynamic =
df.shape[0]) assert r.chunks[0].inputs[0].shape[0] == df_raw.shape[0] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE # test transform scenarios on data frames r = tile(df.transform(lambda x: list(range(len(x))))) assert all(v == np.dtype('int64') for v in r.dtypes) is True assert r.shape == df.shape assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.dataframe assert r.chunks[0].shape == (df.shape[0], 20 // df.shape[0]) assert r.chunks[0].inputs[0].shape[0] == df_raw.shape[0] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE r = tile(df.transform(lambda x: list(range(len(x))), axis=1)) assert all(v == np.dtype('int64') for v in r.dtypes) is True assert r.shape == df.shape assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.dataframe assert r.chunks[0].shape == (20 // df.shape[1], df.shape[1]) assert r.chunks[0].inputs[0].shape[1] == df_raw.shape[1] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE r = tile(df.transform(['cumsum', 'cummax', lambda x: x + 1])) assert all(v == np.dtype('int64') for v in r.dtypes) is True assert r.shape == (df.shape[0], df.shape[1] * 3) assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.dataframe assert r.chunks[0].shape == (df.shape[0], 20 // df.shape[0] * 3) assert r.chunks[0].inputs[0].shape[0] == df_raw.shape[0] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE r = tile(df.transform({'A': 'cumsum', 'D': ['cumsum', 'cummax'], 'F': lambda x: x + 1})) assert all(v == np.dtype('int64') for v in r.dtypes) is True assert r.shape == (df.shape[0], 4) assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.dataframe assert r.chunks[0].shape == (df.shape[0], 1) assert r.chunks[0].inputs[0].shape[0] == df_raw.shape[0] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE # test agg scenarios on series r = tile(df.transform(lambda x: x.iloc[:-1], _call_agg=True)) assert all(v == np.dtype('int64') for v in r.dtypes) is True assert r.shape == (np.nan, df.shape[1]) assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.dataframe assert r.chunks[0].shape == (np.nan, 1) assert r.chunks[0].inputs[0].shape[0] == df_raw.shape[0] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE r = tile(df.transform(lambda x: x.iloc[:-1], axis=1, _call_agg=True)) assert all(v == np.dtype('int64') for v in r.dtypes) is True assert r.shape == (df.shape[0], np.nan) assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.dataframe assert r.chunks[0].shape == (2, np.nan) assert r.chunks[0].inputs[0].shape[1] == df_raw.shape[1] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE fn_list = [rename_fn(lambda x: x.iloc[1:].reset_index(drop=True), 'f1'), lambda x: x.iloc[:-1].reset_index(drop=True)] r = tile(df.transform(fn_list, _call_agg=True)) assert all(v == np.dtype('int64') for v in r.dtypes) is True assert r.shape == (np.nan, df.shape[1] * 2) assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.dataframe assert r.chunks[0].shape == (np.nan, 2) assert r.chunks[0].inputs[0].shape[0] == df_raw.shape[0] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE r = tile(df.transform(lambda x: x.sum(), _call_agg=True)) assert r.dtype == np.dtype('int64') assert r.shape == (df.shape[1],) assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.series assert r.chunks[0].shape == (20 // df.shape[0],) assert r.chunks[0].inputs[0].shape[0] == df_raw.shape[0] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE fn_dict = { 'A': rename_fn(lambda x: x.iloc[1:].reset_index(drop=True), 'f1'), 'D': [rename_fn(lambda x: x.iloc[1:].reset_index(drop=True), 'f1'), lambda x: x.iloc[:-1].reset_index(drop=True)], 'F': lambda x: x.iloc[:-1].reset_index(drop=True), } r = tile(df.transform(fn_dict, _call_agg=True)) assert all(v == np.dtype('int64') for v in r.dtypes) is True assert r.shape == (np.nan, 4) assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.dataframe assert r.chunks[0].shape == (np.nan, 1) assert r.chunks[0].inputs[0].shape[0] == df_raw.shape[0] assert r.chunks[0].inputs[0].op._op_type_ == opcodes.CONCATENATE # SERIES CASES # test transform scenarios on series r = tile(series.transform(lambda x: x + 1)) assert np.dtype('int64') == r.dtype assert r.shape == series.shape assert r.op._op_type_ == opcodes.TRANSFORM assert r.op.output_types[0] == OutputType.series assert r.chunks[0].shape == (5,) assert r.chunks[0].inputs[0].shape == (5,) finally: options.chunk_store_limit = old_chunk_store_limit def test_string_method(): s = pd.Series(['a', 'b', 'c'], name='s') series = from_pandas_series(s, chunk_size=2) with pytest.raises(AttributeError): _ = series.str.non_exist r = series.str.contains('c') assert r.dtype == np.bool_ assert r.name == s.name pd.testing.assert_index_equal(r.index_value.to_pandas(), s.index) assert r.shape == s.shape r = tile(r) for i, c in enumerate(r.chunks): assert c.index == (i,) assert c.dtype == np.bool_ assert c.name == s.name pd.testing.assert_index_equal(c.index_value.to_pandas(), s.index[i * 2: (i + 1) * 2]) assert c.shape == (2,) if i == 0 else (1,) r = series.str.split(',', expand=True, n=1) assert r.op.output_types[0] == OutputType.dataframe assert r.shape == (3, 2) pd.testing.assert_index_equal(r.index_value.to_pandas(), s.index) pd.testing.assert_index_equal(r.columns_value.to_pandas(), pd.RangeIndex(2)) r = tile(r) for i, c in enumerate(r.chunks): assert c.index == (i, 0) pd.testing.assert_index_equal(c.index_value.to_pandas(), s.index[i * 2: (i + 1) * 2]) pd.testing.assert_index_equal(c.columns_value.to_pandas(), pd.RangeIndex(2)) assert c.shape == (2, 2) if i == 0 else (1, 2) with pytest.raises(TypeError): _ = series.str.cat([['1', '2']]) with pytest.raises(ValueError): _ = series.str.cat(['1', '2']) with pytest.raises(ValueError): _ = series.str.cat(',') with pytest.raises(TypeError): _ = series.str.cat({'1', '2', '3'}) r = series.str.cat(sep=',') assert r.op.output_types[0] == OutputType.scalar assert r.dtype == s.dtype r = tile(r) assert len(r.chunks) == 1 assert r.chunks[0].op.output_types[0] == OutputType.scalar assert r.chunks[0].dtype == s.dtype r = series.str.extract(r'[ab](\d)', expand=False) assert r.op.output_types[0] == OutputType.series assert r.dtype == s.dtype r = tile(r) for i, c in enumerate(r.chunks): assert c.index == (i,) assert c.dtype == s.dtype assert c.name == s.name pd.testing.assert_index_equal(c.index_value.to_pandas(), s.index[i * 2: (i + 1) * 2]) assert c.shape == (2,) if i == 0 else (1,) r = series.str.extract(r'[ab](\d)', expand=True) assert r.op.output_types[0] == OutputType.dataframe assert r.shape == (3, 1) pd.testing.assert_index_equal(r.index_value.to_pandas(), s.index) pd.testing.assert_index_equal(r.columns_value.to_pandas(), pd.RangeIndex(1)) r = tile(r) for i, c in enumerate(r.chunks): assert c.index == (i, 0) pd.testing.assert_index_equal(c.index_value.to_pandas(), s.index[i * 2: (i + 1) * 2]) pd.testing.assert_index_equal(c.columns_value.to_pandas(), pd.RangeIndex(1)) assert c.shape == (2, 1) if i == 0 else (1, 1) assert 'lstrip' in dir(series.str) def test_datetime_method(): s = pd.Series([pd.Timestamp('2020-1-1'), pd.Timestamp('2020-2-1'), pd.Timestamp('2020-3-1')], name='ss') series = from_pandas_series(s, chunk_size=2) r = series.dt.year assert r.dtype == s.dt.year.dtype pd.testing.assert_index_equal(r.index_value.to_pandas(), s.index) assert r.shape == s.shape assert r.op.output_types[0] == OutputType.series assert r.name == s.dt.year.name r = tile(r) for i, c in enumerate(r.chunks): assert c.index == (i,) assert c.dtype == s.dt.year.dtype assert c.op.output_types[0] == OutputType.series assert r.name == s.dt.year.name pd.testing.assert_index_equal(c.index_value.to_pandas(), s.index[i * 2: (i + 1) * 2]) assert c.shape == (2,) if i == 0 else (1,) with pytest.raises(AttributeError): _ = series.dt.non_exist assert 'ceil' in dir(series.dt) def test_series_isin(): # one chunk in multiple chunks a = from_pandas_series(pd.Series([0, 1, 2, 3, 4, 5, 6, 7, 8, 9]), chunk_size=10) b = from_pandas_series(pd.Series([2, 1, 9, 3]), chunk_size=2) r = tile(a.isin(b)) for i, c in enumerate(r.chunks): assert c.index == (i,) assert c.dtype == np.dtype('bool') assert c.shape == (10,) assert len(c.op.inputs) == 2 assert c.op.output_types[0] == OutputType.series assert c.op.inputs[0].index == (i,) assert c.op.inputs[0].shape == (10,) assert c.op.inputs[1].index == (0,) assert c.op.inputs[1].shape == (4,) # has been rechunked # multiple chunk in one chunks a = from_pandas_series(pd.Series([0, 1, 2, 3, 4, 5, 6, 7, 8, 9]), chunk_size=2) b = from_pandas_series(pd.Series([2, 1, 9, 3]), chunk_size=4) r = tile(a.isin(b)) for i, c in enumerate(r.chunks): assert c.index == (i,) assert c.dtype == np.dtype('bool') assert c.shape == (2,) assert len(c.op.inputs) == 2 assert c.op.output_types[0] == OutputType.series assert c.op.inputs[0].index == (i,) assert c.op.inputs[0].shape == (2,) assert c.op.inputs[1].index == (0,) assert c.op.inputs[1].shape == (4,) # multiple chunk in multiple chunks a = from_pandas_series(pd.Series([0, 1, 2, 3, 4, 5, 6, 7, 8, 9]), chunk_size=2) b = from_pandas_series(pd.Series([2, 1, 9, 3]), chunk_size=2) r = tile(a.isin(b)) for i, c in enumerate(r.chunks): assert c.index == (i,) assert c.dtype == np.dtype('bool') assert c.shape == (2,) assert len(c.op.inputs) == 2 assert c.op.output_types[0] == OutputType.series assert c.op.inputs[0].index == (i,) assert c.op.inputs[0].shape == (2,) assert c.op.inputs[1].index == (0,) assert c.op.inputs[1].shape == (4,) # has been rechunked with pytest.raises(TypeError): _ = a.isin('sth') with pytest.raises(TypeError): _ = a.to_frame().isin('sth') def test_cut(): s = from_pandas_series(pd.Series([1., 2., 3., 4.]), chunk_size=2) with pytest.raises(ValueError): _ = cut(s, -1) with pytest.raises(ValueError): _ = cut([[1, 2], [3, 4]], 3) with pytest.raises(ValueError): _ = cut([], 3) r, b = cut(s, [1.5, 2.5], retbins=True) assert isinstance(r, SERIES_TYPE) assert isinstance(b, TENSOR_TYPE) r = tile(r) assert len(r.chunks) == 2 for c in r.chunks: assert isinstance(c, SERIES_CHUNK_TYPE) assert c.shape == (2,) r = cut(s.to_tensor(), [1.5, 2.5]) assert isinstance(r, CATEGORICAL_TYPE) assert len(r) == len(s) assert 'Categorical' in repr(r) r = tile(r) assert len(r.chunks) == 2 for c in r.chunks: assert isinstance(c, CATEGORICAL_CHUNK_TYPE) assert c.shape == (2,) assert c.ndim == 1 r = cut([0, 1, 1, 2], bins=4, labels=False) assert isinstance(r, TENSOR_TYPE) e = pd.cut([0, 1, 1, 2], bins=4, labels=False) assert r.dtype == e.dtype def test_to_numeric(): raw = pd.DataFrame({"a": [1.0, 2, 3, -3]}) df = from_pandas_df(raw, chunk_size=2) with pytest.raises(ValueError): _ = to_numeric(df) with pytest.raises(ValueError): _ = to_numeric([['1.0', 1]]) with pytest.raises(ValueError): _ = to_numeric([]) s = from_pandas_series(pd.Series(['1.0', '2.0', 1, -2]), chunk_size=2) r = tile(to_numeric(s)) assert len(r.chunks) == 2 assert isinstance(r, SERIES_TYPE) r = tile(to_numeric(['1.0', '2.0', 1, -2])) assert isinstance(r, TENSOR_TYPE) def test_astype(): s = from_pandas_series(pd.Series([1, 2, 1, 2], name='a'), chunk_size=2) with pytest.raises(KeyError): astype(s, {'b': 'str'}) df = from_pandas_df(pd.DataFrame({'a': [1, 2, 1, 2], 'b': ['a', 'b',
OperationalError: # something error occured break ln = _bytes_to_bint(self._read(4)) - 4 data = self._read(ln) if code == 90: self._trans_status = data DEBUG_OUTPUT("-> ReadyForQuery('Z'):{}".format(data)) break elif code == 82: auth_method = _bytes_to_bint(data[:4]) DEBUG_OUTPUT("-> Authentication('R'):{}".format(auth_method)) if auth_method == 0: # trust pass elif auth_method == 5: # md5 salt = data[4:] hash1 = hashlib.md5(self.password.encode('ascii') + self.user.encode("ascii")).hexdigest().encode("ascii") hash2 = hashlib.md5(hash1+salt).hexdigest().encode("ascii") self._send_data(b'p', b''.join([b'md5', hash2, b'\x00'])) # accept code = ord(self._read(1)) assert code == 82 ln = _bytes_to_bint(self._read(4)) - 4 data = self._read(ln) assert _bytes_to_bint(data[:4]) == 0 elif auth_method == 10: # SASL assert data[4:-2].decode('utf-8') == 'SCRAM-SHA-256' printable = string.ascii_letters + string.digits + '+/' client_nonce = ''.join( printable[random.randrange(0, len(printable))] for i in range(24) ) # send client first message first_message = 'n,,n=,r=' + client_nonce self._send_data(b'p', b''.join([ b'SCRAM-SHA-256\x00', _bint_to_bytes(len(first_message)), first_message.encode('utf-8') ])) code = ord(self._read(1)) assert code == 82 ln = _bytes_to_bint(self._read(4)) - 4 data = self._read(ln) _bytes_to_bint(data[:4]) == 11 # SCRAM first server = { kv[0]: kv[2:] for kv in data[4:].decode('utf-8').split(',') } # r: server nonce # s: servre salt # i: iteration count assert server['r'][:len(client_nonce)] == client_nonce # send client final message salted_pass = hashlib.pbkdf2_hmac( '<PASSWORD>', self.password.encode('utf-8'), base64.standard_b64decode(server['s']), int(server['i']), ) client_key = hmac.HMAC( salted_pass, b"Client Key", hashlib.sha256 ).digest() client_first_message_bare = "n=,r=" + client_nonce server_first_message = "r=%s,s=%s,i=%s" % (server['r'], server['s'], server['i']) client_final_message_without_proof = "c=biws,r=" + server['r'] auth_msg = ','.join([ client_first_message_bare, server_first_message, client_final_message_without_proof ]) client_sig = hmac.HMAC( hashlib.sha256(client_key).digest(), auth_msg.encode('utf-8'), hashlib.sha256 ).digest() proof = base64.standard_b64encode( b"".join([bytes([x ^ y]) for x, y in zip(client_key, client_sig)]) ) self._send_data( b'p', (client_final_message_without_proof + ",p=").encode('utf-8') + proof ) code = ord(self._read(1)) assert code == 82 ln = _bytes_to_bint(self._read(4)) - 4 data = self._read(ln) _bytes_to_bint(data[:4]) == 12 # SCRAM final # accept code = ord(self._read(1)) assert code == 82 ln = _bytes_to_bint(self._read(4)) - 4 data = self._read(ln) assert _bytes_to_bint(data[:4]) == 0 else: errobj = InterfaceError("Authentication method %d not supported." % (auth_method,)) elif code == 83: k, v, _ = data.split(b'\x00') DEBUG_OUTPUT("-> ParameterStatus('S'):{}:{}".format(k, v)) if k == b'server_encoding': self.encoding = v.decode('ascii') elif k == b'server_version': version = v.decode('ascii').split('(')[0].split('.') self.server_version = int(version[0]) * 10000 if len(version) > 0: try: self.server_version += int(version[1]) * 100 except Exception: pass if len(version) > 1: try: self.server_version += int(version[2]) except Exception: pass elif k == b'TimeZone': self.tz_name = v.decode('ascii') self.tzinfo = None elif code == 75: DEBUG_OUTPUT("-> BackendKeyData('K')") pass elif code == 67: if not obj: DEBUG_OUTPUT("-> CommandComplete('C')") continue command = data[:-1].decode('ascii') DEBUG_OUTPUT("-> CommandComplete('C'):{}".format(command)) if command == 'SHOW': obj._rowcount = 1 else: for k in ('SELECT', 'UPDATE', 'DELETE', 'INSERT'): if command[:len(k)] == k: obj._rowcount = int(command.split(' ')[-1]) break elif code == 84: if not obj: continue count = _bytes_to_bint(data[0:2]) obj.description = [None] * count n = 2 idx = 0 for i in range(count): name = data[n:n+data[n:].find(b'\x00')] n += len(name) + 1 try: name = name.decode(self.encoding) except UnicodeDecodeError: pass type_code = _bytes_to_bint(data[n+6:n+10]) if type_code == PG_TYPE_VARCHAR: size = _bytes_to_bint(data[n+12:n+16]) - 4 precision = -1 scale = -1 elif type_code == PG_TYPE_NUMERIC: size = _bytes_to_bint(data[n+10:n+12]) precision = _bytes_to_bint(data[n+12:n+14]) scale = precision - _bytes_to_bint(data[n+14:n+16]) else: size = _bytes_to_bint(data[n+10:n+12]) precision = -1 scale = -1 # table_oid = _bytes_to_bint(data[n:n+4]) # table_pos = _bytes_to_bint(data[n+4:n+6]) # size = _bytes_to_bint(data[n+10:n+12]) # modifier = _bytes_to_bint(data[n+12:n+16]) # format = _bytes_to_bint(data[n+16:n+18]), field = Description(name, type_code, None, size, precision, scale, None) n += 18 obj.description[idx] = field idx += 1 DEBUG_OUTPUT("-> RowDescription('T'):{}".format(obj.description)) elif code == 68: if not obj: DEBUG_OUTPUT("-> DataRow('D')") continue n = 2 row = [] while n < len(data): if data[n:n+4] == b'\xff\xff\xff\xff': row.append(None) n += 4 else: ln = _bytes_to_bint(data[n:n+4]) n += 4 row.append(data[n:n+ln]) n += ln for i in range(len(row)): row[i] = self._decode_column(row[i], obj.description[i][1]) obj._rows.append(tuple(row)) DEBUG_OUTPUT("-> DataRow('D'):{}".format(tuple(row))) elif code == 78: DEBUG_OUTPUT("-> NoticeResponse('N')") pass elif code == 69 and not errobj: err = data.split(b'\x00') # http://www.postgresql.org/docs/9.3/static/errcodes-appendix.html errcode = err[2][1:].decode('utf-8') message = "{}:{}".format(self.query, err[3][1:].decode(self.encoding)) DEBUG_OUTPUT("-> ErrorResponse('E'):{}:{}".format(errcode, message)) if errcode[:2] == '0A': errobj = NotSupportedError(message, errcode) elif errcode[:2] in ('20', '21'): errobj = ProgrammingError(message, errcode) elif errcode[:2] in ('22', ): errobj = DataError(message, errcode) elif errcode[:2] == '23': errobj = IntegrityError(message, errcode) elif errcode[:2] in('24', '25'): errobj = InternalError(message, errcode) elif errcode[:2] in('26', '27', '28'): errobj = OperationalError(message, errcode) elif errcode[:2] in('2B', '2D', '2F'): errobj = InternalError(message, errcode) elif errcode[:2] == '34': errobj = OperationalError(message, errcode) elif errcode[:2] in ('38', '39', '3B'): errobj = InternalError(message, errcode) elif errcode[:2] in ('3D', '3F'): errobj = ProgrammingError(message, errcode) elif errcode[:2] in ('40', '42', '44'): errobj = ProgrammingError(message, errcode) elif errcode[:1] == '5': errobj = OperationalError(message, errcode) elif errcode[:1] in 'F': errobj = InternalError(message, errcode) elif errcode[:1] in 'H': errobj = OperationalError(message, errcode) elif errcode[:1] in ('P', 'X'): errobj = InternalError(message, errcode) else: errobj = DatabaseError(message, errcode) elif code == 72: # CopyOutputResponse('H') pass elif code == 100: # CopyData('d') obj.write(data) elif code == 99: # CopyDataDone('c') pass elif code == 71: # CopyInResponse('G') while True: buf = obj.read(8192) if not buf: break # send CopyData self._write(b'd' + _bint_to_bytes(len(buf) + 4)) self._write(buf) # send CopyDone and Sync self._write(b'c\x00\x00\x00\x04S\x00\x00\x00\x04') else: DEBUG_OUTPUT("-> Unknown({}):{}{}".format(code, ln, binascii.b2a_hex(data))) pass return errobj def process_messages(self, obj): err = self._process_messages(obj) if err: raise err def _read(self, ln): if not self.sock: raise InterfaceError("Lost connection", "08003") r = b'' while len(r) < ln: b = self.sock.recv(ln-len(r)) if not b: raise InterfaceError("Can't recv packets", "08003") r += b return r def _write(self, b): if not self.sock: raise InterfaceError("Lost connection", "08003") n = 0 while (n < len(b)): n += self.sock.send(b[n:]) def _open(self): self.sock = socket.create_connection((self.host, self.port), self.timeout) DEBUG_OUTPUT("Connection._open() socket %s:%d" % (self.host, self.port)) if self.use_ssl: import ssl self._write(_bint_to_bytes(8)) self._write(_bint_to_bytes(80877103)) # SSL request if self._read(1) == b'S': self.sock = ssl.wrap_socket(self.sock) else: raise InterfaceError("Server refuses SSL") # protocol version 3.0 v = b'\x00\x03\x00\x00' v += b'user\x00' + self.user.encode('ascii') + b'\x00' if self.database: v += b'database\x00' + self.database.encode('ascii') + b'\x00' v += b'\x00' self._write(_bint_to_bytes(len(v) + 4) + v) self.process_messages(None) self._begin() if self.tz_name and self.tzinfo is None: self.set_timezone(self.tz_name) def escape_parameter(self, v): if isinstance(v, enum.Enum): v = v.value t = type(v) func = self.encoders.get(t) if func: return func(self, v) if v is None: return 'NULL' elif t == str: return u"'" + v.replace(u"'", u"''") + u"'" elif t == bytearray or t == bytes: # binary return "'" + ''.join(['\\%03o' % (c, ) for c in v]) + "'::bytea" elif t == bool: return u"TRUE" if v else u"FALSE" elif t == time.struct_time: return u'%04d-%02d-%02d %02d:%02d:%02d' % ( v.tm_year, v.tm_mon, v.tm_mday, v.tm_hour, v.tm_min, v.tm_sec) elif t == datetime.datetime: if v.tzinfo: return "timestamp with time zone '" + v.isoformat() + "'" else: return "timestamp '" + v.isoformat() + "'" elif t == datetime.date: return "date '" + str(v) + "'" elif t == datetime.timedelta: return u"interval '" + str(v) + "'" elif t == int or t == float: return str(v) elif t == decimal.Decimal: return "decimal '" + str(v) + "'" elif t == list or t == tuple: return u'ARRAY[' + u','.join([self.escape_parameter(e) for e in v]) + u']' else: return "'" + str(v) + "'" def is_connect(self): return bool(self.sock) def cursor(self, factory=Cursor): return factory(self) def execute(self, query, obj=None): self.query = query self._send_message(b'Q', query.encode(self.encoding) + b'\x00') self.process_messages(obj) if self.autocommit: self.commit() def get_parameter_status(self, s): with self.cursor() as cur: cur.execute('SHOW {}'.format(s)) return cur.fetchone()[0] def set_timezone(self, timezone_name): self.tz_name = timezone_name with self.cursor() as cur: cur.execute("SET TIME ZONE %s", [self.tz_name]) self.tzinfo = zoneinfo.ZoneInfo(self.tz_name) @property def isolation_level(self): return self.get_parameter_status('TRANSACTION ISOLATION LEVEL') def set_autocommit(self, autocommit): self.autocommit = autocommit def _begin(self): self._send_message(b'Q', b"BEGIN\x00") self._process_messages(None) def begin(self): if DEBUG: DEBUG_OUTPUT('BEGIN') self._begin() def commit(self): if DEBUG: DEBUG_OUTPUT('COMMIT') if self.sock: self._send_message(b'Q', b"COMMIT\x00") self.process_messages(None) self._begin() def _rollback(self): self._send_message(b'Q', b"ROLLBACK\x00") self._process_messages(None) def rollback(self): if DEBUG: DEBUG_OUTPUT('ROLLBACK') if self.sock: self._rollback() self._begin() def reopen(self): self.close() self._open() def close(self): if DEBUG: DEBUG_OUTPUT('Connection::close()') if self.sock: # send Terminate self._write(b'X\x00\x00\x00\x04') self.sock.close() self.sock = None def connect(host, user, password='', database=None, port=None, timeout=None, use_ssl=False): return Connection(user, password, database, host, port if port else 5432, timeout, use_ssl) def create_database(database, host, user, password='', port=None, use_ssl=False): with connect(host, user, password, None, port, None, use_ssl) as conn: conn._rollback() conn._send_message(b'Q', 'CREATE DATABASE {}'.format(database).encode('utf-8') + b'\x00') conn.process_messages(None) def drop_database(database, host,
"""Android Calculator App Test: Addition""" # Created by <NAME>. # GitHub: https://github.com/ikostan # LinkedIn: https://www.linkedin.com/in/egor-kostan/ import allure from tests.android_native.calculator_tests.calculator_base_testcase import AndroidCalculatorBaseTestCase @allure.epic('Android Native App') @allure.parent_suite('Functional Test') @allure.suite("Calculator Test Suite") @allure.sub_suite("Positive Tests") @allure.feature("Addition Calculation") @allure.story('Addition Button') class TestAdditionCase(AndroidCalculatorBaseTestCase): """ Android Calculator App Test: Addition This suite tests the current code in the calculator. Terminology Addend + Addend = Sum Test Suite List: Should be able to add two positive integers numbers Should be able to add a negative integer to a positive floating point number Should be able to add a floating point number to an integer Should be able to add an integer to a floating point number Should be able to add two floating point numbers Should be able to add a negative integer and zero Should be able to add zero and a positive integer Should be able to add a negative integer with a positive number Should be able to add two large positive integers Should be able to add a negative floating point and a positive integer Should be able to add a positive integer to the results of a previous operation Should be able to add a positive floating point number to the results of a previous operation Should be able to add a floating point number with many decimal places to a previous result Should be able to add a large integer to a previous result Source: https://mozilla.github.io/calculator/test/ """ def test_able_to_add_two_positive_integers(self): """ Should be able to add two positive integers numbers and display the result Steps: 1. Key in a valid integer from - 9999999999 to +9999999999 2. Key in operator + 3. Key in second operand,a valid integer from - 9999999999 To +999999999 4. Result verification > check the screen output Source: https://www.ques10.com/p/38809/prepare-and-write-six-test-cases-for-simple-calcul/? :return: """ allure.dynamic.title("Add two positive integers numbers and display the result") allure.dynamic.severity(allure.severity_level.BLOCKER) # Should be able to add two positive integers numbers numbers = [1, 1] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == str(sum(numbers)) numbers = [1, 9] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == str(sum(numbers)) numbers = [19, 2] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == str(sum(numbers)) numbers = [19, 37] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == str(sum(numbers)) numbers = [1500, 2000] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) assert self.app.screen_result.formatted_text == str(sum(numbers)) numbers = [999999, 1] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == str(sum(numbers)) numbers = [9999999, 1] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [99999999, 1] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [999999999, 1] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [9999999999, 1] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_a_negative_integer_to_a_positive_floating_point_number(self): """ Should be able to add a negative integer to a positive floating point number :return: """ allure.dynamic.title("Add a negative integer to a positive floating point number") allure.dynamic.severity(allure.severity_level.BLOCKER) numbers = [-1, 1.000] with allure.step("Check the addition of negative integer to a positive floating point number: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [-2, 1.000] with allure.step( "Check the addition of negative integer to a positive floating point number: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [-1, 2.000] with allure.step( "Check the addition of negative integer to a positive floating point number: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_a_floating_point_number_to_an_integer(self): """ Should be able to add a floating point number to an integer :return: """ allure.dynamic.title("Add a floating point number to an integer") allure.dynamic.severity(allure.severity_level.BLOCKER) numbers = [10.1, 2] with allure.step( "Check the addition of floating point number to an integer: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [10.000, 2] with allure.step( "Check the addition of floating point number to an integer: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [0.0, 2] with allure.step( "Check the addition of floating point number to an integer: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_an_integer_to_a_floating_point_number(self): """ Should be able to add an integer to a floating point number :return: """ allure.dynamic.title("Add an integer to a floating point number") allure.dynamic.severity(allure.severity_level.BLOCKER) numbers = [10, 9.9999] with allure.step( "Check the addition of an integer to a floating point number: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [9, 10.9999] with allure.step( "Check the addition of an integer to a floating point number: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_two_floating_point_numbers(self): """ Should be able to add two floating point numbers :return: """ allure.dynamic.title("Add two floating point numbers") allure.dynamic.severity(allure.severity_level.BLOCKER) numbers = [34.999, 1.0] with allure.step( "Check the addition of two floating point numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [1.0, 34.999] with allure.step( "Check the addition of two floating point numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [1.0000, 34.999] with allure.step( "Check the addition of two floating point numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_a_negative_integer_and_zero(self): """ Should be able to add a negative integer and zero :return: """ allure.dynamic.title("Add a negative integer and zero") allure.dynamic.severity(allure.severity_level.BLOCKER) numbers = [0, -5] with allure.step( "Check the addition of negative integer and zero: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [-5, 0] with allure.step( "Check the addition of negative integer and zero: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [5, -0] with allure.step( "Check the addition of negative integer and zero: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [-0, 5] with allure.step( "Check the addition of negative integer and zero: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_zero_and_a_positive_integer(self): """ Should be able to add zero and a positive integer :return: """ allure.dynamic.title("Add zero and a positive integer") allure.dynamic.severity(allure.severity_level.BLOCKER) numbers = [0, 0] with allure.step("Check the addition of zero and a positive integer: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [0, 1] with allure.step("Check the addition of zero and a positive integer: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [1, 0] with allure.step("Check the addition of zero and a positive integer: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [0, 5] with allure.step("Check the addition of zero and a positive integer: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_a_negative_integer_with_a_positive_number(self): """ Should be able to add a negative integer with a positive number :return: """ allure.dynamic.title("Add a negative integer with a positive number") allure.dynamic.severity(allure.severity_level.BLOCKER) numbers = [-5, 5] with allure.step("Check the addition of a negative integer with a positive number: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [5, -5] with allure.step("Check the addition of a negative integer with a positive number: {}".format(numbers)): self.perform_addition(numbers) assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [6, -5] with allure.step("Check the addition of a negative integer with a positive number: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [-6, 5] with allure.step("Check the addition of a negative integer with a positive number: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_two_large_positive_integers(self): """ Should be able to add two large positive integers :return: """ allure.dynamic.title("Add two large positive integers") allure.dynamic.severity(allure.severity_level.BLOCKER) numbers = [999999, 999999] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [999999, 99999] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [99999, 99999] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [53645567, 78967875] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [9999999999, 567457362343241] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [300000000, 900000000] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [900000000, 900000000] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [999999999, 1] with allure.step("Check the addition of integer numbers: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_a_negative_floating_point_and_a_positive_integer(self): """ Should be able to add a negative floating point and a positive integer :return: """ allure.dynamic.title("Add a negative floating point and a positive integer") allure.dynamic.severity(allure.severity_level.BLOCKER) numbers = [-1987.50, 1987] with allure.step("Check the addition of negative floating point and a positive integer: {}".format(numbers)): self.perform_addition(numbers) assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) numbers = [1987, -1987.50] with allure.step("Check the addition of negative floating point and a positive integer: {}".format(numbers)): self.perform_addition(numbers) with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) def test_able_to_add_a_positive_integer_to_the_results_of_a_previous_operation(self): """ Should be able to add a positive integer to the results of a previous operation :return: """ allure.dynamic.title("Add a positive integer to the results of a previous operation") allure.dynamic.severity(allure.severity_level.BLOCKER) # 1500 - 2000 = -500 + 500 = numbers = [1500, -2000, -500, 500] with allure.step("Enter following: 1500 - 2000 = -500 + 500 ="): self.enter_digit(numbers[0]) self.app.plus.tap() self.enter_digit(numbers[1]) self.app.plus.tap() self.enter_digit(numbers[2]) self.app.plus.tap() self.enter_digit(numbers[3]) self.app.equal.tap() with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(sum(numbers)) # 6 * 2 + 8 = 20 numbers = [6, 2, 8] with allure.step("Enter following: 6 * 2 + 8 ="): self.enter_digit(numbers[0]) self.app.multiplication.tap() self.enter_digit(numbers[1]) self.app.plus.tap() self.enter_digit(numbers[2]) self.app.equal.tap() with allure.step("Check the result"): assert self.app.screen_result.formatted_text == self.eval_formula(6 * 2 + 8) def test_able_to_add_a_positive_floating_point_number_to_the_results_of_a_previous_operation(self): """ Should
actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.move_book), '__call__') as call: # Designate an appropriate return value for the call. call.return_value =grpc_helpers_async.FakeUnaryUnaryCall(library.Book( name='name_value', author='author_value', title='title_value', read=True, )) response = await client.move_book(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == library.MoveBookRequest() # Establish that the response is the type that we expect. assert isinstance(response, library.Book) assert response.name == 'name_value' assert response.author == 'author_value' assert response.title == 'title_value' assert response.read is True @pytest.mark.asyncio async def test_move_book_async_from_dict(): await test_move_book_async(request_type=dict) def test_move_book_field_headers(): client = LibraryServiceClient( credentials=ga_credentials.AnonymousCredentials(), ) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = library.MoveBookRequest() request.name = 'name/value' # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.move_book), '__call__') as call: call.return_value = library.Book() client.move_book(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ( 'x-goog-request-params', 'name=name/value', ) in kw['metadata'] @pytest.mark.asyncio async def test_move_book_field_headers_async(): client = LibraryServiceAsyncClient( credentials=ga_credentials.AnonymousCredentials(), ) # Any value that is part of the HTTP/1.1 URI should be sent as # a field header. Set these to a non-empty value. request = library.MoveBookRequest() request.name = 'name/value' # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.move_book), '__call__') as call: call.return_value = grpc_helpers_async.FakeUnaryUnaryCall(library.Book()) await client.move_book(request) # Establish that the underlying gRPC stub method was called. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0] == request # Establish that the field header was sent. _, _, kw = call.mock_calls[0] assert ( 'x-goog-request-params', 'name=name/value', ) in kw['metadata'] def test_move_book_flattened(): client = LibraryServiceClient( credentials=ga_credentials.AnonymousCredentials(), ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.move_book), '__call__') as call: # Designate an appropriate return value for the call. call.return_value = library.Book() # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. client.move_book( name='name_value', other_shelf_name='other_shelf_name_value', ) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) == 1 _, args, _ = call.mock_calls[0] assert args[0].name == 'name_value' assert args[0].other_shelf_name == 'other_shelf_name_value' def test_move_book_flattened_error(): client = LibraryServiceClient( credentials=ga_credentials.AnonymousCredentials(), ) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): client.move_book( library.MoveBookRequest(), name='name_value', other_shelf_name='other_shelf_name_value', ) @pytest.mark.asyncio async def test_move_book_flattened_async(): client = LibraryServiceAsyncClient( credentials=ga_credentials.AnonymousCredentials(), ) # Mock the actual call within the gRPC stub, and fake the request. with mock.patch.object( type(client.transport.move_book), '__call__') as call: # Designate an appropriate return value for the call. call.return_value = library.Book() call.return_value = grpc_helpers_async.FakeUnaryUnaryCall(library.Book()) # Call the method with a truthy value for each flattened field, # using the keyword arguments to the method. response = await client.move_book( name='name_value', other_shelf_name='other_shelf_name_value', ) # Establish that the underlying call was made with the expected # request object values. assert len(call.mock_calls) _, args, _ = call.mock_calls[0] assert args[0].name == 'name_value' assert args[0].other_shelf_name == 'other_shelf_name_value' @pytest.mark.asyncio async def test_move_book_flattened_error_async(): client = LibraryServiceAsyncClient( credentials=ga_credentials.AnonymousCredentials(), ) # Attempting to call a method with both a request object and flattened # fields is an error. with pytest.raises(ValueError): await client.move_book( library.MoveBookRequest(), name='name_value', other_shelf_name='other_shelf_name_value', ) def test_credentials_transport_error(): # It is an error to provide credentials and a transport instance. transport = transports.LibraryServiceGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) with pytest.raises(ValueError): client = LibraryServiceClient( credentials=ga_credentials.AnonymousCredentials(), transport=transport, ) # It is an error to provide a credentials file and a transport instance. transport = transports.LibraryServiceGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) with pytest.raises(ValueError): client = LibraryServiceClient( client_options={"credentials_file": "credentials.json"}, transport=transport, ) # It is an error to provide scopes and a transport instance. transport = transports.LibraryServiceGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) with pytest.raises(ValueError): client = LibraryServiceClient( client_options={"scopes": ["1", "2"]}, transport=transport, ) def test_transport_instance(): # A client may be instantiated with a custom transport instance. transport = transports.LibraryServiceGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) client = LibraryServiceClient(transport=transport) assert client.transport is transport def test_transport_get_channel(): # A client may be instantiated with a custom transport instance. transport = transports.LibraryServiceGrpcTransport( credentials=ga_credentials.AnonymousCredentials(), ) channel = transport.grpc_channel assert channel transport = transports.LibraryServiceGrpcAsyncIOTransport( credentials=ga_credentials.AnonymousCredentials(), ) channel = transport.grpc_channel assert channel @pytest.mark.parametrize("transport_class", [ transports.LibraryServiceGrpcTransport, transports.LibraryServiceGrpcAsyncIOTransport, ]) def test_transport_adc(transport_class): # Test default credentials are used if not provided. with mock.patch.object(google.auth, 'default') as adc: adc.return_value = (ga_credentials.AnonymousCredentials(), None) transport_class() adc.assert_called_once() def test_transport_grpc_default(): # A client should use the gRPC transport by default. client = LibraryServiceClient( credentials=ga_credentials.AnonymousCredentials(), ) assert isinstance( client.transport, transports.LibraryServiceGrpcTransport, ) def test_library_service_base_transport_error(): # Passing both a credentials object and credentials_file should raise an error with pytest.raises(core_exceptions.DuplicateCredentialArgs): transport = transports.LibraryServiceTransport( credentials=ga_credentials.AnonymousCredentials(), credentials_file="credentials.json" ) def test_library_service_base_transport(): # Instantiate the base transport. with mock.patch('google.example.library_v1.services.library_service.transports.LibraryServiceTransport.__init__') as Transport: Transport.return_value = None transport = transports.LibraryServiceTransport( credentials=ga_credentials.AnonymousCredentials(), ) # Every method on the transport should just blindly # raise NotImplementedError. methods = ( 'create_shelf', 'get_shelf', 'list_shelves', 'delete_shelf', 'merge_shelves', 'create_book', 'get_book', 'list_books', 'delete_book', 'update_book', 'move_book', ) for method in methods: with pytest.raises(NotImplementedError): getattr(transport, method)(request=object()) with pytest.raises(NotImplementedError): transport.close() @requires_google_auth_gte_1_25_0 def test_library_service_base_transport_with_credentials_file(): # Instantiate the base transport with a credentials file with mock.patch.object(google.auth, 'load_credentials_from_file', autospec=True) as load_creds, mock.patch('google.example.library_v1.services.library_service.transports.LibraryServiceTransport._prep_wrapped_messages') as Transport: Transport.return_value = None load_creds.return_value = (ga_credentials.AnonymousCredentials(), None) transport = transports.LibraryServiceTransport( credentials_file="credentials.json", quota_project_id="octopus", ) load_creds.assert_called_once_with("credentials.json", scopes=None, default_scopes=( ), quota_project_id="octopus", ) @requires_google_auth_lt_1_25_0 def test_library_service_base_transport_with_credentials_file_old_google_auth(): # Instantiate the base transport with a credentials file with mock.patch.object(google.auth, 'load_credentials_from_file', autospec=True) as load_creds, mock.patch('google.example.library_v1.services.library_service.transports.LibraryServiceTransport._prep_wrapped_messages') as Transport: Transport.return_value = None load_creds.return_value = (ga_credentials.AnonymousCredentials(), None) transport = transports.LibraryServiceTransport( credentials_file="credentials.json", quota_project_id="octopus", ) load_creds.assert_called_once_with("credentials.json", scopes=( ), quota_project_id="octopus", ) def test_library_service_base_transport_with_adc(): # Test the default credentials are used if credentials and credentials_file are None. with mock.patch.object(google.auth, 'default', autospec=True) as adc, mock.patch('google.example.library_v1.services.library_service.transports.LibraryServiceTransport._prep_wrapped_messages') as Transport: Transport.return_value = None adc.return_value = (ga_credentials.AnonymousCredentials(), None) transport = transports.LibraryServiceTransport() adc.assert_called_once() @requires_google_auth_gte_1_25_0 def test_library_service_auth_adc(): # If no credentials are provided, we should use ADC credentials. with mock.patch.object(google.auth, 'default', autospec=True) as adc: adc.return_value = (ga_credentials.AnonymousCredentials(), None) LibraryServiceClient() adc.assert_called_once_with( scopes=None, default_scopes=( ), quota_project_id=None, ) @requires_google_auth_lt_1_25_0 def test_library_service_auth_adc_old_google_auth(): # If no credentials are provided, we should use ADC credentials. with mock.patch.object(google.auth, 'default', autospec=True) as adc: adc.return_value = (ga_credentials.AnonymousCredentials(), None) LibraryServiceClient() adc.assert_called_once_with( scopes=(), quota_project_id=None, ) @pytest.mark.parametrize( "transport_class", [ transports.LibraryServiceGrpcTransport, transports.LibraryServiceGrpcAsyncIOTransport, ], ) @requires_google_auth_gte_1_25_0 def test_library_service_transport_auth_adc(transport_class): # If credentials and host are not provided, the transport class should use # ADC credentials. with mock.patch.object(google.auth, 'default', autospec=True) as adc: adc.return_value = (ga_credentials.AnonymousCredentials(), None) transport_class(quota_project_id="octopus", scopes=["1", "2"]) adc.assert_called_once_with( scopes=["1", "2"], default_scopes=(), quota_project_id="octopus", ) @pytest.mark.parametrize( "transport_class", [ transports.LibraryServiceGrpcTransport, transports.LibraryServiceGrpcAsyncIOTransport, ], ) @requires_google_auth_lt_1_25_0 def test_library_service_transport_auth_adc_old_google_auth(transport_class): # If credentials and host are not provided, the transport class should use # ADC credentials. with mock.patch.object(google.auth, "default", autospec=True) as adc: adc.return_value = (ga_credentials.AnonymousCredentials(), None) transport_class(quota_project_id="octopus") adc.assert_called_once_with(scopes=( ), quota_project_id="octopus", ) @pytest.mark.parametrize( "transport_class,grpc_helpers", [ (transports.LibraryServiceGrpcTransport, grpc_helpers), (transports.LibraryServiceGrpcAsyncIOTransport, grpc_helpers_async) ], ) def test_library_service_transport_create_channel(transport_class, grpc_helpers): # If credentials and host are not provided, the transport class should use # ADC credentials. with mock.patch.object(google.auth, "default", autospec=True) as adc, mock.patch.object( grpc_helpers, "create_channel", autospec=True ) as create_channel: creds = ga_credentials.AnonymousCredentials() adc.return_value = (creds, None) transport_class( quota_project_id="octopus", scopes=["1", "2"] ) create_channel.assert_called_with( "library-example.googleapis.com:443", credentials=creds, credentials_file=None, quota_project_id="octopus", default_scopes=( ), scopes=["1", "2"], default_host="library-example.googleapis.com", ssl_credentials=None, options=[ ("grpc.max_send_message_length", -1), ("grpc.max_receive_message_length", -1), ], ) @pytest.mark.parametrize("transport_class", [transports.LibraryServiceGrpcTransport, transports.LibraryServiceGrpcAsyncIOTransport]) def test_library_service_grpc_transport_client_cert_source_for_mtls( transport_class ): cred = ga_credentials.AnonymousCredentials() # Check ssl_channel_credentials is used if provided. with mock.patch.object(transport_class, "create_channel") as mock_create_channel: mock_ssl_channel_creds = mock.Mock() transport_class( host="squid.clam.whelk", credentials=cred, ssl_channel_credentials=mock_ssl_channel_creds ) mock_create_channel.assert_called_once_with( "squid.clam.whelk:443", credentials=cred, credentials_file=None, scopes=None, ssl_credentials=mock_ssl_channel_creds, quota_project_id=None, options=[ ("grpc.max_send_message_length", -1), ("grpc.max_receive_message_length", -1), ], ) # Check if ssl_channel_credentials is not provided, then client_cert_source_for_mtls # is used. with mock.patch.object(transport_class, "create_channel", return_value=mock.Mock()): with mock.patch("grpc.ssl_channel_credentials") as mock_ssl_cred: transport_class( credentials=cred, client_cert_source_for_mtls=client_cert_source_callback ) expected_cert, expected_key = client_cert_source_callback() mock_ssl_cred.assert_called_once_with( certificate_chain=expected_cert, private_key=expected_key ) def test_library_service_host_no_port(): client = LibraryServiceClient( credentials=ga_credentials.AnonymousCredentials(), client_options=client_options.ClientOptions(api_endpoint='library-example.googleapis.com'), ) assert client.transport._host == 'library-example.googleapis.com:443' def test_library_service_host_with_port(): client = LibraryServiceClient( credentials=ga_credentials.AnonymousCredentials(), client_options=client_options.ClientOptions(api_endpoint='library-example.googleapis.com:8000'), ) assert client.transport._host == 'library-example.googleapis.com:8000' def test_library_service_grpc_transport_channel(): channel = grpc.secure_channel('http://localhost/', grpc.local_channel_credentials()) # Check that channel is used if provided. transport = transports.LibraryServiceGrpcTransport( host="squid.clam.whelk", channel=channel, ) assert transport.grpc_channel == channel assert transport._host == "squid.clam.whelk:443" assert transport._ssl_channel_credentials == None def test_library_service_grpc_asyncio_transport_channel(): channel = aio.secure_channel('http://localhost/', grpc.local_channel_credentials()) # Check that channel is used if provided. transport = transports.LibraryServiceGrpcAsyncIOTransport( host="squid.clam.whelk", channel=channel, ) assert transport.grpc_channel == channel assert transport._host == "squid.clam.whelk:443" assert transport._ssl_channel_credentials == None # Remove this test when deprecated arguments (api_mtls_endpoint,
""" Module containing all necessary calculations, functions and classes, for ionization calculations from Budapest-Florida code output. It uses the interface given in tcdata.py module. Most important feature is: Ionization.IonizationForRawprofile static method calculates ionization for given rawProfile object. """ #TODO: # - Callable functions from outside # - Testing utilites # - resolve circular dependencies from math import pi from math import exp from math import sqrt import astropy.constants as consts import astropy.units as u from astropy.units.core import _recreate_irreducible_unit import numpy as np #from . import tcdata as tcdata #import __init__ #import tcdata.tcdata as tcdata try: from . import tcdata as tcdata except (SystemError,ImportError): #this should be removed when all tests are defined in tests import tcdata as tcdata class IterationError(Exception): def __init__(self, *args: object) -> None: super().__init__(*args) class ConstantsCalculator: """ Class calculating the right hand side of Saha equations. """ R_HII = 0.0 R_HeII = 0.0 R_HeIII = 0.0 n_H = 0.0 n_He = 0.0 M_He = 6.6464764e-24 M_H = 1.6735575e-24 X=0.75 Y=0.2499 def __init__(self, X=0, Y=0): self.R_HII = 0.0 self.R_HeII = 0.0 self.R_HeIII = 0.0 self.n_H = 0.0 self.n_He = 0.0 self.M_He = 6.6464764e-24 self.M_H = 1.6735575e-24 self.X=X self.Y=Y #@staticmethod def RHS_calc(self, T, khi, g_factor): m_e = consts.m_e.cgs.value k_B = consts.k_B.cgs.value h = consts.h.cgs.value RHS = (2 * pi * m_e * k_B * T) ** 1.5 / h ** 3 * g_factor * exp(-khi / k_B / T) return RHS def Calc_R_HII(self, Temp): khi = 13.54 * u.eV self.R_HII = self.RHS_calc(Temp, khi.to_value(u.erg), 1 ) return None def Calc_R_HeII(self, Temp): khi = 24.48 * u.eV self.R_HeII = self.RHS_calc(Temp, khi.to_value(u.erg), 4 ) return None def Calc_R_HeIII(self, Temp): khi = 54.17 * u.eV self.R_HeIII = self.RHS_calc(Temp, khi.to_value(u.erg), 1 ) return None def Calc_n_H(self, rho): self.n_H = self.X * rho / self.M_H return None def Calc_n_He(self, rho): self.n_He = self.Y * rho / self.M_He return None def Calc_consts(self,rho,Temp): self.Calc_n_H(rho) self.Calc_n_He(rho) self.Calc_R_HII(Temp) self.Calc_R_HeII(Temp) self.Calc_R_HeIII(Temp) return None class IonizationData(tcdata.BaseData): """ Class which communicates with tcdata objects. """ def __init__(self): ionization_columnnames = ('HII_fraction','HeII_fraction','HeIII_fraction') super().__init__(dict(zip(ionization_columnnames,[0,0,0])),ionization_columnnames) @classmethod def initWithData(cls,x,y,z): obj = IonizationData() obj.datablock['HII_fraction'] = x obj.datablock['HeII_fraction'] = y obj.datablock['HeIII_fraction'] = z return obj def injectToDataPoint(self, datapoint_obj : tcdata.DataPoint): #print(self.datablock) datapoint_obj.insertColumn(self.datablock,self.column_names) #print(datapoint_obj.HII_fraction) return datapoint_obj class Ionization: """ Class mainly responsible for ionization calculations. """ def __init__(self,tc_cell_object : tcdata.DataPoint,X,Y,rho=None,T=None ): self.Constants = ConstantsCalculator(X,Y) self.x = 0 self.y = 0 self.z = 0 self.tc_object = tc_cell_object self.Constants.X = X self.Constants.Y = Y if rho is None or T is None: self.Constants.Calc_consts(1/self.tc_object.spec_vol,self.tc_object.temperature) else: self.Constants.Calc_consts(rho,T) @staticmethod def diff(x1,y1,z1,x2,y2,z2): dx=x2-x1 dy=y2-y1 dz=z2-z1 difference=sqrt(dx**2+dy**2+dz**2) return difference @staticmethod def __Discriminant(b,c): return b ** 2 - 4 *c def __CalcSecondOrder(self,b,c): det = self.__Discriminant(b,c) return (- b + sqrt(det))/2 def __FirstIteration(self): """ In this step we calcute x whitout y and z, calculate y without z and calculate z with y~1-z """ x = y = z = 0 b_x = self.Constants.R_HII / self.Constants.n_H c_x = - self.Constants.R_HII / self.Constants.n_H x = self.__CalcSecondOrder(b_x, c_x) b_y = (x* self.Constants.n_H + self.Constants.R_HeII) / self.Constants.n_He c_y = - self.Constants.R_HeII / self.Constants.n_He y = self.__CalcSecondOrder(b_y,c_y) b_z = (x* self.Constants.n_H + self.Constants.n_He + self.Constants.R_HeIII) / self.Constants.n_He c_z = - self.Constants.R_HeIII / self.Constants.n_He z = self.__CalcSecondOrder(b_z, c_z) #print(x,y,z) return x,y,z def __SecondIteration(self,x0,y0,z0): """ In this step we uses previous x0 y0 and z0 values, with full n_e. Here we calcute frist z and after that y, because 1-y-z < 0 or should use only 1-y? """ b_x = (y0 * self.Constants.n_He + 2 * z0 * self.Constants.n_He + self.Constants.R_HII) / self.Constants.n_H c_x = - self.Constants.R_HII / self.Constants.n_H b_y = (x0* self.Constants.n_H + self.Constants.R_HeII + 2 * z0 * self.Constants.n_He) / self.Constants.n_He c_y = (z0 - 1) * self.Constants.R_HeII / self.Constants.n_He y = self.__CalcSecondOrder(b_y,c_y) b_z = (x0* self.Constants.n_H + y * self.Constants.n_He) / (2 * self.Constants.n_He) c_z = - y * self.Constants.R_HeIII / (2* self.Constants.n_He) x = self.__CalcSecondOrder(b_x, c_x) z = self.__CalcSecondOrder(b_z, c_z) self.x = x self.y = y self.z = z return x,y,z def Calculation(self): """ The calculation of the ionization fractions. """ x,y,z = self.__FirstIteration() x,y,z = self.__SecondIteration(x,y,z) next_iterations = NewtonianIterator(x,y,z,self.Constants) x,y,z = next_iterations.NewtonianIteration() self.x = x self.y = y self.z = z return x,y,z def Reload(self, tc_cell_object : tcdata.DataPoint,X,Y,rho=None, T=None): self.x = 0 self.y = 0 self.z = 0 self.tc_object = tc_cell_object self.Constants.X = X self.Constants.Y = Y if rho is None or T is None: self.Constants.Calc_consts(1/self.tc_object.spec_vol,self.tc_object.temperature) else: self.Constants.Calc_consts(rho,T) @staticmethod def IonizationForRawprofile(raw_obj : tcdata.RawProfiles,X,Y): calculator = Ionization(raw_obj[1],X,Y) for cell_obj in raw_obj: #print(cell_obj.zone) if cell_obj.temperature <= 0: iondata = IonizationData.initWithData(0,0,0) iondata.injectToDataPoint(cell_obj) continue calculator.Reload(cell_obj,X,Y) x,y,z = calculator.Calculation() iondata = IonizationData.initWithData(x,y,z) iondata.injectToDataPoint(cell_obj) # print(iondata.datablock) # print(cell_obj.data('HeII_fraction')) #print(raw_obj[15].HII_fraction) return raw_obj class NewtonianIterator: """ Helper class for Newton iterations. """ def __init__(self,x0,y0,z0,_Constants : ConstantsCalculator): self.Constants = _Constants self.__x_vec_n = np.array([x0,y0,z0]) self.__x_vec_np1 = np.array([x0,x0,x0]) def __f_vector(self,x_vec) -> np.array : x = x_vec[0] y = x_vec[1] z = x_vec[2] b_x = (y * self.Constants.n_He + 2 * z * self.Constants.n_He + self.Constants.R_HII) / self.Constants.n_H c_x = - self.Constants.R_HII / self.Constants.n_H b_y = (x* self.Constants.n_H + self.Constants.R_HeII + 2 * z * self.Constants.n_He) / self.Constants.n_He c_y = (z - 1) * self.Constants.R_HeII / self.Constants.n_He b_z = (x* self.Constants.n_H + y * self.Constants.n_He) / (2 * self.Constants.n_He) c_z = - y * self.Constants.R_HeIII / (2* self.Constants.n_He) fvec = np.array( [x ** 2 + x * b_x + c_x, y ** 2 + y * b_y + c_y, z ** 2 + z * b_z + c_z] ) return fvec def __jacobian(self,x_vec = None) -> np.array : if x_vec is None: x_vec = self.__x_vec_n x = x_vec[0] y = x_vec[1] z = x_vec[2] b_x = (y * self.Constants.n_He + 2 * z * self.Constants.n_He + self.Constants.R_HII) / self.Constants.n_H b_y = (x* self.Constants.n_H + self.Constants.R_HeII + 2 * z * self.Constants.n_He) / self.Constants.n_He b_z = (x* self.Constants.n_H + y * self.Constants.n_He) / (2 * self.Constants.n_He) thejacobian = np.array( [ [2 *x + b_x, x * self.Constants.n_He/self.Constants.n_H, 2* x *self.Constants.n_He / self.Constants.n_H], [y * self.Constants.n_H / self.Constants.n_He, 2*y + b_y, 2 * y + self.Constants.R_HeII / self.Constants.n_He] , [0.5 *z * self.Constants.n_H / self.Constants.n_He, 0.5 * (z - self.Constants.R_HeIII / self.Constants.n_He), 2*z + b_z] ] ) return thejacobian def NewtonianIteration(self,x_vec = None): """ Starting from the third step, we use Newton-Raphson method using previous results as starting values. """ if x_vec is None: x_vec = self.__x_vec_n x_vec_np1 = self.__x_vec_np1 else: x_vec=np.array([x0,y0,z0]) iteration_cnt = 0 while True: Jac=self.__jacobian(x_vec) x_vec_np1 = x_vec - np.linalg.inv(Jac).dot(self.__f_vector(x_vec)) iteration_cnt += 1 if Ionization.diff(*x_vec_np1,*x_vec) < 1e-8 or iteration_cnt >= 1000: x_vec=x_vec_np1 if iteration_cnt >= 1000: raise IterationError("Iteration not converge") break x_vec=x_vec_np1 return x_vec[0],x_vec[1],x_vec[2] if __name__ == '__main__': infile = open("adat_ready.txt", "r") lines = [line.strip("\n") for line in infile] infile.close() data=list() for line in lines: data.append(list(float(words) for words in line.split())) datablock = [[] for i in range(4) ] print(len(lines)) line= None outfile = open("kimenet.txt","w") # adatsor for line in data: if len(line) == 0: continue rho = 1/line[8] #adat_ready.txt T = line[10] # adat_ready.txt if T <= 0: continue datablock[0].append(T) # x0,y0,z0 = FirstIteration() # x0,y0,z0 = SecondIteration(x0,y0,z0) # x0,y0,z0 = NewtonianIteration(x0,y0,z0) ionization_obj = Ionization(tcdata.DataPoint(""),0.75,0.2499,rho,T) x0,y0,z0 = ionization_obj.Calculation() datablock[1].append(x0) datablock[2].append(y0) datablock[3].append(z0) outfile.write("{0} {1:8.6E} {2:8.6E} {3:8.6E} {4:8.6E} {5:8.6E} {6:8.6E}\n".format(T,x0,y0,z0,line[2],line[3],line[4])) ###Checking """n_e=x2*Constants.n_H + (y2 + 2 * z2) * Constants.n_He n_e0=x0*Constants.n_H + (y0 + 2 * z0) * Constants.n_He egy1 = x2 * n_e / (1 - x2) - Constants.R_HII egy2 = y2 * n_e / (1 - y2 - z2) - Constants.R_HeII egy3 = z2 * n_e / y2 - Constants.R_HeIII egy01 = x0 * n_e0 / (1 - x0) - Constants.R_HII egy02 = y0 * n_e0 / (1 - y0 - z0) - Constants.R_HeII egy03 = z0 * n_e0 / y0 - Constants.R_HeIII """ #print(" pontosság: ", (egy1/Constants.R_HII+egy1/(x0 * n_e / (1 - x0)))/2) #y0 = #fsolve(f02, 0.675486) #z0 = #fsolve(f03, 0.664258) #print(x0,y0,z0) #x,y,z, = -1, -1,-1 #if T > 100000: # x0,y0,z0 = 0.99 , 0.01, 0.99 #elif T > 50000: # x0,y0,z0 = 0.9576, 0.6548, 0.4012
<reponame>matthewpipie/vectra_api_tools import json import requests import warnings import html import re warnings.filterwarnings('always', '.*', PendingDeprecationWarning) class HTTPException(Exception): def __init__(self, response): """ Custom exception class to report possible API errors The body is contructed by extracting the API error code from the requests.Response object """ try: r = response.json() if 'detail' in r: detail = r['detail'] elif 'errors' in r: detail = r['errors'][0]['title'] elif '_meta' in r: detail = r['_meta']['message'] else: detail = response.content except Exception: detail = response.content body = 'Status code: {code} - {detail}'.format(code=str(response.status_code), detail=detail) super().__init__(body) def request_error_handler(func): def request_handler(self, *args, **kwargs): response = func(self, *args, **kwargs) if response.status_code in [200, 201, 204]: return response else: raise HTTPException(response) return request_handler def validate_api_v2(func): def api_validator(self, *args, **kwargs): if self.version == 2: return func(self, *args, **kwargs) else: raise NotImplementedError('Method only accessible via v2 of API') return api_validator def deprecation(message): warnings.warn(message, PendingDeprecationWarning) def param_deprecation(key): message = '{0} will be deprecated with Vectra API v1 which will be annouced in an upcoming release'.format(key) warnings.warn(message, PendingDeprecationWarning) class VectraClient(object): def __init__(self, url=None, token=None, user=None, password=None, verify=False): """ Initialize Vectra client :param url: IP or hostname of Vectra brain (ex https://www.example.com) - required :param token: API token for authentication when using API v2* :param user: Username to authenticate to Vectra brain when using API v1* :param password: Password when using username to authenticate using API v1* :param verify: Verify SSL (default: False) - optional *Either token or user are required """ self.url = url self.version = 2 if token else 1 self.verify = verify url = VectraClient._remove_trailing_slashes(url) if token: self.url = '{url}/api/v2'.format(url=url) self.headers = { 'Authorization': "Token " + token.strip(), 'Content-Type': "application/json", 'Cache-Control': "no-cache" } elif user and password: self.url = '{url}/api'.format(url=url) self.auth = (user, password) deprecation('Deprecation of the Vectra API v1 will be announced in an upcoming release. Migrate to API v2' ' when possible') else: raise RuntimeError("At least one form of authentication is required. Please provide a token or username" " and password") @staticmethod def _remove_trailing_slashes(url): url = url[:-1] if url.endswith('/') else url return url @staticmethod def _generate_campaign_params(args): """ Generate query parameters for campaigns based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['fields', 'dst_ip', 'target_domain', 'state', 'name', 'last_updated_gte', 'note_modified_timestamp_gte','page', 'page_size'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid campaign query parameter'.format(str(k))) return params @staticmethod def _generate_host_params(args): """ Generate query parameters for hosts based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['active_traffic', 'all', 'c_score', 'c_score_gte', 'certainty', 'certainty_gte', 'fields', 'has_active_traffic', 'include_detection_summaries', 'is_key_asset', 'is_targeting_key_asset', 'key_asset', 'last_detection_timestamp', 'last_source', 'mac_address', 'max_id', 'min_id', 'name', 'note_modified_timestamp_gte', 'ordering','page', 'page_size', 'privilege_category', 'privilege_level', 'privilege_level_gte', 'state', 't_score', 't_score_gte', 'tags', 'targets_key_asset', 'threat', 'threat_gte'] deprecated_keys = ['c_score', 'c_score_gte', 'key_asset', 't_score', 't_score_gte', 'targets_key_asset'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid host query parameter'.format(str(k))) if k in deprecated_keys: param_deprecation(k) return params @staticmethod def _generate_host_by_id_params(args): """ Generate query parameters for host based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['fields', 'include_external', 'include_ldap'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid host query parameter'.format(str(k))) return params @staticmethod def _generate_detection_params(args): """ Generate query parameters for detections based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['c_score', 'c_score_gte', 'category', 'certainty', 'certainty_gte', 'description', 'detection', 'detection_category', 'detection_type', 'fields', 'host_id', 'is_targeting_key_asset', 'is_triaged', 'last_timestamp', 'max_id', 'min_id', 'note_modified_timestamp_gte', 'ordering', 'page', 'page_size', 'src_ip', 'state', 't_score', 't_score_gte', 'tags', 'targets_key_asset', 'threat', 'threat_gte'] deprecated_keys = ['c_score', 'c_score_gte', 'category', 'detection', 't_score', 't_score_gte', 'targets_key_asset'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid detection query parameter'.format(str(k))) if k in deprecated_keys: param_deprecation(k) return params @staticmethod def _generate_group_params(args): """ Generate query parameters for groups based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['description', 'domains', 'host_ids', 'host_names', 'last_modified_by', 'last_modified_timestamp', 'name', 'page', 'page_size', 'type'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid group query parameter'.format(str(k))) return params @staticmethod def _generate_rule_params(args): """ Generate query parameters for rules based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['contains', 'fields', 'include_templates', 'page', 'page_size', 'ordering'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid rule query parameter'.format(str(k))) return params @staticmethod def _generate_rule_by_id_params(args): """ Generate query parameters for rule based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['fields'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid rule query parameter'.format(str(k))) return params @staticmethod def _generate_user_params(args): """ Generate query parameters for users based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['username', 'role', 'account_type', 'authentication_profile', 'last_login_gte'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid user query parameter'.format(str(k))) return params @staticmethod def _generate_ip_address_params(args): """ Generate query parameters for ip address queries based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['include_ipv4', 'include_ipv6'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid ip address query parameter'.format(str(k))) return params @staticmethod def _generate_subnet_params(args): """ Generate query parameters for subnet queries based on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['ordering', 'search'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid subnet query parameter'.format(str(k))) return params @staticmethod def _generate_internal_network_params(args): """ Generate query parameters for internal network queries based on provided argsbased on provided args :param args: dict of keys to generate query params :rtype: dict """ params = {} valid_keys = ['include_ipv4', 'include_ipv6'] for k, v in args.items(): if k in valid_keys: if v is not None: params[k] = v else: raise ValueError('argument {} is an invalid internal network query parameter'.format(str(k))) return params @validate_api_v2 @request_error_handler def _get_request(self, url, **kwargs): """ Do a get request on the provided URL This is used by paginated endpoints :rtype: requests.Response """ params = {} for k, v in kwargs.items(): params[k] = v if self.version == 2: return requests.get(url, headers=self.headers, params=params, verify=self.verify) else: return requests.get(url, auth=self.auth, params=params, verify=self.verify) @validate_api_v2 @request_error_handler def get_campaigns(self, **kwargs): """ Query all campaigns - all parameters are optional :param dst_ip: filter on campaign destination IP :param target_domain: filter on campaign destination domain :param state: campaign state, possible values are: init, active, closed, closed_never_active :param name: filter on campaign name :param last_updated_gte: return only campaigns with a last updated timestamp gte (datetime) :param note_modified_timestamp_gte: return only campaigns with a last updated timestamp on their note gte (datetime) :param fields: comma separated string of fields to be filtered and returned possible values are: id, dst_ip, target_domain, state, name, last_updated, note, note_modified_by, note_modified_timestamp :param page: page number to return (int) :param page_size: number of object to return in repsonse (int) """ return requests.get('{url}/campaigns'.format(url=self.url), headers=self.headers, params=self._generate_campaign_params(kwargs), verify=self.verify) def
= [slice(None), slice(tl_y, br_y), slice(tl_x, br_x)] >>> # Note: I'm not 100% sure this work right with non-intergral slices >>> outputs = kwimage.subpixel_slice(inputs, index) Example: >>> inputs = np.arange(5 * 5 * 3).reshape(5, 5, 3) >>> index = [slice(0, 3), slice(0, 3)] >>> outputs = subpixel_slice(inputs, index) >>> index = [slice(0.5, 3.5), slice(-0.5, 2.5)] >>> outputs = subpixel_slice(inputs, index) >>> inputs = np.arange(5 * 5).reshape(1, 5, 5).astype(float) >>> index = [slice(None), slice(3, 6), slice(3, 6)] >>> outputs = subpixel_slice(inputs, index) >>> print(outputs) [[[18. 19. 0.] [23. 24. 0.] [ 0. 0. 0.]]] >>> index = [slice(None), slice(3.5, 6.5), slice(2.5, 5.5)] >>> outputs = subpixel_slice(inputs, index) >>> print(outputs) [[[20. 21. 10.75] [11.25 11.75 6. ] [ 0. 0. 0. ]]] """ subpixel_starts = np.array( [0 if sl.start is None else sl.start for sl in index]) subpixel_stops = np.array( [inputs.shape[i] if sl.stop is None else sl.stop for i, sl in enumerate(index)]) is_fractional = ((subpixel_starts % 1) + (subpixel_stops % 1)) > 0 if not np.any(is_fractional): # If none of the slices are fractional just do the simple thing int_index = [slice(int(s), int(t)) for s, t in zip(subpixel_starts, subpixel_stops)] outputs, _ = _padded_slice(inputs, int_index) else: interp_axes = np.where(is_fractional)[0] shift = -subpixel_starts[interp_axes] output_shape = subpixel_stops - subpixel_starts if np.any(output_shape % 1 > 0): output_shape = np.ceil(output_shape) # raise ValueError('the slice length must be integral') output_shape = output_shape.astype(int) outputs = subpixel_translate(inputs, shift, interp_axes=interp_axes, output_shape=output_shape) return outputs def subpixel_translate(inputs, shift, interp_axes=None, output_shape=None): """ Translates an image by a subpixel shift value using bilinear interpolation Args: inputs (ArrayLike): data to translate shift (Sequence): amount to translate each dimension specified by `interp_axes`. Note: if inputs contains more than one "image" then all "images" are translated by the same amount. This function contains no mechanism for translating each image differently. Note that by default this is a y,x shift for 2 dimensions. interp_axes (Sequence, default=None): axes to perform interpolation on, if not specified the final `n` axes are interpolated, where `n=len(shift)` output_shape (tuple, default=None): if specified the output is returned with this shape, otherwise Notes: This function powers most other functions in this file. Speedups here can go a long way. Example: >>> inputs = np.arange(5) + 1 >>> print(inputs.tolist()) [1, 2, 3, 4, 5] >>> outputs = subpixel_translate(inputs, 1.5) >>> print(outputs.tolist()) [0.0, 0.5, 1.5, 2.5, 3.5] Example: >>> # xdoctest: +REQUIRES(module:torch) >>> inputs = torch.arange(9).view(1, 1, 3, 3).float() >>> print(inputs.long()) tensor([[[[0, 1, 2], [3, 4, 5], [6, 7, 8]]]]) >>> outputs = subpixel_translate(inputs, (-.4, .5), output_shape=(1, 1, 2, 5)) >>> print(outputs) tensor([[[[0.6000, 1.7000, 2.7000, 1.6000, 0.0000], [2.1000, 4.7000, 5.7000, 3.1000, 0.0000]]]]) Ignore: >>> inputs = np.arange(5) >>> shift = -.6 >>> interp_axes = None >>> subpixel_translate(inputs, -.6) >>> subpixel_translate(inputs[None, None, None, :], -.6) >>> inputs = np.arange(25).reshape(5, 5) >>> shift = (-1.6, 2.3) >>> interp_axes = (0, 1) >>> subpixel_translate(inputs, shift, interp_axes, output_shape=(9, 9)) >>> subpixel_translate(inputs, shift, interp_axes, output_shape=(3, 4)) """ impl = kwarray.ArrayAPI.impl(inputs) if output_shape is None: output_shape = inputs.shape if interp_axes is None: shift = _ensure_arraylike(shift) interp_axes = np.arange(-len(shift), 0) else: interp_axes = _ensure_arraylike(interp_axes) shift = _ensure_arraylike(shift, len(interp_axes)) ndims = len(inputs.shape) # number of inputs dimensions interp_order = len(interp_axes) # number of interpolated dimensions output_dims = [output_shape[i] for i in interp_axes] # The negative shift defines the new start coordinate start = -shift # Sample values (using padded slice to deal with borders) # border_mode = 'zeros' # if border_mode == 'zeros': # padkw = dict(pad_mode='constant', constant_value=0) # if border_mode == 'edge': # padkw = dict(pad_mode='edge') padkw = {} if np.all(start % 1 == 0): # short circuit common simple cases where no interpolation is needed relevant_slice = [slice(None)] * ndims for i, x, d in zip(interp_axes, map(int, start), output_dims): relevant_slice[i] = slice(x, x + d) subpxl_vals, _ = _padded_slice(inputs, relevant_slice, **padkw) elif interp_order == 1: i, = interp_axes width, = output_dims x, = start # Get quantized pixel locations near subpixel pts x0 = int(np.floor(x)) x1 = x0 + 1 # Find linear weights wa = (x1 - x) wb = (x - x0) # Create a (potentially negative) slice containing the relvant area relevant_slice = [slice(None)] * ndims relevant_slice[i] = slice(x0, x1 + width) relevant, _ = _padded_slice(inputs, relevant_slice, **padkw) if impl.dtype_kind(relevant) != 'f': relevant = impl.astype(relevant, 'float32') # Take subslices of the relevant area sl_a = [slice(None)] * ndims sl_b = [slice(None)] * ndims # Sample values (using padded slice to deal with borders) sl_a[i] = slice(0, width) sl_b[i] = slice(1, width + 1) Ia = relevant[tuple(sl_a)] Ib = relevant[tuple(sl_b)] # Perform the linear interpolation subpxl_vals = (wa * Ia) + (wb * Ib) elif interp_order == 2: j, i = interp_axes height, width = output_dims y, x = start # Get quantized pixel locations near subpixel pts start0 = kwarray.ArrayAPI.ifloor(start) start1 = start0 + 1 alpha = start1 - start beta = start - start0 # Find bilinear weights wa = alpha[1] * alpha[0] wb = alpha[1] * beta[0] wc = beta[1] * alpha[0] wd = beta[1] * beta[0] # Create a (potentially negative) slice containing the relvant area relevant_slice = [slice(None)] * ndims y0, x0 = start0 y1, x1 = start1 relevant_slice[j] = slice(y0, y1 + height) relevant_slice[i] = slice(x0, x1 + width) relevant, _ = _padded_slice(inputs, relevant_slice, **padkw) if impl.dtype_kind(relevant) != 'f': relevant = impl.astype(relevant, 'float32') # Take subslices of the relevant area sl_a = [slice(None)] * ndims sl_b = [slice(None)] * ndims sl_c = [slice(None)] * ndims sl_d = [slice(None)] * ndims # Sample values (using padded slice to deal with borders) sl_a[j] = slice(0, height) sl_a[i] = slice(0, width) sl_b[j] = slice(1, height + 1) sl_b[i] = slice(0, width) sl_c[j] = slice(0, height) sl_c[i] = slice(1, width + 1) sl_d[j] = slice(1, height + 1) sl_d[i] = slice(1, width + 1) Ia = relevant[tuple(sl_a)] Ib = relevant[tuple(sl_b)] Ic = relevant[tuple(sl_c)] Id = relevant[tuple(sl_d)] # Perform the bilinear interpolation subpxl_vals = (wa * Ia) + (wb * Ib) + (wc * Ic) + (wd * Id) else: raise NotImplementedError('trilinear interpolation is not implemented') return subpxl_vals def _padded_slice(data, in_slice, ndim=None, pad_slice=None, pad_mode='constant', **padkw): """ Allows slices with out-of-bound coordinates. Any out of bounds coordinate will be sampled via padding. Note: Negative slices have a different meaning here then they usually do. Normally, they indicate a wrap-around or a reversed stride, but here they index into out-of-bounds space (which depends on the pad mode). For example a slice of -2:1 literally samples two pixels to the left of the data and one pixel from the data, so you get two padded values and one data value. Args: data (Sliceable[T]): data to slice into. Any channels must be the last dimension. in_slice (Tuple[slice, ...]): slice for each dimensions ndim (int): number of spatial dimensions pad_slice (List[int|Tuple]): additional padding of the slice Returns: Tuple[Sliceable, List] : data_sliced: subregion of the input data (possibly with padding, depending on if the original slice went out of bounds) st_dims : a list indicating the low and high space-time coordinate values of the returned data slice. Example: >>> data = np.arange(5) >>> in_slice = [slice(-2, 7)] >>> data_sliced, st_dims = _padded_slice(data, in_slice) >>> print(ub.repr2(data_sliced, with_dtype=False)) >>> print(st_dims) np.array([0, 0, 0, 1, 2, 3, 4, 0, 0]) [(-2, 7)] >>> data_sliced, st_dims = _padded_slice(data, in_slice, pad_slice=(3, 3)) >>> print(ub.repr2(data_sliced, with_dtype=False)) >>> print(st_dims) np.array([0, 0, 0, 0, 0, 0, 1, 2, 3, 4, 0, 0, 0, 0, 0]) [(-5, 10)] >>> data_sliced, st_dims = _padded_slice(data, slice(3, 4), pad_slice=[(1, 0)]) >>> print(ub.repr2(data_sliced, with_dtype=False)) >>> print(st_dims) np.array([2, 3]) [(2, 4)] """ # TODO: use kwarray instead if isinstance(in_slice, slice): in_slice = [in_slice] ndim = len(in_slice) data_dims = data.shape[:ndim] low_dims = [sl.start for sl in in_slice] high_dims = [sl.stop for sl in in_slice] data_slice, extra_padding = _rectify_slice(data_dims, low_dims, high_dims, pad_slice=pad_slice) in_slice_clipped = tuple(slice(*d) for d in data_slice) # Get the parts of the image
<filename>pandaharvester/harvestermonitor/htcondor_monitor.py import re import time import datetime import threading import random import xml.etree.ElementTree as ET try: import subprocess32 as subprocess except Exception: import subprocess try: from threading import get_ident except ImportError: from thread import get_ident import six from concurrent.futures import ThreadPoolExecutor as Pool from pandaharvester.harvestercore import core_utils from pandaharvester.harvesterconfig import harvester_config from pandaharvester.harvestercore.core_utils import SingletonWithID from pandaharvester.harvestercore.work_spec import WorkSpec from pandaharvester.harvestercore.plugin_base import PluginBase from pandaharvester.harvestercore.fifos import SpecialFIFOBase try: import htcondor except ImportError: CONDOR_API = 'command' else: CONDOR_API = 'python' # logger baseLogger = core_utils.setup_logger('htcondor_monitor') ## Run shell function def _runShell(cmd): cmd = str(cmd) p = subprocess.Popen(cmd.split(), shell=False, universal_newlines=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE) stdOut, stdErr = p.communicate() retCode = p.returncode return (retCode, stdOut, stdErr) ## Native HTCondor status map CONDOR_JOB_STATUS_MAP = { '1': 'idle', '2': 'running', '3': 'removed', '4': 'completed', '5': 'held', '6': 'transferring_output', '7': 'suspended', } ## List of job ads required CONDOR_JOB_ADS_LIST = [ 'ClusterId', 'ProcId', 'JobStatus', 'LastJobStatus', 'JobStartDate', 'EnteredCurrentStatus', 'ExitCode', 'HoldReason', 'LastHoldReason', 'RemoveReason', ] ## harvesterID harvesterID = harvester_config.master.harvester_id ## generate condor job id with schedd host from workspec def condor_job_id_from_workspec(workspec): return '{0}#{1}'.format(workspec.submissionHost, workspec.batchID) ## Condor queue cache fifo class CondorQCacheFifo(six.with_metaclass(SingletonWithID, SpecialFIFOBase)): global_lock_id = -1 def __init__(self, target, *args, **kwargs): name_suffix = target.split('.')[0] self.titleName = 'CondorQCache_{0}'.format(name_suffix) SpecialFIFOBase.__init__(self) def lock(self, score=None): lock_key = format(int(random.random() * 2**32), 'x') if score is None: score = time.time() retVal = self.putbyid(self.global_lock_id, lock_key, score) if retVal: return lock_key return None def unlock(self, key=None, force=False): peeked_tuple = self.peekbyid(id=self.global_lock_id) if peeked_tuple.score is None or peeked_tuple.item is None: return True elif force or self.decode(peeked_tuple.item) == key: self.release([self.global_lock_id]) return True else: return False ## Condor job ads query class CondorJobQuery(six.with_metaclass(SingletonWithID, object)): ## class lock classLock = threading.Lock() ## Query commands orig_comStr_list = [ 'condor_q -xml', 'condor_history -xml', ] # Bad text of redundant xml roots to eleminate from condor XML badtext = """ </classads> <?xml version="1.0"?> <!DOCTYPE classads SYSTEM "classads.dtd"> <classads> """ def __init__(self, cacheEnable=False, cacheRefreshInterval=None, useCondorHistory=True, *args, **kwargs): self.submissionHost = str(kwargs.get('id')) # Make logger tmpLog = core_utils.make_logger(baseLogger, 'submissionHost={0}'.format(self.submissionHost), method_name='CondorJobQuery.__init__') # Initialize with self.classLock: tmpLog.debug('Start') self.lock = threading.Lock() self.condor_api = CONDOR_API self.condor_schedd = None self.condor_pool = None self.cacheEnable = False if self.submissionHost in ('LOCAL', 'None'): tmpLog.debug('submissionHost is {0}, treated as local schedd. Skipped'.format(self.submissionHost)) else: try: self.condor_schedd, self.condor_pool = self.submissionHost.split(',')[0:2] except ValueError: tmpLog.error('Invalid submissionHost: {0} . Skipped'.format(self.submissionHost)) if self.condor_api == 'python': try: self.secman = htcondor.SecMan() self.renew_session() except Exception as e: self.condor_api = 'command' tmpLog.warning('Using condor command instead due to exception from unsupported version of python or condor api: {0}'.format(e)) self.cacheEnable = cacheEnable if self.cacheEnable: self.cache = ([], 0) self.cacheRefreshInterval = cacheRefreshInterval self.useCondorHistory = useCondorHistory tmpLog.debug('Initialize done') def get_all(self, batchIDs_list=[]): # Make logger tmpLog = core_utils.make_logger(baseLogger, 'submissionHost={0}'.format(self.submissionHost), method_name='CondorJobQuery.get_all') # Get all tmpLog.debug('Start') job_ads_all_dict = {} if self.condor_api == 'python': try: if self.cacheEnable: job_ads_all_dict = self.query_with_python_cached(batchIDs_list) else: job_ads_all_dict = self.query_with_python(batchIDs_list) except RuntimeError as e: tmpLog.error(e) if self.lock.acquire(False): self.renew_session() self.lock.release() except Exception as e: tmpLog.warning('Using condor command instead due to exception from unsupported version of python or condor api: {0}'.format(e)) job_ads_all_dict = self.query_with_command(batchIDs_list) else: job_ads_all_dict = self.query_with_command(batchIDs_list) return job_ads_all_dict def query_with_command(self, batchIDs_list=[]): # Make logger tmpLog = core_utils.make_logger(baseLogger, 'submissionHost={0}'.format(self.submissionHost), method_name='CondorJobQuery.query_with_command') ## Start query tmpLog.debug('Start query') job_ads_all_dict = {} batchIDs_set = set(batchIDs_list) for orig_comStr in self.orig_comStr_list: ## String of batchIDs batchIDs_str = ' '.join(list(batchIDs_set)) ## Command if 'condor_q' in orig_comStr or ('condor_history' in orig_comStr and batchIDs_set): name_opt = '-name {0}'.format(self.condor_schedd) if self.condor_schedd else '' pool_opt = '-pool {0}'.format(self.condor_pool) if self.condor_pool else '' ids = batchIDs_str comStr = '{cmd} {name_opt} {pool_opt} {ids}'.format(cmd=orig_comStr, name_opt=name_opt, pool_opt=pool_opt, ids=ids) else: # tmpLog.debug('No batch job left to query in this cycle by this thread') continue tmpLog.debug('check with {0}'.format(comStr)) (retCode, stdOut, stdErr) = _runShell(comStr) if retCode == 0: ## Command succeeded job_ads_xml_str = '\n'.join(str(stdOut).split(self.badtext)) if '<c>' in job_ads_xml_str: ## Found at least one job ## XML parsing xml_root = ET.fromstring(job_ads_xml_str) def _getAttribute_tuple(attribute_xml_element): ## Attribute name _n = str(attribute_xml_element.get('n')) ## Attribute value text _t = ' '.join(attribute_xml_element.itertext()) return (_n, _t) ## Every batch job for _c in xml_root.findall('c'): job_ads_dict = dict() ## Every attribute attribute_iter = map(_getAttribute_tuple, _c.findall('a')) job_ads_dict.update(attribute_iter) batchid = str(job_ads_dict['ClusterId']) condor_job_id = '{0}#{1}'.format(self.submissionHost, batchid) job_ads_all_dict[condor_job_id] = job_ads_dict ## Remove batch jobs already gotten from the list if batchid in batchIDs_set: batchIDs_set.discard(batchid) else: ## Job not found tmpLog.debug('job not found with {0}'.format(comStr)) continue else: ## Command failed errStr = 'command "{0}" failed, retCode={1}, error: {2} {3}'.format(comStr, retCode, stdOut, stdErr) tmpLog.error(errStr) if len(batchIDs_set) > 0: ## Job unfound via both condor_q or condor_history, marked as unknown worker in harvester for batchid in batchIDs_set: condor_job_id = '{0}#{1}'.format(self.submissionHost, batchid) job_ads_all_dict[condor_job_id] = dict() tmpLog.info( 'Unfound batch jobs of submissionHost={0}: {1}'.format( self.submissionHost, ' '.join(list(batchIDs_set)) ) ) ## Return return job_ads_all_dict def query_with_python(self, batchIDs_list=[]): # Make logger tmpLog = core_utils.make_logger(baseLogger, 'submissionHost={0}'.format(self.submissionHost), method_name='CondorJobQuery.query_with_python') ## Start query tmpLog.debug('Start query') job_ads_all_dict = {} batchIDs_set = set(batchIDs_list) if self.useCondorHistory: query_method_list = [self.schedd.xquery, self.schedd.history] else: query_method_list = [self.schedd.xquery] for query_method in query_method_list: ## Make requirements batchIDs_str = ','.join(list(batchIDs_set)) requirements = 'member(ClusterID, {{{0}}})'.format(batchIDs_str) tmpLog.debug('Query method: {0} ; batchIDs: "{1}"'.format(query_method.__name__, batchIDs_str)) ## Query jobs_iter = query_method(requirements=requirements, projection=CONDOR_JOB_ADS_LIST) for job in jobs_iter: job_ads_dict = dict(job) batchid = str(job_ads_dict['ClusterId']) condor_job_id = '{0}#{1}'.format(self.submissionHost, batchid) job_ads_all_dict[condor_job_id] = job_ads_dict ## Remove batch jobs already gotten from the list batchIDs_set.discard(batchid) if len(batchIDs_set) == 0: break ## Remaining if len(batchIDs_set) > 0: ## Job unfound via both condor_q or condor_history, marked as unknown worker in harvester for batchid in batchIDs_set: condor_job_id = '{0}#{1}'.format(self.submissionHost, batchid) job_ads_all_dict[condor_job_id] = dict() tmpLog.info( 'Unfound batch jobs of submissionHost={0}: {1}'.format( self.submissionHost, ' '.join(list(batchIDs_set)) ) ) ## Return return job_ads_all_dict def query_with_python_cached(self, batchIDs_list=[]): # Make logger tmpLog = core_utils.make_logger(baseLogger, 'submissionHost={0}'.format(self.submissionHost), method_name='CondorJobQuery.query_with_python_cached') ## Start query tmpLog.debug('Start query') cache_fifo = CondorQCacheFifo(target=self.submissionHost, id='{0},{1}'.format(self.submissionHost, get_ident())) job_ads_all_dict = {} batchIDs_set = set(batchIDs_list) ## query from cache def cache_query(requirements=None, projection=CONDOR_JOB_ADS_LIST, timeout=60): # query from condor xquery and update cache to fifo def update_cache(lockInterval=90): tmpLog.debug('update_cache') # acquire lock with score timestamp score = time.time() - self.cacheRefreshInterval + lockInterval lock_key = cache_fifo.lock(score=score) if lock_key is not None: # acquired lock, update from condor schedd tmpLog.debug('got lock, updating cache') jobs_iter_orig = self.schedd.xquery(requirements=requirements, projection=projection) jobs_iter = [ dict(job) for job in jobs_iter_orig ] timeNow = time.time() cache_fifo.put(jobs_iter, timeNow) self.cache = (jobs_iter, timeNow) # release lock retVal = cache_fifo.unlock(key=lock_key) if retVal: tmpLog.debug('done update cache and unlock') else: tmpLog.warning('cannot unlock... Maybe something wrong') return jobs_iter else: tmpLog.debug('cache fifo locked by other thread. Skipped') return None # remove invalid or outdated caches from fifo def cleanup_cache(timeout=60): tmpLog.debug('cleanup_cache') id_list = list() attempt_timestamp = time.time() n_cleanup = 0 while True: if time.time() > attempt_timestamp + timeout: tmpLog.debug('time is up when cleanup cache. Skipped') break peeked_tuple = cache_fifo.peek(skip_item=True) if peeked_tuple is None: tmpLog.debug('empty cache fifo') break elif peeked_tuple.score is not None \ and time.time() <= peeked_tuple.score + self.cacheRefreshInterval: tmpLog.debug('nothing expired') break elif peeked_tuple.id is not None: retVal = cache_fifo.release([peeked_tuple.id]) if isinstance(retVal, int): n_cleanup += retVal else: # problematic tmpLog.warning('got nothing when cleanup cache, maybe problematic. Skipped') break tmpLog.debug('cleaned up {0} objects in cache fifo'.format(n_cleanup)) # start jobs_iter = tuple() try: attempt_timestamp = time.time() while True: if time.time() > attempt_timestamp + timeout: # skip cache_query if too long tmpLog.debug('cache_query got timeout ({0} seconds). Skipped '.format(timeout)) break # get latest cache peeked_tuple = cache_fifo.peeklast(skip_item=True) if peeked_tuple is not None and peeked_tuple.score is not None: # got something if peeked_tuple.id == cache_fifo.global_lock_id: if time.time() <= peeked_tuple.score + self.cacheRefreshInterval: # lock tmpLog.debug('got fifo locked. Wait and retry...') time.sleep(random.uniform(1, 5)) continue else: # expired lock tmpLog.debug('got lock expired. Clean up and retry...') cleanup_cache() continue elif time.time() <= peeked_tuple.score + self.cacheRefreshInterval: # got valid cache _obj, _last_update = self.cache if _last_update >= peeked_tuple.score: # valid local cache tmpLog.debug('valid local cache') jobs_iter = _obj else: # valid fifo cache tmpLog.debug('update local cache from fifo') peeked_tuple_with_item = cache_fifo.peeklast() if peeked_tuple_with_item is not None \ and peeked_tuple.id != cache_fifo.global_lock_id \ and peeked_tuple_with_item.item is not None: jobs_iter = cache_fifo.decode(peeked_tuple_with_item.item) self.cache = (jobs_iter, peeked_tuple_with_item.score) else: tmpLog.debug('peeked invalid cache fifo object. Wait and retry...') time.sleep(random.uniform(1, 5)) continue else: # cache expired tmpLog.debug('update cache in fifo') retVal = update_cache() if retVal is not None: jobs_iter = retVal cleanup_cache() break else: # no cache in fifo, check with size again if cache_fifo.size() == 0: if time.time() > attempt_timestamp + random.uniform(10, 30): # have waited for long enough, update cache tmpLog.debug('waited enough, update
0x00, 0x00, # 0x00, 0x00, # 0x00, 0x00, # 0x00, 0x00, # # @1024 'Z' (7 pixels wide) 0x00, # 0xFE, # OOOOOOO 0x02, # O 0x04, # O 0x08, # O 0x08, # O 0x10, # O 0x20, # O 0x20, # O 0x40, # O 0x80, # O 0xFE, # OOOOOOO 0x00, # 0x00, # 0x00, # 0x00, # # @1040 '[' (2 pixels wide) 0x00, # 0xC0, # OO 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0xC0, # OO 0x00, # # @1056 '\' (4 pixels wide) 0x00, # 0x80, # O 0x80, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x20, # O 0x20, # O 0x20, # O 0x10, # O 0x10, # O 0x00, # 0x00, # 0x00, # 0x00, # # @1072 ']' (2 pixels wide) 0x00, # 0xC0, # OO 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0xC0, # OO 0x00, # # @1088 '^' (5 pixels wide) 0x00, # 0x20, # O 0x20, # O 0x50, # O O 0x50, # O O 0x50, # O O 0x88, # O O 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # # @1104 '_' (7 pixels wide) 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0xFE, # OOOOOOO 0x00, # 0x00, # # @1120 '`' (2 pixels wide) 0x00, # 0x80, # O 0x40, # O 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # 0x00, # # @1136 'a' (5 pixels wide) 0x00, # 0x00, # 0x00, # 0x00, # 0x60, # OO 0x90, # O O 0x88, # O O 0x18, # OO 0x68, # OO O 0x88, # O O 0x98, # O OO 0x68, # OO O 0x00, # 0x00, # 0x00, # 0x00, # # @1152 'b' (6 pixels wide) 0x00, # 0x80, # O 0x80, # O 0x80, # O 0xB0, # O OO 0xC8, # OO O 0x84, # O O 0x84, # O O 0x84, # O O 0x84, # O O 0xC8, # OO O 0xB0, # O OO 0x00, # 0x00, # 0x00, # 0x00, # # @1168 'c' (5 pixels wide) 0x00, # 0x00, # 0x00, # 0x00, # 0x30, # OO 0x48, # O O 0x88, # O O 0x80, # O 0x80, # O 0x88, # O O 0x48, # O O 0x30, # OO 0x00, # 0x00, # 0x00, # 0x00, # # @1184 'd' (6 pixels wide) 0x00, # 0x04, # O 0x04, # O 0x04, # O 0x34, # OO O 0x4C, # O OO 0x84, # O O 0x84, # O O 0x84, # O O 0x84, # O O 0x4C, # O OO 0x34, # OO O 0x00, # 0x00, # 0x00, # 0x00, # # @1200 'e' (6 pixels wide) 0x00, # 0x00, # 0x00, # 0x00, # 0x30, # OO 0x48, # O O 0x84, # O O 0xFC, # OOOOOO 0x80, # O 0x84, # O O 0x48, # O O 0x30, # OO 0x00, # 0x00, # 0x00, # 0x00, # # @1216 'f' (3 pixels wide) 0x00, # 0x60, # OO 0x40, # O 0x40, # O 0xE0, # OOO 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x00, # 0x00, # 0x00, # 0x00, # # @1232 'g' (6 pixels wide) 0x00, # 0x00, # 0x00, # 0x00, # 0x34, # OO O 0x4C, # O OO 0x84, # O O 0x84, # O O 0x84, # O O 0x84, # O O 0x4C, # O OO 0x34, # OO O 0x84, # O O 0x88, # O O 0x70, # OOO 0x00, # # @1248 'h' (5 pixels wide) 0x00, # 0x80, # O 0x80, # O 0x80, # O 0xB0, # O OO 0xC8, # OO O 0x88, # O O 0x88, # O O 0x88, # O O 0x88, # O O 0x88, # O O 0x88, # O O 0x00, # 0x00, # 0x00, # 0x00, # # @1264 'i' (1 pixels wide) 0x00, # 0x80, # O 0x00, # 0x00, # 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x00, # 0x00, # 0x00, # 0x00, # # @1280 'j' (2 pixels wide) 0x00, # 0x40, # O 0x00, # 0x00, # 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0x40, # O 0xC0, # OO 0x00, # # @1296 'k' (5 pixels wide) 0x00, # 0x80, # O 0x80, # O 0x80, # O 0x88, # O O 0x90, # O O 0xA0, # O O 0xE0, # OOO 0x90, # O O 0x90, # O O 0x88, # O O 0x88, # O O 0x00, # 0x00, # 0x00, # 0x00, # # @1312 'l' (1 pixels wide) 0x00, # 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x80, # O 0x00, # 0x00, # 0x00, # 0x00, # # @1328 'm' (9 pixels wide) 0x00, 0x00, # 0x00, 0x00, # 0x00, 0x00, # 0x00, 0x00, # 0xB7, 0x00, # O OO OOO 0xCC, 0x80, # OO OO O 0x88, 0x80, # O O O 0x88, 0x80, # O O O 0x88, 0x80, # O O O 0x88, 0x80, # O O O 0x88, 0x80, # O O O 0x88, 0x80, # O O O 0x00, 0x00, # 0x00, 0x00, # 0x00, 0x00, # 0x00, 0x00, # # @1360 'n' (5 pixels wide) 0x00, # 0x00, # 0x00, # 0x00,
"CSF", "GM", "WM"], "title": "MRBrainS Confusion Matrix"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "ABIDE Confusion Matrix", PlotType.HEATMAP_PLOT, params={ "opts": {"columnnames": ["VM", "GM", "CSF", "Background"], "rownames": ["Background", "CSF", "GM", "WM"], "title": "ABIDE Confusion Matrix"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "Runtime", PlotType.TEXT_PLOT, params={"opts": {"title": "Runtime"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Dice score per class per epoch", every=1, params={"title": "Dice score on test patches per class per epoch", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Hausdorff Distance per class per epoch on reconstructed iSEG image", every=1, params={ "title": "Hausdorff Distance per class per epoch on reconstructed iSEG image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Hausdorff Distance per class per epoch on reconstructed MRBrainS image", every=1, params={ "title": "Hausdorff Distance per class per epoch on reconstructed MRBrainS image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Hausdorff Distance per class per epoch on reconstructed ABIDE image", every=1, params={ "title": "Hausdorff Distance per class per epoch on reconstructed ABIDE image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Dice score per class per epoch on reconstructed iSEG image", every=1, params={ "title": "Dice score per class per epoch on reconstructed iSEG image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Dice score per class per epoch on reconstructed MRBrainS image", every=1, params={ "title": "Dice score per class per epoch on reconstructed MRBrainS image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Dice score per class per epoch on reconstructed ABIDE image", every=1, params={ "title": "Dice score per class per epoch on reconstructed ABIDE image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Input iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Input iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Segmented iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Segmented iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Ground Truth iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Ground Truth iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Input MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Input MRBrainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Segmented MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Segmented MRBrainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Ground Truth MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Ground Truth MRBrainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Input ABIDE Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Input ABIDE Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Ground Truth ABIDE Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Ground Truth ABIDE Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Segmented ABIDE Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Segmented ABIDE Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Per Dataset Mean Hausdorff Distance", every=1, params={"title": "Per Dataset Mean Hausdorff Distance", "legend": list(dataset_configs.keys())}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( Checkpoint(save_folder, monitor_fn=lambda model_trainer: model_trainer.valid_loss, delta=0.01, mode=MonitorMode.MIN), Event.ON_EPOCH_END) \ .with_event_handler(PlotAvgGradientPerLayer(visdom_logger, every=25), Event.ON_TRAIN_BATCH_END) return trainer elif self._trainer == TrainerType.WGAN_Multimodal: trainer = WGANMultimodalTrainer(training_config, model_trainers, dataloaders[0], dataloaders[1], dataloaders[2], reconstruction_datasets, normalized_reconstructor, input_reconstructor, segmentation_reconstructor, augmented_input_reconstructor, gt_reconstructor, run_config, dataset_configs, save_folder) \ .with_event_handler(PrintTrainingStatus(every=25), Event.ON_BATCH_END) \ .with_event_handler(PrintMonitors(every=25), Event.ON_BATCH_END) \ .with_event_handler(PlotMonitors(visdom_logger), Event.ON_EPOCH_END) \ .with_event_handler(PlotLR(visdom_logger), Event.ON_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Generated Batch Process {} Channel 0".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Training Generated Patches Process {} Channel 0".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Generated Batch Process {} Channel 1".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Training Generated Patches Process {} Channel 1".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Generated Batch Process {} Channel 0".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Generated Patches Process {} Channel 0".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Generated Batch Process {} Channel 1".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Generated Patches Process {} Channel 1".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Generated Batch Process {} Channel 0".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Generated Patches Process {} Channel 0".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Generated Batch Process {} Channel 1".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Generated Patches Process {} Channel 1".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Input Batch Process {} Channel 0".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Training Input Patches Process {} Channel 0".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Input Batch Process {} Channel 1".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Training Input Patches Process {} Channel 1".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Input Batch Process {} Channel 0".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Input Patches Process {} Channel 0".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Input Batch Process {} Channel 1".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Input Patches Process {} Channel 1".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Input Batch Process {} Channel 0".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Input Patches Process {} Channel 0".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Input Batch Process {} Channel 1".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Input Patches Process {} Channel 1".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Segmented Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Segmented Patches Process {}".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Segmented Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Segmented Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Segmented Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Segmented Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Segmentation Ground Truth Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Training Ground Truth Patches Process {}".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Segmentation Ground Truth Batch Process {}".format( run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Ground Truth Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Segmentation Ground Truth Batch Process {}".format( run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Ground Truth Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Label Map Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Training Label Map Patches Process {}".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Label Map Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Label Map Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Label Map Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Label Map Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Generated Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "Generated Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Background Generated Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "Background Generated Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "CSF Generated Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "CSF Generated Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "GM Generated Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "GM Generated Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "WM Generated Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "WM Generated Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "Inputs Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Background Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "Background Input Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "CSF Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "CSF Input Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "GM Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "GM Input Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "WM Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "WM Input Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "Pie Plot", PlotType.PIE_PLOT, params={"opts": {"title": "Classification hit per classes", "legend": list(map(lambda key: key, dataset_configs.keys())) + [ "Fake Class"]}}, every=25), Event.ON_TRAIN_BATCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "Pie Plot True", PlotType.PIE_PLOT, params={"opts": {"title": "Batch data distribution", "legend": list(map(lambda key: key, dataset_configs.keys())) + [ "Fake Class"]}}, every=25), Event.ON_TRAIN_BATCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "Mean Hausdorff Distance", PlotType.LINE_PLOT, params={"opts":
<reponame>lrivallain/pyvcloud # VMware vCloud Director Python SDK # Copyright (c) 2014-2018 VMware, Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import math import os import shutil import tarfile import tempfile import time import traceback import urllib from lxml import etree from lxml import objectify from pyvcloud.vcd.acl import Acl from pyvcloud.vcd.client import ApiVersion from pyvcloud.vcd.client import E from pyvcloud.vcd.client import E_OVF from pyvcloud.vcd.client import EntityType from pyvcloud.vcd.client import find_link from pyvcloud.vcd.client import get_links from pyvcloud.vcd.client import MetadataDomain from pyvcloud.vcd.client import MetadataValueType from pyvcloud.vcd.client import MetadataVisibility from pyvcloud.vcd.client import NSMAP from pyvcloud.vcd.client import QueryResultFormat from pyvcloud.vcd.client import RelationType from pyvcloud.vcd.client import ResourceType from pyvcloud.vcd.exceptions import DownloadException from pyvcloud.vcd.exceptions import EntityNotFoundException from pyvcloud.vcd.exceptions import InvalidParameterException from pyvcloud.vcd.exceptions import OperationNotSupportedException from pyvcloud.vcd.exceptions import UploadException from pyvcloud.vcd.metadata import Metadata from pyvcloud.vcd.system import System from pyvcloud.vcd.utils import extract_id from pyvcloud.vcd.utils import get_admin_href from pyvcloud.vcd.utils import get_non_admin_href from pyvcloud.vcd.utils import get_safe_members_in_tar_file from pyvcloud.vcd.utils import is_admin from pyvcloud.vcd.utils import retrieve_compute_policy_id_from_href from pyvcloud.vcd.utils import to_dict from pyvcloud.vcd.utils import update_vm_compute_policy_element from pyvcloud.vcd.utils import VDC_COMPUTE_POLICY_MAX_API_VERSION from pyvcloud.vcd.utils import VDC_COMPUTE_POLICY_MIN_API_VERSION from pyvcloud.vcd.utils import VM_SIZING_POLICY_MIN_API_VERSION # Uptil pyvcloud v20.0.0 1 MB was the default chunk size, # in constrast vCD H5 UI uses 50MB for upload chunk size, # 10MB is a happy medium between 50MB and 1MB. DEFAULT_CHUNK_SIZE = 10 * 1024 * 1024 TENANT_CONTEXT_HDR = 'X-VMWARE-VCLOUD-TENANT-CONTEXT' class Org(object): def __init__(self, client, href=None, resource=None): """Constructor for Org objects. :param pyvcloud.vcd.client.Client client: the client that will be used to make REST calls to vCD. :param str href: URI of the entity. :param lxml.objectify.ObjectifiedElement resource: object containing EntityType.ORG XML data representing the organization. """ self.client = client if href is None and resource is None: raise InvalidParameterException('Org initialization failed as ' 'arguments are either invalid ' 'or None') self.href = href self.resource = resource if resource is not None: self.href = resource.get('href') self.href_admin = get_admin_href(self.href) def reload(self): """Reloads the resource representation of the organization. This method should be called in between two method invocations on the Org object, if the former call changes the representation of the organization in vCD. """ self.resource = self.client.get_resource(self.href) def get_name(self): """Retrieves the name of the organization. :return: name of the organization. :rtype: str """ if self.resource is None: self.reload() return self.resource.get('name') def create_catalog(self, name, description): """Create a catalog in the organization. :param str name: name of the catalog to be created. :param str description: description of the catalog to be created. :return: an object containing EntityType.ADMIN_CATALOG XML data representing a sparsely populated catalog element. :rtype: lxml.objectify.ObjectifiedElement """ if self.resource is None: self.reload() payload = E.AdminCatalog(E.Description(description), name=name) extra_headers = {TENANT_CONTEXT_HDR: extract_id(self.resource.attrib['id'])} return self.client.post_linked_resource( self.resource, RelationType.ADD, EntityType.ADMIN_CATALOG.value, payload, extra_headers=extra_headers) def delete_catalog(self, name): """Delete a catalog in the organization. :param str name: name of the catalog to be deleted. :raises: EntityNotFoundException: if the named catalog can not be found. :raises: sub-class of VcdResponseException: if the REST call is not successful. """ catalog_admin_resource = self.get_catalog( name=name, is_admin_operation=True) self.client.delete_linked_resource( catalog_admin_resource, RelationType.REMOVE, media_type=None) def list_catalogs(self): """List all catalogs in the organization. :return: a list of dictionaries, where each item contains information about a catalog in the organization. :rtype: list """ if self.client.is_sysadmin(): resource_type = ResourceType.ADMIN_CATALOG.value else: resource_type = ResourceType.CATALOG.value result = [] q = self.client.get_typed_query( resource_type, query_result_format=QueryResultFormat.ID_RECORDS) records = list(q.execute()) for r in records: result.append( to_dict( r, resource_type=resource_type, exclude=['owner', 'org'])) return result def get_catalog(self, name, is_admin_operation=False): """Retrieves a catalog by name. :param str name: name of the catalog to be retrieved. :param bool is_admin_operation: if set True, will return the admin view of the catalog. :return: an object containing EntityType.CATALOG or EntityType.ADMIN_CATALOG XML data representing the catalog. :rtype: lxml.objectify.ObjectifiedElement :raises: EntityNotFoundException: if the named catalog can not be found. """ if self.resource is None: self.reload() if self.client.get_api_version() < ApiVersion.VERSION_33.value: links = get_links( self.resource, rel=RelationType.DOWN, media_type=EntityType.CATALOG.value) else: if hasattr(self.resource, "Catalogs"): catalogs = self.resource.Catalogs for catalog in catalogs: if hasattr(catalog, "CatalogReference"): if name == catalog.CatalogReference.get("name"): href = catalog.CatalogReference.get("href") return self.client.get_resource(href) else: links = self.client.get_resource_link_from_query_object( self.resource, media_type=EntityType.RECORDS.value, type='catalog') if links: for link in links: if name == link.name: if is_admin_operation: href = get_admin_href(link.href) else: href = link.href return self.client.get_resource(href) raise EntityNotFoundException('Catalog not found (or)' ' Access to resource is forbidden') def update_catalog(self, old_catalog_name, new_catalog_name, description): """Update the name and/or description of a catalog. :param str old_catalog_name: current name of the catalog. :param str new_catalog_name: new name of the catalog. :param str description: new description of the catalog. :return: an object containing EntityType.ADMIN_CATALOG XML data describing the updated catalog. :rtype: lxml.objectify.ObjectifiedElement :raises: EntityNotFoundException: if the named catalog can not be found. """ admin_catalog_resource = self.get_catalog( old_catalog_name, is_admin_operation=True) if new_catalog_name is not None: admin_catalog_resource.set('name', new_catalog_name) if description is not None: admin_catalog_resource['Description'] = E.Description(description) return self.client.put_linked_resource( admin_catalog_resource, rel=RelationType.EDIT, media_type=EntityType.ADMIN_CATALOG.value, contents=admin_catalog_resource) def share_catalog(self, name, share=True): """Share a catalog with all org-admins of all organizations. This operation can be performed by only System Administrators. :param str name: name of the catalog to be shared. :raises: EntityNotFoundException: if the named catalog can not be found. """ # The link to publish catalog was moved to /api/catalog/{id}'s body in # vCD 9.1 (api v30.0). In previous versions the link to share catalog # was present in the /api/admin/catalog/{id}'s body. # Currently the lowest supported vCD api version is 29.0, which is the # only version for which we need to look in /api/admin/catalog/{id}'s # body while trying to share a catalog. # TODO() remove this conditional logic once we stop supporting api # version 29.0. if self.client.get_api_version() == ApiVersion.VERSION_29.value: catalog_resource = self.get_catalog(name, is_admin_operation=True) else: catalog_resource = self.get_catalog(name) is_published = 'true' if share else 'false' params = E.PublishCatalogParams(E.IsPublished(is_published)) return self.client.post_linked_resource( resource=catalog_resource, rel=RelationType.PUBLISH, media_type=EntityType.PUBLISH_CATALOG_PARAMS.value, contents=params) def change_catalog_owner(self, catalog_name, user_name): """Change the ownership of catalog to a given user. This operation can be performed by only users with admin privileges. :param str catalog_name: name of the catalog whose ownership needs to be changed :param str user_name: name of the new owner of the catalog """ catalog_admin_resource = self.get_catalog( catalog_name, is_admin_operation=True) new_user_resource = self.get_user(user_name) owner_resource = catalog_admin_resource.Owner owner_resource.User.set('href', new_user_resource.get('href')) objectify.deannotate(owner_resource) return self.client.put_linked_resource( resource=catalog_admin_resource, rel=RelationType.DOWN, media_type=EntityType.OWNER.value, contents=owner_resource) def list_catalog_items(self, name): """Retrieve all items in a catalog. :param str name: name of the catalog whose items need to be retrieved. :return: a list of dictionaries. Each dict object contains 'name' and 'id' of an item in the catalog. :rtype: dict :raises: EntityNotFoundException: if the named catalog can not be found. """ catalog_resource = self.get_catalog(name) items = [] for item in catalog_resource.CatalogItems.getchildren(): items.append({'name': item.get('name'), 'id': item.get('id')}) return items def get_catalog_item(self, name, item_name): """Retrieve an item in a catalog. :param str name: name of the catalog whose item needs to be retrieved. :param str item_name: name of the item which needs to be retrieved. :return: an object containing EntityType.MEDIA or EntityTYPE.VAPP_TEMPLATE XML data describing the entity corresponding to the catalog item. :rtype: lxml.objectify.ObjectifiedElement :raises: EntityNotFoundException: if the catalog/named item can not be found. """ catalog_resource = self.get_catalog(name) for item in catalog_resource.CatalogItems.getchildren(): if item.get('name') == item_name: return self.client.get_resource(item.get('href')) raise EntityNotFoundException('Catalog item not found.') def delete_catalog_item(self, name, item_name): """Delete an item from a catalog. :param str name: name of the catalog whose item needs to be deleted. :param str item_name: name of the item which needs to be deleted. :raises: EntityNotFoundException: if the catalog/named item can not be found. """ catalog_resource = self.get_catalog(name) for item in catalog_resource.CatalogItems.getchildren(): if item.get('name') == item_name: self.client.delete_resource(item.get('href')) return raise EntityNotFoundException('Catalog item not found.') def _is_enable_download_required(self, entity_resource, item_type): """Helper method to determine need for download enabling. :param lxml.objectify.ObjectifiedElement entity_resource: an object containing EntityType.MEDIA or EntityType.VAPP_TEMPLATE XML data describing the entity corresponding to the catalog item which needs to be downloaded. :param str item_type: type of entity we are trying to enable for download. Valid values are EntityType.VAPP_TEMPLATE and EntityType.MEDIA. return: True, if the entity needs to
from https://github.com/google/jax/issues/1907 key = jax.random.PRNGKey(0) key, split = jax.random.split(key) n = 5 def func(D0): def shift(R, dR, **unused_kwargs): return R + dR def apply_fn(R): return D0 * R Rinit = jax.random.uniform(split, (n,3), minval=0.0, maxval=5.0, dtype=jnp.float32) def move(R,i): F = apply_fn(R) return shift(R, 0.001 * F), jnp.array([0.]) move = api.remat(move) R, temp = lax.scan(move, Rinit, jnp.arange(2)) return R[0, 0] api.grad(func)(5.0) # doesn't crash def test_remat_jit2(self): @api.jit def f(x): y = 2 * x @api.remat def g(): return y return g() self.assertAllClose(f(3), 6, check_dtypes=False) def test_remat_nontrivial_env(self): # simplified from https://github.com/google/jax/issues/2030 @api.remat def foo(state, dt=0.5, c=1): u, u_t = state u_tt = c**2 * u u_t = u_t + u_tt * dt return (u, u_t) @partial(api.jit, static_argnums=(1,)) def _multi_step(state, count, dt, c): f = lambda s, _: (foo(s, dt, c), _) return lax.scan(f, state, None, count) def multi_step(state, count, dt=1/jnp.sqrt(2), c=1): return _multi_step(state, count, dt, c) def loss(u0, target, steps, dt=1/jnp.sqrt(2), c=1): init = (u0, jnp.zeros_like(u0)) (uf, _), _ = multi_step(init, steps, dt, c) return ((uf - target) ** 2).mean() target = jnp.zeros((128, 128)) u0 = jnp.ones_like(target) loss(u0, target, 10) # doesn't crash def test_remat_jit3(self): # https://github.com/google/jax/issues/2180 def f(w, x): a = jnp.dot(x, w) b = jnp.einsum("btd,bTd->btT", a, a) c = jnp.einsum("btT,btd->btd", b, a) return jnp.sum(c) w = jnp.ones([1, 1]) x = jnp.ones([1, 1, 1]) f = api.remat(f) api.grad(f)(w, x) # doesn't crash @api.jit def mul(a, b): return a * b def f(w, x): a = mul(w, x) b = mul(a, a) return b w = 1. x = 1. f = api.remat(f) api.grad(f)(w, x) # doesn't crash def test_remat_scan2(self): # https://github.com/google/jax/issues/1963 def scan_bug(x0): f = lambda x, _: (x + 1, None) def scanned_f(x, _): return lax.scan(f, x, xs=None, length=1)[0], None x, _ = jax.remat(scanned_f)(x0, None) return x jax.grad(scan_bug)(1.0) # doesn't crash def test_remat_jit_static_argnum_omnistaging(self): # https://github.com/google/jax/issues/2833 def named_call(f): def named_f(*args): f_ = lu.wrap_init(lambda: (f(*args),)) out, = core.call_p.bind(f_) return out return named_f def f(a_bool, y): if a_bool: return y + 1 else: return y api.jit(named_call(f), static_argnums=0)(True, 1) # no crash def test_remat_eval_counter(self): # https://github.com/google/jax/issues/2737 add_one_p = Primitive('add_one') add_one = add_one_p.bind num_evals = 0 @contextmanager def assertEvals(n): start = num_evals yield assert num_evals - start == n def add_one_impl(x): nonlocal num_evals num_evals += 1 return x + 1 add_one_p.def_impl(add_one_impl) def add_one_jvp(pin, tin): pout = add_one(pin[0]) return pout, pout * tin[0] ad.primitive_jvps[add_one_p] = add_one_jvp add_one_p.def_abstract_eval(lambda x: x) v = np.zeros((1,)) f = jax.remat(add_one) g = jax.remat(lambda x: add_one(f(x))) # 2 calls needed to evaluate g with assertEvals(2): _, vjp = jax.vjp(g, v) # 2 calls made while transposing g, 1 call made while transposing f with assertEvals(3): vjp(v) @jax._src.util.curry def call(f, *args): return jax.core.call( jax.linear_util.wrap_init(lambda *args: [f(*args)]), *args, name='foo')[0] f = call(add_one) g = jax.remat(lambda x: add_one(f(x))) # 2 calls needed to evaluate g with assertEvals(2): _, vjp = jax.vjp(g, v) # 2 calls made while transposing g, no reevaluation for transposition of f with assertEvals(2): vjp(v) def test_escaped_tracer_remat(self): # b/169779185 def f(): seq = [jnp.zeros([])] def g(): seq[0] += 1 # this is line 7 btw return seq[0] api.remat(g)() api.remat(g)() with self.assertRaisesRegex(core.UnexpectedTracerError, "global state"): api.jit(f)() class JaxprTest(jtu.JaxTestCase): def test_scalar_literals(self): jaxpr = api.make_jaxpr(lambda x: x + 2)(42) self.assertLen(jaxpr.jaxpr.constvars, 0) def test_abstract_inputs(self): jaxpr = api.make_jaxpr(lambda x: x + 2.)( types.SimpleNamespace(shape=(), dtype=np.float32)) self.assertEqual(jaxpr.in_avals[0].shape, ()) self.assertEqual(jaxpr.in_avals[0].dtype, np.float32) def test_const(self): def fun(x): return (x, 1., np.zeros(1)) expected = """ { lambda a ; b. let in (b, 1.0, a) } """ jaxpr = api.make_jaxpr(fun)(0.) self.assertMultiLineStrippedEqual(expected, str(jaxpr)) def test_cond(self): def f(x): return lax.cond(x >= 0., x + 1., lambda xt: xt + x, x + 2., lambda xf: xf - x) expected = """ { lambda ; a. let b = ge a 0.0 c = add a 1.0 d = add a 2.0 e = convert_element_type[ new_dtype=int32 weak_type=False ] b f = cond[ branches=( { lambda ; e_ a b c. let d = sub c a in (d,) } { lambda ; a f_ b c. let d = add b a in (d,) } ) linear=(False, False, False, False) ] e a a c d in (f,) } """ jaxpr = api.make_jaxpr(f)(3.) self.assertMultiLineStrippedEqual(expected, str(jaxpr)) def test_make_jaxpr_static_argnums(self): def f(x, y): return x + y jaxpr = api.make_jaxpr(f, static_argnums=(1,))(2, 3) self.assertIn('3', str(jaxpr)) def test_make_jaxpr_return_shape(self): _, shape_tree = api.make_jaxpr(lambda x: (x + 1, jnp.zeros(2, jnp.float32)), return_shape=True)(np.int32(1)) expected = (api.ShapeDtypeStruct(shape=(), dtype=jnp.int32), api.ShapeDtypeStruct(shape=(2,), dtype=jnp.float32)) self.assertEqual(shape_tree, expected) def test_make_jaxpr_axis_env(self): def f(x): return x - lax.psum(x, 'i') jaxpr = api.make_jaxpr(f, axis_env=[('i', 4)])(2) self.assertIn('psum', str(jaxpr)) def test_make_jaxpr_named(self): def f(x): return x - lax.psum(x, 'i') x = types.SimpleNamespace( shape=(2, 3), dtype=jnp.float32, named_shape={'i': 10}) jaxpr = api.make_jaxpr(f, axis_env=[('i', 10)])(x) named_shapes = [v.aval.named_shape for v in jaxpr.jaxpr.eqns[1].invars] self.assertEqual(named_shapes, [{'i': 10}, {}]) class CustomJVPTest(jtu.JaxTestCase): def test_basic(self): @api.custom_jvp def f(x): return jnp.sin(x) def f_jvp(primals, tangents): x, = primals g, = tangents return f(x), 2 * jnp.cos(x) * g f.defjvp(f_jvp) x = 3. self.assertAllClose(f(x), jnp.sin(x)) self.assertAllClose(api.jvp(f, (x,), (1.,)), (jnp.sin(x), 2 * jnp.cos(x))) self.assertAllClose(api.grad(f)(x), 2 * jnp.cos(x)) def test_invariance(self): @api.custom_jvp def f(x): return jnp.cos(2 * x) / 2. def f_jvp(primals, tangents): x, = primals g, = tangents return (f(x), 3 * g) f.defjvp(f_jvp) def f2(x): y, _ = api.jvp(f, (x,), (x,)) return y def f3(x): y, _ = api.jvp(f2, (x,), (x,)) return y x = 1. self.assertAllClose(api.jvp(f, (x,), (x,)), api.jvp(f2, (x,), (x,)), check_dtypes=False) self.assertAllClose(api.jvp(f, (x,), (x,)), api.jvp(f3, (x,), (x,)), check_dtypes=False) def test_python_control_flow(self): @api.custom_jvp def f(x): if x > 0: return jnp.sin(x) else: return jnp.cos(x) def f_jvp(primals, tangents): x, = primals g, = tangents if x > 0: return f(x), 2 * g else: return f(x), 3 * g f.defjvp(f_jvp) x = 2. self.assertAllClose(f(x), jnp.sin(x)) self.assertAllClose(f(-x), jnp.cos(-x)) self.assertAllClose(api.jvp(f, (x,), (1.,)), (jnp.sin(x), 2.), check_dtypes=False) self.assertAllClose(api.jvp(f, (-x,), (1.,)), (jnp.cos(-x), 3.), check_dtypes=False) self.assertAllClose(api.grad(f)(x), 2., check_dtypes=False) self.assertAllClose(api.grad(f)(-x), 3., check_dtypes=False) def test_vmap(self): @api.custom_jvp def f(x): assert jnp.ndim(x) == 0 return jnp.sin(x) def f_jvp(primals, tangents): x, = primals g, = tangents assert jnp.ndim(x) == jnp.ndim(g) == 0 return f(x), 2 * jnp.cos(x) * g f.defjvp(f_jvp) x = jnp.arange(3.) xx = jnp.arange(6.).reshape(2, 3) # vmap of f self.assertAllClose(api.vmap(f)(x), jnp.sin(x)) self.assertAllClose(api.vmap(api.vmap(f))(xx), jnp.sin(xx)) # vmap of jvp of f self.assertAllClose(api.vmap(lambda x: api.jvp(f, (x,), (x,)))(x), (jnp.sin(x), 2 * jnp.cos(x) * x)) self.assertAllClose(api.vmap(api.vmap(lambda x: api.jvp(f, (x,), (x,))))(xx), (jnp.sin(xx), 2 * jnp.cos(xx) * xx)) # jvp of vmap of f self.assertAllClose(api.jvp(api.vmap(f), (x,), (x,)), (jnp.sin(x), 2 * jnp.cos(x) * x)) self.assertAllClose(api.jvp(api.vmap(api.vmap(f)), (xx,), (xx,)), (jnp.sin(xx), 2 * jnp.cos(xx) * xx)) # vmap of jvp of vmap of f self.assertAllClose(api.vmap(lambda x: api.jvp(api.vmap(f), (x,), (x,)))(xx), (jnp.sin(xx), 2 * jnp.cos(xx) * xx)) def test_jit(self): @api.custom_jvp def f(x): return jnp.sin(x) def f_jvp(primals, tangents): x, = primals g, = tangents return f(x), 2 * jnp.cos(x) * g f.defjvp(f_jvp) x = 3. # jit self.assertAllClose(api.jit(f)(x), jnp.sin(x)) self.assertAllClose(api.jit(api.jit(f))(x), jnp.sin(x)) # jit of jvp self.assertAllClose(api.jit(lambda x: api.jvp(f, (x,), (x,)))(x), (jnp.sin(x), 2 * jnp.cos(x) * x), check_dtypes=False) # jvp of jit self.assertAllClose(api.jvp(api.jit(f), (x,), (x,)), (jnp.sin(x), 2 * jnp.cos(x) * x), check_dtypes=False) def test_pytrees(self): @api.custom_jvp def f(x): return {'b': jnp.sin(x['a'])} def f_jvp(primals, tangents): x, = primals g, = tangents return f(x), {'b': 2 * jnp.cos(x['a']) * g['a']} f.defjvp(f_jvp) x = {'a': 3.} self.assertAllClose(f(x)['b'], jnp.sin(x['a'])) self.assertAllClose(api.jvp(f, (x,), (x,)), ({'b': jnp.sin(x['a'])}, {'b': 2 * jnp.cos(x['a']) * x['a']}), check_dtypes=False) def test_kwargs(self): # from https://github.com/google/jax/issues/1938 @api.custom_jvp def my_fun(x, y, c=1.): return c * (x + y) def my_jvp(primals, tangents): x, y, c = primals t_x, t_y, t_c = tangents return my_fun(x, y, c), t_c my_fun.defjvp(my_jvp) f = lambda x, y: jnp.square(my_fun(x, y, c=2.)).sum() f(10., 5.) # doesn't crash api.jvp(f, (10., 5.), (1., 1.)) # doesn't crash def test_initial_style(self): @api.custom_jvp def f(x): return 3 * x def f_jvp(primals, tangents): x, = primals g, = tangents return f(x), 2 * g f.defjvp(f_jvp) def foo(x): out, _ = lax.scan(lambda c, _: (f(c), None), x, None, length=1) return out ans = api.grad(foo)(3.) expected = 2. self.assertAllClose(ans, expected, check_dtypes=False) ans = api.grad(api.jit(foo))(3.) expected = 2. self.assertAllClose(ans, expected, check_dtypes=False) ans = api.jit(api.grad(foo))(3.) expected = 2. self.assertAllClose(ans, expected, check_dtypes=False) ans = api.grad(api.grad(foo))(3.) expected = 0. self.assertAllClose(ans, expected, check_dtypes=False) ans =
import json import logging from cryptojwt.exception import BadSignature from cryptojwt.jws.exception import JWSException from cryptojwt.key_jar import KeyJar from fedoidcmsg import ClientMetadataStatement from fedoidcmsg import DoNotCompare from fedoidcmsg import IgnoreKeys from fedoidcmsg import MetadataStatementError from fedoidcmsg import is_lesser from fedoidcmsg import unfurl from oidcmsg.exception import MissingSigningKey from oidcmsg.oauth2 import Message from oidcmsg.time_util import utc_time_sans_frac __author__ = 'roland' logger = logging.getLogger(__name__) class ParseError(Exception): pass class ParseInfo(object): def __init__(self): self.input = None self.parsed_statement = [] self.error = {} self.result = None self.branch = {} self.keyjar = None self.signing_keys = None class LessOrEqual(object): """ Class in which to store the parse result from flattening a compounded metadata statement. """ def __init__(self, iss='', sup=None, exp=0, keyjar=None, **kwargs): """ :param iss: Issuer ID :param sup: Superior :type sup: LessOrEqual instance :param exp: Expiration time """ if sup: self.fo = sup.fo else: self.fo = iss self.iss = iss self.sup = sup self.err = {} self.le = {} self.exp = exp self.keyjar = keyjar def __setitem__(self, key, value): self.le[key] = value def keys(self): return self.le.keys() def items(self): return self.le.items() def __getitem__(self, item): return self.le[item] def __contains__(self, item): return item in self.le def sup_items(self): """ Items (key+values) from the superior """ if self.sup: return self.sup.le.items() else: return {} def eval(self, orig): """ Apply the less or equal algorithm on the ordered list of metadata statements :param orig: Start values :return: """ _le = {} _err = [] for k, v in self.sup_items(): if k in DoNotCompare: continue if k in orig: if is_lesser(orig[k], v): _le[k] = orig[k] else: _err.append({'claim': k, 'policy': orig[k], 'err': v, 'signer': self.iss}) else: _le[k] = v for k, v in orig.items(): if k in DoNotCompare: continue if k not in _le: _le[k] = v self.le = _le self.err = _err def protected_claims(self): """ Someone in the list of signers has said this information is OK """ if self.sup: return self.sup.le def unprotected_and_protected_claims(self): """ This is both verified and self asserted information. As expected verified information beats self-asserted so if there is both self-asserted and verified values for a claim then only the verified will be returned. """ if self.sup: res = {} for k, v in self.le.items(): if k not in self.sup.le: res[k] = v else: res[k] = self.sup.le[k] return res else: return self.le def is_expired(self): now = utc_time_sans_frac() if self.exp < now: return True if self.sup: return self.sup.is_expired() else: return False def le_dict(les): return dict([(l.fo, l) for l in les]) def get_fo(ms): try: _mds = ms['metadata_statements'] except KeyError: return ms['iss'] else: # should only be one try: assert len(_mds) == 1 except AssertionError: raise MetadataStatementError('Branching not allowed') _ms = list(_mds.values())[0] return get_fo(_ms) class Operator(object): """ An operator in a OIDC federation. """ def __init__(self, self_signer=None, jwks_bundle=None, httpcli=None, iss=None, lifetime=3600, verify_ssl=True): """ :param self_signer: A Signing Service instance :param jwks_bundle: Contains the federation operators signing keys for all the federations this instance wants to talk to. If present it MUST be a JWKSBundle instance. :param httpcli: A http client to use when information has to be fetched from somewhere else :param iss: Issuer ID :param lifetime: Default lifetime of signed statements produced by this signer. :param verify_ssl: Whether SSL certificates should be verified """ self.self_signer = self_signer self.jwks_bundle = jwks_bundle self.httpcli = httpcli self.iss = iss self.failed = {} self.lifetime = lifetime self.verify_ssl = verify_ssl def signing_keys_as_jwks(self): """ Build a JWKS from the signing keys belonging to the self signer :return: Dictionary """ _l = [x.serialize() for x in self.self_signer.keyjar.get_signing_key()] if not _l: _l = [x.serialize() for x in self.self_signer.keyjar.get_signing_key(owner=self.iss)] return {'keys': _l} def signing_keys_as_jwks_json(self): return json.dumps(self.signing_keys_as_jwks()) def _ums(self, pr, meta_s, keyjar): try: _pi = self.unpack_metadata_statement( jwt_ms=meta_s, keyjar=keyjar) except (JWSException, BadSignature, MissingSigningKey) as err: logger.error('Encountered: {}'.format(err)) pr.error[meta_s] = err else: pr.branch[meta_s] = _pi if _pi.result: pr.parsed_statement.append(_pi.result) pr.signing_keys = _pi.signing_keys return pr def self_signed(self, ms_dict, jwt_ms, cls): kj = KeyJar() kj.import_jwks_as_json(ms_dict['signing_keys'], ms_dict['iss']) return cls().from_jwt(jwt_ms, keyjar=kj) def _unpack(self, ms_dict, keyjar, cls, jwt_ms=None, liss=None): """ :param ms_dict: Metadata statement as a dictionary :param keyjar: A keyjar with the necessary FO keys :param cls: What class to map the metadata into :param jwt_ms: Metadata statement as a JWS :param liss: List of FO issuer IDs :return: ParseInfo instance """ if liss is None: liss = [] _pr = ParseInfo() _pr.input = ms_dict ms_flag = False if 'metadata_statements' in ms_dict: ms_flag = True for iss, _ms in ms_dict['metadata_statements'].items(): if liss and iss not in liss: continue _pr = self._ums(_pr, _ms, keyjar) if 'metadata_statement_uris' in ms_dict: ms_flag = True if self.httpcli: for iss, url in ms_dict['metadata_statement_uris'].items(): if liss and iss not in liss: continue rsp = self.httpcli(method='GET', url=url, verify=self.verify_ssl) if rsp.status_code == 200: _pr = self._ums(_pr, rsp.text, keyjar) else: raise ParseError( 'Could not fetch jws from {}'.format(url)) for _ms in _pr.parsed_statement: if _ms: # can be None loaded = False try: keyjar.import_jwks_as_json(_ms['signing_keys'], ms_dict['iss']) except KeyError: pass except TypeError: try: keyjar.import_jwks(_ms['signing_keys'], ms_dict['iss']) except Exception as err: logger.error(err) raise else: loaded = True else: loaded = True if loaded: logger.debug( 'Loaded signing keys belonging to {} into the ' 'keyjar'.format(ms_dict['iss'])) if ms_flag is True and not _pr.parsed_statement: return _pr if jwt_ms: logger.debug("verifying signed JWT: {}".format(jwt_ms)) try: _pr.result = cls().from_jwt(jwt_ms, keyjar=keyjar) except MissingSigningKey: if 'signing_keys' in ms_dict: try: _pr.result = self.self_signed(ms_dict, jwt_ms, cls) except MissingSigningKey as err: logger.error('Encountered: {}'.format(err)) _pr.error[jwt_ms] = err except (JWSException, BadSignature, KeyError) as err: logger.error('Encountered: {}'.format(err)) _pr.error[jwt_ms] = err else: _pr.result = ms_dict if _pr.result and _pr.parsed_statement: _prr = _pr.result _res = {} for x in _pr.parsed_statement: if x: _res[get_fo(x)] = x _msg = Message(**_res) logger.debug('Resulting metadata statement: {}'.format(_msg)) _pr.result['metadata_statements'] = _msg return _pr def unpack_metadata_statement(self, ms_dict=None, jwt_ms='', keyjar=None, cls=ClientMetadataStatement, liss=None): """ Starting with a signed JWT or a JSON document unpack and verify all the separate metadata statements. :param ms_dict: Metadata statement as a dictionary :param jwt_ms: Metadata statement as JWT :param keyjar: Keys that should be used to verify the signature of the document :param cls: What type (Class) of metadata statement this is :param liss: list of FO identifiers that matters. The rest will be ignored :return: A ParseInfo instance """ if not keyjar: if self.jwks_bundle: keyjar = self.jwks_bundle.as_keyjar() else: keyjar = KeyJar() if jwt_ms: try: ms_dict = unfurl(jwt_ms) except JWSException as err: logger.error('Could not unfurl jwt_ms due to {}'.format(err)) raise if ms_dict: return self._unpack(ms_dict, keyjar, cls, jwt_ms, liss) else: raise AttributeError('Need one of ms_dict or jwt_ms') def pack_metadata_statement(self, metadata, receiver='', iss='', lifetime=0, sign_alg=''): """ Given a MetadataStatement instance create a signed JWT. :param metadata: Original metadata statement as a MetadataStatement instance :param receiver: Receiver (audience) of the JWT :param iss: Issuer ID if different from default :param lifetime: jWT signature life time :param sign_alg: JWT signature algorithm :return: A JWT """ return self.self_signer.sign(metadata, receiver=receiver, iss=iss, lifetime=lifetime, sign_alg=sign_alg) def evaluate_metadata_statement(self, metadata, keyjar=None): """ Computes the resulting metadata statement from a compounded metadata statement. If something goes wrong during the evaluation an exception is raised :param metadata: The compounded metadata statement as a dictionary :return: A list of :py:class:`fedoidc.operator.LessOrEqual` instances, one per FO. """ # start from the innermost metadata statement and work outwards res = dict([(k, v) for k, v in metadata.items() if k not in IgnoreKeys]) les = [] if 'metadata_statements' in metadata: for fo, ms in metadata['metadata_statements'].items(): if isinstance(ms, str): ms = json.loads(ms) for _le in self.evaluate_metadata_statement(ms): if isinstance(ms, Message): le = LessOrEqual(sup=_le, **ms.to_dict()) else: # Must be a dict le = LessOrEqual(sup=_le, **ms) if le.is_expired(): logger.error( 'This metadata statement has expired: {}'.format(ms) ) logger.info('My time: {}'.format(utc_time_sans_frac())) continue le.eval(res) les.append(le) return les else: # this is the innermost try: _iss = metadata['iss'] except: le = LessOrEqual() le.eval(res) else: le = LessOrEqual(iss=_iss, exp=metadata['exp']) le.eval(res) les.append(le) return les def correct_usage(self, metadata, federation_usage): """ Remove MS paths that are marked to be used for another usage :param metadata: Metadata statement as dictionary :param federation_usage: In which context this is expected to used. :return: Filtered Metadata statement. """ if 'metadata_statements' in metadata: _msl = {} for fo, ms in metadata['metadata_statements'].items(): if not isinstance(ms,
# -*- coding: utf-8 -*- from __future__ import absolute_import, unicode_literals from __future__ import division, print_function from .image import Image import os import pygame import numpy as np PYGAME_INITIALIZED = False __all__ = [ 'Display' ] class Display(object): """ WindowsStream opens a window (Pygame Display Surface) to which you can write images. The default resolution is (640, 480) but you can also specify (0, 0) which will maximize the display. Flags are pygame constants, including: By default display will attempt to scale the input image to fit neatly on the screen with minimal distortion. This means that if the aspect ratio matches the screen it will scale cleanly. If your image does not match the screen aspect ratio we will scale it to fit nicely while maintaining its natural aspect ratio. Because PhloxAR performs this scaling there are two sets of input mouse coordinates, the (mouse_x, mouse_y) which scale to the image, and (mouse_raw_x, mouse_raw_y) which do are the actual screen coordinates. pygame.FULLSCREEN: create a fullscreen display. pygame.DOUBLEBUF: recommended for HWSURFACE or OPENGL. pygame.HWSURFACE: hardware accelerated, only in FULLSCREEN. pygame.OPENGL: create an opengl renderable display. pygame.RESIZABLE: display window should be sizeable. pygame.NOFRAME: display window will have no border or controls. Display should be used in a while loop with the isDone() method, which checks events and sets the following internal state controls: mouse_x: the x position of the mouse cursor on the input image. mouse_y: the y position of the mouse cursor on the input image. mouse_raw_x: The position of the mouse on the screen. mouse_raw_y: The position of the mouse on the screen. Note: The mouse position on the screen is not the mouse position on the image. If you are trying to draw on the image or take in coordinates use mouse_x and mouse_y as these values are scaled along with the image. mouse_l: the state of the left button. mouse_r: the state of the right button. mouse_m: the state of the middle button. mouse_wheel_u: scroll wheel has been moved up. mouse_wheel_d: the wheel has been clicked towards the bottom of the mouse. """ res = '' src_res = '' src_offset = '' screen = '' event_handler = '' mq = '' done = False mouse_x = 0 mouse_y = 0 # actual (x, y) position on the screen mouse_raw_x = 0 mouse_raw_y = 0 mouse_l = 0 mouse_r = 0 mouse_wheel_u = 0 mouse_wheel_d = 0 scale_x = 1.0 scale_y = 1.0 offset_x = 0 offset_y = 0 img_w = 0 img_h = 0 # lb for last left button & rb for right button last_lb = 0 last_rb = 0 lb_down = None lb_up = None rb_down = None rb_up = None display_type = None do_clamp = None pressed = [] def __init__(self, res=(640, 480), flags=0, title='PhloxAR', disptype='standard', headless=False): """ This is the generic display object. You are able to set the display type. The standard display type will pop up a window. The notebook display type is to be used in conjunction with IPython Notebooks. If you have IPython Notebooks installed you just need to start IPython Notebooks an open in your browser. :param res: the size of the display in pixels :param flags: pygame flags :param title: the title bar on the display :param disptype: type of display. Options are as follows: 'standard': a pygame window 'notebook': IPython web notebook output. :param headless: if False we ignore headless mode. If True, all rendering is suspended. """ global PYGAME_INITIALIZED if headless: os.environ['SDL_VIDEODRIVER'] = 'dummy' if not PYGAME_INITIALIZED: if not disptype == 'notebook': pygame.init() PYGAME_INITIALIZED = True self.scale_x = 1.0 self.scale_y = 1.0 self.offset_x = 0 self.offset_y = 0 self.last_lb = 0 self.last_rb = 0 self.lb_down = 0 self.rb_down = 0 self.lb_up = 0 self.rb_up = 0 self.pressed = None self.display_type = disptype self.mouse_raw_x = 0 self.mouse_raw_y = 0 self.res = res self.do_clamp = False if not disptype == 'notebook': self.screen = pygame.display.set_mode(res, flags) # checks if phloxar.png exists if os.path.isfile(os.path.join(LAUNCH_PATH, 'sample_images', 'phloxar.png')): plxlogo = Image('phloxar').scale(32, 32) pygame.display.set_icon(plxlogo.surface()) if flags != pygame.FULLSCREEN and flags != pygame.NOFRAME: pygame.display.set_caption(title) def left_button_up_pos(self): """ Returns the position where the left mouse button go up. :return: an (x, y) mouse position tuple. Note: You must call 'check_events' or 'is_done' in you main display loop for this method to work. """ return self.lb_up def left_button_down_pos(self): """ Returns the position where the left mouse button go down. :return: an (x, y) mouse position tuple. Note: You must call 'check_events' or 'is_done' in you main display loop for this method to work. """ return self.lb_down def right_button_up_pos(self): """ Returns the position where the right mouse button go up. :return: an (x, y) mouse position tuple. Note: You must call 'check_events' or 'is_done' in you main display loop for this method to work. """ return self.rb_up def right_button_down_pos(self): """ Returns the position where the right mouse button go down. :return: an (x, y) mouse position tuple. Note: You must call 'check_events' or 'is_done' in you main display loop for this method to work. """ return self.rb_down def points2boundingbox(self, pt0, pt1): """ Given two screen coordinates return the bounding box in x, y, w, h format. This is helpful for drawing regions on the display. :param pt0: first points :param pt1: second points :return: (x, y, w, h) tuple """ max_x = np.max((pt0[0], pt1[0])) max_y = np.max((pt0[1], pt1[1])) min_x = np.min((pt0[0], pt1[0])) min_y = np.min((pt0[1], pt1[1])) return min_x, min_y, max_x-min_x, max_y-min_y def write_frame(self, img, fit=True): """ Copies the given Image object to the display, you can also use Image.save() Write frame try to fit the image to the display with the minimum amount of distortion possible. When fit=True write frame will decide how to scale the image such that aspect ratio is maintained and the smallest amount of distortion possible is completed. This means the axis that has the minimum scaling needed will be shrunk or enlarged to match the display. :param img: the PhloxAR Image to save to the display :param fit: if False, write frame will crop and center the image as best it can. If the image is too big it is cropped and centered. If it is too small it is centered. If it is too big along one axis that axis is cropped and the other axis is centered if necessary. :return: None """ wnd_ratio = self.res[0] / self.res[1] img_ratio = img.width / img.height self.src_res = img.size() self.img_w = img.width self.img_h = img.height self.scale_x = 1.0 self.scale_y = 1.0 self.offset_x = 0 self.offset_y = 0 if img.size() == self.res: s = img.surface() self.screen.blit(s, s.get_rect()) pygame.display.flip() elif img_ratio == wnd_ratio: self.scale_x = img.width / self.res[0] self.scale_y = img.height / self.res[1] img = img.scale(self.res[0], self.res[1]) s = img.surface() self.screen.blit(s, s.get_rect()) pygame.display.flip() elif fit: # scale factors wscale = img.width / self.res[0] hscale = img.height / self.res[1] w = img.width h = img.height # shrink what is the percent reduction if wscale > 1: wscale = 1.0 - (1 / wscale) else: # grow the image by a percentage wscale = 1.0 - wscale if hscale > 1: hscale = 1.0 - (1 / hscale) else: hscale = 1.0 - hscale if wscale == 0: x = 0 y = (self.res[1] - img.height) / 2 w = img.width h = img.height s = img.surface() elif hscale == 0: x = (self.res[0] - img.width) / 2 y = 0 w = img.width h = img.height s = img.surface() elif wscale < hscale: # width has less distortion sfactor = self.res[0] / img.width w = int(img.width * sfactor) h = int(img.height * sfactor) if w > self.res[0] or h > self.res[1]: sfactor = self.res[1] / img.heigt w = int(img.width * sfactor) h = int(img.height * sfactor) x = (self.res[0] - w) / 2 y = 0 else: x = 0 y = (self.res[1] - h) / 2
optional A constant that specify the scaling factor for the features of this namespace. Examples -------- >>> from vowpalwabbit.DFtoVW import Namespace, Feature >>> ns_one_feature = Namespace(Feature("a")) >>> ns_multi_features = Namespace([Feature("a"), Feature("b")]) >>> ns_one_feature_with_name = Namespace(Feature("a"), name="FirstNamespace") >>> ns_one_feature_with_name_and_value = Namespace(Feature("a"), name="FirstNamespace", value=2) Returns ------- self : Namespace """ if (value is not None) and (name is None): raise ValueError( "Namespace can't have a 'value' argument without a 'name' argument" ) self.name = name self.value = value self.features = ( list(features) if isinstance(features, (list, set)) else [features] ) self.check_attributes_type() def check_attributes_type(self): """Check if attributes are of valid type. Raises ------ TypeError If one of the attribute is not valid. """ for attribute_name in ["name", "value"]: attribute_value = getattr(self, attribute_name) if attribute_value is not None and not isinstance( attribute_value, self.expected_type[attribute_name] ): raise TypeError( "In Namespace, argument '{attribute_name}' should be either of the following type(s): {types}".format( attribute_name=attribute_name, types=repr( [ x.__name__ for x in self.expected_type[attribute_name] ] )[1:-1], ) ) valid_feature = all( [ isinstance(feature, self.expected_type["features"]) for feature in self.features ] ) if not valid_feature: raise TypeError( "In Namespace, argument 'features' should be a Feature or a list of Feature." ) def process(self): """Returns the Namespace string representation""" out = ["|"] if self.name is not None: out += str(self.name) if self.value is not None: out += [":", str(self.value)] return "".join(out) class DFtoVW: """Convert a pandas DataFrame to a suitable VW format. Instances of this class are built with classes such as SimpleLabel, MulticlassLabel, Feature or Namespace. The class also provided a convenience constructor to initialize the class based on the target/features column names only. """ def __init__( self, df, features=None, namespaces=None, label=None, tag=None, ): """Initialize a DFtoVW instance. Parameters ---------- df : pandas.DataFrame The dataframe to convert to VW input format. features: Feature/list of Feature One or more Feature object(s). namespaces : Namespace/list of Namespace One or more Namespace object(s), each of being composed of one or more Feature object(s). label : SimpleLabel/MulticlassLabel/MultiLabel The label. tag : str/int/float The tag (used as identifiers for examples). Examples -------- >>> from vowpalwabbit.DFtoVW import DFtoVW, SimpleLabel, Feature >>> import pandas as pd >>> df = pd.DataFrame({"y": [1], "a": [2], "b": [3], "c": [4]}) >>> conv1 = DFtoVW(df=df, label=SimpleLabel("y"), features=Feature("a")) >>> conv1.convert_df() >>> conv2 = DFtoVW(df=df, label=SimpleLabel("y"), features=[Feature(col) for col in ["a", "b"]]) >>> conv2.convert_df() >>> conv3 = DFtoVW(df=df, label=SimpleLabel("y"), namespaces=Namespace( name="DoubleIt", value=2, features=Feature(value="a", rename_feature="feat_a"))) >>> conv3.convert_df() >>> conv4 = DFtoVW(df=df, label=SimpleLabel("y"), namespaces=[Namespace(name="NS1", features=[Feature(col) for col in ["a", "c"]]), Namespace(name="NS2", features=Feature("b"))]) >>> conv4.convert_df() Returns ------- self : DFtoVW """ self.df = df self.n_rows = df.shape[0] self.label = label self.tag = _Tag(tag) if tag else None if features is not None: self.check_features_type(features) self.set_namespaces_or_features(namespaces, features) self.check_label_type() self.check_namespaces_type() self.check_columns_existence_in_df() self.check_columns_type_and_values() @classmethod def from_colnames(cls, y, x, df, label_type="simple_label"): """Build DFtoVW instance using column names only. Parameters ---------- y : str/list of str The column for the label. x : str/list of str The column(s) for the feature(s). df : pandas.DataFrame The dataframe used. label_type: str (default: 'simple_label') The type of the label. Available labels: 'simple_label', 'multiclass', 'multilabel'. Raises ------ TypeError If argument label is not of valid type. ValueError If argument label_type is not valid. Examples -------- >>> from vowpalwabbit.DFtoVW import DFtoVW >>> import pandas as pd >>> df = pd.DataFrame({"y": [1], "x": [2]}) >>> conv = DFtoVW.from_colnames(y="y", x="x", df=df) >>> conv.convert_df() >>> df2 = pd.DataFrame({"y": [1], "x1": [2], "x2": [3], "x3": [4]}) >>> conv2 = DFtoVW.from_colnames(y="y", x=set(df2.columns) - set("y"), df=df2) >>> conv2.convert_df() Returns ------- DFtoVW A initialized DFtoVW instance. """ dict_label_type = { "simple_label": SimpleLabel, "multiclass": MulticlassLabel, "multilabel": MultiLabel, } if label_type not in dict_label_type: raise ValueError( "'label_type' should be either of the following string: {label_types}".format( label_types=repr(list(dict_label_type.keys()))[1:-1] ) ) y = y if isinstance(y, list) else [y] if not all(isinstance(yi, str) for yi in y): raise TypeError( "Argument 'y' should be a string or a list of string(s)." ) if label_type != "multilabel": if len(y) == 1: y = y[0] else: raise ValueError( "When label_type is 'simple_label' or 'multiclass', argument 'y' should be a string or a list of exactly one string." ) label = dict_label_type[label_type](y) x = x if isinstance(x, list) else [x] if not all(isinstance(xi, str) for xi in x): raise TypeError( "Argument 'x' should be a string or a list of string." ) namespaces = Namespace( features=[Feature(value=colname) for colname in x] ) return cls(namespaces=namespaces, label=label, df=df) def check_features_type(self, features): """Check if the features argument is of type Feature. Parameters ---------- features: (list of) Feature, The features argument to check. Raises ------ TypeError If the features is not a Feature of a list of Feature. """ if isinstance(features, list): valid_feature = all( [isinstance(feature, Feature) for feature in features] ) else: valid_feature = isinstance(features, Feature) if not valid_feature: raise TypeError( "Argument 'features' should be a Feature or a list of Feature." ) def set_namespaces_or_features(self, namespaces, features): """Set namespaces attributes Parameters ---------- namespaces: Namespace / list of Namespace objects The namespaces argument. features: Feature / list of Feature objects The features argument. Raise ----- ValueError: If argument 'features' or 'namespaces' are not valid. """ if (features is None) and (namespaces is None): raise ValueError("Missing 'features' or 'namespace' argument") if (features is not None) and (namespaces is not None): raise ValueError( "Arguments supplied for both 'features' and 'namespaces', only one of the these arguments should be supplied." ) if features is not None: namespaces = Namespace(features=features) namespaces = ( list(namespaces) if isinstance(namespaces, (list, set)) else [namespaces] ) self.namespaces = namespaces def check_label_type(self): """Check label type. Raises ------ TypeError If label is not of type SimpleLabel or MulticlassLabel. """ available_labels = (SimpleLabel, MulticlassLabel, MultiLabel) if self.label is None: pass else: if not isinstance(self.label, available_labels): raise TypeError( "Argument 'label' should be either of the following type: {label_types}.".format( label_types=repr( [x.__name__ for x in available_labels] )[1:-1] ) ) def check_namespaces_type(self): """Check if namespaces arguments are of type Namespace. Raises ------ TypeError If namespaces are not of type Namespace or list of Namespace. """ wrong_type_namespaces = [ not isinstance(namespace, Namespace) for namespace in self.namespaces ] if any(wrong_type_namespaces): raise TypeError( "Argument 'namespaces' should be a Namespace or a list of Namespace." ) def check_columns_existence_in_df(self): """Check if the columns are in the dataframe.""" absent_cols = {} df_colnames = set(self.df.columns) try: missing_cols = self.label.columns except AttributeError: pass else: if missing_cols is not None: type_label = type(self.label).__name__ absent_cols[type_label] = list(missing_cols - df_colnames) try: missing_cols = self.tag.columns except AttributeError: pass else: if missing_cols is not None: absent_cols["tag"] = list(missing_cols - df_colnames) all_features = [ feature for namespace in self.namespaces for feature in namespace.features ] missing_features_cols = [] for feature in all_features: try: missing_cols = feature.columns except AttributeError: pass else: if missing_cols is not None: missing_features_cols += list(missing_cols - df_colnames) absent_cols["Feature"] = sorted(list(set(missing_features_cols))) absent_cols = { key: value for (key, value) in absent_cols.items() if len(value) > 0 } self.generate_missing_col_error(absent_cols) def generate_missing_col_error(self, absent_cols_dict): """Generate error if some columns are missing Raises ------ ValueError If one or more columns are not in the dataframe. """ if absent_cols_dict: msg_error = "" for attribute_name, missing_cols in absent_cols_dict.items(): missing_cols = ( repr(missing_cols)[1:-1] if isinstance(missing_cols, list) else missing_cols ) if len(msg_error) > 0: msg_error += " " msg_error += "In '{attribute}': column(s) {colnames} not found in dataframe.".format( attribute=attribute_name, colnames=missing_cols, ) raise ValueError(msg_error) def check_columns_type_and_values(self): """Check columns type and values range""" for instance in [self.tag, self.label]: self.check_instance_columns(instance) for namespace in self.namespaces: for feature in namespace.features: self.check_instance_columns(feature) def check_instance_columns(self, instance): """Check the columns type and values of a given instance. The method iterate through the attributes and look for _Col type attribute. Once found, the method use the _Col methods to check the type and the value range of the column. Also, the instance type in which the errors occur are prepend to the error message to be more explicit about where the error occurs in the formula. Raises ------ TypeError If a column is not of valid type. ValueError If a column
import pytest import os, thread from hippy.debugger import Connection, Message from hippy.objspace import ObjSpace from testing.test_interpreter import MockInterpreter, preparse class TestDebugger(object): def setup_method(self, meth): self.read_fd1, self.write_fd1 = os.pipe() self.read_fd2, self.write_fd2 = os.pipe() def teardown_method(self, meth): os.close(self.read_fd1) os.close(self.write_fd1) os.close(self.read_fd2) os.close(self.write_fd2) def run(self, interp, source): source = preparse(source) bc = interp.compile(source) interp.run_bytecode(bc) def test_basic_pipe_communication(self): d = Connection(self.read_fd1, self.write_fd2) os.write(self.write_fd1, "breakpoint a;") assert d.read() == Message("breakpoint", ["a"]) os.write(self.write_fd1, "echo a;echo") assert d.read() == Message("echo", ["a"]) os.write(self.write_fd1, " b;echo a;echo b;echo c;") assert d.read() == Message("echo", ["b"]) assert d.read() == Message("echo", ["a"]) assert d.read() == Message("echo", ["b"]) assert d.read() == Message("echo", ["c"]) d.write(Message("foo", ["a", "b"])) s = os.read(self.read_fd2, 100) assert s == "foo a b;" def test_basic_debugger(self): space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("force_breakpoint", ["f"])); ok(c) c.write(Message("continue", None)); ok(c) interp.debugger.run_debugger_loop(interp) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["Breakpoint set f"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["Continuing"]) self.run(interp, """ function f() { } """) def c1(): assert c.read() == Message("echo", ["stop breakpoint f"]) ok(c) assert c.read() == Message(">", None) c.write(Message("continue", None)); ok(c) thread.start_new_thread(c1, ()) self.run(interp, "f();") assert not c.more_pending_messages() assert not interp.debugger.conn.more_pending_messages() assert not interp.msgs interp.shutdown() def test_eval(self): space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("force_breakpoint", ["f"])); ok(c) c.write(Message("continue", None)); ok(c) interp.debugger.run_debugger_loop(interp) self.run(interp, """ function f($a, $b, $x) { } """) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["Breakpoint set f"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["Continuing"]) ok(c) c.write(Message("eval", ["$x"])); ok(c) c.write(Message("backtrace", None)); ok(c) c.write(Message("continue", None)); ok(c) self.run(interp, """ f(1, 2, 3); """) assert c.read() == Message("echo", ["stop breakpoint f"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["int(3)"]) assert c.read() == Message(">", None) exp_traceback = ["<input>", "f", "2", "function f($a, $b, $x) {", "<input>", "<main>", "2", "f(1, 2, 3);"] msg = c.read() assert msg == Message("traceback", exp_traceback) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['Continuing']) assert not c.more_pending_messages() assert not interp.debugger.conn.more_pending_messages() assert not interp.msgs interp.shutdown() def test_empty_backtrace(self): space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("backtrace", None)); ok(c) c.write(Message("continue", None)); ok(c) interp.debugger.run_debugger_loop(interp) self.run(interp, "") assert c.read() == Message(">", None) assert c.read() == Message("warn", ["empty backtrace"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['Continuing']) assert not c.more_pending_messages() assert not interp.debugger.conn.more_pending_messages() assert not interp.msgs interp.shutdown() def test_class_breakpoint_and_traceback(self): space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("force_breakpoint", ["klass::method"])); ok(c) c.write(Message("continue", None)); ok(c) interp.debugger.run_debugger_loop(interp) def c1(): assert c.read() == Message(">", None) assert c.read() == Message("echo", ["Breakpoint set klass::method"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["Continuing"]) assert c.read() == Message("echo", ["stop breakpoint klass::method"]) ok(c) assert c.read() == Message(">", None) c.write(Message("eval", ["$x"])); ok(c) c.write(Message("continue", None)); ok(c) thread.start_new_thread(c1, ()) self.run(interp, """ class klass { function method($x) { } } $x = new klass(); $x->method(13); """) assert c.read() == Message("echo", ["int(13)"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['Continuing']) assert not c.more_pending_messages() assert not interp.debugger.conn.more_pending_messages() assert not interp.msgs interp.shutdown() def test_next_step(self): pytest.xfail() space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("force_breakpoint", ["f"])); ok(c) c.write(Message("continue", None)); ok(c) interp.debugger.run_debugger_loop(interp) def c1(): assert c.read() == Message(">", None) assert c.read() == Message("echo", ["Breakpoint set f"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["Continuing"]) assert c.read() == Message("echo", ["stop breakpoint f"]) ok(c) assert c.read() == Message(">", None) c.write(Message("eval", ["$a"])) assert c.read() == Message("echo", ["int(1)"]) ok(c) assert c.read() == Message(">", None) c.write(Message("next", None)) assert c.read() == Message("linechange", ["<input>", "3", "f", " $z = $a + $b + $c;"]) ok(c) assert c.read() == Message(">", None) c.write(Message("next", None)) assert c.read() == Message("linechange", ["<input>", "4", "f", " $a = $z - 3 + g();"]) ok(c) assert c.read() == Message(">", None) c.write(Message("eval", ["$z"])) assert c.read() == Message("echo", ["int(6)"]) ok(c) assert c.read() == Message(">", None) c.write(Message("step", None)) assert c.read() == Message("echo", ["enter g"]) ok(c) assert c.read() == Message("linechange", ["<input>", "8", "g", " return 13;"]) ok(c) c.write(Message("continue", None)) ok(c) thread.start_new_thread(c1, ()) self.run(interp, """ function f($a, $b, $c) { $z = $a + $b + $c; $a = $z - 3 + g(); return $a; } function g() { return 13; } f(1, 2, 3); """) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['Continuing']) assert not c.more_pending_messages() assert not interp.debugger.conn.more_pending_messages() assert not interp.msgs interp.shutdown() def test_step_precise_position(self): space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("step", None)); ok(c); ok(c) c.write(Message("step", None)); ok(c) c.write(Message("step", None)); ok(c); ok(c) c.write(Message("continue", None)); ok(c); ok(c) interp.debugger.run_debugger_loop(interp) interp.echo = interp.print_expr # <= hack self.run(interp, """ $a = 5; echo 'foobar'; echo 'baz'; """) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["enter <main>"]) assert c.read() == Message("linechange", ["<input>", "2", "<main>", "$a = 5;"]) assert c.read() == Message(">", None) assert c.read() == Message("linechange", ["<input>", "3", "<main>", "echo 'foobar';"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['string(6) "foobar"']) assert c.read() == Message("linechange", ["<input>", "4", "<main>", "echo 'baz';"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['Continuing']) assert c.read() == Message("echo", ['string(3) "baz"']) assert not c.more_pending_messages() assert not interp.debugger.conn.more_pending_messages() assert not interp.msgs interp.shutdown() def test_step_enter_leave(self): space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("step", None)); ok(c); ok(c) c.write(Message("step", None)); ok(c); ok(c) c.write(Message("backtrace", None)); ok(c) c.write(Message("step", None)); ok(c); ok(c); ok(c); ok(c) c.write(Message("step", None)); ok(c); ok(c); ok(c) c.write(Message("step", None)); ok(c); ok(c) c.write(Message("continue", None)); ok(c); ok(c) interp.debugger.run_debugger_loop(interp) interp.echo = interp.print_expr # <= hack self.run(interp, """ function F() { echo 'fff'; } F(); F(); F(); """) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["enter <main>"]) assert c.read() == Message("linechange", ["<input>", "5", "<main>", "F(); F();"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["enter F"]) assert c.read() == Message("linechange", ["<input>", "3", "F", " echo 'fff';"]) assert c.read() == Message(">", None) exp_traceback = ["<input>", "F", "3", " echo 'fff';", "<input>", "<main>", "5", "F(); F();"] assert c.read() == Message("traceback", exp_traceback) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['string(3) "fff"']) assert c.read() == Message("echo", ["leave F"]) assert c.read() == Message("echo", ["enter F"]) assert c.read() == Message("linechange", ["<input>", "3", "F", " echo 'fff';"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['string(3) "fff"']) assert c.read() == Message("echo", ["leave F"]) assert c.read() == Message("linechange", ["<input>", "6", "<main>", "F();"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["enter F"]) assert c.read() == Message("linechange", ["<input>", "3", "F", " echo 'fff';"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['Continuing']) assert c.read() == Message("echo", ['string(3) "fff"']) assert not c.more_pending_messages() assert not interp.debugger.conn.more_pending_messages() assert not interp.msgs interp.shutdown() def test_next_is_step_if_not_a_call(self): space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("next", None)); ok(c); ok(c) c.write(Message("next", None)); ok(c); ok(c) c.write(Message("continue", None)); ok(c) interp.debugger.run_debugger_loop(interp) interp.echo = interp.print_expr # <= hack self.run(interp, """ echo 'fff'; $a = 5; """) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["enter <main>"]) assert c.read() == Message("linechange", ["<input>", "2", "<main>", "echo 'fff';"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['string(3) "fff"']) assert c.read() == Message("linechange", ["<input>", "3", "<main>", "$a = 5;"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['Continuing']) assert not c.more_pending_messages() assert not interp.debugger.conn.more_pending_messages() assert not interp.msgs interp.shutdown() def test_next_skips_all_nested_calls(self): space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("next", None)); ok(c); ok(c) c.write(Message("next", None)); ok(c) c.write(Message("continue", None)); ok(c) interp.debugger.run_debugger_loop(interp) interp.echo = interp.print_expr # <= hack self.run(interp, """ function F() { return G(); } function G() { return 42; } $a = F(); $a++; """) assert c.read() == Message(">", None) assert c.read() == Message("echo", ["enter <main>"]) assert c.read() == Message("linechange", ["<input>", "8", "<main>", "$a = F();"]) assert c.read() == Message(">", None) assert c.read() == Message("linechange", ["<input>", "9", "<main>", "$a++;"]) assert c.read() == Message(">", None) assert c.read() == Message("echo", ['Continuing']) assert not c.more_pending_messages() assert not interp.debugger.conn.more_pending_messages() assert not interp.msgs interp.shutdown() def test_next_passes_over_calls_on_the_same_line(self): space = ObjSpace() interp = MockInterpreter(space) interp.setup_debugger(self.read_fd1, self.write_fd2) c = Connection(self.read_fd2, self.write_fd1) c.write(Message("next", None)); ok(c); ok(c) c.write(Message("next", None)); ok(c); ok(c); ok(c)
= Vertex(name = 'V_311', particles = [ P.G0, P.G__plus__, P.sl3__minus__, P.sv3__tilde__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_1134}) V_312 = Vertex(name = 'V_312', particles = [ P.A0, P.H__plus__, P.sl3__minus__, P.sv3__tilde__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_2247}) V_313 = Vertex(name = 'V_313', particles = [ P.a, P.sl3__plus__, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.VSS2 ], couplings = {(0,0):C.GC_412}) V_314 = Vertex(name = 'V_314', particles = [ P.vt__tilde__, P.x1__plus__, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.FFS3 ], couplings = {(0,0):C.GC_861}) V_315 = Vertex(name = 'V_315', particles = [ P.vt__tilde__, P.x2__plus__, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.FFS3 ], couplings = {(0,0):C.GC_879}) V_316 = Vertex(name = 'V_316', particles = [ P.tau__plus__, P.n1, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.FFS3, L.FFS4 ], couplings = {(0,1):C.GC_951,(0,0):C.GC_102}) V_317 = Vertex(name = 'V_317', particles = [ P.tau__plus__, P.n2, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.FFS3, L.FFS4 ], couplings = {(0,1):C.GC_952,(0,0):C.GC_125}) V_318 = Vertex(name = 'V_318', particles = [ P.tau__plus__, P.n3, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.FFS3, L.FFS4 ], couplings = {(0,1):C.GC_953,(0,0):C.GC_148}) V_319 = Vertex(name = 'V_319', particles = [ P.tau__plus__, P.n4, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.FFS3, L.FFS4 ], couplings = {(0,1):C.GC_954,(0,0):C.GC_171}) V_320 = Vertex(name = 'V_320', particles = [ P.sl1__plus__, P.sl1__minus__, P.sl3__plus__, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_424}) V_321 = Vertex(name = 'V_321', particles = [ P.sl2__plus__, P.sl2__minus__, P.sl3__plus__, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_425}) V_322 = Vertex(name = 'V_322', particles = [ P.sl3__plus__, P.sl3__plus__, P.sl3__minus__, P.sl3__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_426}) V_323 = Vertex(name = 'V_323', particles = [ P.sl4__plus__, P.sl4__minus__, P.sv1__tilde__, P.sv1 ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_445}) V_324 = Vertex(name = 'V_324', particles = [ P.sl4__plus__, P.sl4__minus__, P.sv2__tilde__, P.sv2 ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_445}) V_325 = Vertex(name = 'V_325', particles = [ P.sl4__plus__, P.sl4__minus__, P.sv3__tilde__, P.sv3 ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_445}) V_326 = Vertex(name = 'V_326', particles = [ P.a, P.a, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.VVSS1 ], couplings = {(0,0):C.GC_444}) V_327 = Vertex(name = 'V_327', particles = [ P.h02, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSS1 ], couplings = {(0,0):C.GC_1867}) V_328 = Vertex(name = 'V_328', particles = [ P.h01, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSS1 ], couplings = {(0,0):C.GC_1866}) V_329 = Vertex(name = 'V_329', particles = [ P.h01, P.h01, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_990}) V_330 = Vertex(name = 'V_330', particles = [ P.h02, P.h02, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_989}) V_331 = Vertex(name = 'V_331', particles = [ P.A0, P.A0, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_1094}) V_332 = Vertex(name = 'V_332', particles = [ P.G0, P.G0, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_1093}) V_333 = Vertex(name = 'V_333', particles = [ P.G__minus__, P.G__plus__, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_1093}) V_334 = Vertex(name = 'V_334', particles = [ P.H__minus__, P.H__plus__, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_1094}) V_335 = Vertex(name = 'V_335', particles = [ P.a, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.VSS2 ], couplings = {(0,0):C.GC_443}) V_336 = Vertex(name = 'V_336', particles = [ P.e__plus__, P.n1, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.FFS4 ], couplings = {(0,0):C.GC_62}) V_337 = Vertex(name = 'V_337', particles = [ P.e__plus__, P.n2, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.FFS4 ], couplings = {(0,0):C.GC_63}) V_338 = Vertex(name = 'V_338', particles = [ P.e__plus__, P.n3, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.FFS4 ], couplings = {(0,0):C.GC_64}) V_339 = Vertex(name = 'V_339', particles = [ P.e__plus__, P.n4, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.FFS4 ], couplings = {(0,0):C.GC_65}) V_340 = Vertex(name = 'V_340', particles = [ P.sl1__plus__, P.sl1__minus__, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_460}) V_341 = Vertex(name = 'V_341', particles = [ P.sl2__plus__, P.sl2__minus__, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_461}) V_342 = Vertex(name = 'V_342', particles = [ P.sl3__plus__, P.sl3__minus__, P.sl4__plus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_462}) V_343 = Vertex(name = 'V_343', particles = [ P.sl4__plus__, P.sl4__plus__, P.sl4__minus__, P.sl4__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_463}) V_344 = Vertex(name = 'V_344', particles = [ P.sl5__plus__, P.sl5__minus__, P.sv1__tilde__, P.sv1 ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_466}) V_345 = Vertex(name = 'V_345', particles = [ P.sl5__plus__, P.sl5__minus__, P.sv2__tilde__, P.sv2 ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_466}) V_346 = Vertex(name = 'V_346', particles = [ P.sl5__plus__, P.sl5__minus__, P.sv3__tilde__, P.sv3 ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_466}) V_347 = Vertex(name = 'V_347', particles = [ P.a, P.a, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.VVSS1 ], couplings = {(0,0):C.GC_465}) V_348 = Vertex(name = 'V_348', particles = [ P.h02, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSS1 ], couplings = {(0,0):C.GC_1869}) V_349 = Vertex(name = 'V_349', particles = [ P.h01, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSS1 ], couplings = {(0,0):C.GC_1868}) V_350 = Vertex(name = 'V_350', particles = [ P.h01, P.h01, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_992}) V_351 = Vertex(name = 'V_351', particles = [ P.h02, P.h02, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_991}) V_352 = Vertex(name = 'V_352', particles = [ P.A0, P.A0, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_1096}) V_353 = Vertex(name = 'V_353', particles = [ P.G0, P.G0, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_1095}) V_354 = Vertex(name = 'V_354', particles = [ P.G__minus__, P.G__plus__, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_1095}) V_355 = Vertex(name = 'V_355', particles = [ P.H__minus__, P.H__plus__, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_1096}) V_356 = Vertex(name = 'V_356', particles = [ P.a, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.VSS2 ], couplings = {(0,0):C.GC_464}) V_357 = Vertex(name = 'V_357', particles = [ P.mu__plus__, P.n1, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.FFS4 ], couplings = {(0,0):C.GC_66}) V_358 = Vertex(name = 'V_358', particles = [ P.mu__plus__, P.n2, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.FFS4 ], couplings = {(0,0):C.GC_67}) V_359 = Vertex(name = 'V_359', particles = [ P.mu__plus__, P.n3, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.FFS4 ], couplings = {(0,0):C.GC_68}) V_360 = Vertex(name = 'V_360', particles = [ P.mu__plus__, P.n4, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.FFS4 ], couplings = {(0,0):C.GC_69}) V_361 = Vertex(name = 'V_361', particles = [ P.sl1__plus__, P.sl1__minus__, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ], couplings = {(0,0):C.GC_481}) V_362 = Vertex(name = 'V_362', particles = [ P.sl2__plus__, P.sl2__minus__, P.sl5__plus__, P.sl5__minus__ ], color = [ '1' ], lorentz = [ L.SSSS1 ],
<filename>targeter/targeter.py import argparse import functools import re from datetime import datetime, timezone import aiohttp import discord from dateutil.parser import parse from redbot.core import checks, commands from redbot.core.commands import BadArgument, Converter, RoleConverter from redbot.core.utils.chat_formatting import humanize_list, pagify from redbot.core.utils.menus import DEFAULT_CONTROLS, menu PERMS = [ "add_reactions", "administrator", "attach_files", "ban_members", "change_nickname", "connect", "create_instant_invite", "deafen_members", "embed_links", "external_emojis", "kick_members", "manage_channels", "manage_emojis", "manage_guild", "manage_messages", "manage_nicknames", "manage_roles", "manage_webhooks", "mention_everyone", "move_members", "mute_members", "priority_speaker", "read_message_history", "read_messages", "send_messages", "send_tts_messages", "speak", "stream", "use_voice_activation", "view_audit_log", ] # Large pieces of the argument parser is taken from Sinbad's cogs. I based mine off of https://github.com/mikeshardmind/SinbadCogs/blob/v3/scheduler/converters.py#L23 class NoExitParser(argparse.ArgumentParser): def error(self, message): raise BadArgument() class Args(Converter): async def convert(self, ctx, argument): argument = argument.replace("—", "--") parser = NoExitParser(description="Targeter argument parser", add_help=False) # Nicknames / Usernames names = parser.add_argument_group() names.add_argument("--nick", nargs="*", dest="nick", default=[]) names.add_argument("--user", nargs="*", dest="user", default=[]) names.add_argument("--name", nargs="*", dest="name", default=[]) names.add_argument("--not-nick", nargs="*", dest="not-nick", default=[]) names.add_argument("--not-user", nargs="*", dest="not-user", default=[]) names.add_argument("--not-name", nargs="*", dest="not-name", default=[]) names.add_argument("--a-nick", dest="a-nick", action="store_true") names.add_argument("--no-nick", dest="no-nick", action="store_true") discs = parser.add_mutually_exclusive_group() discs.add_argument("--disc", nargs="*", dest="disc", default=[]) discs.add_argument("--not-disc", nargs="*", dest="ndisc", default=[]) # Roles parser.add_argument("--roles", nargs="*", dest="roles", default=[]) parser.add_argument("--any-role", nargs="*", dest="any-role", default=[]) parser.add_argument("--not-roles", nargs="*", dest="not-roles", default=[]) parser.add_argument("--not-any-role", nargs="*", dest="not-any-role", default=[]) single = parser.add_mutually_exclusive_group() single.add_argument("--a-role", dest="a-role", action="store_true") single.add_argument("--no-role", dest="no-role", action="store_true") # Date stuff jd = parser.add_argument_group() jd.add_argument("--joined-on", nargs="*", dest="joined-on", default=[]) jd.add_argument("--joined-before", nargs="*", dest="joined-be", default=[]) jd.add_argument("--joined-after", nargs="*", dest="joined-af", default="") cd = parser.add_argument_group() cd.add_argument("--created-on", nargs="*", dest="created-on", default=[]) cd.add_argument("--created-before", nargs="*", dest="created-be", default=[]) cd.add_argument("--created-after", nargs="*", dest="created-af", default=[]) # Status / Activity / Device / Just Basically Profile Stuff parser.add_argument("--status", nargs="*", dest="status", default=[]) parser.add_argument("--device", nargs="*", dest="device", default=[]) bots = parser.add_mutually_exclusive_group() bots.add_argument("--only-bots", dest="bots", action="store_true") bots.add_argument("--no-bots", dest="nbots", action="store_true") parser.add_argument("--activity-type", nargs="*", dest="at", default=[]) parser.add_argument("--activity", nargs="*", dest="a", default=[]) at = parser.add_mutually_exclusive_group() at.add_argument("--no-activity", dest="na", action="store_true") at.add_argument("--an-activity", dest="aa", action="store_true") # Permissions parser.add_argument("--perms", nargs="*", dest="perms", default=[]) parser.add_argument("--any-perm", nargs="*", dest="any-perm", default=[]) parser.add_argument("--not-perms", nargs="*", dest="not-perms", default=[]) parser.add_argument("--not-any-perm", nargs="*", dest="not-any-perm", default=[]) # Extra parser.add_argument("--format", nargs="*", dest="format", default=["menu"]) try: vals = vars(parser.parse_args(argument.split(" "))) except Exception as exc: raise BadArgument() from exc try: for key, value in vals.items(): if type(value) == list: split_words = value word_list = [] tmp = "" for word in split_words: if not word.startswith('"') and not word.endswith('"') and not tmp: if word.startswith(r"\""): word = word[1:] word_list.append(word) else: echanged = False if word.endswith(r"\""): word = word[:-2] + '"' echanged = True schanged = False if word.startswith(r"\""): word = word[1:] schanged = True if word.startswith('"') and not schanged: if word.startswith('"') and word.endswith('"') and len(word) > 1: word_list.append(word) else: if tmp.endswith(" "): word_list.append(tmp) tmp = "" continue tmp += word[1:] + " " elif word.endswith('"') and not echanged: tmp += word[:-1] word_list.append(tmp) tmp = "" else: if schanged or echanged: word_list.append(word) continue tmp += word + " " if tmp: raise BadArgument("A quote was started but never finished.") vals[key] = word_list except Exception as e: raise BadArgument(str(e)) if any(s for s in vals["status"] if not s.lower() in ["online", "dnd", "idle", "offline"]): raise BadArgument( "Invalid status. Must be either `online`, `dnd`, `idle` or `offline`." ) # Useeeeeeeeeeeeeeeeeeeernames (and Stuff) if vals["disc"]: new = [] for disc in vals["disc"]: if len(disc) != 4: raise BadArgument("Discriminators must have the length of 4") try: new.append(int(disc)) except ValueError: raise BadArgument("Discriminators must be valid integers") vals["disc"] = new if vals["ndisc"]: new = [] for disc in vals["ndisc"]: if len(disc) != 4: raise BadArgument("Discriminators must have the length of 4") try: new.append(int(disc)) except ValueError: raise BadArgument("Discriminators must be valid integers") vals["ndisc"] = new # Rooooooooooooooooles rc = RoleConverter() new = [] for role in vals["roles"]: r = await rc.convert(ctx, role) if not r: raise BadArgument(f"Couldn't find a role matching: {role}") new.append(r) vals["roles"] = new new = [] for role in vals["any-role"]: r = await rc.convert(ctx, role) if not r: raise BadArgument(f"Couldn't find a role matching: {role}") new.append(r) vals["any-role"] = new new = [] for role in vals["not-roles"]: r = await rc.convert(ctx, role) if not r: raise BadArgument(f"Couldn't find a role matching: {role}") new.append(r) vals["not-roles"] = new new = [] for role in vals["not-any-role"]: r = await rc.convert(ctx, role) if not r: raise BadArgument(f"Couldn't find a role matching: {role}") new.append(r) vals["not-any-role"] = new # Daaaaaaaaaaaaaaaaaates if vals["joined-on"]: try: vals["joined-on"] = parse(" ".join(vals["joined-on"])) except: raise BadArgument("Failed to parse --joined-on argument") if vals["joined-be"]: try: vals["joined-be"] = parse(" ".join(vals["joined-be"])) except: raise BadArgument("Failed to parse --joined-be argument") if vals["joined-af"]: try: vals["joined-af"] = parse(" ".join(vals["joined-af"])) except: raise BadArgument("Failed to parse --joined-after argument") if vals["created-on"]: try: vals["created-on"] = parse(" ".join(vals["created-on"])) except: raise BadArgument("Failed to parse --created-on argument") if vals["created-be"]: try: vals["created-be"] = parse(" ".join(vals["created-be"])) except: raise BadArgument("Failed to parse --created-be argument") if vals["created-af"]: try: vals["created-af"] = parse(" ".join(vals["created-af"])) except: raise BadArgument("Failed to parse --created-af argument") # Actiiiiiiiiiiiiiiiiivities if vals["device"]: if not all(d in ["desktop", "mobile", "web"] for d in vals["device"]): raise BadArgument("Bad device. Must be `desktop`, `mobile` or `web`.") if vals["at"]: at = discord.ActivityType switcher = { "unknown": at.unknown, "playing": at.playing, "streaming": at.streaming, "listening": at.listening, "watching": at.watching, "competing": at.competing } if not all([a.lower() in switcher for a in vals["at"]]): raise BadArgument( "Invalid Activity Type. Must be either `unknown`, `playing`, `streaming`, `listening`, `competing` or `watching`." ) new = [switcher[name.lower()] for name in vals["at"]] vals["at"] = new new = [] for perm in vals["perms"]: perm = perm.replace(" ", "_") if not perm.lower() in PERMS: raise BadArgument( f"Invalid permission. Run `{ctx.prefix}target permissions` to see a list of valid permissions." ) new.append(perm) vals["perms"] = new new = [] for perm in vals["any-perm"]: perm = perm.replace(" ", "_") if not perm.lower() in PERMS: raise BadArgument( f"Invalid permission. Run `{ctx.prefix}target permissions` to see a list of valid permissions." ) new.append(perm) vals["any-perm"] = new new = [] for perm in vals["not-perms"]: perm = perm.replace(" ", "_") if not perm.lower() in PERMS: raise BadArgument( f"Invalid permission. Run `{ctx.prefix}target permissions` to see a list of valid permissions." ) new.append(perm) vals["not-perms"] = new new = [] for perm in vals["not-any-perm"]: perm = perm.replace(" ", "_") if not perm.lower() in PERMS: raise BadArgument( f"Invalid permission. Run `{ctx.prefix}target permissions` to see a list of valid permissions." ) new.append(perm) vals["not-any-perm"] = new if vals["format"]: if not vals["format"][0].lower() in ["page", "menu"]: raise BadArgument( "Invalid format. Must be `page` for in a bin or `menu` for in an embed." ) vals["format"] = vals["format"][0].lower() return vals class Targeter(commands.Cog): """Target members and get a list of them based on the passed arguments""" def __init__(self, bot): self.bot = bot self.conv = Args() # For evals self.s = aiohttp.ClientSession() async def red_delete_data_for_user(self, **kwargs): """This cog does not store user data""" return async def post(self, string): async with self.s.put("http://bin.doyle.la", data=string.encode("utf-8")) as post: text = await post.text() return text def lookup(self, ctx, args): matched = ctx.guild.members passed = [] # --- Go through each possible argument --- # -- Nicknames/Usernames -- if args["nick"]: matched_here = [] for user in matched: if any( [user.nick and piece.lower() in user.nick.lower() for piece in args["nick"]] ): matched_here.append(user) passed.append(matched_here) if args["user"]: matched_here = [] for user in matched: if any([piece.lower() in user.name.lower() for piece in args["user"]]): matched_here.append(user) passed.append(matched_here) if args["name"]: matched_here = [] for user in matched: if any([piece.lower() in user.display_name.lower() for piece in args["name"]]): matched_here.append(user) passed.append(matched_here) if args["not-nick"]: matched_here = [] for user in matched: if not any( [ user.nick and piece.lower() in user.nick.lower() for piece in args["not-nick"] ] ): matched_here.append(user) passed.append(matched_here) if args["not-user"]: matched_here = [] for user in matched: if not any([piece.lower() in user.name.lower() for piece in args["not-user"]]): matched_here.append(user) passed.append(matched_here) if args["not-name"]: matched_here = [] for user in matched: if not any( [piece.lower() in user.display_name.lower() for piece in args["not-name"]] ): matched_here.append(user) passed.append(matched_here) if args["a-nick"]: matched_here = [] for user in matched: if user.nick: matched_here.append(user) passed.append(matched_here) if args["no-nick"]: matched_here = [] for user in matched: if not user.nick: matched_here.append(user) passed.append(matched_here) if args["disc"]: matched_here = [] for user in matched: if any([disc == int(user.discriminator) for disc in args["disc"]]): matched_here.append(user) passed.append(matched_here) if args["ndisc"]: matched_here = [] for user in matched: if not any([disc == int(user.discriminator) for disc in args["ndisc"]]): matched_here.append(user) passed.append(matched_here) # -- End Nicknames/Usernames -- # -- Roles -- if args["roles"]: matched_here = [] for user in matched: ur = [role.id for role in user.roles] if all(role.id in ur for
1 or hroots[0] != root_join_order[nridx]: break if nridx == 0: return partitions # Now merge all other partitions from 0 to nridx-1 into nridx bigone = [] tozero=[] for idx,part in (enumerate(partitions)): if idx > nridx: break if part: bigone = list(bigone) + list(part) tozero.append(idx) break if not bigone: return partitions for idx in tozero: partitions[idx] = OrderByBlock([]) partitions[nridx] = OrderByBlock(bigone + list(partitions[nridx])) return partitions # ------------------------------------------------------------------------------ # guaranteed to return a list the same size as the root_join_order. The ideal # case is that the orderbys are in the same order as the root_join_order. BUG # NOTE: This partitioning scheme is flawed. It only works in a special case # (when the join clause matches the ordering statement). See below for temporary # fix. # ------------------------------------------------------------------------------ def partition_orderbys(root_join_order, orderbys=[]): partitions = make_orderby_partitions(root_join_order,orderbys) partitions = remove_orderby_gaps(partitions) partitions = merge_orderby_partitions(root_join_order,partitions) return partitions # ------------------------------------------------------------------------------ # Because of the logical bug generating valid sorts (what I was doing previously # only works for a special case), a temporary solution is to merge all # partitions into the lowest root with an orderby statement. # ------------------------------------------------------------------------------ def partition_orderbys_simple(root_join_order, orderbys=[]): partitions = [OrderByBlock([])]*len(root_join_order) if not orderbys: return partitions visited = set([hashable_path(ob.path.meta.root) for ob in orderbys]) # Loop through the root_join_order until all orderby statements have been # visited. for i,root in enumerate(root_join_order): rp = hashable_path(root) visited.discard(rp) if not visited: partitions[i] = OrderByBlock(orderbys) return partitions raise RuntimeError("Shouldn't reach here") #------------------------------------------------------------------------------ # QuerySpec stores all the parameters needed to generate a query plan in one # data-structure # ------------------------------------------------------------------------------ class QuerySpec(object): allowed = [ "roots", "join", "where", "order_by", "ordered", "group_by", "tuple", "distinct", "bind", "select", "heuristic", "joh" ] def __init__(self,**kwargs): for k,v in kwargs.items(): if k not in QuerySpec.allowed: raise ValueError("Trying to set unknown parameter '{}'".format(k)) if v is None: raise ValueError(("Error for QuerySpec parameter '{}': 'None' " "values are not allowed").format(k)) self._params = dict(kwargs) # Return a new QuerySpec with added parameters def newp(self, **kwargs): if not kwargs: return self nparams = dict(self._params) for k,v in kwargs.items(): if v is None: raise ValueError("Cannot specify empty '{}'".format(v)) if k in self._params: raise ValueError("Cannot specify '{}' multiple times".format(k)) nparams[k] = v return QuerySpec(**nparams) # Return a new QuerySpec with modified parameters def modp(self, **kwargs): if not kwargs: return self nparams = dict(self._params) for k,v in kwargs.items(): if v is None: raise ValueError("Cannot specify empty '{}'".format(v)) nparams[k] = v return QuerySpec(**nparams) # Return a new QuerySpec with specified parameters deleted def delp(self, keys=[]): if not keys: return self nparams = dict(self._params) for k in keys: nparams.pop(k,None) return QuerySpec(**nparams) # Return the value of a parameter - behaves slightly differently to simply # specify the parameter as an attribute because you can return a default # value if the parameter is not set. def getp(self,name,default=None): return self._params.get(name,default) def bindp(self, *args, **kwargs): where = self.where if where is None: raise ValueError("'where' must be specified before binding placeholders") np = {} pp = {} for p in where.placeholders: if isinstance(p, NamedPlaceholder): np[p.name] = p elif isinstance(p, PositionalPlaceholder): pp[p.posn] = p for idx, v in enumerate(args): if idx not in pp: raise ValueError(("Trying to bind value '{}' to positional " "argument '{}' but there is no corresponding " "positional placeholder in where clause " "'{}'").format(v,idx,where)) for k,v in kwargs.items(): if k not in np: raise ValueError(("Trying to bind value '{}' to named " "argument '{}' but there is no corresponding " "named placeholder in where clause " "'{}'").format(v,k,where)) nwhere = where.ground(*args, **kwargs) return self.modp(where=nwhere,bind=True) def fill_defaults(self): toadd = dict(self._params) for n in [ "roots","join","where","order_by" ]: v = self._params.get(n,None) if v is None: toadd[n]=[] toadd["group_by"] = self._params.get("group_by",[]) toadd["bind"] = self._params.get("bind",{}) toadd["tuple"] = self._params.get("tuple",False) toadd["distinct"] = self._params.get("distinct",False) toadd["heuristic"] = self._params.get("heuristic",False) toadd["joh"] = self._params.get("joh",oppref_join_order) # Note: No default values for "select" so calling its attribute will # return None if toadd: return QuerySpec(**toadd) else: return self def __getattr__(self, item): if item not in QuerySpec.allowed: raise ValueError(("Trying to get the value of unknown parameter " "'{}'").format(item)) return self._params.get(item,None) def __str__(self): return str(self._params) def __repr__(self): return repr(self._params) # Replace any None with a [] def fix_query_spec(inspec): join = inspec.join if inspec.join else [] where = inspec.where if inspec.where else [] order_by = inspec.order_by if inspec.order_by else [] return QuerySpec(roots=inspec.roots, join=join, where=where, order_by=order_by) # ------------------------------------------------------------------------------ # Takes a list of paths that have an index, then based on a # list of root paths and a query specification, builds the queryplan. # ------------------------------------------------------------------------------ def make_query_plan_preordered_roots(indexed_paths, root_join_order, qspec): qspec = fix_query_spec(qspec) joins = qspec.join whereclauses = qspec.where orderbys = qspec.order_by joinset=set(joins) clauseset=set(whereclauses) visited=set({}) orderbys=list(orderbys) if not root_join_order: raise ValueError("Cannot make query plan with empty root join order") # orderbygroups = partition_orderbys(root_join_order, orderbys) orderbygroups = partition_orderbys_simple(root_join_order, orderbys) # For a set of visited root paths and a set of comparator # statements return the subset of join statements that only reference paths # that have been visited. Removes these joins from the original set. def visitedsubset(visited, inset): outlist=[] for comp in inset: if visited.issuperset([hashable_path(r) for r in comp.roots]): outlist.append(comp) for comp in outlist: inset.remove(comp) return outlist # Generate a list of JoinQueryPlan consisting of a root path and join # comparator and clauses that only reference previous plans in the list. output=[] for idx,(root,rorderbys) in enumerate(zip(root_join_order,orderbygroups)): if rorderbys: rorderbys = OrderByBlock(rorderbys) visited.add(hashable_path(root)) rpjoins = visitedsubset(visited, joinset) rpclauses = visitedsubset(visited, clauseset) if rpclauses: rpclauses = ClauseBlock(rpclauses) joinsc, rpclauses = make_join_pair(rpjoins, rpclauses,rorderbys) if not rpclauses: rpclauses = [] rpjoins = [joinsc] if joinsc else [] output.append(JoinQueryPlan.from_specification(indexed_paths, root_join_order[:idx], root,rpjoins,rpclauses, rorderbys)) return QueryPlan(output) # ------------------------------------------------------------------------------ # Join-order heuristics. The heuristic is a function that takes a set of # indexes, and a query specification with a set of roots and join/where/order_by # expressions. It then returns an ordering over the roots that are used to # determine how the joins are built. To interpret the returned list of root # paths: the first element will be the outer loop query and the last will be the # inner loop query. # # Providing two fixed heuristics: 1) fixed_join_order is a heuristic generator # and the user specifies the exact ordering, 2) basic_join_order simply retains # the ordering given as part of the query specification. # # The default heuristic, oppref_join_order, is a operator preference heuristic. # The idea is to assign a preference value to each join expression based on the # number of join expressions connected with a root path and the operator # preference. The higher the value the further it is to the outer loop. The # intuition is that the joins reduce the number of tuples, so by assigning the # joins early you generate the fewest tuples. Note: not sure about my intuitions # here. Need to look more closely at the mysql discussion on query execution. # ------------------------------------------------------------------------------ def fixed_join_order(*roots): def validate(r): r=path(r) if not r.meta.is_root: raise ValueError(("Bad query roots specification '{}': '{}' is not " "a root path").format(roots, r)) return r if not roots: raise ValueError("Missing query roots specification: cannot create " "a fixed join order heuristic from an empty list") paths = [validate(r) for r in roots] hashables = set([ hashable_path(r) for r in roots ]) def fixed_join_order_heuristic(indexed_paths, qspec): hps = set([hashable_path(r) for r in qspec.roots]) if hps != set(hashables): raise ValueError(("Mis-matched query roots: fixed join order " "heuristic '{}' must contain exactly the " "roots '{}").format(roots, qspec.roots)) return list(paths) return fixed_join_order_heuristic def basic_join_order(indexed_paths, qspec): return [path(r) for r in qspec.roots] def oppref_join_order(indexed_paths, qspec): roots= qspec.roots joins= qspec.join root2val = { hashable_path(rp) : 0 for rp in roots } for join in joins: for rp in join.roots: hrp = hashable_path(rp) v = root2val.setdefault(hrp, 0) root2val[hrp] += join.preference return [path(hrp) for hrp in \ sorted(root2val.keys(), key = lambda k : root2val[k], reverse=True)] # ------------------------------------------------------------------------------ # Take a join order heuristic, a list of joins, and a list of clause blocks and # and generates a query. # ------------------------------------------------------------------------------ def make_query_plan(indexed_paths, qspec): qspec = qspec.fill_defaults() root_order = qspec.joh(indexed_paths, qspec) return make_query_plan_preordered_roots(indexed_paths, root_order, qspec) #------------------------------------------------------------------------------ # Implementing Queries - taking a QuerySpec, QueryPlan, and a FactMap and # generating an actual query. # ------------------------------------------------------------------------------ #------------------------------------------------------------------------------ # Creates a mechanism for sorting using the order_by statements within queries. # # Works by creating a
version_dict['version']['disks'][disk_name]['type_of_disk'] = \ m.groupdict()['type_of_disk'] continue # BIOS Flash Firmware Hub @ 0x0, 0KB m = p10.match(line) if m: bios_flash = m.groupdict()['bios_flash'] version_dict['version']['bios_flash'] = bios_flash # 0: Ext: Management0/0 : address is 5001.0003.0000, irq 11 # 1: Ext: GigabitEthernet0/0 : address is 5001.0003.0001, irq 11 # 2: Ext: GigabitEthernet0/1 : address is 5001.0003.0002, irq 10 # 3: Ext: GigabitEthernet0/2 : address is 5001.0003.0003, irq 10 # 4: Ext: GigabitEthernet0/3 : address is 5001.0003.0004, irq 11 # 5: Ext: GigabitEthernet0/4 : address is 5001.0003.0005, irq 11 # 6: Ext: GigabitEthernet0/5 : address is 5001.0003.0006, irq 10 # 7: Ext: GigabitEthernet0/6 : address is 5001.0003.0007, irq 10 m = p11.match(line) if m: intf_number = int(m.groupdict()['intf_number']) if 'interfaces' not in version_dict['version']: version_dict['version']['interfaces'] = {} if intf_number not in version_dict['version']['interfaces']: version_dict['version']['interfaces'][intf_number] = {} version_dict['version']['interfaces'][intf_number]['interface'] = \ m.groupdict()['interface'] version_dict['version']['interfaces'][intf_number]['mac_addr'] = \ m.groupdict()['mac_addr'] version_dict['version']['interfaces'][intf_number]['intf_irq'] = \ int(m.groupdict()['intf_irq']) continue # 5: Int: Not used : irq 11 # 6: Int: Not used : irq 5 m = p11_1.match(line) if m: intf_number = int(m.groupdict()['intf_number']) if 'interfaces' not in version_dict['version']: version_dict['version']['interfaces'] = {} if intf_number not in version_dict['version']['interfaces']: version_dict['version']['interfaces'][intf_number] = {} version_dict['version']['interfaces'][intf_number]['interface'] = \ m.groupdict()['interface'].strip() version_dict['version']['interfaces'][intf_number]['intf_irq'] = \ int(m.groupdict()['intf_irq']) continue # License mode: Smart Licensing m = p12.match(line) if m: license_mode = m.groupdict()['license_mode'] version_dict['version']['license_mode'] = license_mode continue # ASAv Platform License State: Unlicensed m = p13.match(line) if m: license_state = m.groupdict()['license_state'] version_dict['version']['license_state'] = license_state continue # No active entitlement: no feature tier and no throughput level configured m = p14.match(line) if m: entitlement = m.groupdict()['entitlement'] version_dict['version']['entitlement'] = entitlement continue # *Memory resource allocation is more than the permitted limit. m = p15.match(line) if m: mem_allocation = m.groupdict()['mem_allocation'] version_dict['version']['mem_allocation'] = mem_allocation continue # Maximum VLANs : 50 # Maximum VLANs : 150 perpetual m = p16.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'max_vlans' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['max_vlans'] = {} version_dict['version']['licensed_features']['max_vlans']['status'] = \ m.groupdict()['max_vlans'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['max_vlans']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Inside Hosts : Unlimited # Inside Hosts : Unlimited perpetual m = p17.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'inside_hosts' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['inside_hosts'] = {} version_dict['version']['licensed_features']['inside_hosts']['status'] = \ m.groupdict()['inside_hosts'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['inside_hosts']['time_remaining'] = \ m.groupdict()['time_remaining'] # Failover : Active/Standby # Failover : Active/Active m = p18.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'failover' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['failover'] = {} version_dict['version']['licensed_features']['failover']['status'] = \ m.groupdict()['failover'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['failover']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Encryption-DES : Enabled # VPN-DES : Enabled perpetual m = p19.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'crypto_des' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['crypto_des'] = {} version_dict['version']['licensed_features']['crypto_des']['status'] = \ m.groupdict()['crypto_des'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['crypto_des']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Encryption-3DES-AES : Enabled # VPN-3DES-AES : Enabled perpetual m = p20.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'crypto_3des_aes' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['crypto_3des_aes'] = {} version_dict['version']['licensed_features']['crypto_3des_aes']['status'] = \ m.groupdict()['crypto_3des_aes'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['crypto_3des_aes']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Security Contexts : 10 m = p21.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'security_contexts' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['security_contexts'] = {} version_dict['version']['licensed_features']['security_contexts']['status'] = \ m.groupdict()['security_contexts'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['security_contexts']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Carrier : Disabled m = p22.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'carrier' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['carrier'] = {} version_dict['version']['licensed_features']['carrier']['status'] = \ m.groupdict()['carrier'] continue # AnyConnect Premium Peers : 2 # AnyConnect Premium Peers : 2 perpetual m = p23.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'anyconnect_premium_peers' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['anyconnect_premium_peers'] = {} version_dict['version']['licensed_features']['anyconnect_premium_peers']['status'] = \ m.groupdict()['anyconnect_premium_peers'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['anyconnect_premium_peers']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # AnyConnect Essentials : Disabled # AnyConnect Essentials : Disabled perpetual m = p24.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'anyconnect_essentials' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['anyconnect_essentials'] = {} version_dict['version']['licensed_features']['anyconnect_essentials']['status'] = \ m.groupdict()['anyconnect_essentials'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['anyconnect_essentials']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Other VPN Peers : 250 # Other VPN Peers : 750 perpetual m = p25.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'other_vpn_peers' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['other_vpn_peers'] = {} version_dict['version']['licensed_features']['other_vpn_peers']['status'] = \ m.groupdict()['other_vpn_peers'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['other_vpn_peers']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Total VPN Peers : 250 # Total VPN Peers : 750 perpetual m = p26.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'total_vpn_peers' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['total_vpn_peers'] = {} version_dict['version']['licensed_features']['total_vpn_peers']['status'] = \ m.groupdict()['total_vpn_peers'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['total_vpn_peers']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # AnyConnect for Mobile : Disabled # AnyConnect for Mobile : Disabled perpetual m = p27.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'anyconnect_for_mobile' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['anyconnect_for_mobile'] = {} version_dict['version']['licensed_features']['anyconnect_for_mobile']['status'] = \ m.groupdict()['anyconnect_for_mobile'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['anyconnect_for_mobile']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # AnyConnect for Cisco VPN Phone : Disabled # AnyConnect for Cisco VPN Phone : Disabled perpetual m = p28.match(line) if m: if 'licensed_features' not in version_dict['version']: m.groupdict()['anyconnect_for_cisco_vpn_phone'] if 'anyconnect_for_cisco_vpn_phone' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['anyconnect_for_cisco_vpn_phone'] = {} version_dict['version']['licensed_features']['anyconnect_for_cisco_vpn_phone']['status'] = \ m.groupdict()['anyconnect_for_cisco_vpn_phone'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['anyconnect_for_cisco_vpn_phone']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Advanced Endpoint Assessment : Disabled # Advanced Endpoint Assessment : Disabled perpetual m = p29.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'advanced_endpoint_assessment' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['advanced_endpoint_assessment'] = {} version_dict['version']['licensed_features']['advanced_endpoint_assessment']['status'] = \ m.groupdict()['advanced_endpoint_assessment'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['advanced_endpoint_assessment']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Shared License : Disabled # Shared License : Enabled perpetual m = p30.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'shared_license' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['shared_license'] = {} version_dict['version']['licensed_features']['shared_license']['status'] = \ m.groupdict()['shared_license'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['shared_license']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Total TLS Proxy Sessions : 2 m = p31.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'total_tls_proxy_sessions' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['total_tls_proxy_sessions'] = {} version_dict['version']['licensed_features']['total_tls_proxy_sessions']['status'] = \ m.groupdict()['total_tls_proxy_sessions'] continue # Botnet Traffic Filter : Enabled # Botnet Traffic Filter : Enabled 646 days m = p32.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'botnet_traffic_filter' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['botnet_traffic_filter'] = {} version_dict['version']['licensed_features']['botnet_traffic_filter']['status'] = \ m.groupdict()['botnet_traffic_filter'] if m.groupdict()['time_remaining'] is not None: version_dict['version']['licensed_features']['botnet_traffic_filter']['time_remaining'] = \ m.groupdict()['time_remaining'] continue # Cluster : Disabled m = p33.match(line) if m: if 'licensed_features' not in version_dict['version']: version_dict['version']['licensed_features'] = {} if 'cluster' not in version_dict['version']['licensed_features']: version_dict['version']['licensed_features']['cluster'] = {} version_dict['version']['licensed_features']['cluster']['status'] = \ m.groupdict()['cluster'] continue # Serial Number: 9A5BHB00D2D m = p34.match(line) if m: serial_number = m.groupdict()['serial_number'] version_dict['version']['serial_number'] = serial_number continue # Image type : Release m = p35.match(line) if m: image_type = m.groupdict()['image_type'] version_dict['version']['image_type'] = image_type continue # Key version : A m = p36.match(line) if m: key_version = m.groupdict()['key_version'] version_dict['version']['key_version'] = key_version continue # Configuration last modified by enable_15 at 20:39:39.869 UTC Mon Jun 7 2021 m = p37.match(line) # Configuration has not been modified since last system restart. m2 = p37_1.match(line) if m: last_modified_by = m.groupdict()['last_modified_by'] last_modified_date = m.groupdict()['last_modified_date'] version_dict['version']['last_modified_by'] = last_modified_by version_dict['version']['last_modified_date'] = last_modified_date elif m2: # We get here if the config hasn't been changed since last restart last_modified_by = '' last_modified_date = m2.groupdict()['last_modified_date'] version_dict['version']['last_modified_by'] = last_modified_by version_dict['version']['last_modified_date'] = last_modified_date continue # Encryption hardware device : Cisco ASA-55x0 on-board accelerator (revision 0x0) m = p38.match(line) if m: if 'encryption_hardware' not in version_dict['version']: version_dict['version']['encryption_hardware'] = {} version_dict['version']['encryption_hardware']['encryption_device'] = \ m.groupdict()['encryption_device'] continue # Boot microcode : CN1000-MC-BOOT-2.00 m = p39.match(line) if m: if 'encryption_hardware' not in version_dict['version']: version_dict['version']['encryption_hardware'] = {} version_dict['version']['encryption_hardware']['boot_microcode'] = \ m.groupdict()['boot_microcode'] continue # SSL/IKE microcode: CNLite-MC-SSLm-PLUS-2.03 m = p40.match(line) if m: if 'encryption_hardware' not in version_dict['version']: version_dict['version']['encryption_hardware'] = {} version_dict['version']['encryption_hardware']['ssl_ike_microcode'] = \ m.groupdict()['ssl_ike_microcode'] continue # IPsec microcode : CNlite-MC-IPSECm-MAIN-2.06 m = p41.match(line) if m: if 'encryption_hardware' not in version_dict['version']: version_dict['version']['encryption_hardware'] = {} version_dict['version']['encryption_hardware']['ipsec_microcode'] = \ m.groupdict()['ipsec_microcode'] continue # GTP/GPRS :
an exponential fit to the intensity histogram. Intensity threshold will be set at where the exponential function will have dropped to exp_intensity_filter (Default = 0.01). min_peaks: int Minimum number of peaks to keep, unless less are present from the start. Default = 10. max_peaks: int Maximum number of peaks to keep. Set to 'None' to ignore (Default = 'None'). aim_min_peaks: int Minium number of peaks to keep (if present) during exponential filtering. """ # Fixed parameters: num_bins = 100 # number of bins for histogram min_peaks_for_exp_fit = 25 # With less peaks exponential fit doesn't make any sense. if aim_min_peaks is None: # aim_min_peaks is not given aim_min_peaks = min_peaks if isinstance(peaks, list): peaks = np.array(peaks) if peaks.shape[1] != 2: print("Peaks were given in unexpected format...") # Remove peaks outside min_frag <-> max_frag window: keep_idx = np.where((peaks[:, 0] > min_frag) & (peaks[:, 0] < max_frag))[0] peaks = peaks[keep_idx, :] # Remove peaks based on relative intensity below min_intensity_perc/100 * max_intensity if min_intensity_perc > 0: intensity_thres = np.max(peaks[:, 1]) * min_intensity_perc/100 keep_idx = np.where((peaks[:, 0] > min_frag) & (peaks[:, 0] < max_frag) & (peaks[:, 1] > intensity_thres))[0] if len(keep_idx) > min_peaks: peaks = peaks[keep_idx, :] # Fit exponential to peak intensity distribution if (exp_intensity_filter is not None) and len(peaks) >= min_peaks_for_exp_fit: peaks = exponential_peak_filter(peaks, exp_intensity_filter, aim_min_peaks, num_bins) # Sort by peak intensity peaks = peaks[np.lexsort((peaks[:, 0], peaks[:, 1])), :] if max_peaks is not None: # TODO: now array is transfered back to list (to store as json later). Seems weird. return [(x[0], x[1]) for x in peaks[-max_peaks:, :]] else: return [(x[0], x[1]) for x in peaks] else: # Sort by peak intensity peaks = peaks[np.lexsort((peaks[:, 0], peaks[:, 1])), :] if max_peaks is not None: return [(x[0], x[1]) for x in peaks[-max_peaks:, :]] else: return [(x[0], x[1]) for x in peaks] def exponential_peak_filter(peaks, exp_intensity_filter, aim_min_peaks, num_bins): """Fit exponential to peak intensity distribution and Args: ------- peaks: list of tuples List of tuples containing (m/z, intensity) pairs. exp_intensity_filter: float Intensity threshold will be set where exponential fit to intensity histogram drops below 1 - exp_intensity_filter. aim_min_peaks: int Desired minimum number of peaks. Filtering step will stop removing peaks when it reaches aim_min_peaks. num_bins: int Number of bins for histogram (to fit exponential to). Returns ------- Filtered List of tuples containing (m/z, intensity) pairs. """ def exponential_func(x, a0, alpha): return a0*np.exp(-alpha*x) # Ignore highest peak for further analysis peaks2 = peaks.copy() peaks2[np.where(peaks2[:, 1] == np.max(peaks2[:, 1])), :] = 0 # Create histogram hist, bins = np.histogram(peaks2[:, 1], bins=num_bins) offset = np.where(hist == np.max(hist))[0][0] # Take maximum intensity bin as starting point last = int(num_bins/2) bins_select = bins[offset:last] hist_select = hist[offset:last] # Try exponential fit: try: popt, _ = curve_fit(exponential_func, bins_select, hist_select, p0=(peaks.shape[0], 1e-4)) lower_guess_offset = bins[max(0, offset-1)] threshold = lower_guess_offset \ - np.log(1 - exp_intensity_filter) / popt[1] except RuntimeError: print("RuntimeError for ", len(peaks), " peaks. Use 1/2 mean intensity as threshold.") threshold = np.mean(peaks2[:, 1])/2 except TypeError: print("Unclear TypeError for ", len(peaks), " peaks. Use 1/2 mean intensity as threshold.") print("Bins:", bins_select, "and hist:", hist_select) threshold = np.mean(peaks2[:, 1])/2 keep_idx = np.where(peaks[:, 1] > threshold)[0] if len(keep_idx) < aim_min_peaks: peaks = peaks[np.lexsort((peaks[:, 0], peaks[:, 1])), :][-aim_min_peaks:] else: peaks = peaks[keep_idx, :] return peaks # ---------------------------------------------------------------------------- # -------------------------- Functions to load MS data------------------------ # ---------------------------------------------------------------------------- def load_ms_data(path_data, path_json, filefilter="*.*", results_file=None, num_decimals=3, min_frag=0.0, max_frag=1000.0, min_loss=5.0, max_loss=500.0, min_intensity_perc=0.0, exp_intensity_filter=0.01, min_keep_peaks_0=10, min_keep_peaks_per_mz=20/200, min_peaks=10, max_peaks=None, aim_min_peak=None, peak_loss_words=['peak_', 'loss_']): """Collect spectra from set of files. Partly taken from ms2ldaviz. Prototype. Needs to be replaces by more versatile parser, accepting more MS data formats. # TODO: add documentation. # TODO: consider removing this function alltogether and only allow for MGF input. """ spectra = [] spectra_dict = {} ms_documents = [] ms_documents_intensity = [] dirs = os.listdir(path_data) spectra_files = fnmatch.filter(dirs, filefilter) if results_file is not None: try: spectra_dict = functions.json_to_dict(path_json + results_file) spectra_metadata = pd.read_csv(path_json + results_file[:-5] + "_metadata.csv") print("Spectra json file found and loaded.") spectra = dict_to_spectrum(spectra_dict) collect_new_data = False with open(path_json + results_file[:-4] + "txt", "r") as f: for line in f: line = line.replace('"', '').replace("'", "").replace( "[", "").replace("]", "").replace("\n", "") ms_documents.append(line.split(", ")) with open(path_json + results_file[:-5] + "_intensity.txt", "r") as f: for line in f: line = line.replace("[", "").replace("]", "") ms_documents_intensity.append([int(x) for x in line.split(", ")]) except FileNotFoundError: print("Could not find file ", path_json, results_file) print("New data from ", path_data, " will be imported.") collect_new_data = True # Read data from files if no pre-stored data is found: if spectra_dict == {} or results_file is None: # Run over all spectrum files: for i, filename in enumerate(spectra_files): # Show progress if (i+1) % 10 == 0 or i == len(spectra_files)-1: print('\r', ' Load spectrum ', i+1, ' of ', len(spectra_files), ' spectra.', end="") if min_keep_peaks_per_mz != 0\ and min_keep_peaks_0 > min_peaks: # TODO: remove following BAD BAD hack: # Import first (acutally only needed is PRECURSOR MASS) spec = Spectrum(min_frag=min_frag, max_frag=max_frag, min_loss=min_loss, max_loss=max_loss, min_intensity_perc=min_intensity_perc, exp_intensity_filter=exp_intensity_filter, min_peaks=min_peaks, max_peaks=max_peaks, aim_min_peak=aim_min_peak) # Load spectrum data from file: spec.read_spectrum(path_data, filename, i) # Scale the min_peak filter def min_peak_scaling(x, a, b): return int(a + b * x) min_peaks_scaled = min_peak_scaling(spec.precursor_mz, min_keep_peaks_0, min_keep_peaks_per_mz) else: min_peaks_scaled = min_peaks spectrum = Spectrum(min_frag=min_frag, max_frag=max_frag, min_loss=min_loss, max_loss=max_loss, min_intensity_perc=min_intensity_perc, exp_intensity_filter=exp_intensity_filter, min_peaks=min_peaks, max_peaks=max_peaks, aim_min_peak=min_peaks_scaled) # Load spectrum data from file: spectrum.read_spectrum(path_data, filename, i) # Get precursor mass (later used to calculate losses!) if spec.precursor_mz is not None: if 'Precursor_MZ' in spec.metadata: spec.precursor_mz = float(spec.metadata['Precursor_MZ']) else: spec.precursor_mz = spec.parent_mz # Calculate losses: spectrum.get_losses() # Collect in form of list of spectrum objects, and as dictionary spectra.append(spectrum) spectra_dict[filename] = spectrum.__dict__ ms_documents, ms_documents_intensity, spectra_metadata = create_ms_documents( spectra, num_decimals, peak_loss_words, min_loss, max_loss) # Add filenames to metadata filenames = [] for spectrum in spectra: filenames.append(spectrum.filename) spectra_metadata["filename"] = filenames # Save collected data if collect_new_data: spectra_metadata.to_csv(path_json + results_file[:-5] + "_metadata.csv", index=False) functions.dict_to_json(spectra_dict, path_json + results_file) # Store documents with open(path_json + results_file[:-4] + "txt", "w") as f: for s in ms_documents: f.write(str(s) +"\n") with open(path_json + results_file[:-5] + "_intensity.txt", "w") as f: for s in ms_documents_intensity: f.write(str(s) +"\n") return spectra, spectra_dict, ms_documents, ms_documents_intensity, spectra_metadata def load_MGF_data(file_mgf, file_json=None, num_decimals=2, min_frag=0.0, max_frag=1000.0, min_loss=10.0, max_loss=200.0, min_intensity_perc=0.0, exp_intensity_filter=0.01, min_keep_peaks_0=10, min_keep_peaks_per_mz=20/200, min_peaks=10, max_peaks=None, peak_loss_words=['peak_', 'loss_'], ignore_losses=False, create_docs=True): """Collect spectra from MGF file. 1) Importing MGF file - based on pyteomics parser. 2) Filter spectra: can be based on mininum relative intensity or based on and exponential intenstiy distribution. 3) Create documents with peaks (and losses) as words. Words are constructed from peak mz values and restricted to 'num_decimals' decimals. Args: ------- file_mgf: str MGF file that should be imported. file_json: str File under which already processed data is stored. If not None and if it exists, data will simply be imported from that file. Otherwise data will be imported from file_mgf and final results are stored under file_json.(default= None). num_decimals: int Number of decimals to keep from each peak-position for creating words. min_frag: float Lower limit of m/z to take into account (Default = 0.0). max_frag: float Upper limit of m/z to take into account (Default = 1000.0). min_loss: float Lower limit of losses to take into account (Default = 10.0). max_loss: float Upper limit of losses to take into account (Default = 200.0). min_intensity_perc: float Filter out peaks with intensities lower than the min_intensity_perc percentage of the highest peak intensity. min_intensity_perc = 1.0 will lead to removal of all peaks with intensities below 1% of the maximum intensity. (Default = 0.0, essentially meaning: OFF). exp_intensity_filter: float Filter out peaks by applying an exponential fit to the intensity histogram. Intensity threshold will be set at where the exponential function will have dropped to exp_intensity_filter (Default = 0.01). min_keep_peaks_0: float Factor to describe constant of mininum peaks per spectrum with increasing parentmass. Formula is: int(min_keep_peaks_0 + min_keep_peaks_per_mz * parentmass). min_keep_peaks_per_mz: float Factor to describe linear increase of mininum peaks per spectrum with increasing parentmass. Formula is: int(min_keep_peaks_0
<filename>tests/modules/test_blazeMeterUploader.py import json import logging import math import os import shutil import time from io import BytesIO from bzt import TaurusException from bzt.bza import Master, Session from bzt.modules.aggregator import DataPoint, KPISet from bzt.modules.blazemeter import BlazeMeterUploader, ResultsFromBZA from bzt.modules.blazemeter import MonitoringBuffer from bzt.six import HTTPError from bzt.six import iteritems, viewvalues from tests import BZTestCase, random_datapoint, RESOURCES_DIR from tests.mocks import EngineEmul, BZMock class TestBlazeMeterUploader(BZTestCase): def test_some_errors(self): mock = BZMock() mock.mock_get.update({ 'https://a.blazemeter.com/api/v4/tests?projectId=1&name=Taurus+Test': {"result": []}, 'https://a.blazemeter.com/api/v4/sessions/1': {"result": {'id': 1, "note": "somenote"}}, 'https://a.blazemeter.com/api/v4/masters/1': {"result": {'id': 1, "note": "somenote"}}, }) mock.mock_post.update({ 'https://a.blazemeter.com/api/v4/projects': {"result": {'id': 1}}, 'https://a.blazemeter.com/api/v4/tests': {"result": {'id': 1}}, 'https://a.blazemeter.com/api/v4/tests/1/start-external': {"result": { "session": {'id': 1, "testId": 1, "userId": 1}, "master": {'id': 1}, "signature": "sign" }}, 'https://data.blazemeter.com/api/v4/image/1/files?signature=sign': {"result": True}, 'https://data.blazemeter.com/submit.php?session_id=1&signature=sign&test_id=1&user_id=1' + '&pq=0&target=labels_bulk&update=1': {}, 'https://a.blazemeter.com/api/v4/sessions/1/stop': {"result": True}, 'https://data.blazemeter.com/submit.php?session_id=1&signature=sign&test_id=1&user_id=1&pq=0&target=engine_health&update=1': {'result': {'session': {}}} }) mock.mock_patch.update({ 'https://a.blazemeter.com/api/v4/sessions/1': {"result": {"id": 1, "note": "somenote"}}, 'https://a.blazemeter.com/api/v4/masters/1': {"result": {"id": 1, "note": "somenote"}}, }) obj = BlazeMeterUploader() mock.apply(obj._user) obj.parameters['project'] = 'Proj name' obj.settings['token'] = '<PASSWORD>' obj.settings['browser-open'] = 'none' obj.engine = EngineEmul() obj.prepare() obj.startup() obj.engine.stopping_reason = ValueError('wrong value') obj.aggregated_second(random_datapoint(10)) obj.kpi_buffer[-1][DataPoint.CUMULATIVE][''][KPISet.ERRORS] = [ {'msg': 'Forbidden', 'cnt': 10, 'type': KPISet.ERRTYPE_ASSERT, 'urls': [], KPISet.RESP_CODES: '111'}, {'msg': 'Allowed', 'cnt': 20, 'type': KPISet.ERRTYPE_ERROR, 'urls': [], KPISet.RESP_CODES: '222'}] obj.post_process() obj.log.info("Requests: %s", mock.requests) # check for note appending in _postproc_phase3() reqs = mock.requests[-4:] self.assertIn('api/v4/sessions/1', reqs[0]['url']) self.assertIn('api/v4/sessions/1', reqs[1]['url']) self.assertIn('api/v4/masters/1', reqs[2]['url']) self.assertIn('api/v4/masters/1', reqs[3]['url']) self.assertIn('ValueError: wrong value', str(reqs[1]['data'])) self.assertIn('ValueError: wrong value', str(reqs[3]['data'])) labels = mock.requests[8]['data'] if not isinstance(labels, str): labels = labels.decode("utf-8") obj.log.info("Labels: %s", labels) data = json.loads(str(labels)) self.assertEqual(1, len(data['labels'])) total_item = data['labels'][0] self.assertEqual('ALL', total_item['name']) self.assertEqual(total_item['assertions'], [{'failureMessage': 'Forbidden', 'failures': 10, 'name': 'All Assertions'}]) self.assertEqual(total_item['errors'], [{'m': 'Allowed', 'count': 20, 'rc': '222'}]) def test_no_notes_for_public_reporting(self): mock = BZMock() mock.mock_post.update({ 'https://a.blazemeter.com/api/v4/sessions/1/terminate-external': {}, 'https://data.blazemeter.com/submit.php?session_id=1&signature=None&test_id=1&user_id=1&pq=0&target=labels_bulk&update=1': {}, }) obj = BlazeMeterUploader() obj.parameters['project'] = 'Proj name' obj.settings['token'] = '' # public reporting obj.settings['browser-open'] = 'none' obj.engine = EngineEmul() mock.apply(obj._user) obj.prepare() obj._session = Session(obj._user, {'id': 1, 'testId': 1, 'userId': 1}) obj._master = Master(obj._user, {'id': 1}) obj.engine.stopping_reason = ValueError('wrong value') obj.aggregated_second(random_datapoint(10)) obj.kpi_buffer[-1][DataPoint.CUMULATIVE][''][KPISet.ERRORS] = [ {'msg': 'Forbidden', 'cnt': 10, 'type': KPISet.ERRTYPE_ASSERT, 'urls': [], KPISet.RESP_CODES: '111'}, {'msg': 'Allowed', 'cnt': 20, 'type': KPISet.ERRTYPE_ERROR, 'urls': [], KPISet.RESP_CODES: '222'}] obj.send_monitoring = False obj.post_process() # TODO: looks like this whole block of checks is useless # check for note appending in _postproc_phase3() reqs = [{'url': '', 'data': ''} for _ in range(4)] # add template for minimal size reqs = (reqs + mock.requests)[-4:] self.assertNotIn('api/v4/sessions/1', reqs[0]['url']) self.assertNotIn('api/v4/sessions/1', reqs[1]['url']) self.assertNotIn('api/v4/masters/1', reqs[2]['url']) self.assertNotIn('api/v4/masters/1', reqs[3]['url']) if reqs[1]['data']: self.assertNotIn('ValueError: wrong value', reqs[1]['data']) if reqs[3]['data']: self.assertNotIn('ValueError: wrong value', reqs[3]['data']) def test_check(self): mock = BZMock() mock.mock_get.update({ 'https://a.blazemeter.com/api/v4/tests?workspaceId=1&name=Taurus+Test': {"result": []}, 'https://a.blazemeter.com/api/v4/tests?projectId=1&name=Taurus+Test': {"result": []} }) mock.mock_post.update({ 'https://a.blazemeter.com/api/v4/projects': {"result": { "id": 1, "name": "boo", "userId": 2, "description": None, "created": time.time(), "updated": time.time(), "organizationId": None }}, 'https://a.blazemeter.com/api/v4/tests': {"result": {'id': 1}}, 'https://a.blazemeter.com/api/v4/tests/1/start-external': {"result": { 'session': {'id': 1, 'userId': 1, 'testId': 1}, 'master': {'id': 1, 'userId': 1}, 'signature': 'sign'}}, 'https://data.blazemeter.com/submit.php?session_id=1&signature=sign&test_id=1&user_id=1&pq=0&target=labels_bulk&update=1': [ {}, {"result": {'session': {"statusCode": 140, 'status': 'ENDED'}}}, {}, ], 'https://data.blazemeter.com/api/v4/image/1/files?signature=sign': [ IOError("monitoring push expected fail"), {"result": True}, {"result": True}, {"result": True}, {"result": True}, {"result": True}, {"result": True}, {"result": True}, {"result": True}, ], 'https://a.blazemeter.com/api/v4/sessions/1/stop': {}, 'https://data.blazemeter.com/submit.php?session_id=1&signature=sign&test_id=1&user_id=1&pq=0&target=engine_health&update=1': {"result": {'session': {}}} }) obj = BlazeMeterUploader() obj.parameters['project'] = 'Proj name' obj.settings['token'] = '123' obj.settings['browser-open'] = 'none' obj.engine = EngineEmul() shutil.copy(__file__, os.path.join(obj.engine.artifacts_dir, os.path.basename(__file__))) mock.apply(obj._user) obj._user.timeout = 0.1 obj.prepare() obj.startup() for x in range(0, 31): obj.aggregated_second(random_datapoint(x)) mon = [{"ts": 1, "source": "local", "cpu": 1, "mem": 2, "bytes-recv": 100, "other": 0}] obj.monitoring_data(mon) obj.check() for x in range(32, 65): obj.aggregated_second(random_datapoint(x)) obj.last_dispatch = time.time() - 2 * obj.send_interval self.assertRaises(KeyboardInterrupt, obj.check) obj.aggregated_second(random_datapoint(10)) obj.shutdown() log_file = obj.engine.create_artifact('log', '.tmp') handler = logging.FileHandler(log_file) obj.engine.log.parent.addHandler(handler) obj.engine.config.get('modules').get('shellexec').get('env')['TAURUS_INDEX_ALL'] = 1 obj.post_process() self.assertEqual(20, len(mock.requests)) obj.engine.log.parent.removeHandler(handler) def test_monitoring_buffer_limit_option(self): obj = BlazeMeterUploader() obj.engine = EngineEmul() mock = BZMock(obj._user) obj.settings["monitoring-buffer-limit"] = 100 obj.prepare() for i in range(1000): mon = [{"ts": i, "source": "local", "cpu": float(i) / 1000 * 100, "mem": 2, "bytes-recv": 100, "other": 0}] obj.monitoring_data(mon) for source, buffer in iteritems(obj.monitoring_buffer.data): self.assertLessEqual(len(buffer), 100) self.assertEqual(1, len(mock.requests)) def test_direct_feeding(self): obj = BlazeMeterUploader() self.sniff_log(obj.log) obj.engine = EngineEmul() mock = BZMock(obj._user) mock.mock_post.update({ 'https://data.blazemeter.com/submit.php?session_id=direct&signature=sign&test_id=None&user_id=None&pq=0&target=labels_bulk&update=1': {}, 'https://data.blazemeter.com/api/v4/image/direct/files?signature=sign': {"result": True}, 'https://a.blazemeter.com/api/v4/sessions/direct/stop': {"result": True}, 'https://data.blazemeter.com/submit.php?session_id=direct&signature=sign&test_id=None&user_id=None&pq=0&target=engine_health&update=1': {'result': {'session': {}}} }) mock.mock_get.update({ 'https://a.blazemeter.com/api/v4/sessions/direct': {"result": {}} }) mock.mock_patch.update({ 'https://a.blazemeter.com/api/v4/sessions/direct': {"result": {}} }) obj.parameters['session-id'] = 'direct' obj.parameters['signature'] = 'sign' obj.settings['token'] = '<PASSWORD>' obj.prepare() obj.startup() obj.check() obj.shutdown() obj.engine.stopping_reason = TaurusException("To cover") obj.post_process() self.assertNotIn("Failed to finish online", self.log_recorder.warn_buff.getvalue()) self.assertEquals('direct', obj._session['id']) self.assertEqual(9, len(mock.requests), "Requests were: %s" % mock.requests) def test_anonymous_feeding(self): obj = BlazeMeterUploader() obj.engine = EngineEmul() obj.browser_open = False mock = BZMock(obj._user) mock.mock_post.update({ 'https://a.blazemeter.com/api/v4/sessions': {"result": { "signature": "sign", "publicTokenUrl": "publicUrl", "session": {"id": 1, "testId": 1, "userId": 1}, "master": {"id": 1}, }}, 'https://data.blazemeter.com/submit.php?session_id=1&signature=sign&test_id=1&user_id=1&pq=0&target=labels_bulk&update=1': {}, 'https://data.blazemeter.com/api/v4/image/1/files?signature=sign': {"result": True}, 'https://data.blazemeter.com/submit.php?session_id=1&signature=sign&test_id=1&user_id=1&pq=0&target=engine_health&update=1': {'result': {'session': {}}}, }) obj.prepare() obj.startup() obj.check() obj.shutdown() obj.post_process() self.assertEquals(1, obj._session['id']) self.assertEqual(6, len(mock.requests), "Requests were: %s" % mock.requests) def test_401(self): obj = BlazeMeterUploader() obj.engine = EngineEmul() mock = BZMock(obj._user) mock.mock_get.update({ 'https://a.blazemeter.com/api/v4/web/version': HTTPError(None, None, None, None, None, ), }) self.assertRaises(HTTPError, obj.prepare) def test_multiple_reporters_one_monitoring(self): obj1 = BlazeMeterUploader() obj1.engine = EngineEmul() BZMock(obj1._user) obj2 = BlazeMeterUploader() obj2.engine = EngineEmul() BZMock(obj2._user) obj1.prepare() obj2.prepare() for i in range(10): mon = [{"ts": i, "source": "local", "cpu": float(i) / 1000 * 100, "mem": 2, "bytes-recv": 100, "other": 0}] obj1.monitoring_data(mon) obj2.monitoring_data(mon) def test_public_report(self): mock = BZMock() mock.mock_get.update({ 'https://a.blazemeter.com/api/v4/tests?workspaceId=1&name=Taurus+Test': {"result": []} }) mock.mock_post.update({ 'https://a.blazemeter.com/api/v4/projects': {"result": {'id': 1}}, 'https://a.blazemeter.com/api/v4/tests': {'result': {'id': 'unittest1'}}, 'https://a.blazemeter.com/api/v4/tests/unittest1/start-external': {"result": { 'session': {'id': 'sess1', 'userId': 1, 'testId': 1}, 'master': {'id': 'master1', 'userId': 1}, 'signature': '' }}, 'https://a.blazemeter.com/api/v4/masters/master1/public-token': {'result': {'publicToken': '<PASSWORD>Token'}}, 'https://data.blazemeter.com/submit.php?session_id=sess1&signature=&test_id=1&user_id=1&pq=0&target=labels_bulk&update=1': { "result": {'session': {}}}, 'https://data.blazemeter.com/api/v4/image/sess1/files?signature=': {'result': True}, }) obj = BlazeMeterUploader() obj.settings['token'] = '<PASSWORD>' obj.settings['browser-open'] = 'none' obj.settings['public-report'] = True obj.settings['send-monitoring'] = False obj.engine = EngineEmul() mock.apply(obj._user) self.sniff_log(obj.log) obj.prepare() obj.startup() obj.aggregated_second(random_datapoint(10)) obj.check() obj.shutdown() obj.post_process() log_buff = self.log_recorder.info_buff.getvalue() log_line = "Public report link: https://a.blazemeter.com/app/?public-token=publicToken#/masters/master1/summary" self.assertIn(log_line, log_buff) logging.warning("\n".join([x['url'] for x in mock.requests])) self.assertEqual(14, len(mock.requests)) def test_new_project_existing_test(self): obj = BlazeMeterUploader() mock = BZMock(obj._user) mock.mock_get.update({ 'https://a.blazemeter.com/api/v4/tests?workspaceId=1&name=Taurus+Test': {'result': [ {'id': 1, 'name': '<NAME>', 'configuration': {"type": 'external'}} ]}, 'https://a.blazemeter.com/api/v4/tests?projectId=1&name=Taurus+Test': {'result': []} }) mock.mock_post.update({ 'https://a.blazemeter.com/api/v4/projects': {"result": {"id": 1}}, 'https://a.blazemeter.com/api/v4/tests': {"result": {"id": 1}}, }) obj.parameters['project'] = 'Proj name' obj.settings['token'] = '<PASSWORD>' obj.settings['browser-open'] = 'none' obj.engine = EngineEmul() obj.prepare() self.assertEquals('https://a.blazemeter.com/api/v4/projects', mock.requests[4]['url']) self.assertEquals('POST', mock.requests[4]['method']) self.assertEquals('https://a.blazemeter.com/api/v4/tests', mock.requests[6]['url']) self.assertEquals('POST', mock.requests[6]['method']) def test_new_project_new_test(self): obj = BlazeMeterUploader() mock = BZMock(obj._user) mock.mock_get.update({ 'https://a.blazemeter.com/api/v4/tests?workspaceId=1&name=Taurus+Test': {'result': []}, 'https://a.blazemeter.com/api/v4/projects?workspaceId=1': {'result': []} }) mock.mock_post.update({ 'https://a.blazemeter.com/api/v4/projects': {"result": {"id": 1}}, 'https://a.blazemeter.com/api/v4/tests': {"result": {"id": 1}}, }) obj.settings['token'] = '<PASSWORD>' obj.settings['browser-open'] = 'none' obj.engine = EngineEmul() obj.prepare() self.assertEquals('https://a.blazemeter.com/api/v4/projects', mock.requests[6]['url']) self.assertEquals('POST', mock.requests[6]['method']) self.assertEquals('https://a.blazemeter.com/api/v4/tests', mock.requests[7]['url']) self.assertEquals('POST', mock.requests[7]['method']) def test_existing_project_new_test(self): obj = BlazeMeterUploader() mock = BZMock(obj._user) mock.mock_get.update({ 'https://a.blazemeter.com/api/v4/tests?projectId=1&name=Taurus+Test': {'result': []}, 'https://a.blazemeter.com/api/v4/projects?workspaceId=1': {'result': [ {'id': 1, 'name': 'Proj name'} ]} }) mock.mock_post.update({ 'https://a.blazemeter.com/api/v4/projects': {"result": {"id": 1}}, 'https://a.blazemeter.com/api/v4/tests': {"result": {"id": 1}}, }) obj.parameters['project'] = 'Proj name' obj.settings['token'] = '<PASSWORD>' obj.settings['browser-open'] = 'none' obj.engine = EngineEmul() obj.prepare() self.assertEquals('https://a.blazemeter.com/api/v4/tests', mock.requests[6]['url']) self.assertEquals('POST', mock.requests[6]['method']) class TestBlazeMeterClientUnicode(BZTestCase): def test_unicode_request(self): """ test UnicodeDecodeError in BlazeMeterClient._request() """ session = Session(data={'id': 1}) mock = BZMock(session) mock.mock_post['https://data.blazemeter.com/api/v4/image/1/files?signature=None'] = {"result": 1} session.upload_file(RESOURCES_DIR + "jmeter/unicode_file") def test_binary_unicode_error(self): session = Session(data={'id': 1}) mock = BZMock(session) mock.mock_post['https://data.blazemeter.com/api/v4/image/1/files?signature=None'] = {"result": 1} with open(RESOURCES_DIR + "jmeter/jmeter-dist-2.13.zip", 'rb') as fds: zip_content = fds.read() session.upload_file("jtls_and_more.zip", zip_content) class DummyHttpResponse(object): def __init__(self): self.fake_socket = BytesIO() self.fake_socket.write(open(RESOURCES_DIR + "unicode_file", 'rb').read()) def read(self): self.fake_socket.seek(0) return self.fake_socket.read(1024) def dummy_urlopen(*args, **kwargs): del args, kwargs return DummyHttpResponse() class TestResultsFromBZA(BZTestCase): @staticmethod def convert_kpi_errors(errors): result = {} for error in errors: result[error['msg']] = {'count': error['cnt'], 'rc': error['rc']} return result @staticmethod def get_errors_mock(errors, assertions=None): # return mock of server response for errors specified in internal format (see __get_errors_from_BZA()) result = [] if not assertions: assertions = {} for _id in list(set(list(errors.keys()) + list(assertions.keys()))): # unique keys from both dictionaries errors_list = [] if errors.get(_id): for msg in errors[_id]: errors_list.append({ "m": msg, "count": errors[_id][msg]["count"], "rc": errors[_id][msg]["rc"]}) assertions_list = [] if assertions.get(_id): for msg in assertions[_id]: assertions_list.append({ "failureMessage": msg, "failures": assertions[_id][msg]["count"], "name": "All Assertions"}) result.append({ "_id": _id, "name": _id, "assertions": assertions_list, "samplesNotCounted": 0, "assertionsNotCounted": 0, "otherErrorsCount": 0, "errors": errors_list}) return { "https://a.blazemeter.com/api/v4/masters/1/reports/errorsreport/data?noDataError=false": { "api_version": 4, "error": None, "result": result}} def test_get_errors(self): mock = BZMock() mock.mock_get.update({ 'https://a.blazemeter.com/api/v4/data/labels?master_id=1': { "api_version": 4, "error": None, "result": [{ "sessions": ["r-t-5746a8e38569a"], "id": "ALL", "name": "ALL" }, { "sessions": ["r-t-5746a8e38569a"], "id": "e843ff89a5737891a10251cbb0db08e5", "name": "http://blazedemo.com/"}]}, 'https://a.blazemeter.com/api/v4/data/kpis?interval=1&from=0&master_ids%5B%5D=1&kpis%5B%5D=t&kpis%5B%5D=lt&kpis%5B%5D=by&kpis%5B%5D=n&kpis%5B%5D=ec&kpis%5B%5D=ts&kpis%5B%5D=na&labels%5B%5D=ALL&labels%5B%5D=e843ff89a5737891a10251cbb0db08e5': { "api_version": 4, "error": None, "result": [{ "labelId": "ALL", "labelName": "ALL", "label": "ALL", "kpis": [{ "n": 1, "na": 1, "ec": 0, "p90": 0, "t_avg": 817, "lt_avg": 82, "by_avg": 0, "n_avg": 1, "ec_avg": 0, "ts": 1464248743 }, {"n": 1, "na":
<reponame>alsyz/genieparser<filename>src/genie/libs/parser/iosxe/tests/test_show_bgp.py # Python import unittest from unittest.mock import Mock # ATS from pyats.topology import Device from pyats.topology import loader # Metaparser from genie.metaparser.util.exceptions import SchemaEmptyParserError, \ SchemaMissingKeyError # iosxe show_bgp from genie.libs.parser.iosxe.show_bgp import ShowIpBgpSummary,\ ShowIpBgpAllSummary,\ ShowIpBgpNeighborsAdvertisedRoutes,\ ShowBgpSummary # ============================== # Unit test for # * 'show ip bgp all summary' # ============================== class TestShowIpBgpAllSummary(unittest.TestCase): device = Device(name='aDevice') empty_output = {'execute.return_value': ''} golden_parsed_output1 = { 'bgp_id': 5918, 'vrf': {'default': {'neighbor': {'192.168.10.253': {'address_family': {'vpnv4 unicast': {'activity_paths': '5564772/1540171', 'activity_prefixes': '2722567/700066', 'as': 60103, 'attribute_entries': '5098/4898', 'bgp_table_version': 9370482, 'cache_entries': {'filter-list': {'memory_usage': 0, 'total_entries': 0}, 'route-map': {'memory_usage': 0, 'total_entries': 0}}, 'community_entries': {'memory_usage': 60056, 'total_entries': 2301}, 'entries': {'AS-PATH': {'memory_usage': 4824, 'total_entries': 201}, 'rrinfo': {'memory_usage': 20080, 'total_entries': 502}}, 'input_queue': 0, 'local_as': 5918, 'msg_rcvd': 0, 'msg_sent': 0, 'output_queue': 0, 'path': {'memory_usage': 482879760, 'total_entries': 4023998}, 'prefixes': {'memory_usage': 517657344, 'total_entries': 2022099}, 'route_identifier': '10.169.197.254', 'routing_table_version': 9370482, 'scan_interval': 60, 'state_pfxrcd': 'Idle', 'tbl_ver': 1, 'total_memory': 1001967936, 'up_down': 'never', 'version': 4}}}}}}} golden_output1 = {'execute.return_value': ''' Router#show ip bgp all summary Load for five secs: 2%/0%; one minute: 10%; five minutes: 9% Time source is NTP, 20:34:39.724 EST Wed Jun 2 2016 For address family: VPNv4 Unicast BGP router identifier 10.169.197.254, local AS number 5918 BGP table version is 9370482, main routing table version 9370482 2022099 network entries using 517657344 bytes of memory 4023998 path entries using 482879760 bytes of memory 5098/4898 BGP path/bestpath attribute entries using 1345872 bytes of memory 502 BGP rrinfo entries using 20080 bytes of memory 201 BGP AS-PATH entries using 4824 bytes of memory 2301 BGP extended community entries using 60056 bytes of memory 0 BGP route-map cache entries using 0 bytes of memory 0 BGP filter-list cache entries using 0 bytes of memory BGP using 1001967936 total bytes of memory BGP activity 2722567/700066 prefixes, 5564772/1540171 paths, scan interval 60 secs Neighbor V AS MsgRcvd MsgSent TblVer InQ OutQ Up/Down State/PfxRcd 192.168.10.253 4 65555 299 332 9370482 0 0 02:27:39 100 192.168.10.253 4 60001 299 333 9370482 0 0 02:27:46 100 192.168.10.253 4 60002 299 333 9370482 0 0 02:27:45 100 192.168.10.253 4 60003 299 331 9370482 0 0 02:27:40 100 192.168.10.253 4 60004 299 334 9370482 0 0 02:27:39 100 192.168.10.253 4 60005 299 334 9370482 0 0 02:27:41 100 192.168.10.253 4 60006 299 333 9370482 0 0 02:27:43 100 192.168.10.253 4 60007 299 332 9370482 0 0 02:27:41 100 192.168.10.253 4 60100 0 0 1 0 0 never Idle 192.168.10.253 4 60101 0 0 1 0 0 never Idle 192.168.10.253 4 60102 0 0 1 0 0 never Idle 192.168.10.253 4 60103 0 0 1 0 0 never Idle '''} golden_parsed_output2 = { "bgp_id": 65109, "vrf": { "VRF1": { "neighbor": { "192.168.10.253": { "address_family": { "vpnv4": { "version": 4, "as": 65555, "msg_rcvd": 10112, "msg_sent": 10107, "tbl_ver": 263, "input_queue": 0, "output_queue": 0, "up_down": "3d05h", "state_pfxrcd": "13", "route_identifier": "10.169.197.254", "local_as": 65109, "bgp_table_version": 263, "routing_table_version": 263, "attribute_entries": "106/104", "prefixes": { "total_entries": 126, "memory_usage": 32256 }, "path": { "total_entries": 189, "memory_usage": 25704 }, "total_memory": 92688, "activity_prefixes": "226/0", "activity_paths": "4035/3696", "scan_interval": 60, "cache_entries": { "route-map": { "total_entries": 0, "memory_usage": 0 }, "filter-list": { "total_entries": 0, "memory_usage": 0 } }, "entries": { "rrinfo": { "total_entries": 1, "memory_usage": 40 }, "AS-PATH": { "total_entries": 2, "memory_usage": 64 } }, "community_entries": { "total_entries": 102, "memory_usage": 3248 } } } } } }, "default": { "neighbor": { "192.168.10.253": { "address_family": { "vpnv4": { "version": 4, "as": 65555, "msg_rcvd": 0, "msg_sent": 0, "tbl_ver": 1, "input_queue": 0, "output_queue": 0, "up_down": "never", "state_pfxrcd": "Idle", "route_identifier": "10.169.197.254", "local_as": 65109, "bgp_table_version": 263, "routing_table_version": 263, "attribute_entries": "106/104", "prefixes": { "total_entries": 126, "memory_usage": 32256 }, "path": { "total_entries": 189, "memory_usage": 25704 }, "total_memory": 92688, "activity_prefixes": "226/0", "activity_paths": "4035/3696", "scan_interval": 60, "cache_entries": { "route-map": { "total_entries": 0, "memory_usage": 0 }, "filter-list": { "total_entries": 0, "memory_usage": 0 } }, "entries": { "rrinfo": { "total_entries": 1, "memory_usage": 40 }, "AS-PATH": { "total_entries": 2, "memory_usage": 64 } }, "community_entries": { "total_entries": 102, "memory_usage": 3248 } } } }, "192.168.36.119": { "address_family": { "vpnv4": { "version": 4, "as": 65109, "msg_rcvd": 10293, "msg_sent": 10213, "tbl_ver": 263, "input_queue": 0, "output_queue": 0, "up_down": "3d05h", "state_pfxrcd": "62", "route_identifier": "10.169.197.254", "local_as": 65109, "bgp_table_version": 263, "routing_table_version": 263, "attribute_entries": "106/104", "prefixes": { "total_entries": 126, "memory_usage": 32256 }, "path": { "total_entries": 189, "memory_usage": 25704 }, "total_memory": 92688, "activity_prefixes": "226/0", "activity_paths": "4035/3696", "scan_interval": 60, "cache_entries": { "route-map": { "total_entries": 0, "memory_usage": 0 }, "filter-list": { "total_entries": 0, "memory_usage": 0 } }, "entries": { "rrinfo": { "total_entries": 1, "memory_usage": 40 }, "AS-PATH": { "total_entries": 2, "memory_usage": 64 } }, "community_entries": { "total_entries": 102, "memory_usage": 3248 } } } }, "192.168.36.120": { "address_family": { "vpnv4": { "version": 4, "as": 65109, "msg_rcvd": 9930, "msg_sent": 9826, "tbl_ver": 263, "input_queue": 0, "output_queue": 0, "up_down": "3d02h", "state_pfxrcd": "62", "route_identifier": "10.169.197.254", "local_as": 65109, "bgp_table_version": 263, "routing_table_version": 263, "attribute_entries": "106/104", "prefixes": { "total_entries": 126, "memory_usage": 32256 }, "path": { "total_entries": 189, "memory_usage": 25704 }, "total_memory": 92688, "activity_prefixes": "226/0", "activity_paths": "4035/3696", "scan_interval": 60, "cache_entries": { "route-map": { "total_entries": 0, "memory_usage": 0 }, "filter-list": { "total_entries": 0, "memory_usage": 0 } }, "entries": { "rrinfo": { "total_entries": 1, "memory_usage": 40 }, "AS-PATH": { "total_entries": 2, "memory_usage": 64 } }, "community_entries": { "total_entries": 102, "memory_usage": 3248 } } } } } } } } def test_show_ip_bgp_all_summary_empty(self): self.device1 = Mock(**self.empty_output) bgp_summary_obj = ShowIpBgpAllSummary(device=self.device1) with self.assertRaises(SchemaEmptyParserError): parsed_output = bgp_summary_obj.parse() def test_show_ip_bgp_all_summary_golden1(self): self.maxDiff = None self.device = Mock(**self.golden_output1) obj = ShowIpBgpAllSummary(device=self.device) parsed_output = obj.parse() self.assertEqual(parsed_output, self.golden_parsed_output1) def test_show_ip_bgp_all_summary_golden2(self): def mapper(key): return self.outputs[key] raw1 = '''\ address-family ipv4 vrf VRF1 bgp router-id 192.168.10.254 redistribute connected redistribute static neighbor 192.168.10.253 remote-as 65555 neighbor 192.168.10.253 timers 30 90 15 neighbor 192.168.10.253 activate neighbor 192.168.10.253 as-override neighbor 192.168.10.253 route-map prepend in ''' golden_output2 = '''\ PE1#show ip bgp vpnv4 all summary Load for five secs: 1%/0%; one minute: 1%; five minutes: 1% Time source is NTP, 05:46:49.882 EST Tue May 28 2019 BGP router identifier 10.169.197.254, local AS number 65109 BGP table version is 263, main routing table version 263 126 network entries using 32256 bytes of memory 189 path entries using 25704 bytes of memory 106/104 BGP path/bestpath attribute entries using 31376 bytes of memory 1 BGP rrinfo entries using 40 bytes of memory 2 BGP AS-PATH entries using 64 bytes of memory 102 BGP extended community entries using 3248 bytes of memory 0 BGP route-map cache entries using 0 bytes of memory 0 BGP filter-list cache entries using 0 bytes of memory BGP using 92688 total bytes of memory BGP activity 226/0 prefixes, 4035/3696 paths, scan interval 60 secs Neighbor V AS MsgRcvd MsgSent TblVer InQ OutQ Up/Down State/PfxRcd 192.168.10.253 4 65555 10112 10107 263 0 0 3d05h 13 192.168.10.253 4 65555 0 0 1 0 0 never Idle 192.168.36.119 4 65109 10293 10213 263 0 0 3d05h 62 192.168.36.120 4 65109 9930 9826 263 0 0 3d02h 62 ''' self.outputs = {} self.maxDiff = None self.outputs['show ip bgp vpnv4 all summary'] = golden_output2 self.outputs['show run | sec address-family ipv4 vrf'] = raw1 self.outputs['show run | sec address-family ipv6 vrf'] = '' self.device.execute = Mock() self.device.execute.side_effect = mapper obj = ShowIpBgpAllSummary(device=self.device) parsed_output = obj.parse(address_family='vpnv4') self.assertEqual(parsed_output, self.golden_parsed_output2) def test_show_ip_bgp_all_summary_golden3(self): def mapper(key): return self.outputs[key] raw1 = ''' [2019-06-05 09:46:16,345] +++ R1_xe: executing command 'show ip bgp all summary' +++ show ip bgp all summary For address family: IPv4 Unicast BGP router identifier 10.4.1.1, local AS number 65000 BGP table version is 4, main routing table version 4 3 network entries using 744 bytes of memory 3 path entries using 408 bytes of memory 3/3 BGP path/bestpath attribute entries using 840 bytes of memory 2 BGP extended community entries using 500 bytes of memory 0 BGP route-map cache entries using 0 bytes of memory 0 BGP filter-list cache entries using 0 bytes of memory BGP using 2492 total bytes of memory BGP activity 12/0 prefixes, 12/0 paths, scan interval 60 secs Neighbor V AS MsgRcvd MsgSent
<reponame>Wouter-Bekker-AI/yolov5-dataset-builder<filename>scripts/Helper.py import cv2 as cv import shutil import numpy as np import os import pandas as pd from tqdm import tqdm import random import time import matplotlib.pyplot as plt import seaborn as sns from scipy.stats import skewnorm from PIL import Image, ExifTags import torch from pathlib import Path def read_label(label_path): with open(label_path) as l: content = l.readlines() return content def rescale_frame(frame, x=640, y=640): dimensions = (x, y) return cv.resize(frame, dimensions, interpolation=cv.INTER_AREA) def draw_box(image, label_filepath, normalized=True): lines = read_label(label_filepath) new = [] for line in lines: new.append(line.split(' ')) # .shape[0] = Height # .shape[1] = Width # .shape[2] = Colour Channels for line in new: if len(line) == 6: conf = float(line[5]) conf = (round(conf * 100)) / 100 else: conf = 0 if normalized: x = float(line[1]) * image.shape[1] y = float(line[2]) * image.shape[0] w = float(line[3]) * image.shape[1] h = float(line[4]) * image.shape[0] else: x = float(line[1]) y = float(line[2]) w = float(line[3]) h = float(line[4]) x1 = round(x - (w / 2)) y1 = round(y - (h / 2)) x2 = round(x + (w / 2)) y2 = round(y + (h / 2)) # b g r cv.rectangle(image, (x1, y1), (x2, y2), (0, 255, 0), thickness=2) font = cv.FONT_HERSHEY_SIMPLEX if conf == 0: image = cv.putText(image, line[0], (x1, y1), font, 0.75, (0, 0, 255), thickness=2) else: # add conf to label if available image = cv.putText(image, f"{line[0]} {conf}", (x1, y1), font, 0.75, (0, 0, 255), thickness=2) return image def empty_folder(folder): for file in tqdm(os.listdir(folder), desc=f"Emptying {folder}..."): path = f"{folder}{file}" try: shutil.rmtree(path) except OSError: os.remove(path) def integrity_check(images_folder, labels_folder): for filename in tqdm(os.listdir(images_folder), desc='Converting all images to .jpg'): filepath = images_folder + filename base_name = os.path.splitext(os.path.basename(filepath))[0] extension = os.path.splitext(os.path.basename(filepath))[1] if extension != '.jpg': img = cv.imread(filepath) os.remove(filepath) cv.imwrite(f"{images_folder}{base_name}.jpg", img, [int(cv.IMWRITE_JPEG_QUALITY), 100]) print('\nChecking if there is a label for every image') # Check if there is a label for every image for filename in tqdm(os.listdir(images_folder)): base_name = os.path.splitext(os.path.basename(filename))[0] image_filepath = f"{images_folder}{filename}" label_filepath = f"{labels_folder}{base_name}.txt" try: with open(label_filepath) as f: lines = f.readlines() if len(lines) < 1: # empty file print( f"\nFile -{labels_folder}{base_name}.txt- is empty." f" Deleting this file and image at {image_filepath}") os.remove(image_filepath) os.remove(label_filepath) if len(np.unique(lines)) < len(lines): # duplicate rows todo NEED SOME FIXING LOOK AT 010000096.txt print( f"\nFile -{label_filepath}- has duplicate lines." f" Deleting this file and image at {image_filepath}") os.remove(image_filepath) os.remove(label_filepath) except Exception as e: print(f"\nFile -{label_filepath}- not found. Deleting image at {image_filepath}. Exception is {e}") os.remove(image_filepath) print('\nChecking if there is a image for every label') # Check if there is a image for every label for filename in tqdm(os.listdir(labels_folder)): base_name = os.path.splitext(os.path.basename(filename))[0] image_filepath = f"{images_folder}{base_name}.jpg" label_filepath = f"{labels_folder}{filename}" if not os.path.isfile(image_filepath): print(f"\nImage at -{image_filepath}- not found. Deleting label at -{label_filepath}") os.remove(label_filepath) print('\nChecking label format') for filename in tqdm(os.listdir(labels_folder)): # remove space at the end of a line base_name = os.path.splitext(os.path.basename(filename))[0] filepath = f"{labels_folder}{filename}" with open(filepath, 'r+') as f: lines = f.readlines() new_lines = [] i = 1 error_found = 0 for line in lines: if line.endswith(" \n"): error_found = 1 if i == len(lines): line = line.replace(' \n', '') else: line = line.replace(' \n', '\n') print(f"\nFound a double space in {filename} and fixed it") new_lines.append(line) else: new_lines.append(line) if error_found == 1: os.remove(filepath) with open(filepath, 'a+') as g: # write the correct file for line in new_lines: g.write(line) for test_line in new_lines: # check if the label is correct and if not then delete image and label test_line = test_line.split(' ') for item in test_line: try: if float(item) > 1: print(f"\nError in {filepath}") print(f"\nLine is {test_line}") print(f"\nDeleted both the label file and image file") os.remove(filepath) os.remove(f"{images_folder}{base_name}.jpg") except Exception as e: print(f"\nCan't fix {filepath} the item is {item} and test_line is {test_line}." f" Exception is {e}") os.remove(filepath) os.remove(f"{images_folder}{base_name}.jpeg") def label_images(images_folder, labels_folder, labeled_images_folder): empty_folder(labeled_images_folder) for filename in tqdm(os.listdir(images_folder), desc='Labeling Images...'): base_name = os.path.splitext(os.path.basename(filename))[0] image_filepath = f"{images_folder}{filename}" label_filepath = f"{labels_folder}{base_name}.txt" if os.path.isfile(label_filepath): img = cv.imread(image_filepath) img = draw_box(img, label_filepath) basedir = os.getcwd() os.chdir(labeled_images_folder) cv.imwrite(base_name + '.jpg', img, [int(cv.IMWRITE_JPEG_QUALITY), 100]) os.chdir(basedir) def rename(images_folder, labels_folder, name): i = 0 for filename in os.listdir(images_folder): filepath = images_folder + filename base_name = os.path.splitext(os.path.basename(filepath))[0] extension = os.path.splitext(os.path.basename(filepath))[1] basedir = os.getcwd() # rename both the image and label os.chdir(images_folder) os.rename(filename, f"{name}_{i}{extension}") os.chdir(basedir) os.chdir(labels_folder) os.rename(f"{base_name}.txt", f"{name}_{i}.txt") os.chdir(basedir) i += 1 def check_resolution(folder, w_threshold=320, h_threshold=180, less_more='less', show=False, rescale_save=False, delete=False): # or_and = 'or' todo implement or_and t0 = time.time() count = 0 found = False print(f"\nChecking image resolution...") for image in tqdm(os.listdir(folder)): # base_name = os.path.splitext(os.path.basename(image))[0] image_filepath = f"{folder}{image}" # label_filepath = f"More weapons/Labels/{base_name}.txt" img = cv.imread(image_filepath) w_scale = img.shape[1] h_scale = img.shape[0] if less_more == 'less': if img.shape[1] < w_threshold or img.shape[0] < h_threshold: found = True if img.shape[1] < w_threshold: w_scale = w_threshold else: w_scale = img.shape[1] if img.shape[0] < h_threshold: h_scale = h_threshold else: h_scale = img.shape[0] else: if img.shape[1] > w_threshold or img.shape[0] > h_threshold: found = True if img.shape[1] > w_threshold: w_scale = w_threshold else: w_scale = img.shape[1] if img.shape[0] > h_threshold: h_scale = h_threshold else: h_scale = img.shape[0] if found: count += 1 found = False if show: cv.imshow(f"{image} has Width: {img.shape[1]} Height: {img.shape[0]}", img) cv.waitKey(0) cv.destroyAllWindows() # if count == 10: # break if rescale_save: img = rescale_frame(img, w_scale, h_scale) cv.imwrite(image_filepath, img, [int(cv.IMWRITE_JPEG_QUALITY), 100]) if delete: os.remove(image_filepath) t1 = time.time() print(f"Found {count} images in {t1 - t0} sec.") def plot_distribution(target_folder): dist = [] for label in tqdm(os.listdir(target_folder)): label_filepath = f"{target_folder}{label}" lines = read_label(label_filepath) split = [] for line in lines: split.append(line.split(' ')) for part in split: dist.append(part[5]) sns.set_style('white') dist = np.array(dist) dist = dist.astype(np.float) print(len(dist)) count, bins_count = np.histogram(dist, bins=10) # finding the PDF of the histogram using count values pdf = count / sum(count) # using numpy np.cumsum to calculate the CDF # We can also find using the PDF values by looping and adding cdf = np.cumsum(pdf) # plotting PDF and CDF plt.plot(bins_count[1:] * 100 - 8, pdf / 10, color="red", label="PDF") plt.plot(bins_count[1:] * 100 - 8, cdf / 10, label="CDF") plt.legend() dist = dist * 100 sns.distplot(dist, kde_kws={"color": "lime"}, fit=skewnorm, bins=90) xt = [] for i in range(0, 102, 2): xt.append(i) plt.xticks(xt) plt.ylim(0, 0.02) plt.xlim(30, 70) for xc in range(101): plt.axvline(x=xc, color='black', alpha=0.1) plt.xlabel('% Certainty') plt.show() def video_to_frames(video_path = f"data/videos/Hunting Trespasser gets Painted.mp4", video_labels = f"data/videos/video_labels/", video_frames = f"data/videos/video_frames/", labeled_video_frames = f"More weapons/videos/labeled_video_frames/", show = False, check = True, label = True): empty_folder(video_frames) frame_n = 1 cap = cv.VideoCapture(video_path) max_frames = int(cap.get(cv.CAP_PROP_FRAME_COUNT)) while cap.isOpened(): print(f"Processing frame {frame_n}/{max_frames}") ret, frame = cap.read() # if frame is read correctly ret is True if not ret: print("Can't receive frame (stream end?). Exiting ...") break frame = cv.cvtColor(frame, cv.COLOR_BGR2GRAY) basedir = os.getcwd() os.chdir(video_frames) cv.imwrite(f"{str(frame_n)}.jpg", frame, [int(cv.IMWRITE_JPEG_QUALITY), 100]) os.chdir(basedir) if show: font = cv.FONT_HERSHEY_SIMPLEX frame = cv.putText(frame, f"{str(frame_n)}/{max_frames}", (5, 25), font, 1, (0, 0, 255), thickness=2) cv.imshow('frame', frame) if cv.waitKey(1) == ord('q'): break frame_n += 1 cap.release() cv.destroyAllWindows() if check: integrity_check(video_frames, video_labels) if label: label_images(video_frames, video_labels, labeled_video_frames) def check_bbox_size(images_folder=f"data/Images/", labels_folder=f"data/Labels/", show=False, less_more='less', w_ratio=0.0, h_ratio=0.0): print('\nScanning') i = 0 for filename in tqdm(os.listdir(images_folder)): base_name = os.path.splitext(os.path.basename(filename))[0] image_filepath = f"{images_folder}{filename}" label_filepath = f"{labels_folder}{base_name}.txt" found = 0 lines = read_label(label_filepath) new = [] for line in lines: new.append(line.split(' ')) # line[3] = Width # line[4] = Height for line in new: if w_ratio != 0: if less_more == 'less': if float(line[3]) < w_ratio: # and float(line[4]) < size: found = True else: if float(line[3]) > w_ratio: # and float(line[4]) < size: found = True if h_ratio != 0: if less_more == 'less': if float(line[4]) < h_ratio: # and float(line[4]) < size: found = True else: if float(line[4]) > h_ratio: # and float(line[4]) < size: found = True if found: i += 1 if show: img = cv.imread(image_filepath) img = draw_box(img, label_filepath) cv.imshow('1', img) cv.waitKey(0) if less_more == 'less': print(f"found a total of {i} files with x < {w_ratio} and y < {h_ratio}") else: print(f"found a total of {i} files with x > {w_ratio} and y > {h_ratio}") for orientation in ExifTags.TAGS.keys(): if ExifTags.TAGS[orientation] == 'Orientation': break def exif_size(img): # Returns exif-corrected PIL
def forward(self, input_token, target_token, timestep, *inputs): """ Decoder step inputs correspond one-to-one to encoder outputs. """ log_probs_per_model = [] state_outputs = [] next_state_input = len(self.models) # underlying assumption is each model has same vocab_reduction_module vocab_reduction_module = self.models[0].decoder.vocab_reduction_module if vocab_reduction_module is not None: possible_translation_tokens = inputs[len(self.models)] next_state_input += 1 else: possible_translation_tokens = None for i, model in enumerate(self.models): encoder_output = inputs[i] prev_hiddens = [] prev_cells = [] for _ in range(len(model.decoder.layers)): prev_hiddens.append(inputs[next_state_input]) prev_cells.append(inputs[next_state_input + 1]) next_state_input += 2 prev_input_feed = inputs[next_state_input].view(1, -1) next_state_input += 1 if ( self.enable_precompute_reduced_weights and hasattr(model.decoder, "_precompute_reduced_weights") and possible_translation_tokens is not None ): # (output_projection_w, output_projection_b) reduced_output_weights = inputs[next_state_input : next_state_input + 2] next_state_input += 2 else: reduced_output_weights = None # no batching, we only care about care about "max" length src_length_int = int(encoder_output.size()[0]) src_length = torch.LongTensor(np.array([src_length_int])) # notional, not actually used for decoder computation src_tokens = torch.LongTensor(np.array([[0] * src_length_int])) src_embeddings = encoder_output.new_zeros(encoder_output.shape) encoder_out = ( encoder_output, prev_hiddens, prev_cells, src_length, src_tokens, src_embeddings, ) # store cached states, use evaluation mode model.decoder._is_incremental_eval = True model.eval() # placeholder incremental_state = {} # cache previous state inputs utils.set_incremental_state( model.decoder, incremental_state, "cached_state", (prev_hiddens, prev_cells, prev_input_feed), ) decoder_output = model.decoder( input_token.view(1, 1), encoder_out, incremental_state=incremental_state, possible_translation_tokens=possible_translation_tokens, ) logits, _, _ = decoder_output log_probs = F.log_softmax(logits, dim=2) log_probs_per_model.append(log_probs) (next_hiddens, next_cells, next_input_feed) = utils.get_incremental_state( model.decoder, incremental_state, "cached_state" ) for h, c in zip(next_hiddens, next_cells): state_outputs.extend([h, c]) state_outputs.append(next_input_feed) if reduced_output_weights is not None: state_outputs.extend(reduced_output_weights) average_log_probs = torch.mean( torch.cat(log_probs_per_model, dim=0), dim=0, keepdim=True ) if possible_translation_tokens is not None: reduced_indices = torch.zeros(self.vocab_size).long().fill_(self.unk_token) # ONNX-exportable arange (ATen op) possible_translation_token_range = torch._dim_arange( like=possible_translation_tokens, dim=0 ) reduced_indices[ possible_translation_tokens ] = possible_translation_token_range reduced_index = reduced_indices.index_select(dim=0, index=target_token) score = average_log_probs.view((-1,)).index_select( dim=0, index=reduced_index ) else: score = average_log_probs.view((-1,)).index_select( dim=0, index=target_token ) word_reward = self.word_rewards.index_select(0, target_token) score += word_reward self.input_names = ["prev_token", "target_token", "timestep"] for i in range(len(self.models)): self.input_names.append(f"fixed_input_{i}") if possible_translation_tokens is not None: self.input_names.append("possible_translation_tokens") outputs = [score] self.output_names = ["score"] for i in range(len(self.models)): self.output_names.append(f"fixed_input_{i}") outputs.append(inputs[i]) if possible_translation_tokens is not None: self.output_names.append("possible_translation_tokens") outputs.append(possible_translation_tokens) for i, state in enumerate(state_outputs): outputs.append(state) self.output_names.append(f"state_output_{i}") self.input_names.append(f"state_input_{i}") return tuple(outputs) class CharSourceEncoderEnsemble(nn.Module): def __init__(self, models, src_dict=None): super().__init__() self.models = models self.src_dict = src_dict for i, model in enumerate(self.models): model.prepare_for_onnx_export_() self._modules[f"model_{i}"] = model self.enable_precompute_reduced_weights = False def forward(self, src_tokens, src_lengths, char_inds, word_lengths): outputs = [] output_names = [] states = [] # (seq_length, batch_size) for compatibility with Caffe2 src_tokens_seq_first = src_tokens.t() futures = [] for model in self.models: # evaluation mode model.eval() futures.append( torch.jit._fork( model.encoder, src_tokens_seq_first, src_lengths, char_inds, word_lengths, ) ) # underlying assumption is each model has same vocab_reduction_module vocab_reduction_module = self.models[0].decoder.vocab_reduction_module possible_translation_tokens = None if vocab_reduction_module is not None: possible_translation_tokens = vocab_reduction_module( src_tokens=src_tokens, decoder_input_tokens=None ) # Precompute reduced decoder weight matrices. # Once we have possible_translation_tokens, we need to gather rows # out of each output_projection_{w,b} tensor for the decoders to # use. We do it here because these reduced matrices are used on each # step of the beam search, and this turns out to be a relatively # expensive operation. reduced_weights = {} for i, model in enumerate(self.models): if ( self.enable_precompute_reduced_weights and hasattr(model.decoder, "_precompute_reduced_weights") and possible_translation_tokens is not None ): reduced_weights[i] = torch.jit._fork( model.decoder._precompute_reduced_weights, possible_translation_tokens, ) # XXX: This loop is where we wait() for each encoder's output to be # ready. If you're trying to add more ops, they should probably not # go in this loop! for i, (model, future) in enumerate(zip(self.models, futures)): encoder_out = torch.jit._wait(future) # "primary" encoder output (vector representations per source token) encoder_outputs = encoder_out[0] outputs.append(encoder_outputs) output_names.append(f"encoder_output_{i}") if hasattr(model.decoder, "_init_prev_states"): states.extend(model.decoder._init_prev_states(encoder_out)) if ( self.enable_precompute_reduced_weights and hasattr(model.decoder, "_precompute_reduced_weights") and possible_translation_tokens is not None ): states.extend(torch.jit._wait(reduced_weights[i])) if possible_translation_tokens is not None: outputs.append(possible_translation_tokens) output_names.append("possible_translation_tokens") for i, state in enumerate(states): outputs.append(state) output_names.append(f"initial_state_{i}") self.output_names = output_names return tuple(outputs) @classmethod def build_from_checkpoints( cls, checkpoint_filenames, src_dict_filename, dst_dict_filename, lexical_dict_paths=None, ): models, src_dict, _ = load_models_from_checkpoints( checkpoint_filenames, src_dict_filename, dst_dict_filename, lexical_dict_paths, ) return cls(models, src_dict=src_dict) class BeamSearchAndDecode(torch.jit.ScriptModule): """ Combines the functionality of BeamSearch and BeamDecode """ def __init__( self, models, tgt_dict, src_tokens, src_lengths, eos_token_id, length_penalty, nbest, beam_size, stop_at_eos, word_reward=0, unk_reward=0, quantize=False, ): super().__init__() self.beam_search = BeamSearch( models, tgt_dict, src_tokens, src_lengths, beam_size, word_reward, unk_reward, quantize, ) self.beam_decode = BeamDecode( eos_token_id, length_penalty, nbest, beam_size, stop_at_eos ) self.input_names = [ "src_tokens", "src_lengths", "prev_token", "prev_scores", "attn_weights", "prev_hypos_indices", "num_steps", ] self.output_names = [ "beam_output", "hypothesis_score", "token_level_scores", "back_alignment_weights", "best_indices", ] @torch.jit.script_method def forward( self, src_tokens: torch.Tensor, src_lengths: torch.Tensor, prev_token: torch.Tensor, prev_scores: torch.Tensor, attn_weights: torch.Tensor, prev_hypos_indices: torch.Tensor, num_steps: int, ) -> List[Tuple[Tensor, float, List[float], Tensor, Tensor]]: beam_search_out = self.beam_search( src_tokens, src_lengths, prev_token, prev_scores, attn_weights, prev_hypos_indices, num_steps, ) all_tokens, all_scores, all_weights, all_prev_indices = beam_search_out outputs = torch.jit.annotate( List[Tuple[Tensor, float, List[float], Tensor, Tensor]], [] ) outputs = self.beam_decode( all_tokens, all_scores, all_weights, all_prev_indices, num_steps ) return outputs @classmethod def build_from_checkpoints( cls, checkpoint_filenames, src_dict_filename, dst_dict_filename, beam_size, length_penalty, nbest, word_reward=0, unk_reward=0, lexical_dict_paths=None, ): length = 10 models, _, tgt_dict = load_models_from_checkpoints( checkpoint_filenames, src_dict_filename, dst_dict_filename, lexical_dict_paths, ) src_tokens = torch.LongTensor(np.ones((length, 1), dtype="int64")) src_lengths = torch.IntTensor(np.array([length], dtype="int32")) eos_token_id = tgt_dict.eos() return cls( models, tgt_dict, src_tokens, src_lengths, eos_token_id, length_penalty=length_penalty, nbest=nbest, beam_size=beam_size, stop_at_eos=True, word_reward=word_reward, unk_reward=unk_reward, quantize=True, ) def save_to_pytorch(self, output_path): def pack(s): if hasattr(s, "_pack"): s._pack() def unpack(s): if hasattr(s, "_unpack"): s._unpack() self.apply(pack) torch.jit.save(self, output_path) self.apply(unpack) @torch.jit.script def finalize_hypos_loop_tokens( finalized_tokens_list: List[Tensor], finalized_idxs, pad_idx: int, finalized_tokens, finalized_scores, ): for i in range(finalized_idxs.size(0)): cutoff = finalized_tokens[i].ne(pad_idx) tokens = finalized_tokens[i][cutoff] finalized_tokens_list[finalized_idxs[i]] = tokens return finalized_tokens_list @torch.jit.script def finalize_hypos_loop_scores( finalized_scores_list: List[Tensor], finalized_idxs, pad_idx: int, finalized_tokens, finalized_scores, ): for i in range(finalized_idxs.size(0)): cutoff = finalized_scores[i].ne(pad_idx) scores = finalized_scores[i][cutoff] finalized_scores_list[finalized_idxs[i]] = scores return finalized_scores_list @torch.jit.script def finalize_hypos_loop_attns( finalized_attns_list: List[Tensor], finalized_alignments_list: List[Tensor], finalized_idxs, pad_idx: int, finalized_tokens, finalized_scores, finalized_attn, ): for i in range(finalized_idxs.size(0)): cutoff = finalized_tokens[i].ne(pad_idx) hypo_attn = finalized_attn[i][cutoff] alignment = hypo_attn.max(dim=1)[1] finalized_attns_list[finalized_idxs[i]] = hypo_attn finalized_alignments_list[finalized_idxs[i]] = alignment return finalized_attns_list, finalized_alignments_list class IterativeRefinementGenerateAndDecode(torch.jit.ScriptModule): def __init__(self, models, tgt_dict, max_iter=1, quantize=True, check_trace=True): super().__init__() src_tokens = torch.tensor([[4, 2]]) src_lengths = torch.tensor([2]) self.models = models generator = IterativeRefinementGenerator( self.models, tgt_dict, max_iter=max_iter ) if quantize: generator = torch.quantization.quantize_dynamic( generator, {torch.nn.Linear}, dtype=torch.qint8, inplace=True ) enc_inputs = (src_tokens, src_lengths) self.generator = torch.jit.trace( generator, enc_inputs, _force_outplace=True, check_trace=check_trace ) @torch.jit.script_method def forward( self, src_tokens: torch.Tensor, src_lengths: torch.Tensor ) -> List[Tuple[Tensor, float, Tensor]]: return [ (x.long(), float(y), at) for x, y, at in list(self.generator(src_tokens.t(), src_lengths)) ] def save_to_pytorch(self, output_path): def pack(s): if hasattr(s, "_pack"): s._pack() def unpack(s): if hasattr(s, "_unpack"): s._unpack() self.apply(pack) torch.jit.save(self, output_path) self.apply(unpack) @classmethod def build_from_checkpoints( cls, checkpoint_filenames, src_dict_filename, tgt_dict_filename, lexical_dict_paths=None, max_iter=1, ): models, _, tgt_dict = load_models_from_checkpoints( checkpoint_filenames, src_dict_filename, tgt_dict_filename, lexical_dict_paths, ) return cls(models, tgt_dict=tgt_dict, max_iter=max_iter) @torch.jit.script def is_a_loop(pad_idx: int, x, y, s, a): b, l_x, l_y = x.size(0), x.size(1), y.size(1) if l_x > l_y: y = torch.cat([y, torch.zeros([b, l_x - l_y]).to(y).fill_(pad_idx)], 1) s = torch.cat([s, torch.zeros([b, l_x - l_y]).to(s)], 1) if a.size()[0] > 0: a = torch.cat([a, torch.zeros([b, l_x - l_y, a.size(2)]).to(a)], 1) elif l_x < l_y: x = torch.cat([x, torch.zeros([b, l_y - l_x]).to(x).fill_(pad_idx)], 1) return (x == y).all(1), y, s, a @torch.jit.script def last_step(step: int, max_iter: int, terminated): if step == max_iter: # reach last iteration, terminate terminated.fill_(1) return terminated class IterativeRefinementGenerator(nn.Module): def __init__( self, models, tgt_dict, eos_penalty=0.0, max_iter=2, max_ratio=2, decoding_format=None, retain_dropout=False, adaptive=True, ): """ Generates translations based on iterative refinement. Args: tgt_dict: target dictionary """ super().__init__() self.models = models self.bos = tgt_dict.bos() self.pad = tgt_dict.pad() self.unk = tgt_dict.unk() self.eos = tgt_dict.eos() self.vocab_size = len(tgt_dict) self.eos_penalty = eos_penalty self.max_iter = max_iter self.max_ratio = max_ratio self.decoding_format = decoding_format self.retain_dropout = retain_dropout self.adaptive = adaptive for i, model in enumerate(self.models): model.prepare_for_onnx_export_() model.eval() if hasattr(model, "get_student_model"): model = model.get_student_model() self.models[i] = model self._modules[f"model_{i}"] = model def forward( self, src_tokens: torch.Tensor, src_lengths: torch.Tensor ) -> Tuple[Tuple[Tensor, Tensor, Tensor]]: o1, o2, o3, _ = self.generate(self.models, src_tokens, src_lengths) return tuple((x, y.float().mean(), z) for x, y, z in zip(o1, o2, o3)) @torch.no_grad() def generate(self, models, src_tokens, src_lengths, prefix_tokens=None): # TODO: model ensemble assert len(models) == 1, "only support single model" model = models[0] bsz, src_len = src_tokens.size() sent_idxs = torch.arange(bsz) # encoding encoder_out = model.encoder(src_tokens, src_lengths) # initialize buffers (very model specific, with length prediction or not) prev_decoder_out = model.initialize_output_tokens(encoder_out, src_tokens) prev_output_tokens = prev_decoder_out.output_tokens.clone() finalized_tokens_list = [torch.tensor(0) for _ in range(bsz)] finalized_scores_list = [torch.tensor(0) for
the attr while not a == '': a = a.split(":") a, new = ':'.join(a[:-1]), a[-1] attr = new if k in form: # If the form has the split key get its value tainted_split_key = k if should_be_tainted(k): tainted_split_key = taint_string(k) item = form[k] if isinstance(item, record): # if the value is mapped to a record, check if it # has the attribute, if it has it, convert it to # a tuple and set it if hasattr(item, attr): value = tuple(getattr(item, attr)) setattr(item, attr, value) else: # It is mapped to a list of records for x in item: # loop through the records if hasattr(x, attr): # If the record has the attribute # convert it to a tuple and set it value = tuple(getattr(x, attr)) setattr(x, attr, value) # Do the same for the tainted counterpart if tainted_split_key in taintedform: tainted = taintedform[tainted_split_key] if isinstance(item, record): seq = tuple(getattr(tainted, attr)) setattr(tainted, attr, seq) else: for trec in tainted: if hasattr(trec, attr): seq = getattr(trec, attr) seq = tuple(seq) setattr(trec, attr, seq) else: # the form does not have the split key tainted_key = key if should_be_tainted(key): tainted_key = taint_string(key) if key in form: # if it has the original key, get the item # convert it to a tuple item = form[key] item = tuple(form[key]) form[key] = item if tainted_key in taintedform: tainted = tuple(taintedform[tainted_key]) taintedform[tainted_key] = tainted if meth: if 'PATH_INFO' in environ: path = environ['PATH_INFO'] while path[-1:] == '/': path = path[:-1] else: path = '' other['PATH_INFO'] = path = "%s/%s" % (path, meth) self._hacked_path = 1 def postProcessInputs(self): """Process the values in request.form to decode strings to unicode. """ for name, value in self.form.items(): self.form[name] = _decode(value, default_encoding) def resolve_url(self, url): # Attempt to resolve a url into an object in the Zope # namespace. The url must be a fully-qualified url. The # method will return the requested object if it is found # or raise the same HTTP error that would be raised in # the case of a real web request. If the passed in url # does not appear to describe an object in the system # namespace (e.g. the host, port or script name dont # match that of the current request), a ValueError will # be raised. if url.find(self.script) != 0: raise ValueError('Different namespace.') path = url[len(self.script):] while path and path[0] == '/': path = path[1:] while path and path[-1] == '/': path = path[:-1] req = self.clone() rsp = req.response req['PATH_INFO'] = path object = None # Try to traverse to get an object. Note that we call # the exception method on the response, but we don't # want to actually abort the current transaction # (which is usually the default when the exception # method is called on the response). try: object = req.traverse(path) except Exception as exc: rsp.exception() req.clear() raise exc.__class__(rsp.errmsg) # The traversal machinery may return a "default object" # like an index_html document. This is not appropriate # in the context of the resolve_url method so we need # to ensure we are getting the actual object named by # the given url, and not some kind of default object. if hasattr(object, 'id'): if callable(object.id): name = object.id() else: name = object.id elif hasattr(object, '__name__'): name = object.__name__ else: name = '' if name != os.path.split(path)[-1]: object = req.PARENTS[0] req.clear() return object def clone(self): # Return a clone of the current request object # that may be used to perform object traversal. environ = self.environ.copy() environ['REQUEST_METHOD'] = 'GET' if self._auth: environ['HTTP_AUTHORIZATION'] = self._auth if self.response is not None: response = self.response.__class__() else: response = None clone = self.__class__(None, environ, response, clean=1) clone['PARENTS'] = [self['PARENTS'][-1]] directlyProvides(clone, *directlyProvidedBy(self)) return clone def getHeader(self, name, default=None, literal=False): """Return the named HTTP header, or an optional default argument or None if the header is not found. Note that both original and CGI-ified header names are recognized, e.g. 'Content-Type', 'CONTENT_TYPE' and 'HTTP_CONTENT_TYPE' should all return the Content-Type header, if available. """ environ = self.environ if not literal: name = name.replace('-', '_').upper() val = environ.get(name, None) if val is not None: return val if name[:5] != 'HTTP_': name = 'HTTP_%s' % name return environ.get(name, default) get_header = getHeader # BBB def get(self, key, default=None, returnTaints=0, URLmatch=re.compile('URL(PATH)?([0-9]+)$').match, BASEmatch=re.compile('BASE(PATH)?([0-9]+)$').match, ): """Get a variable value Return a value for the required variable name. The value will be looked up from one of the request data categories. The search order is environment variables, other variables, form data, and then cookies. """ other = self.other if key in other: if key == 'REQUEST': return self return other[key] if key[:1] == 'U': match = URLmatch(key) if match is not None: pathonly, n = match.groups() path = self._script + self._steps n = len(path) - int(n) if n < 0: raise KeyError(key) if pathonly: path = [''] + path[:n] else: path = [other['SERVER_URL']] + path[:n] URL = '/'.join(path) if 'PUBLISHED' in other: # Don't cache URLs until publishing traversal is done. other[key] = URL self._urls = self._urls + (key,) return URL if key in isCGI_NAMEs or key[:5] == 'HTTP_': environ = self.environ if key in environ and (key not in hide_key): return environ[key] return '' if key == 'REQUEST': return self if key[:1] == 'B': match = BASEmatch(key) if match is not None: pathonly, n = match.groups() path = self._steps n = int(n) if n: n = n - 1 if len(path) < n: raise KeyError(key) v = self._script + path[:n] else: v = self._script[:-1] if pathonly: v.insert(0, '') else: v.insert(0, other['SERVER_URL']) URL = '/'.join(v) if 'PUBLISHED' in other: # Don't cache URLs until publishing traversal is done. other[key] = URL self._urls = self._urls + (key,) return URL if key == 'BODY' and self._file is not None: p = self._file.tell() self._file.seek(0) v = self._file.read() self._file.seek(p) self.other[key] = v return v if key == 'BODYFILE' and self._file is not None: v = self._file self.other[key] = v return v v = self.common.get(key, _marker) if v is not _marker: return v if self._lazies: v = self._lazies.get(key, _marker) if v is not _marker: if callable(v): v = v() self[key] = v # Promote lazy value del self._lazies[key] return v # Return tainted data first (marked as suspect) if returnTaints: v = self.taintedform.get(key, _marker) if v is not _marker: other[key] = v return v # Untrusted data *after* trusted data v = self.form.get(key, _marker) if v is not _marker: other[key] = v return v # Return tainted data first (marked as suspect) if returnTaints: v = self.taintedcookies.get(key, _marker) if v is not _marker: other[key] = v return v # Untrusted data *after* trusted data v = self.cookies.get(key, _marker) if v is not _marker: other[key] = v return v return default def __getitem__(self, key, default=_marker, returnTaints=0): v = self.get(key, default, returnTaints=returnTaints) if v is _marker: raise KeyError(key) return v # Using the getattr protocol to retrieve form values and similar # is discouraged and is likely to be deprecated in the future. # request.get(key) or request[key] should be used instead def __getattr__(self, key, default=_marker, returnTaints=0): v = self.get(key, default, returnTaints=returnTaints) if v is _marker: if key == 'locale': # we only create the _locale on first access, as setting it # up might be slow and we don't want to slow down every # request if self._locale is _marker: self.setupLocale() return self._locale if key == 'debug': return self._debug raise AttributeError(key) return v def set_lazy(self, key, callable): self._lazies[key] = callable def __contains__(self, key, returnTaints=0): return self.has_key(key, returnTaints=returnTaints) # NOQA def has_key(self, key, returnTaints=0): try: self.__getitem__(key, returnTaints=returnTaints) except Exception: return 0 else: return 1 def keys(self, returnTaints=0): keys = {} keys.update(self.common) keys.update(self._lazies) for key in self.environ.keys(): if ((key in isCGI_NAMEs or key[:5] == 'HTTP_') and (key not in hide_key)): keys[key] = 1 # Cache URLN
gapxy) # set y coordinate to y_centerline_fit[iz] for elements 1 and 2 of the cross for i in range(1,3): landmark_curved[index][i][1] = y_centerline_fit[iz_curved[index]] # set coordinates for landmarks +y and -y. Here, x coordinate is 0 (already initialized). landmark_curved[index][3][2], landmark_curved[index][3][1], landmark_curved[index][4][2], landmark_curved[index][4][1] = get_points_perpendicular_to_curve(polyy, polyy.deriv(), iz_curved[index], gapxy) # set x coordinate to x_centerline_fit[iz] for elements 3 and 4 of the cross for i in range(3,5): landmark_curved[index][i][0] = x_centerline_fit[iz_curved[index]] elif centerline_fitting=='splines': for index in range(0, n_iz_curved, 1): # calculate d (ax+by+cz+d=0) # print iz_curved[index] a=x_centerline_deriv[iz_curved[index]] b=y_centerline_deriv[iz_curved[index]] c=z_centerline_deriv[iz_curved[index]] x=x_centerline_fit[iz_curved[index]] y=y_centerline_fit[iz_curved[index]] z=iz_curved[index] d=-(a*x+b*y+c*z) #print a,b,c,d,x,y,z # set coordinates for landmark at the center of the cross landmark_curved[index][0][0], landmark_curved[index][0][1], landmark_curved[index][0][2] = x_centerline_fit[iz_curved[index]], y_centerline_fit[iz_curved[index]], iz_curved[index] # set y coordinate to y_centerline_fit[iz] for elements 1 and 2 of the cross for i in range(1,3): landmark_curved[index][i][1] = y_centerline_fit[iz_curved[index]] # set x and z coordinates for landmarks +x and -x, forcing de landmark to be in the orthogonal plan and the distance landmark/curve to be gapxy x_n=Symbol('x_n') landmark_curved[index][2][0],landmark_curved[index][1][0]=solve((x_n-x)**2+((-1/c)*(a*x_n+b*y+d)-z)**2-gapxy**2,x_n) #x for -x and +x landmark_curved[index][1][2]=(-1/c)*(a*landmark_curved[index][1][0]+b*y+d) #z for +x landmark_curved[index][2][2]=(-1/c)*(a*landmark_curved[index][2][0]+b*y+d) #z for -x # set x coordinate to x_centerline_fit[iz] for elements 3 and 4 of the cross for i in range(3,5): landmark_curved[index][i][0] = x_centerline_fit[iz_curved[index]] # set coordinates for landmarks +y and -y. Here, x coordinate is 0 (already initialized). y_n=Symbol('y_n') landmark_curved[index][4][1],landmark_curved[index][3][1]=solve((y_n-y)**2+((-1/c)*(a*x+b*y_n+d)-z)**2-gapxy**2,y_n) #y for -y and +y landmark_curved[index][3][2]=(-1/c)*(a*x+b*landmark_curved[index][3][1]+d)#z for +y landmark_curved[index][4][2]=(-1/c)*(a*x+b*landmark_curved[index][4][1]+d)#z for -y # #display # fig = plt.figure() # ax = fig.add_subplot(111, projection='3d') # ax.plot(x_centerline_fit, y_centerline_fit,z_centerline, 'g') # ax.plot(x_centerline, y_centerline,z_centerline, 'r') # ax.plot([landmark_curved[i][j][0] for i in range(0, n_iz_curved) for j in range(0, 5)], \ # [landmark_curved[i][j][1] for i in range(0, n_iz_curved) for j in range(0, 5)], \ # [landmark_curved[i][j][2] for i in range(0, n_iz_curved) for j in range(0, 5)], '.') # ax.set_xlabel('x') # ax.set_ylabel('y') # ax.set_zlabel('z') # plt.show() # Get coordinates of landmarks along straight centerline #========================================================================================== print '\nGet coordinates of landmarks along straight centerline...' landmark_straight = [ [ [ 0 for i in range(0,3)] for i in range (0,5) ] for i in iz_curved ] # same structure as landmark_curved # calculate the z indices corresponding to the Euclidean distance between two consecutive points on the curved centerline (approximation curve --> line) iz_straight = [0 for i in range (0,gapz+1)] #print iz_straight,len(iz_straight) for index in range(1, n_iz_curved, 1): # compute vector between two consecutive points on the curved centerline vector_centerline = [x_centerline_fit[iz_curved[index]] - x_centerline_fit[iz_curved[index-1]], \ y_centerline_fit[iz_curved[index]] - y_centerline_fit[iz_curved[index-1]], \ iz_curved[index] - iz_curved[index-1]] # compute norm of this vector norm_vector_centerline = numpy.linalg.norm(vector_centerline, ord=2) # round to closest integer value norm_vector_centerline_rounded = int(round(norm_vector_centerline,0)) # assign this value to the current z-coordinate on the straight centerline iz_straight[index] = iz_straight[index-1] + norm_vector_centerline_rounded # initialize x0 and y0 to be at the center of the FOV x0 = int(round(nx/2)) y0 = int(round(ny/2)) for index in range(0, n_iz_curved, 1): # set coordinates for landmark at the center of the cross landmark_straight[index][0][0], landmark_straight[index][0][1], landmark_straight[index][0][2] = x0, y0, iz_straight[index] # set x, y and z coordinates for landmarks +x landmark_straight[index][1][0], landmark_straight[index][1][1], landmark_straight[index][1][2] = x0 + gapxy, y0, iz_straight[index] # set x, y and z coordinates for landmarks -x landmark_straight[index][2][0], landmark_straight[index][2][1], landmark_straight[index][2][2] = x0-gapxy, y0, iz_straight[index] # set x, y and z coordinates for landmarks +y landmark_straight[index][3][0], landmark_straight[index][3][1], landmark_straight[index][3][2] = x0, y0+gapxy, iz_straight[index] # set x, y and z coordinates for landmarks -y landmark_straight[index][4][0], landmark_straight[index][4][1], landmark_straight[index][4][2] = x0, y0-gapxy, iz_straight[index] # # display # fig = plt.figure() # ax = fig.add_subplot(111, projection='3d') # #ax.plot(x_centerline_fit, y_centerline_fit,z_centerline, 'r') # ax.plot([landmark_straight[i][j][0] for i in range(0, n_iz_curved) for j in range(0, 5)], \ # [landmark_straight[i][j][1] for i in range(0, n_iz_curved) for j in range(0, 5)], \ # [landmark_straight[i][j][2] for i in range(0, n_iz_curved) for j in range(0, 5)], '.') # ax.set_xlabel('x') # ax.set_ylabel('y') # ax.set_zlabel('z') # plt.show() # # Create NIFTI volumes with landmarks #========================================================================================== # Pad input volume to deal with the fact that some landmarks on the curved centerline might be outside the FOV # N.B. IT IS VERY IMPORTANT TO PAD ALSO ALONG X and Y, OTHERWISE SOME LANDMARKS MIGHT GET OUT OF THE FOV!!! print '\nPad input volume to deal with the fact that some landmarks on the curved centerline might be outside the FOV...' sct.run('c3d '+fname_centerline_orient+' -pad '+str(padding)+'x'+str(padding)+'x'+str(padding)+'vox '+str(padding)+'x'+str(padding)+'x'+str(padding)+'vox 0 -o tmp.centerline_pad.nii.gz') # TODO: don't pad input volume: no need for that! instead, try to increase size of hdr when saving landmarks. # Open padded centerline for reading print '\nOpen padded centerline for reading...' file = nibabel.load('tmp.centerline_pad.nii.gz') data = file.get_data() hdr = file.get_header() # Create volumes containing curved and straight landmarks data_curved_landmarks = data * 0 data_straight_landmarks = data * 0 # initialize landmark value landmark_value = 1 # Loop across cross index for index in range(0, n_iz_curved, 1): # loop across cross element index for i_element in range(0, 5, 1): # get x, y and z coordinates of curved landmark (rounded to closest integer) x, y, z = int(round(landmark_curved[index][i_element][0])), int(round(landmark_curved[index][i_element][1])), int(round(landmark_curved[index][i_element][2])) # attribute landmark_value to the voxel and its neighbours data_curved_landmarks[x+padding-1:x+padding+2, y+padding-1:y+padding+2, z+padding-1:z+padding+2] = landmark_value # get x, y and z coordinates of straight landmark (rounded to closest integer) x, y, z = int(round(landmark_straight[index][i_element][0])), int(round(landmark_straight[index][i_element][1])), int(round(landmark_straight[index][i_element][2])) # attribute landmark_value to the voxel and its neighbours data_straight_landmarks[x+padding-1:x+padding+2, y+padding-1:y+padding+2, z+padding-1:z+padding+2] = landmark_value # increment landmark value landmark_value = landmark_value + 1 # Write NIFTI volumes hdr.set_data_dtype('uint32') # set imagetype to uint8 #TODO: maybe use int32 print '\nWrite NIFTI volumes...' img = nibabel.Nifti1Image(data_curved_landmarks, None, hdr) nibabel.save(img, 'tmp.landmarks_curved.nii.gz') print '.. File created: tmp.landmarks_curved.nii.gz' img = nibabel.Nifti1Image(data_straight_landmarks, None, hdr) nibabel.save(img, 'tmp.landmarks_straight.nii.gz') print '.. File created: tmp.landmarks_straight.nii.gz' # Estimate deformation field by pairing landmarks #========================================================================================== # Dilate landmarks (because nearest neighbour interpolation will be later used, therefore some landmarks may "disapear" if they are single points) #print '\nDilate landmarks...' #sct.run(fsloutput+'fslmaths tmp.landmarks_curved.nii -kernel box 3x3x3 -dilD tmp.landmarks_curved_dilated -odt short') #sct.run(fsloutput+'fslmaths tmp.landmarks_straight.nii -kernel box 3x3x3 -dilD tmp.landmarks_straight_dilated -odt short') # Estimate rigid transformation print '\nEstimate rigid transformation between paired landmarks...' sct.run('ANTSUseLandmarkImagesToGetAffineTransform tmp.landmarks_straight.nii.gz tmp.landmarks_curved.nii.gz rigid tmp.curve2straight_rigid.txt') # Apply rigid transformation print '\nApply rigid transformation to curved landmarks...' sct.run('WarpImageMultiTransform 3 tmp.landmarks_curved.nii.gz tmp.landmarks_curved_rigid.nii.gz -R tmp.landmarks_straight.nii.gz tmp.curve2straight_rigid.txt --use-NN') # Estimate b-spline transformation curve --> straight print '\nEstimate b-spline transformation: curve --> straight...' sct.run('ANTSUseLandmarkImagesToGetBSplineDisplacementField tmp.landmarks_straight.nii.gz tmp.landmarks_curved_rigid.nii.gz tmp.warp_curve2straight.nii.gz 5x5x5 3 2 0') # Concatenate rigid and non-linear transformations... print '\nConcatenate rigid and non-linear transformations...' #sct.run('ComposeMultiTransform 3 tmp.warp_rigid.nii -R tmp.landmarks_straight.nii tmp.warp.nii tmp.curve2straight_rigid.txt') # TODO: use sct.run() when output from the following command will be different from 0 (currently there seem to be a bug) cmd = 'ComposeMultiTransform 3 tmp.curve2straight.nii.gz -R tmp.landmarks_straight.nii.gz tmp.warp_curve2straight.nii.gz tmp.curve2straight_rigid.txt' print('>> '+cmd) commands.getstatusoutput(cmd) # Estimate b-spline transformation straight --> curve # TODO: invert warping field instead of estimating a new one print '\nEstimate b-spline transformation: straight --> curve...' sct.run('ANTSUseLandmarkImagesToGetBSplineDisplacementField tmp.landmarks_curved_rigid.nii.gz tmp.landmarks_straight.nii.gz tmp.warp_straight2curve.nii.gz 5x5x5 3 2 0') # Concatenate rigid and non-linear transformations... print '\nConcatenate rigid and non-linear transformations...' #sct.run('ComposeMultiTransform 3 tmp.warp_rigid.nii -R tmp.landmarks_straight.nii tmp.warp.nii tmp.curve2straight_rigid.txt') # TODO: use sct.run() when output from the following command will be different from 0 (currently there seem to be a bug) cmd = 'ComposeMultiTransform 3 tmp.straight2curve.nii.gz -R tmp.landmarks_straight.nii.gz -i tmp.curve2straight_rigid.txt tmp.warp_straight2curve.nii.gz' print('>> '+cmd) commands.getstatusoutput(cmd) #print '\nPad input image...' #sct.run('c3d '+fname_anat+' -pad '+str(padz)+'x'+str(padz)+'x'+str(padz)+'vox '+str(padz)+'x'+str(padz)+'x'+str(padz)+'vox 0 -o tmp.anat_pad.nii') # Unpad landmarks... # THIS WAS REMOVED ON 2014-06-03 because the output data was cropped at the edge, which caused landmarks to sometimes disappear # print '\nUnpad landmarks...' # sct.run('fslroi tmp.landmarks_straight.nii.gz tmp.landmarks_straight_crop.nii.gz '+str(padding)+' '+str(nx)+' '+str(padding)+' '+str(ny)+' '+str(padding)+' '+str(nz)) # Apply deformation to input image print '\nApply transformation to input image...' sct.run('WarpImageMultiTransform 3 '+fname_anat+' tmp.anat_rigid_warp.nii.gz -R tmp.landmarks_straight.nii.gz '+interpolation_warp+ ' tmp.curve2straight.nii.gz') # sct.run('WarpImageMultiTransform 3 '+fname_anat+' tmp.anat_rigid_warp.nii.gz -R tmp.landmarks_straight_crop.nii.gz '+interpolation_warp+ ' tmp.curve2straight.nii.gz') # Generate output file (in current folder) # TODO: do not uncompress the warping field, it is too time consuming! print '\nGenerate output file (in current folder)...' sct.generate_output_file('tmp.curve2straight.nii.gz','./','warp_curve2straight',ext_anat) # warping field sct.generate_output_file('tmp.straight2curve.nii.gz','./','warp_straight2curve',ext_anat) # warping field sct.generate_output_file('tmp.anat_rigid_warp.nii.gz','./',file_anat+'_straight',ext_anat) # straightened anatomic # Delete
queryset=RackReservation.objects.all(), widget=forms.MultipleHiddenInput() ) user = forms.ModelChoiceField( queryset=User.objects.order_by( 'username' ), required=False ) tenant = forms.ModelChoiceField( queryset=Tenant.objects.all(), required=False ) description = forms.CharField( max_length=100, required=False ) class Meta: nullable_fields = [] # # Manufacturers # class ManufacturerForm(BootstrapMixin, forms.ModelForm): slug = SlugField() class Meta: model = Manufacturer fields = [ 'name', 'slug', ] class ManufacturerCSVForm(forms.ModelForm): class Meta: model = Manufacturer fields = Manufacturer.csv_headers help_texts = { 'name': 'Manufacturer name', 'slug': 'URL-friendly slug', } # # Device types # class DeviceTypeForm(BootstrapMixin, CustomFieldForm): slug = SlugField( slug_source='model' ) tags = TagField( required=False ) class Meta: model = DeviceType fields = [ 'manufacturer', 'model', 'slug', 'part_number', 'u_height', 'is_full_depth', 'subdevice_role', 'comments', 'tags', ] class DeviceTypeCSVForm(forms.ModelForm): manufacturer = forms.ModelChoiceField( queryset=Manufacturer.objects.all(), required=True, to_field_name='name', help_text='Manufacturer name', error_messages={ 'invalid_choice': 'Manufacturer not found.', } ) subdevice_role = CSVChoiceField( choices=SUBDEVICE_ROLE_CHOICES, required=False, help_text='Parent/child status' ) class Meta: model = DeviceType fields = DeviceType.csv_headers help_texts = { 'model': 'Model name', 'slug': 'URL-friendly slug', } class DeviceTypeBulkEditForm(BootstrapMixin, AddRemoveTagsForm, CustomFieldBulkEditForm): pk = forms.ModelMultipleChoiceField( queryset=DeviceType.objects.all(), widget=forms.MultipleHiddenInput() ) manufacturer = forms.ModelChoiceField( queryset=Manufacturer.objects.all(), required=False ) u_height = forms.IntegerField( min_value=1, required=False ) is_full_depth = forms.NullBooleanField( required=False, widget=BulkEditNullBooleanSelect(), label='Is full depth' ) class Meta: nullable_fields = [] class DeviceTypeFilterForm(BootstrapMixin, CustomFieldFilterForm): model = DeviceType q = forms.CharField( required=False, label='Search' ) manufacturer = FilterChoiceField( queryset=Manufacturer.objects.annotate( filter_count=Count('device_types') ), to_field_name='slug' ) subdevice_role = forms.NullBooleanField( required=False, label='Subdevice role', widget=forms.Select( choices=add_blank_choice(SUBDEVICE_ROLE_CHOICES) ) ) console_ports = forms.NullBooleanField( required=False, label='Has console ports', widget=forms.Select( choices=BOOLEAN_WITH_BLANK_CHOICES ) ) console_server_ports = forms.NullBooleanField( required=False, label='Has console server ports', widget=forms.Select( choices=BOOLEAN_WITH_BLANK_CHOICES ) ) power_ports = forms.NullBooleanField( required=False, label='Has power ports', widget=forms.Select( choices=BOOLEAN_WITH_BLANK_CHOICES ) ) power_outlets = forms.NullBooleanField( required=False, label='Has power outlets', widget=forms.Select( choices=BOOLEAN_WITH_BLANK_CHOICES ) ) interfaces = forms.NullBooleanField( required=False, label='Has interfaces', widget=forms.Select( choices=BOOLEAN_WITH_BLANK_CHOICES ) ) pass_through_ports = forms.NullBooleanField( required=False, label='Has pass-through ports', widget=forms.Select( choices=BOOLEAN_WITH_BLANK_CHOICES ) ) # # Device component templates # class ConsolePortTemplateForm(BootstrapMixin, forms.ModelForm): class Meta: model = ConsolePortTemplate fields = [ 'device_type', 'name', ] widgets = { 'device_type': forms.HiddenInput(), } class ConsolePortTemplateCreateForm(ComponentForm): name_pattern = ExpandableNameField( label='Name' ) class ConsoleServerPortTemplateForm(BootstrapMixin, forms.ModelForm): class Meta: model = ConsoleServerPortTemplate fields = [ 'device_type', 'name', ] widgets = { 'device_type': forms.HiddenInput(), } class ConsoleServerPortTemplateCreateForm(ComponentForm): name_pattern = ExpandableNameField( label='Name' ) class PowerPortTemplateForm(BootstrapMixin, forms.ModelForm): class Meta: model = PowerPortTemplate fields = [ 'device_type', 'name', ] widgets = { 'device_type': forms.HiddenInput(), } class PowerPortTemplateCreateForm(ComponentForm): name_pattern = ExpandableNameField( label='Name' ) class PowerOutletTemplateForm(BootstrapMixin, forms.ModelForm): class Meta: model = PowerOutletTemplate fields = [ 'device_type', 'name', ] widgets = { 'device_type': forms.HiddenInput(), } class PowerOutletTemplateCreateForm(ComponentForm): name_pattern = ExpandableNameField( label='Name' ) class InterfaceTemplateForm(BootstrapMixin, forms.ModelForm): class Meta: model = InterfaceTemplate fields = [ 'device_type', 'name', 'form_factor', 'mgmt_only', ] widgets = { 'device_type': forms.HiddenInput(), } class InterfaceTemplateCreateForm(ComponentForm): name_pattern = ExpandableNameField( label='Name' ) form_factor = forms.ChoiceField( choices=IFACE_FF_CHOICES ) mgmt_only = forms.BooleanField( required=False, label='Management only' ) class InterfaceTemplateBulkEditForm(BootstrapMixin, BulkEditForm): pk = forms.ModelMultipleChoiceField( queryset=InterfaceTemplate.objects.all(), widget=forms.MultipleHiddenInput() ) form_factor = forms.ChoiceField( choices=add_blank_choice(IFACE_FF_CHOICES), required=False ) mgmt_only = forms.NullBooleanField( required=False, widget=BulkEditNullBooleanSelect, label='Management only' ) class Meta: nullable_fields = [] class FrontPortTemplateForm(BootstrapMixin, forms.ModelForm): class Meta: model = FrontPortTemplate fields = [ 'device_type', 'name', 'type', 'rear_port', 'rear_port_position', ] widgets = { 'device_type': forms.HiddenInput(), } class FrontPortTemplateCreateForm(ComponentForm): name_pattern = ExpandableNameField( label='Name' ) type = forms.ChoiceField( choices=PORT_TYPE_CHOICES ) rear_port_set = forms.MultipleChoiceField( choices=[], label='Rear ports', help_text='Select one rear port assignment for each front port being created.' ) def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) # Determine which rear port positions are occupied. These will be excluded from the list of available mappings. occupied_port_positions = [ (front_port.rear_port_id, front_port.rear_port_position) for front_port in self.parent.frontport_templates.all() ] # Populate rear port choices choices = [] rear_ports = RearPortTemplate.objects.filter(device_type=self.parent) for rear_port in rear_ports: for i in range(1, rear_port.positions + 1): if (rear_port.pk, i) not in occupied_port_positions: choices.append( ('{}:{}'.format(rear_port.pk, i), '{}:{}'.format(rear_port.name, i)) ) self.fields['rear_port_set'].choices = choices def clean(self): # Validate that the number of ports being created equals the number of selected (rear port, position) tuples front_port_count = len(self.cleaned_data['name_pattern']) rear_port_count = len(self.cleaned_data['rear_port_set']) if front_port_count != rear_port_count: raise forms.ValidationError({ 'rear_port_set': 'The provided name pattern will create {} ports, however {} rear port assignments ' 'were selected. These counts must match.'.format(front_port_count, rear_port_count) }) def get_iterative_data(self, iteration): # Assign rear port and position from selected set rear_port, position = self.cleaned_data['rear_port_set'][iteration].split(':') return { 'rear_port': int(rear_port), 'rear_port_position': int(position), } class RearPortTemplateForm(BootstrapMixin, forms.ModelForm): class Meta: model = RearPortTemplate fields = [ 'device_type', 'name', 'type', 'positions', ] widgets = { 'device_type': forms.HiddenInput(), } class RearPortTemplateCreateForm(ComponentForm): name_pattern = ExpandableNameField( label='Name' ) type = forms.ChoiceField( choices=PORT_TYPE_CHOICES ) positions = forms.IntegerField( min_value=1, max_value=64, initial=1, help_text='The number of front ports which may be mapped to each rear port' ) class DeviceBayTemplateForm(BootstrapMixin, forms.ModelForm): class Meta: model = DeviceBayTemplate fields = [ 'device_type', 'name', ] widgets = { 'device_type': forms.HiddenInput(), } class DeviceBayTemplateCreateForm(ComponentForm): name_pattern = ExpandableNameField( label='Name' ) # # Device roles # class DeviceRoleForm(BootstrapMixin, forms.ModelForm): slug = SlugField() class Meta: model = DeviceRole fields = [ 'name', 'slug', 'color', 'vm_role', ] class DeviceRoleCSVForm(forms.ModelForm): slug = SlugField() class Meta: model = DeviceRole fields = DeviceRole.csv_headers help_texts = { 'name': 'Name of device role', 'color': 'RGB color in hexadecimal (e.g. 00ff00)' } # # Platforms # class PlatformForm(BootstrapMixin, forms.ModelForm): slug = SlugField() class Meta: model = Platform fields = [ 'name', 'slug', 'manufacturer', 'napalm_driver', 'napalm_args', ] widgets = { 'napalm_args': SmallTextarea(), } class PlatformCSVForm(forms.ModelForm): slug = SlugField() manufacturer = forms.ModelChoiceField( queryset=Manufacturer.objects.all(), required=False, to_field_name='name', help_text='Manufacturer name', error_messages={ 'invalid_choice': 'Manufacturer not found.', } ) class Meta: model = Platform fields = Platform.csv_headers help_texts = { 'name': 'Platform name', } # # Devices # class DeviceForm(BootstrapMixin, TenancyForm, CustomFieldForm): site = forms.ModelChoiceField( queryset=Site.objects.all(), widget=forms.Select( attrs={ 'filter-for': 'rack', } ) ) rack = ChainedModelChoiceField( queryset=Rack.objects.all(), chains=( ('site', 'site'), ), required=False, widget=APISelect( api_url='/api/dcim/racks/?site_id={{site}}', display_field='display_name', attrs={ 'filter-for': 'position', } ) ) position = forms.TypedChoiceField( required=False, empty_value=None, help_text="The lowest-numbered unit occupied by the device", widget=APISelect( api_url='/api/dcim/racks/{{rack}}/units/?face={{face}}', disabled_indicator='device' ) ) manufacturer = forms.ModelChoiceField( queryset=Manufacturer.objects.all(), widget=forms.Select( attrs={ 'filter-for': 'device_type', } ) ) device_type = ChainedModelChoiceField( queryset=DeviceType.objects.all(), chains=( ('manufacturer', 'manufacturer'), ), label='Device type', widget=APISelect( api_url='/api/dcim/device-types/?manufacturer_id={{manufacturer}}', display_field='model' ) ) cluster_group = forms.ModelChoiceField( queryset=ClusterGroup.objects.all(), required=False, widget=forms.Select( attrs={'filter-for': 'cluster', 'nullable': 'true'} ) ) cluster = ChainedModelChoiceField( queryset=Cluster.objects.all(), chains=( ('group', 'cluster_group'), ), required=False, widget=APISelect( api_url='/api/virtualization/clusters/?group_id={{cluster_group}}', ) ) comments = CommentField() tags = TagField(required=False) local_context_data = JSONField(required=False) class Meta: model = Device fields = [ 'name', 'device_role', 'device_type', 'serial', 'asset_tag', 'site', 'rack', 'position', 'face', 'status', 'platform', 'primary_ip4', 'primary_ip6', 'cluster_group', 'cluster', 'tenant_group', 'tenant', 'comments', 'tags', 'local_context_data' ] help_texts = { 'device_role': "The function this device serves", 'serial': "Chassis serial number", 'local_context_data': "Local config context data overwrites all source contexts in the final rendered " "config context", } widgets = { 'face': forms.Select( attrs={ 'filter-for': 'position', } ), } def __init__(self, *args, **kwargs): # Initialize helper selectors instance = kwargs.get('instance') # Using hasattr() instead of "is not None" to avoid RelatedObjectDoesNotExist on required field if instance and hasattr(instance, 'device_type'): initial = kwargs.get('initial', {}).copy() initial['manufacturer'] = instance.device_type.manufacturer kwargs['initial'] = initial super().__init__(*args, **kwargs) if self.instance.pk: # Compile list of choices for primary IPv4 and IPv6 addresses for family in [4, 6]: ip_choices = [(None, '---------')] # Gather PKs of all interfaces belonging to this Device or a peer VirtualChassis member interface_ids = self.instance.vc_interfaces.values('pk') # Collect interface IPs interface_ips = IPAddress.objects.select_related('interface').filter( family=family, interface_id__in=interface_ids ) if interface_ips: ip_list = [(ip.id, '{} ({})'.format(ip.address, ip.interface)) for ip in interface_ips] ip_choices.append(('Interface IPs', ip_list)) # Collect NAT IPs nat_ips = IPAddress.objects.select_related('nat_inside').filter( family=family, nat_inside__interface__in=interface_ids ) if nat_ips: ip_list = [(ip.id, '{} ({})'.format(ip.address, ip.nat_inside.address)) for ip in nat_ips] ip_choices.append(('NAT IPs', ip_list)) self.fields['primary_ip{}'.format(family)].choices = ip_choices # If editing an existing device, exclude it from the list of occupied rack units. This ensures that a device # can be flipped from one face to another. self.fields['position'].widget.attrs['api-url'] += '&exclude={}'.format(self.instance.pk) # Limit platform by manufacturer self.fields['platform'].queryset = Platform.objects.filter( Q(manufacturer__isnull=True) | Q(manufacturer=self.instance.device_type.manufacturer) ) else: # An object that doesn't exist yet can't have any IPs assigned to it self.fields['primary_ip4'].choices = [] self.fields['primary_ip4'].widget.attrs['readonly'] = True self.fields['primary_ip6'].choices = [] self.fields['primary_ip6'].widget.attrs['readonly'] = True # Rack position pk = self.instance.pk if self.instance.pk else None try: if self.is_bound and self.data.get('rack') and str(self.data.get('face')): position_choices = Rack.objects.get(pk=self.data['rack']) \ .get_rack_units(face=self.data.get('face'), exclude=pk) elif self.initial.get('rack') and str(self.initial.get('face')): position_choices = Rack.objects.get(pk=self.initial['rack']) \ .get_rack_units(face=self.initial.get('face'), exclude=pk) else: position_choices = [] except Rack.DoesNotExist: position_choices = [] self.fields['position'].choices = [('', '---------')] + [ (p['id'], { 'label': p['name'], 'disabled': bool(p['device'] and p['id'] != self.initial.get('position')), }) for p in position_choices ] # Disable rack assignment if this is a
not data.positive: msg = "Can't use negative index %s" % value if msg: global error_occurred error_occurred = True print("ERROR - %s near line %i" % (msg, t.lineno(1))) def p_type_def_1(t): '''type_def : TYPEDEF declaration SEMI''' # declarations is a type_info d = t[2] lineno = t.lineno(1) sortno = t.lineno(3) + 0.5 if d.type == 'void': global error_occurred error_occurred = True print("ERROR - can't use void in typedef at line %i" % lineno) return d.lineno = lineno if id_unique(d.id, d.type, lineno): if d.type == 'enum': info = d.create_enum(lineno, sortno) elif d.type == 'struct': info = d.create_struct(lineno, sortno) elif d.type == 'union': info = d.create_union(lineno, sortno) else: info = d name_dict[d.id] = info def p_type_def_2(t): '''type_def : ENUM ID enum_body SEMI''' id = t[2] body = t[3] lineno = t.lineno(1) sortno = t.lineno(4) + 0.5 if id_unique(id, 'enum', lineno): name_dict[id] = enum_info(id, body, lineno, sortno) def p_type_def_3(t): '''type_def : STRUCT ID struct_body SEMI''' id = t[2] body = t[3] lineno = t.lineno(1) if id_unique(id, 'struct', lineno): name_dict[id] = struct_info(id, body, lineno) def p_type_def_4(t): '''type_def : UNION ID union_body SEMI''' id = t[2] body = t[3] lineno = t.lineno(1) if id_unique(id, 'union', lineno): name_dict[id] = union_info(id, body, lineno) def p_declaration_1(t): '''declaration : type_specifier ID''' t[1].id = t[2] t[0] = t[1] def p_declaration_2(t): '''declaration : type_specifier ID LBRACKET value RBRACKET | type_specifier ID LT optional_value GT | OPAQUE ID LBRACKET value RBRACKET | OPAQUE ID LT optional_value GT | STRING ID LT optional_value GT''' if not isinstance(t[1], type_info): t[1] = type_info(t[1], t.lineno(1)) t[1].id = t[2] t[1].array = True if t[3] == '[': t[1].fixed = True else: t[1].fixed = False t[1].len = t[4] t[0] = t[1] def p_declaration_3(t): '''declaration : type_specifier STAR ID''' # encode this as the equivalent 'type_specifier ID LT 1 GT' if not isinstance(t[1], type_info): t[1] = type_info(t[1], t.lineno(1)) t[1].id = t[3] t[1].array = True t[1].fixed = False t[1].len = '1' t[0] = t[1] def p_declaration_4(t): '''declaration : VOID''' t[0] = type_info(t[1], t.lineno(1)) def p_type_specifier_1(t): '''type_specifier : UNSIGNED INT | UNSIGNED HYPER''' t[0] = type_info('u' + t[2], t.lineno(1)) def p_type_specifier_2(t): '''type_specifier : INT | HYPER | FLOAT | DOUBLE | QUADRUPLE | BOOL | ID | UNSIGNED | enum_type_spec | struct_type_spec | union_type_spec''' # FRED - Note UNSIGNED is not in spec if isinstance(t[1], type_info): t[0] = t[1] else: t[0] = type_info(t[1], t.lineno(1)) def p_enum_type_spec(t): '''enum_type_spec : ENUM enum_body''' t[0] = type_info("enum", t.lineno(1), body=t[2]) def p_struct_type_spec(t): '''struct_type_spec : STRUCT struct_body''' t[0] = type_info("struct", t.lineno(1), body=t[2]) def p_union_type_spec(t): '''union_type_spec : UNION union_body''' t[0] = type_info("union", t.lineno(1), body=t[2]) def p_union_body(t): '''union_body : SWITCH LPAREN declaration RPAREN LBRACE switch_body RBRACE''' t[0] = [Case_Spec(['switch'], [t[3]])] + t[6] def p_switch_body(t): '''switch_body : case_spec_list default_declaration''' # default_declaration is a list of type_info t[0] = t[1] + [Case_Spec(['default'], t[2])] def p_case_spec(t): '''case_spec : case_statement_list declaration SEMI''' # Note a declaration is a type_info # case_* are both lists of strings (values) t[0] = [Case_Spec(t[1], [t[2]])] def p_nonempty_lists(t): '''case_spec_list : case_spec case_spec_list | case_spec case_statement_list : case_statement case_statement_list | case_statement''' if len(t) == 2: t[0] = t[1] else: t[0] = t[1] + t[2] def p_case_statement(t): '''case_statement : CASE value COLON''' t[0] = [t[2]] def p_default_declaration_1(t): '''default_declaration : empty''' t[0] = [] def p_default_declaration_(t): '''default_declaration : DEFAULT COLON declaration SEMI''' t[0] = [t[3]] def p_struct_body(t): '''struct_body : LBRACE declaration_list RBRACE''' # Returns a list of type_info declarations t[0] = t[2] def p_declaration_list_1(t): '''declaration_list : declaration SEMI''' t[0] = [t[1]] def p_declaration_list_2(t): '''declaration_list : declaration SEMI declaration_list''' t[0] = [t[1]] + t[3] def p_enum_body(t): '''enum_body : LBRACE enum_constant_list RBRACE''' # Returns a list of const_info t[0] = t[2] def p_enum_constant(t): '''enum_constant : ID EQUALS value''' global name_dict, error_occurred id = t[1] value = t[3] lineno = t.lineno(1) if id_unique(id, 'enum', lineno): info = name_dict[id] = const_info(id, value, lineno, enum=True) if not (value[0].isdigit() or value[0] == '-'): # We have a name instead of a constant, make sure it is defined if value not in name_dict: error_occurred = True print("ERROR - can't derefence %s at line %s" % (value, lineno)) elif not isinstance(name_dict[value], const_info): error_occurred = True print("ERROR - reference to %s at line %s is not a constant" %\ (value, lineno)) else: info.positive = name_dict[value].positive t[0] = [info] else: t[0] = [] def p_enum_constant_list_1(t): '''enum_constant_list : enum_constant''' t[0] = t[1] def p_enum_constant_list_2(t): '''enum_constant_list : enum_constant COMMA enum_constant_list''' t[0] = t[1] + t[3] def p_empty(t): 'empty :' def p_error(t): global error_occurred error_occurred = True if t: print("Syntax error at '%s' (lineno %d)" % (t.value, t.lineno)) else: print("Syntax error: unexpectedly hit EOF") # # RPC specific routines follow # def p_program_def(t): '''program_def : PROGRAM ID LBRACE version_def version_def_list RBRACE EQUALS constant SEMI''' print("Ignoring program %s = %s" % (t[2], t[8])) global name_dict id = t[2] value = t[8] lineno = t.lineno(1) if id_unique(id, 'program', lineno): name_dict[id] = const_info(id, value, lineno) def p_version_def(t): '''version_def : VERSION ID LBRACE procedure_def procedure_def_list RBRACE EQUALS constant SEMI''' global name_dict id = t[2] value = t[8] lineno = t.lineno(1) if id_unique(id, 'version', lineno): name_dict[id] = const_info(id, value, lineno) def p_version_def_list(t): '''version_def_list : version_def version_def_list | empty''' def p_procedure_def(t): '''procedure_def : proc_return ID LPAREN proc_firstarg type_specifier_list RPAREN EQUALS constant SEMI''' global name_dict id = t[2] value = t[8] lineno = t.lineno(1) if id_unique(id, 'procedure', lineno): name_dict[id] = const_info(id, value, lineno) def p_procedure_def_list(t): '''procedure_def_list : procedure_def procedure_def_list | empty''' def p_proc_return(t): '''proc_return : type_specifier | VOID''' def p_proc_firstarg(t): '''proc_firstarg : type_specifier | VOID''' def p_type_specifier_list(t): '''type_specifier_list : COMMA type_specifier type_specifier_list | empty''' ########################################################################## # # # Global Variables # # # ########################################################################## error_occurred = False # Parsing of infile status INDENT = 4 # Number of spaces for each indent level indent = ' ' * INDENT indent2 = indent * 2 ########################################################################## # # # Helper classes and functions # # # ########################################################################## def id_unique(id, name, lineno): """Returns True if id not already used. Otherwise, invokes error""" if id in name_dict: global error_occurred error_occurred = True print("ERROR - %s definition %s at line %s conflicts with %s" % \ (name, id, lineno, name_dict[id])) return False else: return True class Case_Spec(object): def __init__(self, cases, declarations): self.cases = cases self.declarations = declarations def __str__(self): return "cases %s: %s" % (self.cases, self.declarations) class Info(object): def __init__(self): self.lineno = None self.sortno = None self.type = None self.array = False self.parent = False def __str__(self): return "%s %s at line %s" % (self.type, self.id, self.lineno) def __cmp__(self, other): """Sort on lineno, but send None to end""" # FRED - not used if self.lineno == other.lineno == None: return 0 if self.lineno == None: return 1 if other.lineno == None: return -1 if self.lineno < other.lineno: return -1 elif self.lineno == other.lineno: return 0 else: return 1 def __cmp__(self, other): """Sort on lineno, but send None to end""" if self.sortno < other.sortno: return -1 elif self.sortno == other.sortno: return 0 else: return 1 def const_output(self): return None def type_output(self): return None def pack_output(Self): return None def _get_filter(self): if use_filters: filter1 = "%sif hasattr(self, 'filter_%s'):\n" % (indent2, self.id) filter2 = "%sdata = getattr(self, 'filter_%s')(data)\n" % (indent*3, self.id) return filter1 + filter2 else: return '' def getTypeHintStr(self, inTypeClass:bool=False) -> str: hint = None # Types which have no "list" if(self.type == "opaque"): return "bytes" if(self.type == "string"): return "bytes" # Types which may be arrayed: if(self.type in ["uint","int"]): hint = "int" if(self.type == "bool"): hint = "bool" if(hint is not None): if(self.array): return "List[%s]"% (hint) return hint if(self.type in ["struct","union"]): typeInfo = name_dict.get(self.id) else: typeInfo = name_dict.get(self.type) if(typeInfo is not None and typeInfo is not self): return typeInfo.getTypeHintStr(inTypeClass) print(f"{typeInfo}: Unknown type {self.type} {self.id}") if(inTypeClass): return "'%s'" %(self.type) else: return "types.%s" % (self.type) def _get_pack_header(self): header = "%sdef pack_%s(self, data: %s) -> None:\n" % (indent, self.id, self.getTypeHintStr()) return header + self._get_filter() def unpack_output(self): return None def _get_unpack_footer(self): footer = "%sreturn data\n" % indent2 return self._get_filter() + footer def brackets(self): if self.array: if self.fixed: out = "[%s]" else: out = "<%s>" if self.len is None: out = out % '' else: out = out % self.len else: out = '' return out def fullname(self, value): """Put 'const.' in front if needed""" if value[0].isdigit() or value[0]=='-': return value else: return
<filename>AnDe/AnDe.py # -*- coding: utf-8 -*- """ Created on Mon Jul 26 11:36:48 2021 @author: ChandrimaBiswas """ import numpy as np import pandas as pd import matplotlib.pyplot as plt import time import os from sklearn.preprocessing import OneHotEncoder from sklearn.compose import ColumnTransformer from sklearn.preprocessing import MinMaxScaler from sklearn import preprocessing import hdbscan import tracemalloc from sklearn.metrics import ConfusionMatrixDisplay clear = lambda:os.system('clear') # extract data from csv files # seperate the Catagorical data and Numaric Data. # Handel the missing value from data set. def extractData(): DP = input("Please, Input the Location of CSV:") while True: DS = pd.read_csv(DP,low_memory=False) missingId = [] missingValue = str(DS.isnull().values.any()) if missingValue == "True": print("There has some missing value.") DS = DS.replace('Infinity', np.nan) totalMissing = DS.isnull().sum().sum() percentMissing = (totalMissing / (DS.count().sum() + DS.isnull().sum().sum())) * 100 for rows in DS: if DS[rows].isnull().sum() != 0: missingId.append(rows) percentMissingRow=(DS[rows].isnull().sum()/DS[rows].count().sum())* 100 if percentMissingRow >= 30: DS = DS.drop(rows, 1) print("The missing values are in the columns:",missingId) print("Total number of missing Values:" , totalMissing) print(percentMissing,"%") num_cols = DS.columns.get_indexer(DS._get_numeric_data().columns) total_cols=DS.columns.get_indexer(DS.columns) while True: withCat = input("Do you want to include Catagorical data [y/n]:") if withCat == "y" or withCat == "n": break else: print("Give your answer only in y or n .\n\n") if withCat == "y": Xdata = DS.iloc[:,total_cols[:-1]].values transform = ColumnTransformer([("Servers", OneHotEncoder(categories = "auto"), [1,2,3])], remainder="passthrough") Xdata = transform.fit_transform(Xdata) Ydata = DS.iloc[:,total_cols[-1]].values le = preprocessing.LabelEncoder() le.fit(Ydata) Ydata=le.transform(Ydata) elif withCat == "n": Xdata = DS.iloc[:,num_cols[:-1]].values Ydata = DS.iloc[:,num_cols[-1]].values while True: decision = input("Scaling data with MinMaxScaler [y/n]:") if decision == "y" or decision == "n": break else: print("Give your answer only in y or n.\n\n") if decision == "y": Xdata = MinMaxScaler(feature_range=(0, 1)).fit_transform(Xdata) return Xdata,Ydata else: return Xdata,Ydata #Hierarchical Clustering def hierarchicalClustering(data,Ydata): from sklearn.cluster import AgglomerativeClustering while True: print("Agglomerative Clustering") clusterNumber = input("How many clusters you want?:") try: clusterNumber = int(clusterNumber) except ValueError: print("Error\n\n") if type(clusterNumber) == int: n = 0 clusters = [] while n < clusterNumber:#Converting nClusters into an array of n clusters [n] for use it later clusters.append(n) n+=1 break while True: linkage = input("The linkage criterion determines which distance to use [‘ward’, ‘complete’, ‘average’, ‘single’]:") if linkage == "ward" or linkage == "complete"or linkage == "average"or linkage == "single": break else: print("Give your answer Correctly.\n\n") print("\nClustering...\n") outliers_fraction = 0.1 start_time = time.time() Aggo = AgglomerativeClustering(n_clusters = clusterNumber,affinity='euclidean',linkage=linkage,compute_distances=True) print("Data Successfully Clustered By Agglomerative Clustering") AggoData = Aggo.fit(data) Xdata_Aggo = Aggo.fit_predict(data) Zdata = AggoData.labels_ runTime=(time.time() - start_time) distance = Aggo.distances_ number_of_outliers = int(outliers_fraction*len(distance)) sorted_index_array = np.argsort(distance) sorted_array = distance[sorted_index_array] rslt = sorted_array[-number_of_outliers : ] threshold = rslt.min() anomaly = (distance >= threshold).astype(int) HR = pd.crosstab(Ydata,Zdata) maxVal = HR.idxmax() return Zdata,clusters,Xdata_Aggo,clusterNumber,anomaly,runTime,maxVal #K-Means Clustering def kmeansClustering(data,labels): from sklearn.cluster import KMeans while True: print("Kmeans Clustering") clusterNumber = input("How many clusters you want?:") try: clusterNumber = int(clusterNumber) except ValueError: print("Error\n\n") if type(clusterNumber) == int: n = 0 clusters = [] while n < clusterNumber: clusters.append(n) n+=1 break outliers_fraction = 0.01 start_time = time.time() KMEANS = KMeans(n_clusters = clusterNumber, init = "k-means++",max_iter = 300,n_init = 10,random_state = 0) print("Data Successfully Clustered with K-means") kmeans = KMEANS.fit(data) Xdata_Kmeans = KMEANS.fit_predict(data) Zdata = kmeans.labels_ runTime=(time.time() - start_time) inertia = KMEANS.inertia_ distance = getDistanceByPoint(data, KMEANS) number_of_outliers = int(outliers_fraction*len(distance)) threshold = distance.nlargest(number_of_outliers).min() anomaly = (distance >= threshold).astype(int) ClusterCenter=kmeans.cluster_centers_ #Kmeans Results kmeansR = pd.crosstab(labels,Zdata) maxVal = kmeansR.idxmax() return Zdata,clusters,Xdata_Kmeans,ClusterCenter,inertia,clusterNumber,anomaly,runTime,maxVal # return Series of distance between each point and his distance with the closest centroid def getDistanceByPoint(data, model): distance = pd.Series() for i in range(0,len(data)): Xa = data[i] Xb = model.cluster_centers_[model.labels_[i]-1] distance.at[i] = np.linalg.norm(Xa-Xb) return distance #HDBSCAN Algorithm def hdbscanClustering(Xdata,Ydata): print("HDBSCAN Clustering") #Computing DBSCAN clusterNumber = input("Minimun size of clusters you want?:") try: clusterNumber = int(clusterNumber) except ValueError: print("Error\n\n") start_time = time.time() hdb = hdbscan.HDBSCAN(min_cluster_size=clusterNumber) print("Data Successfully Clustered with HDBSCAN") Zdata = hdb.fit_predict(Xdata)+1 runTime = (time.time() - start_time) threshold = pd.Series(hdb.outlier_scores_).quantile(0.9) outliers = np.where(hdb.outlier_scores_ > threshold)[0] n_clusters = len(set(Zdata)) n = 0 clusters = [] while n < n_clusters: clusters.append(n) n += 1 HDBR = pd.crosstab(Ydata,Zdata) maxVal = HDBR.idxmax() return Zdata,clusters,outliers,runTime,maxVal #DBSCAN Algorithm def dbscanClustering(Xdata,Ydata): from sklearn.cluster import DBSCAN while True: print("DBSCAN Clustering") epsilon = input("epsilon in Decimal:") try: epsilon = float(epsilon) except ValueError: print("Decimal numbers only") if type(epsilon) == float: break while True: minSamples = input("Min Samples In Integer:") try: minSamples = int(minSamples) except ValueError: print("Integer Numbers only") if type(minSamples) == int: break #Computing DBSCAN start_time = time.time() db = DBSCAN(eps= epsilon, min_samples = minSamples,algorithm ='auto').fit(Xdata) print("Data Successfully Clustered by DBSCAN") core_samples_mask = np.zeros_like(db.labels_, dtype=bool) core_samples_mask[db.core_sample_indices_] = True Zdata = db.labels_ runTime=(time.time() - start_time) nClusters = len(set(Zdata)) noise_ = list(Zdata).count(-1) clusters = [] if noise_ > 0: i = -1 while i + 1 < nClusters: clusters.append(i) i += 1 else: i=0 while i < nClusters: clusters.append(i) i += 1 #DBSCAN Results dbscanR = pd.crosstab(Ydata,Zdata) maxVal = dbscanR.idxmax() return Zdata,clusters,noise_,runTime,maxVal def isolationForest(Xdata,Ydata):#Isolation Forest algorithm from sklearn.ensemble import IsolationForest print("Isolation Forest Clustering") while True: contamination = input("Contamination value between [0,0.5]: ") try: contamination = float(contamination) except ValueError: print("Enter a Number between [0,0.5]") if type(contamination) == float and (contamination >= 0 and contamination <= 0.5): break start_time = time.time() Zdata = IsolationForest(max_samples = "auto",contamination = contamination).fit_predict(Xdata) print("Data Successfully Clustered by Isolation Forest") runTime=(time.time() - start_time) Zdata = np.array(Zdata,dtype = object) n = -1 clusters = [] IFR = pd.crosstab(Ydata,Zdata) maxVal = IFR.idxmax() while n < len(IFR.columns): clusters.append(n) n += 2 return Zdata,clusters,runTime,maxVal def LFO(Xdata,Ydata):#Local Outlier Factor algorithm from sklearn.neighbors import LocalOutlierFactor print("Local Outlier Factor Clustering") while True: contamination = input("Contamination value between [0,0.5]: ") try: contamination = float(contamination) except ValueError: print("Enter a Number") if type(contamination) == float and (contamination > 0 and contamination <= 0.5): break start_time = time.time() lof = LocalOutlierFactor(contamination = contamination,algorithm = 'auto').fit_predict(Xdata) print("Data Successfully Clustered by Local Outlier Factor") runTime=(time.time() - start_time) n = -1 clusters = [] LOFR = pd.crosstab(Ydata,lof) maxVal = LOFR.idxmax() while n < len(LOFR.columns): clusters.append(n) n += 2 return lof,clusters,runTime,maxVal def hierarchicalVisualization(Xdata,Xdata_aggo,nClusters,anomaly): # Visualising the clusters length=len(Xdata) color=['yellow','blue', 'green','cyan','magenta','violet', 'Antique ruby','Aqua','Blush' ] for i in range (0,nClusters): plt.scatter(Xdata[Xdata_aggo == i, 0], Xdata[Xdata_aggo == i,1],s = length, c=color[i], label = 'Cluster'+ str(i+1)) plt.scatter(Xdata[:-1][anomaly == 1,0], Xdata[:-1][anomaly == 1,1], s = length, c = 'red', label = 'Outliers') plt.title('Agglomerative Clustering') plt.show() bars = ('anomaly','normal') Xdata_pos = range(len(bars)) # Create bars barlist=plt.bar(Xdata_pos, [len(anomaly[anomaly==1]),len(anomaly[anomaly==0])]) plt.xticks(Xdata_pos, bars) barlist[0].set_color('r') plt.title('Agglomerative Bar Chart') plt.show() def hdbscanVisualization(Xdata,outliers): # Visualising the clusters plt.scatter(Xdata.T[0],Xdata.T[1], s=100, linewidth=0, c='gray', alpha=0.25) plt.scatter(Xdata[outliers].T[0], Xdata[outliers].T[1],s=100, linewidth=0, c='red', alpha=0.5) plt.title('HDBSCAN Clustering') plt.show() bars = ('anomaly','normal') Xdata_pos = range(len(bars)) # Create bars barlist=plt.bar(Xdata_pos, [len(Xdata[outliers].T[0]),len(Xdata.T[0])]) plt.xticks(Xdata_pos, bars) plt.title('HDBSCAN Bar Chart') barlist[0].set_color('r') plt.show() def kmeansVisualization(Xdata,Xdata_Kmeans,ClusterCenter,nClusters,anomaly): # Visualising the clusters color=['yellow','blue', 'green','cyan','magenta','violet', 'ruby','Aqua','Blush' ] for i in range (0,nClusters): plt.scatter(Xdata[Xdata_Kmeans == i, 0], Xdata[Xdata_Kmeans == i,1],s = 100, c=color[i], label = 'Cluster'+ str(i+1)) plt.scatter(ClusterCenter[:,0], ClusterCenter[:,1], s = 300, c = 'Black', label = 'Centroids') plt.scatter(Xdata[anomaly == 1,0], Xdata[anomaly == 1,1], s = 100, c = 'red', label = 'Outliers') plt.title('K-means Clustering') plt.show() bars = ('anomaly','normal') Xdata_pos = range(len(bars)) # Create bars barlist=plt.bar(Xdata_pos, [len(anomaly[anomaly==1]),len(anomaly[anomaly==0])]) plt.xticks(Xdata_pos, bars) plt.title('K-means Bar Chart') barlist[0].set_color('r') plt.show() def dbscanVisualization(Xdata,dblabels,dbClusters): # Visualising the clusters color=['yellow','blue', 'green','cyan','magenta','violet', 'orange'] a=0 if dbClusters[a] == -1: plt.scatter(Xdata[dblabels == dbClusters[0], 0], Xdata[dblabels == dbClusters[0],1],s = 100, c='red', label = 'Cluster'+ str(1)) a=+1 for i in range (a,len(dbClusters)): plt.scatter(Xdata[dblabels == dbClusters[i], 0], Xdata[dblabels == dbClusters[i],1],s = 100, c=color[i % len(color)], label = 'Cluster'+ str(i+1)) plt.title('DBSCAN Clustering') plt.show() bars = ('anomaly','normal') Xdata_pos = range(len(bars)) # Create bars barlist=plt.bar(Xdata_pos, [len(Xdata[dblabels==-1]),len(Xdata[dblabels!=-1])]) plt.xticks(Xdata_pos, bars) plt.title('DBSCAN Bar Chart') barlist[0].set_color('r') plt.show() def isolationForestVisualization(Xdata,ifLabels,ifNclusters): # Visualising the
<reponame>Vladimir-Ivanov-Git/raw_packet #!/usr/bin/env python3 # -*- coding: utf-8 -*- # region Description """ dhcp_fuzz.py: DHCPv4 fuzzing script Author: <NAME> License: MIT Copyright 2020, Raw-packet Project """ # endregion # region Import from sys import path from os.path import dirname, abspath from argparse import ArgumentParser from socket import socket, AF_PACKET, SOCK_RAW from struct import pack from socket import inet_aton from time import sleep from typing import Union, List, Dict from re import sub from paramiko import RSAKey from pathlib import Path from os.path import isfile from os import remove from scapy.all import rdpcap, BOOTP # endregion # region Authorship information __author__ = '<NAME>' __copyright__ = 'Copyright 2020, Raw-packet Project' __credits__ = [''] __license__ = 'MIT' __version__ = '0.2.1' __maintainer__ = '<NAME>' __email__ = '<EMAIL>' __status__ = 'Development' # endregion tested_index: int = 0 transactions: List[int] = list() send_transactions: Dict[int, List[int]] = {} # region Get address of IPv4 gateway over ssh def get_ipv4_gateway_over_ssh(ssh_user: str = 'root', ssh_password: Union[None, str] = None, ssh_pkey: Union[None, RSAKey] = None, ssh_host: str = '192.168.0.1', os: str = 'MacOS', network_interface: str = 'en0') -> Union[None, str]: """ Get IPv4 gateway address over SSH :param ssh_user: SSH Username :param ssh_password: <PASSWORD> :param ssh_pkey: SSH Private key :param ssh_host: SSH Host :param os: MacOS, Linux or Windows (Installation of OpenSSH For Windows: https://docs.microsoft.com/en-us/windows-server/administration/openssh/openssh_install_firstuse) :param network_interface: Network interface :return: IPv4 gateway address or None if error """ gateway_ipv4_address: Union[None, str] = None try: if os == 'MacOS': route_table_command: str = 'netstat -nr | grep default | grep ' + network_interface + \ ' | awk \'{print $2}\'' elif os == 'Linux': route_table_command: str = 'route -n | grep UG | grep ' + network_interface + \ ' | awk \'{print $2}\'' else: route_table_command: str = 'ipconfig | findstr /i "Gateway"' route_table_result: str = base.exec_command_over_ssh(command=route_table_command, ssh_user=ssh_user, ssh_password=<PASSWORD>, ssh_pkey=ssh_pkey, ssh_host=ssh_host) route_table_result: List[str] = route_table_result.splitlines() route_table_result: str = route_table_result[0] if os == 'Windows': route_table_result: str = route_table_result.replace(' .', '').replace(' :', '') route_table_result: str = sub(r' +', ' ', route_table_result) route_table_result: List[str] = route_table_result.split() route_table_result: str = route_table_result[2] assert base.ip_address_validation(route_table_result), \ 'Bad IPv4 address: ' + base.error_text(route_table_result) assert base.ip_address_in_range(route_table_result, first_ip_address, last_ip_address), \ 'Router IPv4 address: ' + base.error_text(route_table_result) + \ ' not in range: ' + base.info_text(first_ip_address + ' - ' + last_ip_address) return route_table_result except AssertionError as Error: base.print_error(Error.args[0]) return gateway_ipv4_address except IndexError: return gateway_ipv4_address # endregion # region Start DHCPv4 client over ssh def dhclient_over_ssh(ssh_user: str = 'root', ssh_password: Union[None, str] = None, ssh_pkey: Union[None, RSAKey] = None, ssh_host: str = '192.168.0.1', os: str = 'MacOS', network_interface: str = 'en0') -> bool: """ Start DHCPv4 client over ssh :param ssh_user: SSH Username :param ssh_password: SSH Password :param ssh_pkey: SSH Private key :param ssh_host: SSH Host :param os: MacOS, Linux or Windows (Installation of OpenSSH For Windows: https://docs.microsoft.com/en-us/windows-server/administration/openssh/openssh_install_firstuse) :param network_interface: Network interface :return: True if success or False if error """ if os == 'MacOS': dhclient_command: str = 'ipconfig set ' + network_interface + ' DHCP' elif os == 'Linux': dhclient_command: str = 'rm -f /var/lib/dhcp/dhclient.leases; dhclient ' + network_interface else: dhclient_command: str = 'ipconfig /release && ipconfig /renew' return base.exec_command_over_ssh(command=dhclient_command, ssh_user=ssh_user, ssh_password=<PASSWORD>, ssh_pkey=ssh_pkey, ssh_host=ssh_host, need_output=False) # endregion # region Start tshark over ssh def start_tshark_over_ssh(ssh_user: str = 'root', ssh_password: Union[None, str] = None, ssh_pkey: Union[None, RSAKey] = None, ssh_host: str = '192.168.0.1', os: str = 'MacOS', network_interface: str = 'en0') -> bool: """ Start tshark over ssh :param ssh_user: SSH Username :param ssh_password: <PASSWORD> :param ssh_pkey: SSH Private key :param ssh_host: SSH Host :param os: MacOS, Linux or Windows (Installation of OpenSSH For Windows: https://docs.microsoft.com/en-us/windows-server/administration/openssh/openssh_install_firstuse) :param network_interface: Network interface :return: True if success or False if error """ if os == 'Linux' or os == 'MacOS': start_tshark_command: str = 'rm -f /tmp/dhcp.pcap; tshark -i ' + network_interface + \ ' -w /tmp/dhcp.pcap -f "ether src ' + your_mac_address + '"' else: start_tshark_command: str = 'cd C:\Windows\Temp && del /f dhcp.pcap && tshark -i ' + network_interface + \ ' -w dhcp.pcap -f "ether src ' + your_mac_address + '"' return base.exec_command_over_ssh(command=start_tshark_command, ssh_user=ssh_user, ssh_password=<PASSWORD>, ssh_pkey=ssh_pkey, ssh_host=ssh_host, need_output=False) # endregion # region Stop tshark over ssh def stop_tshark_over_ssh(ssh_user: str = 'root', ssh_password: Union[None, str] = None, ssh_pkey: Union[None, RSAKey] = None, ssh_host: str = '192.168.0.1', os: str = 'MacOS') -> bool: """ Stop tshark over ssh :param ssh_user: SSH Username :param ssh_password: <PASSWORD> Password :param ssh_pkey: SSH Private key :param ssh_host: SSH Host :param os: MacOS, Linux or Windows (Installation of OpenSSH For Windows: https://docs.microsoft.com/en-us/windows-server/administration/openssh/openssh_install_firstuse) :return: True if success or False if error """ if os == 'Linux' or os == 'MacOS': stop_tshark_command: str = 'pkill tshark' else: stop_tshark_command: str = 'taskkill /IM "tshark.exe" /F' return base.exec_command_over_ssh(command=stop_tshark_command, ssh_user=ssh_user, ssh_password=<PASSWORD>, ssh_pkey=ssh_pkey, ssh_host=ssh_host, need_output=False) # endregion # region Make DHCPv4 reply packet def make_reply(bootp_transaction_id: int = 1, dhcpv4_message_type: int = 2) -> bytes: if tested_index == len(tested_parameters): base.info_text('Exit ...') exit(0) bootp_packet: bytes = pack('!B', tested_parameters[tested_index]['BOOTP']['message_type']) # Message type bootp_packet += pack('!B', tested_parameters[tested_index]['BOOTP']['hardware_type']) # Hardware type: 1 - Ethernet bootp_packet += pack('!B', tested_parameters[tested_index]['BOOTP']['hardware_length']) # Hardware address length: 6 - Ethernet header length bootp_packet += pack('!B', tested_parameters[tested_index]['BOOTP']['hops']) # Number of hops bootp_packet += pack('!L', bootp_transaction_id) # Transaction ID bootp_packet += pack('!H', 0) # Seconds elapsed bootp_packet += pack('!H', tested_parameters[tested_index]['BOOTP']['flags']) # Flags bootp_packet += pack('!4s', inet_aton(tested_parameters[tested_index]['BOOTP']['client_ip'])) # CIADDR - Client IP address bootp_packet += pack('!4s', inet_aton(tested_parameters[tested_index]['BOOTP']['your_ip'])) # YIADDR - Your client IP address bootp_packet += pack('!4s', inet_aton(tested_parameters[tested_index]['BOOTP']['next_server_ip'])) # SIADDR - Next server IP address bootp_packet += pack('!4s', inet_aton(tested_parameters[tested_index]['BOOTP']['relay_agent_ip'])) # GIADDR - Relay agent IP address bootp_packet += eth.convert_mac(mac_address=tested_parameters[tested_index]['BOOTP']['client_mac']) # CHADDR - Client hardware address bootp_packet += b''.join(pack('B', 0) for _ in range(10)) # Client hardware address padding bootp_packet += b''.join(pack('B', 0) for _ in range(64)) # Server host name bootp_packet += b''.join(pack('B', 0) for _ in range(128)) # Boot file name bootp_packet += dhcpv4.dhcp_magic_cookie # DHCPv4 magic cookie dhcpv4_packet: bytes = pack('!3B', 53, 1, dhcpv4_message_type) # 53 DHCPv4 message type dhcpv4_packet += pack('!' '2B' '4s', 54, 4, inet_aton(tested_parameters[tested_index]['DHCP']['server_identifier'])) # 54 DHCPv4 server identifier dhcpv4_packet += pack('!' '2B' 'L', 51, 4, tested_parameters[tested_index]['DHCP']['lease_time']) # 51 - DHCPv4 IP address lease time option dhcpv4_packet += pack('!' '2B' '4s', 1, 4, inet_aton(tested_parameters[tested_index]['DHCP']['subnet_mask'])) # 1 - DHCPv4 Subnet mask option dhcpv4_packet += pack('!' '2B' '4s', 3, 4, inet_aton(tested_parameters[tested_index]['DHCP']['router'])) # 3 - DHCPv4 Router option (Router IPv4 address) dhcpv4_packet += pack('!' '2B' '4s', 6, 4, inet_aton(tested_parameters[tested_index]['DHCP']['dns_server'])) # 6 - DHCPv4 DNS option (Domain name server IPv4 address) dhcpv4_packet += pack('!' '2B', 15, len(tested_parameters[tested_index]['DHCP']['domain'])) + \ tested_parameters[tested_index]['DHCP']['domain'] # 15 - DHCPv4 Domain name option dhcpv4_packet += pack('B', 255) # 255 - End of DHCPv4 options eth_header: bytes = eth.make_header(source_mac=tested_parameters[tested_index]['Ethernet']['source_mac_address'], destination_mac=tested_parameters[tested_index]['Ethernet']['destination_mac_address'], network_type=tested_parameters[tested_index]['Ethernet']['network_type']) ip_header: bytes = ipv4.make_header(source_ip=tested_parameters[tested_index]['Network']['source_ip_address'], destination_ip=tested_parameters[tested_index]['Network']['destination_ip_address'], data_len=len(bootp_packet + dhcpv4_packet), transport_protocol_len=udp.header_length, transport_protocol_type=udp.header_type) udp_header: bytes = udp.make_header(source_port=tested_parameters[tested_index]['Transport']['source_port'], destination_port=tested_parameters[tested_index]['Transport']['destination_port'], data_length=len(bootp_packet + dhcpv4_packet)) return eth_header + ip_header + udp_header + bootp_packet + dhcpv4_packet # endregion # region DHCPv4 reply def reply(packet: Dict): global tested_index if 'DHCPv4' in packet.keys(): # DHCPv4 Discover if packet['DHCPv4'][53] == 1: base.print_info('Index of tested parameters: ', str(tested_index)) if packet['BOOTP']['transaction-id'] not in transactions: transactions.append(packet['BOOTP']['transaction-id']) else: tested_index += 1 reply_packet = make_reply(bootp_transaction_id=packet['BOOTP']['transaction-id'], dhcpv4_message_type=2) raw_socket.send(reply_packet) base.print_info('DHCPv4 Discover from: ', packet['Ethernet']['source']) # DHCPv4 Request if packet['DHCPv4'][53] == 3: reply_packet = make_reply(bootp_transaction_id=packet['BOOTP']['transaction-id'], dhcpv4_message_type=5) raw_socket.send(reply_packet) base.print_info('DHCPv4 Request from: ', packet['Ethernet']['source']) sleep(2) current_gateway_ipv4_address = get_ipv4_gateway_over_ssh(ssh_user=args.target_ssh_user, ssh_password=<PASSWORD>, ssh_pkey=private_key, ssh_host=args.target_ip, os=args.target_os, network_interface=args.target_interface) if current_gateway_ipv4_address is not None: base.print_success('Index: ', str(tested_index), ' Gateway: ', current_gateway_ipv4_address, ' Parameters: ', str(tested_parameters[tested_index])) else: base.print_error('Index: ', str(tested_index), ' Gateway: ', 'None', ' Parameters: ', str(tested_parameters[tested_index])) tested_index += 1 dhclient_over_ssh(ssh_user=args.target_ssh_user, ssh_password=args.target_ssh_pass, ssh_pkey=private_key, ssh_host=args.target_ip, os=args.target_os, network_interface=args.target_interface) # endregion # region Main function if __name__ == '__main__': # region Import Raw-packet classes path.append(dirname(dirname(dirname(abspath(__file__))))) from raw_packet.Utils.base import Base from raw_packet.Utils.network import RawEthernet, RawIPv4, RawUDP, RawDHCPv4, RawSniff from raw_packet.Utils.tm import ThreadManager base: Base = Base() eth: RawEthernet = RawEthernet() ipv4: RawIPv4 = RawIPv4() udp: RawUDP = RawUDP() sniff: RawSniff = RawSniff() dhcpv4: RawDHCPv4 = RawDHCPv4() thread_manager: ThreadManager = ThreadManager(2) # endregion # region Raw socket raw_socket: socket = socket(AF_PACKET, SOCK_RAW) # endregion # region Check user and platform base.check_user() base.check_platform() # endregion # region Parse script arguments parser: ArgumentParser = ArgumentParser(description='DHCPv4 fuzzing script') parser.add_argument('-i', '--interface', help='Set interface name for send ARP packets', default=None) parser.add_argument('-m', '--target_mac', help='Set target MAC address', required=True) parser.add_argument('-t', '--target_ip', help='Set target IPv4 address', required=True) parser.add_argument('-o', '--target_os', help='Set target OS (MacOS, Linux,
* cenrace', 'detailed'), }, }, CC.ROUNDER_QUERY_ORDERING: { 0: { 0: ('total', 'hhgq', 'hhgq * hispanic', 'hhgq * hispanic * cenrace', 'hhgq * votingage * hispanic * cenrace', 'detailed'), }, }, } cty_tr_bg_ordering = { CC.L2_QUERY_ORDERING: { 0: { 0: ('total',), 1: ('cenrace', 'hispanic', 'votingage', 'hhinstlevels', 'hhgq', 'votingage * hispanic', 'hhgq', 'hispanic * cenrace', 'votingage * cenrace', 'votingage * hispanic', 'votingage * hispanic * cenrace', 'detailed'), }, }, CC.L2_CONSTRAIN_TO_QUERY_ORDERING: { 0: { 0: ('total',), 1: ('cenrace', 'hispanic', 'votingage', 'hhinstlevels', 'hhgq', 'votingage * hispanic', 'hhgq', 'hispanic * cenrace', 'votingage * cenrace', 'votingage * hispanic', 'votingage * hispanic * cenrace', 'detailed'), }, }, CC.ROUNDER_QUERY_ORDERING: { 0: { 0: ('total',), 1: ('hhgq', 'hhgq * hispanic', 'hhgq * hispanic * cenrace', 'hhgq * votingage * hispanic * cenrace', 'detailed'), }, }, } default_ordering = { CC.L2_QUERY_ORDERING: { 0: { 0: ('total', 'cenrace', 'hispanic', 'votingage', 'hhinstlevels', 'hhgq', 'votingage * hispanic', 'hhgq', 'hispanic * cenrace', 'votingage * cenrace', 'votingage * hispanic', 'votingage * hispanic * cenrace', 'detailed'), }, }, CC.L2_CONSTRAIN_TO_QUERY_ORDERING: { 0: { 0: ('total', 'cenrace', 'hispanic', 'votingage', 'hhinstlevels', 'hhgq', 'votingage * hispanic', 'hhgq', 'hispanic * cenrace', 'votingage * cenrace', 'votingage * hispanic', 'votingage * hispanic * cenrace', 'detailed'), }, }, CC.ROUNDER_QUERY_ORDERING: { 0: { 0: ('total', 'hhgq', 'hhgq * hispanic', 'hhgq * hispanic * cenrace', 'hhgq * votingage * hispanic * cenrace', 'detailed'), }, }, } query_ordering = {} for geolevel in levels: if geolevel in ("State"): query_ordering[geolevel] = st_ordering elif geolevel in ("County", "Tract", "Block_Group"): query_ordering[geolevel] = cty_tr_bg_ordering else: query_ordering[geolevel] = default_ordering return query_ordering class Strategy2a_St_Cty_isoTot(PL94Strategy, USLevelStrategy): @staticmethod def make(levels): geos_qs_props_dict = defaultdict(lambda: defaultdict(dict)) geos_qs_props_dict.update({ CC.GEODICT_GEOLEVELS: levels, }) for level in geos_qs_props_dict[CC.GEODICT_GEOLEVELS]: if level == "US": # No 'total' query geos_qs_props_dict[CC.DPQUERIES][level] = ("hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = tuple([Fr(1, 6)] * 6) elif level == "State": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(509,512),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(1,1024)) elif level == "County": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,7),Fr(1,7),Fr(1,7),Fr(1,7), Fr(1,7),Fr(1,7),Fr(1,7)) else: # Only per-geolevel rho actively tuned in other geolevels; query allocations left at default geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,7),Fr(1,7),Fr(1,7),Fr(1,7), Fr(1,7),Fr(1,7),Fr(1,7)) return geos_qs_props_dict class Strategy2a_St_Cty_isoTot_Ordering: @staticmethod def make(levels): # levels = USGeolevelsNoTractGroup.getLevels() us_ordering = { CC.L2_QUERY_ORDERING: { 0: { 0: ('hispanic * cenrace11cats', 'votingage', 'hhinstlevels', 'hhgq'), 1: ('hhgq',), 2: ('hispanic * cenrace11cats * votingage',), 3: ('detailed',), }, }, CC.L2_CONSTRAIN_TO_QUERY_ORDERING: { 0: { 0: ('hispanic * cenrace11cats', 'votingage', 'hhinstlevels'), 1: ('hhgq',), 2: ('hispanic * cenrace11cats * votingage',), 3: ('detailed',), }, }, CC.ROUNDER_QUERY_ORDERING: { 0: { 0: ('total', 'hhgq', 'hhgq * hispanic', 'hhgq * hispanic * cenrace', 'hhgq * votingage * hispanic * cenrace', 'detailed'), }, }, } st_cty_ordering = { CC.L2_QUERY_ORDERING: { 0: { 0: ('total',), 1: ('hispanic * cenrace11cats', 'votingage', 'hhinstlevels', 'hhgq'), 2: ('hhgq',), 3: ('hispanic * cenrace11cats * votingage',), 4: ('detailed',), }, }, CC.L2_CONSTRAIN_TO_QUERY_ORDERING: { 0: { 0: ('total',), 1: ('hispanic * cenrace11cats', 'votingage', 'hhinstlevels'), 2: ('hhgq',), 3: ('hispanic * cenrace11cats * votingage',), 4: ('detailed',), }, }, CC.ROUNDER_QUERY_ORDERING: { 0: { 0: ('total',), 1: ('hhgq', 'hhgq * hispanic', 'hhgq * hispanic * cenrace', 'hhgq * votingage * hispanic * cenrace', 'detailed'), }, }, } subCounty_ordering = { CC.L2_QUERY_ORDERING: { 0: { 0: ('total', 'hispanic * cenrace11cats', 'votingage', 'hhinstlevels', 'hhgq'), 1: ('hhgq',), 2: ('hispanic * cenrace11cats * votingage',), 3: ('detailed',), }, }, CC.L2_CONSTRAIN_TO_QUERY_ORDERING: { 0: { 0: ('total', 'hispanic * cenrace11cats', 'votingage', 'hhinstlevels'), 1: ('hhgq',), 2: ('hispanic * cenrace11cats * votingage',), 3: ('detailed',), }, }, CC.ROUNDER_QUERY_ORDERING: { 0: { 0: ('total', 'hhgq', 'hhgq * hispanic', 'hhgq * hispanic * cenrace', 'hhgq * votingage * hispanic * cenrace', 'detailed'), }, }, } query_ordering = {} for geolevel in levels: if geolevel == "US": query_ordering[geolevel] = us_ordering elif geolevel in ("State", "County"): query_ordering[geolevel] = st_cty_ordering else: query_ordering[geolevel] = subCounty_ordering return query_ordering class Strategy2b_St_Cty_isoTot(PL94Strategy, USLevelStrategy): @staticmethod def make(levels): geos_qs_props_dict = defaultdict(lambda: defaultdict(dict)) geos_qs_props_dict.update({ CC.GEODICT_GEOLEVELS: levels, }) for level in geos_qs_props_dict[CC.GEODICT_GEOLEVELS]: if level == "US": # No 'total' query geos_qs_props_dict[CC.DPQUERIES][level] = ("hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(1019,1024)) elif level == "State": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(905,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(57,512)) elif level == "County": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(1018,1024)) else: # Only per-geolevel rho actively tuned in other geolevels; query allocations left at default geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(1018,1024)) return geos_qs_props_dict class Strategy2b_St_Cty_B_optSpine_ppmfCandidate(PL94Strategy, USLevelStrategy): @staticmethod def make(levels): geos_qs_props_dict = defaultdict(lambda: defaultdict(dict)) geos_qs_props_dict.update({ CC.GEODICT_GEOLEVELS: levels, }) for level in geos_qs_props_dict[CC.GEODICT_GEOLEVELS]: if level == "US": # No 'total' query geos_qs_props_dict[CC.DPQUERIES][level] = ("hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(1019,1024)) elif level == "State": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(815,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(204,1024)) elif level == "County": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(342,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(677,1024)) elif level == "Block": geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(190,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(829,1024)) else: # Only per-geolevel rho actively tuned in other geolevels; query allocations left at default geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(1018,1024)) return geos_qs_props_dict class Strategy2b_St_Cty_B_aianSpine_ppmfCandidate(PL94Strategy, USLevelStrategy): @staticmethod def make(levels): geos_qs_props_dict = defaultdict(lambda: defaultdict(dict)) geos_qs_props_dict.update({ CC.GEODICT_GEOLEVELS: levels, }) for level in geos_qs_props_dict[CC.GEODICT_GEOLEVELS]: if level == "US": # No 'total' query geos_qs_props_dict[CC.DPQUERIES][level] = ("hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(1019,1024)) elif level == "State": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(815,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(204,1024)) elif level == "County": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(342,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(677,1024)) elif level == "Block": geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(208,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(811,1024)) else: # Only per-geolevel rho actively tuned in other geolevels; query allocations left at default geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(1018,1024)) return geos_qs_props_dict class Strategy2b_St_Cty_BG_optSpine_ppmfCandidate(PL94Strategy, USLevelStrategy): @staticmethod def make(levels): geos_qs_props_dict = defaultdict(lambda: defaultdict(dict)) geos_qs_props_dict.update({ CC.GEODICT_GEOLEVELS: levels, }) for level in geos_qs_props_dict[CC.GEODICT_GEOLEVELS]: if level == "US": # No 'total' query geos_qs_props_dict[CC.DPQUERIES][level] = ("hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(1019,1024)) elif level == "State": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(815,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(204,1024)) elif level == "County": # In Redistricting, separately tuned rho on 'total' geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(342,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(677,1024)) elif level == "Block_Group": geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic * cenrace11cats * votingage", "detailed") geos_qs_props_dict[CC.QUERIESPROP][level] = (Fr(530,1024),Fr(1,1024),Fr(1,1024),Fr(1,1024), Fr(1,1024),Fr(1,1024),Fr(489,1024)) else: # Only per-geolevel rho actively tuned in other geolevels; query allocations left at default geos_qs_props_dict[CC.DPQUERIES][level] = ("total", "hispanic * cenrace11cats", "votingage", "hhinstlevels", "hhgq", "hispanic *
tree header_all_in_i, unheader_all_in_i = check_header(item) # Logic for applying and removing headers if any([header_all_in_p, header_all_in_s, header_all_in_i]): if item['content'][0] != '*': item.update(content='* ' + item['content']) for ci in child_items: if not ci['content'].startswith('*'): ci.update(content='* ' + ci['content']) if any([unheader_all_in_p, unheader_all_in_s]): if item['content'][0] == '*': item.update(content=item['content'][2:]) if unheader_all_in_i: [ci.update(content=ci['content'][2:]) for ci in child_items] # Logic for recurring lists if not args.regeneration: try: # If old label is present, reset it if item['r_tag'] == 1: item['r_tag'] = 0 api.items.update(item['id']) except: pass # If options turned on, start recurring lists logic if args.regeneration is not None or args.end: run_recurring_lists_logic( args, api, item, child_items, child_items_all, regen_labels_id) # If options turned on, start labelling logic if label_id is not None: # Skip processing an item if it has already been checked or is a header if item['checked'] == 1: continue if item['content'].startswith('*'): # Remove next action label if it's still present remove_label(item, label_id, overview_item_ids,overview_item_labels) continue # Check item type item_type, item_type_changed = get_item_type( args, item, project_type) if item_type is not None: logging.debug('Identified \'%s\' as %s type', item['content'], item_type) # Determine hierarchy types for logic hierarchy_types = [item_type, section_type, project_type] active_types = [type(x) != type(None) for x in hierarchy_types] # If it is a parentless task if item['parent_id'] == 0: if active_types[0]: # Do item types active_type = item_type add_label( item, label_id, overview_item_ids, overview_item_labels) elif active_types[1]: # Do section types active_type = section_type if section_type == 'sequential' or section_type == 's-p': if not first_found_section: add_label( item, label_id, overview_item_ids, overview_item_labels) first_found_section = True elif section_type == 'parallel' or section_type == 'p-s': add_label( item, label_id, overview_item_ids, overview_item_labels) elif active_types[2]: # Do project types active_type = project_type if project_type == 'sequential' or project_type == 's-p': if not first_found_project: add_label( item, label_id, overview_item_ids, overview_item_labels) first_found_project = True elif project_type == 'parallel' or project_type == 'p-s': add_label( item, label_id, overview_item_ids, overview_item_labels) # Mark other conditions too if first_found_section == False and active_types[1]: first_found_section = True if first_found_project is False and active_types[2]: first_found_project = True # If there are children if len(child_items) > 0: # Check if item state has changed, if so clean children for good measure if item_type_changed == 1: [remove_label(child_item, label_id, overview_item_ids, overview_item_labels) for child_item in child_items] # If a sub-task, inherit parent task type if item['parent_id'] !=0: try: active_type = item['parent_type'] except: pass # Process sequential tagged items (item_type can overrule project_type) if active_type == 'sequential' or active_type == 'p-s': for child_item in child_items: # Ignore headered children if child_item['content'].startswith('*'): continue # Pass item_type down to the children child_item['parent_type'] = active_type # Pass label down to the first child if child_item['checked'] == 0 and label_id in item['labels']: add_label( child_item, label_id, overview_item_ids, overview_item_labels) remove_label( item, label_id, overview_item_ids, overview_item_labels) else: # Clean for good measure remove_label( child_item, label_id, overview_item_ids, overview_item_labels) # Process parallel tagged items or untagged parents elif active_type == 'parallel' or (active_type == 's-p' and label_id in item['labels']): remove_label( item, label_id, overview_item_ids, overview_item_labels) for child_item in child_items: # Ignore headered children if child_item['content'].startswith('*'): continue child_item['parent_type'] = active_type if child_item['checked'] == 0: # child_first_found = True add_label( child_item, label_id, overview_item_ids, overview_item_labels) # Remove labels based on start / due dates # If item is too far in the future, remove the next_action tag and skip try: if args.hide_future > 0 and 'due' in item.data and item['due'] is not None: due_date = datetime.strptime( item['due']['date'], "%Y-%m-%d") future_diff = ( due_date - datetime.today()).days if future_diff >= args.hide_future: remove_label( item, label_id, overview_item_ids, overview_item_labels) continue except: # Hide-future not set, skip continue # If start-date has not passed yet, remove label try: f1 = item['content'].find('start=') f2 = item['content'].find('start=due-') if f1 > -1 and f2 == -1: f_end = item['content'][f1+6:].find(' ') if f_end > -1: start_date = item['content'][f1 + 6:f1+6+f_end] else: start_date = item['content'][f1+6:] # If start-date hasen't passed, remove all labels start_date = datetime.strptime( start_date, args.dateformat) future_diff = ( datetime.today()-start_date).days if future_diff < 0: remove_label( item, label_id, overview_item_ids, overview_item_labels) [remove_label(child_item, label_id, overview_item_ids, overview_item_labels) for child_item in child_items] continue except: logging.warning( 'Wrong start-date format for item: "%s". Please use "start=<DD-MM-YYYY>"', item['content']) continue # Recurring task friendly - remove label with relative change from due date try: f = item['content'].find('start=due-') if f > -1: f1a = item['content'].find( 'd') # Find 'd' from 'due' f1b = item['content'].rfind( 'd') # Find 'd' from days f2 = item['content'].find('w') f_end = item['content'][f+10:].find(' ') if f_end > -1: offset = item['content'][f+10:f+10+f_end-1] else: offset = item['content'][f+10:-1] try: item_due_date = item['due']['date'] item_due_date = datetime.strptime( item_due_date, '%Y-%m-%d') except: logging.warning( 'No due date to determine start date for item: "%s".', item['content']) continue if f1a != f1b and f1b > -1: # To make sure it doesn't trigger if 'w' is chosen td = timedelta(days=int(offset)) elif f2 > -1: td = timedelta(weeks=int(offset)) # If we're not in the offset from the due date yet, remove all labels start_date = item_due_date - td future_diff = ( datetime.today()-start_date).days if future_diff < 0: remove_label( item, label_id, overview_item_ids, overview_item_labels) [remove_label(child_item, label_id, overview_item_ids, overview_item_labels) for child_item in child_items] continue except: logging.warning( 'Wrong start-date format for item: %s. Please use "start=due-<NUM><d or w>"', item['content']) continue # call overdue_recurring_completed if args.overdue is not None and args.overdue: overdue_recurring_completed(api) return overview_item_ids, overview_item_labels # Main def main(): # Version current_version = 'v1.5' # Main process functions. parser = argparse.ArgumentParser( formatter_class=make_wide(argparse.HelpFormatter, w=120, h=60)) parser.add_argument('-a', '--api_key', help='takes your Todoist API Key.', type=str) parser.add_argument( '-l', '--label', help='enable next action labelling. Define which label to use.', type=str) parser.add_argument( '-r', '--regeneration', help='enable regeneration of sub-tasks in recurring lists. Chose overall mode: 0 - regen off, 1 - regen all (default), 2 - regen only if all sub-tasks are completed. Task labels can be used to overwrite this mode.', nargs='?', const='1', default=None, type=int) parser.add_argument( '-o', '--overdue', help='overdue daily tasks next occurence gets set to today instead of tomorrow. Chose mode: 0 - off, 1 - on', nargs='?', const='1', default=None, type=int) parser.add_argument( '-e', '--end', help='enable alternative end-of-day time instead of default midnight. Enter a number from 1 to 24 to define which hour is used.', type=int) parser.add_argument( '-d', '--delay', help='specify the delay in seconds between syncs (default 5).', default=5, type=int) parser.add_argument( '-pp', '--pp_suffix', help='change suffix for parallel-parallel labeling (default "//").', default='//') parser.add_argument( '-ss', '--ss_suffix', help='change suffix for sequential-sequential labeling (default "--").', default='--') parser.add_argument( '-ps', '--ps_suffix', help='change suffix for parallel-sequential labeling (default "/-").', default='/-') parser.add_argument( '-sp', '--sp_suffix', help='change suffix for sequential-parallel labeling (default "-/").', default='-/') parser.add_argument( '-df', '--dateformat', help='strptime() format of starting date (default "%%d-%%m-%%Y").', default='%d-%m-%Y') parser.add_argument( '-hf', '--hide_future', help='prevent labelling of future tasks beyond a specified number of days.', default=0, type=int) parser.add_argument( '--onetime', help='update Todoist once and exit.', action='store_true') parser.add_argument( '--nocache', help='disables caching data to disk for quicker syncing.', action='store_true') parser.add_argument('--debug', help='enable debugging and store detailed to a log file.', action='store_true') parser.add_argument('--inbox', help='the method the Inbox should be processed with.', default=None, choices=['parallel', 'sequential']) args = parser.parse_args() print(args) # Addition of regeneration labels args.regen_label_names = ('Regen_off', 'Regen_all', 'Regen_all_if_completed') # Set debug if args.debug: log_level = logging.DEBUG else: log_level = logging.INFO logging.basicConfig(level=log_level, format='%(asctime)s %(levelname)-8s %(message)s', datefmt='%Y-%m-%d %H:%M:%S', handlers=[logging.FileHandler( 'debug.log', 'w+', 'utf-8'), logging.StreamHandler()] ) # Check for updates check_for_update(current_version) # Initialise api api, label_id, regen_labels_id = initialise(args) # Start main loop while True: start_time = time.time() sync(api) # Evaluate projects, sections, and items overview_item_ids, overview_item_labels = autodoist_magic( args, api, label_id, regen_labels_id) # Commit the queue with changes if label_id is not None: update_labels(api, label_id, overview_item_ids, overview_item_labels) if len(api.queue): len_api_q = len(api.queue) api.commit() if len_api_q == 1: logging.info( '%d change committed to Todoist.', len_api_q) else: logging.info( '%d changes committed to Todoist.', len_api_q) else: logging.info('No changes in queue, skipping sync.') # If onetime is set, exit after first execution. if args.onetime: break # Set a delay before next sync end_time = time.time() delta_time = end_time - start_time if args.delay - delta_time < 0: logging.debug( 'Computation time %d is larger than the specified delay %d. Sleeping skipped.', delta_time, args.delay) elif args.delay >= 0: sleep_time = args.delay - delta_time logging.debug('Sleeping
silent_option)) else: os.system("chown -R {} {}".format(owner+":"+group, path)) else: if sudo: os.system("sudo chown {} {} {}".format(owner+":"+group, path, silent_option)) else: os.system("chown {} {} {}".format(owner+":"+group, path, silent_option)) def check(self, owner=None, group=None, sudo=False, silent=False, iterate=False, recursive=False, path=None): # combine [recursive] and [iterate] to walk all set all files in an directory and check it with the given permission. if path == None: path = self.path if group == None: if OS in ["macos"]: group = "wheel" elif OS in ["linux"]: group = "root" else: raise ValueError("Unsupported operating system [{}].".format(OS)) _owner_, _group_ = self.get(path=path) if _owner_ != owner or _group_ != group: self.set(owner=owner, group=group, sudo=sudo, silent=silent, recursive=recursive, path=path) if recursive and iterate and Files.directory(self.path): for dirpath, subdirs, files in os.walk(self.path): for path in subdirs: #print("DIRECTORY:",path) #print("> FULL PATH NAME:",dirpath+"/"+path) if path not in ["lost+found"]: file_path = Formats.FilePath(dirpath+"/"+path) file_path.ownership.check(owner=owner, group=group, sudo=sudo, silent=silent) for path in files: #print("FILE NAME:",path) #print("> FULL PATH:",dirpath+"/"+path) file_path = Formats.FilePath(dirpath+"/"+path) file_path.ownership.check(owner=owner, group=group, sudo=sudo, silent=silent) class Permission(object): def __init__(self, path=None, load=False): # docs. DOCS = { "module":"FilePath.Permission", "initialized":False, "description":[], "chapter": "Defaults", } # defaults. #self.__class__.__name__ = "Permission" # init. self.path = path self.permission = None if load: self.permission = self.get() # - info: def get(self, path=None): if path == None: path = self.path status = os.stat(path) permission = oct(status.st_mode)[-3:] return permission def set(self, # the permission (int) (#1). permission=None, # the path (optional) (overwrites self.path) (#2). path=None, # root permission required. sudo=False, # recursive. recursive=False, # silent. silent=False, ): if path == None: path = self.path silent_option = "" if silent: silent_option = ' 2> /dev/null' if recursive: if sudo: os.system("sudo chmod -R {} {} {}".format(permission, path, silent_option)) else: os.system("chmod -R {} {} {}".format(permission, path, silent_option)) else: if sudo: os.system("sudo chmod {} {} {}".format(permission, path, silent_option)) else: os.system("chmod {} {} {}".format(permission, path, silent_option)) def check(self, permission=None, sudo=False, silent=False, iterate=False, recursive=False, path=None): # combine [recursive] and [iterate] to walk all set all files in an directory and check it with the given permission. if path == None: path = self.path if self.get(path=path) != permission: self.set(permission=permission, sudo=sudo, silent=silent, recursive=recursive, path=path) if recursive and iterate and Files.directory(path): for dirpath, subdirs, files in os.walk(path): for path in subdirs: #print("DIR NAME:",path) #print("> FULL PATH:",dirpath+"/"+path) if path not in ["lost+found"]: file_path = Formats.FilePath(dirpath+"/"+path) file_path.permission.check(permission=permission, sudo=sudo, silent=silent) for path in files: #print("FILE NAME:",path) #print("> FULL PATH:",dirpath+"/"+path) file_path = Formats.FilePath(dirpath+"/"+path) file_path.permission.check(permission=permission, sudo=sudo, silent=silent) # # the string object class. class String(object): def __init__(self, # the string's value (str) (#1). string="", # the path (str, FilePath) (param #2). path=False, # load the data on initialization. load=False, # the default array (will be created if file path does not exist). default=None, ): # docs. DOCS = { "module":"String", "initialized":False, "description":[], "chapter": "Defaults", } # init. self.string = str(string) # path. if path == False: self.file_path = self.fp = None # used in local memory (not fysical) else: self.file_path = self.fp = Formats.FilePath(path) if default != None and not Files.exists(self.file_path.path): self.save(array=default) if load: self.load() # def save(self, string=None, path=None, sudo=False): if string == None: string = self.string if path == None: path = self.file_path.path utils.__check_memory_only__(path) self.string = str(string) return Files.save(path, str(string), format="str", sudo=sudo) def load(self, default=None, sudo=False): utils.__check_memory_only__(self.file_path.path) if not os.path.exists(self.file_path.path) and default != None: self.save(default, sudo=sudo) self.string = Files.load(self.file_path.path, format="str", sudo=sudo) return self.string def is_numerical(self): for i in ["q", "w", "e", "r", "t", "y", "u", "i", "o", "p", "a", "s", "d", "f", "g", "h", "j", "k", "l", "z", "x", "c", "v", "b", "n", "m"]: if i in self.string.lower(): return False return True def bash(self): a = self.string.replace('(','\(').replace(')','\)').replace("'","\'").replace(" ","\ ").replace("$","\$").replace("!","\!").replace("?","\?").replace("@","\@").replace("$","\$").replace("%","\%").replace("^","\^").replace("&","\&").replace("*","\*").replace("'","\'").replace('"','\"') return a def identifier(self): x = self.string.lower().replace(' ','-') return x def variable_format(self, exceptions={ "smart_card":"smartcard", "smart_cards":"smartcards" , "web_server":"webserver" , }, ): s, c = "", 0 for i in self.string: try: n = self.string[c+1] except: n = "none" try: p = self.string[c-1] except: p = "none" if s != "" and i.lower() != i and str(n).lower() == str(n) and str(p).lower() == str(p): s += "_" s += i.lower() c += 1 if s in list(exceptions.keys()): return exceptions[s] else: return s def class_format(self): s, next_capital = "", False for i in self.string: if i == "_": next_capital = True elif next_capital: s += i.upper() else: s += i return s def capitalized_scentence(self): x = self.string.split(" ") cap = [y.capitalize() for y in x] return " ".join(cap) def capitalized_word(self): try: new = self.string[0].upper() c = 0 for i in self.string: if c > 0: new += i c += 1 return new except IndexError: return self.string def generate(self, # the length of the generated string. length=6, # include digits. digits=False, # include capital letters. capitalize=False, # include special characters. special=False, ): charset = ["a","b","c","d","e","f","g","h","i","j","k","l","m","n","o","p","q","r","s","t","u","v","w","x","y","z"] if capitalize: for i in ["a","b","c","d","e","f","g","h","i","j","k","l","m","n","o","p","q","r","s","t","u","v","w","x","y","z"]: charset.append(i.upper()) if digits: digits = ["1","2","3","4","5","6","7","8","9","0"] else: digits = [] if special: special = ["!", "?", "&", "#","@", "*"] else: special = [] s = "" for i in range(length): if len(digits) > 0 and random.randrange(1,101) <= 40: s += digits[random.randrange(0, len(digits))] elif len(special) > 0 and random.randrange(1,101) <= 10: s += special[random.randrange(0, len(special))] else: s += charset[random.randrange(0, len(charset))] return s # # iterate a string (backwards) to check the first occurency of a specified charset. def first_occurence(self, charset=[" ", "\n"], reversed=False, string=None): if string == None: string = self.string if reversed: c, space_newline_id = len(string)-1, "" for _ in string: char = string[c] if char in charset: a = 0 for i in charset: if i == char: return i c -= 1 return None else: c, space_newline_id = 0, "" for _ in string: char = string[c] if char in charset: a = 0 for i in charset: if i == char: return i c += 1 return None # splice a string into before/after by a first occurence. # if include is True and both include_before and inluce_after are False it includes at before. def before_after_first_occurence(self, slicer=" ", include=True, include_before=False, include_after=False, string=None): if isinstance(slicer, list): first = self.first_occurence(charset=slicer, string=string) return self.before_after_first_occurence(slicer=first, include=include, include_before=include_before, include_after=include_after, string=string) else: if string == None: string = self.string before, after, slice_count, slices, _last_ = "", "", string.count(slicer), 0, "" for char in string: if len(_last_) >= len(slicer): _last_ = _last_[1:] _last_ += char if _last_ == slicer: slices += 1 if include: if slices != slice_count or include_before: before += char elif include_after: after += char else: before += char elif slices > 0: after += char else: before += char return before, after # splice a string into before/selected/after by a first occurence. def before_selected_after_first_occurence(self, slicer=" ", string=None): if string == None: string = self.string before, selected, after, slice_count, open, _last_ = "", "", "", string.count(slicer), False, "" selected_sliced_count = 0 for char in string: if isinstance(slicer, str) and len(_last_) >= len(slicer): _last_ = _last_[1:] elif isinstance(slicer, list) and len(_last_) >= len(slicer[selected_sliced_count]): _last_ = _last_[1:] _last_ += char if (isinstance(slicer, str) and _last_ == slicer) or (isinstance(slicer, list) and _last_ == slicer[selected_sliced_count]): selected_sliced_count += 1 selected += char if open: open = False else: open = True elif open: after += char else: before += char return before, selected, after # splice a string into before/after by a last occurence. # if include is True and both include_before and inluce_after are False it includes at before. def before_after_last_occurence(self, slicer=" ", include=True, include_before=False, include_after=False, string=None): if string == None: string = self.string before, after, slice_count, slices, _last_ = "", "", string.count(slicer), 0, "" for char in string: if len(_last_) >= len(slicer): _last_ = _last_[1:] _last_ += char if _last_ == slicer: slices += 1 if include: if slices != slice_count or include_before: before += char elif include_after: after += char else: before += char elif slices == slice_count: after += char else: before += char return before, after # splice a string into before/selected/after by a last occurence. def before_selected_after_last_occurence(self, slicer=" ", string=None): if string == None: string = self.string before, selected, after, slice_count, slices, _last_ = "", "", "", string.count(slicer), 0, "" for char in string: if len(_last_) >= len(slicer): _last_ = _last_[1:] _last_ += char if _last_ == slicer: slices += 1 selected += char elif slices == slice_count: after += char else: before += char return before, selected, after # get the first text between an 2 string identifiers [start,end] by depth. # identifiers must be parameter number 1. def between(self, identifiers=["{","}"], depth=1, include=True, string=None): # vars. if string == None: string = self.string keep_last = [len(identifiers[0]), len(identifiers[1])] last = ["", ""] unadded = "" s, open, opened, first_open = "", 0, False, False # iterate. for i in string: # set last & unadded. unadded += i last[0] += i last[1] += i if len(last[0]) > keep_last[0]: last[0] = str(String(last[0]).remove_first(1)) if len(last[1]) > keep_last[1]: last[1] = str(String(last[1]).remove_first(1)) # check ids. if last[0] == identifiers[0]: open += 1 first_open = True elif last[1] == identifiers[1]: open -= 1 if open >= depth: if include or open == depth: if include and first_open: s += identifiers[0] unadded = "" first_open = False else: s += unadded unadded = "" opened = True if opened and open < depth: if include: s += unadded unadded = "" break # remainders. if unadded != "" and opened and open < depth: if include: s += unadded unadded = "" # handler. return Formats.String(s) # # get the text with betwee & replace the inside between str with a new str. def replace_between(self, # the between identifiers (list) (#1). identifiers=["{","}"], # the new string (str) (#2). to="", # the identifiers depth. depth=1, # the optional string. string=None, ): update = False if string == None: update = True string = self.string sliced = self.between(identifiers, depth=depth, include=True, string=string) string = string.replace(str(sliced), to) if update: self.string = string return string # # increase version. def increase_version(self): # version 2. # path = "/tmp/increase_version" Files.save(path, f"""version='{self.string}"""+"""' && echo $version | awk -F. -v OFS=. 'NF==1{print ++$NF}; NF>1{if(length($NF+1)>length($NF))$(NF-1)++; $NF=sprintf("%0*d", length($NF), ($NF+1)%(10^length($NF))); print}'""") return subprocess.check_output([f"bash", path]).decode().replace("\n","") #
# -*- coding: utf-8 -*- # ------------------------------------------------------------------------------ # # Copyright 2018 Fetch.AI Limited # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # ------------------------------------------------------------------------------ """ oef.messages ~~~~~~~~~~~~ This module contains classes to manage serialization of data in Protobuf messages. """ from abc import ABC, abstractmethod from typing import Optional, Union, List from enum import Enum from oef.schema import Description from oef import agent_pb2, fipa_pb2 from oef.query import Query NoneType = type(None) CFP_TYPES = Union[Query, bytes, NoneType] PROPOSE_TYPES = Union[bytes, List[Description]] class OEFErrorOperation(Enum): """Operation code for the OEF. It is returned in the OEF Error messages.""" REGISTER_SERVICE = 0 UNREGISTER_SERVICE = 1 REGISTER_DESCRIPTION = 2 UNREGISTER_DESCRIPTION = 3 class BaseMessage(ABC): """ An abstract class to represent the messages exchanged with the OEF. Every subclass must implement the :func:`~oef.messages.to_envelope` method that serialize the data into a protobuf message. """ def __init__(self, msg_id): """ Initialize a message. :param msg_id: the identifier of the message. """ self.msg_id = msg_id @abstractmethod def to_envelope(self) -> agent_pb2.Envelope: """ Pack the message into a protobuf message. :return: the envelope. """ class RegisterDescription(BaseMessage): """ This message is used for registering a new agent in the Agent Directory of an OEF Node. The agent is described by a :class:`~oef.schema.Description` object. It is used in the method :func:`~oef.core.OEFCoreInterface.register_agent`. """ def __init__(self, msg_id: int, agent_description: Description): """ Initialize a RegisterDescription message. :param msg_id: the identifier of the message. :param agent_description: the agent's description. """ super().__init__(msg_id) self.agent_description = agent_description def to_envelope(self) -> agent_pb2.Envelope: envelope = agent_pb2.Envelope() envelope.msg_id = self.msg_id envelope.register_description.CopyFrom(self.agent_description.to_agent_description_pb()) return envelope class RegisterService(BaseMessage): """ This message is used for registering a new agent in the Service Directory of an OEF Node. The service agent is described by a :class:`~oef.schema.Description` object. It is used in the method :func:`~oef.core.OEFCoreInterface.register_service`. """ def __init__(self, msg_id: int, service_description: Description): """ Initialize a RegisterService message. :param msg_id: the identifier of the message. :param service_description: the service agent's description. """ super().__init__(msg_id) self.service_description = service_description def to_envelope(self) -> agent_pb2.Envelope: envelope = agent_pb2.Envelope() envelope.msg_id = self.msg_id envelope.register_service.CopyFrom(self.service_description.to_agent_description_pb()) return envelope class UnregisterDescription(BaseMessage): """ This message is used for unregistering an agent in the Agent Directory of an OEF Node. It is used in the method :func:`~oef.core.OEFCoreInterface.unregister_agent`. """ def __init__(self, msg_id: int): """Initialize a UnregisterDescription message. :param msg_id: the identifier of the message. """ super().__init__(msg_id) def to_envelope(self) -> agent_pb2.Envelope: envelope = agent_pb2.Envelope() envelope.msg_id = self.msg_id envelope.unregister_description.CopyFrom(agent_pb2.Envelope.Nothing()) return envelope class UnregisterService(BaseMessage): """ This message is used for unregistering a `(service agent, description)` in the Service Directory of an OEF Node. The service agent is described by a :class:`~oef.schema.Description` object. It is used in the method :func:`~oef.core.OEFCoreInterface.unregister_service`. """ def __init__(self, msg_id: int, service_description): """ Initialize a UnregisterService message. :param msg_id: the identifier of the message. :param service_description: the service agent's description. """ super().__init__(msg_id) self.service_description = service_description def to_envelope(self) -> agent_pb2.Envelope: envelope = agent_pb2.Envelope() envelope.msg_id = self.msg_id envelope.unregister_service.CopyFrom(self.service_description.to_agent_description_pb()) return envelope class SearchAgents(BaseMessage): """ This message is used for searching agents in the Agent Directory of an OEF Node. It contains: * a search id, that identifies the search query. This id will be used by the sender in order to distinguish different incoming search results. * a query, i.e. a list of constraints defined over a data model. If everything works correctly, eventually, the sender of the message will receive a search result message and the agent's :func:`~oef.core.OEFCoreInterface.on_search_result` will be executed. It is used in the method :func:`~oef.core.OEFCoreInterface.search_agents`. """ def __init__(self, msg_id: int, query: Query): """ Initialize a SearchAgents message. :param msg_id: the identifier of the message. :param query: the query that describe the agent we are looking for. """ super().__init__(msg_id) self.query = query def to_envelope(self): envelope = agent_pb2.Envelope() envelope.msg_id = self.msg_id envelope.search_agents.query.CopyFrom(self.query.to_pb()) return envelope class SearchServices(BaseMessage): """ This message is used for searching services in the Service Directory of an OEF Node. It contains: * a search id, that identifies the search query. This id will be used by the sender in order to distinguish different incoming search results. * a query, i.e. a list of constraints defined over a data model. If everything works correctly, eventually, the sender of the message will receive a search result message and the agent's :func:`~oef.core.OEFCoreInterface.on_search_result` is executed. It is used in the method :func:`~oef.core.OEFCoreInterface.search_services`. """ def __init__(self, msg_id: int, query: Query): """ Initialize a SearchServices message. :param msg_id: the identifier of the message. :param query: the query that describe the agent we are looking for. """ super().__init__(msg_id) self.query = query def to_envelope(self) -> agent_pb2.Envelope: envelope = agent_pb2.Envelope() envelope.msg_id = self.msg_id envelope.search_services.query.CopyFrom(self.query.to_pb()) return envelope class AgentMessage(BaseMessage, ABC): """ This type of message is used for interacting with other agents, via an OEF Node. There are five different type of agent messages: 1. :class:`.Message`, to convey a generic message (that is, a sequence of bytes). 2. :class:`.CFP`, to make a `Call For Proposals` for some resources. 3. :class:`.Propose`, to make a `Proposal` about a specific resource. 4. :class:`.Accept`, to accept a previous `Proposal`. 5. :class:`.Decline`, to decline the negotiation. Using message 1 is the most generic way to interact with other OEF agent. It is flexible, but requires extra development efforts to come up with a working protocol. Messages 2-5 are used in the negotiation protocol, where some agents are buyers and other are sellers. The protocol is compliant with FIPA specifications. """ class Message(AgentMessage): """ This message is used to send a generic message to other agents. It contains: * a dialogue id, that identifies the dialogue in which the message is sent. * a destination, that is the public key of the recipient of the message. * a sequence of bytes, that is the content of the message. If everything works correctly, eventually, the recipient will receive the content of the message and the recipient's :func:`~oef.core.OEFCoreInterface.on_message` is executed. It is used in the method :func:`~oef.core.OEFCoreInterface.send_message`. """ def __init__(self, msg_id: int, dialogue_id: int, destination: str, msg: bytes): """ Initialize a simple message. :param msg_id: the identifier of the message. :param dialogue_id: the identifier of the dialogue. :param destination: the public key of the recipient agent. :param msg: the content of the message. """ super().__init__(msg_id) self.dialogue_id = dialogue_id self.destination = destination self.msg = msg def to_envelope(self) -> agent_pb2.Envelope: agent_msg = agent_pb2.Agent.Message() agent_msg.dialogue_id = self.dialogue_id agent_msg.destination = self.destination agent_msg.content = self.msg envelope = agent_pb2.Envelope() envelope.msg_id = self.msg_id envelope.send_message.CopyFrom(agent_msg) return envelope class CFP(AgentMessage): """ This message is used to send a `Call For Proposals`. It contains: * a message id, that is an unique identifier for a message, given the dialogue. * a dialogue id, that identifies the dialogue in which the message is sent. * a destination, that is the public key of the recipient of the message. * a target id, that is, the identifier of the message to whom this message is targeting, in a given dialogue. * a query, that describes the resources the sender is interested in. If everything works correctly, eventually, the recipient will receive the content of the message and the recipient's :func:`~oef.core.OEFCoreInterface.on_cfp` is executed. It is used in the method :func:`~oef.core.OEFCoreInterface.send_cfp`. """ def __init__(self, msg_id: int, dialogue_id: int, destination: str, target: int, query: CFP_TYPES): """ Initialize a `Call For Proposal` message. :param msg_id: the unique identifier of the message in the dialogue denoted by ``dialogue_id``. :param dialogue_id: the identifier of the dialogue. :param destination: the public key of the recipient agent. :param target: the identifier of the message to whom this message is targeting. :param query: the query, an instance of `~oef.schema.Query`, ``bytes``, or ``None``. """ super().__init__(msg_id) self.dialogue_id = dialogue_id self.destination = destination self.query = query self.target = target def to_envelope(self) -> agent_pb2.Agent.Message: fipa_msg
in parms: hstrainRef = wx.CheckBox(DData,wx.ID_ANY,label=Pa) hstrainRef.thisown = False hstrainRef.SetValue(ref) Indx[hstrainRef.GetId()] = [G2frame.hist,Id] hstrainRef.Bind(wx.EVT_CHECKBOX, OnHstrainRef) hstrainSizer.Add(hstrainRef,0,WACV|wx.LEFT,5) # azmthOff = G2G.ValidatedTxtCtrl(G2frame.dataDisplay,data,'azmthOff',nDig=(10,2),typeHint=float,OnLeave=OnAzmthOff) hstrainVal = wx.TextCtrl(DData,wx.ID_ANY,'%.3g'%(val),style=wx.TE_PROCESS_ENTER) Indx[hstrainVal.GetId()] = [G2frame.hist,Id] hstrainVal.Bind(wx.EVT_TEXT_ENTER,OnHstrainVal) hstrainVal.Bind(wx.EVT_KILL_FOCUS,OnHstrainVal) hstrainSizer.Add(hstrainVal,0,WACV) return hstrainSizer def PoTopSizer(POData): poSizer = wx.FlexGridSizer(0,6,5,5) choice = ['March-Dollase','Spherical harmonics'] POtype = choice[['MD','SH'].index(POData[0])] poSizer.Add(wx.StaticText(DData,wx.ID_ANY,' Preferred orientation model '),0,WACV) POType = wx.ComboBox(DData,wx.ID_ANY,value=POtype,choices=choice, style=wx.CB_READONLY|wx.CB_DROPDOWN) POType.Bind(wx.EVT_COMBOBOX, OnPOType) poSizer.Add(POType) if POData[0] == 'SH': poSizer.Add(wx.StaticText(DData,wx.ID_ANY,' Harmonic order: '),0,WACV) poOrder = wx.ComboBox(DData,wx.ID_ANY,value=str(POData[4]),choices=[str(2*i) for i in range(18)], style=wx.CB_READONLY|wx.CB_DROPDOWN) poOrder.Bind(wx.EVT_COMBOBOX,OnPOOrder) poSizer.Add(poOrder,0,WACV) poRef = wx.CheckBox(DData,wx.ID_ANY,label=' Refine? ') poRef.SetValue(POData[2]) poRef.Bind(wx.EVT_CHECKBOX,OnPORef) poSizer.Add(poRef,0,WACV) return poSizer def MDDataSizer(POData): poSizer = wx.BoxSizer(wx.HORIZONTAL) poRef = wx.CheckBox(DData,wx.ID_ANY,label=' March-Dollase ratio: ') poRef.SetValue(POData[2]) poRef.Bind(wx.EVT_CHECKBOX,OnPORef) poSizer.Add(poRef,0,WACV|wx.LEFT,5) poVal = G2G.ValidatedTxtCtrl(DData,POData,1,nDig=(10,3),typeHint=float,min=0.) poSizer.Add(poVal,0,WACV) poSizer.Add(wx.StaticText(DData,wx.ID_ANY,' Unique axis, H K L: '),0,WACV) h,k,l =POData[3] poAxis = wx.TextCtrl(DData,wx.ID_ANY,'%3d %3d %3d'%(h,k,l),style=wx.TE_PROCESS_ENTER) poAxis.Bind(wx.EVT_TEXT_ENTER,OnPOAxis) poAxis.Bind(wx.EVT_KILL_FOCUS,OnPOAxis) poSizer.Add(poAxis,0,WACV) return poSizer def SHDataSizer(POData): def OnODFValue(invalid,value,tc): G2plt.PlotSizeStrainPO(G2frame,data,G2frame.hist) ODFSizer = wx.FlexGridSizer(0,8,2,2) ODFkeys = list(POData[5].keys()) ODFkeys.sort() for odf in ODFkeys: ODFSizer.Add(wx.StaticText(DData,wx.ID_ANY,odf),0,WACV) ODFval = G2G.ValidatedTxtCtrl(DData,POData[5],odf,nDig=(8,3),typeHint=float,OnLeave=OnODFValue) ODFSizer.Add(ODFval,0,WACV|wx.LEFT,5) return ODFSizer def SHPenalty(POData): def OnHKLList(event): dlg = G2G.G2MultiChoiceDialog(G2frame, 'Select penalty hkls', 'Penalty hkls',hkls,filterBox=False) try: if dlg.ShowModal() == wx.ID_OK: POData[6] = [hkls[i] for i in dlg.GetSelections()] if not POData[6]: POData[6] = ['',] else: return finally: dlg.Destroy() wx.CallLater(100,RepaintHistogramInfo,DData.GetScrollPos(wx.VERTICAL)) A = G2lat.cell2A(generalData['Cell'][1:7]) hkls = G2lat.GenPfHKLs(10,SGData,A) shPenalty = wx.BoxSizer(wx.HORIZONTAL) shPenalty.Add(wx.StaticText(DData,wx.ID_ANY,' Negative MRD penalty list: '),0,WACV) shPenalty.Add(wx.ComboBox(DData,value=POData[6][0],choices=POData[6], style=wx.CB_DROPDOWN),0,WACV|wx.LEFT,5) hklList = wx.Button(DData,label='Select penalty hkls') hklList.Bind(wx.EVT_BUTTON,OnHKLList) shPenalty.Add(hklList,0,WACV) shPenalty.Add(wx.StaticText(DData,wx.ID_ANY,' Zero MRD tolerance: '),0,WACV) shToler = G2G.ValidatedTxtCtrl(DData,POData,7,nDig=(10,2),typeHint=float) shPenalty.Add(shToler,0,WACV) return shPenalty def ExtSizer(Type): def OnSCExtType(event): Obj = event.GetEventObject() item = Indx[Obj.GetId()] UseList[item[0]]['Extinction'][item[1]] = Obj.GetValue() wx.CallLater(100,RepaintHistogramInfo,DData.GetScrollPos(wx.VERTICAL)) def OnEref(event): Obj = event.GetEventObject() item = Indx[Obj.GetId()] UseList[item[0]]['Extinction'][2][item[1]][1] = Obj.GetValue() def OnExtRef(event): Obj = event.GetEventObject() UseList[G2frame.hist]['Extinction'][1] = Obj.GetValue() if Type == 'HKLF': extSizer = wx.BoxSizer(wx.VERTICAL) typeSizer = wx.BoxSizer(wx.HORIZONTAL) typeSizer.Add(wx.StaticText(DData,wx.ID_ANY,' Extinction type: '),0,WACV) Choices = ['None','Primary','Secondary Type I','Secondary Type II',] # remove 'Secondary Type I & II' typeTxt = wx.ComboBox(DData,wx.ID_ANY,choices=Choices,value=UseList[G2frame.hist]['Extinction'][1], style=wx.CB_READONLY|wx.CB_DROPDOWN) Indx[typeTxt.GetId()] = [G2frame.hist,1] typeTxt.Bind(wx.EVT_COMBOBOX,OnSCExtType) typeSizer.Add(typeTxt) typeSizer.Add(wx.StaticText(DData,wx.ID_ANY,' Approx: '),0,WACV) Choices=['Lorentzian','Gaussian'] approxTxT = wx.ComboBox(DData,wx.ID_ANY,choices=Choices,value=UseList[G2frame.hist]['Extinction'][0], style=wx.CB_READONLY|wx.CB_DROPDOWN) Indx[approxTxT.GetId()] = [G2frame.hist,0] approxTxT.Bind(wx.EVT_COMBOBOX,OnSCExtType) typeSizer.Add(approxTxT) if UseList[G2frame.hist]['Extinction'][1] == 'None': extSizer.Add(typeSizer,0,WACV) else: extSizer.Add(typeSizer,0,WACV|wx.BOTTOM,5) if 'Tbar' in UseList[G2frame.hist]['Extinction'][2]: #skipped for TOF valSizer =wx.BoxSizer(wx.HORIZONTAL) valSizer.Add(wx.StaticText(DData,wx.ID_ANY,' Tbar(mm):'),0,WACV) tbarVal = G2G.ValidatedTxtCtrl(DData,UseList[G2frame.hist]['Extinction'][2],'Tbar', min=0.,nDig=(10,3),typeHint=float) valSizer.Add(tbarVal,0,WACV) valSizer.Add(wx.StaticText(DData,wx.ID_ANY,' cos(2ThM):'),0,WACV) cos2tm = G2G.ValidatedTxtCtrl(DData,UseList[G2frame.hist]['Extinction'][2],'Cos2TM', min=0.,max=1.,nDig=(10,3),typeHint=float) valSizer.Add(cos2tm,0,WACV) extSizer.Add(valSizer,0,WACV) val2Sizer =wx.BoxSizer(wx.HORIZONTAL) if 'Primary' in UseList[G2frame.hist]['Extinction'][1]: Ekey = ['Ep',] elif 'Secondary Type II' == UseList[G2frame.hist]['Extinction'][1]: Ekey = ['Es',] elif 'Secondary Type I' == UseList[G2frame.hist]['Extinction'][1]: Ekey = ['Eg',] else: Ekey = ['Eg','Es'] for ekey in Ekey: Eref = wx.CheckBox(DData,wx.ID_ANY,label=ekey+' : ') Eref.SetValue(UseList[G2frame.hist]['Extinction'][2][ekey][1]) Indx[Eref.GetId()] = [G2frame.hist,ekey] Eref.Bind(wx.EVT_CHECKBOX, OnEref) val2Sizer.Add(Eref,0,WACV|wx.LEFT,5) Eval = G2G.ValidatedTxtCtrl(DData,UseList[G2frame.hist]['Extinction'][2][ekey],0, min=0.,nDig=(10,3,'g'),typeHint=float) val2Sizer.Add(Eval,0,WACV) extSizer.Add(val2Sizer,0,WACV) else: #PWDR extSizer = wx.BoxSizer(wx.HORIZONTAL) extRef = wx.CheckBox(DData,wx.ID_ANY,label=' Extinction: ') extRef.SetValue(UseList[G2frame.hist]['Extinction'][1]) extRef.Bind(wx.EVT_CHECKBOX, OnExtRef) extSizer.Add(extRef,0,WACV|wx.LEFT,5) extVal = G2G.ValidatedTxtCtrl(DData,UseList[G2frame.hist]['Extinction'],0, min=0.,nDig=(10,2),typeHint=float) extSizer.Add(extVal,0,WACV) return extSizer def BabSizer(): def OnBabRef(event): Obj = event.GetEventObject() item,bab = Indx[Obj.GetId()] UseList[item]['Babinet']['Bab'+bab][1] = Obj.GetValue() babSizer = wx.BoxSizer(wx.HORIZONTAL) for bab in ['A','U']: babRef = wx.CheckBox(DData,wx.ID_ANY,label=' Babinet '+bab+': ') babRef.SetValue(UseList[G2frame.hist]['Babinet']['Bab'+bab][1]) Indx[babRef.GetId()] = [G2frame.hist,bab] babRef.Bind(wx.EVT_CHECKBOX, OnBabRef) babSizer.Add(babRef,0,WACV|wx.LEFT,5) babVal = G2G.ValidatedTxtCtrl(DData,UseList[G2frame.hist]['Babinet']['Bab'+bab],0, nDig=(10,3),min=0.,typeHint=float) babSizer.Add(babVal,0,WACV) return babSizer def FlackSizer(): def OnFlackRef(event): Obj = event.GetEventObject() UseList[G2frame.hist]['Flack'][1] = Obj.GetValue() flackSizer = wx.BoxSizer(wx.HORIZONTAL) flackRef = wx.CheckBox(DData,wx.ID_ANY,label=' Flack parameter: ') flackRef.SetValue(UseList[G2frame.hist]['Flack'][1]) flackRef.Bind(wx.EVT_CHECKBOX, OnFlackRef) flackSizer.Add(flackRef,0,WACV|wx.LEFT,5) flackVal = G2G.ValidatedTxtCtrl(DData,UseList[G2frame.hist]['Flack'],0,nDig=(10,3),typeHint=float) flackSizer.Add(flackVal,0,WACV) return flackSizer def twinSizer(): def OnAddTwin(event): twinMat = np.array([[-1,0,0],[0,-1,0],[0,0,-1]]) #inversion by default twinVal = 0.0 UseList[G2frame.hist]['Twins'].append([twinMat,twinVal]) nNonM = UseList[G2frame.hist]['Twins'][0][1][2] for i in range(nNonM): UseList[G2frame.hist]['Twins'].append([False,0.0]) addtwin.SetValue(False) wx.CallLater(100,RepaintHistogramInfo,DData.GetScrollPos(wx.VERTICAL)) def OnMat(event): event.Skip() Obj = event.GetEventObject() it,im = Indx[Obj.GetId()] newMat = Obj.GetValue().split() try: uvw = [int(newMat[i]) for i in range(3)] except ValueError: uvw = UseList[G2frame.hist]['Twins'][it][0][im] UseList[G2frame.hist]['Twins'][it][0][im] = uvw Obj.SetValue('%3d %3d %3d'%(uvw[0],uvw[1],uvw[2])) def OnTwinVal(invalid,value,tc): it = Indx[tc.GetId()] sumTw = 0. for it,twin in enumerate(UseList[G2frame.hist]['Twins']): if it: sumTw += twin[1] UseList[G2frame.hist]['Twins'][0][1][0] = 1.-sumTw wx.CallLater(100,RepaintHistogramInfo,DData.GetScrollPos(wx.VERTICAL)) def OnTwinRef(event): Obj = event.GetEventObject() UseList[G2frame.hist]['Twins'][0][1][1] = Obj.GetValue() def OnTwinInv(event): Obj = event.GetEventObject() it = Indx[Obj.GetId()] UseList[G2frame.hist]['Twins'][it][0] = Obj.GetValue() def OnTwinDel(event): Obj = event.GetEventObject() it = Indx[Obj.GetId()] nNonM = UseList[G2frame.hist]['Twins'][0][1][2] for i in range(nNonM): del UseList[G2frame.hist]['Twins'][1+i+it] del UseList[G2frame.hist]['Twins'][it] sumTw = 0. for it,twin in enumerate(UseList[G2frame.hist]['Twins']): if it: sumTw += twin[1] UseList[G2frame.hist]['Twins'][0][1][0] = 1.-sumTw if len(UseList[G2frame.hist]['Twins']) == 1: UseList[G2frame.hist]['Twins'][0][1][1] = False wx.CallLater(100,RepaintHistogramInfo,DData.GetScrollPos(wx.VERTICAL)) nTwin = len(UseList[G2frame.hist]['Twins']) twinsizer = wx.BoxSizer(wx.VERTICAL) topsizer = wx.BoxSizer(wx.HORIZONTAL) topsizer.Add(wx.StaticText(DData,wx.ID_ANY,' Merohedral twins: '),0,WACV) #temporary - add twin not allowed if nonmerohedral twins present # if nTwin == 1 or 'bool' not in str(type(UseList[G2frame.hist]['Twins'][1][0])): addtwin = wx.CheckBox(DData,wx.ID_ANY,label=' Add Twin Law') addtwin.Bind(wx.EVT_CHECKBOX, OnAddTwin) topsizer.Add(addtwin,0,WACV|wx.LEFT,5) twinsizer.Add(topsizer) Indx = {} if nTwin > 1: for it,Twin in enumerate(UseList[G2frame.hist]['Twins']): twinMat,twinVal = Twin matSizer = wx.BoxSizer(wx.HORIZONTAL) if it: Style = wx.TE_PROCESS_ENTER TwVal = Twin[1] else: Style = wx.TE_READONLY TwVal = Twin[1][0] if 'bool' not in str(type(Twin[0])): matSizer.Add(wx.StaticText(DData,-1,' Twin Law: '),0,WACV|wx.LEFT,5) for im,Mat in enumerate(twinMat): mat = wx.TextCtrl(DData,wx.ID_ANY,'%3d %3d %3d'%(Mat[0],Mat[1],Mat[2]), style=Style) if it: Indx[mat.GetId()] = [it,im] mat.Bind(wx.EVT_TEXT_ENTER,OnMat) mat.Bind(wx.EVT_KILL_FOCUS,OnMat) else: mat.SetBackgroundColour(VERY_LIGHT_GREY) matSizer.Add(mat,0,WACV|wx.LEFT,5) else: matSizer.Add(wx.StaticText(DData,-1,' Nonmerohedral twin component %d: '%(it)),0,WACV|wx.LEFT,5) if not SGData['SGInv']: twinv = wx.CheckBox(DData,wx.ID_ANY,label=' Use enantiomorph?') twinv.SetValue(Twin[0]) Indx[twinv.GetId()] = it twinv.Bind(wx.EVT_CHECKBOX, OnTwinInv) matSizer.Add(twinv,0,WACV) twinsizer.Add(matSizer,0,WACV|wx.LEFT,5) valSizer = wx.BoxSizer(wx.HORIZONTAL) valSizer.Add(wx.StaticText(DData,-1,label=' Twin element fraction:'),0,WACV) if it: twinval = G2G.ValidatedTxtCtrl(DData,UseList[G2frame.hist]['Twins'][it],1,nDig=(10,3), min=0.,max=1.,typeHint=float,OnLeave=OnTwinVal) Indx[twinval.GetId()] = it else: twinval = wx.TextCtrl(DData,-1,'%.3f'%(TwVal),style=Style) twinval.SetBackgroundColour(VERY_LIGHT_GREY) valSizer.Add(twinval,0,WACV) if it and 'bool' not in str(type(Twin[0])): twindel = wx.CheckBox(DData,wx.ID_ANY,label=' Delete?') Indx[twindel.GetId()] = it twindel.Bind(wx.EVT_CHECKBOX, OnTwinDel) valSizer.Add(twindel,0,WACV) elif not it: twinref = wx.CheckBox(DData,wx.ID_ANY,label=' Refine?') twinref.SetValue(Twin[1][1]) twinref.Bind(wx.EVT_CHECKBOX, OnTwinRef) valSizer.Add(twinref,0,WACV) twinsizer.Add(valSizer,0,WACV|wx.LEFT,5) return twinsizer def OnSelect(event): G2frame.hist = G2frame.dataWindow.HistsInPhase[DData.select.GetSelection()] oldFocus = wx.Window.FindFocus() G2plt.PlotSizeStrainPO(G2frame,data,G2frame.hist) wx.CallLater(100,RepaintHistogramInfo) if oldFocus: wx.CallAfter(oldFocus.SetFocus) def RepaintHistogramInfo(Scroll=0): if 'phoenix' in wx.version(): G2frame.bottomSizer.Clear(True) # deal with case where this is called after another tree item has been selected try: DData.Shown except RuntimeError: if GSASIIpath.GetConfigValue('debug'): print('DBG: DData window deleted. Ignoring RepaintHistogramInfo, forcing redraw') # Repaint called while DData window deleted, force redraw of entire window import GSASIIdataGUI G2frame.PickIdText = '' wx.CallLater(100,GSASIIdataGUI.SelectDataTreeItem,G2frame,G2frame.GPXtree.Selection) return else: # deal with case where this is called after another tree item has been selected if DData.__class__ is not wx._windows.ScrolledWindow: # fix bug where this is called after the Window is deleted return G2frame.bottomSizer.DeleteWindows() Indx.clear() G2frame.bottomSizer = ShowHistogramInfo() mainSizer.Add(G2frame.bottomSizer) mainSizer.Layout() G2frame.dataWindow.Refresh() DData.SetVirtualSize(mainSizer.GetMinSize()) DData.Scroll(0,Scroll) G2frame.dataWindow.SendSizeEvent() def ShowHistogramInfo(): '''This creates a sizer with all the information pulled out from the Phase/data dict ''' def OnUseData(event): Obj = event.GetEventObject() UseList[G2frame.hist]['Use'] = Obj.GetValue() wx.CallLater(100,RepaintHistogramInfo,DData.GetScrollPos(wx.VERTICAL)) def OnLeBail(event): Obj = event.GetEventObject() if not UseList[G2frame.hist]['LeBail']: UseList[G2frame.hist]['newLeBail'] = True Obj.SetLabel('Do new LeBail extraction?') UseList[G2frame.hist]['LeBail'] = Obj.GetValue() def OnResetSize(event): Obj = event.GetEventObject() Obj.SetValue(False) item,name = Indx[Obj.GetId()] if name == 'isotropic': UseList[item]['Size'][1][0] = 1.0 elif name == 'uniaxial': UseList[item]['Size'][1][0] = 1.0 UseList[item]['Size'][1][1] = 1.0 elif name == 'ellipsoidal': for i in range(3): UseList[item]['Size'][4][i] = 1.0 UseList[item]['Size'][4][i+3] = 0.0 G2plt.PlotSizeStrainPO(G2frame,data,item) wx.CallLater(100,RepaintHistogramInfo,DData.GetScrollPos(wx.VERTICAL)) def OnSizeAxis(event): event.Skip() Obj = event.GetEventObject() Saxis = Obj.GetValue().split() try: hkl = [int(Saxis[i]) for i in range(3)] except (ValueError,IndexError): hkl = UseList[G2frame.hist]['Size'][3] if not np.any(np.array(hkl)): hkl = UseList[G2frame.hist]['Size'][3] UseList[G2frame.hist]['Size'][3] = hkl h,k,l = hkl Obj.SetValue('%3d %3d %3d'%(h,k,l)) def OnFixVals(event): Obj = event.GetEventObject() UseList[G2frame.hist]['Fix FXU'] = Obj.GetValue() if G2frame.hist not in UseList: G2frame.ErrorDialog('Missing data error', G2frame.hist+' not in GSAS-II data tree') return if 'Use' not in UseList[G2frame.hist]: #patch UseList[G2frame.hist]['Use'] = True if 'LeBail' not in UseList[G2frame.hist]: UseList[G2frame.hist]['LeBail'] = False if 'newLeBail' not in UseList[G2frame.hist]: UseList[G2frame.hist]['newLeBail'] = True if 'Babinet' not in UseList[G2frame.hist]: UseList[G2frame.hist]['Babinet'] = {'BabA':[0.0,False],'BabU':[0.0,False]} if 'Fix FXU' not in UseList[G2frame.hist]: UseList[G2frame.hist]['Fix FXU'] = ' ' bottomSizer = wx.BoxSizer(wx.VERTICAL) useBox = wx.BoxSizer(wx.HORIZONTAL) useData = wx.CheckBox(DData,wx.ID_ANY,label='Use Histogram: '+G2frame.hist+' ?') useData.Bind(wx.EVT_CHECKBOX, OnUseData) useData.SetValue(UseList[G2frame.hist]['Use']) useBox.Add(useData,0,WACV) if not generalData['doPawley'] and 'PWDR' in G2frame.hist[:4]: lbLabel = 'Redo LeBail extraction? ' if UseList[G2frame.hist]['newLeBail']: lbLabel = 'Do new LeBail extraction?' lebail = wx.CheckBox(DData,wx.ID_ANY,label=lbLabel) lebail.Bind(wx.EVT_CHECKBOX, OnLeBail) lebail.SetValue(UseList[G2frame.hist]['LeBail']) useBox.Add(lebail,0,WACV) if UseList[G2frame.hist]['LeBail']: G2frame.SetStatusText('To reset LeBail, cycle LeBail check box.',1) bottomSizer.Add(useBox,0,WACV|wx.TOP|wx.BOTTOM|wx.LEFT,5) fixBox = wx.BoxSizer(wx.HORIZONTAL) parmChoice = [' ','X','XU','U','F','FX','FXU','FU'] if generalData['Type'] == 'magnetic': parmChoice += ['M','MX','MXU','MU','MF','MFX','MFXU','MFU'] fixBox.Add(wx.StaticText(DData,label=' In sequential refinement, fix these in '+generalData['Name']+' for this histogram: '),0,WACV) fixVals = wx.ComboBox(DData,value=UseList[G2frame.hist]['Fix FXU'],choices=parmChoice, style=wx.CB_DROPDOWN) fixVals.Bind(wx.EVT_COMBOBOX,OnFixVals) fixBox.Add(fixVals,0,WACV) bottomSizer.Add(fixBox) #TODO - put Sequential refinement fix F? fix X? fix U? CheckBox here bottomSizer.Add(ScaleSizer(),0,WACV|wx.BOTTOM,5) if G2frame.hist[:4] == 'PWDR': if UseList[G2frame.hist]['Size'][0] == 'isotropic': isoSizer = wx.BoxSizer(wx.HORIZONTAL) isoSizer.Add(TopSizer(' Domain size model: ',['isotropic','uniaxial','ellipsoidal'], 'Size',OnSizeType),0,WACV) isoSizer.Add(LGmixSizer('Size',OnLGmixVal,OnLGmixRef)) isoSizer.Add(ResetSizer('isotropic',OnResetSize),0,WACV) bottomSizer.Add(isoSizer) bottomSizer.Add(IsoSizer(u'size(\xb5m): ','Size','%.3f', OnSizeVal,OnSizeRef),0,WACV|wx.BOTTOM,5) elif UseList[G2frame.hist]['Size'][0] == 'uniaxial': uniSizer = wx.BoxSizer(wx.HORIZONTAL) uniSizer.Add(TopSizer(' Domain size model: ',['isotropic','uniaxial','ellipsoidal'], 'Size',OnSizeType),0,WACV) uniSizer.Add(LGmixSizer('Size',OnLGmixVal,OnLGmixRef)) uniSizer.Add(ResetSizer('uniaxial',OnResetSize),0,WACV) bottomSizer.Add(UniSizer('Size',OnSizeAxis),0,WACV) bottomSizer.Add(uniSizer) bottomSizer.Add(UniDataSizer(u'size(\xb5m): ','Size','%.3f',OnSizeVal,OnSizeRef) ,0,WACV|wx.BOTTOM,5) elif UseList[G2frame.hist]['Size'][0]
<reponame>florianjehn/IPCC-Reports-Focus-Overview<gh_stars>0 # -*- coding: utf-8 -*- """ Created on Fri Sep 17 10:12:26 2021 @author: <NAME> """ import os import pandas as pd import numpy as np import re import random def read_ipcc_counts_temp(): """reads all counts of temperatures for all reports and makes on df""" files = os.listdir(os.getcwd()+os.sep+"Results"+ os.sep + "temperatures") all_df = pd.DataFrame() for file in files: file_df = pd.read_csv("Results" + os.sep + "temperatures" + os.sep + file, sep=";", index_col=0) file_df.columns = [file[:-4]] all_df = pd.concat([all_df, file_df], axis=1) return all_df.transpose() def read_ipcc_counts_dates(): """reads all counts of dates for all reports and makes on df""" files = os.listdir(os.getcwd()+os.sep+"Results"+ os.sep + "dates") all_df = pd.DataFrame() for file in files: file_df = pd.read_csv("Results" + os.sep + "dates" + os.sep + file, sep=";", index_col=0) file_df.columns = [file[:-4]] all_df = pd.concat([all_df, file_df], axis=1) return all_df.transpose() def read_ipcc_counts_rfc(): """reads all counts of reasons of concern for all reports and makes on df""" files = os.listdir(os.getcwd()+os.sep+"Results"+ os.sep + "reasons_for_concern") all_df = pd.DataFrame() for file in files: file_df = pd.read_csv("Results" + os.sep + "reasons_for_concern" + os.sep + file, sep=";", index_col=0) file_df.columns = [file[:-4]] all_df = pd.concat([all_df, file_df], axis=1) return all_df.transpose() def read_false_positive(): """reads in all the counted false/true positive rates for the temperatres in the IPCC and calculates a true positive rate for each entry""" files = os.listdir(os.getcwd()+os.sep+"Results"+ os.sep + "false_positive_check_files") all_df = pd.DataFrame() for file in files: # only read those files that contains the counting results if "results" not in file: continue file_df = pd.read_csv("Results" + os.sep + "false_positive_check_files" + os.sep + file, sep=",", index_col=0) # calculate the true positive rate file_df["True Positive Rate [%]"] = (file_df["n true positive"]/(file_df["n true positive"]+file_df["n false positive"]))*100 # Arange the df for seaborn file_df["Temperature [°C]"] = file_df.index file_df.reset_index(inplace=True, drop=True) all_df = pd.concat([all_df, file_df]) return all_df def scale_counts(ipcc_counts): """scale the counts by overall sum""" sums = ipcc_counts.sum(axis=1) for col in ipcc_counts: ipcc_counts[col] = ipcc_counts[col]/sums*100 return ipcc_counts def read_meta(): """reads in the meta data of the reports""" meta = pd.read_csv("Reports" + os.sep + "meta_data_reports.tsv", sep="\t") meta["Year"] = meta["Year"].astype("str") return meta def group_temps(ipcc_counts): """groups the temperatures into three categories""" ipcc_counts["0.5°C - 2°C"] = ipcc_counts[" 0.5°C"] + ipcc_counts[" 1°C"] + ipcc_counts[" 1.5°C"] +ipcc_counts[" 2°C"] ipcc_counts["2.5°C - 4°C"] = ipcc_counts[" 2.5°C"] + ipcc_counts[" 3°C"] + ipcc_counts[" 3.5°C"] +ipcc_counts[" 4°C"] ipcc_counts["≥ 4.5°C"] = ipcc_counts[" 4.5°C"] + ipcc_counts[" 5°C"] + ipcc_counts[" 5.5°C"] +ipcc_counts[" 6°C"] +ipcc_counts[" 6.5°C"] + ipcc_counts[" 7°C"] + ipcc_counts[" 7.5°C"] +ipcc_counts[" 8°C"] + ipcc_counts[" 8.5°C"] + ipcc_counts[" 9°C"] + ipcc_counts[" 9.5°C"] +ipcc_counts[" 10°C"] return ipcc_counts.iloc[:,20:] def merge_counts_meta(ipcc_counts, meta): """merges the df with the counted temperatures/rfcs with the metadata""" return pd.merge(meta, ipcc_counts, right_index=True, left_on="count_names") def lookup_names(): """"Returns lookup dict for different files names to merge them""" lookup_dict = { "IPCC_AR6_WGI_Full_Report":"counts_IPCC_AR6_WGI_Full_Report_parsed", "IPCC_AR6_WGII_Full_Report":"counts_IPCC_AR6_WGII_FinalDraft_FullReport_parsed", "IPCC_AR6_WGIII_FinalDraft_FullReport":"counts_IPCC_AR6_WGIII_FinalDraft_FullReport_parsed", "SROCC_FullReport_FINAL":"counts_SROCC_FullReport_FINAL_parsed", "210714-IPCCJ7230-SRCCL-Complete-BOOK-HRES":"counts_210714-IPCCJ7230-SRCCL-Complete-BOOK-HRES_parsed", "SR15_Full_Report_Low_Res":"counts_SR15_Full_Report_Low_Res_parsed", "SYR_AR5_FINAL_full":"counts_SYR_AR5_FINAL_full_wcover_parsed", "ipcc_wg3_ar5_full":"counts_ipcc_wg3_ar5_full_parsed", "WGIIAR5-PartA_FINAL":"counts_WGIIAR5-PartA_FINAL_parsed", "WGIIAR5-PartB_FINAL":"counts_WGIIAR5-PartB_FINAL_parsed", "WG1AR5_all_final":"counts_WG1AR5_all_final_parsed", "SREX_Full_Report-1":"counts_SREX_Full_Report-1_parsed", "SRREN_Full_Report-1":"counts_SRREN_Full_Report-1_parsed", "ar4_syr_full_report":"counts_ar4_syr_full_report_parsed", "ar4_wg2_full_report":"counts_ar4_wg2_full_report_parsed", "ar4_wg1_full_report-1":"counts_ar4_wg1_full_report-1_parsed", "ar4_wg3_full_report-1":"counts_ar4_wg3_full_report-1_parsed", "sroc_full-1":"counts_sroc_full-1_parsed", "srccs_wholereport-1":"counts_srccs_wholereport-1_parsed", "SYR_TAR_full_report":"counts_SYR_TAR_full_report_parsed", "WGII_TAR_full_report-2":"counts_WGII_TAR_full_report-2_parsed", "WGI_TAR_full_report":"counts_WGI_TAR_full_report_parsed", "WGIII_TAR_full_report":"counts_WGIII_TAR_full_report_parsed", "srl-en-1":"counts_srl-en-1_parsed", "srtt-en-1":"counts_srtt-en-1_parsedd", "emissions_scenarios-1":"counts_emissions_scenarios-1_parsed", "av-en-1":"counts_av-en-1_parsed", "The-Regional-Impact":"counts_The-Regional-Impact_parsed", "2nd-assessment-en-1":"counts_2nd-assessment-en-1_parsed", "ipcc_sar_wg_III_full_report":"counts_ipcc_sar_wg_III_full_report_parsed", "ipcc_sar_wg_II_full_report":"counts_ipcc_sar_wg_II_full_report_parsed", "ipcc_sar_wg_I_full_report":"counts_ipcc_sar_wg_I_full_report_parsed", "climate_change_1994-2":"counts_climate_change_1994-2_parsed", # "ipcc-technical-guidelines-1994n-1":"", # could not read in, but also contains no temp mentions "ipcc_wg_I_1992_suppl_report_full_report":"counts_ipcc_wg_I_1992_suppl_report_full_report_parsed", "ipcc_wg_II_1992_suppl_report_full_report":"counts_ipcc_wg_II_1992_suppl_report_full_report_parsed", "ipcc_90_92_assessments_far_full_report":"counts_ipcc_90_92_assessments_far_full_report_parsed", "ipcc_far_wg_III_full_report":"counts_ipcc_far_wg_III_full_report_parsed", "ipcc_far_wg_II_full_report":"counts_ipcc_far_wg_II_full_report_parsed", "ipcc_far_wg_I_full_report":"counts_ipcc_far_wg_I_full_report_parsed", } return lookup_dict def create_temp_keys(): """Creates a list of strings for all temperatures the paper looked at""" temps = [] for i,temp in enumerate(np.arange(0.5,10.1,0.5)): if i % 2 != 0: temps.append(" "+str(int(temp))+"°C") else: temps.append(" "+str(temp)+"°C" ) return temps def combine_all_raw_strings(): """combines all raw strings into one big file to search through""" reports = [file for file in os.listdir(os.getcwd() + os.sep + "Raw IPCC Strings") if file[-4:] == ".csv" ] all_reports = " " for report in reports: print("Starting with " + report) report_df = pd.read_csv(os.getcwd() + os.sep + "Raw IPCC Strings" + os.sep + report, sep="\t", usecols=[0]) report_list = report_df[report_df.columns[0]].tolist() report_str = " ".join([str(item) for item in report_list]) all_reports += report_str with open(os.getcwd() + os.sep + "Raw IPCC Strings" + os.sep + "all_ipcc_strings.csv", 'w', encoding='utf-8') as f: # this file is not included in the repository, as it is too large for Github f.write(all_reports) def create_temp_dict(): """Creates a dictionary for all the single temperatures to count and returns it""" temp_dict = {} for i in np.arange(0.5,10.5, 0.5): # Test if it is a float or not to format it right if i == int(i): # Add an empty space at the beginnign to make sure this is not counting e.g. 1.5°C as 5°C key = " " + str(int(i)) + "°C" else: key = " " + str(i )+ "°C" temp_dict[key] = 0 return temp_dict def get_all_string(report): with open(os.getcwd() + os.sep + "Raw IPCC Strings" + os.sep + report, 'r', encoding='utf-8') as f: return f.read() def count_temperatures(report): """counts all temperatures between 0.5°C and 10°C in 0.5°C steps""" temp_dict = create_temp_dict() report_df = pd.read_csv(os.getcwd() + os.sep + "Raw IPCC Strings" + os.sep + report, sep="\t", usecols=[0]) report_list = report_df[report_df.columns[0]].tolist() report_str = " ".join([str(item) for item in report_list]) # count how often a temperature occures for temp in temp_dict.keys(): number_of_occurences = report_str.count(temp) print("Found " + temp + " " + str(number_of_occurences) + " time(s)") temp_dict[temp] += number_of_occurences # Save the results for the single pdf temp_counts_pdf = pd.DataFrame.from_dict(temp_dict, orient="index") temp_counts_pdf.to_csv("Results" + os.sep + "temperatures" + os.sep + "counts_" + report[:-4] + ".csv", sep=";") def count_temp_in_all_reports(): """iterates over all reports""" reports = [file for file in os.listdir(os.getcwd() + os.sep + "Raw IPCC Strings") if file[-4:] == ".csv" ] for report in reports: print("Starting with " + report) count_temperatures(report) def create_rfc_dict(): """Creates a dictionary for all "reasons for concern" to count and returns it""" rfc_dict = { "unique and threatened systems":0, "extreme climate events":0, "distribution of impacts":0, "aggregate impacts":0, "large-scale singular event":0 } return rfc_dict def count_rfc(report): """counts all reasons of concerns mentioned in a given report""" rfc_dict = create_rfc_dict() report_df = pd.read_csv(os.getcwd() + os.sep + "Raw IPCC Strings" + os.sep + report, sep="\t", usecols=[0]) report_list = report_df[report_df.columns[0]].tolist() report_str = " ".join([str(item) for item in report_list]) # count how often a temperature occures for reason_for_concern in rfc_dict.keys(): number_of_occurences = report_str.count(reason_for_concern) print("Found " + reason_for_concern + " " + str(number_of_occurences) + " time(s)") rfc_dict[reason_for_concern] += number_of_occurences # Save the results for the single pdf rfc_counts_pdf = pd.DataFrame.from_dict(rfc_dict, orient="index") rfc_counts_pdf.to_csv("Results" + os.sep + "reasons_for_concern" + os.sep + "counts_" + report[:-4] + ".csv", sep=";") def count_rfc_in_all_reports(): """iterates over all reports""" reports = [file for file in os.listdir(os.getcwd() + os.sep + "Raw IPCC Strings") if file[-4:] == ".csv" ] for report in reports: print("Starting with " + report) count_rfc(report) def read_ipcc_string(): """reads in the string that contains all reports""" with open(os.getcwd() + os.sep + "Raw IPCC Strings" + os.sep + "all_ipcc_strings.csv", 'r', encoding='utf-8') as f: return str(f.readlines()) def find_all_temp_occurence(ipcc_string): """finds all occurences for all temperatures""" temp_dict = {} for i in [1,1.5,2,3,4,5,6,7,8,9,10]: # Test if it is a float or not to format it right if i == int(i): # Add an empty space at the beginnign to make sure this is not counting e.g. 1.5°C as 5°C key = " " + str(int(i)) + "°C" else: key = " " + str(i)+ "°C" temp_dict[key] = [m.start() for m in re.finditer(key, ipcc_string)] return temp_dict def get_strings_around_temps(temp_dict, ipcc_string, n_temp_sample=10, sample_length=250): """extracts the text around a given index in the string of all ipcc reports""" # number of files created with independent samples amount_files = 6 for file in range(amount_files): with open(os.getcwd() + os.sep + "Results" + os.sep + "false_positive_check_files" + os.sep + "false_positive_"+str(file+1)+".csv", 'w', encoding='utf-8') as f: for temp in temp_dict.keys(): random_temp_sample = random.sample(temp_dict[temp],n_temp_sample) for index in random_temp_sample: f.write(ipcc_string[int(index-(sample_length/2)):int(index+(sample_length/2))]+"\n\n") def count_dates(report): """counts all dates between 2000 and 2100 in 10 year steps""" dates = {str(year):0 for year in range(2000,2105,10)} report_df = pd.read_csv(os.getcwd() + os.sep + "Raw IPCC Strings" + os.sep + report, sep="\t", usecols=[0]) report_list = report_df[report_df.columns[0]].tolist() report_str = " ".join([str(item) for item in report_list]) # count how often a temperature occures for date in dates.keys(): number_of_occurences = report_str.count(date) print("Found " + date + " " + str(number_of_occurences) + " time(s)") dates[date] += number_of_occurences # Save the results for the single pdf temp_counts_pdf = pd.DataFrame.from_dict(dates,
import pickle, glob, sys, csv, warnings from sklearn.preprocessing import PolynomialFeatures, StandardScaler from sklearn.metrics import accuracy_score, confusion_matrix, auc, roc_curve from feature_extraction_utils import _load_file, _save_file, _get_node_info from scipy.stats import multivariate_normal from scipy.ndimage.filters import median_filter from time import time from mpi4py import MPI import numpy as np from utils import * # Do not display warnings in the output file warnings.filterwarnings('ignore') def _LOO(X_tr_, Z_tr_, W_tr_, theta_): def __validation_dataset(X_, Z_, W_, i): return X_[..., i], Z_[..., i], W_[..., i] def __training_dataset(X_, Z_, W_, i): x_ = np.delete(X_, i, axis = 2) z_ = np.delete(Z_, i, axis = 1) w_ = np.delete(W_, i, axis = 1) return x_, z_, w_ try: n = X_tr_.shape[-1] e_ = np.zeros((n,)) for i in range(n): x_tr_, z_tr_, w_tr_ = __training_dataset(X_tr_, Z_tr_, W_tr_, i) x_val_, z_val_, w_val_ = __validation_dataset(X_tr_, Z_tr_, W_tr_, i) model_ = _train(x_tr_, w_tr_, theta_)[0] e_[i] = _test(x_val_, w_val_, theta_, model_) return e_.mean() except: return -1. def _train(X_, W_, theta_, n_init = 3): t_init = time() # Model Fit X_ = X_.reshape(60, 80, X_.shape[-2], X_.shape[-1]) _N_0, _N_1 = _Iterated_Conditional_Modes(X_, W_, _cliques, beta = theta_[-1], gamma = theta_[1], n_eval = 100, n_init = n_init) tm = time() - t_init return [[_N_0, _N_1], False], tm def _test(X_, W_, theta_, model_): # Predict Probabilities X_ = X_.reshape(60, 80, X_.shape[-1])[..., np.newaxis] Z_hat_ = _predict_proba(X_, _cliques, beta = theta_[-1], _N_0 = model_[0][0], _N_1 = model_[0][1], T_init = 4., T_min = 1e-4, epsilon = theta_[3], n_eval = 100) Z_hat_ = Z_hat_[..., 0].reshape(Z_hat_.shape[0]*Z_hat_.shape[1], Z_hat_.shape[2]) W_hat_ = _classify(Z_hat_, prob = theta_[0], invert_label = model_[1]) return _scores(W_, W_hat_)[-1] # Test Results for Computing Time def _predict(X_, theta_, model_): X_ = X_.reshape(60, 80, X_.shape[-1])[..., np.newaxis] # Initial time t_init = time() # Do the segmentation Z_hat_ = _predict_proba(X_, _cliques, beta = theta_[-1], _N_0 = model_[0][0], _N_1 = model_[0][1], T_init = 4., T_min = 1e-4, epsilon = theta_[3], n_eval = 100) Z_hat_ = np.swapaxes(Z_hat_, 2, 3) Z_hat_ = Z_hat_.reshape(Z_hat_.shape[0]*Z_hat_.shape[1]*Z_hat_.shape[2], Z_hat_.shape[3]) W_hat_ = _classify(Z_hat_, prob = theta_[0], invert_label = model_[-1]) # Get this frame time tm = time() - t_init return W_hat_, tm # ICM Optimization for Markov Random Field Model def _Iterated_Conditional_Modes(X_, W_, _cliques, beta, gamma, n_eval, n_init): # Fit Multivariate Normal Distribution to each class samples def __class_distribution(X_, W_, M, N, D, n, gamma): x_ = X_.swapaxes(2, 3).reshape(M*N*n, D) w_ = W_.reshape(M*N*n) # Find each class elements idx_0_ = w_ == 0 idx_1_ = w_ == 1 # sample mean for each class mu_0_ = np.mean(x_[idx_0_, :], axis = 0) mu_1_ = np.mean(x_[idx_1_, :], axis = 0) # sample covariance for each class E_0_ = np.cov(x_[idx_0_, :].T) + np.eye(D)*gamma E_1_ = np.cov(x_[idx_1_, :].T) + np.eye(D)*gamma # Define Normal Distribution for each clasee return multivariate_normal(mu_0_, E_0_), multivariate_normal(mu_1_, E_1_) # Evaluate Likelihood def __likelihood(X_, _N_0, _N_1, M, N, D): x_ = X_.reshape(M*N, D) return _N_0.logpdf(x_), _N_1.logpdf(x_) # Energy Potential Function def __prior(W_, cliques_, beta, M, N): # Prior based on neigborhood class def ___neigborhood(w, W_, i, j, cliques_, beta, M, N): prior = 0 # Loop over neigbors for clique_ in cliques_: k = i + clique_[0] m = j + clique_[1] if k < 0 or m < 0 or k >= M or m >= N: pass else: if w == W_[k, m]: prior += beta else: prior -= beta return prior # Variable Initialization prior_0_ = np.zeros((M, N)) prior_1_ = np.zeros((M, N)) # Loop over Pixels in an Image for i in range(M): for j in range(N): # Energy function Value and Prior Probability prior_0_[i, j] = ___neigborhood(0, W_, i, j, cliques_, beta, M, N) prior_1_[i, j] = ___neigborhood(1, W_, i, j, cliques_, beta, M, N) return prior_0_, prior_1_ # Evaluate Energy and Classification def __energy(lik_, pri_, M, N): # Variables Initialization W_ = np.zeros((M, N)) Z_ = np.zeros((M, N, 2)) Z_[..., 0] = lik_[0].reshape(M, N) + pri_[0] Z_[..., 1] = lik_[1].reshape(M, N) + pri_[1] # Maximum Energy Classification idx_ = Z_[..., 0] < Z_[..., 1] W_[idx_] = 1 # Maximum Pixel's Energy U_ = Z_[..., 0].copy() U_[idx_] = Z_[idx_, 1] return U_, W_ # Random Initialization def __rand_init(X_): M, N, D, n = X_.shape W_init_ = np.zeros((M*N, n)) for i in range(n): idx_ = np.random.randint(0, M*N - 1, size = M*N//2) W_init_[idx_, i] = 1. return W_init_.reshape(M, N, n) def __run_icm(X_, W_, cliques_, beta, gamma, n_eval): # Constants Initialization M, N, D, n = X_.shape # Stopping criteria Initialization u_k = - np.inf U_k_1_ = np.zeros((M, N, n)) W_k_1_ = np.zeros((M, N, n)) # Class Distribution Inference _N_0, _N_1 = __class_distribution(X_, W_, M, N, D, n, gamma) # Loop over No. of evaluation for k in range(n_eval): # loop over No. of samples for i in range(n): # Evaluate likelihood function lik_ = __likelihood(X_[..., i], _N_0, _N_1, M, N, D) # Evaluate prior function prior_ = __prior(W_[..., i], cliques_, beta, M, N) # Current Evaluation Weights Initialization U_k_1_[..., i], W_k_1_[..., i] = __energy(lik_, prior_, M, N) # Current Evaluation Total Energy u_k_1 = U_k_1_.sum() #print('>>> No Iter.: {} Energy: {}'.format(k, u_k_1)) # Stop if it is a minima if u_k >= u_k_1: break # If not keep optimizing else: # Update next iteration objective functions W_ = W_k_1_.copy() u_k = u_k_1.copy() # Class Distribution Inference _N_0, _N_1 = __class_distribution(X_, W_, M, N, D, n, gamma) return _N_0, _N_1, u_k # Variables Initialization cliques_ = [C_0_, C_1_, C_1_ + C_2_][_cliques] energy_ = np.zeros((n_init,)) class_ = [] for i in range(n_init): #print('>>> No. Init.: {} '.format(i)) W_ = __rand_init(X_) _N_0, _N_1, u = __run_icm(X_, W_, cliques_, beta, gamma, n_eval) energy_[i] = u class_.append([_N_0, _N_1]) return class_[np.argmax(energy_)] # Stochastic Optimization of the Markov Random Field Model def _predict_proba(X_, cliques_, beta, _N_0, _N_1, n_eval = 5, T_init = 4., T_min = 1e-4, epsilon = 0.75): # Cooling Function def __exp_cooling(T, epsilon): return T * epsilon # Perturbation Generate from Importance Sampling def __importance_perturbation(U_, M, N): E_ = U_.copy() E_ = np.absolute(E_ - np.max(E_)) E_ = E_ / np.sum(E_) i_, j_ = np.where(E_ == np.random.choice(E_.flatten(), 1, p = E_.flatten())) return i_[0], j_[0] # Evaluate Likelhood def __likelihood(X_, _N_0, _N_1, M, N, D): x_ = X_.reshape(M*N, D) Z_ = np.zeros((M, N, 2)) Z_[..., 0] = _N_0.logpdf(x_).reshape(M, N) Z_[..., 1] = _N_1.logpdf(x_).reshape(M, N) return Z_ # Compute the Pixels' Energy def __eval_energy(Z_, M, N): # Variables initialization W_ = np.zeros((M, N)) E_ = Z_[..., 0].copy() # Maximum Energy Energy Classification idx_ = Z_[..., 0] < Z_[..., 1] E_[idx_] = Z_[idx_, 1] W_[idx_] = 1 return E_, W_ # Prior based on neigborhood class def __neigborhood(w, W_, i, j, cliques_, beta): M, N = W_.shape prior = 0 # Loop over neigbors for clique_ in cliques_: k = i + clique_[0] m = j + clique_[1] if k < 0 or m < 0 or k >= M or m >= N: pass else: if w == W_[k, m]: prior += beta else: prior -= beta return prior # Calcualate the pixels' posterior energy def __eval_posterior(Z_, U_, W_, i, j, cliques_, beta): E_ = U_.copy() G_ = W_.copy() Z_[i, j, 0] = Z_[i, j, 0] + __neigborhood(0, W_, i, j, cliques_, beta) Z_[i, j, 1] = Z_[i, j, 1] + __neigborhood(1, W_, i, j, cliques_, beta) if G_[i, j] == 1: G_[i, j] = 0 E_[i, j] = Z_[i, j, 0] else: G_[i, j] = 1 E_[i, j] = Z_[i, j, 1] return E_, G_, Z_ # Softmax function to transform energy to probabilities def __softmax(x_): z_ = np.exp(x_) return z_ / np.tile( np.sum(z_, axis = 1)[:, np.newaxis], (1, 2)) # Compute the sum of the values to add to 1 def __hardmax(x_): x_ = x_ - x_.min() return np.nan_to_num(x_ / np.tile(np.sum(x_, axis = 1)[:, np.newaxis], (1, 2))) # Main Run Simulate Anniling Initialization def __run_optimization(X_, W_, cliques_, beta, _N_0, _N_1, M, N, D): # Eval Likelihood Z_ = __likelihood(X_, _N_0, _N_1, M, N, D) # Initialization of Energy Function U_, W_ = __eval_energy(Z_, M, N) # Variables initialization n_accept = 0 T =
"Kernel", lineno), "Complex", [self._parse_numeric_string(s)], None, lineno ) def _parse_int(self, s): if "X" in s: base = 16 elif "O" in s: base = 8 elif "B" in s: base = 2 else: base = 10 if base != 10: # Strip off the leading 0[xob] s = s[2:] val = rbigint() i = 0 while i < len(s): c = ord(s[i]) if ord("a") <= c <= ord("z"): digit = c - ord("a") + 10 elif ord("A") <= c <= ord("Z"): digit = c - ord("A") + 10 elif ord("0") <= c <= ord("9"): digit = c - ord("0") else: break if digit >= base: break val = val.mul(rbigint.fromint(base)).add(rbigint.fromint(digit)) i += 1 try: return ast.ConstantInt(val.toint()) except OverflowError: return ast.ConstantBigInt(val) pg = ParserGenerator([ "CLASS", "MODULE", "DEF", "UNDEF", "BEGIN", "RESCUE", "ENSURE", "END", "IF", "UNLESS", "THEN", "ELSIF", "ELSE", "CASE", "WHEN", "WHILE", "UNTIL", "FOR", "BREAK", "NEXT", "REDO", "RETRY", "IN", "DO", "DO_COND", "DO_BLOCK", "RETURN", "YIELD", "SUPER", "SELF", "NIL", "TRUE", "FALSE", "AND", "OR", "NOT", "IF_MOD", "UNLESS_MOD", "WHILE_MOD", "UNTIL_MOD", "RESCUE_MOD", "ALIAS", "DEFINED", "lBEGIN", "lEND", "__LINE__", "__FILE__", "__ENCODING__", "DO_LAMBDA", "IDENTIFIER", "FID", "GVAR", "IVAR", "CONSTANT", "CVAR", "LABEL", "CHAR", "UPLUS", "UMINUS", "UMINUS_NUM", "POW", "CMP", "EQ", "EQQ", "NEQ", "GEQ", "LEQ", "ANDOP", "OROP", "MATCH", "NMATCH", "DOT", "DOT2", "DOT3", "AREF", "ASET", "LSHFT", "RSHFT", "COLON2", "COLON3", "ANDDOT", "OP_ASGN", "ASSOC", "LPAREN", "LPAREN2", "RPAREN", "LPAREN_ARG", "LBRACK", "RBRACK", "LBRACE", "LBRACE_ARG", "STAR", "STAR2", "DSTAR", "AMPER", "AMPER2", "TILDE", "PERCENT", "DIVIDE", "PLUS", "MINUS", "LT", "GT", "PIPE", "BANG", "CARET", "LCURLY", "RCURLY", "BACK_REF2", "SYMBEG", "STRING_BEG", "XSTRING_BEG", "REGEXP_BEG", "WORDS_BEG", "QWORDS_BEG", "STRING_DBEG", "STRING_DVAR", "STRING_END", "LAMBDA", "LAMBEG", "NTH_REF", "BACK_REF", "STRING_CONTENT", "INTEGER", "FLOAT", "REGEXP_END", "SYMBOLS_BEG", "QSYMBOLS_BEG", "RATIONAL", "IMAGINARY", "LABEL_END", "LITERAL_EQUAL", "LITERAL_COLON", "LITERAL_COMMA", "LITERAL_LBRACKET", "LITERAL_SEMICOLON", "LITERAL_QUESTION_MARK", "LITERAL_SPACE", "LITERAL_NEWLINE", ], precedence=[ ("nonassoc", ["LOWEST"]), ("nonassoc", ["LBRACE_ARG"]), ("nonassoc", ["IF_MOD", "UNLESS_MOD", "WHILE_MOD", "UNTIL_MOD"]), ("left", ["OR", "AND"]), ("right", ["NOT"]), ("nonassoc", ["DEFINED"]), ("right", ["LITERAL_EQUAL", "OP_ASGN"]), ("left", ["RESCUE_MOD"]), ("right", ["LITERAL_QUESTION_MARK", "LITERAL_COLON"]), ("nonassoc", ["DOT2", "DOT3"]), ("left", ["OROP"]), ("left", ["ANDOP"]), ("nonassoc", ["CMP", "EQ", "EQQ", "NEQ", "MATCH", "NMATCH"]), ("left", ["GT", "GEQ", "LT", "LEQ"]), ("left", ["PIPE", "CARET"]), ("left", ["AMPER2"]), ("left", ["LSHFT", "RSHFT"]), ("left", ["PLUS", "MINUS"]), ("left", ["STAR2", "DIVIDE", "PERCENT"]), ("right", ["UMINUS_NUM", "UMINUS"]), ("right", ["POW"]), ("right", ["BANG", "TILDE", "UPLUS"]), ], cache_id="topaz") def error_handler(state, token): raise ParsingError( "Token(%s, %s)" % (token.gettokentype(), token.getstr()), token.getsourcepos() ) pg.error(error_handler) @pg.production("program : top_compstmt") def program(self, p): """ program : { lexer.setState(LexState.EXPR_BEG); support.initTopLocalVariables(); } top_compstmt { // ENEBO: Removed !compile_for_eval which probably is to reduce warnings if ($2 != null) { /* last expression should not be void */ if ($2 instanceof BlockNode) { support.checkUselessStatement($<BlockNode>2.getLast()); } else { support.checkUselessStatement($2); } } support.getResult().setAST(support.addRootNode($2, support.getPosition($2))); } """ # TODO: sym table setup, and useless statement return BoxAST(ast.Main(ast.Block(p[0].getastlist()) if p[0] is not None else ast.Nil())) @pg.production("top_compstmt : top_stmts opt_terms") def top_compstmt(self, p): return p[0] @pg.production("top_stmts : none") def top_stmts_none(self, p): return p[0] @pg.production("top_stmts : top_stmt") def top_stmts_top_stmt(self, p): return self.new_list(p[0]) @pg.production("top_stmts : top_stmts terms top_stmt") def top_stmts(self, p): return self.append_to_list(p[0], p[2]) @pg.production("top_stmts : error top_stmt") def top_stmts_error(self, p): return p[1] @pg.production("top_stmt : stmt") def top_stmt_stmt(self, p): return p[0] @pg.production("top_stmt : lBEGIN LCURLY top_compstmt RCURLY") def top_stmt_lbegin(self, p): """ top_stmt : stmt | klBEGIN { if (support.isInDef() || support.isInSingle()) { support.yyerror("BEGIN in method"); } } tLCURLY top_compstmt tRCURLY { support.getResult().addBeginNode(new PreExe19Node($1.getPosition(), support.getCurrentScope(), $4)); $$ = null; } """ raise NotImplementedError(p) @pg.production("bodystmt : compstmt opt_rescue opt_else opt_ensure") def bodystmt(self, p): body = ast.Block(p[0].getastlist()) if p[0] is not None else ast.Nil() if p[1] is not None: except_handlers = p[1].getastlist() body = ast.TryExcept(body, except_handlers, ast.Nil()) elif p[2] is not None: body = ast.TryExcept(body, [], p[2].getast()) if p[3] is not None: body = ast.TryFinally(body, ast.Block(p[3].getastlist())) return BoxAST(body) @pg.production("compstmt : stmts opt_terms") def compstmt(self, p): """ compstmt : stmts opt_terms { if ($1 instanceof BlockNode) { support.checkUselessStatements($<BlockNode>1); } $$ = $1; } """ # TODO: checkUslessStatements? return p[0] @pg.production("stmts : none") def stmts_none(self, p): return p[0] @pg.production("stmts : stmt_or_begin") def stmts_stmt(self, p): return self.new_list(p[0]) @pg.production("stmts : stmts terms stmt_or_begin") def stmts(self, p): return self.append_to_list(p[0], p[2]) @pg.production("stmts : error stmt") def stmts_error(self, p): return p[1] @pg.production("stmt_or_begin : stmt") def stmt_or_begin(self, p): return p[0] @pg.production("stmt_or_begin : lBEGIN LCURLY top_compstmt RCURLY") def stmt_or_begin_curly(self, p): raise NotImplementedError @pg.production("stmt : ALIAS fitem alias_after_fitem fitem") def stmt_alias_fitem(self, p): return BoxAST(ast.Alias(p[1].getast(), p[3].getast(), p[0].getsourcepos().lineno)) @pg.production("alias_after_fitem : ") def alias_after_fitem(self, p): self.lexer.state = self.lexer.EXPR_FNAME @pg.production("stmt : ALIAS GVAR GVAR") def stmt_alias_gvar(self, p): """ kALIAS tGVAR tGVAR { $$ = new VAliasNode($1.getPosition(), (String) $2.getValue(), (String) $3.getValue()); } """ raise NotImplementedError(p) @pg.production("stmt : ALIAS GVAR BACK_REF") def stmt_alias_gvar_backref(self, p): """ kALIAS tGVAR tBACK_REF { $$ = new VAliasNode($1.getPosition(), (String) $2.getValue(), "$" + $<BackRefNode>3.getType()); } """ raise NotImplementedError(p) @pg.production("stmt : ALIAS GVAR NTH_REF") def stmt_alias_gvar_nref(self, p): """ kALIAS tGVAR tNTH_REF { support.yyerror("can't make alias for the number variables"); } """ raise NotImplementedError(p) @pg.production("stmt : UNDEF undef_list") def stmt_undef(self, p): return BoxAST(ast.Undef(p[1].getastlist(), p[0].getsourcepos().lineno)) @pg.production("stmt : stmt IF_MOD expr_value") def stmt_ifmod(self, p): return self._new_stmt(ast.If( p[2].getast(), ast.Block([p[0].getast()]), ast.Nil(), )) @pg.production("stmt : stmt UNLESS_MOD expr_value") def stmt_unlessmod(self, p): return self._new_stmt(ast.If( p[2].getast(), ast.Nil(), ast.Block([p[0].getast()]), )) @pg.production("stmt : BEGIN bodystmt END WHILE_MOD expr_value") def stmt_while_mod(self, p): return self._new_stmt(ast.While( p[4].getast(), p[1].getast(), post_check=True )) @pg.production("stmt : stmt WHILE_MOD expr_value") def stmt_while_mod(self, p): return self._new_stmt(ast.While( p[2].getast(), ast.Block([p[0].getast()]) )) @pg.production("stmt : BEGIN bodystmt END UNTIL_MOD expr_value") def stmt_until_mod(self, p): return self._new_stmt(ast.Until( p[4].getast(), p[1].getast(), post_check=True )) @pg.production("stmt : stmt UNTIL_MOD expr_value") def stmt_until_mod(self, p): return self._new_stmt(ast.Until( p[2].getast(), ast.Block([p[0].getast()]) )) @pg.production("stmt : stmt RESCUE_MOD stmt") def stmt_rescue_mod(self, p): lineno = p[1].getsourcepos().lineno return self._new_stmt(ast.TryExcept( ast.Block([p[0].getast()]), [ ast.ExceptHandler( [ast.LookupConstant(ast.Scope(lineno), "StandardError", lineno)], None, ast.Block([p[2].getast()]), ) ], ast.Nil() )) @pg.production("stmt : lEND LCURLY compstmt RCURLY") def stmt_lend(self, p): """ klEND tLCURLY compstmt tRCURLY { if (support.isInDef() || support.isInSingle()) { support.warn(ID.END_IN_METHOD, $1.getPosition(), "END in method; use at_exit"); } $$ = new PostExeNode($1.getPosition(), $3); } """ raise NotImplementedError(p) @pg.production("stmt : command_asgn") def stmt_command_assign(self, p): return self.new_stmt(p[0]) @pg.production("stmt : mlhs LITERAL_EQUAL command_call") def stmt_mlhs_equal_command_call(self, p): return self._new_stmt(ast.MultiAssignment( p[0].getassignment(), p[2].getast() )) @pg.production("stmt : lhs LITERAL_EQUAL mrhs") def stmt_lhs_equal_mrhs(self, p): return self._new_stmt(ast.Assignment(p[0].getast(), ast.Array(p[2].getastlist()))) @pg.production("stmt : mlhs LITERAL_EQUAL mrhs_arg") def stmt_mlhs_equal_arg_value(self, p): return self._new_stmt(ast.MultiAssignment( p[0].getassignment(), p[2].getast() )) @pg.production("stmt : expr") def stmt_expr(self, p): return self.new_stmt(p[0]) @pg.production("command_asgn : lhs LITERAL_EQUAL command_rhs") def command_asgn_lhs_equal_command_call(self, p): return BoxAST(ast.Assignment( p[0].getast(), p[2].getast() )) @pg.production("command_asgn : var_lhs OP_ASGN command_rhs") def command_asgn_var(self, p): return self.new_augmented_assignment(p[1], p[0], p[2]) @pg.production("command_asgn : primary_value LITERAL_LBRACKET opt_call_args rbracket OP_ASGN command_rhs") def command_asgn_subscript_op_asgn_command_call(self, p): raise NotImplementedError(p) @pg.production("command_asgn : primary_value call_op IDENTIFIER OP_ASGN command_rhs") def command_asgn_method_op_asgn_command_call(self, p): raise NotImplementedError(p) @pg.production("command_asgn : primary_value call_op CONSTANT OP_ASGN command_rhs") def command_asgnmethod_constant_op_asgn_command_call(self, p): raise NotImplementedError(p) @pg.production("command_asgn : primary_value COLON2 CONSTANT OP_ASGN command_rhs") def command_asgnprimary_value_colon_constant_op_asgn_command_call(self, p): raise NotImplementedError(p) @pg.production("command_asgn : primary_value COLON2 IDENTIFIER OP_ASGN command_rhs") def command_asgnconstant_op_asgn_command_call(self, p): raise NotImplementedError(p) @pg.production("command_asgn : backref OP_ASGN command_rhs") def command_asgnbackref_op_asgn_command_call(self, p): raise NotImplementedError(p) self.backref_assign_error(p[0]) @pg.production("command_rhs : command_call", precedence="OP_ASGN") def command_rhs_call(self, p): return p[0] @pg.production("command_rhs : command_call RESCUE_MOD stmt") def command_rhs_call_rescue(self, p): lineno = p[1].getsourcepos().lineno return self._new_stmt(ast.TryExcept( ast.Block([p[0].getast()]), [ ast.ExceptHandler( [ast.LookupConstant(ast.Scope(lineno), "StandardError", lineno)], None, ast.Block([p[2].getast()]), ) ], ast.Nil() )) @pg.production("command_rhs : command_asgn") def command_rhs_asgn(self, p): return p[0] @pg.production("expr : command_call") def expr_command_call(self, p): return p[0] @pg.production("expr : expr AND expr") def expr_and(self, p): return self.new_and(p[0], p[2]) @pg.production("expr : expr OR expr") def expr_or(self, p): return self.new_or(p[0], p[2]) @pg.production("expr : NOT opt_nl expr") def expr_not(self, p): return self.new_call(p[2], self.new_token(p[0], "!", "!"), None) @pg.production("expr : BANG command_call") def expr_bang_command_call(self, p): return self.new_call(p[1], self.new_token(p[0], "!", "!"), None) @pg.production("expr : arg") def expr_arg(self, p): return p[0] @pg.production("expr_value : expr") def expr_value(self, p): """ expr { support.checkExpression($1); } """ # TODO: checkExpression? return p[0] @pg.production("command_call : command") def command_call_command(self, p): return p[0] @pg.production("command_call : block_command") def command_call_block_command(self, p): return p[0] @pg.production("block_command : block_call") def block_command_block_call(self, p): return p[0] @pg.production("block_command : block_call call_op2 operation2 command_args") def block_command_dot(self, p): return self.new_call(p[0], p[2], p[3]) @pg.production("cmd_brace_block : LBRACE_ARG brace_body RCURLY") def cmd_brace_block(self, p): box = self.new_send_block(p[0].getsourcepos().lineno, p[1].getblockparam(), p[1].getblockstmts()) self.save_and_pop_scope(box.getast()) return box @pg.production("fcall : operation") def fcall(self, p): return p[0] @pg.production("command : fcall command_args", precedence="LOWEST") def command_operation_command_args(self, p): return self.new_fcall(p[0], p[1]) @pg.production("command : fcall command_args cmd_brace_block") def command_operation_command_args_cmd_brace_block(self, p): return self.combine_send_block(self.new_fcall(p[0], p[1]), p[2]) @pg.production("command : primary_value call_op operation2 command_args", precedence="LOWEST") def command_method_call_args(self, p): return self.new_call(p[0], p[2], p[3]) @pg.production("command : primary_value call_op operation2 command_args
#!/usr/bin/env python2 # -*- coding: utf-8 -*- """Process wind data for adjacent years and save processed data to a NetCDF file per subset. Settings, such as target file name, are imported from config.py. Example:: $ python process_data.py : process all latitudes (all subsets) $ python process_data.py -s subsetID : process individual subset with ID subsetID $ python process_data.py -s ID1 -e ID2 : process range of subsets starting at subset ID1 until ID2 (inclusively) $ python process_data.py -h : display this help """ import xarray as xr import numpy as np from timeit import default_timer as timer from scipy.stats import percentileofscore from os.path import join as path_join import sys import getopt import dask try: from .utils import compute_level_heights, flatten_dict from ..utils.convenience_utils import hour_to_date_str from .config import start_year, final_year, era5_data_dir, model_level_file_name_format, surface_file_name_format,\ output_file_name, output_file_name_subset, read_n_lats_per_subset from ..utils.wind_resource_utils import calc_power except ImportError: # TODO hotfix to be able to run single location plotting... from utils import compute_level_heights, flatten_dict from convenience_utils import hour_to_date_str from config import start_year, final_year, era5_data_dir, model_level_file_name_format, surface_file_name_format,\ output_file_name, output_file_name_subset, read_n_lats_per_subset from wind_resource_utils import calc_power # Overwrite default with single-threaded scheduler. dask.config.set(scheduler='synchronous') # Set the relevant heights for the different analysis types in meter. analyzed_heights = { 'floor': 50., 'ceilings': [200., 300., 400., 500., 1000., 1250.], 'fixed': [100.], 'integration_ranges': [(50., 150.), (10., 500.)], } dimension_sizes = { 'ceilings': len(analyzed_heights['ceilings']), 'fixed': len(analyzed_heights['fixed']), 'integration_ranges': len(analyzed_heights['integration_ranges']), } integration_range_ids = list(range(dimension_sizes['integration_ranges'])) # Heights above the ground at which the wind speed is evaluated (using interpolation). heights_of_interest = [500., 440.58, 385.14, 334.22, 287.51, 244.68, 200., 169.50, 136.62, 100., 80., 50., 30.96, 10.] # Add the analyzed_heights values to the heights_of_interest list and remove duplicates. heights_of_interest = set(heights_of_interest + [analyzed_heights['floor']] + analyzed_heights['ceilings'] + analyzed_heights['fixed'] + [h for int_range in analyzed_heights['integration_ranges'] for h in int_range]) heights_of_interest = sorted(heights_of_interest, reverse=True) # Determine the analyzed_heights ids in heights_of_interest. analyzed_heights_ids = { 'floor': heights_of_interest.index(analyzed_heights['floor']), 'ceilings': [heights_of_interest.index(h) for h in analyzed_heights['ceilings']], 'fixed': [heights_of_interest.index(h) for h in analyzed_heights['fixed']], 'integration_ranges': [] } for int_range in analyzed_heights['integration_ranges']: analyzed_heights_ids['integration_ranges'].append([heights_of_interest.index(int_range[0]), heights_of_interest.index(int_range[1])]) def get_statistics(vals): """Determine mean and 5th, 32nd, and 50th percentile of input values. Args: vals (list): Series of floats. Returns: tuple of float: Tuple with mean and 5th, 32nd, and 50th percentile of series. """ mean = np.mean(vals) perc5, perc32, perc50 = np.percentile(vals, [5., 32., 50.]) return mean, perc5, perc32, perc50 def get_percentile_ranks(vals, scores=(150., 200., 250.)): """"Determine percentile ranks corresponding to the scores. Args: vals (list): Series of floats. scores (tuple of float, optional): Percentile scores. Defaults to [5., 32., 50.]. Returns: list of float: List with percentile ranks. """ ranks = [percentileofscore(vals, s) for s in scores] return ranks def read_raw_data(start_year, final_year): """"Read ERA5 wind data for adjacent years. Args: start_year (int): Read data starting from this year. final_year (int): Read data up to this year. Returns: tuple of Dataset, ndarray, ndarray, ndarray, and ndarray: Tuple containing reading object of multiple wind data (netCDF) files, longitudes of grid, latitudes of grid, model level numbers, and timestamps in hours since 1900-01-01 00:00:0.0. """ # Construct the list of input NetCDF files ml_files = [] sfc_files = [] for y in range(start_year, final_year+1): for m in range(1, 13): ml_files.append(path_join(era5_data_dir, model_level_file_name_format.format(y, m))) sfc_files.append(path_join(era5_data_dir, surface_file_name_format.format(y, m))) # Load the data from the NetCDF files. ds = xr.open_mfdataset(ml_files+sfc_files, decode_times=False) lons = ds['longitude'].values lats = ds['latitude'].values levels = ds['level'].values # Model level numbers. hours = ds['time'].values # Hours since 1900-01-01 00:00:0.0, see: print(nc.variables['time']). dlevels = np.diff(levels) if not (np.all(dlevels == 1) and levels[-1] == 137): i_highest_level = len(levels) - np.argmax(dlevels[::-1] > 1) - 1 print("Not all the downloaded model levels are consecutive. Only model levels up to {} are evaluated." .format(levels[i_highest_level])) levels = levels[i_highest_level:] else: i_highest_level = 0 return ds, lons, lats, levels, hours, i_highest_level def merge_output_files(start_year, final_year, max_subset_id): """"Merge subset-wise output files to one total output file, the arguments are given to specify the matching files Args: start_year (int): First year of processing final_year (int): Final year of processing max_subset_id (int): Maximal subset id """ all_year_subset_files = [output_file_name_subset.format(**{'start_year': start_year, 'final_year': final_year, 'lat_subset_id': subset_id, 'max_lat_subset_id': max_subset_id}) for subset_id in range(max_subset_id+1)] print('All data for the years {} to {} is read from subset_files from 0 to {}'.format(start_year, final_year, max_subset_id)) nc = xr.open_mfdataset(all_year_subset_files, concat_dim='latitude') nc.to_netcdf(output_file_name.format(**{'start_year': start_year, 'final_year': final_year})) return 0 def check_for_missing_data(hours): """"Print message if hours are missing in timestamp series. Args: hours (list): Hour timestamps. """ d_hours = np.diff(hours) gaps = d_hours != 1 if np.any(gaps): i_gaps = np.argwhere(gaps) for i in i_gaps: print("Gap found between {} and {}.".format(hour_to_date_str(hours[i]), hour_to_date_str(hours[i+1]))) def process_grid_subsets(output_file, start_subset_id=0, end_subset_id=-1): """"Execute analyses on the data of the complete grid and save the processed data to a netCDF file. By default all subsets are analyzed Args: output_file (str): Name of netCDF file to which the results are saved for the respective subset. (including format {} placeholders) start_subset_id (int): Starting subset id to be analyzed end_subset_id (int): Last subset id to be analyzed (set to -1 to process all subsets after start_subset_id) """ ds, lons, lats, levels, hours, i_highest_level = read_raw_data(start_year, final_year) check_for_missing_data(hours) # Reading the data of all grid points from the NetCDF file all at once requires a lot of memory. On the other hand, # reading the data of all grid points one by one takes up a lot of CPU. Therefore, the dataset is analysed in # pieces: the subsets are read and processed consecutively. n_subsets = int(np.ceil(float(len(lats)) / read_n_lats_per_subset)) # Define subset range to be processed in this run if end_subset_id == -1: subset_range = range(start_subset_id, n_subsets) else: subset_range = range(start_subset_id, end_subset_id+1) if subset_range[-1] > (n_subsets-1): raise ValueError("Requested subset ID ({}) is higher than maximal subset ID {}." .format(subset_range[-1], (n_subsets-1))) # Loop over all specified subsets to write processed data to the output file. counter = 0 total_iters = len(lats) * len(lons)*len(subset_range)/n_subsets start_time = timer() for i_subset in subset_range: # Find latitudes corresponding to the current i_subset i_lat0 = i_subset * read_n_lats_per_subset if i_lat0+read_n_lats_per_subset < len(lats): lat_ids_subset = range(i_lat0, i_lat0 + read_n_lats_per_subset) else: lat_ids_subset = range(i_lat0, len(lats)) lats_subset = lats[lat_ids_subset] print("Subset {}, Latitude(s) analysed: {} to {}".format(i_subset, lats_subset[0], lats_subset[-1])) # Initialize result arrays for this subset res = initialize_result_dict(lats_subset, lons) print(' Result array configured, reading subset input now, time lapsed: {:.2f} hrs' .format(float(timer()-start_time)/3600)) # Read data for the subset latitudes v_levels_east = ds.variables['u'][:, i_highest_level:, lat_ids_subset, :].values v_levels_north = ds.variables['v'][:, i_highest_level:, lat_ids_subset, :].values v_levels = (v_levels_east**2 + v_levels_north**2)**.5 t_levels = ds.variables['t'][:, i_highest_level:, lat_ids_subset, :].values q_levels = ds.variables['q'][:, i_highest_level:, lat_ids_subset, :].values try: surface_pressure = ds.variables['sp'][:, lat_ids_subset, :].values except KeyError: surface_pressure = np.exp(ds.variables['lnsp'][:, lat_ids_subset, :].values) print(' Input read, performing statistical analysis now, time lapsed: {:.2f} hrs' .format(float(timer()-start_time)/3600)) for i_lat_in_subset in range(len(lat_ids_subset)): # Saves a file for each subset. for i_lon in range(len(lons)): if (i_lon % 20) == 0: # Give processing info every 20 longitudes print(' {} of {} longitudes analyzed, satistical analysis of longitude {}, time lapsed: ' '{:.2f} hrs'.format(i_lon, len(lons), lons[i_lon], float(timer()-start_time)/3600)) counter += 1 level_heights, density_levels = compute_level_heights(levels, surface_pressure[:, i_lat_in_subset, i_lon], t_levels[:, :, i_lat_in_subset, i_lon], q_levels[:, :, i_lat_in_subset, i_lon]) # Determine wind at altitudes of interest by means of interpolating the raw wind data. v_req_alt = np.zeros((len(hours), len(heights_of_interest))) # Interpolation results array. rho_req_alt = np.zeros((len(hours), len(heights_of_interest))) for i_hr in range(len(hours)): if not np.all(level_heights[i_hr, 0] > heights_of_interest): raise ValueError("Requested height ({:.2f} m) is higher than height of highest model level." .format(level_heights[i_hr, 0])) v_req_alt[i_hr, :] = np.interp(heights_of_interest, level_heights[i_hr, ::-1], v_levels[i_hr, ::-1, i_lat_in_subset, i_lon]) rho_req_alt[i_hr, :] = np.interp(heights_of_interest, level_heights[i_hr, ::-1], density_levels[i_hr, ::-1]) p_req_alt = calc_power(v_req_alt, rho_req_alt) # Determine wind statistics at fixed heights of interest. for i_out, fixed_height_id in enumerate(analyzed_heights_ids['fixed']): v_mean, v_perc5, v_perc32, v_perc50 = get_statistics(v_req_alt[:, fixed_height_id]) res['fixed']['wind_speed']['mean'][i_out, i_lat_in_subset, i_lon] = v_mean res['fixed']['wind_speed']['percentile'][5][i_out, i_lat_in_subset, i_lon] = v_perc5 res['fixed']['wind_speed']['percentile'][32][i_out, i_lat_in_subset, i_lon] = v_perc32 res['fixed']['wind_speed']['percentile'][50][i_out, i_lat_in_subset, i_lon] = v_perc50 v_ranks = get_percentile_ranks(v_req_alt[:, fixed_height_id], [4., 8., 14., 25.]) res['fixed']['wind_speed']['rank'][4][i_out, i_lat_in_subset, i_lon] = v_ranks[0] res['fixed']['wind_speed']['rank'][8][i_out, i_lat_in_subset, i_lon] = v_ranks[1] res['fixed']['wind_speed']['rank'][14][i_out, i_lat_in_subset, i_lon] = v_ranks[2] res['fixed']['wind_speed']['rank'][25][i_out, i_lat_in_subset, i_lon] = v_ranks[3] p_fixed_height = p_req_alt[:, fixed_height_id] p_mean, p_perc5, p_perc32, p_perc50 = get_statistics(p_fixed_height) res['fixed']['wind_power_density']['mean'][i_out, i_lat_in_subset, i_lon] = p_mean res['fixed']['wind_power_density']['percentile'][5][i_out, i_lat_in_subset, i_lon] = p_perc5 res['fixed']['wind_power_density']['percentile'][32][i_out, i_lat_in_subset, i_lon] = p_perc32 res['fixed']['wind_power_density']['percentile'][50][i_out, i_lat_in_subset, i_lon] = p_perc50 p_ranks = get_percentile_ranks(p_fixed_height, [40., 300., 1600., 9000.]) res['fixed']['wind_power_density']['rank'][40][i_out, i_lat_in_subset, i_lon]
# pubsub completion notification def test_cron_abort_expired_task_to_run_retry(self): pub_sub_calls = self.mock_pub_sub() run_result = self._quick_reap( 1, 0, pubsub_topic='projects/abc/topics/def', task_slices=[ task_request.TaskSlice( expiration_secs=600, properties=_gen_properties(idempotent=True), wait_for_capacity=False), ]) # Fake first try bot died. self.assertEqual(1, len(pub_sub_calls)) # PENDING -> RUNNING now_1 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 1) self.assertEqual(([], 1, 0), task_scheduler.cron_handle_bot_died()) self.assertEqual(State.BOT_DIED, run_result.key.get().state) self.assertEqual(State.PENDING, run_result.result_summary_key.get().state) self.assertEqual(1, self.execute_tasks()) self.assertEqual(2, len(pub_sub_calls)) # RUNNING -> PENDING # BOT_DIED is kept instead of EXPIRED. abandoned_ts = self.mock_now( self.now, run_result.request_key.get().expiration_secs+1) self.assertEqual( (['1d69b9f088008910'], []), task_scheduler.cron_abort_expired_task_to_run()) self.assertEqual(1, len(task_result.TaskRunResult.query().fetch())) expected = self._gen_result_summary_reaped( abandoned_ts=abandoned_ts, completed_ts=abandoned_ts, costs_usd=[0.], id='1d69b9f088008910', internal_failure=True, modified_ts=abandoned_ts, started_ts=self.now, state=State.BOT_DIED) self.assertEqual(expected, run_result.result_summary_key.get().to_dict()) self.assertEqual(1, self.execute_tasks()) self.assertEqual(3, len(pub_sub_calls)) # PENDING -> BOT_DIED def test_cron_abort_expired_fallback(self): # 1 and 4 have capacity. self.bot_dimensions[u'item'] = [u'1', u'4'] self._register_bot(0, self.bot_dimensions) result_summary = self._quick_schedule( 4, task_slices=[ task_request.TaskSlice( expiration_secs=600, properties=_gen_properties( dimensions={u'pool': [u'default'], u'item': [u'1']})), task_request.TaskSlice( expiration_secs=600, properties=_gen_properties( dimensions={u'pool': [u'default'], u'item': [u'2']})), task_request.TaskSlice( expiration_secs=600, properties=_gen_properties( dimensions={u'pool': [u'default'], u'item': [u'3']})), task_request.TaskSlice( expiration_secs=600, properties=_gen_properties( dimensions={u'pool': [u'default'], u'item': [u'4']})), ]) self.assertEqual(State.PENDING, result_summary.state) self.assertEqual(0, result_summary.current_task_slice) # Expire the first slice. self.mock_now(self.now, 601) # cron job 'expires' the task slices but not the whole task. self.assertEqual( ([], ['1d69b9f088008910']), task_scheduler.cron_abort_expired_task_to_run()) result_summary = result_summary.key.get() self.assertEqual(State.PENDING, result_summary.state) # Skipped the second and third TaskSlice. self.assertEqual(3, result_summary.current_task_slice) def test_cron_abort_expired_fallback_wait_for_capacity(self): # 1 has capacity. self.bot_dimensions[u'item'] = [u'1'] self._register_bot(0, self.bot_dimensions) result_summary = self._quick_schedule( 2, task_slices=[ task_request.TaskSlice( expiration_secs=600, properties=_gen_properties( dimensions={u'pool': [u'default'], u'item': [u'1']}), wait_for_capacity=False), task_request.TaskSlice( expiration_secs=600, properties=_gen_properties( dimensions={u'pool': [u'default'], u'item': [u'2']}), wait_for_capacity=True), ]) self.assertEqual(State.PENDING, result_summary.state) self.assertEqual(0, result_summary.current_task_slice) # Expire the first slice. self.mock_now(self.now, 601) self.assertEqual( ([], ['1d69b9f088008910']), task_scheduler.cron_abort_expired_task_to_run()) result_summary = result_summary.key.get() self.assertEqual(State.PENDING, result_summary.state) # Wait for the second TaskSlice even if there is no capacity. self.assertEqual(1, result_summary.current_task_slice) def test_cron_handle_bot_died(self): pub_sub_calls = self.mock_pub_sub() # Test first retry, then success. run_result = self._quick_reap( 1, 0, pubsub_topic='projects/abc/topics/def', task_slices=[ task_request.TaskSlice( expiration_secs=600, properties=_gen_properties(idempotent=True), wait_for_capacity=False), ]) self.assertEqual(1, len(pub_sub_calls)) # PENDING -> RUNNING request = run_result.request_key.get() def is_in_negative_cache(t): to_run_key = task_to_run.request_to_task_to_run_key(request, t, 0) return task_to_run._lookup_cache_is_taken_async(to_run_key).get_result() self.assertEqual(True, is_in_negative_cache(1)) # Was just reaped. self.assertEqual(False, is_in_negative_cache(2)) now_1 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 1) self.assertEqual(([], 1, 0), task_scheduler.cron_handle_bot_died()) self.assertEqual(1, self.execute_tasks()) self.assertEqual(2, len(pub_sub_calls)) # RUNNING -> PENDING self.assertEqual(False, is_in_negative_cache(1)) self.assertEqual(False, is_in_negative_cache(2)) # Refresh and compare: expected = self._gen_result_summary_reaped( costs_usd=[0.], id='1d69b9f088008910', modified_ts=now_1, state=State.PENDING, try_number=1) self.assertEqual(expected, run_result.result_summary_key.get().to_dict()) expected = self._gen_run_result( abandoned_ts=now_1, completed_ts=now_1, id='1d69b9f088008911', internal_failure=True, modified_ts=now_1, state=State.BOT_DIED) self.assertEqual(expected, run_result.key.get().to_dict()) # Task was retried. now_2 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 2) bot_dimensions_second = self.bot_dimensions.copy() bot_dimensions_second[u'id'] = [u'localhost-second'] self._register_bot(1, bot_dimensions_second) _request, _, run_result = task_scheduler.bot_reap_task( bot_dimensions_second, 'abc', None) self.assertEqual(1, self.execute_tasks()) self.assertEqual(3, len(pub_sub_calls)) # PENDING -> RUNNING self.assertEqual(2, run_result.try_number) self.assertEqual(False, is_in_negative_cache(1)) self.assertEqual(True, is_in_negative_cache(2)) # Was just reaped. self.assertEqual( State.COMPLETED, task_scheduler.bot_update_task( run_result_key=run_result.key, bot_id='localhost-second', cipd_pins=None, output='Foo1', output_chunk_start=0, exit_code=0, duration=0.1, hard_timeout=False, io_timeout=False, cost_usd=0.1, outputs_ref=None, performance_stats=None)) expected = self._gen_result_summary_reaped( bot_dimensions=bot_dimensions_second, bot_id=u'localhost-second', completed_ts=now_2, costs_usd=[0., 0.1], duration=0.1, exit_code=0, id='1d69b9f088008910', modified_ts=now_2, started_ts=now_2, state=State.COMPLETED, try_number=2) self.assertEqual(expected, run_result.result_summary_key.get().to_dict()) self.assertEqual(0.1, run_result.key.get().cost_usd) self.assertEqual(4, len(pub_sub_calls)) # RUNNING -> COMPLETED def test_cron_handle_bot_died_no_update_not_idempotent(self): # A bot reaped a task but the handler returned HTTP 500, leaving the task in # a lingering state. pub_sub_calls = self.mock_pub_sub() # Test first try, then success. run_result = self._quick_reap( 1, 0, pubsub_topic='projects/abc/topics/def', task_slices=[ task_request.TaskSlice( expiration_secs=600, properties=_gen_properties(), wait_for_capacity=False), ]) self.assertEqual(1, len(pub_sub_calls)) # PENDING -> RUNNING # Bot becomes MIA. now_1 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 1) self.assertEqual(([], 1, 0), task_scheduler.cron_handle_bot_died()) self.assertEqual(1, self.execute_tasks()) self.assertEqual(2, len(pub_sub_calls)) # RUNNING -> PENDING # Refresh and compare: expected = self._gen_result_summary_reaped( costs_usd=[0.], id='1d69b9f088008910', modified_ts=now_1, state=State.PENDING, try_number=1) self.assertEqual(expected, run_result.result_summary_key.get().to_dict()) expected = self._gen_run_result( abandoned_ts=now_1, completed_ts=now_1, id='1d69b9f088008911', internal_failure=True, modified_ts=now_1, state=task_result.State.BOT_DIED) self.assertEqual(expected, run_result.key.get().to_dict()) # Task was retried. now_2 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 2) bot_dimensions_second = self.bot_dimensions.copy() bot_dimensions_second[u'id'] = [u'localhost-second'] self._register_bot(1, bot_dimensions_second) _request, _, run_result = task_scheduler.bot_reap_task( bot_dimensions_second, 'abc', None) self.assertEqual(1, self.execute_tasks()) self.assertEqual(3, len(pub_sub_calls)) # PENDING -> RUNNING self.assertEqual(2, run_result.try_number) self.assertEqual( task_result.State.COMPLETED, task_scheduler.bot_update_task( run_result_key=run_result.key, bot_id='localhost-second', cipd_pins=None, output='Foo1', output_chunk_start=0, exit_code=0, duration=0.1, hard_timeout=False, io_timeout=False, cost_usd=0.1, outputs_ref=None, performance_stats=None)) expected = self._gen_result_summary_reaped( bot_dimensions=bot_dimensions_second, bot_id=u'localhost-second', completed_ts=now_2, costs_usd=[0., 0.1], duration=0.1, exit_code=0, id='1d69b9f088008910', modified_ts=now_2, started_ts=now_2, state=task_result.State.COMPLETED, try_number=2) self.assertEqual(expected, run_result.result_summary_key.get().to_dict()) self.assertEqual(0.1, run_result.key.get().cost_usd) self.assertEqual(4, len(pub_sub_calls)) # RUNNING -> COMPLETED def test_cron_handle_bot_died_broken_task(self): # Not sure why, but this was observed on the fleet: the TaskRequest is # missing from the DB. This test ensures the cron job doesn't throw in this # situation. run_result = self._quick_reap( 1, 0, task_slices=[ task_request.TaskSlice( expiration_secs=60, properties=_gen_properties(), wait_for_capacity=False), ]) to_run_key = task_to_run.request_to_task_to_run_key( run_result.request_key.get(), 1, 0) now_1 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 1) # Very unusual, the TaskRequest disappeared: run_result.request_key.delete() self.assertEqual( (['1d69b9f088008911'], 0, 0), task_scheduler.cron_handle_bot_died()) def test_bot_poll_http_500_but_bot_reapears_after_BOT_PING_TOLERANCE(self): # A bot reaped a task, sleeps for over BOT_PING_TOLERANCE (2 minutes), then # sends a ping. # In the meantime the cron job ran, saw the job idle with 0 update for more # than BOT_PING_TOLERANCE, re-enqueue it. run_result = self._quick_reap( 1, 0, task_slices=[ task_request.TaskSlice( expiration_secs= 3*int(task_result.BOT_PING_TOLERANCE.total_seconds()), properties=_gen_properties(), wait_for_capacity=False), ]) to_run_key_1 = task_to_run.request_to_task_to_run_key( run_result.request_key.get(), 1, 0) self.assertIsNone(to_run_key_1.get().queue_number) # See _handle_dead_bot() with special case about non-idempotent task that # were never updated. now_1 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 1) self.assertEqual(([], 1, 0), task_scheduler.cron_handle_bot_died()) # Now the task is available. Bot magically wakes up (let's say a laptop that # went to sleep). The update is denied. self.assertEqual( None, task_scheduler.bot_update_task( run_result_key=run_result.key, bot_id='localhost-second', cipd_pins=None, output='Foo1', output_chunk_start=0, exit_code=0, duration=0.1, hard_timeout=False, io_timeout=False, cost_usd=0.1, outputs_ref=None, performance_stats=None)) # Confirm it is denied. run_result = run_result.key.get() self.assertEqual(State.BOT_DIED, run_result.state) result_summary = run_result.result_summary_key.get() self.assertEqual(State.PENDING, result_summary.state) # The old TaskToRun is not reused. self.assertIsNone(to_run_key_1.get().queue_number) to_run_key_2 = task_to_run.request_to_task_to_run_key( run_result.request_key.get(), 2, 0) self.assertTrue(to_run_key_2.get().queue_number) def test_cron_handle_bot_died_same_bot_denied(self): # Test first retry, then success. run_result = self._quick_reap( 1, 0, task_slices=[ task_request.TaskSlice( expiration_secs=600, properties=_gen_properties(idempotent=True), wait_for_capacity=False), ]) self.assertEqual(1, run_result.try_number) self.assertEqual(State.RUNNING, run_result.state) now_1 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 1) self.assertEqual(([], 1, 0), task_scheduler.cron_handle_bot_died()) # Refresh and compare: # The interesting point here is that even though the task is PENDING, it has # worker information from the initial BOT_DIED task. expected = self._gen_run_result( abandoned_ts=now_1, completed_ts=now_1, id='1d69b9f088008911', internal_failure=True, modified_ts=now_1, state=State.BOT_DIED) self.assertEqual(expected, run_result.key.get().to_dict()) expected = self._gen_result_summary_pending( bot_dimensions=self.bot_dimensions.copy(), bot_version=u'abc', bot_id=u'localhost', costs_usd=[0.], id='1d69b9f088008910', modified_ts=now_1, try_number=1) self.assertEqual(expected, run_result.result_summary_key.get().to_dict()) # Task was retried but the same bot polls again, it's denied the task. now_2 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 2) request, _, run_result = task_scheduler.bot_reap_task( self.bot_dimensions, 'abc', None) self.assertIsNone(request) self.assertIsNone(run_result) def test_cron_handle_bot_died_second(self): # Test two tries internal_failure's leading to a BOT_DIED status. run_result = self._quick_reap( 1, 0, task_slices=[ task_request.TaskSlice( expiration_secs=600, properties=_gen_properties(idempotent=True), wait_for_capacity=False), ]) request = run_result.request_key.get() def is_in_negative_cache(t): to_run_key = task_to_run.request_to_task_to_run_key(request, t, 0) return task_to_run._lookup_cache_is_taken_async(to_run_key).get_result() self.assertEqual(1, run_result.try_number) self.assertEqual(True, is_in_negative_cache(1)) # Was just reaped. self.assertEqual(False, is_in_negative_cache(2)) self.assertEqual(State.RUNNING, run_result.state) self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 1) self.assertEqual(([], 1, 0), task_scheduler.cron_handle_bot_died()) self.assertEqual(False, is_in_negative_cache(1)) self.assertEqual(False, is_in_negative_cache(2)) # A second bot comes to reap the task. now_1 = self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 2) bot_dimensions_second = self.bot_dimensions.copy() bot_dimensions_second[u'id'] = [u'localhost-second'] self._register_bot(1, bot_dimensions_second) _request, _, run_result = task_scheduler.bot_reap_task( bot_dimensions_second, 'abc', None) self.assertTrue(run_result) self.assertEqual(False, is_in_negative_cache(1)) # Was just tried to be reaped. self.assertEqual(True, is_in_negative_cache(2)) now_2 = self.mock_now(self.now + 2 * task_result.BOT_PING_TOLERANCE, 3) self.assertEqual( (['1d69b9f088008912'], 0, 0), task_scheduler.cron_handle_bot_died()) self.assertEqual(([], 0, 0), task_scheduler.cron_handle_bot_died()) self.assertEqual(False, is_in_negative_cache(1)) self.assertEqual(False, is_in_negative_cache(2)) expected = self._gen_result_summary_reaped( abandoned_ts=now_2, completed_ts=now_2, bot_dimensions=bot_dimensions_second, bot_id=u'localhost-second', costs_usd=[0., 0.], id='1d69b9f088008910', internal_failure=True, modified_ts=now_2, started_ts=now_1, state=State.BOT_DIED, try_number=2) self.assertEqual(expected, run_result.result_summary_key.get().to_dict()) def test_cron_handle_bot_died_ignored_expired(self): run_result = self._quick_reap( 1, 0, task_slices=[ task_request.TaskSlice( expiration_secs=600, properties=_gen_properties(), wait_for_capacity=False), ]) self.assertEqual(1, run_result.try_number) self.assertEqual(State.RUNNING, run_result.state) self.mock_now(self.now + task_result.BOT_PING_TOLERANCE, 601) self.assertEqual( (['1d69b9f088008911'], 0, 0), task_scheduler.cron_handle_bot_died()) def test_cron_handle_external_cancellations(self): es_address = 'externalscheduler_address' es_id = 'es_id' external_schedulers = [ pools_config.ExternalSchedulerConfig(es_address, es_id, None, True), pools_config.ExternalSchedulerConfig(es_address, es_id, None, True), pools_config.ExternalSchedulerConfig(es_address, es_id, None, False), ] self.mock_pool_config('es-pool', external_schedulers=external_schedulers) known_pools = pools_config.known() self.assertEqual(len(known_pools), 1) calls = [] def mock_get_cancellations(es_cfg): calls.append(es_cfg) c = plugin_pb2.GetCancellationsResponse.Cancellation() # Note: This task key is invalid, but that helps to exercise # the exception handling in the handler. # Also, in the wild we would not be making duplicate calls with the same # task and bot; this is simply convenient for testing. c.task_id = "task1" c.bot_id = "bot1" return [c] self.mock(external_scheduler, 'get_cancellations', mock_get_cancellations) task_scheduler.cron_handle_external_cancellations() self.execute_tasks() self.assertEqual(len(calls), 2) self.assertEqual(len(self._enqueue_calls), 2) def test_cron_handle_external_cancellations_none(self): es_address = 'externalscheduler_address' es_id = 'es_id' external_schedulers = [ pools_config.ExternalSchedulerConfig(es_address, es_id, None, True), pools_config.ExternalSchedulerConfig(es_address, es_id, None, True), pools_config.ExternalSchedulerConfig(es_address, es_id, None, False), ] self.mock_pool_config('es-pool', external_schedulers=external_schedulers) known_pools = pools_config.known() self.assertEqual(len(known_pools), 1) calls = [] def mock_get_cancellations(es_cfg): calls.append(es_cfg) return None self.mock(external_scheduler, 'get_cancellations', mock_get_cancellations) task_scheduler.cron_handle_external_cancellations() self.assertEqual(len(calls), 2) self.assertEqual(len(self._enqueue_calls), 0) def mock_pool_config( self, name, scheduling_users=None, scheduling_groups=None, trusted_delegatees=None, service_accounts=None, service_accounts_groups=None, external_schedulers=None): self._known_pools = self._known_pools or set() self._known_pools.add(name) def mocked_get_pool_config(pool): if pool == name: return pools_config.PoolConfig( name=name, rev='rev', scheduling_users=frozenset(scheduling_users or []), scheduling_groups=frozenset(scheduling_groups or
<filename>Empirical_Roofline_Tool-1.1.0/Python/ert_core.py import sys,operator,subprocess,os,glob,filecmp,math import socket,platform,time,json,optparse,ast from ert_utils import * def text_list_2_string(text_list): return reduce(operator.add,[t+" " for t in text_list]) class ert_core: def __init__(self): self.ert_version = "1.1.0" self.dict = {} self.metadata = {} self.metadata["ERT_VERSION"] = self.ert_version hostname = socket.gethostname() try: new_hostname = socket.gethostbyaddr(hostname) except socket.herror: new_hostname = hostname hostname = new_hostname hostname = os.getenv("NERSC_HOST",hostname) self.metadata["HOSTNAME"] = hostname self.metadata["UNAME"] = platform.uname() def build_only(self, option, opt, value, parser): parser.values.build = True parser.values.run = False parser.values.post = False def run_only(self, option, opt, value, parser): parser.values.build = False parser.values.run = True parser.values.post = False def post_only(self, option, opt, value, parser): parser.values.build = False parser.values.run = False parser.values.post = True def flags(self): parser = optparse.OptionParser(usage="%prog [-h] [--help] [options] config_file",version="%prog " + self.ert_version) build_group = optparse.OptionGroup(parser,"Build options"); build_group.add_option("--build",dest="build",action="store_true",default=True,help="Build the micro-kernels [default]") build_group.add_option("--no-build",dest="build",action="store_false",default=True,help="Don't build the micro-kernels") build_group.add_option("--build-only",dest="build",action="callback",callback=self.build_only,help="Only build the micro-kernels") parser.add_option_group(build_group) run_group = optparse.OptionGroup(parser,"Run options"); run_group.add_option("--run",dest="run",action="store_true",default=True,help="Run the micro-kernels [default]") run_group.add_option("--no-run",dest="run",action="store_false",default=True,help="Don't run the micro-kernels") run_group.add_option("--run-only",dest="run",action="callback",callback=self.run_only,help="Only run the micro-kernels") parser.add_option_group(run_group) post_group = optparse.OptionGroup(parser,"Post-processing options"); post_group.add_option("--post",dest="post",action="store_true",default=True,help="Run the post-processing [default]") post_group.add_option("--no-post",dest="post",action="store_false",default=True,help="Don't run the post-processing") post_group.add_option("--post-only",dest="post",action="callback",callback=self.post_only,help="Only run the post-processing") post_group.add_option("--gnuplot",dest="gnuplot",action="store_true",default=True,help="Generate graphs using GNUplot [default]") post_group.add_option("--no-gnuplot",dest="gnuplot",action="store_false",default=True,help="Don't generate graphs using GNUplot") parser.add_option_group(post_group) parser.add_option("--verbose",dest="verbose",action="store",nargs=1,default=1,type=int,help="Set the verbosity of the screen output [default = %default]. = 0 : no output, = 1 : outlines progress, = 2 : good for debugging (prints all commands)") parser.add_option("--quiet",dest="verbose",action="store_const",const=0,help="Don't generate any screen output, '--verbose=0'") (options,args) = parser.parse_args() def nullusage(fd): fd.write("\n") if len(args) < 1: parser.print_help() parser.print_usage = nullusage parser.error("no configuration file given") if len(args) > 1: parser.print_help() parser.print_usage = nullusage parser.error("more than one configuration file given") self.options = options self.configure_filename = args[0] return 0 def configure(self): if self.options.verbose > 0: print print "Reading configuration from '%s'..." % self.configure_filename try: configure_file = open(self.configure_filename,"r") except IOError: sys.stderr.write("Unable to open '%s'...\n" % self.configure_filename) return 1 self.dict["CONFIG"] = {} for line in configure_file: line = line[:-1] if len(line) > 0 and line[0] != "#": line = line.split() if len(line) > 0: target = line[0] value = line[1:] if len(target) > 0: if target == "ERT_PRECISION": prec_list = value[0].split(",") self.dict["CONFIG"][target] = prec_list else: self.dict["CONFIG"][target] = value if "ERT_MPI" not in self.dict["CONFIG"]: self.dict["CONFIG"]["ERT_MPI"] = [False] if "ERT_OPENMP" not in self.dict["CONFIG"]: self.dict["CONFIG"]["ERT_OPENMP"] = [False] if "ERT_GPU" not in self.dict["CONFIG"]: self.dict["CONFIG"]["ERT_GPU"] = [False] if "ERT_PRECISION" not in self.dict["CONFIG"]: self.dict["CONFIG"]["ERT_PRECISION"] = ["FP64"] if "ERT_OCL" not in self.dict["CONFIG"]: self.dict["CONFIG"]["ERT_OCL"] = [False] self.results_dir = self.dict["CONFIG"]["ERT_RESULTS"][0] made_results = make_dir_if_needed(self.results_dir,"results",False) if self.options.verbose > 0: if made_results: print " Making new results directory, %s..." % self.results_dir else: print " Using existing results directory, %s..." % self.results_dir run_files = glob.glob("%s/Run.[0-9][0-9][0-9]" % self.results_dir) used_run_files = [] used_run_list = [] no_dir = True for run_file in run_files: run_configure_filename = "%s/config.ert" % run_file if os.path.exists(run_configure_filename): if filecmp.cmp(self.configure_filename,run_configure_filename): self.results_dir = run_file no_dir = False if self.options.verbose > 0: print " Using existing run directory, %s..." % self.results_dir break else: used_run_files.append(run_file) used_run_list.append(int(run_file[-3:])) else: used_run_files.append(run_file) used_run_list.append(int(run_file[-3:])) if no_dir: if self.options.build or self.options.run: if len(used_run_list) == 0: used_run_list = [0] for n in xrange(1,max(used_run_list)+2): if n not in used_run_list: self.results_dir = "%s/Run.%03d" % (self.results_dir,n) if self.options.verbose > 0: if made_results: print " Making new run directory, '%s'..." % self.results_dir else: print print "*** WARNING ***" print "**" print "** Making new run directory, '%s'," % self.results_dir print "** because the current connfiguration file, '%s' " % self.configure_filename print "** doesn't match the configuration files, 'config.ert', under:" print "**" for u in sorted(used_run_files): print "** %s" % u print "**" print "*** WARNING ***" command = ["mkdir",self.results_dir] if execute_noshell(command,self.options.verbose > 1) != 0: sys.stderr.write("Unable to make new run directory, '%s'\n" % self.results_dir) return 1 command = ["cp",self.configure_filename,"%s/config.ert" % self.results_dir] if execute_noshell(command,self.options.verbose > 1) != 0: sys.stderr.write("Unable to copy configuration file, '%s', into new run directory, %s\n" % (self.configure_filename,self.results_dir)) return 1 break else: sys.stderr.write("\nNo run directory for '%s' found under '%s'\n" % (self.configure_filename,self.results_dir)) return 1 if self.options.verbose > 0: print return 0 def build(self): if self.options.build: if self.options.verbose > 0: if self.options.verbose > 1: print print " Building ERT core code..." command_prefix = \ self.dict["CONFIG"]["ERT_CC"] + \ self.dict["CONFIG"]["ERT_CFLAGS"] + \ ["-I%s/Kernels" % self.exe_path] + \ ["-DERT_FLOP=%d" % self.flop] + \ ["-DERT_ALIGN=%s" % self.dict["CONFIG"]["ERT_ALIGN"][0]] + \ ["-DERT_MEMORY_MAX=%s" % self.dict["CONFIG"]["ERT_MEMORY_MAX"][0]] + \ ["-DERT_WORKING_SET_MIN=%s" % self.dict["CONFIG"]["ERT_WORKING_SET_MIN"][0]] + \ ["-DERT_TRIALS_MIN=%s" % self.dict["CONFIG"]["ERT_TRIALS_MIN"][0]] if self.dict["CONFIG"]["ERT_MPI"][0] == "True": command_prefix += ["-DERT_MPI"] + self.dict["CONFIG"]["ERT_MPI_CFLAGS"] if self.dict["CONFIG"]["ERT_OPENMP"][0] == "True": command_prefix += ["-DERT_OPENMP"] + self.dict["CONFIG"]["ERT_OPENMP_CFLAGS"] if self.dict["CONFIG"]["ERT_GPU"][0] == "True": command_prefix += ["-DERT_GPU"] + self.dict["CONFIG"]["ERT_GPU_CFLAGS"] for p in self.dict["CONFIG"]["ERT_PRECISION"]: command_prefix += ["-DERT_%s" % p] command = command_prefix + \ ["-c","%s/Drivers/%s.cxx" % (self.exe_path,self.dict["CONFIG"]["ERT_DRIVER"][0])] + \ ["-o","%s/%s.o" % (self.flop_dir,self.dict["CONFIG"]["ERT_DRIVER"][0])] if execute_noshell(command,self.options.verbose > 1) != 0: sys.stderr.write("Compiling driver, %s, failed\n" % self.dict["CONFIG"]["ERT_DRIVER"][0]) return 1 if self.dict["CONFIG"]["ERT_OCL"][0] != "True": command = command_prefix + \ ["-c","%s/Kernels/%s.cxx" % (self.exe_path,self.dict["CONFIG"]["ERT_KERNEL"][0])] + \ ["-o","%s/%s.o" % (self.flop_dir,self.dict["CONFIG"]["ERT_KERNEL"][0])] if execute_noshell(command,self.options.verbose > 1) != 0: sys.stderr.write("Compiling kernel, %s, failed\n" % self.dict["CONFIG"]["ERT_KERNEL"][0]) return 1 command = self.dict["CONFIG"]["ERT_LD"] + \ self.dict["CONFIG"]["ERT_LDFLAGS"] if self.dict["CONFIG"]["ERT_MPI"][0] == "True": command += self.dict["CONFIG"]["ERT_MPI_LDFLAGS"] if self.dict["CONFIG"]["ERT_OPENMP"][0] == "True": command += self.dict["CONFIG"]["ERT_OPENMP_LDFLAGS"] if self.dict["CONFIG"]["ERT_GPU"][0] == "True": command += self.dict["CONFIG"]["ERT_GPU_LDFLAGS"] if self.dict["CONFIG"]["ERT_OCL"][0] != "True": command += ["%s/%s.o" % (self.flop_dir,self.dict["CONFIG"]["ERT_DRIVER"][0])] + \ ["%s/%s.o" % (self.flop_dir,self.dict["CONFIG"]["ERT_KERNEL"][0])] + \ self.dict["CONFIG"]["ERT_LDLIBS"] + \ ["-o","%s/%s.%s" % (self.flop_dir,self.dict["CONFIG"]["ERT_DRIVER"][0],self.dict["CONFIG"]["ERT_KERNEL"][0])] else: command += ["%s/%s.o" % (self.flop_dir,self.dict["CONFIG"]["ERT_DRIVER"][0])] + \ self.dict["CONFIG"]["ERT_LDLIBS"] + \ ["-o","%s/%s" % (self.flop_dir,self.dict["CONFIG"]["ERT_DRIVER"][0])] if execute_noshell(command,self.options.verbose > 1) != 0: sys.stderr.write("Linking code failed\n") return 1 return 0 def add_metadata(self,outputname): try: output = open(outputname,"a") except IOError: sys.stderr.write("Unable to open output file, %s, to add metadata\n" % outputfile) return 1 for k,v in self.metadata.items(): output.write("%s %s\n" % (k,v)) for k,v in self.dict.items(): output.write("%s %s\n" % (k,v)) output.close() return 0 def run(self): if self.options.run: if self.options.verbose > 0: if self.options.verbose > 1: print print " Running ERT core code..." self.run_list = [] if self.dict["CONFIG"]["ERT_MPI"][0] == "True": mpi_procs_list = parse_int_list(self.dict["CONFIG"]["ERT_MPI_PROCS"][0]) else: mpi_procs_list = [1] if self.dict["CONFIG"]["ERT_OPENMP"][0] == "True": openmp_threads_list = parse_int_list(self.dict["CONFIG"]["ERT_OPENMP_THREADS"][0]) else: openmp_threads_list = [1] if self.dict["CONFIG"]["ERT_MPI"][0] == "True": if self.dict["CONFIG"]["ERT_OPENMP"][0] == "True": procs_threads_list = parse_int_list(self.dict["CONFIG"]["ERT_PROCS_THREADS"][0]) else: procs_threads_list = mpi_procs_list else: if self.dict["CONFIG"]["ERT_OPENMP"][0] == "True": procs_threads_list = openmp_threads_list else: procs_threads_list = [1] if self.dict["CONFIG"]["ERT_GPU"][0] == "True": gpu_blocks_list = parse_int_list(self.dict["CONFIG"]["ERT_GPU_BLOCKS"][0]) else: gpu_blocks_list = [1] if self.dict["CONFIG"]["ERT_GPU"][0] == "True": gpu_threads_list = parse_int_list(self.dict["CONFIG"]["ERT_GPU_THREADS"][0]) else: gpu_threads_list = [1] if self.dict["CONFIG"]["ERT_GPU"][0] == "True": blocks_threads_list = parse_int_list(self.dict["CONFIG"]["ERT_BLOCKS_THREADS"][0]) else: blocks_threads_list = [1] num_experiments = int(self.dict["CONFIG"]["ERT_NUM_EXPERIMENTS"][0]) base_command = list_2_string(self.dict["CONFIG"]["ERT_RUN"]) for mpi_procs in mpi_procs_list: for openmp_threads in openmp_threads_list: if mpi_procs * openmp_threads in procs_threads_list: for gpu_blocks in gpu_blocks_list: for gpu_threads in gpu_threads_list: if gpu_blocks * gpu_threads in blocks_threads_list: print_str = "" if self.dict["CONFIG"]["ERT_MPI"][0] == "True": mpi_dir = "%s/MPI.%04d" % (self.flop_dir,mpi_procs) print_str += "MPI %d, " % mpi_procs else: mpi_dir = self.flop_dir if self.options.run: make_dir_if_needed(mpi_dir,"run",self.options.verbose > 1) if self.dict["CONFIG"]["ERT_OPENMP"][0] == "True": openmp_dir = "%s/OpenMP.%04d" % (mpi_dir,openmp_threads) print_str += "OpenMP %d, " % openmp_threads else: openmp_dir = mpi_dir if self.options.run: make_dir_if_needed(openmp_dir,"run",self.options.verbose > 1) if self.dict["CONFIG"]["ERT_GPU"][0] == "True": gpu_dir = "%s/GPU_Blocks.%04d" % (openmp_dir,gpu_blocks) print_str += "GPU blocks %d, " % gpu_blocks else: gpu_dir = openmp_dir if self.options.run: make_dir_if_needed(gpu_dir,"run",self.options.verbose > 1) if self.dict["CONFIG"]["ERT_GPU"][0] == "True": run_dir = "%s/GPU_Threads.%04d" % (gpu_dir,gpu_threads) print_str += "GPU threads %d, " % gpu_threads else: run_dir = gpu_dir if self.options.run: make_dir_if_needed(run_dir,"run",self.options.verbose > 1) self.run_list.append(run_dir) if print_str == "": print_str = "serial" else: print_str = print_str[:-2] if self.options.run: if os.path.exists("%s/run.done" % run_dir): if self.options.verbose > 1: print " Skipping %s - already run" % print_str else: if self.options.verbose > 0: print " %s" % print_str command = base_command command = command.replace("ERT_OPENMP_THREADS",str(openmp_threads)) command = command.replace("ERT_MPI_PROCS",str(mpi_procs)) if self.dict["CONFIG"]["ERT_OCL"][0] == "True": command = command.replace("ERT_CODE","%s/%s" % (self.flop_dir,self.dict["CONFIG"]["ERT_DRIVER"][0])) elif self.dict["CONFIG"]["ERT_GPU"][0] == "True": command = command.replace("ERT_CODE","%s/%s.%s %d %d" % (self.flop_dir,self.dict["CONFIG"]["ERT_DRIVER"][0],self.dict["CONFIG"]["ERT_KERNEL"][0],gpu_blocks,gpu_threads)) else: command = command.replace("ERT_CODE","%s/%s.%s" % (self.flop_dir,self.dict["CONFIG"]["ERT_DRIVER"][0],self.dict["CONFIG"]["ERT_KERNEL"][0])) command = "(" + command + ") > %s/try.ERT_TRY_NUM 2>&1 " % run_dir for t in xrange(1,num_experiments+1): output = "%s/try.%03d" % (run_dir,t) cur_command = command cur_command = cur_command.replace("ERT_TRY_NUM","%03d" % t) self.metadata["TIMESTAMP_DATA"] = time.time() if execute_shell(cur_command,self.options.verbose > 1) != 0: sys.stderr.write("Unable to complete %s, experiment %d\n" % (run_dir,t)) return 1 if self.add_metadata(output) != 0: return 1 command = ["touch","%s/run.done" % run_dir] if execute_noshell(command,self.options.verbose > 1) != 0: sys.stderr.write("Unable to make 'run.done' file in %s\n" % run_dir) return 1 if self.options.verbose > 1: print
<reponame>bentley/tools<filename>se/spelling.py #!/usr/bin/env python3 """ Defines various spelling-related helper functions. """ from pathlib import Path from pkg_resources import resource_filename import regex import se DICTIONARY = [] # Store our hyphenation dictionary so we don't re-read the file on every pass def modernize_hyphenation(xhtml: str) -> str: """ Convert old-timey hyphenated compounds into single words based on the passed DICTIONARY. INPUTS xhtml: A string of XHTML to modernize OUTPUTS: A string representing the XHTML with its hyphenation modernized """ # First, initialize our dictionary if we haven't already if not se.spelling.DICTIONARY: se.spelling.DICTIONARY = set(line.strip().lower() for line in open(resource_filename("se", str(Path("data") / "words")))) # Easy fix for a common case xhtml = regex.sub(r"\b([Nn])ow-a-days\b", r"\1owadays", xhtml) # now-a-days -> nowadays result = regex.findall(r"\b[^\W\d_]+\-[^\W\d_]+\b", xhtml) for word in set(result): # set() removes duplicates new_word = word.replace("-", "").lower() if new_word in se.spelling.DICTIONARY: # To preserve capitalization of the first word, we get the individual parts # then replace the original match with them joined together and titlecased. lhs = regex.sub(r"\-.+$", r"", word) rhs = regex.sub(r"^.+?\-", r"", word) xhtml = regex.sub(r"" + lhs + "-" + rhs, lhs + rhs.lower(), xhtml) # Quick fix for a common error cases xhtml = xhtml.replace("z3998:nonfiction", "z3998:non-fiction") xhtml = regex.sub(r"\b([Dd])og’seared", r"\1og’s-eared", xhtml) xhtml = regex.sub(r"\b([Mm])anat-arms", r"\1an-at-arms", xhtml) xhtml = regex.sub(r"\b([Tt])abled’hôte", r"\1able-d’hôte", xhtml) return xhtml def modernize_spelling(xhtml: str) -> str: """ Convert old-timey spelling on a case-by-case basis. INPUTS xhtml: A string of XHTML to modernize language: The IETF language tag of the XHTML, like "en-US" or "en-GB" OUTPUTS: A string representing the XHTML with its spelling modernized """ # What language are we using? language = regex.search(r"<html[^>]+?xml:lang=\"([^\"]+)\"", xhtml) if language is None or (language.group(1) != "en-US" and language.group(1) != "en-GB"): raise se.InvalidLanguageException("No valid xml:lang attribute in <html> root. Only en-US and en-GB are supported.") # ADDING NEW WORDS TO THIS LIST: # A good way to check if a word is "archaic" is to do a Google N-Gram search: https://books.google.com/ngrams/graph?case_insensitive=on&year_start=1800&year_end=2000&smoothing=3 # Remember that en-US and en-GB differ significantly, and just because a word might seem strange to you, doesn't mean it's not the common case in the other variant. # If Google N-Gram shows that a word has declined significantly in usage in BOTH en-US and en-GB (or the SE editor-in-chief makes an exception) then it may be a good candidate to add to this list. xhtml = regex.sub(r"\b([Dd])evelope\b", r"\1evelop", xhtml) # develope -> develop xhtml = regex.sub(r"\b([Oo])ker\b", r"\1cher", xhtml) # oker -> ocher xhtml = regex.sub(r"\b([Ww])ellnigh\b", r"\1ell-nigh", xhtml) # wellnigh -> well-nigh xhtml = regex.sub(r"\b([Tt]he|[Aa]nd|[Oo]r) what not(?! to)\b", r"\1 whatnot", xhtml) # what not -> whatnot xhtml = regex.sub(r"\b([Gg])ood\-bye?\b", r"\1oodbye", xhtml) # good-by -> goodbye xhtml = regex.sub(r"\b([Hh])ind(u|oo)stanee", r"\1industani", xhtml) # hindoostanee -> hindustani xhtml = regex.sub(r"\b([Hh])indoo", r"\1indu", xhtml) # hindoo -> hindu xhtml = regex.sub(r"\b([Ee])xpence", r"\1xpense", xhtml) # expence -> expense xhtml = regex.sub(r"\b([Ll])otos", r"\1otus", xhtml) # lotos -> lotus xhtml = regex.sub(r"\b([Ss])collop", r"\1callop", xhtml) # scollop -> scallop xhtml = regex.sub(r"\b([Ss])ubtil(?!(ize|izing))", r"\1ubtle", xhtml) # subtil -> subtle (but "subtilize" and "subtilizing") xhtml = regex.sub(r"\bQuoiff", r"Coif", xhtml) # quoiff -> coif xhtml = regex.sub(r"\bquoiff", r"coif", xhtml) # quoiff -> coif xhtml = regex.sub(r"\bIndorse", r"Endorse", xhtml) # indorse -> endorse xhtml = regex.sub(r"\bindorse", r"endorse", xhtml) # indorse -> endorse xhtml = regex.sub(r"\bIntrust", r"Entrust", xhtml) # Intrust -> Entrust xhtml = regex.sub(r"\bintrust", r"entrust", xhtml) # intrust -> entrust xhtml = regex.sub(r"\bPhantas(y|ie)", r"Fantasy", xhtml) # phantasie -> fantasy xhtml = regex.sub(r"\bphantas(y|ie)", r"fantasy", xhtml) # phantasie -> fantasy xhtml = regex.sub(r"\bPhantastic", r"Fantastic", xhtml) # phantastic -> fantastic xhtml = regex.sub(r"\bphantastic", r"fantastic", xhtml) # phantastic -> fantastic xhtml = regex.sub(r"\bPhrensy", r"Frenzy", xhtml) # Phrensy -> Frenzy xhtml = regex.sub(r"\bphrensy", r"frenzy", xhtml) # phrensy -> frenzy xhtml = regex.sub(r"\b([Mm])enage\b", r"\1énage", xhtml) # menage -> ménage xhtml = regex.sub(r"([Hh])ypothenuse", r"\1ypotenuse", xhtml) # hypothenuse -> hypotenuse xhtml = regex.sub(r"[‘’]([Bb])us\b", r"\1us", xhtml) # ’bus -> bus xhtml = regex.sub(r"([Nn])aïve", r"\1aive", xhtml) # naïve -> naive xhtml = regex.sub(r"([Nn])a[ïi]vet[ée]", r"\1aivete", xhtml) # naïveté -> naivete xhtml = regex.sub(r"&amp;c\.", r"etc.", xhtml) # &c. -> etc. xhtml = regex.sub(r"([Pp])rot[ée]g[ée]", r"\1rotégé", xhtml) # protege -> protégé xhtml = regex.sub(r"([Tt])ete-a-tete", r"\1ête-à-tête", xhtml) # tete-a-tete -> tête-à-tête xhtml = regex.sub(r"([Vv])is-a-vis", r"\1is-à-vis", xhtml) # vis-a-vis _> vis-à-vis xhtml = regex.sub(r"([Ff])acade", r"\1açade", xhtml) # facade -> façade xhtml = regex.sub(r"([Cc])h?ateau(s?\b)", r"\1hâteau\2", xhtml) # chateau -> château xhtml = regex.sub(r"([Hh])abitue", r"\1abitué", xhtml) # habitue -> habitué xhtml = regex.sub(r"\b([Bb])lase\b", r"\1lasé", xhtml) # blase -> blasé xhtml = regex.sub(r"\b([Bb])bee[’']s[ \-]wax\b", r"\1eeswax", xhtml) # bee’s-wax -> beeswax xhtml = regex.sub(r"\b([Cc])afe\b", r"\1afé", xhtml) # cafe -> café xhtml = regex.sub(r"\b([Cc])afes\b", r"\1afés", xhtml) # cafes -> cafés; We break up cafe so that we don't catch 'cafeteria' xhtml = regex.sub(r"([Mm])êlée", r"\1elee", xhtml) # mêlée -> melee xhtml = regex.sub(r"\b([Ff])ete([sd])?\b", r"\1ête\2", xhtml) # fete -> fête xhtml = regex.sub(r"\b([Rr])ôle\b", r"\1ole", xhtml) # rôle -> role xhtml = regex.sub(r"\b([Cc])oö", r"\1oo", xhtml) # coö -> coo (as in coöperate) xhtml = regex.sub(r"\b([Rr])eë", r"\1ee", xhtml) # reë -> ree (as in reëvaluate) xhtml = regex.sub(r"\b([Dd])aïs\b", r"\1ais", xhtml) # daïs -> dais xhtml = regex.sub(r"\b([Cc])oup\-de\-grace", r"\1oup-de-grâce", xhtml) # coup-de-grace -> coup-de-grâce xhtml = regex.sub(r"\b([Cc])anape", r"\1anapé", xhtml) # canape -> canapé xhtml = regex.sub(r"\b([Pp])recis\b", r"\1récis", xhtml) # precis -> précis xhtml = regex.sub(r"\b([Gg])ood\-by([^e])", r"\1oodbye\2", xhtml) # good-by -> goodbye xhtml = regex.sub(r"\b([Gg])ood\-night", r"\1ood night", xhtml) # good-night -> good night xhtml = regex.sub(r"\b([Gg])ood\-morning", r"\1ood morning", xhtml) # good-morning -> good morning xhtml = regex.sub(r"\b([Gg])ood\-evening", r"\1ood evening", xhtml) # good-evening -> good evening xhtml = regex.sub(r"\b([Gg])ood\-day", r"\1ood day", xhtml) # good-day -> good day xhtml = regex.sub(r"\b([Gg])ood\-afternoon", r"\1ood afternoon", xhtml) # good-afternoon -> good afternoon xhtml = regex.sub(r"\b([Bb])ete noir", r"\1ête noir", xhtml) # bete noir -> bête noir xhtml = regex.sub(r"\bEclat\b", r"Éclat", xhtml) # eclat -> éclat xhtml = regex.sub(r"\beclat\b", r"éclat", xhtml) # eclat -> éclat xhtml = regex.sub(r"\ba la\b", r"à la", xhtml) # a la -> à la xhtml = regex.sub(r"\ba propos\b", r"apropos", xhtml) # a propos -> apropos xhtml = regex.sub(r"\bper cent(s?)\b", r"percent\1", xhtml) # per cent -> percent xhtml = regex.sub(r"\bpercent\.(\s+[a-z])", r"percent\1", xhtml) # percent. followed by lowercase -> percent xhtml = regex.sub(r"\bpercent\.,\b", r"percent,", xhtml) # per cent. -> percent xhtml = regex.sub(r"\b([Ff])iance", r"\1iancé", xhtml) # fiance -> fiancé xhtml = regex.sub(r"\b([Oo])utre\b", r"\1utré", xhtml) # outre -> outré xhtml = regex.sub(r"\b([Ff])etich", r"\1etish", xhtml) # fetich -> fetish xhtml = regex.sub(r"\b([Pp])igstye\b", r"\1igsty", xhtml) # pigstye -> pigsty xhtml = regex.sub(r"\b([Pp])igstyes\b", r"\1igsties", xhtml) # pigstyes -> pigsties xhtml = regex.sub(r"\b([Cc])lew(s?)\b", r"\1lue\2", xhtml) # clew -> clue xhtml = regex.sub(r"\b[ÀA]\s?propos\b", r"Apropos", xhtml) # à propos -> apropos xhtml = regex.sub(r"\b[àa]\s?propos\b", r"apropos", xhtml) # à propos -> apropos xhtml = regex.sub(r"\b([Nn])ew comer(s?)\b", r"\1ewcomer\2", xhtml) # new comer -> newcomer xhtml = regex.sub(r"\b([Pp])ease\b(?![ \-]pudding)", r"\1eas", xhtml) # pease -> peas (but "pease pudding") xhtml = regex.sub(r"\b([Ss])uch like\b", r"\1uchlike", xhtml) # such like -> suchlike xhtml = regex.sub(r"\b([Ee])mployé", r"\1mployee", xhtml) # employé -> employee xhtml = regex.sub(r"\b(?<!ancien )([Rr])égime", r"\1egime", xhtml) # régime -> regime (but "ancien régime") xhtml = regex.sub(r"\b([Bb])urthen", r"\1urden", xhtml) # burthen -> burden xhtml = regex.sub(r"\b([Dd])isburthen", r"\1isburden", xhtml) # disburthen -> disburthen xhtml = regex.sub(r"\b[EÉ]lys[eé]e", r"Élysée", xhtml) # Elysee -> Élysée xhtml = regex.sub(r"\b([Ll])aw suit", r"\1awsuit", xhtml) # law suit -> lawsuit xhtml = regex.sub(r"\bIncase", r"Encase", xhtml) # incase -> encase xhtml = regex.sub(r"\bincase", r"encase", xhtml) # incase -> encase xhtml = regex.sub(r"\b([Cc])ocoa-?nut", r"\1oconut", xhtml) # cocoanut / cocoa-nut -> coconut xhtml = regex.sub(r"\b([Ww])aggon", r"\1agon", xhtml) # waggon -> wagon xhtml = regex.sub(r"\b([Ss])wop", r"\1wap", xhtml) # swop -> swap xhtml = regex.sub(r"\b([Ll])acquey", r"\1ackey", xhtml) # lacquey -> lackey xhtml = regex.sub(r"\b([Bb])ric-à-brac", r"\1ric-a-brac", xhtml) # bric-à-brac -> bric-a-brac xhtml = regex.sub(r"\b([Kk])iosque", r"\1iosk", xhtml) # kiosque -> kiosk xhtml = regex.sub(r"\b([Dd])epôt", r"\1epot", xhtml) # depôt -> depot xhtml = regex.sub(r"(?<![Cc]ompl)exion", r"ection", xhtml) # -extion -> -exction (connexion, reflexion, etc., but "complexion") xhtml = regex.sub(r"\b([Dd])ulness", r"\1ullness", xhtml) # dulness -> dullness xhtml = regex.sub(r"\b([Ff])iord", r"\1jord", xhtml) # fiord -> fjord xhtml = regex.sub(r"\b([Ff])ulness\b", r"\1ullness", xhtml) # fulness -> fullness (but not for ex. thoughtfulness) xhtml = regex.sub(r"\b’([Pp])hone", r"\1hone", xhtml) # ’phone -> phone xhtml = regex.sub(r"\b([Ss])hew", r"\1how", xhtml) # shew -> show xhtml = regex.sub(r"\b([Tt])rowsers", r"\1rousers", xhtml) # trowsers -> trousers xhtml = regex.sub(r"\b([Bb])iass", r"\1ias", xhtml) # biass -> bias xhtml = regex.sub(r"\b([Cc])huse", r"\1hoose", xhtml) # chuse -> choose xhtml = regex.sub(r"\b([Cc])husing", r"\1hoosing", xhtml) # chusing -> choosing xhtml = regex.sub(r"\b([Cc])ontroul(s?)\b", r"\1ontrol\2", xhtml) # controul -> control xhtml = regex.sub(r"\b([Cc])ontroul(ing|ed)", r"\1ontroll\2", xhtml) # controuling/ed -> controlling/ed xhtml = regex.sub(r"\b([Ss])urpriz(e|ing)", r"\1urpris\2", xhtml) # surprize->surprise, surprizing->surprising xhtml = regex.sub(r"\b([Dd])oat\b", r"\1ote", xhtml) # doat -> dote xhtml = regex.sub(r"\b([Dd])oat(ed|ing)", r"\1ot\2", xhtml) # doating -> doting xhtml = regex.sub(r"\b([Ss])topt", r"\1topped", xhtml) # stopt -> stopped xhtml = regex.sub(r"\b([Ss])tept", r"\1tepped", xhtml) # stept -> stepped xhtml = regex.sub(r"\b([Ss])ecresy", r"\1ecrecy", xhtml) # secresy -> secrecy xhtml = regex.sub(r"\b([Mm])esalliance", r"\1ésalliance", xhtml) # mesalliance -> mésalliance xhtml = regex.sub(r"\b([Ss])ate\b", r"\1at", xhtml) # sate -> sat xhtml = regex.sub(r"\b([Aa])ttache\b", r"\1ttaché", xhtml) # attache -> attaché xhtml = regex.sub(r"\b([Pp])orte[\- ]coch[eè]re\b", r"\1orte-cochère", xhtml) # porte-cochere -> porte-cochère xhtml = regex.sub(r"\b([Nn])égligée?(s?)\b", r"\1egligee\2", xhtml) # négligée -> negligee xhtml = regex.sub(r"\b([Ss])hort cut(s?)\b", r"\1hortcut\2", xhtml) # short cut -> shortcut xhtml = regex.sub(r"\b([Ff])ocuss", r"\1ocus", xhtml) # focuss -> focus xhtml = regex.sub(r"\b([Mm])ise[ \-]en[ \-]sc[eè]ne", r"\1ise-en-scène", xhtml) # mise en scene -> mise-en-scène xhtml = regex.sub(r"\b([Nn])ee\b", r"\1ée", xhtml) # nee -> née xhtml = regex.sub(r"\b([Ee])au[ \-]de[ \-]Cologne\b", r"\1au de cologne", xhtml) # eau de Cologne -> eau de cologne xhtml = regex.sub(r"\b([Ss])enor", r"\1eñor", xhtml) # senor -> señor (senores, senorita/s, etc.) xhtml = regex.sub(r"\b([Gg])ramme?(s)?\b", r"\1ram\2", xhtml) # gramm/grammes -> gram/grams xhtml = regex.sub(r"\b([Aa])larum\b", r"\1larm", xhtml) # alarum -> alarm xhtml = regex.sub(r"\b([Bb])owlder(s?)\b", r"\1oulder\2", xhtml) # bowlder/bowlders -> boulder/boulders xhtml = regex.sub(r"\b([Dd])istingue\b", r"\1istingué", xhtml) # distingue -> distingué xhtml = regex.sub(r"\b[EÉ]cart[eé]\b", r"Écarté", xhtml) # ecarte -> écarté xhtml = regex.sub(r"\b[eé]cart[eé]\b",
# # Copyright (c) 2014 NORDUnet A/S # All rights reserved. # # Redistribution and use in source and binary forms, with or # without modification, are permitted provided that the following # conditions are met: # # 1. Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # 2. Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following # disclaimer in the documentation and/or other materials provided # with the distribution. # 3. Neither the name of the NORDUnet nor the names of its # contributors may be used to endorse or promote products derived # from this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS # FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE # COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, # INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, # BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER # CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT # LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN # ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # POSSIBILITY OF SUCH DAMAGE. # # Author : <NAME> <<EMAIL>> # """ Module handling authentication of users. Also applies login policies such as rate limiting. """ from __future__ import annotations import logging from dataclasses import asdict, dataclass, field from datetime import datetime from typing import Any, Dict, List, Mapping, Optional, Sequence, Tuple, Type from bson import ObjectId from eduid_common.api import exceptions from eduid_common.authn import get_vccs_client from eduid_common.misc.timeutil import utc_now from eduid_userdb import MongoDB from eduid_userdb.credentials import Credential, Password from eduid_userdb.exceptions import UserHasNotCompletedSignup from eduid_userdb.idp import IdPUser, IdPUserDb from vccs_client import VCCSClientHTTPError, VCCSPasswordFactor from eduid_webapp.idp.settings.common import IdPConfig logger = logging.getLogger(__name__) @dataclass class AuthnData(object): """ Data about a successful authentication. Returned from functions performing authentication. """ cred_id: str timestamp: datetime = field(default_factory=utc_now) def to_dict(self) -> Dict[str, Any]: """ Return the object in dict format (serialized for storing in MongoDB). """ res = asdict(self) # rename 'timestamp' to 'authn_ts' when writing to the database to match legacy code res['authn_ts'] = res.pop('timestamp') return res @classmethod def from_dict(cls: Type[AuthnData], data: Mapping[str, Any]) -> AuthnData: """ Construct element from a data dict in database format. """ _data = dict(data) # to not modify callers data # 'timestamp' is called 'authn_ts' in the database for legacy reasons if 'authn_ts' in _data: _data['timestamp'] = _data.pop('authn_ts') return cls(**_data) class IdPAuthn(object): """ :param config: IdP configuration data """ def __init__( self, config: IdPConfig, userdb: IdPUserDb, ): self.config = config self.userdb = userdb self.auth_client = get_vccs_client(config.vccs_url) # already checked with isinstance in app init assert config.mongo_uri is not None self.authn_store = AuthnInfoStore(uri=config.mongo_uri) def password_authn(self, username: str, password: str) -> Tuple[Optional[IdPUser], Optional[AuthnData]]: """ Authenticate someone using a username and password. :returns: The IdPUser found, and AuthnData on success """ try: user = self.userdb.lookup_user(username) except UserHasNotCompletedSignup: # XXX Redirect user to some kind of info page return None, None if not user: logger.info(f'Unknown user : {repr(username)}') # XXX we effectively disclose there was no such user by the quick # response in this case. Maybe send bogus auth request to backends? return None, None logger.debug(f'Found user {user}') cred = self._verify_username_and_password2(user, password) if not cred: return None, None return user, AuthnData(cred_id=cred.key) def _verify_username_and_password2(self, user: IdPUser, password: str) -> Optional[Password]: """ Attempt to verify that a password is valid for a specific user. Currently, the naive approach of looping through all the users password credentials is taken. This is bad because the more passwords a user has, the more likely an online attacker is to guess any one of them. :return: IdPUser on successful authentication :rtype: Credential | None """ pw_credentials = user.credentials.filter(Password).to_list() if self.authn_store: # requires optional configuration authn_info = self.authn_store.get_user_authn_info(user) if authn_info.failures_this_month > self.config.max_authn_failures_per_month: logger.info( "User {!r} AuthN failures this month {!r} > {!r}".format( user, authn_info.failures_this_month, self.config.max_authn_failures_per_month ) ) raise exceptions.EduidTooManyRequests("Too Many Requests") # Optimize list of credentials to try based on which credentials the # user used in the last successful authentication. This optimization # is based on plain assumption, no measurements whatsoever. last_creds = authn_info.last_used_credentials sorted_creds = sorted(pw_credentials, key=lambda x: x.credential_id not in last_creds) if sorted_creds != pw_credentials: logger.debug( "Re-sorted list of credentials into\n{}\nbased on last-used {!r}".format(sorted_creds, last_creds) ) pw_credentials = sorted_creds return self._authn_passwords(user, password, pw_credentials) def _authn_passwords(self, user: IdPUser, password: str, pw_credentials: Sequence[Password]) -> Optional[Password]: """ Perform the final actual authentication of a user based on a list of (password) credentials. :param user: User object :param password: <PASSWORD> :param pw_credentials: Password credentials to try :return: Credential used, or None if authentication failed """ for cred in pw_credentials: try: factor = VCCSPasswordFactor(password, str(cred.credential_id), str(cred.salt)) except ValueError as exc: logger.info(f'User {user} password factor {cred.credential_id} unusable: {exc}') continue logger.debug(f"Password-authenticating {user}/{cred.credential_id} with VCCS: {factor}") user_id = str(user.user_id) try: if self.auth_client.authenticate(user_id, [factor]): logger.debug(f'VCCS authenticated user {user}') # Verify that the credential had been successfully used in the last 18 months # (Kantara AL2_CM_CSM#050). if self.credential_expired(cred): logger.info(f'User {user} credential {cred.key} has expired') raise exceptions.EduidForbidden('CREDENTIAL_EXPIRED') self.log_authn(user, success=[cred.credential_id], failure=[]) return cred except VCCSClientHTTPError as exc: if exc.http_code == 500: logger.debug(f'VCCS credential {cred.credential_id} might be revoked') continue logger.debug(f'VCCS username-password authentication FAILED for user {user}') self.log_authn(user, success=[], failure=[cred.credential_id for cred in pw_credentials]) return None def credential_expired(self, cred: Password) -> bool: """ Check that a credential hasn't been unused for too long according to Kantara AL2_CM_CSM#050. :param cred: Authentication credential """ if not self.authn_store: # requires optional configuration logger.debug(f"Can't check if credential {cred.key} is expired, no authn_store available") return False last_used = self.authn_store.get_credential_last_used(cred.credential_id) if last_used is None: # Can't disallow this while there is a short-path from signup to dashboard unforch... logger.debug('Allowing never-used credential {!r}'.format(cred)) return False now = utc_now() delta = now - last_used logger.debug(f'Credential {cred.key} last used {delta.days} days ago') return delta.days >= int(365 * 1.5) def log_authn(self, user: IdPUser, success: Sequence[str], failure: Sequence[str]) -> None: """ Log user authn success as well as failures. :param user: User :param success: List of successfully authenticated credentials :param failure: List of failed credentials """ if not self.authn_store: # requires optional configuration return None if success: self.authn_store.credential_success(success) if success or failure: self.authn_store.update_user(user.user_id, success, failure) return None class AuthnInfoStore: """ In this database, information about users have ObjectId _id's corresponding to user.user_id, and information about credentials have string _id's. Example: User info: { "_id" : ObjectId("5fc5f6a318e93a5e90212c0e"), "success_ts" : ISODate("2020-12-01T07:54:24.309Z"), "last_credential_ids" : [ "5fc5f6ab18e93a5e90212c11" ], "fail_count" : { "202012" : 0 }, "success_count" : { "202012" : 1 } } Credential info: { "_id" : "5fc5f74618e93a5e90212c16", "success_ts" : ISODate("2020-12-01T07:56:58.665Z") } """ def __init__(self, uri: str, db_name: str = 'eduid_idp_authninfo', collection_name: str = 'authn_info'): logger.debug('Setting up AuthnInfoStore') self._db = MongoDB(db_uri=uri, db_name=db_name) self.collection = self._db.get_collection(collection_name) def credential_success(self, cred_ids: Sequence[str], ts: Optional[datetime] = None) -> None: """ Kantara AL2_CM_CSM#050 requires that any credential that is not used for a period of 18 months is disabled (taken to mean revoked). Therefore we need to log all successful authentications and have a cron job handling the revoking of unused credentials. :param cred_ids: List of Credential ID :param ts: Optional timestamp :return: None """ if ts is None: ts = utc_now() # Update all existing entries in one go would've been nice, but pymongo does not # return meaningful data for multi=True, so it is not possible to figure out # which entries were actually updated :( for this in cred_ids: self.collection.save({'_id': this, 'success_ts': ts}) return None def update_user( self, user_id: ObjectId, success: Sequence[str], failure: Sequence[str], ts: Optional[datetime] = None ) -> None: """ Log authentication result data for this user. The fail_count.month is logged to be able to lock users out after too many failed authentication attempts in a month (yet unspecific Kantara requirement). The success_count.month is logged for symmetry. The last_credential_ids are logged so that the IdP can sort the list of credentials giving preference
self.colors.keys(): cr = Color(c, v, p.get_shades()) cr.default = p.get_core_shade() self._colors[c] = cr self.log.info( f"Color '{c}' extracted from '{p.get_palette_name()}'") self.log.info(f"Total of {len(self.colors) - previous} new colors " f"added to the current color list") def _extract(self, name: str) -> Color: name = name.strip() if name not in self.colors.keys(): self.log.warn(f"Color '{name}' not found in current palette. " f"Checking if it is present in other available " f"palettes.") self._generate_additional_colors() if name not in self.colors.keys(): if name in SYNONYM.keys(): self.log.info(f"{SYNONYM[name]} is used instead {name}") return self.colors[SYNONYM[name]] # If color is still not present, then it is an error if name not in self.colors.keys(): self.log.error(f"Unable to find '{name}'. Please check " f"spelling error. Currently available colors: " f"{list(self.colors.keys())}", exception=KeyError) return self.colors[name] def _extract_color_list(self, name, no_of_colors: int, *, starting_shade: float = None, ending_shade: float = None, reverse: bool = False, **kwargs) -> List[ColorString]: # If staring and ending shades are not provided, take the ones # present in the default shades if starting_shade is None: starting_shade = min(self._value.get_shades()) if ending_shade is None: ending_shade = max(self._value.get_shades()) shades = [starting_shade + x * (ending_shade - starting_shade) / no_of_colors for x in range(no_of_colors)] if reverse: shades = reversed(shades) return [self._extract(name).shade(s) for s in shades] def random(self, no_of_colors: int = 1, *, shade: float = None, alpha: float = None, starting_shade: float = None, ending_shade: float = None, gradient: bool = True, avoid: list = None, reverse: bool = False, force_list: bool = False, print_colors: bool = False, seed=None, **kwargs): """ Generate random color(s) from current palette. >>> p = Palette() >>> p.random() # Single random color >>> p.random(no_of_colors=5) # 5 random colors >>> p.random(shade=20) # Random color whos shade is 20 >>> p.random(shade=60, no_of_colors=8) # 8 random colors whose shade is 60 >>> p.random(starting_shade=50, ending_shade=80, no_of_colors=4) #Random colors whos shades are between 50-80 >>> p.random(no_of_colors=4, gradient=False) # 4 completely random colors with random shades >>> p.random(no_of_colors=40, avoid=["blue"]) # 40 random colors but do not use "blue" >>> p.random(no_of_colors=10, seed=100) # Generate 10 random color with seed 100 >>> p.random(force_list=True) # List containing single random color >>> p.random(print_colors=True) # Print color on the console >>> p.random(no_of_colors=5, reverse=True) # 5 random colors whos shades should arange in darker to lighter :param no_of_colors: Number of colors (default: 1) :param shade: Shade of the color (default: palette's default). This will be ignored when number of colors are greater than 1 and starting_shade /ending_shade arguments are provided :param alpha: Transparency value (beteen 0-1). This will only be considered if palette 'color_mode' supports Alpha channel. This will be applied to all colors. :param starting_shade: Starting shade of colors (used when number of colors are more than 1.) :param ending_shade: Ending shade of colors (used when number of colors are more than 1.) :param gradient: If True, all shades (not colors) will be sorted in ascending order. (default: True) :param avoid: List of colors which should not be considered while generating random numbers. (default: white, black) :param reverse: If True, shades will be ordered in descending order :param force_list: If True, return type will always be list. Else when no of colors is 1, this function will return str/tuple. :param print_colors: If True, colors generated will be printed on the console. :param seed: Seed for random number generator (will override the global palette seed) :param kwargs: Other named arguments :return: Str/Tuple/list of random colors depending above options """ _param_deprecation(self.log, "ignore_gray", **kwargs) _param_deprecation(self.log, "force_gray", **kwargs) if seed is not None: self.seed = seed if avoid is None: avoid = ["white", "black"] use_only_shade = True if shade is not None and starting_shade is not None: use_only_shade = False if shade is not None and ending_shade is not None: use_only_shade = False if starting_shade is None: starting_shade = min(self._value.get_shades()) if ending_shade is None: ending_shade = max(self._value.get_shades()) # remove the restricted colors provided by 'avoid' accepted_colors = [] for x in self.colors.values(): if x.name not in avoid: accepted_colors.append(x) # Select random colors colors = [] for i in range(no_of_colors): colors.append(random.choice(accepted_colors)) # If shade is specified, directly return the selected colors if shade is not None: if no_of_colors == 1 and not force_list: return self._send(colors[0].shade(shade), alpha=alpha, print_colors=print_colors) return self._send([x.shade(shade) for x in colors], alpha=alpha, print_colors=print_colors) # Select the shade # First check if we can return one of the standard shade. # This will provide proper palette shade and will also reduce the # computation time of all conversion possible_shades = [x for x in self._value.get_shades() if starting_shade <= x <= ending_shade] shades = [] if no_of_colors <= len(possible_shades): for i in range(no_of_colors): shades.append(random.choice(possible_shades)) else: for i in range(no_of_colors): shades = random.randint(starting_shade, ending_shade) # If gradient is true, sort the shades if gradient: shades = list(sorted(shades)) if reverse: shades = list(reversed(shades)) if use_only_shade and shade is not None: shades = [shade for _ in range(len(shades))] if no_of_colors == 1 and not force_list: return self._send(colors[0].shade(shades[0]), alpha=alpha, print_colors=print_colors) return self._send([x[0].shade(x[1]) for x in zip(colors, shades)], alpha=alpha, print_colors=print_colors) def random_balanced(self, no_of_colors: int = 1): """ Generates balanced random colors by defining shade. It essentially just predefines the shade to palettes default shade. :param no_of_colors: Number of colors :return: str/tuple/list based on number of colors and global 'color_mode' """ return self.random(no_of_colors, shade=self._value.get_core_shade()) def random_gradient(self, no_of_colors: int = 3, *, shade: float = None, alpha: float = 1, print_colors: bool = False, complementary=True, **kwargs): """ Generates random gradient between two colors >>> p = Palette() >>> p.random_gradient() # Random gradient between two colors >>> p.random_gradient(no_of_colors=5) # Generates gradient between 2 colors and also adds 3 more colors between them >>> p.random_gradient(complementary=False) # Use totally random colors for the gradient :param no_of_colors: Number of in-between colors (default: 3) :param shade: Shades of color :param alpha: Alpha value between 0-1 (will ne applied to all colors) :param print_colors: If True, prints colors on the console :param complementary: If True, generates gradient between two complementary colors. (default: True) :param kwargs: Other named arguments :return: List of colors representing gradient """ _param_deprecation(self.log, "ignore_gray", **kwargs) colors = set() colors.add(random.choice(list(self.colors.values()))) colors.add(random.choice(list(self.colors.values()))) if shade is None: shade = self._value.get_core_shade() colors = [x.shade(shade) for x in colors] if complementary: colors[1] = ColorString(get_complementary(colors[0])) if no_of_colors < 3: return self._send(colors[:no_of_colors], alpha=alpha, print_colors=print_colors) no_of_colors = no_of_colors - 2 mid_colors = color_in_between(colors[0], colors[1], no_of_colors) mid_colors = [ColorString(x) for x in mid_colors] mid_colors.insert(0, colors[0]) mid_colors.append(colors[1]) return self._send(mid_colors, alpha=alpha, print_colors=print_colors) @staticmethod @deprecated("This method will be removed from Palette class in future. " "Please use ColorMap class for this purpose") def cmap_from(matplotlib, hex_color_list: list): """Creates custom cmap from given hex_color list. Use :class:`~ColorMap` for more refined control. Color inputs should be HEX format. :param matplotlib: matplotlib object (https://matplotlib.org/) :param hex_color_list: List of colors in Hex format :return: *LinearSegmentedColormap* segment which can be used with *matplotlib* plots. """ if type(hex_color_list) is not list: raise Exception("Please provide list of colors") try: return matplotlib.colors.LinearSegmentedColormap.from_list( "cMap_secret_colors", hex_color_list) except AttributeError: raise Exception("Add 'matplotlib' as a first argument. For " "example, import matplotlib; palette.cmap_from(" "matplotlib, " "palette.red());") def _common_color(self, name, kwargs): del kwargs["self"] color = self._extract(name) if kwargs["no_of_colors"] > 1: if kwargs["gradient"]: colors = self._extract_color_list(name, **kwargs) else: shades = [] for i in range(int(kwargs["no_of_colors"])): shades.append(random.randint( self._value.get_shades()[-1], self._value.get_shades()[0] )) colors = [color.shade(x) for x in shades] return self._send(colors, **kwargs) else: shade = color.default if kwargs["shade"]: shade = kwargs["shade"] return self._send(color.shade(shade), **kwargs) def _named_color(self, name: str, system: str, strict: bool): both = [W3_DATA, X11_DATA] if system == "x11": both = list(reversed(both)) if strict: # If it is strict search, take only named data data = both[0] else: # If it is not strict search, merge both names such that one # will get priority over another data = {**both[1], **both[0]} if name not in data.keys(): raise KeyError(f"Unfortunately, '{name}' is not found in " f"available naming datasets. Please check " f"spelling mistake. This search is case sensitive" f" if 'strict_search' option is enabled.") return Color(name, [self.white(), data[name], self.black()], [0, 50, 100])
without extension # NOTE: not compatible with use of the -i option xtitle_filename = os.path.split(xfile)[1] xtitle_filename = os.path.splitext(xtitle_filename)[0] logging.info('Title:[%s]', NP.strunicodeout(xtitle_filename)) # For each pic found on Flickr 1st check title and then Sets pic_index = 0 for pic in search_is_uploaded.find('photos').findall('photo'): pic_index += 1 logging.debug('idx=[%s] pic.id=[%s] ' 'pic.title=[%s] pic.tags=[%s]', pic_index, pic.attrib['id'], NP.strunicodeout(pic.attrib['title']), NP.strunicodeout(pic.attrib['tags'])) # Use NP.strunicodeout in comparison to avoid warning: # "UnicodeWarning: Unicode equal comparison failed to # convert both arguments to Unicode" logging.debug('xtitle_filename/type=[%s]/[%s] ' 'pic.attrib[title]/type=[%s]/[%s]', NP.strunicodeout(xtitle_filename), type(xtitle_filename), NP.strunicodeout(pic.attrib['title']), type(pic.attrib['title'])) logging.info('Compare Titles=[%s]', (NP.strunicodeout(xtitle_filename) == NP.strunicodeout(pic.attrib['title']))) # if pic with checksum has a different title, continue if not (NP.strunicodeout(xtitle_filename) == NP.strunicodeout(pic.attrib['title'])): logging.info('Different titles: File:[%s] Flickr:[%s]', NP.strunicodeout(xtitle_filename), NP.strunicodeout(pic.attrib['title'])) continue ctx_success, resp, ctx_errcode = faw.flickrapi_fn( self.nuflickr.photos.getAllContexts, (), dict(photo_id=pic.attrib['id']), 3, 8, True, caughtcode='195') if not (ctx_success and ctx_errcode == 0): # CODING: how to indicate an error? # Possibly raising an exception? # raise Exception('photos_getAllContexts: ' # 'Max attempts exhausted.') NP.niceprint(' IS_UPLOADED=[ERROR#2]', fname='isuploaded', verbosity=3, logalso=logging.WARNING) return ret_is_photo_uploaded, ret_photos_uploaded, \ ret_photo_id, ret_uploaded_no_set logging.info('len(resp.findall(''set'')):[%s]', len(resp.findall('set'))) # B) checksum, title, empty setname, Count=1 # THEN EXISTS, ASSIGN SET IF tag album IS FOUND if not resp.findall('set'): # CODING: Consider one additional result for PHOTO UPLOADED # WITHOUT SET WITH ALBUM TAG when row exists on DB. Mark # such row on the database files.set_id to null # to force re-assigning to Album/Set on flickr. tfind, _ = self.photos_find_tag( photo_id=pic.attrib['id'], intag='album:{}' .format(xsetname)) if tfind: NP.niceprint(' IS_UPLOADED=[UPLOADED WITHOUT' ' SET WITH ALBUM TAG]', fname='isuploaded', verbosity=2, logalso=logging.WARNING) ret_is_photo_uploaded = True ret_photo_id = pic.attrib['id'] ret_uploaded_no_set = True return ret_is_photo_uploaded, ret_photos_uploaded, \ ret_photo_id, ret_uploaded_no_set # B1) checksum, title, empty setname, Count=1 # THEN NOT EXISTS, IGNORE IF tag album NOT FOUND else: NP.niceprint('IS_UPLOADED=[UPLOADED WITHOUT' ' SET WITHOUT ALBUM TAG]', fname='isuploaded', verbosity=2, logalso=logging.WARNING) ret_is_photo_uploaded = False ret_uploaded_no_set = True for setinlist in resp.findall('set'): logging.warning('Output for setinlist: %s', xml.etree.ElementTree.tostring( setinlist, encoding='utf-8', method='xml')) logging.warning( '\nCheck : id:[%s] File:[%s]\n' 'Check : Title:[%s] Set:[%s]\n' 'Flickr: Title:[%s] Set:[%s] Tags:[%s]\n', pic.attrib['id'], NP.strunicodeout(xfile), NP.strunicodeout(xtitle_filename), NP.strunicodeout(xsetname), NP.strunicodeout(pic.attrib['title']), NP.strunicodeout(setinlist.attrib['title']), NP.strunicodeout(pic.attrib['tags'])) logging.warning( 'Compare Sets=[%s]', (NP.strunicodeout(xsetname) == NP.strunicodeout(setinlist.attrib['title']))) # C) checksum, title, setname (1 or more), Count>=1 # THEN EXISTS if (NP.strunicodeout(xsetname) == NP.strunicodeout(setinlist.attrib['title'])): NP.niceprint(' IS_UPLOADED=[TRUE WITH SET]', fname='isuploaded', verbosity=2, logalso=logging.WARNING) ret_is_photo_uploaded = True ret_photo_id = pic.attrib['id'] ret_uploaded_no_set = False return ret_is_photo_uploaded, ret_photos_uploaded, \ ret_photo_id, ret_uploaded_no_set else: # D) checksum, title, other setname, Count>=1 # THEN NOT EXISTS NP.niceprint(' IS_UPLOADED=[FALSE OTHER SET, ' 'CONTINUING SEARCH IN SETS]', fname='isuploaded', verbosity=2, logalso=logging.WARNING) continue return ret_is_photo_uploaded, ret_photos_uploaded, \ ret_photo_id, ret_uploaded_no_set # ------------------------------------------------------------------------- # photos_find_tag # # Determines if tag is assigned to a pic. # def photos_find_tag(self, photo_id, intag): """ photos_find_tag Determines if intag is assigned to a pic. Returns: found_tag = False/True tag_id = tag_id if found """ logging.info('find_tag: photo:[%s] intag:[%s]', photo_id, intag) tag_success, tag_result, tag_errcode = faw.flickrapi_fn( self.nuflickr.tags.getListPhoto, (), dict(photo_id=photo_id), 3, 15, True, caughtcode='205') if tag_success and tag_errcode == 0: tag_id = None for tag in tag_result.find('photo').find('tags').findall('tag'): logging.info('photos_find_tag tag:[%s]', tag.attrib['raw']) if (NP.strunicodeout(tag.attrib['raw']) == NP.strunicodeout(intag)): tag_id = tag.attrib['id'] logging.info('Found tag_id:[%s] for intag:[%s]', tag_id, intag) return True, tag_id return False, '' # ------------------------------------------------------------------------- # photos_remove_tag # # Local Wrapper for Flickr photos.removeTag # The tag to remove from the photo. This parameter should contain # a tag id, as returned by flickr.photos.getInfo. # def photos_remove_tag(self, tag_id): """ photos_remove_tag Local Wrapper for Flickr photos.removeTag The tag to remove from the photo. This parameter should contain a tag id, as returned by flickr.photos.getInfo. """ logging.info('remove_tag: tag_id:[%s]', tag_id) get_success, _, _ = faw.flickrapi_fn( self.nuflickr.tags.removeTag, (), dict(tag_id=tag_id), 3, 5, False, caughtcode='206') return get_success # ------------------------------------------------------------------------- # photos_set_dates # # Update Date/Time Taken on Flickr for Video files # def photos_set_dates(self, photo_id, datetxt): """ photos_set_dates Update Date/Time Taken on Flickr for Video files """ logging.warning(' Setting Date:[%s] Id=[%s]', datetxt, photo_id) get_success, get_result, get_errcode = faw.flickrapi_fn( self.nuflickr.photos.setdates, (), dict(photo_id=photo_id, date_taken='{!s}'.format(datetxt), date_taken_granularity=0), 3, 15, True, caughtcode='210') if get_success and get_errcode == 0: logging.debug('Set Date Response: OK!') else: logging.error('Set Date Response: NOK!') return get_result # ------------------------------------------------------------------------- # madd_albums_tag # # madd_albums_tag wrapper for multiprocessing purposes # def madd_albums_tag(self, lock, running, mutex, filelist, c_total, cur): """ madd_albums_tag Wrapper function for multiprocessing support to call add_albums_tag with a chunk of the files. lock = for database access control in multiprocessing running = shared value to count processed files in multiprocessing mutex = for running access control in multiprocessing cur = cursor for database access control in multiprocessing Remarks: code, cur = Not used as function does not update database. pylint: disable=unused-argument """ # CODING pylint # pylint: disable=unused-argument for i, afile in enumerate(filelist): logging.warning('===Element of Chunk:[%s] file:[%s]', i, afile) # CODING: ALBUM_TAGS_01: Refactor with code at ALBUM_TAGS_02 # afile[0] = files_id # afile[1] = path # afile[2] = set_name # afile[3] = set_id NP.niceprint('ID:[{!s}] Path:[{!s}] Set:[{!s}] SetID:[{!s}]' .format(str(afile[0]), afile[1], afile[2], afile[3]), fname='addAlbumMigrate') # row[1] = path for the file from table files setname = faw.set_name_from_file(afile[1], self.xcfg.FILES_DIR, self.xcfg.FULL_SET_NAME) tfind, tid = self.photos_find_tag( photo_id=afile[0], intag='album:{}'.format(afile[2] if afile[2] is not None else setname)) NP.niceprint(' Find Tag:[{!s}] TagId:[{!s}]' .format(tfind, tid), verbosity=1, logalso=logging.WARNING) if not tfind: get_success, _, get_errcode = faw.flickrapi_fn( self.nuflickr.photos.addTags, (), dict(photo_id=afile[0], tags='album:"{}"'.format(afile[2] if afile[2] is not None else setname)), 2, 2, False, caughtcode='214') a_result = get_success and get_errcode == 0 NP.niceprint('{!s}: Photo_id:[{!s}] File:[{!s}]' .format('Added album tag' if a_result else ' Failed tagging', str(afile[0]), NP.strunicodeout(afile[1])), fname='addAlbumMigrate', logalso=logging.WARNING) else: NP.niceprint(' Found Tag:[{!s}] TagId:[{!s}]' .format(tfind, tid), verbosity=1, logalso=logging.WARNING) logging.debug('===Multiprocessing=== in.mutex.acquire(w)') mutex.acquire() running.value += 1 xcount = running.value mutex.release() logging.info('===Multiprocessing=== out.mutex.release(w)') # Show number of files processed so far NP.niceprocessedfiles(xcount, c_total, False, msg='Album tag Added') # Control pace (rate limit)of each proceess rate_limited.rate_5_callspersecond() # ------------------------------------------------------------------------- # add_albums_tag # # Prepare for version 2.7.0 Add album info to loaded pics # def add_albums_tag(self): """ add_albums_tag Adds tag:album to pics """ # --------------------------------------------------------------------- # Local Variables # # mlockdb = multiprocessing Lock for access to Database # mmutex = multiprocessing mutex for access to value mrunning # mrunning = multiprocessing Value to count processed photos mlockdb = None mmutex = None mrunning = None if not self.check_token(): # authenticate sys.exits in case of failure self.authenticate() con, cur = litedb.connect(self.xcfg.DB_PATH) if not litedb.execute(con, 'SELECT#215', None, self.args.processes, # No need for lock cur, 'SELECT files_id, path, sets.name, sets.set_id ' 'FROM files LEFT OUTER JOIN sets ON ' 'files.set_id = sets.set_id', dbcaughtcode='215'): return False existing_media = cur.fetchall() logging.info('len(existing_media)=[%s]', len(existing_media)) count_total = len(existing_media) # running in multi processing mode if self.args.processes and self.args.processes > 0: logging.debug('Running [%s] processes pool.', self.args.processes) logging.debug('__name__:[%s] to prevent recursive calling)!', __name__) # To prevent recursive calling, check if __name__ == '__main__' # if __name__ == '__main__': mp.mprocessing(self.args.processes, mlockdb, mrunning, mmutex, existing_media, self.madd_albums_tag, cur) # running in single processing mode else: count = 0 count_total = len(existing_media) for row in existing_media: count += 1 # CODING: ALBUM_TAGS_02: Refactor with code at ALBUM_TAGS_01 # row[0] = files_id # row[1] = path # row[2] = set_name # row[3] = set_id NP.niceprint('ID:[{!s}] Path:[{!s}] Set:[{!s}] SetID:[{!s}]' .format(str(row[0]), row[1], row[2], row[3]), fname='addAlbumMigrate') # row[1] = path for the file from table files setname = faw.set_name_from_file(row[1], self.xcfg.FILES_DIR, self.xcfg.FULL_SET_NAME) tfind, tid = self.photos_find_tag( photo_id=row[0], intag='album:{}'.format(row[2] if row[2] is not None else setname)) NP.niceprint(' Find Tag:[{!s}] TagId:[{!s}]' .format(tfind, tid), verbosity=1, logalso=logging.WARNING) if not tfind: get_success, _, get_errcode = faw.flickrapi_fn( self.nuflickr.photos.addTags, (), dict(photo_id=row[0], tags='album:"{}"'.format(row[2] if row[2] is not None else setname)), 2, 2, False, caughtcode='218') a_result = get_success and get_errcode == 0 NP.niceprint('{!s}: Photo_id:[{!s}] [{!s}]' .format('Added album tag' if a_result else ' Failed tagging', str(row[0]), NP.strunicodeout(row[1])), fname='addAlbumMigrate', logalso=logging.WARNING) else: NP.niceprint(' Found Tag:[{!s}] TagId:[{!s}]' .format(tfind, tid), verbosity=1, logalso=logging.WARNING) NP.niceprocessedfiles(count, count_total, False, msg='Album tag Added') NP.niceprocessedfiles(count, count_total, True, msg='Album tag Added') return True # ------------------------------------------------------------------------- # list_bad_files # # List badfiles recorded on Local DB from previous loads # def list_bad_files(self): """ list_bad_files List badfiles recorded on Local DB from previous loads """ NP.niceprint('*****Listing badfiles: Start.*****', fname='list_bad_files') con, cur = litedb.connect(self.xcfg.DB_PATH) if not litedb.execute(con, 'SELECT#218', None, self.args.processes, # No need for lock cur, 'SELECT files_id, path, set_id, md5, tagged, ' 'last_modified ' 'FROM badfiles ORDER BY
bool = False, modules_query: Optional[Tuple[str, str]] = None, extensions_ver: Optional[str] = None, architectures_ver: Optional[str] = None, archives_query: Optional[List[str]] = None, tool_name: Optional[str] = None, is_long_listing: bool = False, ): """ Construct MetadataFactory. :param spec: When set, the MetadataFactory will filter out all versions of Qt that don't fit this SimpleSpec. :param is_latest_version: When True, the MetadataFactory will find all versions of Qt matching filters, and only print the most recent version :param modules_query: [Version of Qt, architecture] for which to list modules :param extensions_ver: Version of Qt for which to list extensions :param architectures_ver: Version of Qt for which to list architectures :param archives_query: [Qt_Version, architecture, *module_names]: used to print list of archives :param tool_name: Name of a tool, without architecture, ie "tools_qtcreator" or "tools_ifw" :param is_long_listing: If true, long listing is used for tools output """ self.logger = getLogger("aqt.metadata") self.archive_id = archive_id self.spec = spec if archive_id.is_tools(): if tool_name: if not tool_name.startswith("tools_"): tool_name = "tools_" + tool_name if is_long_listing: self.request_type = "tool long listing" self._action = lambda: self.fetch_tool_long_listing(tool_name) else: self.request_type = "tool variant names" self._action = lambda: self.fetch_tool_modules(tool_name) else: self.request_type = "tools" self._action = self.fetch_tools elif is_latest_version: self.request_type = "latest version" self._action = lambda: Versions(self.fetch_latest_version()) elif modules_query: self.request_type = "modules" version, arch = modules_query self._action = lambda: self.fetch_modules(self._to_version(version), arch) elif extensions_ver: self.request_type = "extensions" self._action = lambda: self.fetch_extensions(self._to_version(extensions_ver)) elif architectures_ver: self.request_type = "architectures" self._action = lambda: self.fetch_arches(self._to_version(architectures_ver)) elif archives_query: if len(archives_query) < 2: raise CliInputError("The '--archives' flag requires a 'QT_VERSION' and an 'ARCHITECTURE' parameter.") self.request_type = "archives for modules" if len(archives_query) > 2 else "archives for qt" version, arch, modules = archives_query[0], archives_query[1], archives_query[2:] self._action = lambda: self.fetch_archives(self._to_version(version), arch, modules) else: self.request_type = "versions" self._action = self.fetch_versions def getList(self) -> Union[List[str], Versions, ToolData]: return self._action() def fetch_arches(self, version: Version) -> List[str]: self.validate_extension(version) if self.archive_id.extension == "src_doc_examples": return [] qt_ver_str = self._get_qt_version_str(version) modules = self._fetch_module_metadata(self.archive_id.to_folder(qt_ver_str)) arches = [] for name in modules.keys(): ver, arch = name.split(".")[-2:] if ver == qt_ver_str: arches.append(arch) return arches def fetch_extensions(self, version: Version) -> List[str]: versions_extensions = MetadataFactory.get_versions_extensions( self.fetch_http(self.archive_id.to_url()), self.archive_id.category ) filtered = filter( lambda ver_ext: ver_ext[0] == version and ver_ext[1], versions_extensions, ) return list(map(lambda ver_ext: ver_ext[1], filtered)) def fetch_versions(self) -> Versions: def filter_by(ver_ext: Tuple[Optional[Version], str]) -> bool: version, extension = ver_ext return version and (self.spec is None or version in self.spec) and (self.archive_id.extension == extension) def get_version(ver_ext: Tuple[Version, str]): return ver_ext[0] versions_extensions = MetadataFactory.get_versions_extensions( self.fetch_http(self.archive_id.to_url()), self.archive_id.category ) versions = sorted(filter(None, map(get_version, filter(filter_by, versions_extensions)))) iterables = itertools.groupby(versions, lambda version: version.minor) return Versions(iterables) def fetch_latest_version(self) -> Optional[Version]: return self.fetch_versions().latest() def fetch_tools(self) -> List[str]: html_doc = self.fetch_http(self.archive_id.to_url()) return list(MetadataFactory.iterate_folders(html_doc, "tools")) def fetch_tool_modules(self, tool_name: str) -> List[str]: tool_data = self._fetch_module_metadata(tool_name) return list(tool_data.keys()) def fetch_tool_by_simple_spec(self, tool_name: str, simple_spec: SimpleSpec) -> Optional[Dict[str, str]]: # Get data for all the tool modules all_tools_data = self._fetch_module_metadata(tool_name) return self.choose_highest_version_in_spec(all_tools_data, simple_spec) def fetch_tool_long_listing(self, tool_name: str) -> ToolData: return ToolData(self._fetch_module_metadata(tool_name)) def validate_extension(self, qt_ver: Version) -> None: """ Checks extension, and raises CliInputError if invalid. Rules: 1. On Qt6 for Android, an extension for processor architecture is required. 2. On any platform other than Android, or on Qt5, an extension for processor architecture is forbidden. 3. The "wasm" extension only works on desktop targets for Qt 5.13-5.15, or for 6.2+ """ if ( self.archive_id.target == "android" and qt_ver.major == 6 and self.archive_id.extension not in ArchiveId.EXTENSIONS_REQUIRED_ANDROID_QT6 ): raise CliInputError( "Qt 6 for Android requires one of the following extensions: " f"{ArchiveId.EXTENSIONS_REQUIRED_ANDROID_QT6}. " "Please add your extension using the `--extension` flag." ) if self.archive_id.extension in ArchiveId.EXTENSIONS_REQUIRED_ANDROID_QT6 and ( self.archive_id.target != "android" or qt_ver.major != 6 ): raise CliInputError(f"The extension '{self.archive_id.extension}' is only valid for Qt 6 for Android") is_in_wasm_range = qt_ver in SimpleSpec(">=5.13,<6") or qt_ver in SimpleSpec(">=6.2.0") if "wasm" in self.archive_id.extension and (self.archive_id.target != "desktop" or not is_in_wasm_range): raise CliInputError( f"The extension '{self.archive_id.extension}' is only available in Qt 5.13-5.15 and 6.2+ on desktop." ) @staticmethod def choose_highest_version_in_spec( all_tools_data: Dict[str, Dict[str, str]], simple_spec: SimpleSpec ) -> Optional[Dict[str, str]]: # Get versions of all modules. Fail if version cannot be determined. try: tools_versions = [ (name, tool_data, Version.permissive(tool_data["Version"])) for name, tool_data in all_tools_data.items() ] except ValueError: return None # Remove items that don't conform to simple_spec tools_versions = filter(lambda tool_item: tool_item[2] in simple_spec, tools_versions) try: # Return the conforming item with the highest version. # If there are multiple items with the same version, the result will not be predictable. return max(tools_versions, key=operator.itemgetter(2))[1] except ValueError: # There were no tools that fit the simple_spec return None def _to_version(self, qt_ver: str) -> Version: """ Turns a string in the form of `5.X.Y | latest` into a semantic version. If the string does not fit either of these forms, CliInputError will be raised. If qt_ver == latest, and no versions exist corresponding to the filters specified, then CliInputError will be raised. If qt_ver == latest, and an HTTP error occurs, requests.RequestException will be raised. :param qt_ver: Either the literal string `latest`, or a semantic version with each part separated with dots. """ assert qt_ver if qt_ver == "latest": latest_version = self.fetch_latest_version() if not latest_version: msg = "There is no latest version of Qt with the criteria '{}'".format(self.describe_filters()) raise CliInputError(msg) return latest_version try: version = Version(qt_ver) except ValueError as e: raise CliInputError(e) from e return version @staticmethod def fetch_http(rest_of_url: str) -> str: base_urls = Settings.baseurl, random.choice(Settings.fallbacks) for i, base_url in enumerate(base_urls): try: url = posixpath.join(base_url, rest_of_url) return getUrl( url=url, timeout=(Settings.connection_timeout, Settings.response_timeout), ) except (ArchiveDownloadError, ArchiveConnectionError) as e: if i == len(base_urls) - 1: raise e from e @staticmethod def iterate_folders(html_doc: str, filter_category: str = "") -> Generator[str, None, None]: def table_row_to_folder(tr: bs4.element.Tag) -> str: try: return tr.find_all("td")[1].a.contents[0].rstrip("/") except (AttributeError, IndexError): return "" soup: bs4.BeautifulSoup = bs4.BeautifulSoup(html_doc, "html.parser") for row in soup.body.table.find_all("tr"): content: str = table_row_to_folder(row) if not content or content == "Parent Directory": continue if content.startswith(filter_category): yield content @staticmethod def get_versions_extensions(html_doc: str, category: str) -> Iterator[Tuple[Optional[Version], str]]: def folder_to_version_extension(folder: str) -> Tuple[Optional[Version], str]: components = folder.split("_", maxsplit=2) ext = "" if len(components) < 3 else components[2] ver = "" if len(components) < 2 else components[1] return ( get_semantic_version(qt_ver=ver, is_preview="preview" in ext), ext, ) return map( folder_to_version_extension, MetadataFactory.iterate_folders(html_doc, category), ) @staticmethod def _has_nonempty_downloads(element: ElementTree.Element) -> bool: """Returns True if the element has an empty '<DownloadableArchives/>' tag""" downloads = element.find("DownloadableArchives") return downloads is not None and downloads.text def _get_qt_version_str(self, version: Version) -> str: """Returns a Qt version, without dots, that works in the Qt repo urls and Updates.xml files""" # NOTE: The url at `<base>/<host>/<target>/qt5_590/` does not exist; the real one is `qt5_59` patch = ( "" if version.prerelease or self.archive_id.is_preview() or version in SimpleSpec("5.9.0") else str(version.patch) ) return f"{version.major}{version.minor}{patch}" def _fetch_module_metadata(self, folder: str, predicate: Optional[Callable[[ElementTree.Element], bool]] = None): rest_of_url = posixpath.join(self.archive_id.to_url(), folder, "Updates.xml") xml = self.fetch_http(rest_of_url) return xml_to_modules( xml, predicate=predicate if predicate else MetadataFactory._has_nonempty_downloads, ) def fetch_modules(self, version: Version, arch: str) -> List[str]: """Returns list of modules""" self.validate_extension(version) qt_ver_str = self._get_qt_version_str(version) # Example: re.compile(r"^(preview\.)?qt\.(qt5\.)?590\.(.+)$") pattern = re.compile(r"^(preview\.)?qt\.(qt" + str(version.major) + r"\.)?" + qt_ver_str + r"\.(.+)$") modules_meta = self._fetch_module_metadata(self.archive_id.to_folder(qt_ver_str)) def to_module_arch(name: str) -> Tuple[Optional[str], Optional[str]]: _match = pattern.match(name) if not _match: return None, None module_with_arch = _match.group(3) if self.archive_id.is_no_arch() or "." not in module_with_arch: return module_with_arch, None module, arch = module_with_arch.rsplit(".", 1) if module.startswith("addons."): module = module[len("addons.") :] return module, arch modules = set() for name in modules_meta.keys(): module, _arch = to_module_arch(name) if _arch == arch: modules.add(module) return sorted(modules) def fetch_archives(self, version: Version, arch: str, modules: List[str]) -> List[str]: qt_version_str = self._get_qt_version_str(version) nonempty = MetadataFactory._has_nonempty_downloads def all_modules(element: ElementTree.Element) -> bool: _module, _arch = element.find("Name").text.split(".")[-2:] return _arch == arch and _module != qt_version_str and nonempty(element) def specify_modules(element: ElementTree.Element) -> bool: _module, _arch = element.find("Name").text.split(".")[-2:] return _arch == arch and _module in modules and nonempty(element) def no_modules(element: ElementTree.Element) -> bool: name: Optional[str] = element.find("Name").text return name and name.endswith(f".{qt_version_str}.{arch}") and nonempty(element) predicate = no_modules if not modules else all_modules if "all" in modules else specify_modules try: mod_metadata = self._fetch_module_metadata(self.archive_id.to_folder(qt_version_str),
<reponame>ChameleonCloud/portal<filename>tas/forms.py import re from django import forms import logging from pytas.http import TASClient logger = logging.getLogger(__name__) ELIGIBLE = "Eligible" INELIGIBLE = "Ineligible" REQUESTED = "Requested" PI_ELIGIBILITY = ( ("", "Choose One"), (ELIGIBLE, ELIGIBLE), (INELIGIBLE, INELIGIBLE), (REQUESTED, REQUESTED), ) USER_PROFILE_TITLES = ( ("", "Choose one"), ("Center Non-Researcher Staff", "Center Non-Researcher Staff"), ("Center Researcher Staff", "Center Researcher Staff"), ("Faculty", "Faculty"), ("Government User", "Government User"), ("Graduate Student", "Graduate Student"), ("High School Student", "High School Student"), ("High School Teacher", "High School Teacher"), ("Industrial User", "Industrial User"), ("Unaffiliated User", "Unaffiliated User"), ("Nonprofit User", "Nonprofit User"), ("NSF Graduate Research Fellow", "NSF Graduate Research Fellow"), ("Other User", "Other User"), ("Postdoctorate", "Postdoctorate"), ("Undergraduate Student", "Undergraduate Student"), ("Unknown", "Unknown"), ("University Non-Research Staff", "University Non-Research Staff"), ( "University Research Staff", "University Research Staff (excluding postdoctorates)", ), ) # ISO-3166 list; this matches what is in the keycloak-chameleon extension. # TODO(jason): pull this list from an endpoint exposed by Keycloak? Hard to keep # this in sync (but how often do new countries come around?) COUNTRY_LIST = ( ("", "Choose one"), ("Afghanistan", "Afghanistan"), ("Åland Islands", "Åland Islands"), ("Albania", "Albania"), ("Algeria", "Algeria"), ("American Samoa", "American Samoa"), ("Andorra", "Andorra"), ("Angola", "Angola"), ("Anguilla", "Anguilla"), ("Antarctica", "Antarctica"), ("Antigua and Barbuda", "Antigua and Barbuda"), ("Argentina", "Argentina"), ("Armenia", "Armenia"), ("Aruba", "Aruba"), ("Australia", "Australia"), ("Austria", "Austria"), ("Azerbaijan", "Azerbaijan"), ("Bahamas", "Bahamas"), ("Bahrain", "Bahrain"), ("Bangladesh", "Bangladesh"), ("Barbados", "Barbados"), ("Belarus", "Belarus"), ("Belgium", "Belgium"), ("Belize", "Belize"), ("Benin", "Benin"), ("Bermuda", "Bermuda"), ("Bhutan", "Bhutan"), ("Bolivia (Plurinational State of)", "Bolivia (Plurinational State of)"), ("Bonaire, Sint Eustatius and Saba", "Bonaire, Sint Eustatius and Saba"), ("Bosnia and Herzegovina", "Bosnia and Herzegovina"), ("Botswana", "Botswana"), ("Bouvet Island", "Bouvet Island"), ("Brazil", "Brazil"), ("British Indian Ocean Territory", "British Indian Ocean Territory"), ("Brunei Darussalam", "Brunei Darussalam"), ("Bulgaria", "Bulgaria"), ("Burkina Faso", "Burkina Faso"), ("Burundi", "Burundi"), ("Cabo Verde", "Cabo Verde"), ("Cambodia", "Cambodia"), ("Cameroon", "Cameroon"), ("Canada", "Canada"), ("Cayman Islands", "Cayman Islands"), ("Central African Republic", "Central African Republic"), ("Chad", "Chad"), ("Chile", "Chile"), ("China", "China"), ("Christmas Island", "Christmas Island"), ("Cocos (Keeling) Islands", "Cocos (Keeling) Islands"), ("Colombia", "Colombia"), ("Comoros", "Comoros"), ("Congo", "Congo"), ("Congo, Democratic Republic of the", "Congo, Democratic Republic of the"), ("Cook Islands", "Cook Islands"), ("Costa Rica", "Costa Rica"), ("Côte d'Ivoire", "Côte d'Ivoire"), ("Croatia", "Croatia"), ("Cuba", "Cuba"), ("Curaçao", "Curaçao"), ("Cyprus", "Cyprus"), ("Czechia", "Czechia"), ("Denmark", "Denmark"), ("Djibouti", "Djibouti"), ("Dominica", "Dominica"), ("Dominican Republic", "Dominican Republic"), ("Ecuador", "Ecuador"), ("Egypt", "Egypt"), ("El Salvador", "El Salvador"), ("Equatorial Guinea", "Equatorial Guinea"), ("Eritrea", "Eritrea"), ("Estonia", "Estonia"), ("Eswatini", "Eswatini"), ("Ethiopia", "Ethiopia"), ("Falkland Islands (Malvinas)", "Falkland Islands (Malvinas)"), ("Faroe Islands", "Faroe Islands"), ("Fiji", "Fiji"), ("Finland", "Finland"), ("France", "France"), ("French Guiana", "French Guiana"), ("French Polynesia", "French Polynesia"), ("French Southern Territories", "French Southern Territories"), ("Gabon", "Gabon"), ("Gambia", "Gambia"), ("Georgia", "Georgia"), ("Germany", "Germany"), ("Ghana", "Ghana"), ("Gibraltar", "Gibraltar"), ("Greece", "Greece"), ("Greenland", "Greenland"), ("Grenada", "Grenada"), ("Guadeloupe", "Guadeloupe"), ("Guam", "Guam"), ("Guatemala", "Guatemala"), ("Guernsey", "Guernsey"), ("Guinea", "Guinea"), ("Guinea-Bissau", "Guinea-Bissau"), ("Guyana", "Guyana"), ("Haiti", "Haiti"), ("Heard Island and McDonald Islands", "Heard Island and McDonald Islands"), ("Holy See", "Holy See"), ("Honduras", "Honduras"), ("Hong Kong", "Hong Kong"), ("Hungary", "Hungary"), ("Iceland", "Iceland"), ("India", "India"), ("Indonesia", "Indonesia"), ("Iran (Islamic Republic of)", "Iran (Islamic Republic of)"), ("Iraq", "Iraq"), ("Ireland", "Ireland"), ("Isle of Man", "Isle of Man"), ("Israel", "Israel"), ("Italy", "Italy"), ("Jamaica", "Jamaica"), ("Japan", "Japan"), ("Jersey", "Jersey"), ("Jordan", "Jordan"), ("Kazakhstan", "Kazakhstan"), ("Kenya", "Kenya"), ("Kiribati", "Kiribati"), ( "Korea (Democratic People's Republic of)", "Korea (Democratic People's Republic of)", ), ("Korea, Republic of", "Korea, Republic of"), ("Kuwait", "Kuwait"), ("Kyrgyzstan", "Kyrgyzstan"), ("Lao People's Democratic Republic", "Lao People's Democratic Republic"), ("Latvia", "Latvia"), ("Lebanon", "Lebanon"), ("Lesotho", "Lesotho"), ("Liberia", "Liberia"), ("Libya", "Libya"), ("Liechtenstein", "Liechtenstein"), ("Lithuania", "Lithuania"), ("Luxembourg", "Luxembourg"), ("Macao", "Macao"), ("Madagascar", "Madagascar"), ("Malawi", "Malawi"), ("Malaysia", "Malaysia"), ("Maldives", "Maldives"), ("Mali", "Mali"), ("Malta", "Malta"), ("Marshall Islands", "Marshall Islands"), ("Martinique", "Martinique"), ("Mauritania", "Mauritania"), ("Mauritius", "Mauritius"), ("Mayotte", "Mayotte"), ("Mexico", "Mexico"), ("Micronesia (Federated States of)", "Micronesia (Federated States of)"), ("Moldova, Republic of", "Moldova, Republic of"), ("Monaco", "Monaco"), ("Mongolia", "Mongolia"), ("Montenegro", "Montenegro"), ("Montserrat", "Montserrat"), ("Morocco", "Morocco"), ("Mozambique", "Mozambique"), ("Myanmar", "Myanmar"), ("Namibia", "Namibia"), ("Nauru", "Nauru"), ("Nepal", "Nepal"), ("Netherlands", "Netherlands"), ("New Caledonia", "New Caledonia"), ("New Zealand", "New Zealand"), ("Nicaragua", "Nicaragua"), ("Niger", "Niger"), ("Nigeria", "Nigeria"), ("Niue", "Niue"), ("Norfolk Island", "Norfolk Island"), ("North Macedonia", "North Macedonia"), ("Northern Mariana Islands", "Northern Mariana Islands"), ("Norway", "Norway"), ("Oman", "Oman"), ("Pakistan", "Pakistan"), ("Palau", "Palau"), ("Palestine, State of", "Palestine, State of"), ("Panama", "Panama"), ("Papua New Guinea", "Papua New Guinea"), ("Paraguay", "Paraguay"), ("Peru", "Peru"), ("Philippines", "Philippines"), ("Pitcairn", "Pitcairn"), ("Poland", "Poland"), ("Portugal", "Portugal"), ("Puerto Rico", "Puerto Rico"), ("Qatar", "Qatar"), ("Réunion", "Réunion"), ("Romania", "Romania"), ("Russian Federation", "Russian Federation"), ("Rwanda", "Rwanda"), ("Saint Barthélemy", "Saint Barthélemy"), ( "Saint Helena, Ascension and <NAME>", "Saint Helena, Ascension and <NAME>", ), ("Saint Kitts and Nevis", "Saint Kitts and Nevis"), ("Saint Lucia", "Saint Lucia"), ("Saint Martin (French part)", "Saint Martin (French part)"), ("Saint Pierre and Miquelon", "Saint Pierre and Miquelon"), ("Saint Vincent and the Grenadines", "Saint Vincent and the Grenadines"), ("Samoa", "Samoa"), ("San Marino", "San Marino"), ("Sao Tome and Principe", "Sao Tome and Principe"), ("Saudi Arabia", "Saudi Arabia"), ("Senegal", "Senegal"), ("Serbia", "Serbia"), ("Seychelles", "Seychelles"), ("Sierra Leone", "Sierra Leone"), ("Singapore", "Singapore"), ("Sint Maarten (Dutch part)", "Sint Maarten (Dutch part)"), ("Slovakia", "Slovakia"), ("Slovenia", "Slovenia"), ("Solomon Islands", "Solomon Islands"), ("Somalia", "Somalia"), ("South Africa", "South Africa"), ( "South Georgia and the South Sandwich Islands", "South Georgia and the South Sandwich Islands", ), ("South Sudan", "South Sudan"), ("Spain", "Spain"), ("Sri Lanka", "Sri Lanka"), ("Sudan", "Sudan"), ("Suriname", "Suriname"), ("Svalbard and <NAME>", "Svalbard and <NAME>"), ("Sweden", "Sweden"), ("Switzerland", "Switzerland"), ("Syrian Arab Republic", "Syrian Arab Republic"), ("Taiwan, Province of China", "Taiwan, Province of China"), ("Tajikistan", "Tajikistan"), ("Tanzania, United Republic of", "Tanzania, United Republic of"), ("Thailand", "Thailand"), ("Timor-Leste", "Timor-Leste"), ("Togo", "Togo"), ("Tokelau", "Tokelau"), ("Tonga", "Tonga"), ("Trinidad and Tobago", "Trinidad and Tobago"), ("Tunisia", "Tunisia"), ("Turkey", "Turkey"), ("Turkmenistan", "Turkmenistan"), ("Turks and Caicos Islands", "Turks and Caicos Islands"), ("Tuvalu", "Tuvalu"), ("Uganda", "Uganda"), ("Ukraine", "Ukraine"), ("United Arab Emirates", "United Arab Emirates"), ( "United Kingdom of Great Britain and Northern Ireland", "United Kingdom of Great Britain and Northern Ireland", ), ("United States of America", "United States of America"), ("United States Minor Outlying Islands", "United States Minor Outlying Islands"), ("Uruguay", "Uruguay"), ("Uzbekistan", "Uzbekistan"), ("Vanuatu", "Vanuatu"), ("Venezuela (Bolivarian Republic of)", "Venezuela (Bolivarian Republic of)"), ("Viet Nam", "Viet Nam"), ("Virgin Islands (British)", "Virgin Islands (British)"), ("Virgin Islands (U.S.)", "Virgin Islands (U.S.)"), ("Wallis and Futuna", "Wallis and Futuna"), ("Western Sahara", "Western Sahara"), ("Yemen", "Yemen"), ("Zambia", "Zambia"), ("Zimbabwe", "Zimbabwe"), ) class EmailConfirmationForm(forms.Form): code = forms.CharField( label="Enter Your Verification Code", required=True, error_messages={ "required": "Please enter the verification code you received via email." }, ) username = forms.CharField(label="Enter Your Chameleon Username", required=True) def check_password_policy(user, password, confirm_password): """ Checks the password for meeting the minimum password policy requirements: * Must be a minimum of 8 characters in length * Must contain characters from at least three of the following: uppercase letters, lowercase letters, numbers, symbols * Must NOT contain the username or the first or last name from the profile Returns: A boolean value indicating if the password meets the policy, An error message string or None """ if password != confirm_password: return False, "The password provided does not match the confirmation." if len(password) < 8: return ( False, "The password provided is too short. Please review the password criteria.", ) char_classes = 0 for cc in ["[a-z]", "[A-Z]", "[0-9]", "[^a-zA-Z0-9]"]: if re.search(cc, password): char_classes += 1 if char_classes < 3: return False, "The password provided does not meet the complexity requirements." pwd_without_case = password.lower() if user["username"].lower() in pwd_without_case: return ( False, "The password provided must not contain parts of your name or username.", ) if ( user["firstName"].lower() in pwd_without_case or user["lastName"].lower() in pwd_without_case ): return ( False, "The password provided must not contain parts of your name or username.", ) return True, None class RecoverUsernameForm(forms.Form): email = forms.CharField(label="Enter Your Email Address", required=True) class PasswordResetRequestForm(forms.Form): username = forms.CharField(label="Enter Your Chameleon Username", required=True) class PasswordResetConfirmForm(forms.Form): username = forms.CharField(label="Enter Your Chameleon Username", required=True) code = forms.CharField(label="Reset Code", required=True) password = forms.CharField( widget=forms.PasswordInput, label="Password", required=True ) confirm_password = forms.CharField( widget=forms.PasswordInput, label="Confirm Password", required=True, help_text="Passwords must meet the following criteria:<ul>" "<li>Must not contain your username or parts of " "your full name;</li><li>Must be a minimum of 8 characters " "in length;</li><li>Must contain characters from at least " "three of the
return resp["router"] @atomic.action_timer("neutron.show_router") def get_router(self, router_id, fields=_NONE): """Get router details :param router_id: Router ID :param fields: The fields that you want the server to return. If no fields list is specified, the networking API returns all attributes allowed by the policy settings. By using fields parameter, the API returns only the requested set of attributes. """ body = _clean_dict(fields=fields) return self.client.show_router(router_id, **body)["router"] @atomic.action_timer("neutron.add_interface_router") def add_interface_to_router(self, router_id, subnet_id=_NONE, port_id=_NONE): """Add interface to router. :param router_id: The ID of the router. :param subnet_id: The ID of the subnet. One of subnet_id or port_id must be specified. :param port_id: The ID of the port. One of subnet_id or port_id must be specified. """ if (subnet_id and port_id) or (not subnet_id and not port_id): raise TypeError("One of subnet_id or port_id must be specified " "while adding interface to router.") body = _clean_dict(subnet_id=subnet_id, port_id=port_id) return self.client.add_interface_router(router_id, body) @atomic.action_timer("neutron.remove_interface_router") def remove_interface_from_router(self, router_id, subnet_id=_NONE, port_id=_NONE): """Remove interface from router :param router_id: The ID of the router. :param subnet_id: The ID of the subnet. One of subnet_id or port_id must be specified. :param port_id: The ID of the port. One of subnet_id or port_id must be specified. """ from neutronclient.common import exceptions as neutron_exceptions if (subnet_id and port_id) or (not subnet_id and not port_id): raise TypeError("One of subnet_id or port_id must be specified " "to remove interface from router.") body = _clean_dict(subnet_id=subnet_id, port_id=port_id) try: self.client.remove_interface_router(router_id, body) except (neutron_exceptions.BadRequest, neutron_exceptions.NotFound): # Some neutron plugins don't use router as # the device ID. Also, some plugin doesn't allow # to update the ha router interface as there is # an internal logic to update the interface/data model # instead. LOG.exception("Failed to remove an interface from a router.") @atomic.action_timer("neutron.add_gateway_router") def add_gateway_to_router(self, router_id, network_id, enable_snat=None, external_fixed_ips=None): """Adds an external network gateway to the specified router. :param router_id: Router ID :param enable_snat: whether SNAT should occur on the external gateway or not """ gw_info = {"network_id": network_id} if enable_snat is not None: if self.supports_extension("ext-gw-mode", silent=True): gw_info["enable_snat"] = enable_snat if external_fixed_ips is not None: gw_info["external_fixed_ips"] = external_fixed_ips self.client.add_gateway_router(router_id, gw_info) @atomic.action_timer("neutron.remove_gateway_router") def remove_gateway_from_router(self, router_id): """Removes an external network gateway from the specified router. :param router_id: Router ID """ self.client.remove_gateway_router(router_id) @atomic.action_timer("neutron.update_router") def update_router(self, router_id, name=_NONE, admin_state_up=_NONE, description=_NONE, external_gateway_info=_NONE, distributed=_NONE, ha=_NONE): """Update router. :param router_id: The ID of the router to update. :param name: Human-readable name of the resource. :param admin_state_up: The administrative state of the resource, which is up (true) or down (false). Default is true. :param description: A human-readable description for the resource. :param external_gateway_info: The external gateway information of the router. If the router has an external gateway, this would be a dict with network_id, enable_snat and external_fixed_ips. :param distributed: true indicates a distributed router. It is available when dvr extension is enabled. :param ha: true indicates a highly-available router. It is available when l3-ha extension is enabled. """ body = _clean_dict( name=name, external_gateway_info=external_gateway_info, description=description, distributed=distributed, ha=ha, admin_state_up=admin_state_up ) if not body: raise TypeError("No updates for a router.") return self.client.update_router(router_id, {"router": body})["router"] @atomic.action_timer("neutron.delete_router") def delete_router(self, router_id): """Delete router :param router_id: Router ID """ self.client.delete_router(router_id) @staticmethod def _filter_routers(routers, subnet_ids): for router in routers: gtw_info = router["external_gateway_info"] if gtw_info is None: continue if any(fixed_ip["subnet_id"] in subnet_ids for fixed_ip in gtw_info["external_fixed_ips"]): yield router @atomic.action_timer("neutron.list_routers") def list_routers(self, subnet_ids=_NONE, **kwargs): """List routers. :param subnet_ids: Filter routers by attached subnet(s). Can be a string or and an array with strings. :param kwargs: additional router list filters """ routers = self.client.list_routers(**kwargs)["routers"] if subnet_ids != _NONE: routers = list(self._filter_routers(routers, subnet_ids=subnet_ids)) return routers @atomic.action_timer("neutron.create_port") def create_port(self, network_id, **kwargs): """Create neutron port. :param network_id: neutron network dict :param kwargs: other optional neutron port creation params (name is restricted param) :returns: neutron port dict """ kwargs["name"] = self.generate_random_name() body = _clean_dict( network_id=network_id, **kwargs ) return self.client.create_port({"port": body})["port"] @atomic.action_timer("neutron.show_port") def get_port(self, port_id, fields=_NONE): """Get port details :param port_id: Port ID :param fields: The fields that you want the server to return. If no fields list is specified, the networking API returns all attributes allowed by the policy settings. By using fields parameter, the API returns only the requested set of attributes. """ body = _clean_dict(fields=fields) return self.client.show_port(port_id, **body)["port"] @atomic.action_timer("neutron.update_port") def update_port(self, port_id, **kwargs): """Update neutron port. :param port_id: The ID of the port to update. :param kwargs: other optional neutron port creation params (name is restricted param) :returns: neutron port dict """ body = _clean_dict(**kwargs) if not body: raise TypeError("No updates for a port.") return self.client.update_port(port_id, {"port": body})["port"] ROUTER_INTERFACE_OWNERS = ("network:router_interface", "network:router_interface_distributed", "network:ha_router_replicated_interface") ROUTER_GATEWAY_OWNER = "network:router_gateway" @atomic.action_timer("neutron.delete_port") def delete_port(self, port): """Delete port. :param port: Port ID or object :returns bool: False if neutron returns NotFound error on port delete """ from neutronclient.common import exceptions as neutron_exceptions if not isinstance(port, dict): port = {"id": port, "device_owner": False} if (port["device_owner"] in self.ROUTER_INTERFACE_OWNERS or port["device_owner"] == self.ROUTER_GATEWAY_OWNER): if port["device_owner"] == self.ROUTER_GATEWAY_OWNER: self.remove_gateway_from_router(port["device_id"]) self.remove_interface_from_router( router_id=port["device_id"], port_id=port["id"]) else: try: self.client.delete_port(port["id"]) except neutron_exceptions.PortNotFoundClient: # port is auto-removed pass @atomic.action_timer("neutron.list_ports") def list_ports(self, network_id=_NONE, device_id=_NONE, device_owner=_NONE, status=_NONE, **kwargs): """List ports. :param network_id: Filter the list result by the ID of the attached network. :param device_id: Filter the port list result by the ID of the device that uses this port. For example, a server instance or a logical router. :param device_owner: Filter the port result list by the entity type that uses this port. For example, compute:nova (server instance), network:dhcp (DHCP agent) or network:router_interface (router interface). :param status: Filter the port list result by the port status. Values are ACTIVE, DOWN, BUILD and ERROR. :param kwargs: additional port list filters """ filters = _clean_dict( network_id=network_id, device_id=device_id, device_owner=device_owner, status=status, **kwargs ) return self.client.list_ports(**filters)["ports"] @atomic.action_timer("neutron.create_floating_ip") def create_floatingip(self, floating_network=None, project_id=_NONE, fixed_ip_address=_NONE, floating_ip_address=_NONE, port_id=_NONE, subnet_id=_NONE, dns_domain=_NONE, dns_name=_NONE): """Create floating IP with floating_network. :param floating_network: external network associated with floating IP. :param project_id: The ID of the project. :param fixed_ip_address: The fixed IP address that is associated with the floating IP. If an internal port has multiple associated IP addresses, the service chooses the first IP address unless you explicitly define a fixed IP address in the fixed_ip_address parameter. :param floating_ip_address: The floating IP address. Default policy settings enable only administrative users to set floating IP addresses and some non-administrative users might require a floating IP address. If you do not specify a floating IP address in the request, the operation automatically allocates one. :param port_id: The ID of a port associated with the floating IP. To associate the floating IP with a fixed IP at creation time, you must specify the identifier of the internal port. :param subnet_id: The subnet ID on which you want to create the floating IP. :param dns_domain: A valid DNS domain. :param dns_name: A valid DNS name. """ from neutronclient.common import exceptions as neutron_exceptions if isinstance(floating_network, dict): net_id = floating_network["id"] elif floating_network: network = self.find_network(floating_network) if not network.get("router:external", False): raise exceptions.NotFoundException( f"Network '{network['name']} (id={network['id']})' is not " f"external.") net_id = network["id"] else: ext_networks = self.list_networks(router_external=True) if not ext_networks: raise exceptions.NotFoundException( "Failed to allocate floating IP since no external " "networks found.") net_id = ext_networks[0]["id"] description = None if not CONF.openstack.pre_newton_neutron: description = self.generate_random_name() body = _clean_dict( tenant_id=project_id, description=description, floating_network_id=net_id, fixed_ip_address=fixed_ip_address, floating_ip_address=floating_ip_address, port_id=port_id, subnet_id=subnet_id, dns_domain=dns_domain, dns_name=dns_name ) try: resp = self.client.create_floatingip({"floatingip": body}) return resp["floatingip"] except neutron_exceptions.BadRequest as e: error = "%s" % e if "Unrecognized attribute" in error and "'description'" in error: LOG.info("It looks like you have Neutron API of pre-Newton " "OpenStack release. Setting " "openstack.pre_newton_neutron option via Rally " "configuration should fix an issue.") raise @atomic.action_timer("neutron.show_floating_ip") def get_floatingip(self, floatingip_id, fields=_NONE): """Get floating IP details :param floatingip_id: Floating IP ID :param fields: The fields that you want the server to return. If no fields list is specified, the networking API returns all attributes allowed by the policy settings. By using fields parameter, the API returns only the requested set of attributes. """ body = _clean_dict(fields=fields) resp = self.client.show_floatingip(floatingip_id, **body) return resp["floatingip"] @atomic.action_timer("neutron.update_floating_ip") def
<filename>frmod/analysis.py """ Frequency ratio model analysis. Perform a landslide susceptibility analysis with the frequency ratio method. @author: <NAME> """ import os import numpy as np import matplotlib.pyplot as plt import pandas as pd import frmod.utils as utils def get_freq_ratios_classic(vr, mask, binc=20, nodata=-99999., categorical=False, ls_marker=1, nls_marker=0): """ Get the frequency ratio of the landslide parts and the whole area. Parameters ---------- vr : Array The array of the analyzed variable. Numeric values. mask : Array The array of the mask. binc : int, optional Bin count for the histogram of the non-categorical variables. The default is 20. nodata : int / float, optional The nodata value of the vr grid. The default is -99999.. categorical : bool, optional Set true if the analysed variable raster is categorical. Categories must be marked with unique integers in the rasters. The dafault is False. ls_marker : int, optional The value marking the landslide parts. The default is 1. nls_marker : int, optional The value marking the non-landslide parts. The default is 0. Returns ------- frequency_ratios : Array The frequency ratio values. Length: number of bins. hst_bins : Array Array containing the edges of the bins. Length: number of bins + 1. fr_stat_df : pandas.DataFrame DataFrame with the statistics. Columns: 'min', 'max', 'LS_density', 'NLS_density', 'frequency_ratio'. """ vr = np.ma.masked_where((vr == nodata), vr) in_all = np.logical_or(mask == ls_marker, mask == nls_marker) ls_area = np.count_nonzero(mask == ls_marker) all_area = np.count_nonzero(mask == nls_marker) + ls_area if categorical: bin_edges = np.unique(vr[in_all]) bin_edges = np.append(bin_edges, bin_edges[-1] + 1) ls_hst = np.histogram(vr[mask == ls_marker], bins=bin_edges, density=False) all_hst = np.histogram(vr[in_all], bins=bin_edges, density=False) else: glob_lim = (vr[in_all].min(), vr[in_all].max()) ls_hst = np.histogram(vr[mask == ls_marker], bins=binc, range=glob_lim, density=False) all_hst = np.histogram(vr[in_all], bins=binc, range=glob_lim, density=False) # Histogram density for the landslide part ls_hst_d = ls_hst[0] / ls_area # Histogram density for the non-landslide part all_hst_d = all_hst[0] / all_area frequency_ratios = ls_hst_d / all_hst_d hst_bins = all_hst[1] mn = hst_bins[:-1] mx = hst_bins[1:] # Create a pd.DataFrame for the bins, densities, and the frequency ratio data = [mn, mx, ls_hst_d, all_hst_d, frequency_ratios] # columns = ["Min", "Max", "LS_density", "NLS_density", "frequency_ratio"] data = {'min': mn, 'max': mx, 'LS_density': ls_hst_d, 'NLS_density': all_hst_d, 'frequency_ratio': frequency_ratios} fr_stat_df = pd.DataFrame(data=data) return frequency_ratios, hst_bins, fr_stat_df def get_freq_ratios(vr, mask, binc=100, nodata=-9999., categorical=False, normalize=False, ls_marker=1, nls_marker=0): """ Get the frequency ratio of the landslide and non-landslide parts. Parameters ---------- vr : Array The array of the analyzed variable. Numeric values. mask : Array The array of the mask. binc : int, optional Bin count for the histogram of the non-categorical variables. The default is 100. categorical : bool, optional Set true if the analysed variable raster is categorical. Categories must be marked with unique integers in the rasters. The dafault is False. normalize : bool, optional Set True for normalized weights (0, 1) The default is False. ls_marker : int, optional The value marking the landslide parts. The default is 1. nls_marker : int, optional The value marking the non-landslide parts. The default is 0. Returns ------- frequency_ratios : Array The frequency ratio values. Length: number of bins. hst_bins : Array Array containing the edges of the bins. Length: number of bins + 1. fr_stat_df : pandas.DataFrame DataFrame with the statistics. """ ls_area = np.count_nonzero(mask == ls_marker) nls_area = np.count_nonzero(mask == nls_marker) if categorical: bin_edges = np.unique(vr[(vr != nodata)]) bin_edges = np.append(bin_edges, bin_edges[-1] + 1) ls_hst = np.histogram(vr[mask == ls_marker], bins=bin_edges, density=False) nls_hst = np.histogram(vr[mask == nls_marker], bins=bin_edges, density=False) else: glob_lim = (vr[vr != nodata].min(), vr[vr != nodata].max()) ls_hst = np.histogram(vr[mask == ls_marker], bins=binc, range=glob_lim, density=False) nls_hst = np.histogram(vr[mask == nls_marker], bins=binc, range=glob_lim, density=False) # Histogram density for the landslide part ls_hst_d = ls_hst[0] / ls_area # Histogram density for the non-landslide part nls_hst_d = nls_hst[0] / nls_area # Histogram bins hst_bins = ls_hst[1] mn = hst_bins[:-1] mx = hst_bins[1:] # Frequency ratios fr = ls_hst_d / nls_hst_d if normalize: frequency_ratios = (fr - fr.min()) / (fr.max() - fr.min()) else: frequency_ratios = fr # Create a pd.DataFrame for the bins, densities, and the frequency ratio data = [mn, mx, ls_hst_d, nls_hst_d, frequency_ratios] # columns = ["Min", "Max", "LS_density", "NLS_density", "frequency_ratio"] data = {'min': mn, 'max': mx, 'LS_density': ls_hst_d, 'NLS_density': nls_hst_d, 'frequency_ratio': fr} fr_stat_df = pd.DataFrame(data=data) return frequency_ratios, hst_bins, fr_stat_df # TODO: a name change is due to reclass_array # TODO Use more generic variable names. This can reclass any array. def reclass_raster(vr, f_ratios, bin_edges, verbose=False): """ Create an array with the frequency ratios. Parameters ---------- vr : Array Array of the analysed variable to be reclassified. f_ratios : Array The frequency ratio values. Length: number of bins. bin_edges : Array Array containing the edges of the bins. Length: number of bins + 1. verbose : bool Set True to print the bin ranges and reclass values. Returns ------- reclassed : Array Reclassified array with the appropriate frequency ratio values. """ reclassed = np.ones(vr.shape) * -99999 for i in range(0, len(f_ratios)): # Reclassifying the raster by assigning the frequency ratio # values of each bin to the corresponding raster values. mn = bin_edges[:-1][i] mx = bin_edges[1:][i] vrange = mx - mn to_reclass = (vr >= mn) & (vr < mx) reclassed[to_reclass] = f_ratios[i] if verbose: print("Min: {} Max: {} Range: {} Ratio: {}".format( mn, mx, vrange, f_ratios[i]) ) return reclassed def show_grid(grid, nodata, name='Grid', **kwargs): """ Plot a grid, nodata values are masked. Plot a grid (2D array). Values equal to nodata will be masked. **kwargs are keywords passed to matplotplit.pyplot.imshow that is used for plotting the masked grid. Eg. color maps (cmap). Parameters ---------- grid : Array Grid to plot. nodata : int / float Nodata value of the grid. Nodata values will be masked. name : str, optional The title of the plot. The default is 'Grid'. Returns ------- None. """ masked_grid = np.ma.masked_where((grid == nodata), grid) plt.figure() plt.title(name) plt.imshow(masked_grid, **kwargs) plt.colorbar() plt.show() class VRaster(): """Variable raster, input for frequency ratio analysis.""" def __init__(self, name, path, bins=10, categorical=False): """ Create the VRaster object. Parameters ---------- name : str Name of the VRaster. path : str Path to the GDAL-compatible raster file. bins : int, optional Number of histogram bins. The default is 10. categorical : bool, optional True if it is a categorical variable, eg: geology. The default is False. Returns ------- None. """ self.name = name self.path = path self.bins = bins self.categorical = categorical self.nodata = utils.get_nodata_value(path) # Convert input grid to array self.grid = utils.raster2array(path) # Calculate basic statistics for the grid self.min = min(self.grid[self.grid != self.nodata]) self.max = max(self.grid[self.grid != self.nodata]) self.limits = (self.min, self.max) def show(self, **kwargs): """ Plot the VRaster.grid. Parameters ---------- **kwargs : Keywords passed to show_grid. Returns ------- None. """ show_grid(self.grid, self.nodata, name=self.name, **kwargs) def show_info(self): """ Show basic information about the VRaster.grid. Returns ------- None. """ valid_values = self.grid[self.grid != self.nodata] if self.categorical: print("Categorical!") else: average = np.mean(valid_values) sdev = np.std(valid_values) print("Name: {} Limits: {}".format(self.name, self.limits)) print("Mean: {} Standard deviation: {}".format(average, sdev)) class LandslideMask(): """LandslideMask.""" def __init__(self, name, path, ls_marker=1, nls_marker=0, fold_count=5): """ Create a LandslideMask object. Parameters ---------- name : str Name of the landslide mask. path : str Path to the file used as the mask in the analysis. ls_marker : int, optional Value marking the landslide pixels. The default is 1. nls_marker : int, optional Value marking the non-landslide pixels. Must be different from the nodata value. The default is 0. fold_count : int, optional The number of cross validation folds. The default is 5. Returns ------- None. """ # Name of the LandslideMask self.name = name # Path to the input mask file. self.path = path # NoData value of the input mask file. self.nodata = utils.get_nodata_value(path) # 2D array representation of the input mask file. self.grid = utils.raster2array(path) # Value marking the landslide cells. self.ls_marker = ls_marker # Value marking the non-landslide cells. Different from nodata! self.nls_marker = nls_marker # Number of folds self.fold_count = fold_count #
import pytest from helpers.cluster import ClickHouseCluster from helpers.test_tools import TSV import re cluster = ClickHouseCluster(__file__) instance = cluster.add_instance('instance') @pytest.fixture(scope="module", autouse=True) def start_cluster(): try: cluster.start() instance.query("CREATE DATABASE test") instance.query("CREATE TABLE test.table(x UInt32, y UInt32) ENGINE = MergeTree ORDER BY tuple()") instance.query("INSERT INTO test.table VALUES (1,5), (2,10)") yield cluster finally: cluster.shutdown() @pytest.fixture(autouse=True) def cleanup_after_test(): try: yield finally: instance.query("DROP USER IF EXISTS A, B") instance.query("DROP TABLE IF EXISTS test.view_1") def test_smoke(): instance.query("CREATE USER A") assert "Not enough privileges" in instance.query_and_get_error("SELECT * FROM test.table", user='A') instance.query('GRANT SELECT ON test.table TO A') assert instance.query("SELECT * FROM test.table", user='A') == "1\t5\n2\t10\n" instance.query('REVOKE SELECT ON test.table FROM A') assert "Not enough privileges" in instance.query_and_get_error("SELECT * FROM test.table", user='A') def test_grant_option(): instance.query("CREATE USER A") instance.query("CREATE USER B") instance.query('GRANT SELECT ON test.table TO A') assert instance.query("SELECT * FROM test.table", user='A') == "1\t5\n2\t10\n" assert "Not enough privileges" in instance.query_and_get_error("GRANT SELECT ON test.table TO B", user='A') instance.query('GRANT SELECT ON test.table TO A WITH GRANT OPTION') instance.query("GRANT SELECT ON test.table TO B", user='A') assert instance.query("SELECT * FROM test.table", user='B') == "1\t5\n2\t10\n" instance.query('REVOKE SELECT ON test.table FROM A, B') def test_revoke_requires_grant_option(): instance.query("CREATE USER A") instance.query("CREATE USER B") instance.query("GRANT SELECT ON test.table TO B") assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" expected_error = "Not enough privileges" assert expected_error in instance.query_and_get_error("REVOKE SELECT ON test.table FROM B", user='A') assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" instance.query("GRANT SELECT ON test.table TO A") expected_error = "privileges have been granted, but without grant option" assert expected_error in instance.query_and_get_error("REVOKE SELECT ON test.table FROM B", user='A') assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" instance.query("GRANT SELECT ON test.table TO A WITH GRANT OPTION") assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" instance.query("REVOKE SELECT ON test.table FROM B", user='A') assert instance.query("SHOW GRANTS FOR B") == "" instance.query("GRANT SELECT ON test.table TO B") assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" instance.query("REVOKE SELECT ON test.* FROM B", user='A') assert instance.query("SHOW GRANTS FOR B") == "" instance.query("GRANT SELECT ON test.table TO B") assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" instance.query("REVOKE ALL ON test.* FROM B", user='A') assert instance.query("SHOW GRANTS FOR B") == "" instance.query("GRANT SELECT ON test.table TO B") assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" instance.query("REVOKE ALL ON *.* FROM B", user='A') assert instance.query("SHOW GRANTS FOR B") == "" instance.query("REVOKE GRANT OPTION FOR ALL ON *.* FROM A") instance.query("GRANT SELECT ON test.table TO B") assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" expected_error = "privileges have been granted, but without grant option" assert expected_error in instance.query_and_get_error("REVOKE SELECT ON test.table FROM B", user='A') assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" instance.query("GRANT SELECT ON test.* TO A WITH GRANT OPTION") instance.query("GRANT SELECT ON test.table TO B") assert instance.query("SHOW GRANTS FOR B") == "GRANT SELECT ON test.table TO B\n" instance.query("REVOKE SELECT ON test.table FROM B", user='A') assert instance.query("SHOW GRANTS FOR B") == "" def test_implicit_show_grants(): instance.query("CREATE USER A") assert instance.query("select count() FROM system.databases WHERE name='test'", user="A") == "0\n" assert instance.query("select count() FROM system.tables WHERE database='test' AND name='table'", user="A") == "0\n" assert instance.query("select count() FROM system.columns WHERE database='test' AND table='table'", user="A") == "0\n" instance.query("GRANT SELECT(x) ON test.table TO A") assert instance.query("SHOW GRANTS FOR A") == "GRANT SELECT(x) ON test.table TO A\n" assert instance.query("select count() FROM system.databases WHERE name='test'", user="A") == "1\n" assert instance.query("select count() FROM system.tables WHERE database='test' AND name='table'", user="A") == "1\n" assert instance.query("select count() FROM system.columns WHERE database='test' AND table='table'", user="A") == "1\n" instance.query("GRANT SELECT ON test.table TO A") assert instance.query("SHOW GRANTS FOR A") == "GRANT SELECT ON test.table TO A\n" assert instance.query("select count() FROM system.databases WHERE name='test'", user="A") == "1\n" assert instance.query("select count() FROM system.tables WHERE database='test' AND name='table'", user="A") == "1\n" assert instance.query("select count() FROM system.columns WHERE database='test' AND table='table'", user="A") == "2\n" instance.query("GRANT SELECT ON test.* TO A") assert instance.query("SHOW GRANTS FOR A") == "GRANT SELECT ON test.* TO A\n" assert instance.query("select count() FROM system.databases WHERE name='test'", user="A") == "1\n" assert instance.query("select count() FROM system.tables WHERE database='test' AND name='table'", user="A") == "1\n" assert instance.query("select count() FROM system.columns WHERE database='test' AND table='table'", user="A") == "2\n" instance.query("GRANT SELECT ON *.* TO A") assert instance.query("SHOW GRANTS FOR A") == "GRANT SELECT ON *.* TO A\n" assert instance.query("select count() FROM system.databases WHERE name='test'", user="A") == "1\n" assert instance.query("select count() FROM system.tables WHERE database='test' AND name='table'", user="A") == "1\n" assert instance.query("select count() FROM system.columns WHERE database='test' AND table='table'", user="A") == "2\n" instance.query("REVOKE ALL ON *.* FROM A") assert instance.query("select count() FROM system.databases WHERE name='test'", user="A") == "0\n" assert instance.query("select count() FROM system.tables WHERE database='test' AND name='table'", user="A") == "0\n" assert instance.query("select count() FROM system.columns WHERE database='test' AND table='table'", user="A") == "0\n" def test_implicit_create_view_grant(): instance.query("CREATE USER A") expected_error = "Not enough privileges" assert expected_error in instance.query_and_get_error("CREATE VIEW test.view_1 AS SELECT 1", user="A") instance.query("GRANT CREATE TABLE ON test.* TO A") instance.query("CREATE VIEW test.view_1 AS SELECT 1", user="A") assert instance.query("SELECT * FROM test.view_1") == "1\n" instance.query("REVOKE CREATE TABLE ON test.* FROM A") instance.query("DROP TABLE test.view_1") assert expected_error in instance.query_and_get_error("CREATE VIEW test.view_1 AS SELECT 1", user="A") def test_implicit_create_temporary_table_grant(): instance.query("CREATE USER A") expected_error = "Not enough privileges" assert expected_error in instance.query_and_get_error("CREATE TEMPORARY TABLE tmp(name String)", user="A") instance.query("GRANT CREATE TABLE ON test.* TO A") instance.query("CREATE TEMPORARY TABLE tmp(name String)", user="A") instance.query("REVOKE CREATE TABLE ON *.* FROM A") assert expected_error in instance.query_and_get_error("CREATE TEMPORARY TABLE tmp(name String)", user="A") def test_introspection(): instance.query("CREATE USER A") instance.query("CREATE USER B") instance.query('GRANT SELECT ON test.table TO A') instance.query('GRANT CREATE ON *.* TO B WITH GRANT OPTION') assert instance.query("SHOW USERS") == TSV([ "A", "B", "default" ]) assert instance.query("SHOW CREATE USERS A") == TSV([ "CREATE USER A" ]) assert instance.query("SHOW CREATE USERS B") == TSV([ "CREATE USER B" ]) assert instance.query("SHOW CREATE USERS A,B") == TSV([ "CREATE USER A", "CREATE USER B" ]) assert instance.query("SHOW CREATE USERS") == TSV([ "CREATE USER A", "CREATE USER B", "CREATE USER default IDENTIFIED WITH plaintext_password SETTINGS PROFILE default" ]) assert instance.query("SHOW GRANTS FOR A") == TSV([ "GRANT SELECT ON test.table TO A" ]) assert instance.query("SHOW GRANTS FOR B") == TSV([ "GRANT CREATE ON *.* TO B WITH GRANT OPTION" ]) assert instance.query("SHOW GRANTS FOR A,B") == TSV([ "GRANT SELECT ON test.table TO A", "GRANT CREATE ON *.* TO B WITH GRANT OPTION" ]) assert instance.query("SHOW GRANTS FOR B,A") == TSV([ "GRANT SELECT ON test.table TO A", "GRANT CREATE ON *.* TO B WITH GRANT OPTION" ]) assert instance.query("SHOW GRANTS FOR ALL") == TSV([ "GRANT SELECT ON test.table TO A", "GRANT CREATE ON *.* TO B WITH GRANT OPTION", "GRANT ALL ON *.* TO default WITH GRANT OPTION" ]) assert instance.query("SHOW GRANTS", user='A') == TSV([ "GRANT SELECT ON test.table TO A" ]) assert instance.query("SHOW GRANTS", user='B') == TSV([ "GRANT CREATE ON *.* TO B WITH GRANT OPTION" ]) expected_access1 = "CREATE USER A\n"\ "CREATE USER B\n"\ "CREATE USER default IDENTIFIED WITH plaintext_password SETTINGS PROFILE default" expected_access2 = "GRANT SELECT ON test.table TO A\n"\ "GRANT CREATE ON *.* TO B WITH GRANT OPTION\n"\ "GRANT ALL ON *.* TO default WITH GRANT OPTION\n" assert expected_access1 in instance.query("SHOW ACCESS") assert expected_access2 in instance.query("SHOW ACCESS") assert instance.query("SELECT name, storage, auth_type, auth_params, host_ip, host_names, host_names_regexp, host_names_like, default_roles_all, default_roles_list, default_roles_except from system.users WHERE name IN ('A', 'B') ORDER BY name") ==\ TSV([[ "A", "local directory", "no_password", "{}", "['::/0']", "[]", "[]", "[]", 1, "[]", "[]" ], [ "B", "local directory", "no_password", "{}", "['::/0']", "[]", "[]", "[]", 1, "[]", "[]" ]]) assert instance.query("SELECT * from system.grants WHERE user_name IN ('A', 'B') ORDER BY user_name, access_type, grant_option") ==\ TSV([[ "A", "\N", "SELECT", "test", "table", "\N", 0, 0 ], [ "B", "\N", "CREATE", "\N", "\N", "\N", 0, 1 ]]) def test_current_database(): instance.query("CREATE USER A") instance.query("GRANT SELECT ON table TO A", database="test") assert instance.query("SHOW GRANTS FOR A") == TSV([ "GRANT SELECT ON test.table TO A" ]) assert
effective_at: str :param as_at: The asAt datetime at which to retrieve the person's relations. Defaults to return the latest LUSID AsAt time if not specified. :type as_at: datetime :param filter: Expression to filter the relations. Users should provide null or empty string for this field until further notice. :type filter: str :param identifier_types: Identifiers types (as property keys) used for referencing Persons or Legal Entities. These take the format {domain}/{scope}/{code} e.g. \"Person/CompanyDetails/Role\". They must be from the \"Person\" or \"LegalEntity\" domain. Only identifier types stated will be used to look up relevant entities in relations. If not applicable, provide an empty array. :type identifier_types: list[str] :param async_req: Whether to execute the request asynchronously. :type async_req: bool, optional :param _return_http_data_only: response data without head status code and headers :type _return_http_data_only: bool, optional :param _preload_content: if False, the urllib3.HTTPResponse object will be returned without reading/decoding response data. Default is True. :type _preload_content: bool, optional :param _request_timeout: timeout setting for this request. If one number provided, it will be total request timeout. It can also be a pair (tuple) of (connection, read) timeouts. :param _request_auth: set to override the auth_settings for an a single request; this effectively ignores the authentication in the spec for a single request. :type _request_auth: dict, optional :return: Returns the result object. If the method is called asynchronously, returns the request thread. :rtype: tuple(ResourceListOfRelation, status_code(int), headers(HTTPHeaderDict)) """ local_var_params = locals() all_params = [ 'id_type_scope', 'id_type_code', 'code', 'effective_at', 'as_at', 'filter', 'identifier_types' ] all_params.extend( [ 'async_req', '_return_http_data_only', '_preload_content', '_request_timeout', '_request_auth' ] ) for key, val in six.iteritems(local_var_params['kwargs']): if key not in all_params: raise ApiTypeError( "Got an unexpected keyword argument '%s'" " to method get_person_relations" % key ) local_var_params[key] = val del local_var_params['kwargs'] if self.api_client.client_side_validation and ('code' in local_var_params and # noqa: E501 len(local_var_params['code']) > 64): # noqa: E501 raise ApiValueError("Invalid value for parameter `code` when calling `get_person_relations`, length must be less than or equal to `64`") # noqa: E501 if self.api_client.client_side_validation and ('code' in local_var_params and # noqa: E501 len(local_var_params['code']) < 1): # noqa: E501 raise ApiValueError("Invalid value for parameter `code` when calling `get_person_relations`, length must be greater than or equal to `1`") # noqa: E501 if self.api_client.client_side_validation and 'code' in local_var_params and not re.search(r'^[a-zA-Z0-9\-_]+$', local_var_params['code']): # noqa: E501 raise ApiValueError("Invalid value for parameter `code` when calling `get_person_relations`, must conform to the pattern `/^[a-zA-Z0-9\-_]+$/`") # noqa: E501 collection_formats = {} path_params = {} if 'id_type_scope' in local_var_params: path_params['idTypeScope'] = local_var_params['id_type_scope'] # noqa: E501 if 'id_type_code' in local_var_params: path_params['idTypeCode'] = local_var_params['id_type_code'] # noqa: E501 if 'code' in local_var_params: path_params['code'] = local_var_params['code'] # noqa: E501 query_params = [] if 'effective_at' in local_var_params and local_var_params['effective_at'] is not None: # noqa: E501 query_params.append(('effectiveAt', local_var_params['effective_at'])) # noqa: E501 if 'as_at' in local_var_params and local_var_params['as_at'] is not None: # noqa: E501 query_params.append(('asAt', local_var_params['as_at'])) # noqa: E501 if 'filter' in local_var_params and local_var_params['filter'] is not None: # noqa: E501 query_params.append(('filter', local_var_params['filter'])) # noqa: E501 if 'identifier_types' in local_var_params and local_var_params['identifier_types'] is not None: # noqa: E501 query_params.append(('identifierTypes', local_var_params['identifier_types'])) # noqa: E501 collection_formats['identifierTypes'] = 'multi' # noqa: E501 header_params = {} form_params = [] local_var_files = {} body_params = None # HTTP header `Accept` header_params['Accept'] = self.api_client.select_header_accept( ['text/plain', 'application/json', 'text/json']) # noqa: E501 header_params['Accept-Encoding'] = "gzip, deflate, br" # Authentication setting auth_settings = ['oauth2'] # noqa: E501 response_types_map = { 200: "ResourceListOfRelation", 400: "LusidValidationProblemDetails", } return self.api_client.call_api( '/api/persons/{idTypeScope}/{idTypeCode}/{code}/relations', 'GET', path_params, query_params, header_params, body=body_params, post_params=form_params, files=local_var_files, response_types_map=response_types_map, auth_settings=auth_settings, async_req=local_var_params.get('async_req'), _return_http_data_only=local_var_params.get('_return_http_data_only'), # noqa: E501 _preload_content=local_var_params.get('_preload_content', True), _request_timeout=local_var_params.get('_request_timeout'), collection_formats=collection_formats, _request_auth=local_var_params.get('_request_auth')) def get_person_relationships(self, id_type_scope, id_type_code, code, **kwargs): # noqa: E501 """[EXPERIMENTAL] GetPersonRelationships: Get Relationships for Person # noqa: E501 Get relationships for the specified person. # noqa: E501 This method makes a synchronous HTTP request by default. To make an asynchronous HTTP request, please pass async_req=True >>> thread = api.get_person_relationships(id_type_scope, id_type_code, code, async_req=True) >>> result = thread.get() :param id_type_scope: Scope of the person's identifier type. (required) :type id_type_scope: str :param id_type_code: Code of the person's identifier type. (required) :type id_type_code: str :param code: Code of the person under specified identifier type's scope and code. This together with stated identifier type uniquely identifies the person. (required) :type code: str :param effective_at: The effective datetime or cut label at which to get relationships. Defaults to the current LUSID system datetime if not specified. :type effective_at: str :param as_at: The asAt datetime at which to retrieve relationships. Defaults to return the latest LUSID AsAt time if not specified. :type as_at: datetime :param filter: Expression to filter relationships. Users should provide null or empty string for this field until further notice. :type filter: str :param identifier_types: Identifiers types (as property keys) used for referencing Persons or Legal Entities. These take the format {domain}/{scope}/{code} e.g. \"Person/CompanyDetails/Role\". They must be from the \"Person\" or \"LegalEntity\" domain. Only identifier types stated will be used to look up relevant entities in relationships. If not applicable, provide an empty array. :type identifier_types: list[str] :param async_req: Whether to execute the request asynchronously. :type async_req: bool, optional :param _preload_content: if False, the urllib3.HTTPResponse object will be returned without reading/decoding response data. Default is True. :type _preload_content: bool, optional :param _request_timeout: timeout setting for this request. If one number provided, it will be total request timeout. It can also be a pair (tuple) of (connection, read) timeouts. :return: Returns the result object. If the method is called asynchronously, returns the request thread. :rtype: ResourceListOfRelationship """ kwargs['_return_http_data_only'] = True return self.get_person_relationships_with_http_info(id_type_scope, id_type_code, code, **kwargs) # noqa: E501 def get_person_relationships_with_http_info(self, id_type_scope, id_type_code, code, **kwargs): # noqa: E501 """[EXPERIMENTAL] GetPersonRelationships: Get Relationships for Person # noqa: E501 Get relationships for the specified person. # noqa: E501 This method makes a synchronous HTTP request by default. To make an asynchronous HTTP request, please pass async_req=True >>> thread = api.get_person_relationships_with_http_info(id_type_scope, id_type_code, code, async_req=True) >>> result = thread.get() :param id_type_scope: Scope of the person's identifier type. (required) :type id_type_scope: str :param id_type_code: Code of the person's identifier type. (required) :type id_type_code: str :param code: Code of the person under specified identifier type's scope and code. This together with stated identifier type uniquely identifies the person. (required) :type code: str :param effective_at: The effective datetime or cut label at which to get relationships. Defaults to the current LUSID system datetime if not specified. :type effective_at: str :param as_at: The asAt datetime at which to retrieve relationships. Defaults to return the latest LUSID AsAt time if not specified. :type as_at: datetime :param filter: Expression to filter relationships. Users should provide null or empty string for this field until further notice. :type filter: str :param identifier_types: Identifiers types (as property keys) used for referencing Persons or Legal Entities. These take the format {domain}/{scope}/{code} e.g. \"Person/CompanyDetails/Role\". They must be from the \"Person\" or \"LegalEntity\" domain. Only identifier types stated will be used to look up relevant entities in relationships. If not applicable, provide an empty array. :type identifier_types: list[str] :param async_req: Whether to execute the request asynchronously. :type async_req: bool, optional :param _return_http_data_only: response data without head status code and headers :type _return_http_data_only: bool, optional :param _preload_content: if False, the urllib3.HTTPResponse object will be returned without reading/decoding response data. Default is True. :type _preload_content: bool, optional :param _request_timeout: timeout setting for this request. If one number provided, it will be total request timeout. It can also be a pair (tuple) of (connection, read) timeouts. :param _request_auth: set to override the auth_settings for an a single request; this effectively ignores the authentication in the spec for a single request. :type _request_auth: dict, optional :return: Returns the result object. If the method is called asynchronously, returns the request thread. :rtype: tuple(ResourceListOfRelationship, status_code(int), headers(HTTPHeaderDict)) """ local_var_params = locals() all_params = [ 'id_type_scope', 'id_type_code', 'code', 'effective_at', 'as_at', 'filter', 'identifier_types' ] all_params.extend( [ 'async_req', '_return_http_data_only', '_preload_content', '_request_timeout', '_request_auth' ] ) for key, val in six.iteritems(local_var_params['kwargs']): if key not in
<gh_stars>0 #!/usr/bin/env python # coding=utf-8 import base64 import os import re import time import datetime import hashlib import string import random import pickle import zlib import math from google.appengine.ext import webapp from google.appengine.api import memcache from google.appengine.api import urlfetch from google.appengine.api.labs import taskqueue from google.appengine.ext import db from google.appengine.ext.webapp import util from google.appengine.ext.webapp import template from v2ex.babel import Member from v2ex.babel import Counter from v2ex.babel import Section from v2ex.babel import Node from v2ex.babel import Topic from v2ex.babel import Reply from v2ex.babel import Notification from v2ex.babel import SYSTEM_VERSION from v2ex.babel.security import * from v2ex.babel.ua import * from v2ex.babel.da import * from v2ex.babel.l10n import * from v2ex.babel.ext.cookies import Cookies from v2ex.babel.ext.sessions import Session from django.utils import simplejson as json template.register_template_library('v2ex.templatetags.filters') import config TOPIC_PAGE_SIZE = 100 class NewTopicHandler(webapp.RequestHandler): def get(self, node_name): site = GetSite() browser = detect(self.request) template_values = {} template_values['site'] = site template_values['system_version'] = SYSTEM_VERSION member = CheckAuth(self) l10n = GetMessages(self, member, site) template_values['l10n'] = l10n template_values['page_title'] = site.title + u' › ' + l10n.create_new_topic.decode('utf-8') can_create = False if site.topic_create_level > 999: if member: can_create = True else: if member: if member.level <= site.topic_create_level: can_create = True if (member): template_values['member'] = member node = GetKindByName('Node', node_name) if node is False: path = os.path.join(os.path.dirname(__file__), 'tpl', 'desktop', 'node_not_found.html') output = template.render(path, template_values) return self.response.out.write(output) template_values['node'] = node section = GetKindByNum('Section', node.section_num) template_values['section'] = section if site.use_topic_types: types = site.topic_types.split("\n") options = '<option value="0">&nbsp;&nbsp;&nbsp;&nbsp;</option>' i = 0 for a_type in types: i = i + 1 detail = a_type.split(':') options = options + '<option value="' + str(i) + '">' + detail[0] + '</option>' tt = '<div class="sep5"></div><table cellpadding="5" cellspacing="0" border="0" width="100%"><tr><td width="60" align="right">Topic Type</td><td width="auto" align="left"><select name="type">' + options + '</select></td></tr></table>' template_values['tt'] = tt else: template_values['tt'] = '' if can_create: if browser['ios']: if node: path = os.path.join(os.path.dirname(__file__), 'tpl', 'mobile', 'new_topic.html') else: path = os.path.join(os.path.dirname(__file__), 'tpl', 'mobile', 'node_not_found.html') else: if node: path = os.path.join(os.path.dirname(__file__), 'tpl', 'desktop', 'new_topic.html') else: path = os.path.join(os.path.dirname(__file__), 'tpl', 'desktop', 'node_not_found.html') else: path = os.path.join(os.path.dirname(__file__), 'tpl', 'desktop', 'access_denied.html') output = template.render(path, template_values) self.response.out.write(output) else: self.redirect('/signin') def post(self, node_name): site = GetSite() ### BEGIN: CAN CONTINUE can_continue = True if ('Host' in self.request.headers): if (self.request.headers['Host'] not in ['www.v2ex.com', 'v2ex.appspot.com', 'fast.v2ex.com', 'beta.v2ex.com', 'us.v2ex.com', 'jp.v2ex.com', 'eu.v2ex.com', 'localhost:10000']): can_continue = True else: can_continue = False if ('User-Agent' not in self.request.headers): can_continue = False if ('Cookie' not in self.request.headers): can_continue = False if ('Referer' in self.request.headers): has_v2ex = False if ('http://localhost:10000' in self.request.headers['Referer']): has_v2ex = True if ('http://www.v2ex.com' in self.request.headers['Referer']): has_v2ex = True if ('http://v2ex.appspot.com' in self.request.headers['Referer']): has_v2ex = True if ('https://www.v2ex.com' in self.request.headers['Referer']): has_v2ex = True if ('http://jp.v2ex.com' in self.request.headers['Referer']): has_v2ex = True if ('http://eu.v2ex.com' in self.request.headers['Referer']): has_v2ex = True if ('http://us.v2ex.com' in self.request.headers['Referer']): has_v2ex = True if ('https://v2ex.appspot.com' in self.request.headers['Referer']): has_v2ex = True if ('http://fast.v2ex.com' in self.request.headers['Referer']): has_v2ex = True if ('http://beta.v2ex.com' in self.request.headers['Referer']): has_v2ex = True if ('http://' + str(site.domain) in self.request.headers['Referer']): has_v2ex = True if has_v2ex is False: can_continue = False else: can_continue = True if ('Content-Type' in self.request.headers): if self.request.headers['Content-Type'].startswith( 'application/x-www-form-urlencoded') is False: can_continue = False else: can_continue = False if can_continue is False: return self.redirect('http://' + site.domain + '/') ### END: CAN CONTINUE browser = detect(self.request) template_values = {} template_values['site'] = site template_values['system_version'] = SYSTEM_VERSION member = CheckAuth(self) l10n = GetMessages(self, member, site) template_values['l10n'] = l10n template_values['page_title'] = site.title + u' › ' + l10n.create_new_topic.decode('utf-8') can_create = False if site.topic_create_level > 999: if member: can_create = True else: if member: if member.level <= site.topic_create_level: can_create = True if (member): template_values['member'] = member if can_create: node = False node = GetKindByName('Node', node_name) template_values['node'] = node section = False if node: section = GetKindByNum('Section', node.section_num) template_values['section'] = section errors = 0 # Verification: title topic_title_error = 0 topic_title_error_messages = ['', u'请输入主题标题', u'主题标题长度不能超过 120 个字符' ] topic_title = self.request.get('title').strip().replace("\n", " ") if (len(topic_title) == 0): errors = errors + 1 topic_title_error = 1 else: if (len(topic_title) > 120): errors = errors + 1 topic_title_error = 2 template_values['topic_title'] = topic_title template_values['topic_title_error'] = topic_title_error template_values['topic_title_error_message'] = topic_title_error_messages[topic_title_error] # Verification: content topic_content_error = 0 topic_content_error_messages = ['', u'主题内容长度不能超过 200000 个字符' ] topic_content = self.request.get('content').strip() topic_content_length = len(topic_content) if (topic_content_length > 0): if (topic_content_length > 200000): errors = errors + 1 topic_content_error = 1 template_values['topic_content'] = topic_content template_values['topic_content_error'] = topic_content_error template_values['topic_content_error_message'] = topic_content_error_messages[topic_content_error] # Verification: type if site.use_topic_types: types = site.topic_types.split("\n") if len(types) > 0: topic_type = self.request.get('type').strip() try: topic_type = int(topic_type) if topic_type < 0: topic_type = 0 if topic_type > len(types): topic_type = 0 if topic_type > 0: detail = types[topic_type - 1].split(':') topic_type_label = detail[0] topic_type_color = detail[1] except: topic_type = 0 else: topic_type = 0 options = '<option value="0">&nbsp;&nbsp;&nbsp;&nbsp;</option>' i = 0 for a_type in types: i = i + 1 detail = a_type.split(':') if topic_type == i: options = options + '<option value="' + str(i) + '" selected="selected">' + detail[0] + '</option>' else: options = options + '<option value="' + str(i) + '">' + detail[0] + '</option>' tt = '<div class="sep5"></div><table cellpadding="5" cellspacing="0" border="0" width="100%"><tr><td width="60" align="right">Topic Type</td><td width="auto" align="left"><select name="type">' + options + '</select></td></tr></table>' template_values['tt'] = tt else: template_values['tt'] = '' template_values['errors'] = errors if (errors == 0): topic = Topic(parent=node) q = db.GqlQuery('SELECT * FROM Counter WHERE name = :1', 'topic.max') if (q.count() == 1): counter = q[0] counter.value = counter.value + 1 else: counter = Counter() counter.name = 'topic.max' counter.value = 1 q2 = db.GqlQuery('SELECT * FROM Counter WHERE name = :1', 'topic.total') if (q2.count() == 1): counter2 = q2[0] counter2.value = counter2.value + 1 else: counter2 = Counter() counter2.name = 'topic.total' counter2.value = 1 topic.num = counter.value topic.title = topic_title topic.content = topic_content if len(topic_content) > 0: topic.has_content = True topic.content_length = topic_content_length else: topic.has_content = False path = os.path.join(os.path.dirname(__file__), 'tpl', 'portion', 'topic_content.html') output = template.render(path, {'topic' : topic}) topic.content_rendered = output.decode('utf-8') topic.node = node topic.node_num = node.num topic.node_name = node.name topic.node_title = node.title topic.created_by = member.username topic.member = member topic.member_num = member.num topic.last_touched = datetime.datetime.now() ua = self.request.headers['User-Agent'] if (re.findall('Mozilla\/5.0 \(iPhone;', ua)): topic.source = 'iPhone' if (re.findall('Mozilla\/5.0 \(iPod;', ua)): topic.source = 'iPod' if (re.findall('Mozilla\/5.0 \(iPad;', ua)): topic.source = 'iPad' if (re.findall('Android', ua)): topic.source = 'Android' if (re.findall('Mozilla\/5.0 \(PLAYSTATION 3;', ua)): topic.source = 'PS3' if site.use_topic_types: if topic_type > 0: topic.type = topic_type_label topic.type_color = topic_type_color node.topics = node.topics + 1 node.put() topic.put() counter.put() counter2.put() memcache.delete('feed_index') memcache.delete('Node_' + str(topic.node_num)) memcache.delete('Node::' + str(node.name)) memcache.delete('q_latest_16') memcache.delete('home_rendered') memcache.delete('home_rendered_mobile') try: taskqueue.add(url='/index/topic/' + str(topic.num)) except: pass # Change newbie status? if member.newbie == 1: now = datetime.datetime.now() created = member.created diff = now - created if diff.seconds > (86400 * 60): member.newbie = 0 member.put() # Notifications: mention_topic taskqueue.add(url='/notifications/topic/' + str(topic.key())) self.redirect('/t/' + str(topic.num) + '#reply0') else: if browser['ios']: path = os.path.join(os.path.dirname(__file__), 'tpl', 'mobile', 'new_topic.html') else: path = os.path.join(os.path.dirname(__file__), 'tpl', 'desktop', 'new_topic.html') output = template.render(path, template_values) self.response.out.write(output) else: path = os.path.join(os.path.dirname(__file__), 'tpl', 'desktop', 'access_denied.html') output = template.render(path, template_values) self.response.out.write(output) else: self.redirect('/signin') class TopicHandler(webapp.RequestHandler): def get(self, topic_num): site = GetSite() browser = detect(self.request) template_values = {} template_values['site'] = site template_values['rnd'] = random.randrange(1, 100) reply_reversed = self.request.get('r') if reply_reversed == '1': reply_reversed = True else: reply_reversed = False filter_mode = self.request.get('f') if filter_mode == '1': filter_mode = True else: filter_mode = False template_values['reply_reversed'] = reply_reversed template_values['filter_mode'] = filter_mode template_values['system_version'] = SYSTEM_VERSION errors = 0 template_values['errors'] = errors member = CheckAuth(self) template_values['member'] = member l10n = GetMessages(self, member, site) template_values['l10n'] = l10n if member is not False: try: blocked = pickle.loads(member.blocked.encode('utf-8')) except: blocked = [] if (len(blocked) > 0): template_values['blocked'] = ','.join(map(str, blocked)) if member.level == 0: template_values['is_admin'] = 1 else: template_values['is_admin'] = 0 topic_num_str = str(topic_num) if len(topic_num_str) > 8: if browser['ios']: path = os.path.join(os.path.dirname(__file__), 'tpl', 'mobile', 'topic_not_found.html') else: path = os.path.join(os.path.dirname(__file__), 'tpl', 'desktop', 'topic_not_found.html') output = template.render(path, template_values) self.response.out.write(output) return topic = False topic = memcache.get('Topic_' + str(topic_num)) if topic is None: q = db.GqlQuery("SELECT * FROM Topic WHERE num = :1", int(topic_num)) if (q.count() == 1): topic = q[0] memcache.set('Topic_' + str(topic_num), topic, 86400) can_edit = False can_move = False if topic: if topic.content: template_values['page_description'] = topic.content[:60] + ' - ' + topic.member.username else: template_values['page_description'] = topic.title[:60] + ' -
len(seqs) == 1, seqs assert seqs[0].startswith('GGTTGACGGGGCTCAGGGGG') def test_screed_streaming_ufq(): # uncompressed fq o = execute_streaming_diginorm(utils.get_test_data('test-fastq-reads.fq')) seqs = [r.sequence for r in screed.open(o)] assert seqs[0].startswith('CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT') def test_screed_streaming_bzipfq(): # bzip compressed fq o = execute_streaming_diginorm(utils.get_test_data('100-reads.fq.bz2')) seqs = [r.sequence for r in screed.open(o)] assert len(seqs) == 100, seqs assert seqs[0].startswith('CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT'), seqs def test_screed_streaming_bzipfa(): # bzip compressed fa o = execute_streaming_diginorm( utils.get_test_data('test-abund-read-2.fa.bz2')) seqs = [r.sequence for r in screed.open(o)] assert len(seqs) == 1, seqs assert seqs[0].startswith('GGTTGACGGGGCTCAGGGGG') @pytest.mark.known_failing def test_screed_streaming_gzipfq(): # gzip compressed fq o = execute_streaming_diginorm(utils.get_test_data('100-reads.fq.gz')) assert os.path.exists(o) seqs = [r.sequence for r in screed.open(o)] assert seqs[0].startswith('CAGGCGCCCACCACCGTGCCCTCCAACCTG') @pytest.mark.known_failing def test_screed_streaming_gzipfa(): o = execute_streaming_diginorm( utils.get_test_data('test-abund-read-2.fa.gz')) assert os.path.exists(o) seqs = [r.sequence for r in screed.open(o)] assert seqs[0].startswith('GGTTGACGGGGCTCAGGGG') def test_read_parser_streaming_ufa(): # uncompressed FASTA _execute_load_graph_streaming(utils.get_test_data('random-20-a.fa')) def test_read_parser_streaming_ufq(): # uncompressed FASTQ _execute_load_graph_streaming(utils.get_test_data('random-20-a.fq')) @pytest.mark.known_failing def test_read_parser_streaming_bzfq(): # bzip compressed FASTQ _execute_load_graph_streaming(utils.get_test_data('random-20-a.fq.bz2')) def test_read_parser_streaming_gzfq(): # gzip compressed FASTQ _execute_load_graph_streaming(utils.get_test_data('random-20-a.fq.gz')) @pytest.mark.known_failing def test_read_parser_streaming_bzfa(): # bzip compressed FASTA _execute_load_graph_streaming(utils.get_test_data('random-20-a.fa.bz2')) def test_read_parser_streaming_gzfa(): # gzip compressed FASTA _execute_load_graph_streaming(utils.get_test_data('random-20-a.fa.gz')) def test_readstats(): readstats_output = ("358 bp / 5 seqs; 71.6 average length", "916 bp / 11 seqs; 83.3 average length") args = [utils.get_test_data("test-sweep-reads.fq"), utils.get_test_data("paired-mixed.fq")] status, out, err = utils.runscript('readstats.py', args) assert status == 0 for k in readstats_output: assert k in out, (k, out) def test_readstats_csv(): readstats_output = ("358,5,71.6," + utils.get_test_data("test-sweep-reads.fq"), "916,11,83.3," + utils.get_test_data("paired-mixed.fq")) args = [utils.get_test_data("test-sweep-reads.fq"), utils.get_test_data("paired-mixed.fq"), '--csv'] status, out, err = utils.runscript('readstats.py', args) assert status == 0 for k in readstats_output: assert k in out, (k, out) def test_readstats_output(): readstats_output = ("358 bp / 5 seqs; 71.6 average length", "916 bp / 11 seqs; 83.3 average length") outfile = utils.get_temp_filename('output.txt') args = ["-o", outfile, utils.get_test_data("test-sweep-reads.fq"), utils.get_test_data("paired-mixed.fq")] status, _, _ = utils.runscript('readstats.py', args) assert status == 0 out = open(outfile).read() for k in readstats_output: assert k in out, (k, out) def test_readstats_empty(): expected_output = "No sequences found in 2 files" args = [utils.get_test_data("test-empty.fa"), utils.get_test_data("test-empty.fa.bz2")] status, out, err = utils.runscript('readstats.py', args) assert status == 0 assert expected_output in out def test_trim_low_abund_1(): infile = utils.copy_test_data('test-abund-read-2.fa') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", infile] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile seqs = set([r.sequence for r in screed.open(outfile)]) assert len(seqs) == 1, seqs assert 'GGTTGACGGGGCTCAGGG' in seqs def test_trim_low_abund_1_duplicate_filename_err(): infile = utils.copy_test_data('test-abund-read-2.fa') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", '-C', '1', infile, infile] (status, out, err) = utils.runscript('trim-low-abund.py', args, in_dir, fail_ok=True) assert status == 1 assert "Error: Cannot input the same filename multiple times." in str(err) def test_trim_low_abund_1_stdin_err(): args = ["-"] (status, out, err) = utils.runscript('trim-low-abund.py', args, fail_ok=True) assert status == 1 assert "Accepting input from stdin; output filename must be provided" \ in str(err) def test_trim_low_abund_2(): infile = utils.copy_test_data('test-abund-read-2.fa') infile2 = utils.copy_test_data('test-abund-read-2.fa', 'copyDataTwo') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", '-C', '1', infile, infile2] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile seqs = set([r.sequence for r in screed.open(outfile)]) assert len(seqs) == 2, seqs assert 'GGTTGACGGGGCTCAGGG' in seqs def test_trim_low_abund_2_o_gzip(): infile = utils.copy_test_data('test-abund-read-2.fa') infile2 = utils.copy_test_data('test-abund-read-2.fa', 'copyDataTwo') outfile = utils.get_temp_filename('out.gz') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", '-C', '1', "-o", outfile, "--gzip", infile, infile2] utils.runscript('trim-low-abund.py', args, in_dir) assert os.path.exists(outfile), outfile x = list(screed.open(outfile)) assert len(x) # make sure that FASTQ records are retained. def test_trim_low_abund_3_fq_retained(): infile = utils.copy_test_data('test-abund-read-2.fq') infile2 = utils.copy_test_data('test-abund-read-2.fq', 'copyDataTwo') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", '-C', '1', infile, infile2] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile seqs = set([r.sequence for r in screed.open(outfile)]) assert len(seqs) == 2, seqs assert 'GGTTGACGGGGCTCAGGG' in seqs # check for 'quality' string. seqs = set([r.quality for r in screed.open(outfile)]) assert len(seqs) == 2, seqs assert '##################' in seqs # test that the -V option does not trim sequences that are low abundance def test_trim_low_abund_4_retain_low_abund(): infile = utils.copy_test_data('test-abund-read-2.fa') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", '-V', infile] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile seqs = set([r.sequence for r in screed.open(outfile)]) assert len(seqs) == 2, seqs assert 'GGTTGACGGGGCTCAGGG' in seqs # test that the -V option *does* trim sequences that are low abundance def test_trim_low_abund_5_trim_high_abund(): infile = utils.copy_test_data('test-abund-read-3.fa') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", '-V', infile] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile seqs = set([r.sequence for r in screed.open(outfile)]) assert len(seqs) == 2, seqs # trimmed sequence @ error assert 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGC' in seqs # test that -V/-Z setting - should not trip if -Z is set high enough. def test_trim_low_abund_6_trim_high_abund_Z(): infile = utils.copy_test_data('test-abund-read-3.fa') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", '-V', '-Z', '25', infile] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile seqs = set([r.sequence for r in screed.open(outfile)]) assert len(seqs) == 2, seqs # untrimmed seq. badseq = 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCgtgCCGCAGCTGTCGTCAGGG' \ 'GATTTCCGGGCGG' assert badseq in seqs # should be there, untrimmed def test_trim_low_abund_keep_paired(): infile = utils.copy_test_data('test-abund-read-2.paired.fq') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", "-V", infile] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile seqs = [r.name for r in screed.open(outfile)] assert seqs[-2:] == ['pair/1', 'pair/2'], seqs def test_trim_low_abund_keep_paired_casava18(): infile = utils.copy_test_data('test-abund-read-2.paired2.fq') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", "-V", infile] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile seqs = [r.name for r in screed.open(outfile)] assert seqs[-2:] == ['pair:foo 1::N', 'pair:foo 2::N'], seqs def test_trim_low_abund_highfpr(): infile = utils.copy_test_data('test-abund-read-2.paired.fq') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1", "-N", "1", "-V", infile] code, out, err = utils.runscript('trim-low-abund.py', args, in_dir, fail_ok=True) assert code == 1 assert '** ERROR: the graph structure is too small' in err, err def test_trim_low_abund_trimtest(): infile = utils.copy_test_data('test-abund-read-2.paired.fq') in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", "-Z", "2", "-C", "1", "-V", infile] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile for record in screed.open(outfile): if record.name == 'seqtrim/1': print(record.name, record.sequence) assert record.sequence == \ 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCC' elif record.name == 'seqtrim/2': print(record.name, record.sequence) assert record.sequence == \ 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGC' elif record.name == 'seqtrim2/1': print(record.name, record.sequence) assert record.sequence == \ 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCA' def test_trim_low_abund_trimtest_after_load(): infile = utils.copy_test_data('test-abund-read-2.paired.fq') in_dir = os.path.dirname(infile) saved_table = utils.get_temp_filename('save.ct') args = ["-k", "17", "-x", "1e7", "-N", "2", saved_table, infile] utils.runscript('load-into-counting.py', args, in_dir) args = ["-Z", "2", "-C", "2", "-V", '--loadgraph', saved_table, infile] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile for record in screed.open(outfile): if record.name == 'seqtrim/1': print(record.name, record.sequence) assert record.sequence == \ 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCC' elif record.name == 'seqtrim/2': print(record.name, record.sequence) assert record.sequence == \ 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGC' elif record.name == 'seqtrim2/1': print(record.name, record.sequence) assert record.sequence == \ 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCA' def test_trim_low_abund_trimtest_savegraph(): infile = utils.copy_test_data('test-abund-read-2.paired.fq') in_dir = os.path.dirname(infile) saved_table = utils.get_temp_filename('save.ct') args = ["-k", "17", "-x", "1e7", "-N", "2", "-Z", "2", "-C", "2", "-V", '--savegraph', saved_table, infile] utils.runscript('trim-low-abund.py', args, in_dir) outfile = infile + '.abundtrim' assert os.path.exists(outfile), outfile assert os.path.exists(saved_table) for record in screed.open(outfile): if record.name == 'seqtrim/1': print(record.name, record.sequence) assert record.sequence == \ 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCC' elif record.name == 'seqtrim/2': print(record.name, record.sequence) assert record.sequence == \ 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCAGCCGC' elif record.name == 'seqtrim2/1': print(record.name, record.sequence) assert record.sequence == \ 'GGTTGACGGGGCTCAGGGGGCGGCTGACTCCGAGAGACAGCA' def test_trim_low_abund_no_summary_info_by_default(): infile = utils.copy_test_data("test-abund-read-2.fa") in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", "-o", "summary", infile] _, out, err = utils.runscript('trim-low-abund.py', args, in_dir) summary_fname = os.path.join(in_dir, "summary.info.json") print(os.path.exists(summary_fname)) assert not os.path.exists(summary_fname), summary_fname def test_trim_low_abund_summary_info_json(): # test JSON file with summary info is created infile = utils.copy_test_data("test-abund-read-2.fa") in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", "--summary-info", "json", "-o", "summary", infile] _, out, err = utils.runscript('trim-low-abund.py', args, in_dir) summary_fname = os.path.join(in_dir, "summary.info.json") assert os.path.exists(summary_fname), summary_fname with open(summary_fname) as f: assert json.load(f), 'summary file does not contain valid JSON' def test_trim_low_abund_summary_info_tsv(): # test TSV file with summary info is created infile = utils.copy_test_data("test-abund-read-2.fa") in_dir = os.path.dirname(infile) args = ["-k", "17", "-x", "1e7", "-N", "2", "--summary-info", "tsv", "-o", "summary", infile] _, out, err = utils.runscript('trim-low-abund.py', args, in_dir) summary_fname = os.path.join(in_dir, "summary.info.tsv") assert os.path.exists(summary_fname), summary_fname with open(summary_fname) as f: reader = csv.DictReader(f, dialect='excel-tab') lines = [row for row in reader] assert len(lines) == 1 # test that -o/--out option outputs to STDOUT def test_trim_low_abund_stdout(): infile = utils.copy_test_data('test-abund-read-2.fa') in_dir =
True dirLen = len(dir) # this skips all of /var/lib/conarydb/ for (dirName, dirNameList, pathNameList) in os.walk(dir): for path in pathNameList: if path[0] == ".": continue fullPath = dirName[dirLen:] + "/" + path if fullPath == "/var/log/conary": continue if fullPath.startswith("/var/lib/conarydb/"): continue if paths.has_key(fullPath): del paths[fullPath] else: self.fail("unexpected file %s" % fullPath) if paths: self.fail("files missing %s" % " ".join(paths.keys())) def cookItem(self, *args, **kw): return self.discardOutput(cook.cookItem, *args, **kw) # Kludge to make debugging tests that only fail in Hudson easier _printOnError = False def cookObject(self, loader, prep=False, macros={}, sourceVersion = None, serverIdx = 0, ignoreDeps = False, logBuild = False, targetLabel = None, repos = None, groupOptions = None, resume = None): theClass = loader.getRecipe() if repos is None: repos = self.openRepository(serverIdx) if sourceVersion is None: sourceVersion = cook.guessSourceVersion(repos, theClass.name, theClass.version, self.cfg.buildLabel, searchBuiltTroves=True)[0] if not sourceVersion: # just make up a sourceCount -- there's no version in # the repository to compare against sourceVersion = versions.VersionFromString('/%s/%s-1' % ( self.cfg.buildLabel.asString(), theClass.version)) use.resetUsed() try: builtList, _ = self.captureOutput(cook.cookObject, repos, self.cfg, [loader], sourceVersion, prep=prep, macros=macros, allowMissingSource=True, ignoreDeps=ignoreDeps, logBuild=logBuild, groupOptions=groupOptions, resume=resume, _printOnError=self._printOnError, ) finally: repos.close() return builtList def cookPackageObject(self, theClass, prep=False, macros={}, sourceVersion = None, serverIdx = 0, ignoreDeps = False): """ cook a package object, return the buildpackage components and package obj """ repos = self.openRepository(serverIdx) if sourceVersion is None: sourceVersion, _ = cook.guessSourceVersion(repos, theClass.name, theClass.version, self.cfg.buildLabel, searchBuiltTroves=True) if not sourceVersion: # just make up a sourceCount -- there's no version in # the repository to compare against sourceVersion = versions.VersionFromString('/%s/%s-1' % ( self.cfg.buildLabel.asString(), theClass.version)) use.resetUsed() stdout = os.dup(sys.stdout.fileno()) stderr = os.dup(sys.stderr.fileno()) null = os.open('/dev/null', os.O_WRONLY) os.dup2(null, sys.stdout.fileno()) os.dup2(null, sys.stderr.fileno()) try: res = cook._cookPackageObject(repos, self.cfg, theClass, sourceVersion, prep=prep, macros=macros, ignoreDeps=ignoreDeps) finally: os.dup2(stdout, sys.stdout.fileno()) os.dup2(stderr, sys.stderr.fileno()) os.close(null) os.close(stdout) os.close(stderr) repos.close() if not res: return None #return bldList, recipeObj return res[0:2] def getRecipeObjFromRepos(self, name, repos): stdout = os.dup(sys.stdout.fileno()) stderr = os.dup(sys.stderr.fileno()) null = os.open('/dev/null', os.O_WRONLY) os.dup2(null, sys.stdout.fileno()) os.dup2(null, sys.stderr.fileno()) try: loader, sourceVersion = loadrecipe.recipeLoaderFromSourceComponent( name, self.cfg, repos)[0:2] recipeObj = cook._cookPackageObject(repos, self.cfg, loader, sourceVersion, prep=True, requireCleanSources=True) finally: os.dup2(stdout, sys.stdout.fileno()) os.dup2(stderr, sys.stderr.fileno()) os.close(null) os.close(stdout) os.close(stderr) return recipeObj def repairTroves(self, pkgList = [], root = None): if root is None: root = self.rootDir repos = self.openRepository() db = self.openDatabase(root = root) troveList = [] for item in pkgList: name, ver, flv = updatecmd.parseTroveSpec(item) troves = db.findTrove(None, (name, ver, flv)) troveList += troves db.repairTroves(repos, troveList) def updatePkg(self, root, pkg=[], version = None, tagScript = None, noScripts = False, keepExisting = False, replaceFiles = None, resolve = False, depCheck = True, justDatabase = False, flavor = None, recurse = True, sync = False, info = False, fromFiles = [], checkPathConflicts = True, test = False, migrate = False, keepRequired = None, raiseError = False, callback = None, restartInfo = None, applyCriticalOnly = False, syncChildren = False, keepJournal = False, noRestart=False, exactFlavors = False, replaceManagedFiles = False, replaceModifiedFiles = False, replaceUnmanagedFiles = False, replaceModifiedConfigFiles = False, skipCapsuleOps = False, criticalUpdateInfo = None, modelFile = None): if not isinstance(root, str) or not root[0] == '/': # hack to allow passing of rootdir as first argument # as we used to if isinstance(root, list): pkg = root else: pkg = [root] root = self.rootDir newcfg = self.cfg newcfg.root = root if callback is None: callback = callbacks.UpdateCallback() if replaceFiles is not None: replaceManagedFiles = replaceFiles replaceUnmanagedFiles = replaceFiles replaceModifiedFiles = replaceFiles replaceModifiedConfigFiles = replaceFiles repos = self.openRepository() if isinstance(pkg, (str, list)): if isinstance(pkg, str): if version is not None: if type(version) is not str: version = version.asString() item = "%s=%s" % (pkg, version) else: item = pkg if flavor is not None: item += '[%s]' % flavor pkgl = [ item ] else: assert(version is None) assert(flavor is None) pkgl = list(itertools.chain(*(util.braceExpand(x) for x in pkg))) # For consistency's sake, if in migrate mode, fake the command # line to say migrate if migrate: newSysArgv = [ 'conary', 'migrate' ] else: newSysArgv = [ 'conary', 'update' ] oldSysArgv = sys.argv # Add the packages to handle newSysArgv.extend(pkgl) newcfg.autoResolve = resolve try: if keepJournal: k = { 'keepJournal' : True } else: k = {} try: sys.argv = newSysArgv updatecmd.doUpdate(newcfg, pkgl, tagScript=tagScript, keepExisting=keepExisting, replaceManagedFiles=\ replaceManagedFiles, replaceUnmanagedFiles=\ replaceUnmanagedFiles, replaceModifiedFiles=\ replaceModifiedFiles, replaceModifiedConfigFiles=\ replaceModifiedConfigFiles, depCheck=depCheck, justDatabase=justDatabase, recurse=recurse, split=True, sync=sync, info=info, fromFiles=fromFiles, checkPathConflicts=checkPathConflicts, test=test, migrate=migrate, keepRequired=keepRequired, callback=callback, restartInfo=restartInfo, applyCriticalOnly=applyCriticalOnly, syncChildren=syncChildren, forceMigrate=migrate, noRestart=noRestart, exactFlavors=exactFlavors, criticalUpdateInfo=criticalUpdateInfo, skipCapsuleOps=skipCapsuleOps, noScripts=noScripts, systemModelFile=modelFile, **k) finally: sys.argv = oldSysArgv except conaryclient.DependencyFailure, msg: if raiseError: raise print msg except errors.InternalConaryError, err: raise except errors.ConaryError, msg: if raiseError: raise log.error(msg) else: # we have a changeset object; mimic what updatecmd does assert(not info) assert(not fromFiles) assert(not test) assert(checkPathConflicts) cl = conaryclient.ConaryClient(self.cfg) cl.setUpdateCallback(callback) job = [ (x[0], (None, None), (x[1], x[2]), not keepExisting) for x in pkg.getPrimaryTroveList() ] try: try: updJob, suggMap = cl.updateChangeSet(job, keepExisting = keepExisting, keepRequired = keepRequired, recurse = recurse, split = True, sync = sync, fromChangesets = [ pkg ]) if depCheck: assert(not suggMap) if replaceFiles is None: replaceFiles = False # old applyUpdate API doesn't support separate args assert(not replaceManagedFiles) assert(not replaceUnmanagedFiles) assert(not replaceModifiedFiles) assert(not replaceModifiedConfigFiles) cl.applyUpdate(updJob, replaceFiles = replaceFiles, tagScript = tagScript, justDatabase = justDatabase, keepJournal = keepJournal) finally: updJob.close() cl.close() except conaryclient.DependencyFailure, msg: if raiseError: raise print msg except errors.InternalConaryError, err: raise except errors.ConaryError, err: if raiseError: raise log.error(err) def verifyDatabase(self): db = self.openDatabase() for info in list(db.iterAllTroves()): assert db.getTrove(*info).verifyDigests(), "Update failed" def updateAll(self, **kw): updatecmd.updateAll(self.cfg, **kw) def localChangeset(self, root, pkg, fileName): db = database.Database(root, self.cfg.dbPath) newcfg = copy.deepcopy(self.cfg) newcfg.root = root db = database.Database(root, self.cfg.dbPath) newcfg = copy.deepcopy(self.cfg) newcfg.root = root verify.LocalChangeSetCommand(db, newcfg, pkg, fileName) db.close() def changeset(self, repos, troveSpecs, fileName, recurse=True): cscmd.ChangeSetCommand(self.cfg, troveSpecs, fileName, recurse=recurse) def erasePkg(self, root, pkg, version = None, tagScript = None, depCheck = True, justDatabase = False, flavor = None, test = False, recurse=True, callback = None, skipCapsuleOps = False): db = database.Database(root, self.cfg.dbPath) try: if type(pkg) == list: sys.argv = [ 'conary', 'erase' ] + pkg updatecmd.doUpdate(self.cfg, pkg, tagScript = tagScript, depCheck = depCheck, justDatabase = justDatabase, updateByDefault = False, test = test, recurse=recurse, callback=callback, skipCapsuleOps = skipCapsuleOps) elif version and flavor: item = "%s=%s[%s]" % (pkg, version, flavor) sys.argv = [ 'conary', 'erase', item ] updatecmd.doUpdate(self.cfg, [ item ], tagScript = tagScript, depCheck = depCheck, justDatabase = justDatabase, updateByDefault = False, test = test, recurse=recurse, callback=callback, skipCapsuleOps = skipCapsuleOps) elif version: item = "%s=%s" % (pkg, version) sys.argv = [ 'conary', 'erase', item ] updatecmd.doUpdate(self.cfg, [ item ], tagScript = tagScript, depCheck = depCheck, justDatabase = justDatabase, updateByDefault = False, test = test, recurse=recurse, callback=callback, skipCapsuleOps = skipCapsuleOps) elif flavor: item = "%s[%s]" % (pkg, flavor) sys.argv = [ 'conary', 'erase', item ] updatecmd.doUpdate(self.cfg, [ item ], tagScript = tagScript, depCheck = depCheck, justDatabase = justDatabase, updateByDefault = False, test = test, recurse=recurse, callback=callback, skipCapsuleOps = skipCapsuleOps) else: sys.argv = [ 'conary', 'erase', pkg ] updatecmd.doUpdate(self.cfg, [ pkg ], tagScript = tagScript, depCheck = depCheck, justDatabase = justDatabase, updateByDefault = False, test = test, recurse=recurse, callback=callback, skipCapsuleOps = skipCapsuleOps) except conaryclient.DependencyFailure, msg: print msg except errors.ClientError, msg: log.error(msg) db.close() def restoreTrove(self, root, *troveList): rmv = conarycmd.RestoreCommand() cfg = copy.copy(self.cfg) cfg.root = root return rmv.runCommand(cfg, {}, ( 'conary', 'restore' ) + troveList) def removeFile(self, root, *pathList): rmv = conarycmd.RemoveCommand() cfg = copy.copy(self.cfg) cfg.root = root return rmv.runCommand(cfg, {}, ( 'conary', 'remove' ) + pathList) def build(self, str, name, vars = None, buildDict = None, sourceVersion = None, serverIdx = 0, logLevel = log.WARNING, returnTrove = None, macros=None, prep = False): (built, d) = self.buildRecipe(str, name, d = buildDict, vars = vars, sourceVersion = sourceVersion, logLevel = logLevel, macros = macros, prep = prep) if prep: return (name, version, flavor) = built[0] if returnTrove is None: returnTroveList = [ name ] else: name = name.split(':')[0] if not isinstance(returnTrove, (list, tuple)): l = ( returnTrove, ) else: l = returnTrove returnTroveList = [] for compName in l: if
<reponame>emailweixu/XWorld """ Copyright (c) 2017 Baidu Inc. All Rights Reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ import copy import itertools import numbers import os import random from maze2d import spanning_tree_maze_generator """ Entity: id - unique str for this entity grid_types - "agent", "goal", "block", "boundary" location - (x, y, z) yaw - in radian scale - (0, 1.0] offset - [0, 1-scale] name - name of the entity asset_path - the model path color - color of the entity """ class Entity: def __init__(self, type, id=None, loc=None, yaw=0.0, scale=1.0, offset=0.0, name=None, asset_path=None, color=None): if not loc is None: assert isinstance(loc, tuple) and len(loc) == 3 self.type = type self.id = id self.loc = loc self.yaw = yaw self.scale = scale self.offset = offset self.name = name self.asset_path = asset_path self.color = color class XWorld3DEnv(object): PI_2 = 1.5707963 PI = 3.1415926 curriculum_check_period = 100 def __init__(self, asset_path, max_height=10, max_width=10): self.current_usage = {} self.action_successful = False self.grid_types = ["goal", "block", "agent", "boundary"] ## init dimensions self.max_height = max_height self.max_width = max_width self.__clean_env() ## event messages self.action_successful = False self.agent_sent = "" self.game_event = "" self.curriculum_check_counter = 0 ## load all items from asset_path self.asset_path = asset_path self.all_object_paths = [] for dirpath, _, files in os.walk(asset_path): for f in files: if f.endswith(".urdf"): self.all_object_paths.append(os.path.join(dirpath, f)) self.set_goal_subtrees([]) ## read item properties color_file = os.path.join(asset_path, "properties.txt") assert os.path.exists(color_file) with open(color_file, "r") as f: lines = f.read().splitlines() self.color_table = {os.path.join(asset_path, l.split()[0]) : l.split()[1]\ for l in lines if not l.startswith("//") and not l == ""} ############################ interface with Python tasks ############################ def reset(self): """ Reset the map. """ self.__clean_env() self._configure() self.__instantiate_entities() def get_current_usage(self): self.curriculum_check_counter += 1 if self.curriculum_check_counter < XWorld3DEnv.curriculum_check_period \ or not self.current_usage: return 0 ## we take the average usage across all the tasks usage = sum([sum(l) / float(len(l)) for l in self.current_usage.values()]) \ / len(self.current_usage) self.curriculum_check_counter = 0 return usage def set_dims(self, h, w): """ Set the dimensions of the map. If h or w is less than self.max_height or self.max_width, then walls will be automatically padded. The python user should use coordinates in [0, h) and [0, w). """ assert h > 1 and w > 1 assert h <= self.max_height and w <= self.max_width self.height = h self.width = w self.boundaries = self.__add_boundaries() self.available_grids = list(set(itertools.product(range(w), range(h), (0,)))) random.shuffle(self.available_grids) self.changed = True def set_entity(self, type, loc=None, name=None): """ Add an entity of type to loc which must be currently empty """ self.set_entity_inst(Entity(type=type, loc=loc, name=name)) def set_entity_inst(self, e): if not e.loc is None: assert e.loc in self.available_grids self.available_grids.remove(e.loc) self.entity_nums[e.type] += 1 self.entities.append(e) self.changed = True def delete_entity(self, x): """ Delete an entity on the current map """ self.entities.remove(x) self.entity_nums[x.type] -= 1 self.available_grids.append(x.loc) self.changed = True def move_entity(self, e, loc): """ Move entity e from its current location to loc """ self.delete_entity(e) e.loc = loc self.set_entity_inst(e) def set_goal_subtrees(self, subtrees): """ Set goal directory substrees so that only goals in the selected subtrees will be sampled when generating the map. The user can use this function to control the number of goal classes. The change of goal subtrees will only be reflected for the next game, after reset() is called. The current game still uses old goal subtrees. """ goal_path = os.path.join(self.asset_path, "goal") self.object_paths = copy.deepcopy(self.all_object_paths) if len(subtrees) > 0: self.object_paths \ = [p for p in self.object_paths \ if not p.startswith(goal_path) or p.split("/")[-3] in subtrees] ## get a hierarchy of all possible objects key = lambda p: '_'.join(p.split('_')[:-1]) objects = itertools.groupby(sorted(self.object_paths, key=key), key=key) self.items = {t : {} for t in self.grid_types} for k, g in objects: type = [t for t in k.split("/") if t in self.grid_types][0] assert type in self.items self.items[type][os.path.basename(k)] = list(g) def get_max_dims(self): """ Get the max height and max width of the map """ return (self.max_height, self.max_width) def get_dims(self): return (self.height, self.width) def get_n(self, type): """ Get the current number of entities on the map for type """ assert type in self.entity_nums return self.entity_nums[type] def get_all_possible_names(self, type): """ Return all possible names for type 'goal' - all unique object names 'block' - all block names 'agent' - all agent names """ return self.items[type].keys() def get_all_colors(self): """ Return all possible colors in xworld """ return list(set(self.color_table.values())) def get_agent(self): """ Get the agent information: (entity, agent sentence, action success) """ agent = [e for e in self.entities if e.type == "agent"][0] return (agent, self.agent_sent, self.action_successful) def get_goals(self): """ Return all the goals on the current map """ return [e for e in self.entities if e.type == "goal"] def get_blocks(self): """ Return all the blocks on the current map """ return [e for e in self.entities if e.type == "block"] def get_available_grids(self): """ Return all the available grids on the current map """ return self.available_grids def get_entities(self): """ Return all the entities on the current map """ return self.entities def record_environment_usage(self, task_name, x): """ Update the current environment usage The higher the usage is, the better the agent handles the environment (so it might be a good time now to move to more difficult scenarios) This quantity can be used to generate a curriculum of the world """ self.current_usage[task_name] = x ######################## interface with C++ ############################# def dump_curriculum_progress(self): return self.current_level def env_changed(self): """ Whether the environment has been changed by the teacher during the current stage of the task. If yes, then teaching_task.cpp will notify the simulator to update the game environment. """ ret = self.changed self.changed = False return ret def cpp_get_entities(self): """ C++ code gets entities information. Used by the underlying simulator. """ actual_entities = [e.__dict__ for e in self.entities] boundary_entities = [e.__dict__ for e in self.boundaries] return actual_entities + boundary_entities def update_entities_from_cpp(self, entities): """ Update the environment from C++. The changes might be due to the environment dynamics or the agent's actions. Entities is a list of python dicts. """ self.entity_nums = {t : 0 for t in self.grid_types} self.entities = [Entity(**i) for i in entities if not self.__is_boundary(i["id"])] for e in self.entities: self.entity_nums[e.type] += 1 # update available grids self.available_grids = set(itertools.product(range(self.width), range(self.height), (0,))) occupied = set([e.loc for e in self.entities]) self.available_grids -= occupied self.available_grids = list(self.available_grids) random.shuffle(self.available_grids) def update_agent_sentence_from_cpp(self, sent): """ Update the agent sentence from the CPP simulator """ self.agent_sent = sent def update_agent_action_success_from_cpp(self, successful): """ Update the agent action success from the CPP simulator """ self.action_successful = successful def update_game_event_from_cpp(self, event): """ Update the game event from CPP simulator """ self.game_event = event ######################## private or protected ######################### def _configure(self): """ The user has to override this function to define how the map will be generated after each session resetting """ raise NotImplementedError() def __instantiate_entities(self): """ For each entity, select an instance from the object class it belongs to, after which its properties are set. The entities should have been set in _configure() """ Y, X = self.get_dims() maze = spanning_tree_maze_generator(X, Y) blocks = [(j, i, 0) for i,m in enumerate(maze) for j,b in enumerate(m) if b == '#'] ## maybe not all blocks of the maze will be used later random.shuffle(blocks) ## first remove all maze blocks from the available set for b in blocks: if b in self.available_grids: self.available_grids.remove(b) ## select a random object path for each non-block entity for i, e in enumerate(self.entities): if e.name is None: e.name = random.choice(self.get_all_possible_names(e.type)) e.id = "%s_%d" % (e.name, i) if e.asset_path is None: icons = self.items[e.type][e.name] e.asset_path = random.choice(icons) e.color = self.color_table[e.asset_path] if e.loc is None and e.type != "block": assert len(self.available_grids) > 0 e.loc =