query stringclasses 175 values | positive listlengths 1 9 | negative listlengths 10 10 | system stringlengths 69 2.19k |
|---|---|---|---|
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context 'Results
As neural crest cells coalesce to form sympathetic ganglia, TrkB-positive cells are seen in both chicken and mouse embryos.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Results
As neural crest cells coalesce to form sympathetic ganglia, TrkB-positive cells are seen in both chicken and mouse embryos.', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context 'In chicken embryos, TrkB-expressing cells first appear at Hamburger-Hamilton Stage (St) 27 and they co-express HNK-1, confirming that they are migrating neural crest cells.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'BDNF transcript expression parallels that of TrkB. In the mouse, TrkB-positive cells surround newly formed sympathetic ganglia and a small number of TrkB positive cells that co-express tyrosine hydroxylase are seen within ganglia between E13.5-15.', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context 'In cell culture, many cells from St. 29–30 chicken lumbar sympathetic ganglia express neural markers and are dividing, indicating that they are sympathoblasts.', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context 'In chicken embryos, migrating neural crest cells express catecholamines at Hamburger/Hamilton Stage (St.) 19, and these cells form the primary sympathetic chain dorsolateral to the aorta at St. 22 (E3.5)', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"rats (rattus norvegicus) (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"rattus (rats (rattus))",
"rats (rattus sp.) (rattus sp.)",
"house rat (rattus rattus)",
"rattus rattoides (rattus rattus)",
"rattus sp. (rats (rattus sp.))",
"mus rattus (rattus rattus)",
"black rat (rattus rattus)",
"roof rat (rattus rattus)"
] | Given the context 'Time lapse photography has shown that cultured E15.5–E16.5 sympathetic neurons from rat embryos extend axons while they divide [3-5].', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'There are severe sympathetic defects in the superior cervical ganglion of individual NT-3 and NGF knockout mice [8-10].', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Furthermore, there is no additional cell death in the superior cervical ganglion of NT-3 and NGF double knockout mouse embryos, suggesting that all of the neurons are dependent on both neurotrophins for survival [11].', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'There is also an increase in sympathetic neuron cell death in TrkA knockout mice [12].', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'However, in TrkB and BDNF knockout mice, there is no apparent phenotype in the superior cervical ganglion, and there is little evidence that TrkB or BDNF is expressed in sympathetic ganglia.', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'To test whether BDNF, the ligand for TrkB, was present in embryonic chick sympathetic ganglia, we used quantitative real-time PCR with TaqMan probes to determine the relative abundance of BDNF transcripts in total RNA extracted from lumbar sympathetic ganglia at St. 29/30 (E6.5), St. 31 (E7), St. 34 (E8), and E9.', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context 'Discussion
We report that the neurotrophin receptor TrkB is expressed in a subset of embryonic sympathoblasts during the early development of lumbar paravertebral sympathetic ganglia in chicken and mouse embryos.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Discussion
We report that the neurotrophin receptor TrkB is expressed in a subset of embryonic sympathoblasts during the early development of lumbar paravertebral sympathetic ganglia in chicken and mouse embryos.', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context 'In the chicken, TrkB expression is transient, and completely lost by St 34 (E8).', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'Early sympathetic ganglia contain at least two subpopulations: early differentiating neurons that lack TrkB expression and express TrkA and TrkC, and late differentiating sympathoblasts that express TrkB. Explant cultures of sympathetic ganglia from E16 chick embryos give rise to two neuronal populations: one that remains close to the explant, and one that migrates away from the explant [1].', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'In the superior cervical ganglion, an increase in the number of neurons of BDNF null mice is likely due to apoptosis induced by BDNF via p75NTR', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context 'If our results indicating that BDNF promotes proliferation of TrkB-positive sympathoblasts in the chicken embryo can be extrapolated to the subset of TrkB-positive sympathoblasts in murine ganglia, then these TrkB-positive cells may be neurons destined to innervate the erector pilli.', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'In other studies, TrkB null mice showed no changes in morphology or cell number in superior cervical ganglia [12] or in the intermediolateral column [20]; but this may not be predictive of a phenotype in the lumbar paravertebral chain.', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'However, if TrkB-positive cells are not normally actively proliferating in vivo, then it would not be surprising that the development of the paravertebral sympathetic chain is not disrupted in TrkB or BDNF null mice.', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'It may be more informative to examine mice that over express BDNF on a promoter that targets expression to embryonic lumbar ganglia.', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Unfortunately, such mice do not exist.
', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Our findings that the St. 29/30 (E6.5) sympathoblasts are dependent on both NT-3 and NGF for survival in culture are consistent with previous work on mouse sympathoblasts from the superior cervical ganglion', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"rats (rattus norvegicus) (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"rattus (rats (rattus))",
"rats (rattus sp.) (rattus sp.)",
"house rat (rattus rattus)",
"rattus rattoides (rattus rattus)",
"rattus sp. (rats (rattus sp.))",
"mus rattus (rattus rattus)",
"black rat (rattus rattus)",
"roof rat (rattus rattus)"
] | Given the context 'In contrast, cultured rat superior cervical ganglion sympathetic neurons respond to NT-3 at E14.5 and then to NGF at E19.5, although time points in between were not analyzed [6].
', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"rats (rattus norvegicus) (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"rattus (rats (rattus))",
"rats (rattus sp.) (rattus sp.)",
"house rat (rattus rattus)",
"rattus rattoides (rattus rattus)",
"rattus sp. (rats (rattus sp.))",
"mus rattus (rattus rattus)",
"black rat (rattus rattus)",
"roof rat (rattus rattus)"
] | Given the context 'NT-3 can promote the incorporation of [3H]-thymidine into cultured quail neural crest cells from the trunk region [21,22], Later in rat sympathetic development, NT-3 supports survival of neurons, but does not promote proliferation', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'NGF promotes an increase in BrdU incorporation from 25% to 35% in the DRG cervical segment 2 in the chick embryo [23].', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context 'In chicken embryos that are treated with NGF in ovo at St. 18 and 21, there is an increase in BrdU uptake after formation of the primary sympathetic chain at St. 23', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'Since NGF does not appear to affect proliferation of St. 29/30 (E6.5) chick sympathoblasts, NGF may only promote proliferation in primary, but not secondary chain sympathoblasts.', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'Motor neuron progenitors in the ventral neural tube from the chick embryo express TrkB and when ventral neural tube explants are treated with BDNF, there is an increase in the number of motor neurons produced and BrdU incorporation', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'Future studies will determine whether constitutive expression of BDNF and TrkB in the chick embryo sustains proliferation of differentiating sympathoblasts.
', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context 'Methods
Preparation of tissue for immunohistochemistry
The lumbar spinal column and surrounding tissues were dissected from chicken embryos at the indicated stages and placed in Zamboni's fixative (4% (w/v) paraformaldehyde, 15% (v/v) picric acid in 0.1 M sodium phosphate buffer, pH 7.4) for two hours at room temperature.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Mouse embryos at 13–15 days post-coitus were collected according to an IACUC-approved protocol to Dr. L. Sherman at the Oregon Health and Science University.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'The mouse embryos were immersion-fixed in Zamboni's fixative overnight at 4 degrees C then washed with phosphate buffered saline (PBS; 130 mM NaCl, 20 mM sodium phosphate buffer, pH 7.4).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Fixed mouse embryos were shipped to Vermont in sucrose.', answer the user's query. |
What is the biomedical concept corresponding to 'horse'? | [
"horse (equus caballus)",
"domestic horse (equus caballus)",
"equine (equus caballus)",
"equus caballus (equus przewalskii forma caballus)"
] | [
"horses (equidae)",
"equidae (horses)",
"equus subg. equus (equus)",
"equus sp.",
"eques",
"rv-horse",
"equus ferus (equus caballus ferus)",
"horsetails (equisetidae)",
"equus subgen. sussemionus (equus)",
"equus caballus ferus (equus ferus)"
] | Given the context 'Sections were dried at room temperature, washed in 1× PBS and incubated overnight in blocking buffer (1× PBS consisting of 10% (v/v) heat-inactivated horse serum (Invitrogen/Gibco), 0.5% Triton X-100 (Sigma), and 0.1% sodium azide (Fisher)).
', answer the user's query. |
What is the biomedical concept corresponding to 'rabbit'? | [
"rabbit (oryctolagus cuniculus)",
"european rabbit (oryctolagus cuniculus)",
"domestic rabbit (oryctolagus cuniculus)",
"rabbits (oryctolagus cuniculus)",
"japanese white rabbit (oryctolagus cuniculus)",
"oryctolagus cuniculus (japanese white rabbit)",
"lepus cuniculus (oryctolagus cuniculus)"
] | [
"oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus)",
"rabbits and hares (leporidae)",
"lepus cuniculus cuniculus (oryctolagus cuniculus cuniculus)",
"marsh rabbit (sylvilagus palustris)",
"leporidae (rabbits and hares)",
"swamp rabbit (sylvilagus aquaticus)",
"oryctolagus sp. 'rabbit_od'",
"... | Given the context 'Primary antibodies used were: rabbit anti-p75 (1:1500, generous gift from Louis Reichardt, UCSF', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', answer the user's query. |
What is the biomedical concept corresponding to 'rabbit'? | [
"rabbit (oryctolagus cuniculus)",
"european rabbit (oryctolagus cuniculus)",
"domestic rabbit (oryctolagus cuniculus)",
"rabbits (oryctolagus cuniculus)",
"japanese white rabbit (oryctolagus cuniculus)",
"oryctolagus cuniculus (japanese white rabbit)",
"lepus cuniculus (oryctolagus cuniculus)"
] | [
"oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus)",
"rabbits and hares (leporidae)",
"lepus cuniculus cuniculus (oryctolagus cuniculus cuniculus)",
"marsh rabbit (sylvilagus palustris)",
"leporidae (rabbits and hares)",
"swamp rabbit (sylvilagus aquaticus)",
"oryctolagus sp. 'rabbit_od'",
"... | Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', answer the user's query. |
What is the biomedical concept corresponding to 'rabbit'? | [
"rabbit (oryctolagus cuniculus)",
"european rabbit (oryctolagus cuniculus)",
"domestic rabbit (oryctolagus cuniculus)",
"rabbits (oryctolagus cuniculus)",
"japanese white rabbit (oryctolagus cuniculus)",
"oryctolagus cuniculus (japanese white rabbit)",
"lepus cuniculus (oryctolagus cuniculus)"
] | [
"oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus)",
"rabbits and hares (leporidae)",
"lepus cuniculus cuniculus (oryctolagus cuniculus cuniculus)",
"marsh rabbit (sylvilagus palustris)",
"leporidae (rabbits and hares)",
"swamp rabbit (sylvilagus aquaticus)",
"oryctolagus sp. 'rabbit_od'",
"... | Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', answer the user's query. |
What is the biomedical concept corresponding to 'rabbit'? | [
"rabbit (oryctolagus cuniculus)",
"european rabbit (oryctolagus cuniculus)",
"domestic rabbit (oryctolagus cuniculus)",
"rabbits (oryctolagus cuniculus)",
"japanese white rabbit (oryctolagus cuniculus)",
"oryctolagus cuniculus (japanese white rabbit)",
"lepus cuniculus (oryctolagus cuniculus)"
] | [
"oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus)",
"rabbits and hares (leporidae)",
"lepus cuniculus cuniculus (oryctolagus cuniculus cuniculus)",
"marsh rabbit (sylvilagus palustris)",
"leporidae (rabbits and hares)",
"swamp rabbit (sylvilagus aquaticus)",
"oryctolagus sp. 'rabbit_od'",
"... | Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', answer the user's query. |
What is the biomedical concept corresponding to 'chicken'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus domesticus (gallus gallus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"gallus sp.",
"galliformes (landfowls)",
"landfowls (galliformes)",
"gallasellus",
"gallio",
"miletus gallus gallus",
"gallacoccus",
"gallus gallus gallus (gallus gallus philippensis)",
"arilus gallus"
] | Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', answer the user's query. |
What is the biomedical concept corresponding to 'sheep'? | [
"sheep (ovis aries)",
"domestic sheep (ovis aries)",
"wild sheep (ovis aries)",
"lambs (ovis aries)",
"ovis ovis (ovis aries)",
"ovis ammon aries (ovis aries)",
"ovis aries (ovis orientalis aries)"
] | [
"ovis sp.",
"ovis",
"ovis aries vignei (ovis vignei)",
"ovis nivicola (ovis canadensis nivicola)",
"ovis dalli (dall's sheep)",
"dall sheep (ovis dalli)",
"ovis canadensis x ovis aries (ovis canadensis x aries)",
"ovis canadensis canadensis",
"snow sheep (ovis nivicola)",
"ovis vignei (ovis orient... | Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', answer the user's query. |
What is the biomedical concept corresponding to 'rabbit'? | [
"rabbit (oryctolagus cuniculus)",
"european rabbit (oryctolagus cuniculus)",
"domestic rabbit (oryctolagus cuniculus)",
"rabbits (oryctolagus cuniculus)",
"japanese white rabbit (oryctolagus cuniculus)",
"oryctolagus cuniculus (japanese white rabbit)",
"lepus cuniculus (oryctolagus cuniculus)"
] | [
"oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus)",
"rabbits and hares (leporidae)",
"lepus cuniculus cuniculus (oryctolagus cuniculus cuniculus)",
"marsh rabbit (sylvilagus palustris)",
"leporidae (rabbits and hares)",
"swamp rabbit (sylvilagus aquaticus)",
"oryctolagus sp. 'rabbit_od'",
"... | Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', answer the user's query. |
What is the biomedical concept corresponding to 'goat'? | [
"domestic goat (capra hircus)",
"goats (capra hircus)",
"goat (capra hircus) (capra hircus)",
"capra aegagrus hircus (capra hircus)",
"capra hircus (capra aegagrus hircus)"
] | [
"wild goat (capra aegagrus)",
"capra",
"capra aegagrus (capra hircus aegagrus)",
"capra hircus aegagrus (capra aegagrus)",
"capra sp.",
"capraita",
"capra aegagrus cretica (capra hircus cretica)",
"capra hircus cretica (capra aegagrus cretica)",
"capneidae",
"capra cretica (capra hircus cretica)"
... | Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'RNA Extraction/cDNA synthesis
Sympathetic ganglia were removed from chick embryos and RNA was isolated using TriReagent (Molecular Research Center), an acidified guanidinium with phenol extraction method', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'TaqMan probes were used to quantify the progression of the PCR reaction and reactions were normalized using the constitutively expressed gene chick ribosomal binding protein s17 (CHRPS).', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'The sequences were used for primer/probes sets: for BDNF: forward: 5'-AGCCCAGTGAGGAAAACAAG-3', reverse: 5'-ACTCCTCGAGCAGAAAGAGC-3', probe: 5'-[6-FAM]-TACACATCCCGAGTCATGCTGAGCA-[BHQ]-3'; for CHRPS (chick ribosomal binding protein S-17): 5'AACGACTTCCACACCAACAA3', reverse: 5'CTTCATCAGGTGGGTGACAT3', probe: 5'-[6-FAM]-CGCCATCATCCCCAGCAAGA [BHQ]-3'.', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'Sympathetic ganglia were removed from the lumbar region of the paravertebral chain of St. 29/30 (E6.5) chick embryos and placed in Modified Puck's solution with glucose (MPG).', answer the user's query. |
What is the biomedical concept corresponding to 'horse'? | [
"horse (equus caballus)",
"domestic horse (equus caballus)",
"equine (equus caballus)",
"equus caballus (equus przewalskii forma caballus)"
] | [
"horses (equidae)",
"equidae (horses)",
"equus subg. equus (equus)",
"equus sp.",
"eques",
"rv-horse",
"equus ferus (equus caballus ferus)",
"horsetails (equisetidae)",
"equus subgen. sussemionus (equus)",
"equus caballus ferus (equus ferus)"
] | Given the context 'Cells were then resuspended in Dulbecco's Modified Eagle Medium (DMEM) consisting of 10% horse serum, 2% fetal calf serum, and 10 mg/ml penicillin/streptomycin.', answer the user's query. |
What is the biomedical concept corresponding to 'chick'? | [
"chicken (gallus gallus)",
"chickens (gallus gallus)",
"gallus domesticus (gallus gallus)",
"gallus gallus (gallus gallus domesticus)",
"gallus gallus domesticus (gallus gallus)",
"phasianus gallus (gallus gallus)"
] | [
"gallus",
"landfowls (galliformes)",
"miletus gallus gallus",
"gallus sp.",
"galliformes (landfowls)",
"gallio",
"avian (aves)",
"gallorhynchus",
"gallasellus",
"arilus gallus"
] | Given the context 'For in vivo studies, 25 μg BrdU was injected into the amnion of chick embryos at St. 27.', answer the user's query. |
What is the biomedical concept corresponding to 'horse'? | [
"horse (equus caballus)",
"domestic horse (equus caballus)",
"equine (equus caballus)",
"equus caballus (equus przewalskii forma caballus)"
] | [
"horses (equidae)",
"equidae (horses)",
"equus subg. equus (equus)",
"equus sp.",
"eques",
"rv-horse",
"equus ferus (equus caballus ferus)",
"horsetails (equisetidae)",
"equus subgen. sussemionus (equus)",
"equus caballus ferus (equus ferus)"
] | Given the context 'Abbreviations
BDNF, brain-derived neurotrophic factor; BrdU, Bromodeoxyuridine; DA, dorsal aorta; DMEM, Dulbecco's Modified Eagle's Medium; DRG, dorsal root ganglion; E, embryonic day; HS, horse serum; MPG, Modified Puck's solution with glucose; NGF, nerve growth factor; NC, notochord; NT, neural tube; NT-3, neurotrophin-3; NTR, neurotrophin receptor; PBS, phosphate-buffered saline; SC, spinal cord; SCG, superior cervical ganglion; SEM, standard error of the mean; SG, sympathetic ganglion; St., stage; w/v, weight/volume; v/v, volume/volume.
', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'Identification of a human peripheral blood monocyte subset that differentiates into osteoclasts
Abstract
Increased bone resorption mediated by osteoclasts causes various diseases such as osteoporosis and bone erosion in rheumatoid arthritis (RA).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'In the present study, we show that the purified CD16- human peripheral blood monocyte subset, but not the CD16+ monocyte subset, differentiates into osteoclast by stimulation with receptor activator of NF-κB ligand (RANKL) in combination with macrophage colony-stimulating factor (M-CSF).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Interestingly, the deletion of RANKL or c-Fos gene, which is important for osteoclastogenesis, results in minimal bone destruction in mouse models of arthritis [1,2].', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'It is reported that osteoclast precursors reside in human peripheral blood monocytes [4,5].', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)"
] | [
"clientister",
"theraps",
"personidae",
"proxys",
"perna",
"genus",
"aides",
"pero",
"inquisitor",
"plasmids"
] | Given the context 'A marked increase of the circulating osteoclast precursors was demonstrated in patients with erosive psoriatic arthritis as well as in arthritic TNFα transgenic mice [6,7].', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'A marked increase of the circulating osteoclast precursors was demonstrated in patients with erosive psoriatic arthritis as well as in arthritic TNFα transgenic mice [6,7].', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'Monocytes are therefore involved not only in synovial inflammation, but also in bone remodeling as potential precursors for synovial macrophages and osteoclasts.
Human peripheral blood monocytes consist of two major subsets, CD16+ and CD16-, comprising 5–10% and 90–95% of the monocytes, respectively.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'In the present study, we determined the human peripheral blood monocyte subset that differentiates into osteoclasts, and revealed that each subset exhibits a different response for osteoclastogenic stimuli.
', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Flow cytometry analysis using FITC-conjugated mouse anti-CD14 mAb (MY4; Bechman Coulter, Fullerton, CA, USA) and phycoerythin-conjugated mouse anti-CD16 mAb (3G8; BD Biosciences, San Jose, CA, USA) showed that the purities of the CD16+ and CD16- monocytes were more than 90% and 92%, respectively.
', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Flow cytometry analysis using FITC-conjugated mouse anti-CD14 mAb (MY4; Bechman Coulter, Fullerton, CA, USA) and phycoerythin-conjugated mouse anti-CD16 mAb (3G8; BD Biosciences, San Jose, CA, USA) showed that the purities of the CD16+ and CD16- monocytes were more than 90% and 92%, respectively.
', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'For the other experiment, monocytes were purified using CD14 MicroBeads (Miltenyi Biotec), and then stained either with FITC-conjugated mouse anti-CD33 mAb (MY9; Bechman Coulter) or phycoerythin-conjugated mouse anti-CD16 mAb (3G8).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'For the other experiment, monocytes were purified using CD14 MicroBeads (Miltenyi Biotec), and then stained either with FITC-conjugated mouse anti-CD33 mAb (MY9; Bechman Coulter) or phycoerythin-conjugated mouse anti-CD16 mAb (3G8).', answer the user's query. |
What is the biomedical concept corresponding to 'bovine'? | [
"bovine (bos taurus)",
"bos bovis (bos taurus)",
"cow (bos taurus) (bos taurus)",
"domestic cattle (bos taurus)",
"domestic cow (bos taurus)",
"bos taurus (bos primigenius taurus)",
"bos primigenius taurus (bos taurus)",
"ox (bos taurus) (bos taurus)",
"dairy cow (bos taurus)"
] | [
"cattle (bos)",
"bos (cattle)",
"bovidae",
"bos taurus indicus (bos indicus)",
"boveria",
"bos sp.",
"bos indicus (bos primigenius indicus)",
"bos primigenius indicus (bos indicus)",
"bos taurus x bos indicus (bos indicus x bos taurus)",
"beefalo (bos taurus x bison bison)"
] | Given the context 'Osteoclast differentiation
Purified CD16+ and CD16- monocytes (5 × 104 cells/well) were incubated in 96-well plates in αMEM (Sigma, St Louis, MO, USA) with heat-inactivated 10% fetal bovine serum (FBS) (Sigma) or with Ultra-Low IgG FBS (IgG < 5 μg/ml; Invitrogen, Carlsbad, CA, USA), and where indicated with M-CSF + RANKL (Peprotech, Rocky Hill, NJ, USA).
', answer the user's query. |
What is the biomedical concept corresponding to 'goat'? | [
"domestic goat (capra hircus)",
"goats (capra hircus)",
"goat (capra hircus) (capra hircus)",
"capra aegagrus hircus (capra hircus)",
"capra hircus (capra aegagrus hircus)"
] | [
"wild goat (capra aegagrus)",
"capra",
"capra aegagrus (capra hircus aegagrus)",
"capra hircus aegagrus (capra aegagrus)",
"capra sp.",
"capraita",
"capra aegagrus cretica (capra hircus cretica)",
"capra hircus cretica (capra aegagrus cretica)",
"capneidae",
"capra cretica (capra hircus cretica)"
... | Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', answer the user's query. |
What is the biomedical concept corresponding to 'goat'? | [
"domestic goat (capra hircus)",
"goats (capra hircus)",
"goat (capra hircus) (capra hircus)",
"capra aegagrus hircus (capra hircus)",
"capra hircus (capra aegagrus hircus)"
] | [
"wild goat (capra aegagrus)",
"capra",
"capra aegagrus (capra hircus aegagrus)",
"capra hircus aegagrus (capra aegagrus)",
"capra sp.",
"capraita",
"capra aegagrus cretica (capra hircus cretica)",
"capra hircus cretica (capra aegagrus cretica)",
"capneidae",
"capra cretica (capra hircus cretica)"
... | Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', answer the user's query. |
What is the biomedical concept corresponding to 'rabbit'? | [
"rabbit (oryctolagus cuniculus)",
"european rabbit (oryctolagus cuniculus)",
"domestic rabbit (oryctolagus cuniculus)",
"rabbits (oryctolagus cuniculus)",
"japanese white rabbit (oryctolagus cuniculus)",
"oryctolagus cuniculus (japanese white rabbit)",
"lepus cuniculus (oryctolagus cuniculus)"
] | [
"oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus)",
"rabbits and hares (leporidae)",
"lepus cuniculus cuniculus (oryctolagus cuniculus cuniculus)",
"marsh rabbit (sylvilagus palustris)",
"leporidae (rabbits and hares)",
"swamp rabbit (sylvilagus aquaticus)",
"oryctolagus sp. 'rabbit_od'",
"... | Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', answer the user's query. |
What is the biomedical concept corresponding to 'goat'? | [
"domestic goat (capra hircus)",
"goats (capra hircus)",
"goat (capra hircus) (capra hircus)",
"capra aegagrus hircus (capra hircus)",
"capra hircus (capra aegagrus hircus)"
] | [
"wild goat (capra aegagrus)",
"capra",
"capra aegagrus (capra hircus aegagrus)",
"capra hircus aegagrus (capra aegagrus)",
"capra sp.",
"capraita",
"capra aegagrus cretica (capra hircus cretica)",
"capra hircus cretica (capra aegagrus cretica)",
"capneidae",
"capra cretica (capra hircus cretica)"
... | Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', answer the user's query. |
What is the biomedical concept corresponding to 'rabbit'? | [
"rabbit (oryctolagus cuniculus)",
"european rabbit (oryctolagus cuniculus)",
"domestic rabbit (oryctolagus cuniculus)",
"rabbits (oryctolagus cuniculus)",
"japanese white rabbit (oryctolagus cuniculus)",
"oryctolagus cuniculus (japanese white rabbit)",
"lepus cuniculus (oryctolagus cuniculus)"
] | [
"oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus)",
"rabbits and hares (leporidae)",
"lepus cuniculus cuniculus (oryctolagus cuniculus cuniculus)",
"marsh rabbit (sylvilagus palustris)",
"leporidae (rabbits and hares)",
"swamp rabbit (sylvilagus aquaticus)",
"oryctolagus sp. 'rabbit_od'",
"... | Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Alexa 647-conjugated mouse IgG2a (Serotec), FITC-conjugated mouse IgG1 (BD Biosciences) and phycoerythin-conjugated mouse IgG1 (Bechman Coulter) were used as isotype controls.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Alexa 647-conjugated mouse IgG2a (Serotec), FITC-conjugated mouse IgG1 (BD Biosciences) and phycoerythin-conjugated mouse IgG1 (Bechman Coulter) were used as isotype controls.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Alexa 647-conjugated mouse IgG2a (Serotec), FITC-conjugated mouse IgG1 (BD Biosciences) and phycoerythin-conjugated mouse IgG1 (Bechman Coulter) were used as isotype controls.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'Peripheral blood monocytes (1 × 105 cells) were incubated with 1 μg human IgG for 15 minutes, and were then stained with three fluorochrome-labeled mAbs for 45 minutes on ice.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'The cells were fixed in acetone and then stained with anti-αvβ3 mAb (LM609; Chemicon, Temecula, CA, USA) or mouse IgG1 (11711; R&D Systems) as an isotype-matched control.', answer the user's query. |
What is the biomedical concept corresponding to 'goat'? | [
"domestic goat (capra hircus)",
"goats (capra hircus)",
"goat (capra hircus) (capra hircus)",
"capra aegagrus hircus (capra hircus)",
"capra hircus (capra aegagrus hircus)"
] | [
"wild goat (capra aegagrus)",
"capra",
"capra aegagrus (capra hircus aegagrus)",
"capra hircus aegagrus (capra aegagrus)",
"capra sp.",
"capraita",
"capra aegagrus cretica (capra hircus cretica)",
"capra hircus cretica (capra aegagrus cretica)",
"capneidae",
"capra cretica (capra hircus cretica)"
... | Given the context 'Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes, Eugene, OR, USA) was used as the second antibody.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes, Eugene, OR, USA) was used as the second antibody.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'A total of 1 × 105 cells was then Fc blocked with 1 μg human IgG for 15 minutes, and was stained with Alexa Fluor 647-conjugated mAb either to phospho-p38 MAPK (T180/Y182) or to phospho-ERK1/2 (T202/Y204) (BD Biosciences) for 30 minutes at room temperature.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'Alexa Fluor 647-conjugated mouse IgG1 (BD Biosciences) was used as an isotype control.', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)"
] | [
"clientister",
"theraps",
"personidae",
"proxys",
"perna",
"genus",
"aides",
"pero",
"inquisitor",
"plasmids"
] | Given the context 'Immunohistochemistry
Synovial tissue samples were obtained during total knee joint replacement surgery from four RA patients.', answer the user's query. |
What is the biomedical concept corresponding to 'goat'? | [
"domestic goat (capra hircus)",
"goats (capra hircus)",
"goat (capra hircus) (capra hircus)",
"capra aegagrus hircus (capra hircus)",
"capra hircus (capra aegagrus hircus)"
] | [
"wild goat (capra aegagrus)",
"capra",
"capra aegagrus (capra hircus aegagrus)",
"capra hircus aegagrus (capra aegagrus)",
"capra sp.",
"capraita",
"capra aegagrus cretica (capra hircus cretica)",
"capra hircus cretica (capra aegagrus cretica)",
"capneidae",
"capra cretica (capra hircus cretica)"
... | Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', answer the user's query. |
What is the biomedical concept corresponding to 'bovine'? | [
"bovine (bos taurus)",
"bos bovis (bos taurus)",
"cow (bos taurus) (bos taurus)",
"domestic cattle (bos taurus)",
"domestic cow (bos taurus)",
"bos taurus (bos primigenius taurus)",
"bos primigenius taurus (bos taurus)",
"ox (bos taurus) (bos taurus)",
"dairy cow (bos taurus)"
] | [
"cattle (bos)",
"bos (cattle)",
"bovidae",
"bos taurus indicus (bos indicus)",
"boveria",
"bos sp.",
"bos indicus (bos primigenius indicus)",
"bos primigenius indicus (bos indicus)",
"bos taurus x bos indicus (bos indicus x bos taurus)",
"beefalo (bos taurus x bison bison)"
] | Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', answer the user's query. |
What is the biomedical concept corresponding to 'goat'? | [
"domestic goat (capra hircus)",
"goats (capra hircus)",
"goat (capra hircus) (capra hircus)",
"capra aegagrus hircus (capra hircus)",
"capra hircus (capra aegagrus hircus)"
] | [
"wild goat (capra aegagrus)",
"capra",
"capra aegagrus (capra hircus aegagrus)",
"capra hircus aegagrus (capra aegagrus)",
"capra sp.",
"capraita",
"capra aegagrus cretica (capra hircus cretica)",
"capra hircus cretica (capra aegagrus cretica)",
"capneidae",
"capra cretica (capra hircus cretica)"
... | Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', answer the user's query. |
What is the biomedical concept corresponding to 'bovine'? | [
"bovine (bos taurus)",
"bos bovis (bos taurus)",
"cow (bos taurus) (bos taurus)",
"domestic cattle (bos taurus)",
"domestic cow (bos taurus)",
"bos taurus (bos primigenius taurus)",
"bos primigenius taurus (bos taurus)",
"ox (bos taurus) (bos taurus)",
"dairy cow (bos taurus)"
] | [
"cattle (bos)",
"bos (cattle)",
"bovidae",
"bos taurus indicus (bos indicus)",
"boveria",
"bos sp.",
"bos indicus (bos primigenius indicus)",
"bos primigenius indicus (bos indicus)",
"bos taurus x bos indicus (bos indicus x bos taurus)",
"beefalo (bos taurus x bison bison)"
] | Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', answer the user's query. |
What is the biomedical concept corresponding to 'goat'? | [
"domestic goat (capra hircus)",
"goats (capra hircus)",
"goat (capra hircus) (capra hircus)",
"capra aegagrus hircus (capra hircus)",
"capra hircus (capra aegagrus hircus)"
] | [
"wild goat (capra aegagrus)",
"capra",
"capra aegagrus (capra hircus aegagrus)",
"capra hircus aegagrus (capra aegagrus)",
"capra sp.",
"capraita",
"capra aegagrus cretica (capra hircus cretica)",
"capra hircus cretica (capra aegagrus cretica)",
"capneidae",
"capra cretica (capra hircus cretica)"
... | Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"mus musculus musculus (eastern european house mouse)",
"eastern european house mouse (mus musculus musculus)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'Results
Induction of osteoclasts from CD16- peripheral blood monocytes
To identify the monocyte subset that differentiates into osteoclasts, we examined osteoclast formation from CD16+ and CD16- human peripheral blood monocytes.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'We therefore examined the involvement of αvβ3 in RANKL + M-CSF-induced osteoclastogenesis in human CD16- monocytes using siRNA targeting the integrin-β3 subunit.', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)"
] | [
"clientister",
"theraps",
"personidae",
"proxys",
"perna",
"genus",
"aides",
"pero",
"inquisitor",
"plasmids"
] | Given the context 'Interestingly, integrin-β3 knockdown did not alter the NFATc1 mRNA level (Figure 7), suggesting that signal transduction mediated by integrin β3 does not affect the expression of NFATc1.
Detection of CD16+ and CD16- macrophages in synovium of RA patients
RA synovial macrophages are derived from peripheral blood monocytes, and their recruitment into the synovium is facilitated by various adhesion molecules and chemokines [24].', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"macrobiotus sapiens",
"primate (primates)",
"hominoidea (apes (hominoidea))",
"hominidae (great apes)",
"ape (hominoidea) (hominoidea)",
"kingdom",
"apes (hominoidea) (hominoidea)",
"homininae (homo/pan/gorilla group)"
] | Given the context 'Discussion
Human peripheral blood monocytes are a heterogeneous population, and they are divided into two subsets based on the expression of CD16.', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"house mouse (mus musculus)",
"mus musculus (house mouse)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mice (mus sp.) (mus sp.)",
"eastern european house mouse (mus musculus musculus)",
"mus musculus musculus (eastern european house mouse)",
"western european house mouse (mus musculus domesticus)",
"mus sp. ... | Given the context 'It was recently reported that bone marrow macrophages of integrin-β3-deficient mice could not differentiate into mature osteoclasts in vitro, suggesting that αvβ3 is involved not only in activation, but also in differentiation, of osteoclasts in mice [26,27].', answer the user's query. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.