text
stringlengths 7
4.92M
|
|---|
Kankaraš
Kankaraš (Montenegrin, ) is a Montenegrin surname found mostly in Montenegro. Its bearers are Orthodox Christian. There is an old Kankaraš brotherhood () of the Голија (Црна Гора) tribe near Nikšić (in northwestern Montenegro). A part of the Kankaraši settled Plovdiv, Bulgaria and changed their surname to Černogorski ("Montenegrin"). At least seven individuals with the surname died in the Holocaust in Croatia.
It may refer to:
Gorica Kankaraš, best Serbian female weightlifter 58 kg, 71 kg and 84 kg.
Miodrag Kankaraš, former mayor of Tivat, Montenegro, and current general consul of Montenegro in Serbia.
Sreten Kankaraš, owner of Grand Travel Agency in Montenegro, and Aikido trainer.
Anto Kankaraš, Serbian mercenary. Also known as the Publisher of Posavina
Petar Kankaraš, Liberal politician and lawyer from Podgorica.
Milivoje Kankaraš (d. 28 August 2000), Serbian local politician killed in Marovac, Serbia in 2000 during the Insurgency in the Preševo Valley. He and his wife were abducted and shot by five Albanians.
Duka Kankaraš ( 1855), Montenegrin serdar, from Golija. Served Danilo I, Prince of Montenegro.
References
Category:Montenegrin-language surnames
Category:Serbian-language surnames
|
The inside story of this virtual world
"Second Life was just unfundable," says the man who dreamed up this virtual world. Funny how things change when you give people the ability to fly. Now everyone, including businesses of all sizes, wants a piece.
Second Life is a place where anyone can have just that. It is a richly detailed virtual world where anything a computer programmer can imagine can exist: There are minutely detailed replicas of Rockefeller Center and human-size raccoons; sex and sadism and spiritual retreats; conference calls and a currency exchange. Almost all of it is created by the people who pay to dwell in it. Linden Lab, the San Francisco company that created and owns Second Life, acts as a sort of laissez-faire government. It makes money primarily by selling property, of which it can conjure an infinite amount.
Second Life seems like an overnight sensation--it drew almost a million new residents in the last two months of 2006, doubling its population. In fact, it began in 1999, when Philip Rosedale quit his job as chief technology officer at RealNetworks to realize his lifelong dream of building a virtual-reality environment. Most people he knew thought he was quixotic and certain to fail. He almost did. No wonder the 38-year-old Rosedale describes the recent onslaught of attention as "almost surreal."
What's real is that Second Life is a haven for entrepreneurs, with thousands of businesses selling things ranging from clothes to office buildings to body parts. Business is conducted in Linden dollars, but those can be cashed for cold, hard credit card credits. The in-world economy is now clipping along at $10 million--those are U.S. dollars--a month. Big companies are popping up, too, experimenting with what might be a look at tomorrow's three-dimensional Web.
I was interested in virtual reality in general from when I was a kid. I was making electronics and programming computers from fifth, sixth grade really seriously. I was really into technology. I was pretty good with my hands and still am. We have a machine shop here and I just like making things. But I always thought the best place to invent would be inside the computer, if we could just get in there.
I started a company when I was 17 doing database business systems. I put in little computer systems for car dealerships and an architecture firm, did things like that. My little company put me through college. [Rosedale majored in physics at the University of California at San Diego.]
After college, I moved to the Bay Area and I moved my office right next to these four guys who were building one of the early Internet service providers. They gave me a line over the ceiling, a big Internet connection. This was 1994. I said, Man, you could use the Internet to hook together a lot of computers. You could simulate a world and then we could all go in there.
But then I said, This is a nonstarter right now because for this to be interesting it has to be sexy, it has to be fun, it has to be fast, it has to be within human response times. It has to be like a video game. And in the mid-'90s you couldn't do 3-D on a PC.
I got interested in video compression. I said, I bet I could write an algorithm that would compress video well enough to look at people's faces over those little cameras and do live video. So I built this thing called FreeVue, me and another guy, one of my buddies from physics. You could download it for free on the Internet. You could have six video windows open on the screen at the same time.
Rob Glaser [CEO of RealNetworks] saw it and came to talk to us in late 1996. He convinced us he had a great company, a great idea. I decided that while the networking and graphics for virtual reality matured, I would go be one of the early people at RealNetworks. There were a lot of amazingly smart people there and they were going to give me one hell of an engineering management experience.
I felt that what I was going to build someday, Second Life, was going to be extremely complex from a systems and software standpoint. I needed some experience working with other people and learning how you get people to work together and work on a really big system. I figured I would get to see all that at Real. And I did.
In mid-1999, I came back to San Francisco and I started the office in Hayes Valley, on Linden Alley. That's where we got the name of the company. I hired one guy, Andrew Meadows, who is still here.
We were steadfast in the belief that what we were creating was a complex emergent system driven by an economy and the contributions of a lot of people, just like the Internet but in 3-D and live--you were really there. The other thing was this idea that it ought to be a creative space where people can be entrepreneurial if they want to.
We always believed that such a place, such a platform, would be something that you could reasonably charge money for. If it provided the opportunity for other people to make money, you could reasonably charge some fraction of that.
Second Life was just unfundable. It was just the dumbest idea ever. Mitch Kapor [the founder of Lotus Development] was the only person who got it. Mitch invested in 2001 after I had invested about a million dollars of my own money. I think some of the early angel investors were largely investing in me. They thought I seemed to be a capable, balanced, good-engineering-background entrepreneur, so I could figure out something.
But we could convince absolutely no one that what we were doing made any sense. People said the technology can't possibly be made to work smoothly because there are too many problems with building a simulation combined with broadband, combined with streaming, combined with rendering, talking to many computers at once, the whole idea is just completely impossible.
The second thing they said was, This is not for ordinary people. Even if it is compelling, there will only be a few crazy people that want to do it. And then you guys will be dead.
Oh, and user-created content had never been a fundable idea. Now, everybody's doing it. But in the beginning the idea that random people were going to build a three-dimensional world was just impossible for people to understand. A lot of applications, and all 3-D applications, were top-down designs, where some master designer built all the content and you just wandered around in it. And we were saying, You [the world's residents] are going to build everything. You are going to build these walls. And everybody was like, That's terribly stupid. Nobody got it.
There were six very quiet years. It wasn't discouraging the first couple of years because we were just having fun. When we got to be 20, 25 employees it got pretty stressful. What we didn't really think about was if the content alone is what compels other people to come and join, then you have a pure word-of-mouth exponential growth model, and that means you are going to have to wait a long time for the plane to take off.
It was discouraging as we grew and we started to make some progress, to the point where residents were making stuff. And the investors would still just say, You have got to turn this thing into some sort of video game. It needs to have a purpose. They wanted us to make it like something that had come before it so that they could value it.
When we couldn't grow it as quickly as it needed to, we had one round of layoffs. There were 31 of us and 11 of us left. That was in late 2003, when we pretty well thought we were dead.
And then we did one discontinuous thing: We recognized that there was a core of people who were really starting to want to build the content and invest in it and really value it. And we said, What you have in Second Life is real and it is yours. It doesn't belong to us. We have no claim to it. Whatever you do with Second Life is your own intellectual property. You can claim copyright on it. You can make money.
We said the same thing about land: Land is yours to own and resell. We had been reading Hernando De Soto's The Mystery of Capital and Jane Jacobs and all these books about innovation and ownership and why great places are great places. And we said, Let's just make this a real world. Let's let it have a real economy and let's make property have real value. There was a lot of buzz around that. The investors could see this thing starting to go. In early 2004 we got a couple million bucks more.
I think I felt like we were going to make it maybe in early 2005. I felt like the fundamental network economics of buying and selling stuff was irreversible.
Our approach to engineering was this: Tell everybody in an e-mail every week what you are doing, then make some progress of some kind and tell everybody in an e-mail how you did it. That was our organizational scheme. We said, Everybody is smart here. Identify what you are going to do today and get it done.
That evolved over time into the work system that we have today. We have this huge database of stuff to do. You choose your own work from it. So groups are formed more organically. I am pretty critical of traditional business styles. The biggest way you avoid that is you continue to make everybody entrepreneurial, which is easy to say--everybody says garbage like that in big companies. But the way you really are entrepreneurial is that you have to set your own strategic direction. That's what entrepreneurs do. You have to take risks and you have to expect to be held accountable.
We have this thing we built called the Love Machine. The Love Machine allows anyone who works here as a Linden employee to send anyone else a brief note that says "Thank you for doing this for me." There is a little webpage where you can go to send an e-mail, and then you get a little e-mail that says "Love From Philip" in the subject and it's got text in it. Now, you think, what's the big deal about that? Well, all of that stuff goes into a database. Your review carries that. Everybody is sending love to each other. It creates a positive collaborative environment.
Most businesspeople communicate in a mostly negative way. If people are encouraged to be entrepreneurs and take risks, they can also become combative and competitive. You have to balance that. So we built the Love Machine for balance. We joke that some day we will be more famous for the Love Machine than for Second Life.
We use a lot of the ideas from The Wisdom of Crowds. We vote internally on tasks. And when you get something done you can say, "Oh, I got 17 votes on this." And again, you use that as part of your review.
We also use anonymous spot surveys for a lot of stuff. So I send out surveys saying, like, "Should we get rid of me as CEO?" Or I send out several options: "We should get a new CEO: now; when we have 200 people; when we have 500 people; never."
There were some nevers. I think people didn't figure I was good for a thousand-person company. I actually think I am, but I'd be fine not doing it, either.
We don't even have a concept of budgeting here, really. For example, we don't have a travel budget. If you travel you have to send an e-mail to everybody that says how much you spent and why it was worth it.
As an entrepreneur in high school, I thought starting a company was about a process where you do all these official things to create a company. I was so proud of my business license. I hung it on the wall. Now I've realized that a company is a culture and a model and a business surrounding an idea or ideas.
People are starting to do business meetings in Second Life. When I looked at that originally, I was like, Why would anybody do a business meeting or a conference call in a virtual world? What a dumb idea. Actually, it is not. You are more likely to speak the truth to me in Second Life than you are in a real business meeting.
An enormous amount of intellectual energy is going to move into this world, and some of what we are doing in the real world will therefore be displaced. You can imagine New York City being kind of like a museum. Still an incredibly cool place to go, but with no one working in those towers because work, creative work, where you are engaging with other people face-to-face, you are going to do in a virtual world. It's going to leave these cities [gestures toward downtown San Francisco] and move into digital worlds. It is easier to do things there.
|
Endothelin receptor antagonist
An endothelin receptor antagonist (ERA) is a drug that blocks endothelin receptors.
Three main kinds of ERAs exist:
selective ETA receptor antagonists (sitaxentan, ambrisentan, atrasentan, BQ-123, zibotentan), which affect endothelin A receptors.
dual antagonists (bosentan, macitentan, tezosentan), which affect both endothelin A and B receptors.
selective ETB receptor antagonists (BQ-788 and A192621) which affect endothelin B receptors are used in research but have not yet reached the clinical trial stage.
Sitaxentan, ambrisentan and bosentan are mainly used for the treatment of pulmonary arterial hypertension, while atrasentan is an experimental anti-cancer drug.
Edonentan is an endothelin receptor antagonist drug.
References
|
Q:
pigpio: PWM range for quadcopter ESC(electronic speed controller) command
Good day,
I am currently working on a quadcopter project and am currently using the pigpio library for the PWM used to command the ESC's of the quadcopter motors.
Will increasing the range of the values used let say (0-40000) from (0-255), will there be a noticable improvement with the fineness or precision of the response of the motors?
I am currently using the default range of 0-255 and a frequency of 400Hz.
int gpioSetPWMrange(unsigned user_gpio, unsigned range);
from: http://abyz.me.uk/rpi/pigpio/cif.html#gpioSetPWMrange
A:
No, changing the range will make no difference to the underlying number of steps between off and fully on.
The following table shows the permitted PWM frequencies at each sample rate.
Hertz
1: 40000 20000 10000 8000 5000 4000 2500 2000 1600
1250 1000 800 500 400 250 200 100 50
2: 20000 10000 5000 4000 2500 2000 1250 1000 800
625 500 400 250 200 125 100 50 25
4: 10000 5000 2500 2000 1250 1000 625 500 400
313 250 200 125 100 63 50 25 13
sample
rate
(us) 5: 8000 4000 2000 1600 1000 800 500 400 320
250 200 160 100 80 50 40 20 10
8: 5000 2500 1250 1000 625 500 313 250 200
156 125 100 63 50 31 25 13 6
10: 4000 2000 1000 800 500 400 250 200 160
125 100 80 50 40 25 20 10 5
So for a sample rate of 5 µs the permitted frequencies are
8000, 4000, 2000, 1600, 1000, 800, 500, 400, 320, 250, 200,
160, 100, 80, 50, 40, 20, and 10 Hz.
The number of steps between off and fully on depends on both
the sampling rate and the frequency and is given by the following
formula
steps = 1000000 / (sample rate * frequency)
For example a sample rate of 5 µs and frequency 1600 Hz has
1000000 / (5 * 1600) = 125 steps
For a sample rate of 5 µs and frequency of 400 Hz
1000000 / (5 * 400) = 500 steps
You can use any range which is convenient for your application, perhaps 0-100 if percents make sense, 0-360 if it is an angle.
However, whatever range (0-X) you use, behind the scenes it will automatically be scaled to (0-steps).
|
TORONTO, ONTARIO--(Marketwired - April 6, 2017) - Constellation Software Inc. (TSX:CSU) announced today that Fitch Ratings has upgraded the long-term issuer default rating of the Company to 'BBB' from 'BBB-', with a Stable Rating Outlook. Fitch's assigned rating and outlook for the Company does not reflect any credit risk from the Total Specific Solutions (TSS) entities, other than obligations related to the TSS minority owner's put options.
Fitch has also assigned individual ratings to the Company's unsecured subordinated floating rate debentures, Series 1, and revolving credit facility as follows:
|
Glory hole anal - have
Manchmal hockt nur eine Frau dahinter, die mehrere Männer gleichzeitig mit Mund und Händen stimuliert. Nov 23, Views: Möglicherweise unterliegen die Inhalte jeweils zusätzlichen Bedingungen. Don't forget to protect your eyes! Vast and ambitious, comic and tragic, the novel also serves as a version of the I Ching , meaning it can be used as an oracle. Embed this video to your site with this code: It is about AIDS, meth, porn, fake biographies, street outreach, the study of Arabic verb forms, Polish transgender modernists, obsession, and future life forms. Some features of toradora hentai page will not work correctly. Season 3 Game of Thrones: There are no critic reviews yet for Hot Anal Gloryhole Best of brazzers. Meine Bücher Hilfe Redtube babysitter Buchsuche. Anal fucked gloryhole ho. Season 2 Rick and Morty:
|
Effect of liposomal encapsulation of cis-platinum diamminodichloride in the treatment of Ehrlich ascites carcinoma.
cis-Platinum diamminodichloride (II) encapsulated in neutral liposomes has been used to enhance the activity of the drug on Ehrlich ascites carcinoma in mice. Both in vitro and in vivo experiments have revealed that better regression in tumor growth and cure, could be achieved with a lower dose, having apparently no toxic effect, by liposomal encapsulation of the drug.
|
[Oxidative stress and susceptibility of periodontal disease].
To investigate the relationship between dietary antioxidant status and susceptibility of periodontal disease in humans. Fifty patients with moderate-to-sever periodontal disease and 50 subjects without periodontal disease were enrolled in this study. Food frequency questionnaire and 72-hour diet recall were conducted to study the dietary pattern and antioxidant nutrients intake in patients and healthy subjects. Nutritional status including vitamins, mineral substance, and antioxidant enzymes in these 2 groups were analyzed in serum and saliva samples by liquid chromatography-mass spectrometry (LC-MS). SPSS 19.0 software package was used for paired t test. Compared with the control group, the chronic periodontal group had lower levels of potatoes, aquatic product, milk, soy, fresh vegetables, fruit and vitamin supplements intake(P<0.05). Through food components analysis we found that the intake of vitamin A, C, B2, E, calcium, magnesium, copper, selenium was significantly lower in the chronic periodontal disease group than that in the control group (P<0.05). Biochemical analysis demonstrated that antioxidant nutrient levels including antioxidant enzyme SOD in serum and saliva together with magnesium, calcium, manganese, zinc in saliva were significantly lower in disease periodontal group than in the control group (P<0.05). Oxidative stress plays an essential role in the occurrence and development of periodontal disease. The antioxidant nutrients may help to protect paradentium. Supported by Research Fund from Shanghai Municipal Health Bureau (20114103).
|
Released November 29/18 (Bandcamp)
Traditional metal fans will be pleased to hear this debut EP from Brooklyn, New York's female-fronted Ritualizer. The lengthy title track opens proceedings with a speedy riff outta the 80's accented by some tasty guitar leads, before going through some twists and turns that harken back to the first two Mercyful Fate opuses. PJ Berlinghof's vocals acrobatically maneuver throughout the various changes, mixing clean, screech and deranged vox adeptly.
'Haunted' follows with another NWOBHM headbanger of a riff, Berlinghof again nailing the vocals, especially during the crazed mid-section. 'Night Terrors' closes things out, a more commercial track that could best be described as being similar to something off of Dio's Holy Diver. Catchy as all hell, it would fit nicely on Ozzy's Boneyard and the like. Kudos to this young outfit for being able to deliver something so professional and effective its first attempt at bat. Impressive.
[7.5]
|
Thursday, September 16, 2010
No children love me - frightening Peter Pan, pathetic Captain Hook
I’ve never seen Peter Pan on stage. Not sure if I’ve ever seen the Disney movie, either. I’ve picked up bits and pieces – Peter and Wendy fly around on wires, and I knew that the audience had to clap its hands to save the poisoned Tinker Bell. I guess I had assumed that the scene was cutesy, or insipid. Maybe most of the time it is. Not in the play I read, though. Not so much. Nana, by the way, is the Darling children’s nanny, and also, in a bit of Surrealism, a dog:
PETER She says – she says she thinks she could get well again if children believed in fairies! (He rises and throws out his arms he knows not to whom, perhaps to the boys and girls of whom he is not one) Do you believe in fairies? Say quick that you believe! If you believe, clap your hands! (4.275-81)
So far, so insipid, although, as usual, there is something odd in that stage direction. What happens?
(Many clap, some don’t, a few hiss. Then perhaps there is a rush of Nanas to the nurseries to see what on earth is happening. But Tink is saved) Oh, thank you, thank you, thank you! And now to rescue Wendy!
(Tink is already as merry and impudent as a grig [grasshopper], with not a thought for those who have saved her. Peter ascends his tree as if he were shot up it. What he is feeling is ‘Hook or me this time!’ He is frightfully happy) (4.281-7)
A few hiss! Tinker Bell is heartless, but is a fairy, so perhaps we excuse her. What Barrie deftly avoids saying here, is that it is not just the inhuman fairy who has not a thought for her saviors, but Peter Pan, too. He is not one of the boys and girls. He’s not human, either.
The Peter Pan of the play is cruel – a bully, frankly. His interest in other people can be intense but is fleeting. He plays a game until he tires of it, and then drops it for the next one. You still wanted to play the other one? Too bad. And for Peter Pan, everything is a game. The story of the play, taken this way, is actually the chronicle of the specific moment when Peter tires of the game of “Pirates.” “Hook or me this time!” The next visitors will get to see Peter fight Fu Manchu or Darth Vader or whatever has taken his fancy. He’s tired of pirates.
Poor Captain Hook. Hook is an amusing blend of boy’s book cliché and anxious Everyman, “[a] man of indomitable courage, the only thing at which he flinches is the sight of his own blood, which is thick and of unusual color.” If Wendy reminds us of one side of growing up, sex and motherhood, Hook is the walking memento mori. To grow up is to die. Is Hook a tragic figure, or a heroic one? Well, mock-tragic, mock-heroic, just as he begins Act 5 with a mock-Shakespearean soliloquy (“No little children love me” and so on). His end, mock-sublime:
Lifting a blunderbuss he strikes forlornly not at the boy but at the barrel, which is hurled across the deck. Peter remains sitting in the air still playing upon his pipes. At this sight the great heart of Hook breaks. That not wholly unheroic figure climbs the bulwarks murmuring ‘Floreat Etona,’ and prostrates himself into the water, where the crocodile is waiting for him open-mouthed. Hook knows the purpose of this yawning cavity, but after what he has gone through he enters it like one greeting a friend. (end of 5.1)
Oh, yes, Hook was an Eton lad. And Peter, larky Peter?
The curtain rises to show Peter a very Napoleon on his ship. It must not rise again lest we see him on the poop in Hook’s hat and cigars, and with a small iron claw.
9 comments:
Fascinating. I've never read the play, but I've seen a couple of different movie versions, and I remember thoroughly disliking Peter at times. I wondered if it was just my grouchy grown-up spirit that kept wanting to tell Peter to "grow up, already" but maybe Peter is written not just as a child, but as an obnoxious, annoying child.
You're right, Peter Pan is a bully. I always found the sheepdog nanny a bit discomfiting too - always this big, solid presence lurking uspeakingly in the background - it seemed menacing rather than reassuring. And then that Mary Poppins - far, far more sinister than that saccharine Julie Andrews film made out (as much as I loved it.)
Ugh - I feel chilled to the bone. Will have to read a nice adult crime novel or something....
I think there was a film done (not Disney) which tried to capture the bully/nastiness of Peter and the tragic side of Captain Hook...cannot for the life of me remember the title. But maybe I've invented this?
I've been thinking about reading Peter Pan (the novel) again. I'm curious to see what I think of it now. I've seen several movies and one play version, and I feel that none of them captured that sense of wrongness that even as a kid I felt threading through the story. I read the book when I was 12 I think - should be a very different experience this time round.
I actually don't think Peter is especially, or maybe I want to say inherently, obnoxious or bullying. In fact, he is, as Captain Hook calls him, a "wonderful boy."
But he's a ten year old boy with no constraints, no adults, and nearly unlimited power. Barrie finds the idea gleefully fun yet terrifying. Me, too. Peter Pan's island of boys is kin to William Golding's.
I agree, The Baker's Daughter - kiddie lit is full of sinsister elements. A fantasy like Mary Poppins is marvelous, but also not quite right. My guess is that children find it satisfying to see rules broken, but also to see order restored, like in The Cat in the Hat (speaking of a bit sinsiter).
I'd be interested in hearing about the novel. Interested in reading ot, too, someday.
The story is rich enough that lots of variations would work - Hook's point of view, certainly. Has there been a girl's version? Toss out the pirates and Indians and replace them with - well, whatever the girl who won't grow up wants.
"With all reverence for the author of that masterpiece I should say he had a wonderful and tender insight into the child mind and knew nothing whatever about boys. To make only one criticism on that particular work, can you imagine a lot of British boys, or boys of any country that one knows of, who would stay contentedly playing children's games in an underground cave when there were wolves and pirates and Red Indians to be had for the asking on the other side of the trap door?"
The form-master laughed. "You evidently think that the 'Boy who would not grow up' must have been written by a 'grown-up who could never have been a boy.' Perhaps that is the meaning of the 'Never- never Land.'"
A contemporary sidelight on Peter Pan- snd J.M. Barrie- from The Unbearable Bassington by Saki
Thanks, Roger, for that excerpt. My one defense of Barrie here is that in the scene with the Lost Boys playing around underground, playing house, they're under the malignant and \ or civilizing influence of Wendy. Barrie describes them doing more boyish things, but only in one of those unstageable stage directions!
I wonder if I when I acted in this in high school we had a simplified stage version -- because I don't remember those stage notes! It does sound very much like the novel (which I recently finished) in tone, though.
Although I loved reading the novel when I was in junior high, I hadn't recalled Peter Pan being so mean as he was on this reread -- I do have to agree on that.
Contact Me
WutheringExpectations@gmail.com
I too could now say to myself: Be no longer a Chaos, but a World, or even Worldkin. Produce! Produce! Were it but the pitifullest infinitesimal fraction of a Product, produce it in God's name! 'Tis the utmost thou hast in thee; out with it then. Up, up! Whatsoever thy hand findeth to do, do it with thy whole might. Work while it is called To-day, for the Night cometh wherein no man can work.
|
Acceleration Programs
Startup
Most common reasons for startup failures
Huge disruptions made by corporations are a thing of the past. Today the most innovative and fastest growing ideas are developed by a common effort of small organisation, startups. as a common effort of just a few people who form small organisations - Startups. Nintey percent of the startups fail within 5 years but if they can survive they can raise capital and grow fast.
Why startups fail
New companies are the future of innovative products.
No Market Need
42 %
42 Complete
Ran Out of Cash
29 %
29 Complete
Not the Right Team
23 %
23 Complete
Get Outcompeted
19 %
19 Complete
Pricing/Cost Issues
18 %
18 Complete
Need/Lack Business Model
18 %
18 Complete
Poor Product
17 %
17 Complete
Poor Marketing
14 %
14 Complete
Ignore Customers
14 %
14 Complete
Lose Focus
13 %
13 Complete
Disharmony on Team/Investors
13 %
13 Complete
Pivot gone bad
10 %
10 Complete
No Financing/Investor Interest
8 %
8 Complete
Legal Challenges
8 %
8 Complete
Don't Use Network/Advisors
8 %
8 Complete
Dedicated services for
Corporations and VCs
Scouting
We help Corporates and VCs in the scouting and implementation processes.
Incubation
We organize incubation programs for early stage projects.
Acceleration
We prepare programs aimed at implementing startups’ products to Corporations.
Negotiations
We help prepare and negotiate termsheets and investment agreements.
Workshops and Trainings
We perform workshops and trainings programs connected with investments and implementations of startups’ products at Corporations.
Experts
We provide experts from a wide range of fields: from business through engineering to biotech and industrial solutions.
Want to work with startups?
Are you a corporation, a governmental body or local authority representative and you want to organise an acceleration program?
Acceleration Programs
Our offer
We help to design acceleration programs. We create the frameworks, procedures for cooperation between large corporations and startups, individual acceleration plans as well as scouting and selection procedures. If you are representing a corporation that would like to start it’s own acceleration program or is not happy with current cooperation with startups, get in touch with us for a 360 diagnosis and recommendation of company needs and help in organization.
If you would like to learn how to carry out acceleration program, as a part of cooperation we include observer status in our Poland Prize by Adventures acceleration program.
Below you can find more details about our current programs.
Poland Prize
Acceleration program
You have a solution for industry? Interested in finding a customer among the biggest companies in Poland and some of the biggest in Europe?
Get a €50k equity-free grant to support implementation and additional €12k in expert services to help you get established and adjust your solution to fit customer’s need.
Soon we are starting our roadtrips through CEE, Israel and Kazachstan to find the best startups.
Biotech path
with Olimp Laboratories
Together with Olimp Laboratories, one of the biggest supplements and OTC drugs producers in Europe, we are looking for early stage ideas, scientist wanting to commercialize their research and biotech passionates wanting to develop projects that will transform the industry.
We are looking for: drugs, supplements, cosmetics, veterinary projects, wearables and IoT solutions related to health of people and animals as well as life science projects.
KRKroad
Municipal Acceleration Program
KRKroad Acceleration program was supported by Krakow City Hall dedicated to early stage projects from Ukraine. Partners included Orange and Olimp Labs. Over 100 application in one edition from Ukraine as result of our roadtrip and scouting activities.
Pitch
Currently we are looking for
Micro Venture
Smart money
We are investing private money and involvement of our experts to support projects at an early stage which can be implemented or launched with our corporate partners. The proceeds can be used to complete initial trials, prototype design and MVP.
We are interested mostly in B2B and industry related solutions as well as game dev. However we will be happy to discuss any great opportunity investment.
Warsaw Office
Registered Office
Ad Ventures Sp. z o.o.ul. Ślusarska 9/22330-710 Kraków
KRS: 0000365904NIP: 6762429644REGON: 121355910
Ad Ventures sp. z o.o. entered in the register of entrepreneurs of the National Court Register kept by the District Court for Kraków-Śródmieście, XI Commercial Division of the National Court Register under number 0000365904, with the share capital of 5000 PLN paid up in full.
|
WASHINGTON -- Rick Santorum, the former Pennsylvania senator who has suddenly become Mitt Romney's top challenger for the Republican presidential nomination, raised a provocative question about Romney's Mormon faith in a 2007 newspaper column:
Would the potential attraction to Mormonism by simply having a Mormon in the White House threaten traditional Christianity by leading more Americans to a church that some Christians believe misleadingly calls itself Christian, is an active missionary church, and a dangerous cult?
His next paragraph began: "Assume for the sake of argument that there are valid considerations."
The column was Santorum's response to Romney's famous "Faith in America" address, in which the former Massachusetts governor tried to reassure evangelical Christians and other religious voters that he shared their values. Santorum's ultimate verdict on Romney was more or less positive: "He should be a viable choice for voters whose faith matters to them," Santorum wrote.
But throughout the piece, Santorum drew distinctions between Mormonism and Christianity that others have avoided lest they seem overly inflammatory in a political context.
For instance, Santorum wrote of Romney's speech, "He tried to address the questions by discussing Jesus, suggesting that the specific theological tenets of Mormonism are not in any important respect different from those of traditional Christianity. I disagree."
Romney was the highest-ranking lay leader of the Church of Jesus Christ of Latter-Day Saints in Boston. And skepticism if not fear of his deep Mormon faith is widely considered to be a significant and ongoing problem for him among evangelical voters in particular.
A top Romney adviser recently told The Huffington Post's Howard Fineman that "the Mormon factor" is "just a fact of life that we know we have to deal with."
Santorum's come-from-way-behind showing in the Iowa caucuses on Tuesday could be attributed in no small part to the fact that several prominent state preachers suddenly endorsed him when all the other "anybody but Romney" candidates had crashed and burned, one after the other.
About 60 percent of Iowa's GOP caucus-goers self-identify as evangelical, and according to CNN entrance polling suggets that Santorum got 34 percent of their votes, compared to 14 percent for Romney.
The undercurrent of anti-Mormon concern has only occasionally risen to the surface of the political discourse. One notable exception came in October, when a prominent Texas pastor who introduced Texas Gov. Rick Perry at the Values Voters Summit called Mormonism a "cult."
In an October interview on Fox News, Santorum was asked if he thinks Mormonism is a cult, and he replied, "No, I don't." He added, "I'm not an expert on Mormonism. All I know is that every Mormon I know is a good and decent person, has great moral values and, by and large, with the exception of Harry Reid, by and large, pretty consistent in the values that I share and that things I want to see happen to this country. And that's what he should be judged on."
Santorum has made his fierce adherence to conservative Roman Catholic "family values" a keystone of his campaign, most recently saying he believes states should have the right to outlaw birth control and sodomy without the interference of the Supreme Court and that gay marriage could doom the United States.
In his 2007 column, Santorum made it clear he thinks matters of faith are fair game. He quoted Romney as saying that "a person should not be rejected ... because of his faith." Then he wrote, "His supporters say it is akin to rejecting a Barack Obama because he is black. But Obama was born black; Romney is a Mormon because he accepts the beliefs of the Mormon faith. This permits us, therefore, to make inferences about his judgment and character, good or bad."
|
Borthwick-Jackson is just 18 and was making his first Premier League start, along with Varela, while McNair is far from Manchester United standard and Dutchman Blind – though the senior option – is not a career centre-half.
It was hardly surprising that they looked vulnerable in a 2-1 defeat to Bournemouth that heaps yet more pressure on Louis van Gaal.
;When you see a back four like that, you almost have to fancy your chances,; said Murray.
;It;s a very different United line-up to what we are used to over the years. So as soon as we have seen that, and obviously on the back of the confidence of last week – and they had a very difficult game in Europe this (buy cheap fifa coins) week – with all the factors, we really fancied ourselves.;
|
Dževdet Mustagrudić
Dževdet Mustagrudić - Deta (Podgorica, Kingdom of Yugoslavia, 1923. - Pazarić, Independent State of Croatia, 1944.) was footballer and member of Yugoslav partisans Podgorica named one street after him in June 8, 2017.
Biography
He started playing at 15 years old in 1937 for GSK Balšić Podgorica. With capitulation of Yugoslavia, he and his family moved to Sarajevo in 1941. He started playing for Đerzelez which competed in Croatian First League. He was best player for Đerzelez at that time. In season 1943 he scored 26 goals. He was scheduled to travel to Zagreb, capital of Independent State of Croatia, a fascist puppet state of Germany, and sign for HŠK Građanski, but he instead chose to enter League of Communist Youth of Yugoslavia. He escaped Sarajevo in September 1944, where he joined partisans on mountain Igman. He died some 7 days later, in Pazarić, nearby Sarajevo, after attacking one German bunker.
Prior to his killing in action by Germans, it was planned that he should get transferred to Yugoslav partisans base in Italy, where Hajduk was stationed as well, so that he can join the club.
References
Category:1923 births
Category:1944 deaths
Category:Yugoslav Partisans members
Category:People from Podgorica
Category:People from Sarajevo
Category:Montenegrin people
|
Receive the latest new-england updates in your inbox
‘No Confidence’ Petition Against Superintendent who Banned Dances
The petition filed Monday with SAU16 has 55 signatures of residents in the Exeter Regional Cooperative School District, calling for a vote of "no confidence" in Superintendent Michael Morgan. (Published Tuesday, Jan. 12, 2016)
Some parents in a New Hampshire school district are trying to get the superintendent removed from office, saying that his decision to cancel school dances was the last straw.
The petition filed Monday with SAU16 has 55 signatures of residents in the Exeter Regional Cooperative School District, calling for a vote of "no confidence" in Superintendent Michael Morgan.
This comes less than a month after Morgan canceled all High School dances except the prom due to "inappropriate student behavior" like grinding on the dance floor. In several media interviews Morgan referred to the sex assault case at St. Paul's Prep as the tipping point for his decision.
Many who signed the petition tell NECN they feel the comment was out of line and an unfair comparison, but nobody was available Tuesday for an on-camera interview. However, Exeter High senior Anastasia Boisvert was more than willing to express her frustration.
"It sucks, I liked going to dances, I never did anything wrong," Boisvert said.
So, she says she and her friends support the citizens petition.
"I want to sign this thing, I have to go register, because I am 18," Boisvert said.
Superintendent Morgan declined an interview Tuesday, but clarified his comments in a letter sent home to parents last month saying, "I was not making any references about 'student rape' at EHS dances nor comparing our students with those individuals who were involved in that St. Paul's School Case."
There is a public hearing on the citizens petition Tuesday at 6 p.m. at the high school.
|
Q:
Shorthand syntax for message-attributes in the send-message command in aws-cli for sqs
When trying to send a message using AWS CLI for SQS, I cannot get the shorthand syntax for the --message-attributes parameter to work.
Specifying a json file works fine, and the reference doesn't show an example for the shorthand option.
Here is the reference for this command which specifies the shorthand I'm trying to use but I can't get it to work: http://docs.aws.amazon.com/cli/latest/reference/sqs/send-message.html
Here's the command I've tried:
aws sqs send-message \
--queue-url https://sqs.us-east-1.amazonaws.com/0000000000/aa_queue_name \
--message-body "message body goes here" \
--message-attributes firstAttribute={DataType=String,StringValue="hello world"},secondAttribute={DataType=String,StringValue="goodbye world"}
I keep getting error messages:
Parameter validation failed: Invalid type for parameter
MessageAttributes.contentType, value: StringValue=Snapshot, type:
, valid types:
Anyone ever managed sending attributes for message using the shorthand?
A:
Currently, the documentation of the short-hand syntax for the --message-attributes option is incorrect and the short-hand syntax does not work.
Instead, you can use the JSON file (as you mentioned). You can also use the inline JSON:
aws sqs send-message
--queue-url https://sqs.us-east-1.amazonaws.com/0000000000/aa_queue_name
--message-body "message body goes here"
--message-attributes '{ "firstAttribute":{ "DataType":"String","StringValue":"hello world" }, "secondAttribute":{ "DataType":"String","StringValue":"goodbye world"} }'
|
I love doggy style for awhile with my big cocked bf as I reach back and play with his nice balls....he likes to switch for me on top for my perky nipples to tease his nose and lips....my arched back lets him spank me as we see ourselves in the mirrors around us. He's expert at pussy eating and I cum often as he really gets his tongue in me....get that little man in the boat! My hot young babe coworker wants to join us for a threesome....I might let it happen as long as she doesn't ride him after sucking his cock.
|
Acute effect of streptozotocin induced diabetes on bar pressing for food reward in albino rats.
The operant behaviour in streptozotocin (45 mg or 65 mg/kg) treated rats was studied using albino rats of either sex. Animals were trained daily for 15 days in an operant chamber (Takei & Co.) to press the bar for getting the reward in the form of 45 mg food pellet following 18 hr of food deprivation. After initial training under continuous reinforcement schedule (CRF), animals were trained under FR2 and FR4 schedules, in which after every second (FR2) or every fourth bar press (FR4) rat received the pellet. The results indicate that the bar pressing for food reward is not altered after induction of experimental diabetes with streptozotocin. It is suggested that insulin lack or hyperglycaemia in this condition fails to influence higher centres associated with regulation of motivated behaviour.
|
Archives December (3) November (10) October (17) September (2) August (9) June (7) May (12) April (22) March (19) February (18) January (18) December (24) November (25) October (28) September (33) August (36) July (43) June (33) May (38) April (46) March (41) February (45) January (39) December (53) November (45) October (48) September (36) August (33) July (10) June (45) May (39) April (34) March (35) February (41) January (41) December (46) November (41) October (40) September (45) August (31) July (50) June (47) May (41) April (37) March (39) February (42) January (40) December (46) November (41) October (44) September (46) August (36) July (38) June (41) May (45) April (42) March (42) February (34) January (33) December (42) November (36) October (41) September (37) August (34) July (18) June (16) May (29) April (44) March (36) February (23) January (40) December (45) November (45) October (41) September (27) August (17) July (12) June (35) May (50) April (49) March (53) February (66) January (54) December (33) November (36) October (42) September (44) August (56) July (59) June (31) May (15)
|
1. Field of the Invention
The present invention relates to a hexagonal ferrite suitably used as a permanent magnet material, such as a motor for an automobile, and particularly relates to a magnet material containing a hexagonal magnetoplumbite ferrite, and a process for producing the same.
2. Description of the Background
As an oxide permanent magnet material, a strontium (Sr) ferrite and a barium (Ba) ferrite, which are of a magnetoplumbite (M type) hexagonal structure, are mainly used, and they are produced as a sintered magnet and a bonded magnet.
Among the various characteristics of a magnet, residual magnetic flux density (Br) and intrinsic coercive force (HcJ) are particularly important.
Br is determined by the density of the magnet, the degree of orientation of the magnet, and the saturation magnetization (4.pi.Is) determined by the crystal structure.
Br is expressed by the following equation: EQU Br=4.pi.Is.times.(degree of orientation).times.(density)
The Sr ferrite and the Ba ferrite of M type has a 4.pi.Is value of about 4.65 kG. The density and the degree of orientation each is about 98% at most in the sintered magnet, which provides the highest values. Therefore, Br of these magnets is limited to about 4.46 kG at most, and it has been practically impossible to provide a high Br value of 4.5 kG or more.
The present inventors previously discovered that the addition of appropriate amounts of La and Zn in an M type ferrite raises the 4.pi.Is value thereof by about 200 G at most, and a Br value of 4.5 kG or more can be obtained, as described in U.S. patent application Ser. No. 08/672,848, now U.S. Pat. No. 5,846,449. In this case, however, since the anisotropic magnetic field (H.sub.A), which will be described herein below, is decreased, it is difficult to obtain a Br value of 4.5 kG or more and an HcJ of 3.5 kOe or more at the same time.
HcJ is in proportion to the product (H.sub.A .times.fc) of the anisotropic magnetic field (H.sub.A (=2K.sub.1 /Is)) and a single magnetic domain grain fraction (fc), in which K.sub.1 represents a crystal magnetic anisotropy constant, which is determined by the crystal structure as similar to Is. The M type Ba ferrite has K.sub.1 of 3.3.times.10.sup.6 erg/cm.sup.3, and the M type Sr ferrite has K.sub.1 of 3.5.times.10.sup.6 erg/cm.sup.3. It has been known that the M type Sr ferrite has the largest K.sub.1 value, but it has been difficult to further raise the K.sub.1 value.
On the other hand, in the case where ferrite particles are in a single magnetic domain condition, the maximum HcJ is expected because the magnetization must be rotated against the anisotropic magnetic field to reverse the magnetization. In order to make ferrite grains into single magnetic domain grains, the size of the ferrite particles must be smaller than the following critical diameter (dc) as expressed by the following equation: EQU dc=2(k.multidot.Tc.multidot.K.sub.1 /a).sup.1/2 /Is.sup.2
wherein k represents the Boltzman constant, Tc represents a Curie temperature, and a represents a distance between iron ions. For M type Sr ferrite, since dc is about 1 .mu.m, in order to produce a sintered magnet it is necessary that the crystal grain size of the sintered magnet be controlled to 1.mu.m or less. While it has been difficult to realize such a fine crystal grain and the high density and the high degree of orientation to provide a high Br at the same time, the present inventors previously proposed a new production process to demonstrate that superior characteristics that cannot be found in the art are obtained, as described in Japanese Patent Application Kokai No. 6-53064. In this process, however, the HcJ value becomes 4.0 kOe when the Br value is 4.4 kG, and therefore it has remained difficult to obtain a high HcJ of 4.5 kOe or more with maintaining a high Br of 4.4 kG or more at the same time.
In order to control crystal grain size of a sintered body to 1 .mu.m or less, it is necessary to make the powder size in the molding step 0.5 .mu.m or less considering the growth of the grains in the sintering step. The use of such fine particles causes a decrease in productivity due to increased molding time and increased crack generation on molding. Thus, it has remained difficult to realize high characteristics and high productivity at the same time.
It is known that the addition of Al.sub.2 O.sub.3 and Cr.sub.2 O.sub.3 is effective to obtain a high HcJ value. Notably, Al.sup.3+ and Cr.sup.3+ lead to an increased H.sub.A and suppress the grain growth by substituting for Fe.sup.3+ having an upward spin in the M type structure, so that a high HcJ value of 4.5 kOe or more is obtained. However, when the Is value is reduced, the Br value is considerably reduced since the sintered density is reduced. As a result, the composition exhibiting a maximum HcJ of 4.5 kOe can only provide a Br value of 4.2 kG.
A sintered magnet of the conventional anisotropic M type ferrite has a temperature dependency of HcJ of about +13 Oe/.degree. C. and a relatively high temperature coefficient of about from +0.3 to +0.5%/.degree. C., which sometimes bring about great reduction in HcJ on the low temperature side and thus demagnetization. In order to prevent such demagnetization, the HcJ value at room temperature must be a large value of about 5 kOe, and therefore it is substantially impossible to obtain a high Br value at the same time. Powder of an isotropic M type ferrite has a temperature dependency of HcJ of at least about +8 Oe/.degree. C., although it is superior to the anisotropic sintered magnet, and a temperature coefficient of +0.15%/.degree. C. Thus, it has remained difficult to further improve the temperature characteristics. A ferrite magnet is excellent in environmental resistance and is not expensive, hence, it is frequently used in a motor in various parts of an automobile. Since an automobile may be used under severe conditions including intense cold and heat, the motor is required to stably function under such severe conditions. However, a conventional ferrite magnet exhibits considerable deterioration in coercive force under low temperature conditions, as described above.
Even though ferrite magnets afford such characteristics, ferrite magnets having low squareness (Hk/HcJ) in the demagnetization curve exhibit low (BH)max and a deteriorated change with time.
Thus, a need exists for a magnet having a high degree of orientation, which is obtained by a production process using an aqueous solvent. This would afford advantages in productivity, and moreover, would not cause environmental contamination, as when organic solvents are used, whereby use of equipment for preventing contamination could be avoided.
|
Q:
Android. Иногда PendingIntent = null и наступает FATAL EXCEPTION, как проверить?
Был такой код в IntentServices
@Override
public void onDestroy() {
super.onDestroy();
try {
pi.send(MyActivityTwo.STATUS_STOP);
//} catch (InterruptedException e) {
//e.printStackTrace();
} catch (PendingIntent.CanceledException e) {
e.printStackTrace();
}
Log.i(LOG_TAG, "In onDestroy");
}
в pi иногда приходил null и приложение ломалось в строке pi.send(MyActivityTwo.STATUS_START);, тогда я решил делать проверку, но теперь оно ломается в строке if (!pi.equals(null)){
@Override
public void onDestroy() {
super.onDestroy();
try {
if (!pi.equals(null)){
pi.send(MyActivityTwo.STATUS_STOP);
}
//} catch (InterruptedException e) {
//e.printStackTrace();
} catch (PendingIntent.CanceledException e) {
e.printStackTrace();
}
Log.i(LOG_TAG, "In onDestroy");
}
как это исправить, мне нужно чтоб когда pi был равен нулю, то ничего не происходило?
A:
Думается мне, что на null нужно сравнивать оператором == (!=), а не методом equals().
Если pi = null, то для него не может быть вызван метод equals(), так как отсутствует объект для вызова метода и вы получите исключение NullPointerExteption
Соответственно:
try {
if (pi != null){
pi.send(MyActivityTwo.STATUS_STOP);
}
} catch (PendingIntent.CanceledException e) {
e.printStackTrace();
}
|
1. Introduction {#s0005}
===============
Mstn is a member of the transforming growth factor beta (TGF-β) superfamily and it plays an essential role in the negative regulation of skeletal muscle mass. Animals either lacking Mstn or treated with substances that block Mstn activity exhibit significant muscle hypertrophy. By contrast, Mstn overexpression or its systemic administration has been implicated in several forms of muscle loss, including severe cachexia [@bib1], [@bib2]. Recent evidence suggests that Mstn and Activin A (another TGF-β superfamily member, shared the same receptor with Mstn to inhibit growth of muscle mass) might contribute to cancer cachexia [@bib3], [@bib4], [@bib5]. Moreover, the inactivation of Mstn by treatment with an activin receptor type IIB (ActRIIB) antagonist or with an antibody directed against Mstn ablates the symptoms of cancer cachexia in tumor-bearing mice [@bib6], [@bib7]. Therefore, Mstn appears to be critical for the pathophysiology of muscle loss during cancer progression, although the functional importance of Mstn in regulating the survival and growth of cancer cells remains obscure.
It has been shown that Mstn plays a crucial role in the regulation of lipid metabolism and energy homeostasis, where Mstn^--/--^ mice exhibit suppressed body fat accumulation [@bib8]. Furthermore, Burgess et al. observed that Mstn^--/--^ mice were protected from the side effects of consuming high-fat diets, where the mice displayed reduced weight gain and intramuscular fat deposits [@bib9]. Mstn^--/--^ mice also exhibited a significant increase in energy expenditure compared with wild-type mice, which was calculated by measuring the food intake, body composition, and rates of oxygen consumption [@bib10]. Using mouse embryonic fibroblasts isolated from Mstn-deficient and wild-type embryos, it was demonstrated that a group of Mstn KO mice exhibited significantly increased levels of genes and proteins involved with energy expenditure under specialized adipogenic conditions, thereby suggesting a possible role of Mstn in the control of energy expenditure in addition to an effect on muscle mass.
Cancer cells have altered metabolic requirements compared with their normal counterparts, which are characterized by an increase in glycolysis (the Warburg effect) as well as an increased rate of glucose transport, diminished pyruvate oxidation and increased lactic acid production, increased fatty acid turnover, and a reduced fatty acid oxidation rate [@bib11], [@bib12], [@bib13]. Cancer cells may be more sensitive to oxidative stress due to the high endogenous ROS levels produced by increased metabolic stress and proliferative capacity [@bib14], [@bib15]. The reliance on increased aerobic glycolysis and reduced mitochondrial respiration can reduce ROS production, which is thought to minimize oxidative stress during the phases of high biosynthetic activity and DNA replication [@bib16]. Furthermore, it has been reported that the increased fatty acid uptake as well as the concomitant rise in oxidative stress initiate apoptosis in cancer cells, possibly providing a selective mechanism for inducing tumor cell death [@bib17].
In the current study, we determined the expression of Mstn in various types of tumor tissues and cancer cells, and aimed to define the mechanisms of Mstn disruption-induced growth inhibition and apoptosis in HeLa cells by using the CRISPR/Cas9 system. Our results show that Mstn is expressed in different types of tumor tissues and cancer cells. In addition, we identify a mechanistic link between cancer metabolism and growth control, which can be useful for designing novel therapeutics to treat human cancer.
2. Materials and methods {#s0010}
========================
2.1. Materials {#s0015}
--------------
To estimate the expression of Mstn, gastric (n = 10), lung (n = 10), esophagus (n = 10) carcinoma tissues and their corresponding pericarcinous tissues (n = 10 each) were collected from Henan provincial the pathology department of the Affiliated Cancer Hospital, Zhengzhou University. This study was approved by the Research Ethics Committee of Henan provincial the Affiliated Cancer Hospital, Zhengzhou University. All these retrospective specimens were handled and made anonymous according to the ethical and legal standards. Written informed consent was obtained from all of the patients.
We obtained a CRISPR/Cas9 genome editing plasmid px330 from Addgene (42230); SYBR Premix Ex Taq (RR420A) and Trizol Reagent (D9108B) from TaKaRa Bio Inc; anti-BCL-2 antibody (\#2870), anti-BAX antibody (\#5023), anti-cleaved caspase-3 antibody (\#9664), anti-cleaved caspase-7 antibody (\#8438), anti-Mstn antibody (\#MAB788), and horseradish-peroxidase-conjugated donkey anti-mouse (715-035-150) and anti-rabbit IgG (711-035-152) antibodies from Jackson ImmunoResearch Laboratories; Genomic DNA Isolation Kit (SK8221) from Sangon Biotech, Shanghai; FITC Annexin V/Dead Cell Apoptosis Kit from Invitrogen (V13242); Caspase-Glo 3/7 Assay from Promega (G8090); JC-1 probe and anti-cytochrome c antibody (AC908) from Beyotime Institute of Biotechnology (China); BODIPY493/503 from ThermoFisher; Cellular total cholesterol and triglyceride extraction kits from Applygen (China); BCA protein assay kit from DingGuo (China); N-acetylcysteine (NAC), PEG-SOD, apocynin, rhodamine 123, MitoPY1, dihydroethidium (DHE), tetramethylrhodamine methyl ester perchlorate (TMRM), from Sigma-Aldrich; and a TdT-mediated dUTP nick-end labeling (TUNEL) staining kit and dichlorofluorescein diacetate (DCFH-DA) from YEASEN Biotechnology Company (Shanghai, China); Etomoxir (CAS No.: 124083-20-1) from MedChemExpress; \[9,10-^3^H(N)\]-Palmitic Acid was obtained from Perkin Elmer Life Sciences.
2.2. Cell culture {#s0020}
-----------------
Cells were grown in monolayers at 37 °C under 5% CO~2~ and maintained in Dulbecco\'s Modified Eagle\'s Medium (Gibco) containing 100 units/ml penicillin and 100 μg/ml streptomycin sulfate, which was supplemented with 10% fetal bovine serum (Gibco).
2.3. Production of Mstn-shRNA stably expressing cells {#s0025}
-----------------------------------------------------
The short hairpin RNA (shRNA) sequences targeting human *Mstn* were selected using BLOCK-iT™ RNAi Designer (Life Technologies, Carlsbad, CA), i.e., sh1: GGCAGAGCATTGATGTGAAGA; sh2: GCTCTGGAGAGTGTGAATTTG; and sh3: GGTCATGATCTTGCTGTAACC. The shRNA expression cassettes against specific genes were designed as follows: forward oligo: 5′-CCGG-21bp sense-CTCG AG-21bp antisense-TTTTTG-3′, reverse oligo: 5′-AATTCAAAAA-21bp sense-CTC GAG-21bp antisense-3′. The oligos containing selected shRNA sequences were flanked by sequences compatible with the sticky ends of *Eco*RI and *Age*I. Forward and reverse oligos were annealed and ligated into the pLKO.1 vector to produce a final plasmid that expressed the shRNA of interest. Lentiviral particles were then produced. Briefly, 4 × 10^6^ human HEK293T cells were plated on 10-cm dishes at 24 h before transfecting with 1 μg shRNA containing pLKO.1 vector, 0.75 μg psPAX2 (packaging plasmid), and 0.25 μg pMD2.G (envelope plasmid). Transfection used a ratio of three volumes FuGENE^®^ HD (μL) to one volume DNA (μg). The medium was changed after 16 h. Viral particles were collected at 48 h after transfection and used to infect human cancer cells (Huh7, HeLa, HepG2, and A549) and non-tumorigenic HEK293 cells. The infected cells were selected in culture medium containing puromycin for 2 weeks.
2.4. gRNA cloning method {#s0030}
------------------------
The genomic target sequence (5′-CTCATCAAACCTATGAAAGA-3′) of *Mstn* for the specificity of the Cas9 nuclease immediately precedes a 5′-NGG-3′ protospacer adjacent motif (PAM). Two partially complementary oligonucleotides (5′-CACCGTCATCAAACCTATGAAAGA-3′ and 5′-AAACTCTTTCATAGGTTTG ATGAC-3′) were synthesized, annealed, and ligated into pX330 after digestion using the *Bbs*I restriction enzyme. This plasmid (designated as the *Mstn* KO plasmid) contained two expression cassettes, hSpCas9 and the chimeric guide RNA, which could guide hSpCas9 to the genomic target site in *Mstn*.
2.5. Establishment of HeLa/Mstn KO cells {#s0035}
----------------------------------------
HeLa cells were seeded into a 60 mm dish at a density of 5 × 10^5^. The Mstn KO plasmid was transfected into cells with Lipofectamine 2000 (Invitrogen) according to the manufacturer\'s instructions. After 48 h, the cells were dissociated by trypsinization to obtain single cells. The cells were counted and serially diluted in culture medium to a final concentration of 0.5 cells per 100 μL in a 96-well plate, which was followed by an expansion period to establish a new clonal cell line. To identify the status of genome editing, PCR amplification was performed with the genomic DNA isolated from different clonal cell lines and primers specific for the target sequence, followed by DNA sequencing.
2.6. Immunoblotting analysis {#s0040}
----------------------------
Whole cell lysates were prepared with RIPA buffer supplemented with protease inhibitors (Roche). Protein samples were separated by SDS-PAGE and transferred to cellulose nitrate membranes (Whatman), after incubation in 5% nonfat milk for 1 h. The membrane was incubated with the primary antibody at 4 °C overnight and then incubated with the horseradish-peroxidase-conjugated secondary antibody for 1 h. The target proteins were detected using Luminata™ Crescendo Western HRP Substrate (Millipore). Each experiment was repeated at least three times using separate batches of cells.
2.7. Caspase 3/7 activity analysis {#s0045}
----------------------------------
The activities of caspases 3 and 7 were analyzed using the Caspase-Glo 3/7 Assay according to the manufacturer\'s instructions. The luminescent signals were detected using a Fluoroskan Ascent™ Microplate Fluorometer FL (Thermo Scientific). The results were calculated as representative examples based on three independent experiments.
2.8. Annexin V/PI Cell Apoptosis analysis {#s0050}
-----------------------------------------
Annexin V/PI (propidium iodide) staining was performed using an FITC Annexin V/Dead Cell Apoptosis Kit according to the manufacturer\'s instructions. Briefly, cells were grown in a 6-well plate for 24 h, washed with PBS, and digested with Trypsin-EDTA solution. Cells were then collected by centrifugation and washed twice with ice-cold PBS. After washing one more time with 1x annexin-binding buffer, the cells were incubated in 100 μL annexin-binding buffer containing 5 μL annexin V and 1 μL PI for 15 min in the dark. Flow cytometric analysis was performed to monitor the green fluorescence of the FITC-conjugated annexin V (488 nm) and the red fluorescence of DNA-bound PI (530 nm) using a BD AccuriC6 flow cytometer. All data were analyzed using FlowJo software.
Cells were grown on coverslips and co-stained with annexin V and PI. After washing with 1x annexin-binding buffer, cells were fixed, mounted, and the fluorescent signals were detected by confocal microscopy (Leica TCS SP5).
2.9. Tumor xenograft model and TUNEL assay {#s0055}
------------------------------------------
Experiments involving animals were performed in accordance with the rules approved by the State Council of the People\'s Republic of China for experimental animal care and use. Four-week-old female BALB/c nude (nu/nu) mice were injected in the flank regions with 4 × 10^6^ HeLa cells in 200 μL of medium. Tumor size and body weight measurements were initiated 7 days post-inoculation and they were recorded every 4 days. Tumor dimensions were measured with calipers and the volumes calculated using the following formula: length × width^2^ × 0.5. All mice were sacrificed 31 days after cell injection, and tumor tissues were collected and weighed.
Apoptotic cells in xenografts were identified by TUNEL staining using an In Situ Cell Death detection kit (TUNEL Apoptosis Detection Kit; YEASEN). The tumor tissue samples were treated according to the manufacturer\'s directions and examined using a fluorescent microscope. The TUNEL-positive cells were counted and the apoptosis index was calculated according to the following formula: (number of apoptotic cells/total number of nuclei) × 100%.
Four-week-old female BALB/c nude (nu/nu) mice were injected in the flank regions with 1 × 10^7^ HeLa/Mstn KO cells in 200 μL of medium (containing PBS or Mstn at a concentration of 300 ng/ml). Seven days after implantation, animals from PBS (n = 8) or Mstn (n = 8) groups were selected to receive direct intratumoral injection of PBS or Mstn at a concentration of 0.5 mg/kg/day. Tumor sizes and body weights of mice were recorded every 4 days. Tumor dimensions were measured with calipers and the volumes calculated using the following formula: length × width^2^ × 0.5. All mice were sacrificed 31 days after cell injection, and tumor tissues were collected and weighed.
2.10. Quantitative real-time PCR (Q-PCR) {#s0060}
----------------------------------------
Total RNA was extracted from cells with Trizol Reagent and reverse transcribed into cDNA with an oligo (dT) primer. Q-PCR was performed using an Eppendorf Mastercycler^®^ ep realplex system according to the manufacturer\'s protocol. All reactions were performed in triplicate and the relative amounts of mRNAs were calculated with the comparative CT method. The results obtained were representative of three independent experiments.
2.11. Measurement of ROS production {#s0065}
-----------------------------------
The intracellular generation of ROS was analyzed using DCFH-DA. The non-fluorescent ester penetrated into the cells and it was hydrolyzed to DCFH by cellular esterases. The probe was rapidly oxidized to yield the highly fluorescent compound, 2′7′-dichlorofluorescein (DCF), in the presence of cellular peroxidase and ROS such as hydrogen peroxide or fatty acid peroxides [@bib18]. Briefly, cells (1 × 10^6^) were cultured and loaded with 10 μM DCFH-DA for 30 min at 37 °C in the dark, and then washed three times with PBS. The fluorescence was measured within 1 h at an excitation wavelength of 488 nm and an emission wavelength of 525 nm.
DHE was used to assess superoxide as a marker of oxidative stress because the membrane-permeable DHE was oxidized by superoxide anions to form ethidium (ETH), which bound to DNA and produced the fluorescent ETH-DNA [@bib19]. Cells were incubated with 5 μM DHE for 30 min at 37 °C in the dark and then rinsed three times with PBS. Cells were visualized and counted within 1 h by fluorescence microscopy.
Mitochondria peroxy yellow 1 (MitoPY1) uses a triphenylphosphonium targeting group and a boronate-based molecular switch to selectively respond to the localized changes in mitochondrial hydrogen peroxide concentrations generated by oxidative stress conditions [@bib20]. Cells were incubated with 5 μM MitoPY1 at 37 °C for 30 min in the dark and then rinsed three times with PBS. Cells were visualized and counted within 1 h by fluorescence microscopy.
2.12. Cell proliferation assay {#s0070}
------------------------------
The cell viability was evaluated using the CCK8 assay according to the manufacturer\'s instructions. In brief, cells were seeded into 96-well plates with 1 × 10^4^ cells/well and incubated in the absence or presence of NAC, PEG-SOD, apocynin or etomoxir for specific time periods. Next, 10 μL of CCK8 was added to each well and the culture medium was incubated at 37 °C for 3 h. The absorbance was detected at 450 nm using a microplate reader (Awareness Technology Inc.).
2.13. Mitochondrial membrane potential assay {#s0075}
--------------------------------------------
Changes in the mitochondrial membrane potential were assessed by JC-1 staining according to the manufacturer\'s protocol. In brief, cells grown on coverslips were stained with JC-1 dye and then observed under a fluorescence microscope. Red fluorescence indicated JC-1 aggregates (excitation/emission = 540/605 nm) formed in normal cells with high Δψ~m~, whereas green fluorescence denoted JC-1 monomers (excitation/emission = 480/510 nm) in apoptotic or unhealthy cells with low Δψ~m~ [@bib21].
TMRM accumulates in hyperpolarized mitochondria and the fluorescence intensity correlates with Δψ~m~ [@bib22]. Cells were incubated with 20 nM TMRM for 30 min at 37 °C in the dark and then rinsed three times with PBS. Cells were visualized and counted within 1 h by fluorescence microscope.
Rhodamine 123 was used to evaluate changes in the mitochondrial membrane potential [@bib23]. Cells were incubated with 1 μM rhodamine 123 for 30 min at 37 °C in the dark and then rinsed three times with PBS. Cells were visualized and counted by fluorescence microscopy within 1 h.
2.14. Subcellular fractionation {#s0080}
-------------------------------
Subcellular fractionation was performed to determine the localization of Cyt-c. In brief, cells were harvested, washed, and homogenized in 500 μL of subcellular fractionation buffer \[250 mM sucrose, 20 mM HEPES (pH 7.4), 10 mM KCl, 1.5 mM MgCl~2~, 1 mM EGTA, 1 mM EDTA, 1 mM DTT, protease and phosphatase inhibitor cocktail\]. The lysates were centrifuged at 700*g* for 5 min at 4 °C to separate the nuclear fraction. Next, the supernatant containing the mitochondrial and cytoplasmic fractions was centrifuged again at 10,000*g* for 15 min at 4 °C. The resulting supernatant was used as the cytoplasmic fraction, and the pellet was washed three times with ice-cold PBS and used as the mitochondrial fraction.
2.15. Lipid droplets (LDs) staining {#s0085}
-----------------------------------
Cells were washed in PBS and fixed with 4% paraformaldehyde for 30 min. After washing with PBS, cells were incubated with 2 μg/ml Bodipy 493/503 (493 nm excitation/503 nm emission) in PBS for 30 min at 37 °C. Digital images were obtained with a fluorescence microscopy.
Cells were washed in PBS and fixed with 4% paraformaldehyde for 30 min. After washing with PBS, cells were stained with Oil Red O (Sigma) solution (Oil Red O saturated solution in isopropanol: water at 3:2) for 15 min. The cells were then washed with 70% alcohol for 5 s to remove background staining, rinsed in double-distilled Millipore water, counterstained with Harris hematoxylin (10 s), mounted, and observed under a light microscope. The diameters of the observed lipid droplets (LDs) were calculated by averaging multiple diameter measurements with Image J software. The LDs number was obtained by Image J analyze particles function (particle area less than 0.01 mm^2^ were excluded).
2.16. Measurement of fatty acid oxidation {#s0090}
-----------------------------------------
Fatty acid oxidation assays were carried out as described [@bib24]. In brief, cells were incubated with MEM Alpha medium containing 5 μCi/ml \[9,10-^3^H(N)\]- Palmitic Acid and 2% fatty acid free BSA overnight. After incubation, the medium was recovered and excess ^3^H-palmitate in the medium was removed by precipitating twice with an equal volume of 10% trichloroacetic acid. The supernatants were extracted by addition of 5 ml of methanol: chloroform (2:1) twice, and an aliquot of the aqueous phase was taken for counting the content of ^3^H~2~O with a liquid scintillation. The values were normalized to total cellular protein content, which were determined with a BCA protein assay kit (Bio-Rad).
2.17. Statistical analysis {#s0095}
--------------------------
In the quantitative analyses, data were obtained based on at least three independent experiments and they were expressed as the mean ± standard error of the mean. Statistical analysis was performed using the *t*-test or one-way analysis of variance (ANOVA). Significant differences were accepted at ^\*^*P* \< 0.05, ^\*\*^*P* \< 0.01, and ^\*\*\*^*P* \< 0.0001 versus the corresponding controls.
3. Results {#s0100}
==========
3.1. Expression of Mstn in gastric, lung, esophagus cancer and their pericarcinous tissues {#s0105}
------------------------------------------------------------------------------------------
Mstn plays an important role in the activation of muscle wasting during cancer cachexia [@bib7], [@bib25]. To clarify the function of Mstn in the development of cancer, the clinical expression of Mstn in patients with gastric, lung, esophagus cancer was analyzed. Here we collected gastric (n = 10), lung (n = 10), esophagus carcinoma tissues (n = 10) and their corresponding pericarcinous tissues (n = 10 each). An immunofluorescent staining analysis using anti-Mstn and DAPI were conducted. The results showed that, compared with pericarcinous tissues, the expression of Mstn in gastric, lung and esophageal cancers was significantly increased ([Fig. 1](#f0005){ref-type="fig"}). Moreover, compared with the cells that were not yet cancerous ([Fig. 1](#f0005){ref-type="fig"}A2, \*), the structure of gastric adenocarcinoma showed a more pronounced Mstn expression ([Fig. 1](#f0005){ref-type="fig"}A2, arrowhead). It is interesting to note that in all three cancers, a capsule like structure was found, which contained a large number of Mstn ([Figs. 1](#f0005){ref-type="fig"}A3, 1B5, 1C3, 1C4, 1C6). However, no positive signal was observed in the pericarcinous tissue ([Figs. 1](#f0005){ref-type="fig"}A1, [1](#f0005){ref-type="fig"}B1, [1](#f0005){ref-type="fig"}B2, [1](#f0005){ref-type="fig"}C1, [1](#f0005){ref-type="fig"}C2). These findings suggest that Mstn protein plays an important role in cancer progression.Fig. 1**The expression of Mstn was up-regulated in human gastric, lung and esophagus cancers**. (A) The expression pattern of Mstn in human gastric carcinoma (3--6) and corresponding pericarcinous tissues (1--2) was determined by immunofluorescent staining. The boxed region in the left image is enlarged on the right. The arrowhead indicates cancer cells, and the asterisk (\*) indicates the remaining normal cells that have not yet been cancerous. (B) The expression pattern of Mstn in human lung carcinoma (3--6) and corresponding pericarcinous tissues (1--2) was determined by immunofluorescent staining. (C) The expression pattern of Mstn in human esophagus carcinoma (3--6) and corresponding pericarcinous tissues (1--2) was determined by immunofluorescent staining. Scale bar, 100 µm.Fig. 1
3.2. Mstn expression in human cancer cells and its knockdown inhibited their proliferation {#s0110}
------------------------------------------------------------------------------------------
To investigate the function of Mstn in cachexia-inducing cancer cells, western blot analyses were performed in order to compare the Mstn expression levels in human cancer cells with those in non-tumorigenic HEK293 cells. As illustrated in [Fig. 2](#f0010){ref-type="fig"}A, human cancer cell lines from different tissue sources such as hepatocarcinoma (Huh-7), cervical cancer (HeLa), liver carcinoma (HepG2), and adenocarcinoma human alveolar basal epithelial (A549) cells had significantly higher Mstn expression levels than the non-tumorigenic HEK293 cells [@bib26], [@bib27]. β-actin was used as a loading control and we confirmed that a similar quantity of protein was loaded in each lane. The levels of both the full length and mature forms of Mstn were highest in HeLa cells ([Fig. 2](#f0010){ref-type="fig"}B). To examine whether Mstn affected cancer cell survival and growth, lentivirus-delivered shRNAs were used to stably knock down *Mstn*. All the Mstn-shRNAs transfected cells exhibited significant reductions in their *Mstn* mRNA levels compared with the control-shRNA cells ([Fig. 2](#f0010){ref-type="fig"}C). *Mstn* knockdown dramatically inhibited the proliferation of cancer cells compared with HEK293 cells ([Figs. 2](#f0010){ref-type="fig"}D--[2](#f0010){ref-type="fig"}H). These results indicated that lentivirus-mediated Mstn knockdown inhibited the growth of cancer cells, but it had little effect on the non-tumorigenic HEK293 cells. Among these cancer cells, HeLa had the highest full length and mature forms of the Mstn expression levels, so we selected this cell line for further characterization.Fig. 2**Expression of Mstn in human cancer and non-tumorigenic HEK293 cells, the Mstn knockdown inhibited growth of cancer cells**. (A) Immunoblot analyses of Mstn expression in human cancer (Huh7, HeLa, HepG2, and A549) and non-tumorigenic HEK293 cells. The antibodies used are indicated on the left. Each blot is representative of three independent experiments. (B) Semi-quantitative densitometric analyses of the full length Mstn and the mature Mstn shown in (A) using Image J software. The protein content was normalized against the corresponding β-actin level. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*\*\*^*P* \< 0.0001. (C) The mRNA levels of *Mstn* in shRNAs stably expressing cells were detected by Q-PCR. Values were normalized relative to the *β-Actin* mRNA levels. Data represent the mean ± standard error of the mean based on three independent experiments. ^\*^*P* \< 0.05, ^\*\*^*P* \< 0.01, one-way ANOVA. (D) Proliferation of control-shRNA or Mstn-shRNAs stably expressing Huh7 cells was determined using the CCK8 assay. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*\*\*^*P* \< 0.0001. (E) Proliferation of control-shRNA or Mstn-shRNAs stably expressing HeLa cells was determined using the CCK8 assay. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*^*P* \< 0.05, ^\*\*^*P* \< 0.01, ^\*\*\*^*P* \< 0.0001. (F) Proliferation of control-shRNA or Mstn-shRNAs stably expressing HepG2 cells was determined using the CCK8 assay. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*\*\*^*P* \< 0.0001. (G) Proliferation of control-shRNA or Mstn-shRNAs stably expressing HEK293 cells was determined using the CCK8 assay. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*^*P* \< 0.05. (H) Proliferation of control-shRNA or Mstn-shRNAs stably expressing A549 cells was determined using the CCK8 assay. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*\*\*^*P* \< 0.0001.Fig. 2
3.3. CRISPR/Cas9-mediated Mstn KO in HeLa cells {#s0115}
-----------------------------------------------
To further confirm the effects of Mstn disruption on cancer cell proliferation, CRISPR/Cas9 was used to knock out Mstn in HeLa cells. The pX330 plasmid expressing both hSpCas9 and a sgRNA targeting exon 2 of Mstn with a 5′-NGG-3′ PAM transfected in HeLa ([Fig. 3](#f0015){ref-type="fig"}A) and single cell clones were then grown up. The presence of Mstn mutations in genomic DNA was measured by DNA sequencing. Some of the clones (37%) had a nucleotide insertion/deletion near the PAM site ([Fig. 3](#f0015){ref-type="fig"}B). To assess the KO efficiency, the Mstn protein levels in different mutant clones were measured by immunoblotting (data not shown). We then selected a clone with sufficient Mstn KO. As shown in [Fig. 3](#f0015){ref-type="fig"}C, the levels of Mstn were greatly reduced in clone-9 compared with the control HeLa cells (pX330 empty plasmid). This KO was due to a four-nucleotide deletion that introduced a premature stop codon, which indicated an effective disruption ([Fig. S1](#s0170){ref-type="sec"}). To test whether off-target mutations occurred in clone-9, we first searched for nucleotide sequences in the human genome that were identical to the sgRNA but with up to three or four base pair (bp) mismatches. We predicted eight potential off-target candidate sites. These off-target sites comprising approximately 300 bp regions were then amplified and sequenced. No mutations were observed in these eight hypothetical off-target loci in clone-9 ([Fig. S2](#s0170){ref-type="sec"}). When cultured in the same conditions, the Mstn KO cells exhibited a marked decrease in their growth rate at specific time points and there were seven times more HeLa cells than KO cells on day 6 based on the number counts ([Fig. 3](#f0015){ref-type="fig"}D). Cell viability measured using the CCK8 assay also confirmed that the loss of Mstn hindered cancer cells\' growth ([Fig. 3](#f0015){ref-type="fig"}E).Fig. 3**Generation of HeLa/Mstn KO cells using CRISPR/Cas9**. (A) Schematic diagram of sgRNA targeting the human *Mstn* exon 2 locus. Protospacer sequences are colored grey. The PAM sequence is framed by a black box. (B) Sequencing of PCR amplification products from Mstn mutant clones confirmed the introduction of insertion-deletion polymorphisms (indels) in exon 2. (C) Immunoblot analysis of Mstn expression in HeLa and HeLa/Mstn KO cells. The antibodies used are indicated on the left. (D) Time-course analysis of viable cell numbers in HeLa and HeLa/Mstn KO cells. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*\*^*P* \< 0.01, ^\*\*\*^*P* \< 0.0001. (E) Proliferation of HeLa and HeLa/Mstn KO cells was determined using CCK8 assays. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*\*^*P* \< 0.01, ^\*\*\*^*P* \< 0.0001.Fig. 3
3.4. Mstn KO induced apoptosis in HeLa cells {#s0120}
--------------------------------------------
We also investigated the possibility that Mstn KO reduced growth of HeLa cells by increasing apoptosis. Apoptosis was analyzed using Annexin V-FITC and PI double staining by confocal microscopy and flow cytometry. The results showed that Mstn KO induced phosphatidylserine externalization to the outer leaflet of the plasma membrane. PI cannot permeate live cells and observations of PI positivity in the Mstn KO cells confirmed the presence of apoptosis ([Fig. 4](#f0020){ref-type="fig"}A). As shown in [Fig. 4](#f0020){ref-type="fig"}B, the percentage of apoptotic cells significantly increased in the Mstn KO group compared with that in the control group (42.82% vs. 0.098%) (*P* \< 0.0001). Q-PCR and western blot detected elevated Bax levels but also a reduction in the expression of Bcl-2 due to the Mstn KO ([Figs. 4](#f0020){ref-type="fig"}C, [4](#f0020){ref-type="fig"}D). Moreover, profound cleavage of caspase-3 and caspase-7 were also observed ([Fig. 4](#f0020){ref-type="fig"}E). We also found that the caspase activity was markedly enhanced in HeLa/Mstn KO cells using the Caspase-Glo 3/7 assay (*P* \< 0.01) ([Fig. 4](#f0020){ref-type="fig"}F). Furthermore, the lentivirus-mediated knockdown of Mstn in human cancer cells (Huh-7, HeLa, HepG2, and A549) increased the activities of caspase-3 and -7, but there were no significant increases in the activities of caspase-3 and -7 in the non-tumorigenic HEK293 cells with Mstn knockdown ([Fig. S3](#s0170){ref-type="sec"}).Fig. 4**Mstn KO promoted HeLa cell apoptosis**. (A) Cells were co-stained with Annexin V/PI and fluorescence was detected using a fluorescence microscope. Scale bar, 10 µm. Each image is representative of three independent experiments. (B) Cells were stained with Annexin V/PI and apoptosis was determined using flow cytometry. (C) The mRNA levels of *Bcl-2* and *Bax* were detected by Q-PCR. Values were normalized relative to the *β-Actin* mRNA levels. Data represent the mean ± standard error of the mean based on three independent experiments. ^\*^*P* \< 0.05, unpaired two-tailed *t*-test. (D) Immunoblot analysis was performed using the indicated antibodies. Semi- quantitative densitometric analyses of BCL-2 and BAX were performed using Image J. The protein content was normalized against the corresponding β-actin content. Data represent the mean ± standard error of the mean based on three independent experiments. ^\*^*P* \< 0.05, ^\*\*^*P* \< 0.01. (E) Immunoblot analysis was performed with the indicated antibodies. Semi- quantitative densitometric analysis of cleaved caspase-3 and caspase-7 was performed using Image J. The protein content was normalized against the corresponding β-actin content. Data represent the mean ± standard error of the mean based on three independent experiments. ^\*\*^*P* \< 0.01. (F) The activities of caspase 3 and 7 were analyzed using the Caspase-Glo 3/7 assay. Data represent the mean ± standard error of the mean based on three independent experiments. ^\*\*^*P* \< 0.01, unpaired two-tailed *t*-test. (G) Recombinant Mstn was expressed and purified as described previously [@bib28]. The purified recombinant Mstn (Lys193-Ser375) protein was visualized by coomassie blue staining. (H) HeLa cells were treated with PBS or Mstn at different concentrations (100, 300, 500, 700, 1000 ng/ml) for the indicated times. Proliferation of cells was determined using the CCK8 assay. Data represent the mean ± standard error of the mean based on three independent experiments. (I) HeLa/Mstn KO cells were treated with PBS or Mstn at different concentrations (100, 300, 500 ng/ml) for the indicated times. Proliferation of cells was determined using the CCK8 assay. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*\*\*^P \< 0.0001. (J) Cells were treated with culture media from normal HeLa cells for the indicated times. Proliferation of cells was determined using the CCK8 assay. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*\*\*^P \< 0.0001.Fig. 4
To assess whether these alterations can be reversed by addition of recombinant Mstn to the culture medium of Mstn KO cells, we purified recombinant Mstn protein [@bib28] ([Fig. 4](#f0020){ref-type="fig"}G) and verified the effect in HeLa and Mstn-deficient cells. As shown in [Fig. 4](#f0020){ref-type="fig"}H, we observed that prolonged exposure of Mstn caused significant viability loss of the HeLa cells in a dose-dependent manner. Nevertheless, the growth inhibition of HeLa/Mstn KO cells was reversed by addition of recombinant Mstn. On the dose, 300 ng/ml had achieved the best effect ([Fig. 4](#f0020){ref-type="fig"}I). In addition, adding culture media from normal HeLa cells also promoted HeLa/Mstn KO cell growth ([Fig. 4](#f0020){ref-type="fig"}J). The results suggest that the function of endogenous Mstn is indispensable for HeLa cell growth but exposure to exogenous Mstn at higher concentrations can be detrimental.
3.5. Mstn KO inhibited the tumor growth in the HeLa xenograft nude mice {#s0125}
-----------------------------------------------------------------------
We then determined whether the loss of Mstn induced HeLa cell apoptosis in a tumor xenograft model. The effect of Mstn KO on xenograft tumors was examined in immune-deficient nude mice. As shown in [Figs. 5](#f0025){ref-type="fig"}A and [5](#f0025){ref-type="fig"}B, tumor progression was more rapid in the HeLa group than those inoculated with HeLa/Mstn KO cells. We also found that the tumor sizes in the Mstn KO group were significantly smaller than those in the HeLa group after injection for 22 days ([Fig. 5](#f0025){ref-type="fig"}C). The tumor weights were substantial reductions in mice bearing Mstn KO cells ([Fig. 5](#f0025){ref-type="fig"}D). We then tested whether the reduced tumor size was due to apoptosis, as observed in the cultured cancer cells. Indeed, TUNEL-staining analysis detected a markedly increased number of apoptotic tumor cells in the Mstn KO group compared with the HeLa group (60% vs. 4%) ([Fig. 5](#f0025){ref-type="fig"}E). We next examined whether adding Mstn promoted HeLa/Mstn KO cells growth in xenograft tumor models. When treated with Mstn, the growth inhibition of Mstn KO cells was obviously attenuated ([Figs. 5](#f0025){ref-type="fig"}F, [5](#f0025){ref-type="fig"}G). Moreover, compared with the PBS group, the tumor weights in the Mstn treated group were significantly increased ([Fig. 5](#f0025){ref-type="fig"}H). These results demonstrate that the Mstn-deficiency can not only induce HeLa cell apoptosis *in vitro*, but also inhibits tumorigenesis *in vivo* in the xenograft tumor model.Fig. 5**Mstn KO inhibited growth of tumor xenograft in nude mice.** (A) Representative mice bearing tumors after 34 days post inoculation. Black arrowheads, inoculation sites. (B) Cells were injected into nude mice and four representative xenograft tumors in each group are shown. Scale bar, 1 cm. (C) Tumor sizes were measured on the days indicated and the tumor volumes were calculated. Data represent the mean ± standard error of the mean (n = 8 per group). ^\*^*P* \< 0.05, ^\*\*^*P* \< 0.01, ^\*\*\*^*P* \< 0.0001, one-way ANOVA. (D) Tumor weights are shown in the scatter plot. Data represent the mean ± standard error of the mean (n = 8 per group). ^\*\*\*^*P* \< 0.0001, unpaired two-tailed *t*-test. (E) Representative images of fluorescent TUNEL and DAPI staining of xenograft tumor sections. The boxed region in the image is enlarged below. Scale bar, 50 µm. The percentages of apoptotic cells in tumor xenografts were quantified and normalized versus the number of nuclei. At least 300 cells from each section were counted. Data represent the mean ± standard error of the mean. ^\*\*\*^*P* \< 0.0001, unpaired two-tailed *t*-test. (F) HeLa/Mstn KO cells were injected into nude mice and PBS or Mstn were injected intratumorally. Four representative xenograft tumors in each group with the treatment of PBS or Mstn were shown. Scale bar, 1 cm. (G) Tumor sizes were measured on the days indicated and the tumor volumes were calculated. Data represent the mean ± standard error of the mean (n = 8 per group). ^\*^P \< 0.05, ^\*\*\*^P \< 0.0001, one-way ANOVA. (H) Tumor weights are shown in the scatter plot. Data represent the mean ± standard error of the mean (n = 8 per group). ^\*^P \< 0.05, unpaired two-tailed *t*-test.Fig. 5
3.6. Mstn KO triggered mitochondria-dependent apoptosis in HeLa cells {#s0130}
---------------------------------------------------------------------
Mstn KO induced apparent changes in the morphology of mitochondria where they transformed from filamentous to dot-shaped ([Fig. 6](#f0030){ref-type="fig"}A). These dot-shaped mitochondria were also apparent in cells during apoptosis [@bib29] or under metabolic stress-induced cell death [@bib30]. To establish whether Mstn KO induces mitochondria- dependent apoptosis in HeLa cells, we measured the mitochondrial membrane potential using JC-1 dye staining. As shown in [Fig. 6](#f0030){ref-type="fig"}B, JC-1 aggregates accumulated in the mitochondrial membrane and emitted a strong red fluorescent signal in HeLa cells, thereby indicating no changes in the mitochondrial membrane potential. However, Mstn KO cells exhibited increased green fluorescence, which indicated the existence of monomeric JC-1 and depolarization of the mitochondrial membrane. Moreover, the significant decreases of fluorescence intensity due to TMRM ([Fig. 6](#f0030){ref-type="fig"}C) and rhodamine 123 ([Fig. 6](#f0030){ref-type="fig"}D) in the Mstn KO cells also reflected the loss of Δψ~m~. Following mitochondrial membrane depolarization, the redistribution of Cyt-c from mitochondria into the cytosol is a fundamental event during apoptosis, where Cyt-c activates caspases. Therefore, we investigated the cellular distribution of Cyt-c using immunostaining and subcellular fractionation assays. The presence of Cyt-c in the cytoplasm was confirmed by microscopy ([Fig. 6](#f0030){ref-type="fig"}E). Furthermore, subcellular fractionation and western blot analysis indicated that the levels of Cyt-c protein were significantly increased in the cytoplasmic fractions from Mstn KO cells compared with those from HeLa cells ([Fig. 6](#f0030){ref-type="fig"}F). In sum, these results demonstrate that mitochondria are involved in Mstn-deficiency induced HeLa cell apoptosis.Fig. 6**Mstn KO induced mitochondrial apoptosis in HeLa cells.** (A) Mstn KO altered the mitochondrial morphology in Hela cells. Cells were transiently transfected with mito-RFP for 24 h, fixed, and the mito-RFP signals were measured using confocal microscopy. Scale bar, 10 µm. Boxed region in the top image is enlarged below. Each image is representative of three independent experiments. (B) Cells were stained with JC-1 to measure the changes in the mitochondrial membrane potential and observed by fluorescence microscopy. Scale bar, 10 µm. Each image is representative of three independent experiments. (C) Representative fluorescence image of cells loaded with TMRM. Scale bar, 10 µm. Quantitative changes in the TMRM fluorescence intensity was analyzed by Image J. At least 300 cells were analyzed based on three independent experiments. Data represent the mean ± standard error of the mean. ^\*\*^*P* \< 0.01, unpaired two-tailed *t*-test. (D) Representative fluorescence image of cells loaded with rhodamine 123. Scale bar, 10 µm. Quantitative changes in the rhodamine 123 fluorescence intensity were analyzed by Image J. At least 300 cells were analyzed based on three independent experiments. Data represent the mean ± standard error of the mean. ^\*\*^*P* \< 0.01, unpaired two-tailed *t*-test. (E) Immunostaining of Cyt-c was observed by fluorescence microscopy. Scale bar, 10 µm. The percentage of cells that released Cyt-c into the cytoplasm was counted. At least 300 cells were analyzed based on three independent experiments. Data represent the mean ± standard error of the mean. ^\*\*\*^*P* \< 0.0001, unpaired two-tailed *t*-test. (F) The release of mitochondrial Cyt-c was estimated by examining the Cyt-c protein content of mitochondria and the extracted mitochondria-free cytoplasmic fraction by western blotting. Prohibitin (PHB) and β-actin antibodies were used as loading controls for the mitochondrial and cytoplasmic fractions, respectively. Results are representative of three independent experiments.Fig. 6
3.7. Mstn KO reduced the lipid content and activated fatty acid oxidation {#s0135}
-------------------------------------------------------------------------
Mstn inhibition leads to reduced body fat levels [@bib31]. To investigate whether Mstn could affect fatty acid metabolism in cultured cancer cells, we examined the intracellular triglyceride (TG) and lipid contents by BODIPY493/503 and Oil Red O staining. Using microscopy, we observed reductions in the intensity of LDs in the cytoplasm of Mstn KO cells ([Figs. 7](#f0035){ref-type="fig"}A, [7](#f0035){ref-type="fig"}B). LD diameter was decreased \~55% (*P* \< 0.0001) compared to HeLa cells, while a \~67% (*P* \< 0.0001) reduction in LD number ([Fig. 7](#f0035){ref-type="fig"}C). The total TG ([Fig. 7](#f0035){ref-type="fig"}D) and total cholesterol (TC) ([Fig. 7](#f0035){ref-type="fig"}E) contents were also lower compared with the control cells. We hypothesized that this could have been caused by reduced triglyceride synthesis or enhanced fatty acid oxidation. Subsequent Q-PCR analysis indicated the elevated expression of genes encoding enzymes involved with cholesterol synthesis (*Hmgcr*) ([Fig. 7](#f0035){ref-type="fig"}F) and fatty acid synthesis (*Fasn*) ([Fig. 7](#f0035){ref-type="fig"}G). However, the mRNA level of *Acc1*, another gene required for the biosynthesis of fatty acids, was not altered ([Fig. 7](#f0035){ref-type="fig"}H). Therefore, we considered that Mstn KO reduced the lipid contents due to increased energy expenditure. Consistent with this hypothesis, the mRNA levels of *Pgc1a* and *Pparg* were upregulated by several times, which are key transcriptional regulators of energy homeostasis, and there were corresponding increases in fatty acid oxidation ([Figs. 7](#f0035){ref-type="fig"}I, [7](#f0035){ref-type="fig"}J). Furthermore, the HADH, UCP2, and CPT1 enzymes are correlated with fatty acid oxidation. We found that the *Hadh*, *Ucp2*, and *Cpt1* mRNA expression levels were markedly increased in HeLa/Mstn KO cells ([Figs. 7](#f0035){ref-type="fig"}K--[7](#f0035){ref-type="fig"}M). To correlate the increase in mRNA expression of fatty acid oxidation genes caused by Mstn with changes in lipid metabolism, we determined the rate of fatty acid oxidation in HeLa and KO cells. The oxidation of exogenously administered 9,10-\[^3^H\]palmitate, measured by ^3^H~2~O production, increased 1.4-fold (*P* \< 0.05) in Mstn KO cells compared with control group ([Fig. 7](#f0035){ref-type="fig"}N). In addition, the rate of fatty acid oxidation was also significantly increased in the Mstn-shRNAs stably expressing HeLa cells ([Fig. 7](#f0035){ref-type="fig"}O). These results indicate that the expression levels of key enzymes are upregulated by Mstn-deficiency, thereby enhancing fatty acid oxidation.Fig. 7**Mstn KO reduced the lipid content and increased fatty acid oxidation.** (A) LDs in cells were stained with BODIPY 493/503. The boxed region in the top image is enlarged on the bottom. Each image is representative of three independent experiments. (B) Cells were fixed and stained with Oil Red O. Nuclei were counterstained with hematoxylin. Scale bar, 10 µm. The boxed region in the top image is enlarged on the bottom. Each image is representative of three independent experiments. (C) Plots of the average LD diameter (left) and LD number per cell (right) in Oil Red O images are shown. At least 40 cells were counted. Data represent the mean ± standard error of the mean. ^\*\*\*^*P* \< 0.0001, unpaired two-tailed *t*-test. (D) TG concentrations in cells were normalized versus the cellular protein content. Data represent the mean ± standard error of the mean based on three independent experiments. ^\*^*P* \< 0.05, unpaired two-tailed *t*-test. (E) TC concentrations in cells were normalized versus the cellular protein content. Data represent the mean ± standard error of the mean based on three independent experiments. ^\*\*^*P* \< 0.01, unpaired two-tailed *t*-test. (F--M) The mRNA levels of *Hmgcr*, *Fasn*, *Acc1*, *Pgc1a*, *Pparg*, *Hadh*, *Ucp2*, and *Cpt1* were examined by Q-PCR in HeLa and HeLa/Mstn KO cells. Values were normalized relative to the *β-Actin* mRNA levels. Data represent the mean ± standard error of the mean based on three independent experiments. NS, not significant, ^\*^*P* \< 0.05, ^\*\*^*P* \< 0.01, ^\*\*\*^*P* \< 0.0001; unpaired two-tailed *t*-test. (N) Fatty acid oxidation in cells was determined as release of ^3^H~2~O from labeled palmitate. Data represent the mean ± standard error of the mean based on three independent experiments. ^\*^*P* \< 0.05; unpaired two-tailed *t*-test. (O) Fatty acid oxidation in control-shRNA or Mstn-shRNAs stably expressing HeLa cells was determined as release of ^3^H~2~O from labeled palmitate. Data represent the mean ± standard error of the mean based on three independent experiments. ^\*^*P* \< 0.05; unpaired two-tailed *t*-test.Fig. 7
3.8. ROS generation involved in apoptosis of HeLa/Mstn KO cells {#s0140}
---------------------------------------------------------------
Tumor cells possess a high rate of glycolysis even in the presence of oxygen and fully functioning mitochondria. This process is known as the Warburg effect, it can protect cells from oxidative stress [@bib12], [@bib16], [@bib17], [@bib32]. Our results demonstrate that mitochondria are involved in the Mstn KO-induced apoptosis of HeLa cells and that the levels of fatty acid oxidation are increased. To test whether fatty acid oxidation leads to ROS generation in cancer cells, we added the intracellular ROS sensors DCFH-DA or DHE to cells. As indicated in [Figs. 8](#f0040){ref-type="fig"}A and [8](#f0040){ref-type="fig"}B, the generation of ROS was detected in Mstn KO cells by fluorescent microscopy (*P* \< 0.0001). Moreover, after adding mitoPY1 (a mitochondria-specific fluorescent probe for H~2~O~2~) to the cell suspension, the intensity of green fluorescence significantly increased in the Mstn KO cells compared with the control group ([Fig. 8](#f0040){ref-type="fig"}C). In addition, the increased ROS production was confirmed in human cancer cells (Huh-7, HeLa, HepG2, and A549) expressing Mstn-shRNAs, while the non-tumorigenic HEK293 cells with Mstn knockdown had raised ROS levels but the increases were not significant ([Fig. S4](#s0170){ref-type="sec"}). These results demonstrate that the loss of Mstn triggers ROS generation. Strikingly, ROS production was markedly blocked by NAC or PEG-SOD treatment, but not by the NADPH oxidase inhibitor apocynin ([Fig. 8](#f0040){ref-type="fig"}D), thereby suggesting that the mitochondria-derived ROS but not NADPH oxidase was responsible for the accelerated generation of cellular ROS in Mstn KO cells. The free radical scavenging properties of NAC or PEG-SOD can be exploited as antioxidants. Thus, as expected, compared with the vehicle control and apocynin treatment, Mstn KO-induced apoptosis was partially abolished by NAC or PEG-SOD treatment ([Figs. 8](#f0040){ref-type="fig"}E--[8](#f0040){ref-type="fig"}G).Fig. 8**ROS production in Mstn KO cells.** (A) Cells were treated with 10 μM DCFH-DA for 30 min and fluorescence was detected using a fluorescence microscope. Scale bar, 10 µm. Image J analysis was used for semi-quantification of the fluorescence intensity. At least 300 cells were analyzed based on three independent experiments. Data represent the mean ± standard error of the mean. ^\*\*\*^*P* \< 0.0001, unpaired two-tailed *t*-test. (B) Cells were treated with 5 μM DHE for 30 min and fluorescence was detected using a fluorescence microscope. Scale bar, 10 µm. Image J analysis was used for semi-quantification of the fluorescence intensity. At least 300 cells were analyzed based on three independent experiments. Data represent the mean ± standard error of the mean. ^\*\*\*^*P* \< 0.0001, unpaired two-tailed *t*-test. (C) Cells were treated with 5 μM MitoPY1 for 30 min and fluorescence was detected using a fluorescence microscope. Scale bar, 10 µm. Image J analysis was used for semi-quantification of the fluorescence intensity. At least 300 cells were analyzed based on three independent experiments. Data represent the mean ± standard error of the mean. ^\*\*\*^*P* \< 0.0001, unpaired two-tailed *t*-test. (D) ROS production was measured using DCFH-DA. HeLa and HeLa/Mstn KO cells were incubated in the absence or presence of 1 mM NAC, PEG-SOD (150 U/ml), or 100 μM apocynin overnight. The fluorescent intensities of DCF were examined using a fluorescent plate reader. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. NS, not significant, ^\*\*\*^*P* \< 0.0001. (E) Cell proliferation was analyzed using the CCK8 assay after incubation in the absence or presence of 300 μM NAC for the indicated time periods. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*^P \< 0.05, ^\*\*^P \< 0.01, ^\*\*\*^P \< 0.0001. (F) Cell proliferation was analyzed using the CCK8 assay after incubation in the absence or presence of PEG-SOD (150 U/ml) for the indicated time periods. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*^P \< 0.05, ^\*\*\*^P \< 0.0001. (G) Cell proliferation was analyzed using the CCK8 assay after incubation in the absence or presence of 100 μM apocynin for the indicated time periods. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. NS, not significant. (H) ROS production was measured using DCFH-DA. HeLa and HeLa/Mstn KO cells were incubated in the absence or presence of 20 μM etomoxir for 48 h. The fluorescent intensities of DCF were examined using a fluorescent plate reader. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. NS, not significant, ^\*\*\*^P \< 0.0001. (I) Cell proliferation was analyzed using the CCK8 assay after incubation in the absence or presence of 20 μM etomoxir for the indicated time periods. Data represent the mean ± standard error of the mean based on three independent experiments, which were analyzed by one-way ANOVA. ^\*^P \< 0.05, ^\*\*^P \< 0.01, ^\*\*\*^P \< 0.0001.Fig. 8
To explore whether ROS generation from enhanced fatty acid oxidation is the cause of Mstn KO cell apoptosis. Etomoxir, an inhibitor of carnitine palmi- toyltransferase 1 (CPT1) that blocks the rate-limiting step in fatty acid oxidation was used. First, the cytotoxic activity of etomoxir to HeLa cells was analyzed. Cells treated with 20 µm etomoxir, no significant reduction in cell viability was detected ([Fig. S5A](#s0170){ref-type="sec"}) and this concentration could significantly inhibit the rate of fatty acid oxidation ([Fig. S5B](#s0170){ref-type="sec"}). To confirm ROS generation was upstream or downstream of fatty acid oxidation in mitochondria, we evaluated the intracellular ROS level. As shown in [Fig. 8](#f0040){ref-type="fig"}H, intracellular ROS level in HeLa/Mstn KO cells was enhanced, whereas etomoxir significantly inhibited the increase of ROS generation. Furthermore, compared with the vehicle control treatment, the cell viability in Mstn KO cells was increased when fatty acid oxidation inhibited by etomoxir ([Fig. 8](#f0040){ref-type="fig"}I). In sum, ROS derived from enhanced fatty acid oxidation are involved in HeLa/Mstn KO cell apoptosis.
3.9. Model of Mstn KO induced ROS-mediated apoptosis in cancer cells {#s0145}
--------------------------------------------------------------------
In summary, our results indicated that Mstn deficiency induced apoptosis in cancer cells. Mstn KO enhanced the fatty acid oxidation and reduced the cellular TG and TC contents, which ultimately triggered ROS generation. The increased production of ROS caused changes in the morphology, function, and physiology of mitochondria. These changes were followed by the release of Cyt-c into the cytoplasm, thereby causing caspase activation, and finally leading to mitochondria- dependent apoptosis in cancer cells ([Fig. 9](#f0045){ref-type="fig"}).Fig. 9Model of Mstn KO induced ROS-mediated apoptosis in cancer cells.Fig. 9
4. Discussion {#s0150}
=============
Muscle loss and cachexia have been postulated to be key determinants of cancer-related death. Mstn is the negative regulator of muscle growth and a crucial player in the development of cancer cachexia [@bib7]. However, the roles of Mstn in cancer as well as in regulating the survival and growth of cancer cells remain obscure. In our study, the expression of Mstn in several types of tumor tissues was investigated, and consistent results had been confirmed. Immunofluorescent analysis of tissues from 10 gastric cancer patients，10 lung cancer patients and 10 esophagus cancer patients demonstrated that cancer cells showed significantly staining of Mstn when compared to their corresponding pericarcinous tissues with positive nuclear staining ([Fig. 1](#f0005){ref-type="fig"}). We also found a capsule like structure contained a large number of Mstn ([Figs. 1](#f0005){ref-type="fig"}A3, [1](#f0005){ref-type="fig"}B5, [1](#f0005){ref-type="fig"}C3, [1](#f0005){ref-type="fig"}C4, [1](#f0005){ref-type="fig"}C6), these packages of Mstn in the capsule may also be released. As shown in [Figs. 1](#f0005){ref-type="fig"}A4, [1](#f0005){ref-type="fig"}B3, [1](#f0005){ref-type="fig"}B4, [1](#f0005){ref-type="fig"}C3 and [1](#f0005){ref-type="fig"}C6, Mstn proteins were dispersed in cancer tissues, if these Mstn circulates in the blood will lead to cachexia. In addition, we demonstrated that Mstn was expressed at higher levels in different types of human cancer cells compared with non-tumorigenic HEK293 cells ([Fig. 2](#f0010){ref-type="fig"}). We propose that Mstn is a cancer-related factor synthesized by cancer cells and that it induces severe skeletal muscle wasting during cancer cachexia. This hypothesis is consistent with the appearance of Mstn in the secretome of the murine C26 colon cancer model [@bib33]. Furthermore, an early study detected the upregulation of Mstn signaling during the pathogenesis of muscle wasting in experimental cancer cachexia [@bib3]. Similarly, elevated serum Mstn levels are correlated with muscle mass loss in patients with liver cirrhosis [@bib34]. Thus, the inhibition of Mstn is a promising approach for treating cancer cachexia. Indeed, recent studies have shown that a therapeutic strategy based on blocking the Mstn pathway fully reverses skeletal muscle loss and dramatically prolongs the survival of tumor-bearing animals. However, the tumor growth rate and weight in the animals were not affected when Mstn pathway abolished by sActRIIB [@bib7]. We consider the failure to decrease tumor growth rate and weight in mice, possibly because previous researchers utilized the intramuscular injection of ActRIIB\'s soluble extracellular domain, which inhibits receptor binding and the biological activity of Mstn, while the expression and function of Mstn within tumor were not affected. Therefore, inhibiting the synthesis and secretion of Mstn might be the most fundamental strategy for overcoming Mstn-related muscle wasting during cancer cachexia.
In the current study, we first found that lentivirus-mediated Mstn knockdown inhibited the growth and promoted the apoptosis of cancer cells (Huh7, HeLa, HepG2, and A549), but it had little effect on non-tumorigenic HEK293 cells ([Fig. 2](#f0010){ref-type="fig"} and [S3](#s0170){ref-type="sec"}). To further confirm the correlation between Mstn level and cancer cell apoptosis, CRISPR/Cas9 was used to directly knock out Mstn in HeLa cells (which had the highest Mstn level). Our results demonstrated that Mstn KO not only induced apoptosis in HeLa cells *in vitro* ([Fig. 4](#f0020){ref-type="fig"}), but also inhibited tumorigenesis *in vivo* in a xenograft tumor model ([Fig. 5](#f0025){ref-type="fig"}), thereby suggesting that Mstn is a cancer-related protein that induces muscle loss and associates with tumor progression. Consequently, Mstn may represent an attractive drug target. In addition, our results showed that when Mstn was knocked out, there were changes in the mitochondrial morphology and function, which led to mitochondria-dependent apoptosis ([Fig. 6](#f0030){ref-type="fig"}). This effect may also be relevant to the severe health problems and low survival rate caused by Mstn KO in animals [@bib35], [@bib36]. To the best of our knowledge, the present findings are the first experimental evidence to demonstrate that the genetic ablation of Mstn induces mitochondria-dependent apoptosis in cancer cells. Interestingly, a previous study showed that prolonged exposure to Mstn also induced mitochondria-dependent apoptosis in cancer cells, but the mechanism was attributed to Mstn induced metabolic shift from oxidative phosphorylation (OXPHOS) to glycolysis in glucose-addicted cancer cells, then, these metabolic changes and ATP depletion were causally linked with VDAC1 upregulated, HKII downregulated and Bax translocation to the mitochondria and subsequent apoptosis in cancer cells. In our study, it was found that the Mstn deficiency resulted in an increase in fatty acid oxidation, which further induced the formation of ROS, when ROS accumulated beyond the ability of cell reduction, apoptosis occurred. These observations are consistent with the result that Mstn-null mice showed slightly higher level of respiration ratio than their wild type littermates [@bib29]. Furthermore, when we exposed HeLa cells to wide range of Mstn concentrations, results confirmed the findings of Liu et al. [@bib29] that higher doses of Mstn led to HeLa cell apoptosis ([Fig. 4](#f0020){ref-type="fig"}H). Collectively, evidence has suggested Mstn plays an important role in regulating mitochondrial energy metabolism, too much or too little both can be bad to cancer cells. Thus, the function of Mstn is complicated, its role in modulating the balance between OXPHOS and glycolysis requires further investigation.
Previous studies demonstrated that Mstn^--/--^ mice exhibited atrophied adipocytes and a failure to accumulate fat [@bib37], [@bib38]. But the Mstn^--/--^ mice are normal animals, the differences between cancer cells and normal cells are vast. We tried to assess whether loss of Mstn could affect fatty acid metabolism in cultured cancer cells. As shown in [Fig. 7](#f0035){ref-type="fig"}, TC and TG contents were strongly reduced in these KO cells. We hypothesized that this could have been due to reduced triacylglycerol synthesis or enhanced fatty acid oxidation. Q-PCR analysis indicated the upregulation of fatty acid oxidation- related genes, while the expression levels of genes involved with triglyceride or cholesterol synthesis were increased or unchanged. The rate of labeled fatty acid oxidation was also increased ([Fig. 7](#f0035){ref-type="fig"}). In addition, two previous studies confirmed an increase in the total energy expenditure in Mstn^--/--^ mice [@bib10], [@bib39], which suggests that increased fatty acid oxidation could be a key factor related to the reduced lipid composition in Mstn KO cells. We also hypothesized that Mstn KO could increase the activity of AMP-activated protein kinase (AMPK), which is a critical regulator of energy metabolism and the expression of genes involved with fatty acid oxidation [@bib40]. Furthermore, AMPK activation has been shown to increase fatty acid oxidation [@bib41]. Consistent with this finding, our unpublished results confirmed the increased phosphorylation of AMPKα in Mstn KO cells. Besides, it has been shown that the activation of ActRIIB by Mstn inhibits the phosphorylation of Akt, which is a key activator of the mTOR pathway related to protein synthesis and an inhibitor of FoxO1, which promotes protein degradation [@bib42]. Thus, Mstn KO should increase protein synthesis and decrease protein degradation to increase the overall levels of proteins, including AMPK and fatty acid oxidation-related enzymes. Finally, Akt stimulates aerobic glycolysis in cancer cells and when the ATP levels are decreased, the compensatory responses of cells may enhance the oxidation of fatty acid to supply sufficient energy for cell survival [@bib29], [@bib43]. The known Mstn signaling is initiated by mature Mstn binding first to ActRIIB receptor. However, the potential role of precursor Mstn that binds to DNA or interacts with other regulatory factors to govern gene expression is still largely unknown. Much attention should focus on the mechanisms changed by Mstn deficiency within cancer cells.
Cancer cells are characterized by a high rate of glycolysis, which is associated with a lower pyruvate oxidation rate. In general, cancer cells are more active in terms of the production of ROS than normal cells, and they are under intrinsic oxidative stress due to their increased metabolic stress and proliferative capacity, and thus they are more sensitive to oxidative stress [@bib35]. Limited mitochondrial respiration and OXPHOS reduces oxidative stress during DNA replication and in phases of high biosynthetic activity [@bib12], [@bib16], [@bib17], [@bib44]. Increased fatty acid oxidation occurs in mitochondria and it is associated with increased OXPHOS and net ROS production [@bib45]. SOD enzymes are key antioxidant enzymes involved with the metabolic elimination of ROS, and our Q-PCR analyses showed that the expression levels of SOD1 and SOD2 were generally higher in cancer cells compared with HEK293 cells ([Fig. S6](#s0170){ref-type="sec"}). The increased expression levels of SOD1 and SOD2 in cancer cells reflect the cellular response to intrinsic oxidative stress, and their upregulation may be an important adaptation mechanism that provides more sustainable protection against increased ROS stress. However, this adaptation process appears to have a limited capacity in cancer cells, where ROS stress is enhanced further to a point that triggers cell death. In the current study, increased ROS production was obtained in HeLa/Mstn KO cells ([Figs. 8](#f0040){ref-type="fig"}A--[8](#f0040){ref-type="fig"}D) and human cancer cells (Huh-7, HeLa, HepG2, and A549) via the lentivirus-mediated RNAi of Mstn, while the non-tumorigenic HEK293 cells with Mstn knockdown had raised ROS levels but the increase was not significant ([Fig. S4](#s0170){ref-type="sec"}). The administration of ROS scavengers prevented the accumulation of ROS and abrogated apoptosis ([Figs. 8](#f0040){ref-type="fig"}D--[8](#f0040){ref-type="fig"}F). In Mstn KO groups treated with etomoxir, ROS level was attenuated and cell viability was significantly improved ([Figs. 8](#f0040){ref-type="fig"}H, [8](#f0040){ref-type="fig"}I), indicating that fatty acid oxidation and ROS were involved in the reduction of cell proliferation. Overall, these results indicate that ROS accumulation is a necessary and critical event in the loss-of-Mstn-induced apoptosis in cancer cells.
It should be noted that only a slight increase in cellular ROS was observed in non-tumorigenic HEK293 cells with Mstn knockdown ([Fig. S4](#s0170){ref-type="sec"}). It is likely that when normal cells are under oxidative stress, they can downregulate their mitochondrial respiratory activity so less ROS are generated in the cells. Previous studies detected a 30% decrease in oxygen consumption (an indication of mitochondrial respiratory activity) when normal lymphocytes were incubated with ROS-generating agents. However, this downregulation of mitochondrial respiration was absent in cancer cells and they continued to consume high levels of oxygen when incubated with ROS-generating agents under the same conditions [@bib35]. Thus, the ability of normal cells to downregulate their oxidative activity when exposed to ROS stress may be a mechanism that protects cells from further ROS production, and thus oxidative damage. This is consistent with our observation that the knockdown of Mstn did not induce apparent changes in the mitochondrial morphology of HEK293 cells, and the rate of fatty acid oxidation was also not altered ([Fig. S7](#s0170){ref-type="sec"}). The molecular basis of the downregulation of the mitochondrial respiration in response to oxidative stress in normal cells is not clear at present, and it is an important subject of future investigations.
Our study demonstrated that it may be possible to exploit the novel function of Mstn in regulating mitochondrial metabolism and apoptosis within cancer cells. The therapeutic disruption of Mstn expression in cancer cells may be a logical strategy for inhibiting cancer growth and muscle loss during cachexia. Further evaluations of this possible therapeutic strategy in preclinical and clinical settings are warranted.
5. Conclusions {#s0155}
==============
We found that Mstn was expressed at higher levels in different types of human tumor tissues and cancer cells, it played an important role in regulating the survival and growth of cancer cells. Given the influential functions of Mstn, we suggest that loss of Mstn could be a useful tool for fighting cancer and muscle loss during cancer cachexia due to enhanced fatty acid oxidation and ROS-induced apoptosis. Agents that target fatty acid oxidation or ROS generation will probably need to be combined with sActRIIB or anti-Mstn antibodies to successfully overcome muscle loss during cancer cachexia. The intra-tumoral injection or virus-mediated treatment with Cas9 as well as a sgRNA against Mstn may be an effective method for combating cancer while avoiding the deteriorating effects on muscle. Further studies, especially *in vivo* studies, are now required to assess whether similar effects to those observed *in vitro* also occur in solid tumors.
Appendix A. Supplementary material {#s0170}
==================================
Supplementary material
This study was supported by a grant for Outstanding Talents of Henan Agricultural University (30600773) and the Ministry of Agriculture of China (2016ZX08006001-006).
Conflicts of interests\' statement {#s0160}
==================================
We declare that we have no potential conflicts of interests concerning this work.
Supplementary data associated with this article can be found in the online version at [doi:10.1016/j.redox.2018.09.009](http://https://doi:10.1016/j.redox.2018.09.009){#ir0005}.
[^1]: These authors contributed equally to this work.
|
Troubleshooting
From JC2-MP Documentation
This page lists problems that people have encountered along with known solutions. Only issues that relate to the current Steam version will be added. The old troubleshooting page can be found here. If you have problems launching the game or otherwise find the mod unplayable, please post in the troubleshooting forum or ask for help from a developer or moderator on our IRC channel. Solutions that have been known to work will be added here.
|
<?php
// Intentionally left blank
?>
|
The in vivo effects of 3-deoxy-3-fluoro-D-glucose metabolism on respiration in Locusta migratoria.
The basis of the toxicity of 3-deoxy-fluoro-D-glucose (3FG) in adult Locusta migratoria is examined in vivo by a radiorespirometric analysis of 14CO2 from the locust after injections of 3FG prior to injections of D-[1-14C]glucose, D-[6-14C]glucose, or [1-14C]acetate. The results indicate that 3FG metabolism irreversibly inhibits glycolysis and not the hexose monophosphate pathway or the tricarboxylic acid cycle. It is also established that during metabolism of 3FG fluoride ion is released. Evidence for the metabolism of 3FG in the whole insect as far as triosephosphate isomerase is based on 3H2O release after injections of D-[3-3H]3FG. Further support for the metabolism of 3FG to fluorinated sugar phosphates is provided by chromatographic and 19F MNR analysis of 3FG poisoned locust tissue extracts. Based on these results a biochemical mode of toxicity of 3FG in locusts is discussed.
|
Presentation Transcript
The Solar System:
The Solar System
The Nebular Theory:
The Nebular Theory The solar system began as a huge cloud of dust and gas, which later condensed to form the sun and its planets.
The Sun Forms First:
The Sun Forms First The nebula was composed of hydrogen and helium.
A star exploded in a supernova and new elements entered our nebula.
Shock waves from the supernova explosion disrupted our nebula and it began to collapse.
As gravity pulled in it spun faster and flattened into a disk, which would become our sun.
After millions of years, it became dense and hot enough for fusion to begin.
The Planets Form:
The Planets Form Gases and matter continued to spin around the sun.
Gravity caused them to pull into clumps of matter which became protoplanets.
Inner Planets:
Inner Planets Protoplanets near the sun became so hot, most of their gases burned boiled away.
The inner, hotter planets were left as collections of metal and rock.
The inner planets are Mercury, Venus, Earth and Mars.
The Gas Giants:
The Gas Giants The protoplanets farther from the sun were less affected by the sun’s heat.
They retained their gases and grew to enormous sizes.
The gas giants are Jupiter, Saturn, Uranus and Neptune.
Moons:
Moons As the newly formed planets began to cool, clumps of matter formed around them.
These clumps became moons or satellites which revolved around the planets.
Asteroid Belt:
Asteroid Belt Between Mars and Jupiter, small clumps of matter formed asteroids.
These rocklike objects are in a region known as the asteroid belt.
Comets:
Comets Farther our in space, near the edge of the solar system a huge cloud formed.
This cloud is believed by some astronomers to be the home of comets.
Motions of the Planets:
Motions of the Planets The Greeks noticed that although the stars appeared to move across the night sky, their position relative to each other was constant.
The Greeks also noticed that some of the stars appeared to wander among the other stars.
The Greeks called these objects, planets, or wanderers.
Ptolemy:
Ptolemy In the second century AD, the Greek scientist Ptolemy proposed a theory that placed Earth at the center of the universe.
He also proposed that all objects in the sky traveled in orbits around an unmoving Earth.
He proposed that the orbits were circular.
Nicolaus Copernicus:
Nicolaus Copernicus Between 1500 and 1530 the Polish astronomer Copernicus developed a new theory about the solar system.
He proposed that the Earth and the other planets revolved around the sun.
He reasoned that the planets revolved in the same direction.
He stated that each planet took a different amount of time to complete their revolution in a perfect circle.
Johannes Kepler:
Johannes Kepler The sixteenth-century German mathematician and astronomer Johannes Kepler discovered something new. He proposed that the planets orbit in an ellipse, or oval orbit (egg shaped).
Today scientists know Kepler was correct.
Law of Inertia:
Law of Inertia An object’s motion will not change unless that object is acted on by an outside force.
A moving object will not change speed or direction unless an outside force causes a change in its motion.
Sir Isaac Newton:
Sir Isaac Newton Newton hypothesized that planets, like all other objects would move in a straight line unless some force causes them to change their motion. He reasoned that the force was the gravitational pull of the sun.
Inertia and gravity:
Inertia and gravity The elliptical orbit is caused by two factors: gravity and inertia.
Inertia causes the planet to move in a straight line.
Gravity pulls the planet toward the sun.
When the two combine, the planet moves in an elliptical orbit.
Period of Revolution:
Period of Revolution A planet’s period of revolution is called a year on that planet.
For example, Mercury takes 88 days to revolve around the sun and Pluto takes about 248 Earth years.
Period of Rotation:
Period of Rotation All planets rotate, or spin, on their axes.
The time it takes a planet to complete one rotation is called its period of rotation.
The Earth takes 24 hours to complete a period of rotation.
Mercury takes almost 59 Earth days to rotate once on its axis.
Mercury:
Mercury
Mercury –Faster than a Speeding Bullet:
Mercury –Faster than a Speeding Bullet Mercury is a rocky planet without almost no atmosphere or weather. In 1975 Mariner 10 found the many craters unchanged.
Mercury moves quickly around the sun at the pace of 48 km per second and was named after the speedy messenger of the Roman gods.
Mercury rotates 3 times for every 2 revolutions. Sunrise occurs every 175 Earth-days making it one of the hottest and coldest planets in the solar system.
Exploration of Mercury:
Exploration of Mercury Mariner 10 flew by Venus and Mercury in 1973-1975 and sent back images.
Venus:
Venus
Venus – Greenhouse in the Sky:
Venus – Greenhouse in the Sky Venus was named for the Roman goddess of beauty and love.
Venus rotates east to west, retrograde rotation.
Why Is Venus So Different From Earth?:
Why Is Venus So Different From Earth? In early days, the sun was cooler.
Venus may have had oceans. (Remains of coastline and beds can still be detected.)
As sun grew hotter, the water evaporated into the atmosphere.
Water vapor and later carbon dioxide in the atmosphere created a greenhouse.
Greenhouse Effect on Earth:
Greenhouse Effect on Earth The Earth’s atmosphere acts like a greenhouse.
This effect helped life evolve and survive.
Burning of fossil fuels, such as coal and oil, add carbon dioxide to the atmosphere.
Some scientists fear Earth may suffer the fate of Venus.
Exploration of Venus:
Exploration of Venus Astronomers believed Venus to be the twin of Earth until explored by the Soviet spacecraft Venera, Pioneer Venus Mariner 2 (1962), and Mariner 5 (1967) which found land forms due to once active volcanoes. Clouds are made of sulfuric acid. The atmosphere is very thick.
Mars:
Mars
Mars – the Rusty Planet:
Mars – the Rusty Planet Mars known as the rusty planet.
Mars was named after the Roman god of war.
Mars has two moons, Phobos (fear) and Deimos (terror).
Exploration of Mars:
Exploration of Mars Viking I and II landed on Mars in 1976 and found that soil is covered in iron oxide.
Mariner 4 (1964-65) and Mariner 6 & 7 (1969) were pass by flights.
Mariner 9 (1971) was an orbiter.
The Rover landed in 2004.
Phoenix Lander will arrive in May 2007 to search for water.
Life on Mars?:
Life on Mars? Scientists found no sign of life on Mars.
There is a possibility life once existed since frozen water can be found in the northern icecap. The southern icecap has frozen carbon dioxide.
Since the atmosphere is so thin, Mars temperature always stays below 0 degrees C.
The Asteroid Belt:
The Asteroid Belt
The Asteroid Belt:
The Asteroid Belt Asteroids are made of rock, metal or a combination of the two.
Asteroids are sometimes called the minor planets. The largest is Ceres (100 km) which is classified as a dwarf planet.
It is believed this matter did not form a planet due to the strong gravitational pull of Jupiter.
Death of Dinosaurs?:
Death of Dinosaurs? One theory states that the collision of a huge asteroid 65 million years resulted in the extinction of dinosaurs and almost 90% of all other life on Earth.
It is believed the force of the collision was 10,000 times greater than the force of all nuclear weapons on Earth.
Jupiter:
Jupiter
Jupiter:
Jupiter Our sun contains 99.8% of all the matter in our solar system.
Jupiter contains 70% of all the remaining matter in the solar system.
Romans named this planet after the king of the Gods.
Jupiter – Almost a Star:
Jupiter – Almost a Star Jupiter is main primarily of hydrogen and helium gases.
The core reaches 30,000 degrees C (5 times the surface of the sun).
If Jupiter had grown larger during formation, it would have become a star.
Jupiter gives off more heat than it receives from the sun.
Galileo:
Galileo Galileo plunged into Jupiter's crushing atmosphere on Sept. 21, 2003. The spacecraft was deliberately destroyed to protect one of its own discoveries - a possible ocean beneath the icy crust of the moon Europa.
The spacecraft was the first to fly past an asteroid and the first to discover a moon of an asteroid. It provided the only direct observations of a comet colliding with a planet.
Galileo was the first to measure Jupiter's atmosphere with a descent probe and the first to conduct long-term observations of the Jovian system from orbit. It found evidence of subsurface saltwater on Europa, Ganymede and Callisto and revealed the intensity of volcanic activity on Io.
New Horizons arrived at Jupiter in 2007.
Features of Jupiter:
Features of Jupiter Astronomers have observed a Great Red Spot which is hurricane-like.(20,000 yr old)
Jupiter has a small solid core.
Jupiter has s liquid hydrogen ocean which causes a magnetic field (magnetosphere).
Jupiter has at least 62 moons. (Io, Europa, Gannymede and Callisto)
Saturn:
Saturn
Saturn – A World of Many Rings:
Saturn – A World of Many Rings Saturn has seven major rings (A-G) made of icy particles ranging in size from 1/1000mm to 100km in diameter.
Saturn, like Jupiter, is made mainly of hydrogen and helium gases and has violent storms. It is the least dense planet.
Saturn spins so fast, it flattens at the poles and bulges at the equator.
Saturn has 33 known moons.
Uranus:
Uranus
Uranus – A Planet on its Side:
Uranus – A Planet on its Side Uranus was named for the father of Saturn.
Uranus was discovered by Sir William Herschel in 1781.
Voyager 2 found Uranus is covered by a thick cloud of hydrogen, helium and methane and an ocean of superheated water.
The axis of Uranus is tilted at a 90 degree angle.Uranus has rings and 27 known moons.
Triton – a moon of Neptune:
Triton – a moon of Neptune
Neptune – the Mathematician’s Planet:
Neptune – the Mathematician’s Planet The orbit of Uranus is affected by Neptune.
Mathematicians predicted the location as early as 1845.
Neptune was named for the Roman god of the sea.
Neptune, like Uranus, is covered by clouds of hydrogen, helium and methane.
Voyager found Neptune to have 13 moons and 5 rings. Triton orbits in a retrograde pattern.
Pluto:
Pluto
Pluto – a Dwarf Planet:
Pluto – a Dwarf Planet When discovered, Neptune did not orbit as predicted. Although astronomer Percival Lowell predicted the existence of Pluto in the early 1900’s, it was not located until 1930.
Pluto was named for the Roman god of the underworld.
The discovery still did not explain the orbit patterns of Uranus and Neptune. Pluto was too small to account for the change. When Charon, a moon, was found in 1978, this helped solved the riddle.
Reclassification of Pluto:
Reclassification of Pluto Planets must
A “planet” is a celestial body that (a) is in orbit around the Sun, (b) has sufficient mass for its self-gravity to overcome rigid body forces so that it assumes a nearly round shape, and (c) has cleared the neighbourhood around its orbit.
Pluto is considered a dwarf planet because it does not clear the neighborhood and is not a satellite.
Other Dwarf Planets:
Other Dwarf Planets The mass of Pluto and its moon is too small to account for the irregular orbits of Uranus and Neptune.
Ceres and Xena are the other two dwarf planets.
Comets:
Comets The Oort Cloud is a collection of ice,gas and dust located 15 million km from the sun.
Sometimes these comets are pulled toward the sun. As they near the sun, they begin to melt which forms a cloud around its core.
Composition of a Comet:
Composition of a Comet The core of a comet is called the nucleus.
The cloud of dust surrounding the nucleus is called the coma. Together they form the head.
The solar wind of the sun blows the coma outward into a long tail. The tail of an incoming streams behind, an outgoing streams in front.
Most of 100,000 comets in the solar system orbit over and over.
Halley’s comet returns every 75-79 years. Some take thousands of years.
Meteoroids, Meteors and Meteorites:
Meteoroids, Meteors and Meteorites Meteoroids are chunks of metal or stone that orbit the sun.
When the meteoroid rubs against the gases in the atmosphere, friction causes it to burn, producing a streak of light known as a meteor or shooting star.
Most burn up in the atmosphere, a few survive to strike the Earth and are called meteorites.
These meteorites can cause craters.
Life in the Solar System:
Life in the Solar System The two conditions necessary for life are moderate temperatures and liquid water.
7.5 million km closer to sun would have been too hot.
1.5 million km farther away and the water would be frozen.
Rocketry:
Rocketry Rocketry is based on Newton’s Third Law of Motion – Every action produces an equal and opposite reaction.
In a reaction engine, the rearward blast of gases causes the rocket to shoot forward. The force of this movement is called the thrust.
History of Rocketry:
History of Rocketry The Greeks and Romans used steam to move toys.
The Chinese developed rockets for use in war in the year 1000. They were hollow bamboo filled with gunpowder. When ignited, gases shot out the end causing a forward reaction.
Escape Velocity:
Escape Velocity In order to escape the Earth’s gravitational pull, the rocket must achieve the proper velocity.
The escape velocity depends on the mass of the planet and the distance of the rocket from the planet’s center.
Tsiolkovsky (Russian, 19th c) predicted a solid fuel would not be able to accomplish this feat. A solid burns too quickly. It cannot maintain the thrust.
Dr. Robert H. Goddard:
Dr. Robert H. Goddard In 1926, Dr. Goddard combined gasoline with liquid oxygen and launched a small rocket.
He eventually developed multistage rockets in which empty fuel containers are dropped off.
Today the fuel is a combination of liquid hydrogen and liquid oxygen.
Probes to Inner Planets:
Probes to Inner Planets In 1962, Mariner 2 probed Venus. Later Magellan studied Venus. Galileo was crushed in the atmosphere in 2003. New Horizons, on the way to Pluto, sent back images in 2007.
Mars was studied by Mariner 4 in 1965, Mariner 7 in 1969 and Mariner 9 in 1971.
Mariner 10 flew past Mercury in 1974.
Viking 1 (1975) and 2 landed on Mars.
Rover landed on Mars in 2004.
Probes to Outer Planets:
Probes to Outer Planets Pioneer 10 studied Jupiter in 1973 and sent back 300 photographs. Pioneer 11 later studied Jupiter. Both are now beyond the solar system.
The Galileo mission to Jupiter ended in 2003.
Voyager 1 and 2 flew by Jupiter (1983) Saturn and Uranus and Neptune (1990s). Voyagers left our solar system at the end of the century.
New Horizons arrived at Jupiter in 2007. It will travel on to Pluto and the Kuiper belt.
|
eduGAIN Operational Practice Statement
This document describes procedures used in the management of the=
eduGAIN core, i.e. global eduGAIN membership issues and information servic=
es. The eduGAIN services are managed by the eduGAIN Operational Team (OT). =
Additional operational documentation is provided separately for each of the=
eduGAIN operational profiles.
Operati=
onal Team tasks
As defined in [eduGAIN-CONST] the Operational Team (OT) is responsible f=
or:
Preparing an audit plan for the eduGAIN operational practices on the re=
quest of the eSG.
=
eduGAIN Joining and Membership
eduGAIN recognises two categories of federation within its structure: me=
mbers and participants. Members are those federations that have compl=
eted the first steps to joining eduGAIN, but are not actively using any tec=
hnology profile (such as providing SAML metadata to the MDS) at the moment.=
Many federations may become a member AND provide documentation to ac=
tively join a federation at the same time. This Operational Practice =
Statement provides more information on the steps needed to become a Member =
only - as described in the eduGAIN Constitution.
The process to join eduGAIN as a Member Federation is as follows:
A representative of the applicant Federation signs the eduGAIN Policy D=
eclaration and presents it to the OT.
The OT confirms that the applicant Federation fulfils the requirements =
in section 3.1 of the eduGAIN constitution.
The OT prepares and presents a membership proposal to the eSG for comme=
nt and review.
The eSG approves or rejects the application via a vote.
When an applicant is approved, the OT takes the necessary steps to regi=
ster the Federation to eduGAIN.
Op=
erational Team procedures
Registration and modification of federation informat=
ion
information type
security level
federation delegate to eduGAIN SG
S
federation delegate deputy to eduGAIN SG
S
federation page URL
1
federation mail contact
2
Federation delegate and deputy are the only federation representatives a=
uthorized to submit information, therefore their identity needs to be estab=
lished in a trusted way, this is however part of the global eduGAIN trust m=
odel, not specific to the SAML prifile.
|
Otitis media, sinusitis, bronchitis, pharyngitis, and nonspecific upper respiratory tract infections (URTI) account for approximately 75% of outpatient antibiotic prescriptions in the United States. Antibiotic use remains high despite the fact that greater than 85% of these infections are due to viruses and resolve without complication. Nonetheless, those remaining infections that are indeed due to bacterial pathogens require more effective management than is currently available. Bacterial cultures provide limited diagnostic value because the most common bacteria responsible for URTI are also often commensal organisms in the nasopharynx.
Infections of the upper airway are the number one reason for office visits in the US (American Academy of Pediatrics. Pediatrics, 2004. 113:1451-1456, Center for Disease Control and Prevention web site, Gonzales R, et al. JAMA, 1997. 278(11):901-904, Nyquist A-C. JAMA, 1998. 279(11): 875-877). About 52% of adults patients and 45% of pediatric patients are prescribed antibiotics when diagnosed with an upper airway infection (Gonzales R, et al. JAMA, 1997. 278(11):901-904, Nyquist A-C. JAMA, 1998. 279(11): 875-877). Upper airway infections are multifactorial and polymicrobial diseases. Infection by respiratory viruses (e.g. RSV, adenovirus, rhinovirus, parainfluenza virus) predisposes to bacterial superinfection by members of the nasopharynx normal flora: nontypeable Haemophilus influenzae, Streptococcus pneumoniae and Moraxella catarrhalis. While viral infections are often self-limiting, therapeutic delay of bacterial disease can lead to complications, permanent sequelae and severe morbidity and mortality.
Diagnosis is mainly based on clinical manifestations. Signs and symptoms of disease of bacterial and nonbacterial etiologies are often indistinguishable. Specific bacterial identification by traditional microbiological culture techniques often fail to detect microorganisms growing within biofilms. Contamination of specimens by resident colonizing flora often results in laboratory culture reports of uncertain clinical value. Indiscriminate antibiotic use modifies the commensal flora in the nasopharynx and induces the selection and emergence of microorganisms resistant to common antibiotics. Despite a decreasing trend in antibiotic prescription in recent years, unnecessary and inappropriate antibiotic therapies are common, particularly in the treatment of otitis media and sinusitis.
Upper respiratory tract infection remains as a major cause of overuse of antibiotics and, therefore, a major contributor to the widespread emergence of antibiotic resistance. Therefore, there is a need for early and rapid diagnostic tests that could discriminate between commensal and pathogenic bacteria. These tests would promote judicious use of antibiotic therapy, promote more effective choice of treatment and improve outcomes.
|
Comparison of polyethylene glycol 3350 and lactulose for treatment of chronic constipation in children.
Polyethylene glycol (PEG) 3350 and lactulose were compared in an unblinded, randomized, crossover design for treatment of constipation in 37 children aged 2 to 16 years. Subjects received lactulose (1.3 g/kg/d divided twice daily up to 20 g) or PEG 3350 (10 g/m2/day) for 2 weeks. PEG 3350 significantly decreased the total colonic transit time compared to lactulose (47.6+/-2.7 vs 55.3+/-2.4 hours, mean +/- SE, PEG 3350 vs lactulose, respectively, p = 0.038). The stool frequency, form, and the ease of passage were similar for each laxative. Polyethylene glycol 3350 is an effective laxative for the treatment of chronic constipation in children.
|
Monkton railway station
Monkton railway station was a railway station serving the village of Monkton, South Ayrshire, Scotland.
The site of the former station is occupied by fuel sidings used by Prestwick Airport.
History
A station at Monkton is listed in Bradshaw for 1843, although the more commonly known station is that opened on 5 August 1859 as part of the Glasgow, Paisley, Kilmarnock and Ayr Railway (later the Glasgow and South Western Railway). The station was closed on 28 October 1940 by the London, Midland and Scottish Railway.
References
Notes
Sources
Category:Disused railway stations in South Ayrshire
Category:Railway stations opened in 1859
Category:Railway stations closed in 1940
Category:Former Glasgow and South Western Railway stations
|
A study of nearly 4,000 pairs of mothers and their children in Children of the 90s has shown that maternal vitamin D levels during pregnancy are not associated with the child’s bone health in later life.
A study of nearly 4,000 pairs of mothers and their children in Children of the 90s has shown that maternal vitamin D levels during pregnancy are not associated with the child’s bone health in later life. The research, published Online First in The Lancet, is the largest ever observational study of the effects of mothers’ vitamin D levels in pregnancy on their children’s bone health, and suggests that UK health guidelines may be overstating the importance of vitamin D supplementation in pregnancy.
The study, led by Professor Debbie Lawlor of the University of Bristol, assessed vitamin D levels in 3960 pregnant women, recording data from all three trimesters. When their children had reached an average age of nine years and 11 months, their bone mineral content (BMC) was assessed using dual-energy X-ray absorptiometry. BMC is a measure of bone health, where a lower mineral content is associated with poorer bone health and higher risk of diseases such as rickets.
The researchers found no significant association between a mother’s vitamin D levels and their child’s BMC. Mothers’ vitamin D levels were on average lowest during their first trimester, and then increased as the pregnancy progressed; as expected, levels were higher when measured during summer months and lower when measured during winter months. Furthermore, although non-white mothers and those who smoked during pregnancy tended to have lower vitamin D levels overall, this appeared to have no effect on their children’s bone health.
Vitamin D helps to keep a person’s bones and teeth healthy by regulating the amount of calcium and phosphate in the body, and it has been thought that as well as affecting maternal bone health, low levels of vitamin D during pregnancy might lead to problems with the baby’s bone formation. Aside from dietary sources of vitamin D, which include oily fish, eggs, and meat, vitamin D is produced naturally in the body by the action of sunlight on skin. However, in recent years, concerns have been raised over possible adverse effects of low levels of vitamin D in pregnancy, leading NICE guidelines to recommend in 2008 that all pregnant and breastfeeding women should take a 10 microgram vitamin D supplement every day.
Results of previous studies into the effects of maternal vitamin D levels on children’s bone health have been inconclusive, but the current study is more than ten times larger than previous studies combined. While there have been no randomised controlled trials of the effect of vitamin D supplementation during pregnancy on children’s bone health, the current study appears to suggest that UK guidelines may be overstating the need to take vitamin D supplements during pregnancy in order to improve the child’s future bone health.
Speaking to Lancet TV, Professor Lawlor said that:
'Current guidelines are relatively vague, in that what they say is that all pregnant women should be made aware that in pregnancy, vitamin D levels can be low, and that it’s important for the mother’s health and for the child’s heath.'
Given uncertain evidence for the effects of maternal vitamin D on bone health, Professor Lawlor suggests that the guidelines may be 'over-emphasising the importance of vitamin D, and we need more evidence … Suggesting to pregnant women that their child’s future bone health depends on their pregnancy vitamin D status or that by taking supplements they will improve [their child’s future bone health], ... I think our study challenges that [suggestion].'
According to Professor Lawlor:
'We believe that there is no strong evidence that pregnant women should receive vitamin D supplementation to prevent low BMC in their offspring, although we cannot comment on other possible effects of vitamin D in pregnant women. While excessive vitamin D intake can affect the body’s calcium balance and result in cardiac arrhythmias and muscle problems (both rare) as well as milder problems such as dry mouth and constipation, our study didn’t look at any other potential beneficial or adverse effects of vitamin D supplementation, besides the association with children’s bone health.'
In a linked Comment, Professor Philip Steer of Imperial College London, UK, adds that:
'In view of the inconsistency in results [of previous studies], it might seem unclear why vitamin D supplementation is officially recommended for all pregnant and breastfeeding women.'
He adds that:
'The safest approach is probably routinely to supplement pregnant women at greatest risk, as defined by the NICE guidelines: women of south Asian, black African, black Caribbean, or Middle Eastern origin, women who have limited exposure to sunlight (eg, those who are predominantly housebound or are generally fully covered when outdoors), women who eat a diet particularly low in vitamin D (eg, no oily fish, eggs, meat, or vitamin D-fortified margarine or breakfast cereal), and women with a body-mass index higher than 30 kg/m² before pregnancy. For other women, the optimum approach is unclear, and long-term randomised trials of supplementation are justified.'
|
Spacer intercalated disassembly and photodynamic activity of zinc phthalocyanine inside nanochannels of mesoporous silica nanoparticles.
Hydrophobic photosensitizer zinc(II) phthalocyanine (ZnPc) was loaded into adamantane (Ad) modified nanochannels of mesoporous silica nanoparticles (MSNPs). The Ad units on the surface of MSNPs were complexed with amino-substituted β-cyclodextrin to enhance the solubility of the hybrid in aqueous solution. The amino groups on β-cyclodextrin also provide functional sites for further conjugation with targeting ligands toward targeted cancer therapy. Since the intercalation of the Ad spacer isolates loaded ZnPc and prevents its aggregation inside MSNPs, ZnPc exhibits its monomeric characteristics to effectively generate cytotoxic singlet oxygen ((1)O2) upon light irradiation (675 nm) in aqueous conditions, leading to efficient photodynamic activity for successful cancer treatment in vitro. Current research presents a convenient approach to maintain the monomeric state of hydrophobic photosensitizer ZnPc by rationally utilizing multifunctional MSNPs as the carriers. The novel hybrid with targeting capability achieves active photodynamic property of monomeric ZnPc in aqueous solution under light irradiation, which may find its way for practical photodynamic therapy in the future.
|
Q:
Why my div's doesn't expand with zoom
Hi I'm making a web page, but I notice that when I make zoom in the page with any web browser the div's doesn't expand only the text. How can make that both the div's and text expand with I make zoom in them?
This is how I'm working in css, I'm making the positioning in the same way for all my page.
#pagina_principal{
position:absolute;
top:5%;
left:5%;
width:90%;
height:190%;
border:solid red 1px;
}
#menu{
position:absolute;
top:10%;
left:5%;
width:90%;
height:3%;
}
#home_principal{
position:absolute;
top:0%;
left:0%;
width:18%;
height:100%;
border:solid lightgrey 1px;
}
A:
You are working with fluid elements whose width and height are assigned in percentage. That means the browser renderer will calculate the elements' size based on the browser's window size. For instance, a 100% width element will automatically be rendered as covering the whole width of the browser's window.
The problem is, when zooming, the size of the window does NOT change, so these elements keep the same size.
|
Most roadways throughout the world are paved with asphalt concrete mixes. Typically, the hot asphalt road mix containing asphalt cement, aggregate, and antistripping agents is produced at an asphalt plant and transported to the construction site in the beds of dump trucks. One of the problems encountered in delivering road asphalt in dump trucks is that the asphalt tends to stick to the metal surfaces of the truck beds. Making this problem worse is the recent trend toward the use of polymer-modified road asphalt mixes which form more tenacious bonds with the truck bed surfaces.
The sticking prevents the asphalt from smoothly sliding out as the dump truck discharges its load. Workers are thus required to expend considerable time and energy to manually scrape the asphalt out of the truck bed with shovels. Most often, however, solidified pieces of asphalt remain adhered to the bed despite the workers best efforts. Asphalt is wasted and material usage suffers. Furthermore, as the hardened deposits build up in the truck bed, the quality of subsequent road mixes is also affected. The adherent pieces eventually fall off as large solid inclusions in subsequent road mixes. Often, the inclusions cause the road paving equipment to tear up the road membrane as the asphalt is laid down.
One approach taken to solve this problem has been to spray asphalt release agents over the truck bed surfaces to prevent asphalt adherence. A popular asphalt release agent used in the past was hydrocarbon fuel such as ordinary diesel fuel. Diesel fuel was extremely effective in cutting and dissolving the asphalt in order to prevent it from sticking. However, diesel fuel has since been outlawed as an asphalt release agent. It presented too many soil and ground water contamination risks and also when not used properly decomposed the asphalt. Other fuel-based release agents such as hydrocarbon wax emulsions have been banned as well, since they also damaged the structural integrity of the contacted asphalt, resulting in inferior and shorter-lasting roads. Furthermore, all release agents which rely upon decomposition or degradation of the contacted asphalt are no longer considered desirable.
Non-fuel based asphalt release agents which provide slippery surfaces on the truck bed to prevent the asphalt from sticking without decomposing the asphalt have also been tried. For instance, U.S. Pat. No. 5,332,554 (DeLong) discloses a foam asphalt release agent including an aqueous solution of an inorganic salt, such as magnesium chloride or calcium chloride, together with a foaming agent, such as an anionic isopropyl alcohol surfactant, a metal corrosion inhibitor, such as sodium phosphate ester, and optional dye. U.S. Pat. No. 5,494,502 (DeLong) discloses another non-fuel based foam asphalt release agent including an aqueous mixture of a fatty oil, together with a foaming agent, such as an anionic surfactant, optional emulsion stabilizer, such as crosslinked polymer microgels, optional alkalinizing agent, such as triethanolamine, and optional preservative or antimicrobial agent, such as sodium benzoate. U.S. Pat. No. 5,407,490 (Zofchak) discloses still another asphalt release agent comprising a water-based mixture of monomethyl coconate esters together with ethoxylated sorbitan ester emulsifiers. These non-fuel based release agents, however, suffer from not being especially effective in releasing the more tenaciously adhered pieces of polymer-modified asphalt from the truck beds, which traditionally have been more difficult to handle. Other non-fuel based release agents have also been tried, but most of these suffer from being limited in ineffectiveness, environmentally hazardous, thermally unstable, costly, or complex in preparation, delivery, or application.
It would be desirable to provide a more effective asphalt release agent which does not suffer from the foregoing disadvantages. Yet, from a practical standpoint, this is difficult because of the stringent requirements that must be satisfied. For instance, economics are extremely important in the asphalt industry due to the large scale of potential application. Thus, any material proposed for use as an asphalt release agent must be very inexpensive, which eliminates many potential candidates. Another important criteria is that the release agent must be derived from relatively high boiling, thermally stable materials that will not substantially decompose and volatilize when contacted with the hot asphalt road mix, which is usually loaded at the asphalt plant onto the truck beds at temperatures typically above 325.degree. F. The release agent should also have a sufficiently high flash point to avoid flammability hazards which may be encountered at the asphalt plant or construction site. Moreover, the release agent should be environmentally friendly, physiologically safe, relatively non-corrosive to human skin, easy to prepare, deliver and apply even in extreme cold weather conditions, and should not degrade the contacted asphalt in any manner that would impair the road quality. And all of the above requirements must be satisfied, while also providing a material possessing effective asphalt release action, especially with respect to polymer-modified asphalt.
What is needed is an asphalt release agent that is exceptionally effective in preventing the sticking of asphalt, especially asphalt containing polymers, to truck beds and other surfaces, is environmentally friendly and physiologically safe, is inexpensive, is easy to prepare, deliver and apply even in extreme cold temperatures, is thermally stable and long-lasting, is non-flammable, and does not compromise the quality of asphalt laid down in the road.
|
Service Guide
Service Guide
There are a total of 14 service areas along the freeways as of yearend 2017, including six on Freeway No. 1, seven on Freeway No. 3, and one on Freeway No. 5. In keeping with catering to travelers' needs, the Freeway Bureau has changed the mode of tender adopted for the service areas by giving each area a featured theme. Upholding the principles of "dining for all", "traveler-friendliness", "local highlights" and "social responsibility", we continue to push for new ideas to better the services.
|
<html>
<head>
<title>016</title>
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
<script>
function navigate(e) {
var keynum = (window.event) // IE
? e.keyCode
: e.which;
if (keynum == 8) {
window.location = "015.php" + ".html";
return false;
}
if (keynum == 13 || keynum == 32) {
window.location = "017" + ".html";
return false;
}
if (keynum == 73 || keynum == 105) {
window.location = "index.html";
return false;
}
return true;
}
</script>
</head>
<body onkeypress="return navigate(event)">
<pre>
GitHub
https://github.com/bookwormkr/phpmeetup
</pre>
</body>
|
{
"images" : [
{
"idiom" : "universal",
"scale" : "1x"
},
{
"idiom" : "universal",
"scale" : "2x"
},
{
"idiom" : "universal",
"scale" : "3x"
}
],
"info" : {
"version" : 1,
"author" : "xcode"
}
}
|
Q:
Trying to combine dates and times
I am trying to combine dates and times. These are from a file when imported, looks like this:
library(tidyverse)
library(lubridate)
bookings <- structure(list(booking_date = structure(c(1549670400, 1550275200,
1550880000, 1551484800, 1552089600, 1552694400), class = c("POSIXct",
"POSIXt"), tzone = "UTC"), start_time = structure(c(-2209043700,
-2209043700, -2209043700, -2209043700, -2209043700, -2209043700
), class = c("POSIXct", "POSIXt"), tzone = "UTC")), row.names = c(NA,
-6L), class = c("tbl_df", "tbl", "data.frame"))
Which looks like this:
# A tibble: 6 x 2
booking_date start_time
<dttm> <dttm>
1 2019-02-09 00:00:00 1899-12-31 08:45:00
2 2019-02-16 00:00:00 1899-12-31 08:45:00
3 2019-02-23 00:00:00 1899-12-31 08:45:00
4 2019-03-02 00:00:00 1899-12-31 08:45:00
5 2019-03-09 00:00:00 1899-12-31 08:45:00
6 2019-03-16 00:00:00 1899-12-31 08:45:00
Obviously the date in the start_time column is wrong. It should be combined with the booking date, so that the first row should read 2019-02-09 08:45:00.
What would the best way of doing that be? I have tried this (based on this other answer), which doesn't really work in my situation.
bookings %>%
select(booking_date, start_time) %>%
mutate(time_2 = as.character(start_time)) %>%
mutate(time_3 = str_sub(time_2, -8, -1)) %>%
mutate(booking_start = dmy(paste(booking_date, time_3)))
Thanks.
A:
If you want to get date for start_time from booking_date a base R approach would be to paste "Date" part from booking_date and "time" part from start_time and convert them to POSIXct.
bookings$start_time <- as.POSIXct(paste(as.Date(bookings$booking_date),
format(bookings$start_time, "%T")))
bookings
# A tibble: 6 x 2
# booking_date start_time
# <dttm> <dttm>
#1 2019-02-09 00:00:00 2019-02-09 08:45:00
#2 2019-02-16 00:00:00 2019-02-16 08:45:00
#3 2019-02-23 00:00:00 2019-02-23 08:45:00
#4 2019-03-02 00:00:00 2019-03-02 08:45:00
#5 2019-03-09 00:00:00 2019-03-09 08:45:00
#6 2019-03-16 00:00:00 2019-03-16 08:45:00
If you want to use it in pipes you can do
library(dplyr)
bookings %>%
mutate(start_time = as.POSIXct(paste(as.Date(booking_date),
format(start_time, "%T"))))
|
Vincent Van Gogh Vintage Art
art styles
All art styles
Vintage Art
Vincent Van Gogh (1853 - 1890) was a Dutch Post-Impressionist Master whose innovative art influenced modern Expressionism, Fauvism, and early Abstract art. Van Gogh produced all of his work during a 10-year period. In 1889, he created 150 paintings and drawings alone! Tormented by mental illness for most of his life, Van Gogh created many of his masterpieces while institutionalized. He sold only one painting during his lifetime ("The Red Vineyards at Arles"), and is now regarded as one of the most important artists of the 19th century.
Ship TimeShip time indicates the typical number of business days it takes for your item(s) to leave our facilities but does not include transit time from our facilities to the final destination.Orders that contain multiple items with different ship times will be shipped out based on the item with the longest ship time.Please note: Ship time is determined based on the method of payment chosen.This item cannot be framed
Add to Cart
find similar
Frame It
save to gallery
Learn More
Back To Top
View Per Page
16
|
32
|
48
This segment of search results is from Artist Rising, an online community of independent artists. Artist Rising is a division of Art.com, Inc. Learn more about Artist Rising
|
REVEALED: First look at new Oman resort
Saraya Bandar Jissah will include residences, two five-star hotels and a secluded beach near the Hajjar Mountains
1 of 19
Saraya Bandar Jissh is Oman’s largest single residential and tourism project since 2007. This artist’s impression shows what the development will look like.
2 of 19
Developers are confident the project will generate up to 1,000 new jobs when complete, with a new tourism complex, residences, two 5-star beachfront hotels, a secluded beach, and recreational and community facilities.
3 of 19
Developers are confident the project will generate up to 1,000 new jobs when complete, with a new tourism complex, residences, two 5-star beachfront hotels, a secluded beach, and recreational and community facilities.
4 of 19
The lobby of the new hotel, which will be operated by Jumeirah Group
5 of 19
The new hotel, which will be operated by Jumeirah Group
6 of 19
The new hotel, which will be operated by Jumeirah Group
7 of 19
The lobby of the new hotel, which will be operated by Jumeirah Group
8 of 19
Advanced earthworks are already underway for the project, following a complete environmental impact assessment and an assessment of the archaeological sites in the area.
9 of 19
The new hotel, which will be operated by Jumeirah Group
10 of 19
The project is being developed by Oman’s tourism development and investment arm, Omran, in partnership with Saraya Oman, a subsidiary of Saraya Holdings.
11 of 19
Advanced earthworks are already underway for the project, following a complete environmental impact assessment and an assessment of the archaeological sites in the area.
12 of 19
Sheikh Hamood Sultan Al Hosni (right), CEO of the project, said construction was ongoing at the site.
13 of 19
Construction will begin in earnest when the earthworks are complete.
14 of 19
The site is currently free from developments.
15 of 19
This aerial map shows the location of the new project.
16 of 19
The current coastline of the Gulf of Oman will change dramatically when the project is complete.
17 of 19
Advanced earthworks are already underway for the project, following a complete environmental impact assessment and an assessment of the archaeological sites in the area.
|
Scott
As discussed.
Date Wedsnesday 23rd May
Time 6.30
Loc Houstons - Willcrest @Westheimer
Eddie's number if there is a problem is 7139890962 ( work )
As mentioned he was approached by us and so is a little cautious.
Please let me and John know how you got on
Thanks
Neil
|
Bulgar–Serb War (853)
The Bulgarian-Serbian War of 853 was fought between the Bulgarian Khanate and the Serbian Principality. It was the second conflict of the medieval Bulgarian–Serbian Wars.
Prelude and the War
After the death of Prince Vlastimir of Serbia in 850, his state was divided between his sons. Vlastimir and Presian, Boris' father, had fought each other in the Bulgar-Serb War (839–42), which resulted in a Serbian victory. Boris sought to avenge that defeat, an in 853 or 854, the Bulgar army led by Vladimir-Rasate, the son of Boris I, invaded Serbia, with the aim to replace the Byzantine overlordship on the Serbs. The Serbian army was led by Mutimir and his two brothers, who defeated the Bulgars, capturing Vladimir and 12 boyars. Boris I and Mutimir agreed on peace (and perhaps an alliance), and Mutimir sent his sons Pribislav and Stefan to the border to escort the prisoners, where they exchanged items as a sign of peace. Boris himself gave them "rich gifts", while he was given "two slaves, two falcons, two dogs, and 80 furs".
Aftermath
An internal conflict among the Serbian brothers resulted in Mutimir banishing the two younger brothers to the Bulgarian court. Mutimir, however, kept a nephew, Petar, in his court for political reasons. The reason of the feud is not known, though it is postulated that it was a result of treachery. Petar would later defeat Pribislav, Mutimir's son, and take the Serbian throne.
See also
Bulgarian–Serbian medieval wars
Bulgar-Serb War (839–42)
Medieval Bulgarian Army
Medieval Serbian Army
References
Sources
Primary sources
Secondary sources
Category:9th century in Serbia
Category:9th century in Bulgaria
Category:Wars involving medieval Serbian states
Category:Wars involving the First Bulgarian Empire
Category:850s conflicts
Category:Byzantine–Bulgarian Wars
Category:Bulgarian–Serbian Wars
Category:Principality of Serbia (medieval)
|
Family Panorpodidae (Insecta, Mecoptera) from Baltic amber (upper Eocene): new species, redescription and palaeogeographic remarks of relict scorpionflies.
The history of the species-poor family Panorpodidae is very interesting due to its uneven present distribution. The only fossils of the genus Panorpodes are two species known from Baltic amber, described in 1856 and 1954. A third species, Panorpodes weitschati sp. nov., is herein described. New diagnoses and descriptions as well as new drawings of all fossil species of Panorpodes are provided, including the first illustration of the wing of P. hageni. Fossil Panorpodes display three diametrically opposed patterns of wings markings, from the highly transparent wings of P. brevicauda, through transparent wings with dark bands and spots of P. weitschati sp. nov., to the dark wings with only narrow transparent bands of P. hageni. The fossil specimens are characterized by a great variability in wing venation, even in a single specimen, similar to that of living species.
|
Sanitary landfills (now there’s an oxymoron) are quite often situated along the primary gateways to the community they serve. Sure, an expressway allows for easy access to the dump by those dingy looking and overloaded welcome wagons of trash. They converge on these mini-mountains like motorized cockroaches, drawing thousands of flying rats (seagulls) to the site.
But, my question is why place one of your least sightly land uses right where anyone and everyone can see it? Is it meant to be a not-so subtle deterrent? Considering that first impressions are lasting, a landfill a lousy way to introduce ourselves? It’s like greeting visitors and newcomers alike with a clear demonstration of how much shit we produce.
Here in Michigan we are particularly bad about siting sanitary landfills along primary highway corridors. Just north of Detroit’s Metropolitan Airport, are several mega-landfills along I-275. You’d think the region was suffering from the mumps given how out-of-place and unnatural these artificial mountains look compared to the generally flat landscape around them. One former landfill south of Detroit is even nicknamed, Mount Trashmore. Frankly, I cannot think of a worse way to welcome visitors from around the globe to our state.
Garbage gateways can be found here in Michigan along I-96 northwest of Lansing,; along U.S. 127 north of Lansing; adjacent to I-94 southeast of Kalamazoo; and in a plethora of other very visible sites. The litany of landfills in this state provides a visual anthesis to the sanitized “Pure Michigan” signs, billboards, slogans, and related spin. Our state has many very beautiful locations, but its waste legacy and many of its landfills are not among them. Perhaps, the next promotional theme could be “What a Waste!”
Michigan is certainly not alone in siting landfills at gateway sites, as one is greeted by a landfill along I-94 in Northwest Indiana, near Chicago and along other key transportation corridors in many states. Landfills seem to have become the 21st century equivalent of automobile junk yards set at the outer entries to cities across the nation.
I realize that until we achieve zero waste production, landfills are a necessary evil, but must they be situated in a manner as to be the unofficial gateway to the community? Let the stupid motorized cockroaches travel down some less-traveled road to dump their loads or better yet, let’s come up with a cost-effective (and mandatory) method for producing zero solid waste so we don’t need landfills any longer. Zero Waste America has some suggestions on its website for accomplishing that goal. Hopefully, Michigan and other states across the country will soon put more of these suggestions into practice.
|
Christian Cooke
Christian Louis Cooke (born 15 September 1987) is an English actor. He is known for playing Luke Kirkwall in Where the Heart Is, Luke Rutherford in Demons, Dorian Gaudain in Trinity, Freddie Taylor in Cemetery Junction and Len Matthews in the Channel 4 mini series The Promise. Cooke's most recent roles include ex-soldier Graham Connor in Crackle's original drama The Art of More and Mickey Argyll in BBC's three-part adaptation of Agatha Christie novel Ordeal by Innocence.
His other television roles have included Echo Beach (2008), Magic City (2012–13) and Witches of East End (2014). His other film roles have included Mercutio in Romeo & Juliet (2013), Electricity (2014), Love, Rosie (2014) and Drunk Wedding (2015).
Background
Cooke was born in Leeds, West Yorkshire, where he attended St Mary's Menston Catholic Voluntary Academy. He has an older brother, Alexander, a younger sister, Gabrielle, and is a first cousin to Mel B from the Spice Girls through his mother, Di, who is sister to Mel's mother, Andrea Brown.
Cooke began his acting career at the age of 10 when he appeared in a production of Bedazzled at the Bingley Arts Centre. His first television appearance was in a commercial for Birds Eye beef burgers, shortly followed by his first lead role as Wilmot Tanner in Granada Television series Wilmot. His career progressed from there.
Career
Cooke played the role of Luke Kirkwall from 2000 to 2006 in the ITV drama Where the Heart Is and guest starred in Doctors, Barking!, The Royal, Casualty & Inspector George Gently. In 2007, he starred in one episode of BBC's Robin Hood as Will Scarlett's younger brother Luke and made his film debut in the short film Wish.
Cooke also appeared in BBC One's The Chase and played Brae Marrack in the ITV1 soap opera Echo Beach. He guest-starred in the Doctor Who episodes "The Sontaran Stratagem" and "The Poison Sky", playing UNIT soldier Ross Jenkins, in 2008.
During 2009, he played the lead roles of Luke Rutherford in ITV1's supernatural drama Demons & Lord Dorian Gaudain in ITV2's eight-part drama Trinity, where he had several rear nude scenes in its first episode, and appeared in Syfy's television film Dark Relic the following year. He went on to play the lead role of Freddie Taylor in Cemetery Junction and starred in the critically acclaimed Channel 4 four-part drama The Promise, directed by Peter Kosminsky in 2011.
That same year, Cooke made his directorial debut in Chandide, an independent short film based in London written & produced by Trinity co-star Arnab Chanda, who also starred in the lead role, before completing Paramount Pictures' romantic comedy Drunk Wedding. The following year, he featured in 1950s Miami-set drama series, Magic City, which came to a close after two seasons in August 2013.
Cooke's film career has since grown in the form of two collaborations with director Bryn Higgins, titled Unconditional and Electricity, starring alongside Charlie Cox in British independent Hello Carter, playing Mercutio in Carlo Carlei's Romeo and Juliet and starring alongside Lily Collins in British-American romantic comedy Love, Rosie. He also made a return to short films, starring in Nativity-inspired Anomaly before taking the lead in Fare with Maimie McCoy, and has since featured regularly throughout the second season of American television series Witches of East End before Lifetime announced the show's cancellation in November 2014.
Spring 2015 saw Cooke return to British television in BBC two-part book-adaptation drama Stonemouth, the first adaptation of Iain Banks' work since his death in 2013, opposite Sharon Small, Gary Lewis & Peter Mullan, as well as the announcement of Magic Citys movie adaptation starring alongside Bruce Willis & Bill Murray, reprising his role as Danny Evans. On top of his return to British television, his role as Stewart Gilmour in Stonemouth marked his return to a lead role, and towards the summer of 2015 came the announcement of a return to directing with Peter Mullan & Michelle Fairley taking the lead roles in short film Edith; news that was followed by the release of Crackle original drama The Art of More, leading alongside Dennis Quaid & Kate Bosworth, where Cooke starred as ex-soldier Graham Connor.
The start of 2016 brought in a reunion with Hello Carter director Anthony Wilcox, starring alongside Example, for Instagram-exclusive Shield 5, the first short film to be distributed across this platform. A year later, and Cooke's career grows in the form of a role in the premiere theatre production of Experience by Dave Florez at Hampstead Theatre, appearing in Yaël Farber's production of Knives In Hens by David Harrower at the Donmar Warehouse and collaborating with Edith producers Sara Huxley & April Kelley to co-produce comedy series Annie Waits.
In April 2018 Cooke played the part of Mickey Argyll in Ordeal by Innocence, a role initially portrayed by Ed Westwick, who was replaced by Cooke amid allegations of sexual assault.
Projects currently under way for Cooke include short film Everything You Didn't Say alongside Magic City co-star Olga Kurylenko, a Netflix adaptation of Point Blank and a feature film adaptation of Knives In Hens, titled Embers.
Filmography
Television
Film
Director
Producer
Theatre
References
External links
Category:1987 births
Category:English male film actors
Category:English male television actors
Category:Living people
Category:Male actors from Leeds
Category:People educated at St. Mary's Catholic High School, Menston
Category:20th-century English male actors
Category:21st-century English male actors
Category:English male child actors
|
USA Midwest Province Jesuits with Established Allegation(s)
of Sexual Abuse of a Minor
USA Midwest Province Jesuits with an Established Allegation of Sexual Abuse of a Minor
The USA Midwest Province was formed in June 2017 from the former Chicago, Chicago-Detroit, Detroit, and Wisconsin provinces, and encompasses Illinois, Indiana, Iowa, Kentucky, Michigan, Minnesota, Nebraska, North Dakota, Ohio, South Dakota, Wisconsin and Wyoming. In 2020, the USA Midwest Province has 490 Jesuit members; approximately 4,000 Jesuits have served in the province since 1955. An established allegation is based on the facts and circumstances of each case wherein there is a reasonable certainty that the sexual abuse of a minor occurred.
An established allegation is based on the facts and circumstances of each case wherein there is a reasonable certainty that the sexual abuse of a minor occurred. An established allegation leads to the Jesuit’s permanent removal from public ministry and possible criminal prosecution. The names on this list are based on a process of consultation and not a legal judgment.
This list is based on investigations that have been completed. Jesuits with allegations that are currently being investigated have not been included on this list. If an allegation is deemed established, the list will be updated. We are also in the process of conducting an examination of our records utilizing outside, third-party investigators in order to make sure that our disclosure of names is complete. Fr. Paulson's letter explaining the list is here.
The list below is organized into three sections:
Contains the names of Jesuits and former Jesuits against whom an established allegation of sexual abuse of a minor was made and investigated while the Jesuit was living or against whom multiple established allegations were received after his death. While an allegation received after a Jesuit is deceased does not provide the opportunity for the Jesuit to respond, multiple allegations against a Jesuit may indicate a corroborative pattern of abuse which support the conclusion of established allegations.
Contains the names of Jesuits and former Jesuits against whom a single established allegation was received after his death. While any allegation received is investigated to the extent possible, an allegation received after a Jesuit is deceased does not provide the opportunity for the Jesuit to respond.
Contains the names of Jesuits whose names have been published on a diocesan website, another Jesuit province website, named in a civil lawsuit, named within a bankruptcy court process, and/or named in a grand jury report.
It is important to note that inclusion on this list does not necessarily mean that these allegations are true or correct or that the accused Jesuit has been found guilty of a crime or liable for any civil claim. Allegations reported decades after the alleged abuse make it difficult to investigate. In addition, some of these allegations were made after an accused Jesuit or former Jesuit died and therefore, he did not have the opportunity to respond for himself.
The Midwest Province encourages anyone who has been abused by a Jesuit to contact the appropriate civil authorities and also Marjorie O’Dea, Director of the Office of Safe Environment at 773-975-6876 or via mail to: 1010 N Hooker St., Chicago, IL 60642.
Updates and previous versions will be noted and linked here
Original list of those with established allegations - published 17 Dec 2018 (Version 1) in .pdf format
Original list of assigments of those with established allegations - published 21 Dec 2018 (Version 1) in .pdf format
Current Updated Lists - published 21 Feb 2020 - in .pdf format
Names of USA Midwest Jesuits with Established Allegations of Sexual Abuse of Minors - Update Published 21 Feb 2020
All Pastoral Assignments of Midwest Jesuits with Established Allegations of Sexual Abuse of Minors - Update published 21 Feb 2020
|
Unemployment
Unemployment is a serious economic issue that affects almost all countries and all people either directly or indirectly. In most market economies not everyone will have jobs all of the time. It is important to understand unemployment and its causes in order to develop policies to help those individuals who suffer from the adverse effects of being unemployed. The unemployment rate in the United States is never zero and usually remains between 5 and 6 percent with some years being slightly better or worse. Unemployment rates fluctuate everywhere depending on the economic circumstances of the time. There are some important things to understand when looking at unemployment:
|
A movie, directed by Alan Peterson, which rebuts some of the deceits in Michael Moore's movie, Fahrenheit 9/11. It includes appearances by actor Ron Silver, Democratic Senator Zell Miller, author Ann Coulter, political adviser Dick Morris, and author Dave Kopel. It documents the misuse of information and footage in Moore's film and combts some of his ideas. Nowhere near as hyped as Moore's film, therefore, nowhere near as profitable.
|
Check out the new single from the "Boss Lady" mixtape featuring Harmony Ella "Next" and if you don't have the "Boss Lady" mixtape your super slow, but you can still download it from www.jigalowrecords.com right now. Hit the like button, hit the share button and for those three haters we know what button yall gonna hit lol!
|
Canciones con alma
Canciones con alma (Songs with Soul) is a studio album by Mexican singer Flor Silvestre, released in 1972 by Musart Records. It is Flor Silvestre's second bolero album.
Critical reception
Billboard included the album in its Top Album Picks section and gave it a positive review: "A good solid LP overall of love ballads. Best cuts: 'Vuelve,' 'Tormento,' 'Quisiera.'"
Track listing
Side one
Side two
Personnel
Salomón Jiménez – arranger
Gustavo A. Santiago – director
References
External links
Canciones con alma at AllMusic
Category:1972 albums
Category:Flor Silvestre albums
Category:Musart Records albums
Category:Spanish-language albums
|
[Music]
Before, you know, if a worker was out, you
were searching through filing cabinets or
their desk drawers, looking for a record or
a piece of paper, and now it's in the system,
and we don't have to do that, so it saves
a lot of time.
[Music]
I was a little, I'll be honest with you, I
was a little iffy about how my elderly clients
would handle the tablet, but they took to
it great.
[Music]
So the case decision can be quicker, if that
is the case, they did something really horrible,
but just normal day to day cases, I think
the social workers, the benefit for the social workers,
well I've gone and lived this horrible,
whatever it was, situation, and I'm done because
it will take you back to your feet, you know
get back to the agency, the documentation
is done, the pictures are taken, everything
is already filed,
[Music]
so I don't have to re-live this again, and document this again in another
hour.
[Music]
Especially with the APS cases, if you go into
a home, and the home is disgusting and there's
maggots, and say it's just hard to explain
to your supervisor exactly the total nastiness
that you just experienced, then you can show
it to them on the camera.
It has definitely saved me a lot of time.
It's kept me up to date on my documentation,
where as before I was behind.
Actually, our whole unit was behind until
we implemented Northwoods, and now I believe
we're all up to date.
[Music]
If, to me, the benefit would be that if it
was implemented state-wide, then all of
us would be on the same page.
We would all know exactly how the system worked,
then the state would have to conform to exactly how the system works.
[Music]
|
On the mechanisms enabling myocardial edema contrast in bSSFP-based imaging approaches.
The biophysical mechanisms influencing balanced steady-state free precession (bSSFP) based edema imaging in the setting of acute myocardial infarction are not well understood. To assess the various mechanisms that enable the detection of myocardial edema on bSSFP-based imaging approaches (cine bSSFP and T(2)-prepared bSSFP), experiments were conducted in canine models subjected to ischemia-reperfusion injury. Results showed that in addition to relaxation effects, the alteration in thermal equilibrium (M(0)) (including magnetization transfer) has a significant contribution to the image contrast between edematous and healthy myocardium. The relative signal-intensity ratios between edematous and healthy myocardium were: 1.51 ± 0.18 (cine bSSFP) and 1.58 ± 0.20 (T(2)-prepared bSSFP); the theoretically estimated relative relaxation and M(0) effects were: 1.17 ± 0.09 and 1.30 ± 0.19, respectively (cine bSSFP), and 1.49 ± 0.23 and 1.06 ± 0.07, respectively (T(2)-prepared bSSFP). There were no significant difference between cine bSSFP and T(2)-prep bSSFP relative signal-intensity ratios. However, the relative relaxation effect in cine bSSFP was significantly lower than in T(2)-prep bSSFP (P < 0.05), and the M(0) effect in cine bSSFP was significantly higher than in T(2)-prep bSSFP (P < 0.05). Hence the acquisition strategies that wish to maximize myocardial edema contrast in cine bSSFP imaging should take both relaxation and M(0) effects into account.
|
Resource-constrained rate control for Motion JPEG2000.
With the increasing importance of heterogeneous networks and time-varying communication channels, fine scalability has become a highly desirable feature in both image and video coders. A single highly scalable bitstream can provide precise rate control for constant bitrate (CBR) traffic and accurate quality control for variable bitrate (VBR) traffic. We first propose two leaky-bucket rate allocation methods that provide constant quality video under buffer constraints. These methods can be used with all scalable coders. Moreover, we make use of one of these methods (DBRC) and extend it so that it can be used when multiple sequences are multiplexed over a single communications channel. The goal is to allocate the capacity of the channel between sequences to achieve constant quality across all sequences. Experimental results using Motion JPEG2000 demonstrate substantial benefits.
|
Vintage Cars at Bromham Mill
Part of the Bromham Show, 9th July 2017.
These images can be downloaded using the download button, they are fine for sharing on social media and the web, however not for printing. If you own one of the vehicles in this gallery and would like a high resolution image(s), please drop us an email with the image number(s).
|
It took Tony Komaroff over thirty years to get this done but it may have been worth it. Komaroff, Harvard doctor, researcher and ME/CFS advocate, has been studying, writing about and advocating for ME/CFS research since at least 1987 when he was the senior author on no less than four studies.
Over his long research history, he’s examined pathogens, the immune system, brain scans, hormones, the autonomic nervous system, cognition and others. His huge 1996 “health status” study demonstrated that people with ME/CFS were more functionally inhibited than people with congestive heart failure, type II diabetes mellitus, heart attack, multiple sclerosis, and depression. All in all, Komaroff has co-authored over 80 studies on ME/CFS.
Only three times has he been able to get something published in JAMA. Ironically, his first “ME/CFS” study – on chronic Epstein-Barr virus – way back in 1987 landed in JAMA. Except for a comment he got published in 1997, that was it until this year when he got “Advances in Understanding the Pathophysiology of Chronic Fatigue Syndrome” article published.
Komaroff’s been doing overviews of ME/CFS for years. In 2015, he scored a coup when he got “Myalgic Encephalomyelitis/Chronic Fatigue Syndrome: A Real Illness” published in the most widely read general internal medicine journal – the Annals of Internal Medicine.
This is different – this is JAMA, the flagship journal of the American Medical Association – “the professional organization for physicians in the United States.” Reportedly “the most widely circulated general medical journal in the world”, JAMA is not a specialty journal; it doesn’t focus on neurology or immunology – it’s a general medical journal aimed primarily at doctors and medical students.
It gets around. JAMA states that its Impact Factor (51.3) is one of the highest in medicine and science, that its website gets almost 25 million visits a year, and that it has more than 750,000 followers on Twitter and Facebook.
Getting this article published in JAMA means more than quite a few doctors and medical students are getting a new view of ME/CFS. It also means the editorial staff of JAMA believes Komaroff’s message – that ME/CFS is a real disease – has merit and that doctors should be exposed to it – a good sign. Komaroff wrote:
JAMA’s “published very little about ME/CFS over the years, but are warming to the subject. They probably are the most widely read English language medical journal in the world, and so their interest is important. The implicit message of the article is that there is a complex underlying biology to ME/CFS and that health authorities are taking it very seriously—which will probably come as a surprise to many readers.”
JAMA now knows that it has good reason to “warm” to ME/CFS. Komaroff’s article is not just beating the competition – it’s blowing it away. The 27,000 plus views it’s had over the past four days are far and away the most of any recently published article. Right now, Komaroff’s article is about 10,000 page views ahead of its closest competitor with most JAMA articles getting around 3-5K views.
Update: as of July 19th the article has received over 57,000 page views, which according to an analysis of the articles appearing on JAMA in 2018, would – just two weeks after its publication- would put it in the top ten most viewed articles of that year.
This is despite the fact that the article is not easy to find. It was published online on July 5th (not in the official JAMA editions on July 2nd/9th) yet readers are still flocking to it. The article is now highlighted in a box marked “trending” – which will undoubtedly get it more views.
The Article
The article is not long but it is impactful. Komaroff smartly refers to the 2015 Institute of Medicine report on ME/CFS, produced by an institution that the doctors/medical students reading this article will know, appreciate and presumably trust. Komaroff has the doctors and medical students know that this report concluded that “ME/CFS is a serious, chronic, complex systemic disease” that affects up to an estimated 2.5 million people in the United States, and causes from $17 billion to $24 billion in economic losses annually in the U.S.
As to the idea that ME/CFS is not a real disease – well, many of the tests doctors used in the 1980’s when ME/CFS first leapt onto the scene in a big way (and the tests that doctors still use today) couldn’t find anything wrong. Many doctors concluded that meant there really was nothing wrong, but Komaroff asserts that the results of the next 3 decades indicate that it was the tests that were wrong (and the doctors who put too much faith in them) – not the patients.
The overwhelming weight of scientific evidence over the past three decades suggests that something has gone wrong biologically in ME/CFS. Most of the tests, which have done that, though, cannot be accessed in doctors’ offices.
Komaroff then quickly spins through the abnormal findings – the autonomic and central nervous system, metabolic, immune, hormonal and exertion findings. Thankfully, he includes the inability to repeat energy production levels on the second day of a two-day exercise test. (Unfortunately, the uniqueness of that finding did not make it into the paper.)
Unifying Models
It’s in the Unifying Model section that things gets really interesting. Komaroff has always been conservative. He’s careful, he doesn’t go out on limbs – and that’s been helpful at times and at times not. Komaroff, for instance, signed off on the chronic fatigue syndrome name in 1988 (it was called chronic Epstein-Barr virus syndrome), he voted against approving Ampligen for ME/CFS (he wanted more studies – which he must have known were not likely to happen – and six years later, haven’t happened and aren’t likely to), and his support of Bill Reeves and the CDC when they were under attack all showed just how conservative he can be. That innate conservatism, however, has also probably enabled him to be a bridge to the outside research world. It’s possible Komaroff is the only figure that could have gotten this paper into JAMA.
That made the first part of the first sentence in the unifying hypothesis section really surprising:
“What if ME/CFS reflects the activation of biologically ancient, evolutionarily conserved responses to injury or potential injury, a pathological inability to turn these responses off, or both?”
Komaroff – our conservative liaison to the medical community – has clearly bought into Naviaux’s dauer hypothesis. Two paragraphs later, he devoted a full paragraph to it, and overall, about 10 percent of this short paper – Komaroff’s outreach to the medical community – is focused on it. He clearly wants doctors to know it’s possible ME/CFS patients are stuck in some kind of hypometabolic, hibernation-like state.
The other model Komaroff presents ends up in a similar state. In that model, neuroinflammation activates a fatigue nucleus in the brain which basically tells the body to shut down. That neuroinflammation could be triggered by any number of things – a herpesvirus infection in the brain, autoimmunity, neurotoxins, a breached blood-brain barrier, inflammation in the periphery that’s tweaking the vagus nerve (aka VanElzakker), gut inflammation and/or chronic stress. Each of these may be present in ME/CFS but in different individuals.
Or, the worm may be in play. Komaroff suggests people with ME/CFS may have gotten stuck in the ancient biological state of metabolic shutdown seen in the state of dauer that the Caenorhabditis elegans worm enters into, or the state of hibernation that some animals enter into during times of stress. Functionality flies out the window as the animal hunkers down and simply tries to survive.
(As the same end point is reached in both the neuroinflammation and the dauer hypothesis, who’s to say (other than perhaps Bob Naviaux :)) that the activation of the fatigue nucleus that Komaroff presents in the first model doesn’t also occur when humans, if they do, enter into a dauer state.)
If Komaroff was aiming at perking up some eyebrows, he surely succeeded. His neuroinflammation hypothesis will undoubtedly ring bells with many of the doctors, etc. who’ve read Komaroff’s article over the past couple of days. Few, on the hand, will have heard of dauer, or will have ever thought to possibly connect ME/CFS with a state of hibernation. (Compare the 27,000 plus views Komaroff’s article has had to the 4800 views the last JAMA publication on ME/CFS in August, 2018 had.)
The article’s Altmetric social media score shows that Komaroff’s ME/CFS JAMA article is scoring in the top 5% of all research articles. JAMA, like all medical journals, likes to know that its articles are being read. The more attention given to a subject, the more likely JAMA will revisit it again – and, of course, with its wide reach into the probably the most ignorant branch of our medical establishment – doctors – JAMA is one place that we really want ME/CFS studies to show up on. Please visit the original article here (no need to read it if you don’t want to) and share it via tweets, Facebook and other social media outlets.
In another sign that JAMA is coming around, on July 9th in its Biotech Innovations section, JAMA also published a short review of the ME/CFS nanoneedle study “Biomarker Test for Myalgic Encephalomyelitis/Chronic Fatigue Syndrome” that was recently published in Proceedings of the National Academy of Sciences. Please visit that article and pass it around as well.
Health Rising – a Vital Source of Information
Keep Us Rocking As Well
|
Immune response induced by major environmental pollutants through altering neutrophils in zebrafish larvae.
Environmental pollutants may cause adverse effects on the immune system of aquatic organisms. However, the cellular effects of pollutants on fish immune system are largely unknown. Here, we exploited the transgenic zebrafish Tg(lysC:DsRed2) larva as a preliminary screening system to evaluate the potential inflammatory effects of environmental pollutants. Tg(lysC:DsRED2) larvae aged 7-day-postfertilization (7 dpf) were treated with selected environmental chemicals for 24 h (24 h) and the number of neutrophils were quantified using both image analysis and fluorescence activated cell sorting (FACS). We found that the numbers of neutrophils in the Tg(lysC:DsRED2) larvae were significantly increased by most of the organic chemicals tested, including E2 (17β-estradiol), BPA (Bisphenol-A), NDEA (N-nitrosodiethylamine), 4-NP (4-Nitrophenol) and Lindane (γ-hexachlorocyclohexane). Neutrophil numbers were also increased by all the metals tested (Na2HAsO4· 7H2O, Pb(NO3)2, HgCl2, CdCl2, CuSO4·5H2O, ZnSO4, and K2Cr2O7). The only exception was TCDD (2,3,7,8-tetrachlorodibenzo-p-dioxin), which significantly reduced the number of neutrophils after exposure. Additionally, the transcription of genes (lyz, mpo, tnfα and il8) related to fish immune system were significantly modulated upon exposure to some of the selected chemicals such as E2, TCDD, Cu and Cd. This study revealed that representatives of major categories of environmental pollutants could cause an acute inflammatory response in zebrafish larvae as shown by alterations in the neutrophils, which may imply a common immunotoxicity mechanism for most environmental pollutants. This study has also demonstrated that Tg(lyz:DsRed2) transgenic zebrafish is an excellent tool for screening environmental chemicals with potential inflammatory effects through FACS-facilitated neutrophil counting.
|
Effect of estrogen administration on endogenous and luteinizing hormone-releasing-hormone-induced luteinizing hormone secretion and follicular development in the lactating sow.
The objectives of this study were to investigate whether estradiol treatment during lactation modifies 1) the patterns of endogenous LH, FSH, and prolactin (PRL) release; 2) the sensitivity of the pituitary to exogenous injections of LHRH; and 3) the responsiveness of the ovarian follicles to gonadotropin. Plasma LH, FSH, and PRL were determined in samples taken repeatedly from 18 sows on Days 24-27 of lactation. Ovaries were then recovered, and follicular development was assessed by measuring the follicular diameter (FFD) and follicular fluid estradiol-17 beta concentration (FFE) of the ten largest follicles dissected from each ovary. Sows were randomly allocated to one of four treatments: 1) Group C (4 sows) received no treatment; 2) Group LHRH (5 sows) received 800 ng of LHRH every 2 h throughout the sampling period; 3) Group E2 (4 sows) received subcutaneous implants containing estradiol-17 beta 24 h after start of sampling; 4) Group LHRH + E2 (5 sows) were administered a combination of LHRH and estradiol-17 beta implants. Between-animal variability for plasma LH, FSH, and PRL was considerable. LH concentration and LH pulse frequency increased (p less than 0.05) after LHRH treatment in the LHRH and LHRH + E2 groups; however, an acute inhibition of LH secretion was observed in the latter group immediately after estradiol implant application. In the absence of LHRH treatment, estradiol caused chronic inhibition of LH secretion. Follicular development was greater in the LHRH and LHRH + E2 groups compared to the C and E2 groups (p less than 0.05 for both FFD and FFE).(ABSTRACT TRUNCATED AT 250 WORDS)
|
Q:
MySQL ignores the NOT NULL constraint
I have created a table with NOT NULL constraints on some columns in MySQL. Then in PHP I wrote a script to insert data, with an insert query. When I omit one of the NOT NULL columns in this insert statement I would expect an error message from MySQL, and I would expect my script to fail. Instead, MySQL inserts empty strings in the NOT NULL fields. In other omitted fields the data is NULL, which is fine. Could someone tell me what I did wrong here?
I'm using this table:
CREATE TABLE IF NOT EXISTS tblCustomers (
cust_id int(11) NOT NULL AUTO_INCREMENT,
custname varchar(50) NOT NULL,
company varchar(50),
phone varchar(50),
email varchar(50) NOT NULL,
country varchar(50) NOT NULL,
...
date_added timestamp NOT NULL DEFAULT CURRENT_TIMESTAMP,
PRIMARY KEY (cust_id)
) ;
And this insert statement:
$sql = "INSERT INTO tblCustomers (custname,company)
VALUES ('".$customerName."','".$_POST["CustomerCompany"]."')";
$res = mysqli_query($mysqli, $sql);
Or using bind variables:
$stmt = mysqli_prepare($mysqli, "INSERT INTO tblCustomers (custname,company, email, country) VALUES (?, ?, ?, ?)");
mysqli_stmt_bind_param($stmt, 'ssss', $customerName, $_POST["CustomerCompany"], $_POST["CustomerEmail"], $_POST["AddressCountry"]);
mysqli_stmt_execute($stmt);
mysqli_stmt_close($stmt);
A:
If you're sure you're not using explicit default values, then check your strict mode:
SELECT @@GLOBAL.sql_mode;
SELECT @@SESSION.sql_mode;
MySQL Data Type Default Values
As of MySQL 5.0.2, if a column
definition includes no explicit
DEFAULT value, MySQL determines the
default value as follows:
If the column can take NULL as a
value, the column is defined with an
explicit DEFAULT NULL clause. This is
the same as before 5.0.2.
If the column cannot take NULL as the
value, MySQL defines the column with
no explicit DEFAULT clause. For data
entry, if an INSERT or REPLACE
statement includes no value for the
column, or an UPDATE statement sets
the column to NULL, MySQL handles the
column according to the SQL mode in
effect at the time:
If strict SQL mode is not enabled, MySQL sets the column to the
implicit default value for the column
data type.
If strict mode is enabled, an error occurs for transactional tables
and the statement is rolled back. For
nontransactional tables, an error
occurs, but if this happens for the
second or subsequent row of a
multiple-row statement, the preceding
rows will have been inserted.
Server SQL Modes
A:
What you are doing wrong is building your query using strings instead of using bind parameters.
Aside from the SQL injection vulnerability, the null values are being converted to empty strings even before the database sees them.
$x = null;
print_r("VALUES ('$x', 42)");
Outputs:
VALUES ('', 42)
In other words, you are inserting an empty string, not a NULL. To insert a NULL you would have needed to write this:
VALUES (NULL, 42)
If you use bind parameters then you won't get this problem and as a bonus your site won't have so many security holes. I suggest you read the answer to this question and follow the advice there. This will solve your immediate problem as well as improving the security of your site.
|
Q:
NOTEPAD++ Change line with variable inside
How to change big file like
GSKPP / 3520767 / 1 / 30300
to
GSKPP / 1 / 30300
if 3520767 is variable?
EDIT:
A:
Here is a way to go:
Ctrl+H
Find what: ^.*?\K/\s+[a-z]?\d+
Replace with: EMPTY
Replace all
Explanation:
^ : begining of line
.*? : 0 or more any character, not greedy
\K : forget all we have seen until now
/ : slash
\s+ : 1 or more space
[a-z]? : an optional letter
\d+ : 1 or more digits
|
Lion Island, Géologie Archipelago
Lion Island is a small rocky island north-northeast of Petrel Island in the Geologie Archipelago. It was surveyed and named by the French Antarctic Expedition (1949–51) under Andre Liotard. The name derives from the rock summit of the island which has the shape of a lion's head.
See also
List of Antarctic and sub-Antarctic islands
Category:Islands of Adélie Land
|
Background
==========
Tissue-based diagnosis includes all diagnosis procedures to analyze spatial configurations of biological functional units. Most frequently cells, cellular agglutinations such as vessels, nerves, glands, etc. are being investigated. Additional structures such as gene sequences, cellular movements, or membrane potentials are covered in advanced studies \[[@B1]-[@B7]\].
From the medical point of view it can be distinguished between several categories, namely
a\) conventional or \"classical histological and cytological\" diagnosis,
b\) \"prospective\" diagnosis,
c\) \"indicative\" diagnosis, and
d\) \"risk-assigned\" diagnosis \[[@B8],[@B9]\].
The different categories of diagnosis require different technologies to be applied, and will lead to different clinical impacts as shown in \<table [1](#T1){ref-type="table"}\>.
######
Diagnosis categories and medical application
**Diagnosis Category** **Medical Task** **Examples** **Tools**
------------------------ ------------------------ ----------------------------------------------------------- ----------------------------------------------------------------------------------------------
*Conventional* Disease classification Lymphoma, Chronic hepatitis, Lung carcinoma Classic microscopy, Immunohistochemistry, Molecular biology, morphometry, structure analysis
*Prospective* Prognosis TNM-stage, tumor proliferation rate, Apoptosis, Adhesion, Immunohistochemistry, morphometry, structure analysis
*Indicative* Therapeutic agents Hormone receptors, Herceptin Immunohistochemistry, Molecular biology, morphometry, structure analysis
*Risk-assigned* Risk factors BRCA1-gene Molecular biology
The classical diagnosis is a prerequisite for any reliable treatment of chronic diseases such as cancer or chronic inflammatory lesions, and, by the way, is by far the cheapest diagnostic medical procedure \[[@B8],[@B9]\]. It is also quite independent from its medical environment, i.e., the specialization of a hospital or pathology institution in contrast to the other diagnosis types.
That of prognosis-associated information requires detailed clinical information in addition to molecular pathology investigations \[[@B8],[@B9]\].
The recognition of a \"risk-associated disease\" such as the genetic predisposition to developing breast cancer is the duty of highly specialized (molecular genetic) institutions or departments.
Therefore, institutions involved in tissue-based diagnosis should have access to a variety of sources for data, information, and knowledge, to enable working in an efficient manner. At the same time they can provide integrated and highly abstracted information of the disease and direct the necessary treatment. This central embedding of diagnostic pathology has opened new doors in medical communication.
It started with telepathology providing on-line and off-line procedures to electronically transfer diagnostic useful information, and continued with image analysis applications available via the Internet. The essential tools are depicted in (figure [1](#F1){ref-type="fig"}). On-line telepathology can be assumed as a static and asynchronous approach sending information upfront without the flexibility for the \"sender\" to immediately react to the reviewer\'s advice. User\'s had to \"synchronize\" their email communications in telephone conferences \[[@B10]-[@B23]\].
{#F1}
Another on-line technology for telepathology is the Remote Controlled Microscope. This is used by small surgical units, which do not host a surgical pathologist. The installed remote control microscopes require also \"visually controlled tissue sampling and cutting tables\". The systems permit intra-operative diagnosis of pathologists working with a congruent control and survey system installed in a remote pathology department or institution \[[@B24]-[@B31]\].
Different to these on-line telepathology systems the so-called off-line telepathology has been developed. Specific servers have been implemented to enable expert consultation, secondary advices, or to provide even a \"virtual pathology institution\" capability \[[@B9],[@B10],[@B32]-[@B41]\]. These systems are usually completely embedded into the Internet. Three main systems have been implemented so far, the iPATH \[[@B10],[@B18],[@B42]\] in Basel, Switzerland; the UICC-TPCC (Telepathology Consultation Center of the Union International Contre Cancer in Berlin, Germany \[[@B40],[@B43]\], and the Telepathology service of the Armed Forces Institute of Pathology (AFIP), located in Bethesda, Maryland, USA \[[@B40],[@B43]-[@B46]\]. These platforms allow sending information between distributed users; however, there is no interaction with communication systems or to grant access to computation facilities or specific data bases.
Another system, the Electronic Automated Measurement User System (EAMUS™, \[[@B47]\]) automatically measures the staining intensities and derived features of images acquired from immunohistochemically stained glass slides. It is an open system and can be accessed via the Internet \[[@B48],[@B49]\].
Obviously, these systems are all build on a specific purpose and cannot interact with each other. They can be considered to be precursors of more advanced and broader designed networks meeting the characteristics of a virtual network, a Grid.
All these systems require digital images acquired from a histological glass slide that are a prerequisite to using these tools. Today, still images of limited size (SVHS, or other formats of approximately 1000 × 1000 pixels) serve for these purposes. The glass slides are still archived in the conventional manner. However, since about two years glass slide scanning technologies are available, which acquire a complete glass slide and also provide interfaces for digital archives and support advanced Internet Communication between pathologists for interactive remote consultation \[[@B48],[@B49]\]. In a next step diagnostic pathology would move on from image acquisition generating \"Digital Slides\", into Virtual Networking, i.e. -- using a Grid.
Grids are based on open standards like PACS (Picture Archiving and Communication System) for Medical Imaging and provide a simple, fast, resilient and open framework. They are designed to generate an easy to use platform for delivering intra- and interdisciplinary collaborative medicine. Images would be one core, and Health Care Systems can share pathology, cardiology, radiology and other digital images across sites.
Grid Technology enables physicians to access and use all compute and storage resources available in a virtual network. Users are granted physical freedom from the underlying technology, enabling fast remote access. Healthcare providers can leverage computing and storage resources across multiple departments and sites. By sharing resources, Grid technology will help to eliminate hardware vendor \'lock-in\' via vendor agnostic architectures.
Obviously, immediate access to different diagnostic resources will improve the patients\' care and physicians\' diagnosis ability. Naturally, the network has to provide security and privacy to protect the patients\' confidentiality.
What are the features of a Grid? Which Grids related to tissue-based diagnosis do already exist, and which specificities can be implemented in computational diagnostic pathology? Is the design of the existing telepathology services appropriate to be migrated into an advanced Grid system? Which features are promising, which ones have to be modified, or even neglected?
This article tries to give some answers from the technological and medical point of view to these questions. In addition, we want to describe the basics of Grid technology in relation to future changes in tissue-based diagnosis, which will most likely occur, in our opinion.
Definition and description of Grid technology
=============================================
Basically, a Grid is an Internet embedded network consisting of a broad variety of connected nodes. These nodes can be compared to servers and assure a platform of communication standards, which permit the users to concentrate solely on their individual tasks. The function of a Grid is also network computing, and can be considered to be a derivative of the development and maturation of the Internet \[[@B50]\]. The principle of implementation is analogue to the implementation of power supply \"grids\" that continuously supply households with electrical power independently where the power has been generated. A Grid uses, in place of electrical power, standardized information transfer between different nodes, for example between data sources, image servers, and highly specialized measuring systems. Similar to telephone services the user does not notice the various embedded communication pathways (e.g. cable, microwave, satellite) and computers. In addition, he is usually not informed whether he actually is connected to a computer system installed in the Far East, in Europe, or in the USA. These approaches to network computing are known as metacomputing, scalable computing, global computing, and Internet computing. Grids enable to share, select, and aggregate a broad variety of resources and devices that are geographically distributed and owned by independent organizations. The generic setup is shown in (figure [2](#F2){ref-type="fig"}). The main applications include large-scale computational and data intensive problems in science, engineering, and commerce.
{#F2}
Basically, the components of a Grid include the end users or clients, the distribution and control nodes, and the servers, anyone able to perform the requested tasks. The concept of Grid computing was primarily developed to make use of the installed compute power, which was not fully utilized (e.g. office equipment during the off-hours). The benefits are improving the execution time for a compute intensive job in linking -- even geographically dispersed computers -- in order to combine their computational power for this individual job. As more users might be interested using this approach all their workload has to be managed to optimize the offered capacities and services. The infrastructure of a Grid is a computer-based collaborative environment using a management software layer (Middleware). This software layer again requires computation nodes, the so-called brokers. A Grid sourced broker administers the workload, potential problems, discovers free resources, and controls the
Grid services
=============
A client uses a Grid to solve his specific tasks, and to receive a solution independently where and by which individual systems, called resources, it has been generated. The Grid manages the accessibility of the combined distributed resources and their services. Therefore, it is adequate to analyze the implemented types of services from the end-user\'s point of view. These include computational, data, application, information, and knowledge services, which can be described as follows:
*Computational services*deal with secure distributed computational resources for executing application jobs and are provided by so-called resources brokers. They serve for the set up and analysis of high energy experiments, and are also a useful tool in astrophysics. Computational services solve tasks that require high computational power, for example to solve recursive formulas. In its simplest manner, a computational task is transferred to one of the distributed supercomputers. This computer takes the job as long as it is not busy with or overloaded by other tasks. Once this happens, the task and its computational stage are transferred to another included supercomputer, etc. as long as the task is not finished. Examples of computational Grids are: NASA IPG \[[@B51]\], the World Wide Grid \[[@B52],[@B53]\], and the NSF Tera-Grid \[[@B54],[@B55]\].
*Data services*offer secure access to distributed datasets. They manage access, retrieval, storage, replication, or catalogues of individual or distributed libraries. In a more simple structure their services can be implemented by so-called links, which has been realized by several search machines. These so-called Data Grids are used in the area of high-energy physics \[[@B56]\] or drug design \[[@B57],[@B58]\]. Another derivative is a Storage Grid as applied for Medical Imaging or data analysis in neurophysiology \[[@B59]\].
*Application services*manage Grid application and give access to remote software, libraries and Web services. They represent the next higher level built on computational and data services provided by the Grid. They combine the computation of specific formulas with access to prerequisite data sets. As an example, the user might be interested to viewing the shape of a new macromolecule that has some structural similarities to a known one. The application services provide the adequate formulas, and, in addition, the necessary databank of parameters etc. to fulfill this task. In tissue-based diagnosis, the EAMUS™ \[[@B9],[@B48],[@B49]\] can be considered as a simple, one node implementation of this service. A well known Grid application service is, for example, created by NetSolve \[[@B60]\].
*Information services*are at an advanced level of application services. They try to extract and present information provided by data of computational, information, and/or application services, and to put these into relationship. In tissue-based diagnosis, a simple implementation could be created by combining the EAMUS™ services with an existing telepathology information system such as UICC-TPCC, or iPATH. At low-level information services handle the way that information is represented, stored, accessed, shared, and maintained (Meta Data). An example of this service is the EU-sponsored Virolab Grid, a project that addresses the problem of HIV drug resistance. Its service offers the integration of biomedical information, advanced applications, patients\' data, and intelligent literature access \[[@B61]\].
*Knowledge services*are the most advanced Grid services from the viewpoint of informatics. They are designed to supporting users in achieving their particular goals or objectives. They offer tools to improve with the way that knowledge is acquired, used, retrieved, published, or maintained. Knowledge is understood in a broad sense or as information applied to achieve a goal, solve a problem, or execute a decision. A characteristic example is data mining for automatically building a new knowledge. In tissue-based diagnosis it would be an appropriate tool in screening and evaluating virtual slides prior to be viewed by the pathologists, or to direct the clinician to providing pathologists with mandatory clinical information \[[@B8],[@B23],[@B62]-[@B64]\].
Basic Grid structure (architecture)
===================================
Grids are designed to integrate and utilize distributed resources in terms of location and functionalities. A Grid system has 1) to handle the access of the user and the presentation of the obtained results. This is done in the \"presentation tier\", which includes a portal framework and the application/presentation management. These (transformed and standardized) data have to be fed into the internal execution network, which is the functionality of the \"service tier\". These programs present the Grid middleware and provide location-independent data access, integration, transformation (standardization), and transport of data, tasks, and results as shown in (figure [3](#F3){ref-type="fig"}). The whole network has to be monitored. This is done by programs of the \"resource tier\" that check the availability of resources, their workload, dynamic status and activity of the network. In principle, a Grid is an open and dynamic communication system and requires the appropriate implementation of security services. Specific service oriented architectures (SOA) can be implemented to enable the flexibility for the Grid to adopt to changes of the workflow process, business environmental, or end user features and capabilities. The principle of a Grid structure is shown in (Figure [4](#F4){ref-type="fig"}). All tiers are composed of hardware and software. The *image acquisition tier*presents the scanners, digital cameras and microphones, image generation and image management SW. The control software of the microscope or scanner itself (e.g. focussing on the field of interest) can be considered being part of this tier. As image acquisition requires the glass slide preparation; this can also be assumed becoming part of image acquisition, especially if Barcode labelling and tracking is part of the implementation. The *presentation tier*includes workstations, software to handle Internet based access and data transfer, and to present the image to the pathologist. The *service tier*includes application servers, line connections, and programs to transfer and direct data streams, to interact with remote control computers, or to monitor access and response times. The *resource tier*includes the local resources in terms of management servers, information access devices such as specific measurement systems, and a broad variety of data bases and software such as libraries or specific application or execution programs. The compliance to open standards is an important aspect of any Grid component. Only these standards permit a Grid internal communication and security. They are created and internationally defined by consortia such as the Global Grid Forum (GGF), IETF, W3C and OASIS.
{#F3}
{#F4}
Internal Grid environment
=========================
The Grid architecture consists of hardware and software that provide, control, and actualize the required functionality. It presents globally distributed resources, called the Grid fabric, as well as the Grid Middleware. Grid applications and portals to be accessible by the user can be considered the third element of the environment. Derived from these compartments four main aspects characterize a Grid in general:
Multiple administrative domains and autonomy have to be combined, synchronized, formed to collaborative function, and supervised
--------------------------------------------------------------------------------------------------------------------------------
Grid resources are geographically distributed and usually belong to different administrative domains and organizations. The autonomy of resource owners, their local resource management and usage policies have to be acknowledged. Their primary local function has not to be touched or even disturbed. It is quite rare that Grid resources only serve for an individual Grid; usually they provide primarily services which they have been designed to.
Heterogeneity is a quality sign of a Grid and has to be carefully considered
----------------------------------------------------------------------------
Grid resources are heterogeneous in nature and encompass multiple technologies. The more can be incorporated the more attractive the Grid becomes;
Scalability is a communication specific problem
-----------------------------------------------
Open communication networks are dynamic. They might grow or shrink. The physical and functional communication channels can cause remarkable delay in information transfer and speed if a communication network expands to fast. The growth of a Grid cannot be foreseen, and might raise the problem of potential performance degradation as the size of Grids increases. Consequently, applications that require a large number of resources must be adequately designed.
Flexibility and coping with the dynamics of the resources are the main task of the Grid Middleware
--------------------------------------------------------------------------------------------------
The Grid Middleware provides capabilities to dynamically identify vacant and non-accessible resources and Workload Balancing ensures the efficient use of the accessible capacities.
Designing a Grid environment requires consideration of various designs to ensure the workflow and the long-term stability. For example, the definition of the information flow, supported communication protocols, file transfer technologies, networking technologies and bandwidths limitations, security and access control management etc have to be defined.
Examples of implemented Medical Grids
=====================================
The implementation of a Grid is often the joint efforts several industrial partners and scientific institutions. These include, for example, NetSolve \[[@B60]\], Globus \[[@B65]\], or Legion \[[@B66]\]. In diagnostic medicine, aspects of diagnostic accuracy and reliability have been in focus of Grid applications. For example, an Age-Related Eye Disease Study system for classifying age-related macular degeneration from stereoscopic color fundus photographs has been published in 2001 \[[@B67],[@B68]\]. Live imaging applied for functional brain analysis by magnetic resonance technique (MRI) \[[@B69]\] is also undertaken with Grid technology. Grid systems to compute patients\' dose, image quality and system performance in cancer screening have been described \[[@B70]\]. Bioinformatics Grids to be applied for analysis of genes and NDA sequences \[[@B71]\] are additional examples. In therapy, a new term called radio-surgery has been introduced to describe potential applications of Grid technology in surgical procedures \[[@B72]\]. These examples indicate that Grids have emerged as a promising technology to handle large amounts of data and compute the specific medical requirements in radiology, bioinformatics, dermatology, and neurosurgery. Especially, digital medical image processing is a promising application area for Grids that try to fill the gap between the Grid middleware and the requirements of clinical applications. A Grid system (Grid Medical Archive System, GMAS) directed to share the access, storage and retrieval of digital images obtained in radiology, cardiology, and other medical live imaging departments enables the application of the common Picture Archive and Communication System (PACS) standard and other documentation systems to access fixed-content data including medical images and documents. An extension called Grid Medical Archive Solution Entry Edition (GMAS EE) has been designed for Regional Hospitals or live imaging departments within larger hospitals to reduce the entry price point for providers while still offering all the advantages of original Grid Medical Archive Solution (GMAS) solution \[[@B73]\]. GMAS EE will allow Hospital Information Systems to share cardiology, radiology and other digital images across sites, and to safely store patient cases for years. This Grid is powered by IBM, and based upon Bycast StorageGRID software, a standard in grid-based fixed-content storage \[[@B74]\].
Recently, the European Community released a new Grid project, called ViroLab \[[@B75]\] or \[[@B76]\]. This Grid is a joined venture of the following institutions: Universiteit van Amsterdam, Institute Universitair Medisch Centrum Utrecht, Institute of Computer Science AGH, Academic Computer Centre Cyfronet, Universita Degli Studi di Brescia, Universita Cattolica del Sacro Cuore, Institute de recerca de la SIDA, Katholieke Universiteit Leuven, Eotvos Lorand Tudomanyegetem, University College London, Virology Education B.V, and Universitaet Stuttgart. Its infrastructure has been designed and built by GridwiseTech, a company specialized in Grid computing \[[@B76]\]. The official starting date of the project was March, 1, 2006. Virolab has been designed as virtual laboratory focusing on viral infections, especially HIV/AIDS. The Virtual Laboratory will include tools to submit data for statistical analysis, visualization, modelling and simulation. Access to patients\' data and genetic information will allow clients to prognosticate the temporal virological and immunological response of viruses with complex mutation patterns to drug therapy.
Potential Grid solution in tissue-based diagnosis
=================================================
Grid-powered image storage and retrieval systems based upon Picture Archive and Communication System (PACS) applications have been developed for live imaging, neurosurgery, or dermatology. Examples have been reported in \[[@B51],[@B72],[@B77]-[@B80]\]. In contrast to these reports, implementations of Grids to be applied in tissue-based diagnosis have not been published to our knowledge. There are descriptions of systems that automatically evaluate cytology smears \[[@B81]-[@B83]\], or automated measure DNA content or expression of antigens \[[@B9],[@B84],[@B85]\], however, these tools can only be considered as precursors and do not meet the performance of a Grid in general, as they are designed for one analysis system with open access.
It would be quite difficult to build a tissue-based diagnosis Grid that includes the performance of conventional microscopes as its application would be limited. Furthermore, it would remarkable influence the common workflow in a pathology institution. The recently technologic progress in digitalization of the whole glass slide (creation of virtual slides) will open a new era in diagnostic pathology and probably promote Grid applications in tissue-based pathology. Virtual slides are digitized images and can be easily submitted to any computational procedure \[[@B8],[@B32],[@B48],[@B63],[@B86]-[@B90]\]. Thus, they are contemporary an appropriate client and a useful resource in an information or even knowledge Grid. The potential architecture of such a Grid is shown in (figure [5](#F5){ref-type="fig"}). The provided applications include a broad range of features that cannot or only to a minor part be fulfilled even by extended certification procedures. To be mentioned have: quality assurance of scanned images, completeness check of the scanned areas, selection of diagnosis -- significant areas, segmentation of objects and structures, digital structure of dictations, statistical analysis of diagnosis reports, standardized interfaces to hospital information systems, digital patients archive, embedding of an expert consultation system, and access to public libraries. Some of these resources do already exist. The EAMUS™ system \[[@B91]\], for example, already provides the client with image quality checks and image measurements. Its proposed extension is designed to perform an image screening to predefine the most likely diagnosis. Other resources have to be developed, especially the identification of diagnosis -- significant image areas. The duty of the brokers to be installed at the users\' level middleware is to administer the laboratory -- surgical pathologists -- secretary interactions, to manage the acute case -- history relation, and to aggregate the patient\'s data to \"a case\". The internet based communication service has to regulate and control especially pathology \<-\> hospital, and pathology \<-\> research institution coupling services. It is the so-called core middle ware and has to ensure the privacy of the patient, a secure information transfer, direct access to the present status of the diagnostic procedure, and to initiate, control, and finalize the reimbursements. Finally, the Grid has to work with hardware components, which define and control the speed of the data flow, the image and connection quality, as well as the accuracy of the underlying technical procedures.
![A layered Grid architecture to be applied in tissue-based diagnosis, according to \[92\].](1746-1596-1-23-5){#F5}
The proposed Grid realizes a virtual pathology institution. It acts simultaneously as data source, data processing, and posting (i.e., diagnosis releasing) system. The released diagnosis depends significantly on small image areas that contain the \"diagnosis clue\". To create a reliable Grid resource to selecting these small image compartments is probably the most difficult task of the proposed Grid. Whether this algorithm can be based upon numerical procedures or has to rely on predefined image examples still remains an open question.
In aggregate, we are convinced that Grid technology will be implemented in diagnostic surgical pathology in the near future. The process of glass slide digitalization will open the door to combine all available information resources in order to furthermore establish tissue-based diagnosis in the medical environment as it is the most reliable and even cheapest diagnostic procedure in numerous and social important diseases, such as cancer or chronic inflammatory lesions.
Acknowledgements
================
The financial support of the International Academy of Telepathology and of the Verein zur Förderung des biologisch -- technologischen Fortschritts in der Medizin e.V. are gratefully acknowledged.
|
Q:
Using bonding in debian 9?
debian 9 is installed by default without net-tools (deprecated).
If you try to install ifenslave, it will install net-tools (i don't wan't this).
How can i do this ?
A:
finally done by installing ifenslave (come with net-tools), and following tutorial
https://help.ubuntu.com/community/UbuntuBonding
|
There they go again
and who “they” is depends on who you are. If you’re a partisan liberal, like the vast majority of political writers at the Washington Post, “they” is the Rove-inspired GOP. No sooner did the Supreme Court strike a major blow at “a signature” part of the Bush administration’s anti-terrorism policy, then the unscrupulous Republicans are “seek[ing] advantage” from the Court’s ruling. How? By accepting the Court’s invitation to go to Congress in search of new rules on how to try terrorists and, to the extent that a disagreement emerges, making that disagreement a political issue.
If you’re not a partisan liberal, “they” is the MSM, hoping once again that their champions in the Democrat party can receive an exemption from the democratic process, and crying foul when they don’t get one. The Republicans, of course, can gain political advantage only to the extent that they take positions supported by the public and the Democrats don’t. Our system is designed precisely to confer a political advantage in that circumstance so that the people, not the self-appointed media elite, can have the final say.
In this case, moreover, the issue — detainee policy — is one that the Post itself (indeed, especially the Post) deems fundamental. Thus, the Post can’t complain that the Republicans are trotting out a trivial (to the Post) issue like flag burning for political gain. If, as the Post maintains, detainee policy lies at the heart of the administration’s anti-terrorism policy and goes to the heart of our national values, then there can be no legitimate objection if this becomes a major a political issue to the extent the parties take opposing positions.
But the Post isn’t concerned about legitimacy. At this point, its political coverage is driven by little more than raw fear that Republicans won’t do badly enough in November to suit the Post.
|
Peitz
Peitz (Lower Sorbian Picnjo) is a town in the district of Spree-Neiße, in southeastern Brandenburg, Germany.
Overview
It is situated 13 km northeast of Cottbus. Surrounded by freshwater lakes, it is well known for its fishing industry. The town was at once time on the border between the states of Brandenburg and Saxony, and was formerly protected by strong artillery fortifications built in brick, dating from the 16th century. Only small parts of these remain.
Demography
References
External links
Category:Localities in Spree-Neiße
Category:Localities in Lower Lusatia
Category:Province of Brandenburg
Category:Bezirk Cottbus
|
On the Black Market, You Can Actually Buy and Sell Bundles of Facebook Account Credentials
NPR has a great story about companies buying Facebook likes and what you might really be buying. Anyone who has been following me knows I preach… do not buy likes and followers. It will not get you anything. The only person who wins is whoever you are paying.
One statement really jumped out at me, “Another company that sells likes showed us a Nashville country singer who was a client. She had a lot of likes — mostly from Egypt.” Do you think for a second those are real fans who are going to support you? NO! You need to spend some time to seek out your fans. There is no easy button.
Here is article I recently wrote about the power of a small, real fan base.
Read this article and think about it.
by Steve Henn and Zoe Chace For $75, This Guy Will Sell You 1,000 Facebook ‘Likes’ : Planet Money : NPR Looking to get more popular on Facebook? Alex Melen will sell you 1,000 “likes” for about $75. Melen runs an Internet marketing company. About six months ago, companies he worked with started coming to him more and more with a simple problem: They had created pages on Facebook, but nobody had clicked the “like” button. “You would go there, and there would be two likes,” Melen says. “And one of them would be the owner. And people right away lost interest in the brand.” For the right price, Melen can fix that. Facebook knows an incredible amount about hundreds of millions of people — what they like, what they want, who their friends are, where they live. This is the key reason why investors think the company is so valuable. But that value only holds up if the data is real — if all those people actually like what they say they like. When Melen sells likes to a company, he goes through an intermediary, who in turn could be working with people anywhere in the world. The people on the other end are just doing it for money. They get paid a very small amount — 10 cents, say — each time they like a company. “Right now on the black market, you can actually buy and sell bundles of Facebook account credentials,” says Ben Zhao, a computer science professor at UC Santa Barbara. “Tens of dollars or hundreds of dollars for hundreds or thousands of Facebook accounts.” In some cases, there are no people involved at all. Those fake accounts are controlled by robots and create fake data. (Melen says all his likers are real people.) The people who pay Melen for likes range from an LED light bulb company to a publicity company for a reality show. The show had 95,000 Facebook fans already, but it wanted about 25,000 more. These likes really matter to television networks, which sell advertising based in part on the number of likes they have. Facebook knows this sort of thing is going on. And the company has created an elaborate system to root out bad data. It has social bot hunters whose job is to track down fake Facebook profiles and kick them off the network. But it’s still happening. Another company that sells likes showed us a Nashville country singer who was a client. She had a lot of likes — mostly from Egypt.
via For $75, This Guy Will Sell You 1,000 Facebook ‘Likes’ : Planet Money : NPR.
|
Southern States Woman Suffrage Conference
The Southern States Woman Suffrage Conference (also known as the Southern States Woman Suffrage Association) was a group dedicated to winning voting rights for white women. The group consisted mainly of highly educated, middle and upper class white women of prominent families. They were originally part of the larger National American Woman Suffrage Association (NAWSA), but broke off in 1906. Prominent leaders in the group included Laura Clay and Kate Gordon, who supported and focused on local and state reforms rather than a national amendment. The group applied tactics like the Lost Cause, the belief that the Confederate cause was moral and just, and the Southern strategy, which appealed to white voters by promoting racism.
Roots
In 1866, Elizabeth Cady Stanton and Susan B. Anthony formed the American Equal Rights Association, an organization working to win suffrage to all, regardless of race or sex. The American Equal Rights Association was a unified group for 3 years, splitting with the ratification of the 14th and 15th amendment .The Fourteenth Amendment (all persons born in the US were citizens and received Due Process) was ratified in 1868. This was followed by the 15th Amendment (black men could vote) in 1870. The ratification of these two Reconstruction-era amendments divided the suffragist movement. The Fourteenth and Fifteenth Amendment addressed racial equality but made no mention of gender. Angered at the exclusion of women in the 15th Amendment, Stanton and Anthony formed the more radical National Woman’s Suffrage Association (NWSA). The NWSA wanted to achieve the vote with a Constitutional amendment, and pressed the federal government with other women’s rights issues (unionization of female workers, marital rights). The American Woman Suffrage Association (AWSA), formed by Lucy Stone, wanted to achieve suffrage by reforming the local and state levels . Local suffrage became the main tactic employed by the Southern States Women’s Suffrage Association in their “white only” movement.
Formation of Southern States Women Suffrage Association
The NWSA and AWSA had their own agendas until 1890, when they decided to reunite and form the National American Woman Suffrage Association (NAWSA). NAWSA worked for state-level amendments, hoping to eventually gain enough momentum for a national amendment. NAWSA was the first group to pioneer the Southern Strategy, convincing Southern political leaders that they could ensure white supremacy by enfranchising white women. At this time, women from the South were interspersed in groups like NAWSA, forming local chapters such as the Equal Suffrage League of Virginia. However, in the early 1900s, a uniquely Southern movement arose. Led by Kate Gordon of Louisiana (1861-1932), these upper class Southern women believed that state-level suffrage measures would help maintain white supremacy. One of Gordon's letters, published in Tennessee's The Journal and Tribune, said "I have always maintained that there are no women in the United States who should feel the degradation of disfranchisement so keenly as Southern women, for they have felt a special resentment in witnessing their government make their ignorant slaves the political superiors of the white women of the nation." Gordon first started the ERA (Equal Rights for All) Club in New Orleans, to gain suffrage while appealing to a majority white electorate. Her leadership in the ERA was noticed by the NAWSA, and she was offered a position as secretary of the organization. However, her more conservative views and state’s right approach ostracized her from NAWSA. Gordon opposed the push for a national amendment, and formed the Southern States Woman Suffrage Association (SSWSA) at a conference in New Orleans. This gathering was later known as the Southern States Woman Suffrage Conference, and was the most notable gathering of these Southern suffragists.
Like Gordon, Laura Clay of Kentucky (1849-1941) had been a prominent member of NAWSA; however, she became distanced from the establishment because she did not fully agree with its goals, specifically its aim of a federal amendment. She saw the federal amendment as a way to gain “publicity,” but would much rather have suffrage come from a grassroots level. Clay was “lukewarm” about a separate suffrage group, but joined forces with Kate Gordon in 1916 and became vice president of SSWSC. Initially, Gordon had promised her new group would work alongside, and not against, NAWSA, appealing to more centrist members like Clay. Another leader of the new SSWSC was Ida Porter Boyer, who took the position of Executive Secretary.
Beliefs and timeline of the SSWSA
SSWSA utilized a local-level suffrage, much like the AWSA’s strategy. Like conservative Southern Democrats at the time, the SSWSA felt that black voters were a source of corruption and saw black disenfranchisement as a positive. The SSWSA, specifically Gordon, paralleled their beliefs to the United Daughters of the Confederacy. Formed in 1894, the United Daughters of the Confederacy was a group championing the Lost Cause, or that the Confederate fight was a just one. They worked to commemorate fallen Confederate soldiers with statues, romanticizing the era of slavery and continuing white supremacy.
Membership numbers of the SSWSA were never recorded. The organization’s New Southern Citizen was a monthly publication updating members on SSWSA’s progress; it was published from October 1914 to 1917. The New Southern Citizen famously said that "like a searchlight, the great white rays of Liberty are turned on one state after another." In a local Tennessee newspaper, the Bristol Herald Courier, the New Southern Citizen is mentioned as reporting on the "state rights" stance of Congressmen who voted against a federal suffrage amendment. The SSWSA perceived its greatest victory to be the 1916 Democratic primary, claiming that its “states' rights suffrage” had been included in the party platform.
Monetary funds for the organization, which were estimated at $6,000 a year, were donated anonymously. Later, it was revealed that these donations came from Alva Belmont (previously a Vanderbilt), who once donated to the CU (Congressional Union). The CU, later named the National Woman’s Party, was the militant, feminist break-off from NAWSA, started by Alice Paul. Its belief in a federal amendment ideologically opposed SSWSA's state rights approach. Nevertheless, Belmont donated to both. Known for her philanthropy towards African Americans in New York, Belmont also wrote to Laura Clay saying that she understood the SSWSA’s “eternal vigilance [on the race problem] in the southern suffrage movement”.
Tension and division
Gordon and Clay’s group was increasingly at odds with NAWSA, and many Southern suffragists opposed Gordon’s state level approach. No policies in the SSWSA were established to govern relations with other suffragist groups. Gordon and her ideas were seen as extreme to most suffragists, even in the South, and was all but shunned by the federal level movement. Gordon’s unwavering opposition to federal suffrage drove some prominent SSWSA leaders out of the group. Many SWWSA members preferred state suffrage, but would accept federal change if it meant gaining suffrage. Laura Clay proposed a bill to bridge the two sides: a goal of national suffrage without infringing on state’s rights. She believed she could unite all suffrage groups (NAWSA, SWWSA) under this one bill. After receiving support from the two groups, she took the bill to Congress, but it never left committee. When the Nineteenth Amendment was written in 1919, Gordon opposed its ratification.
End of SWWSA
The groups activity began to decline in 1917, becoming nothing more than a “paper organization”. The group officially ended after the 19th amendment was ratified in 1920.
References
Category:Women's suffrage advocacy groups in the United States
|
File Type
CSI Divisions
About the Brand
For almost a century, Kurt Versen Company has been on the forefront combining art and science in the lighting industry. Our founder established a practice of designing high quality aesthetically pleasing lighting products, a standard we follow today. His invention of the legendary gooseneck lamp, which has evolved into one of the most prominent designs in lighting, resides in the Smithsonian Museum. Kurt's innovative spirit continues to be seen in each of our products today and has been the foundation on which we built our company identity. Our philosophy is to design products to complement, rather than compete with, a broad range of architectural designs.
By continuing to use a delicate, art-deco style, we began specializing in optical design and brightness control. Not only did we establish the criteria for what lighting performance specifications should aspire to, we also delivered the lighting solutions that exceeded those expectations. Our products, developed with much research, are featured in some of the most prestigious architectural projects across the globe.
We are continuing to build our reputation project by project as we bring new and better products to market. We are dedicated to understanding the unique
|
Extension of cervical carcinoma to lumbar spine.
Carcinoma of the cervix is a lesion in which involvement of the spinal column is not generally considered. Two recent cases attest to the fact that this lesion may compress the lumbar vertebrae and cause paralysis, due to aorta iliac node metastases. Laminectomy with decompression, followed by radiation therapy, only temporarily alters the course of the lesion. With present technics the portals of irradiation are inadequate to prevent this lesion.
|
Has the info here been useful? Support George’s efforts by clicking below.
Looking for other ways to support George?
Juniper ‘Gold Cone’
* What it is: A very narrow, pyramidal evergreen with stiff, slender golden needles.
* Size: 8 feet tall by only 2 to 3 feet wide in about 10 years.
* Where to use: Any skinny situation in full sun where you need something upright. Especially good choice for those narrow beds between a wall and a walk in a south- or west-facing site. Also good for flanking sunny doorways or arbors.
* Care: Keep damp the first season, then ‘Gold Cone’ should never need supplemental water. Also very heat-tolerant. Fertilize with an annual spring scattering of acidifying, organic, granular fertilizer such as Holly-tone or Holly-Care. Pruning not needed unless it grows beyond allotted space, in which case the plant can be sheared lightly at the end of each winter but never back into bare wood.
* Great partner: Ring with gaillardia ‘Goblin’ or ‘Arizona Sun’ (perennial) or with red petunias or dwarf ‘Profusion’ zinnias (annuals).
|
Changes in intraocular pressure and tear secretion in patients given 5 mg solifenacin for the treatment of overactive bladder.
To investigate the effect of solifenacin succinate on intraocular pressure (IOP) and dry eye in patients with overactive bladder (OAB). The study was conducted prospectively between October 2014 and November 2015. A total of 93 female OAB patients with a mean age of 48.59 ± 11.28 years (range 19-75 years) were evaluated. A full ophthalmic examination, including the Schirmer I test and IOP measurements, was conducted. Solifenacin succinate (5 mg/day) was started orally. All procedures were repeated at the 4- and 12-week follow-up, and the effects and side effects were documented. No statistically significant difference was observed in IOP (p = 0.282, p = 0.189) and tear secretion (p = 0.122, p = 0.071) values from the baseline (day 0) to the 12th week in OAB patients using solifenacin succinate. Solifenacin succinate treatment was terminated in 3 patients owing to dry eye in 1 patient, increased IOP in 1 patient, and systemic side effects in 1 patient. Constipation and dry mouth at various rates were the most common systemic side effects observed. Solifenacin succinate is useful in eliminating OAB symptoms in female patients, but can cause systemic side effects. It had no significant side effects on tear secretion (Schirmer I) and IOP. We concluded that solifenacin succinate could be reliably used in pure OAB patients without comorbidity in terms of dry eye and IOP. We believe that prospective studies with larger series are still needed to reach a definite conclusion.
|
// this is *not* allowed
int operator[](int *p, int i);
int main()
{
}
|
Q:
Format String with Trailing Space
I have some doubles that I want to format as strings so that they look like this:
$ 123.00
($ 3,231.99)
$ 0.82
So basically I need to get the positive doubles to print with a single trailing space. Here is the string formatted:
Value1.ToString("$ #,0.00 ;($ #,0.00);$ 0.00 ");
However, when they are being printed, on the web page the trailing space is not included. What am I missing?
A:
You need to add the non-breaking space character in your string. To do that, use unicode
\u00A0
Example:
string a = "b\u00A0cd"
Will be printed as:
b cd
|
Q:
Is there a way to transfer an app from a device to another one (App no longer on the app store)?
I have and use Photosynth regularly on an iPhone 4s.
I bought a 5s last week and when i wanted to install the app on it i realised that the app isn't on the app store anymore.
Is there a way to transfer it from the 4s to the 5s ?
Thanks
A:
if you have purchased/downloaded the app with your Apple ID, you would still be able to download the app from the "Purchased" section of the App Store even if the app has been removed from the shelves.
|
49ers Darcel McBath, (28) Perrish Cox, (20) , Anthony Dixon, (24) and Donte Whitner, (31) celebrate at the end of the game, as the San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC Championship game on Sunday Jan. 20, 2013, at the Georgia Dome in Atlanta Ga.
The San Francisco 49ers played the Atlanta Falcons in the NFC Championship Game in the Georgia Dome in Atlanta, Ga., on Sunday, January 20, 2013. The 49ers defeated the Falcons 28-24 and advancing to the Superbowl.
Photo: Carlos Avila Gonzalez, The Chronicle
The San Francisco 49ers played the Atlanta Falcons in the NFC...
The San Francisco 49ers played the Atlanta Falcons in the NFC... Photo-4060731.55440 - SFGate
Image 3 of 117
49ers Michael Crabtree, (15) fumbles the ball on the one yard line in the fourth quarter, as the San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC Championship game on Sunday Jan. 20, 2013, at the Georgia Dome in Atlanta Ga.
San Francisco 49ers coach Jim Harbaugh during the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Michael Macor, The Chronicle
San Francisco 49ers coach Jim Harbaugh during the San Francisco...
San Francisco 49ers coach Jim Harbaugh during the San Francisco... Photo-4060730.55440 - SFGate
Image 5 of 117
Wide receiver Randy Moss (84) runs through the Falcons defense during the second half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Frank Gore salutes fans as he walked off the field with his son. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
Frank Gore salutes fans as he walked off the field with his son....
Frank Gore salutes fans as he walked off the field with his son.... Photo-4060726.55440 - SFGate
Image 7 of 117
San Francisco 49ers Quarterback Colin Kaepernick (7) on a quarterback sneak past cornerback Robert McClain (27) in the first half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
49ers quarterback Colin Kaepernick, (7) comes back into the game after a time out, as the San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC Championship game on Sunday Jan. 20, 2013, at the Georgia Dome in Atlanta Ga.
49ers quarterback Colin Kaepernick warms up before as the San Francisco 49ers take on the Atlanta Falcons in the NFC Championship game on Sunday Jan. 20, 2013, at the Georgia Dome in Atlanta Ga.
Photo: Michael Macor, The Chronicle
49ers quarterback Colin Kaepernick warms up before as the San...
49ers quarterback Colin Kaepernick warms up before as the San... Photo-4061697.55440 - SFGate
Image 10 of 117
San Francisco 49ers fans congregated at the Georgia 49ers Fan Club tailgate in the Yellow Lot of the Georgia Dome in Atlanta Georgia for the NFC Championship on January 20, 2013.
Photo by David Walter Banks for The San Francisco Chronicle.
San Francisco 49ers fan Quince Rgainous at the Georgia 49ers Fan Club tailgate in the Yellow Lot of the Georgia Dome in Atlanta Georgia for the NFC Championship on January 20, 2013.
Photo by David Walter Banks for The San Francisco Chronicle.
Cornerback Chris Culliver (29) and Safety Dashon Goldson (38) break up a pass in the first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Atlanta Falcons wide receiver Julio Jones (11) catches a pass int he first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
San Francisco 49ers Quarterback Colin Kaepernick (7) is sacked by Defensive tackle Ray McDonald (91) in the first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Quarterback Colin Kaepernick (7) during the second quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
Quarterback Colin Kaepernick (7) during the second quarter of the...
Quarterback Colin Kaepernick (7) during the second quarter of the... Photo-4061691.55440 - SFGate
Image 16 of 117
quarterback Matt Ryan (2) in the second quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
quarterback Matt Ryan (2) in the second quarter of the San...
quarterback Matt Ryan (2) in the second quarter of the San... Photo-4061692.55440 - SFGate
Image 17 of 117
Atlanta Falcons kicker Matt Bryant (3) kicks a field goal in the first half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Running back Frank Gore (21) takes the field at the start of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Carlos Avila Gonzalez, The Chronicle
Running back Frank Gore (21) takes the field at the start of the...
Running back Frank Gore (21) takes the field at the start of the... Photo-4061689.55440 - SFGate
Image 19 of 117
Tight end Vernon Davis (85) is pushed out of bonds by Atlanta Falcons linebacker Akeem Dent (52) during the second quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Carlos Avila Gonzalez, The Chronicle
Tight end Vernon Davis (85) is pushed out of bonds by Atlanta...
Tight end Vernon Davis (85) is pushed out of bonds by Atlanta... Photo-4061688.55440 - SFGate
Image 20 of 117
Quarterback Colin Kaepernick (7) during the first half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Michael Macor, The Chronicle
Quarterback Colin Kaepernick (7) during the first half of the San...
Quarterback Colin Kaepernick (7) during the first half of the San... Photo-4061687.55440 - SFGate
Image 21 of 117
Quarterback Colin Kaepernick (7) and Wide receiver Michael Crabtree (15) with coach jim Harbaugh during the first half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Wide receiver Michael Crabtree (15) runs past Running back Rock Cartwright (28) and snapper Charles Mitchell (26)during the second half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Both teams react after Wide receiver Michael Crabtree (15) fumbles the ball on the one yard line in the fourth quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Wide receiver Michael Crabtree (15) runs past Atlanta Falcons cornerback Asante Samuel (22) in the fourth quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Colin Kaepernick was mobbed by photographers after the contest. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
Colin Kaepernick was mobbed by photographers after the contest. The...
Colin Kaepernick was mobbed by photographers after the contest. The... Photo-4061682.55440 - SFGate
Image 26 of 117
Frank Gore looked at some 49er fans after finishing an interview for television. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
Quarterback Colin Kaepernick (7) talks with Running back Frank Gore (21) about a play prior to the snap late in the fourth quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Frank Gore and his ten year old son Little Frank waited for an interview on television after the game. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
Frank Gore and his ten year old son Little Frank waited for an...
Frank Gore and his ten year old son Little Frank waited for an... Photo-4061675.55440 - SFGate
Image 30 of 117
LaMichael James hurtled some defensive players during a fourth quarter run back from a punt. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
LaMichael James hurtled some defensive players during a fourth...
LaMichael James hurtled some defensive players during a fourth... Photo-4061676.55440 - SFGate
Image 31 of 117
San Francisco 49ers fans inside the Georgia Dome in Atlanta Georgia for the NFC Championship on January 20, 2013.
Photo by David Walter Banks for The San Francisco Chronicle.
Colin Kaepernick speaks with Matt Ryan after the 49ers defeated the Falcons on Sunday. The San Francisco 49ers played the Atlanta Falcons in the NFC Championship Game in the Georgia Dome in Atlanta, Ga., on Sunday, January 20, 2013. The 49ers defeated the Falcons 28-24 and advancing to the Superbowl.
Linebacker Aldon Smith (99) takes down wide receiver Roddy White (84) during the fourth quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Carlos Avila Gonzalez, The Chronicle
the San Francisco 49ers game against the Atlanta Falcons in the NFC...
the San Francisco 49ers game against the Atlanta Falcons in the NFC... Photo-4061669.55440 - SFGate
Image 37 of 117
Kicker David Akers (2) in the fourth quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Carlos Avila Gonzalez, The Chronicle
Kicker David Akers (2) in the fourth quarter of the San Francisco...
Kicker David Akers (2) in the fourth quarter of the San Francisco... Photo-4061665.55440 - SFGate
Image 38 of 117
Matt Ryan throws under pressure in the fourth quarter. The San Francisco 49ers played the Atlanta Falcons in the NFC Championship Game in the Georgia Dome in Atlanta, Ga., on Sunday, January 20, 2013. The 49ers defeated the Falcons 28-24 and advancing to the Superbowl.
San Francisco 49ers huddle before a play during the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Michael Macor, The Chronicle
San Francisco 49ers huddle before a play during the San Francisco...
San Francisco 49ers huddle before a play during the San Francisco... Photo-4061662.55440 - SFGate
Image 43 of 117
Quarterback Colin Kaepernick (7) celebrates with Running back Frank Gore (21) following a touchdown in the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
49er fans greeted Frank Gore as he walked to an interview after the game. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
49er fans greeted Frank Gore as he walked to an interview after the...
49er fans greeted Frank Gore as he walked to an interview after the... Photo-4061660.55440 - SFGate
Image 45 of 117
Atlanta coach Mike Smith congratulated Jim Harbaugh on the victory. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
Matt Ryan lost a fumble in the second half recovered by Aldon Smith. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
Matt Ryan lost a fumble in the second half recovered by Aldon...
Matt Ryan lost a fumble in the second half recovered by Aldon... Photo-4061656.55440 - SFGate
Image 47 of 117
Patrick Willis stopped running back Jason Snelling for a short gain in the second half. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
Patrick Willis stopped running back Jason Snelling for a short gain...
A SFPD officer swept broken glass out of the street after a fan threw a trash can into the middle of 24th Street during celebrations after the San Francisco 49er's beat the Atlanta Falcons and was promptly arrested by SFPD in San Francisco, Calif., Sunday, January, 20, 2013.
Photo: Jason Henry, Special To The Chronicle
A SFPD officer swept broken glass out of the street after a fan...
A SFPD officer swept broken glass out of the street after a fan... Photo-4061652.55440 - SFGate
Image 49 of 117
A Niner's fan pushed a trash can onto 24th Street during celebrations after the San Francisco 49er's beat the Atlanta Falcons and was promptly arrested by SFPD in San Francisco, Calif., Sunday, January, 20, 2013.
A Niner's fan pushed a trash can onto 24th Street during celebrations after the San Francisco 49er's beat the Atlanta Falcons and was promptly arrested by SFPD in San Francisco, Calif., Sunday, January, 20, 2013.
Ben Mosqueda played a vuvuzela along Mission Street after the San Francisco 49er's beat the Atlanta Falcons in San Francisco, Calif., Sunday, January, 20, 2013.
Photo: Jason Henry, Special To The Chronicle
Ben Mosqueda played a vuvuzela along Mission Street after the San...
Ben Mosqueda played a vuvuzela along Mission Street after the San... Photo-4061648.55440 - SFGate
Image 53 of 117
Cesar Martinez celebrated along 24th Street after the San Francisco 49er's beat the Atlanta Falcons in San Francisco, Calif., Sunday, January, 20, 2013.
Photo: Jason Henry, Special To The Chronicle
Cesar Martinez celebrated along 24th Street after the San Francisco...
Cesar Martinez celebrated along 24th Street after the San Francisco... Photo-4061647.55440 - SFGate
Image 54 of 117
Francisco Duartez shaved the 49ers logo onto the side of his head as he celebrated along 24th Street after the San Francisco 49er's beat the Atlanta Falcons in San Francisco, Calif., Sunday, January, 20, 2013.
Photo: Jason Henry, Special To The Chronicle
Francisco Duartez shaved the 49ers logo onto the side of his head...
Francisco Duartez shaved the 49ers logo onto the side of his head... Photo-4061645.55440 - SFGate
Image 55 of 117
Will-G beat on a newspaper stand along Mission Street after the San Francisco 49er's beat the Atlanta Falcons in San Francisco, Calif., Sunday, January, 20, 2013.
Photo: Jason Henry, Special To The Chronicle
Will-G beat on a newspaper stand along Mission Street after the San...
Will-G beat on a newspaper stand along Mission Street after the San... Photo-4061644.55440 - SFGate
Image 56 of 117
Fans honked their horns and hung out the windows of cars during celebrations along 24th Street after the San Francisco 49er's beat the Atlanta Falcons in San Francisco, Calif., Sunday, January, 20, 2013.
Photo: Jason Henry, Special To The Chronicle
Fans honked their horns and hung out the windows of cars during...
Fans honked their horns and hung out the windows of cars during... Photo-4061643.55440 - SFGate
Image 57 of 117
A Niner's fan pushed a trash can onto 24th Street and was promptly arrested by SFPD during celebrations and residents helped clean it up after the San Francisco 49er's beat the Atlanta Falcons in San Francisco, Calif., Sunday, January, 20, 2013.
49ers Michael Crabtree, (15) fumbles the ball on the one yard line in the fourth quarter, as the San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC Championship game on Sunday Jan. 20, 2013, at the Georgia Dome in Atlanta Ga.
John Abraham and Corey Peters sit on the sideline dejected in the fourth quarter. The San Francisco 49ers played the Atlanta Falcons in the NFC Championship Game in the Georgia Dome in Atlanta, Ga., on Sunday, January 20, 2013. The 49ers defeated the Falcons 28-24 and advancing to the Superbowl.
Photo: Carlos Avila Gonzalez, The Chronicle
John Abraham and Corey Peters sit on the sideline dejected in the...
John Abraham and Corey Peters sit on the sideline dejected in the... Photo-4061461.55440 - SFGate
Image 62 of 117
San Francisco 49ers fans inside the Georgia Dome in Atlanta Georgia for the NFC Championship on January 20, 2013.
Photo by David Walter Banks for The San Francisco Chronicle.
Wide receiver Michael Crabtree (15) fumbles the ball on the one yard line during fourth quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Wide receiver Michael Crabtree (15) fumbles the ball on the one yard line during fourth quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
San Francisco 49ers fans congregated at the Georgia 49ers Fan Club tailgate in the Yellow Lot of the Georgia Dome in Atlanta Georgia for the NFC Championship on January 20, 2013.
Photo by David Walter Banks for The San Francisco Chronicle.
Cornerback Carlos Rogers (22) blocks a pass intended for wide receiver Roddy White (84) during the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Wide receiver Michael Crabtree (15) runs over Falcons cornerback Asante Samuel (22) during the first half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
ATLANTA, GA - JANUARY 20: Defensive back Darcel McBath #28, Anthony Dixon #24 and defensive back Perrish Cox #20 of the San Francisco 49ers react after stopping the Atlanta Falcons on fourth down in the fourth quarter in the NFC Championship game at the Georgia Dome on January 20, 2013 in Atlanta, Georgia.
San Francisco 49ers' Colin Kaepernick (7) celebrates with Leonard Davis and Daniel Kilgore (67) after the NFL football NFC Championship game against the Atlanta Falcons Sunday, Jan. 20, 2013, in Atlanta. The 49ers won 28-24 to advance to Superbowl XLVII.
San Francisco 49ers' Ricky Jean Francois reacts after the NFL football NFC Championship game against the Atlanta Falcons Sunday, Jan. 20, 2013, in Atlanta. The 49ers won 28-24 to advance to Superbowl XLVII.
San Francisco 49ers head coach Jim Harbaugh runs onto the field with an assistant after the NFL football NFC Championship game against the Atlanta Falcons Sunday, Jan. 20, 2013, in Atlanta. The 49ers won 28-24 to advance to Superbowl XLVII.
Wide receiver Michael Crabtree #15, running back Frank Gore #21 and tight end Vernon Davis #85 of the San Francisco 49ers celebrate after the 49ers defeated the Atlanta Falcons 28-24 in the NFC Championship game at the Georgia Dome on January 20, 2013 in Atlanta, Georgia.
The San Francisco 49ers celebrate with head coach Jim Harbaugh, center, after the NFL football NFC Championship game against the Atlanta Falcons Sunday, Jan. 20, 2013, in Atlanta. The 49ers won 28-24 to advance to Super Bowl XLVII.
Photo: Dave Martin, Associated Press
The San Francisco 49ers celebrate with head coach Jim Harbaugh,...
The San Francisco 49ers celebrate with head coach Jim Harbaugh,... Photo-4061276.55440 - SFGate
Image 84 of 117
Atlanta Falcons' Dunta Robinson sits on the team bench after being defeated by San Francisco 49ers in the NFL football NFC Championship game Sunday, Jan. 20, 2013, in Atlanta. The 49ers won 28-24 to advance to Superbowl XLVII.
Offensive tackle Anthony Davis (76) during the first half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
San Francisco 49ers Running back LaMichael James (23) runs pass Atlanta Falcons cornerback Chris Owens (21) during the second quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Brant Ward, The Chronicle
the San Francisco 49ers game against the Atlanta Falcons in the NFC...
the San Francisco 49ers game against the Atlanta Falcons in the NFC... Photo-4059925.55440 - SFGate
Image 89 of 117
San Francisco 49ers Quarterback Colin Kaepernick (7) during the second quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Quarterback Colin Kaepernick (7) is sacked in the first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Running back LaMichael James (23) runs past Atlanta Falcons cornerback Chris Owens (21) and running back Jason Snelling (44) int he second quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
San Francisco 49ers Offensive tackle Joe Staley (74) and Offensive guard Mike Iupati (77) before the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Atlanta Falcons quarterback Matt Ryan (2) during the first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
San Francisco 49ers Cornerback Tarell Brown (25) attempts to stop Atlanta Falcons wide receiver Julio Jones (11) during the first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
San Francisco 49ers Linebacker Patrick Willis (52) takes down Atlanta Falcons tight end Tony Gonzalez (88) in the first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Cornerback Chris Culliver (29) and Safety Dashon Goldson (38) break up a pass in the first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Quarterback Colin Kaepernick (7) is sacked during the fist half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Atlanta Falcons wide receiver Julio Jones (11) runs past San Francisco 49ers Safety Dashon Goldson (38) in the first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Wide receiver Roddy White #84 of the Atlanta Falcons catches a pass as he is hit by free safety Dashon Goldson #38 of the San Francisco 49ers in the first quarter in the NFC Championship game at the Georgia Dome on January 20, 2013 in Atlanta, Georgia.
Atlanta Falcons running back Jacquizz Rodgers (32) breaks through an attempted tackle by Defensive tackle Justin Smith (94) and Linebacker Patrick Willis (52) in the first quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Atlanta quarterback Matt Ryan walked away after greeting Colin Kaepernick at midfield. The San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC title and advance to the Super Bowl Sunday January 20, 2013.
San Francisco 49ers Quarterback Colin Kaepernick (7) laughs with coach Jim Harbaugh before the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Cornerback Chris Culliver (29) catches an interception in the third quarter of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
Photo: Carlos Avila Gonzalez, The Chronicle
Cornerback Chris Culliver (29) catches an interception in the third...
Daniel Kilgore, left, and Alex Boone, right after the 49ers defeated the Falcons on Sunday. The San Francisco 49ers played the Atlanta Falcons in the NFC Championship Game in the Georgia Dome in Atlanta, Ga., on Sunday, January 20, 2013. The 49ers defeated the Falcons 28-24 and advancing to the Superbowl.
Photo: Carlos Avila Gonzalez, The Chronicle
Daniel Kilgore, left, and Alex Boone, right after the 49ers...
Daniel Kilgore, left, and Alex Boone, right after the 49ers... Photo-4060733.55440 - SFGate
Image 105 of 117
San Francisco 49ers fans congregated at the Georgia 49ers Fan Club tailgate in the Yellow Lot of the Georgia Dome in Atlanta Georgia for the NFC Championship on January 20, 2013.
Atlanta Falcons running back Jacquizz Rodgers (32) is picked up and carried back for a loss of yards by Linebacker Aldon Smith (99), Linebacker NaVorro Bowman (53), Defensive tackle Ray McDonald (91) and Defensive tackle Justin Smith (94) in the second half of the San Francisco 49ers game against the Atlanta Falcons in the NFC Championship game at the Georgia Dome in Atlanta, GA., on Sunday January 20, 2013.
ATLANTA, GA - JANUARY 20: (L-R) Leonard Davis #68 and head coach Jim Harbaugh and Jonathan Goodwin #59 of the San Francisco 49ers celebrate as they walk off of the field after they won 28-24 against the Atlanta Falcons in the NFC Championship game at the Georgia Dome on January 20, 2013 in Atlanta, Georgia. (Photo by Streeter Lecka/Getty Images)
49ers head coach Jm Harbaugh talks with a referee in the fourth quarter, as the San Francisco 49ers beat the Atlanta Falcons 28-24 to win the NFC Championship game on Sunday Jan. 20, 2013, at the Georgia Dome in Atlanta Ga.
Photo: Michael Macor, The Chronicle
49ers head coach Jm Harbaugh talks with a referee in the fourth...
49ers head coach Jm Harbaugh talks with a referee in the fourth... Photo-4060280.55440 - SFGate
Image 115 of 117
San Francisco 49ers' Frank Gore gets past Atlanta Falcons' Dunta Robinson (23) for a first down during the first half of the NFL football NFC Championship game Sunday, Jan. 20, 2013, in Atlanta. (AP Photo/Mark Humphrey)
|
Huntington's disease (HD) is an autosomal dominant, adult-onset neurodegenerative disease[@R1]. Patients with a single mutant huntingtin (Htt) gene develop symptoms in midlife with 100% penetrance. The mutation is a toxic gain of function, because loss of a single gene has no phenotype and the Htt-null is embryonic lethal[@R2]. The disease-causing mutation is expansion of a CAG trinucleotide repeat encoding a polyglutamine (polyQ) tract and polyQ-expansions in other genes may also lead to adult-onset neurodegeneration, but pathogenic mechanisms remained uncertain[@R2]. Several lines of evidence indicated that pathogenesis in Huntington's disease include inhibition of fast axonal transport (FAT)[@R3]. Although consequences of FAT inhibition in neurons are well established, mechanisms underlying inhibition of FAT by pathogenic Htt (polyQ-Htt) were unknown. Proposed mechanisms included wild-type Htt (WT-Htt) loss of function[@R4], physical blockade by polyQ-Htt aggregates[@R5],[@R6], sequestration of motor molecules[@R4], [@R6], and misregulation of FAT[@R3], [@R7], [@R8].
We found no evidence for direct interactions of conventional kinesin and cytoplasmic dynein (CDyn) with WT-Htt or polyQ-Htt *in vivo*. However, analysis of HD models showed that polyQ-Htt, but not WT-Htt increased cJun N-terminal kinase (JNK) activity. Pharmacological and peptide inhibitors of JNK prevented inhibition of FAT by polyQ-Htt. Surprisingly, only a subset of JNK isoforms inhibited FAT, with neuron-specific JNK3 selectively mimicking effects of polyQ-Htt. *In vitro* phosphorylation and mass spectrometry studies showed that JNK3, but not ubiquitously expressed JNK1, phosphorylated Ser176 in the kinesin heavy chain (kinesin-1, KHC) motor domain. Consistent with this location, phosphorylation of kinesin-1 by JNK3 inhibited kinesin binding to microtubules and translocation along axons. Our data indicate that polyQ-Htt inhibits FAT by a mechanism involving axonal JNK3 activation and phosphorylation of kinesin-1.
RESULTS {#S1}
=======
Htt does not interact with microtubule-based motors {#S2}
---------------------------------------------------
PolyQ-Htt inhibits FAT in various experimental systems, including Drosophila[@R4], [@R5], neuroblastoma cells[@R9], [@R10], and isolated squid axoplasm[@R8], but the molecular basis of inhibition was undetermined[@R3]. Interactions have been reported between exogenously overexpressed Htt and conventional kinesin[@R4] or various subunits of cytoplasmic dynein (CDyn)[@R9]-[@R11]. Alternatively, polyQ-expansion was proposed to affect Htt function as a scaffolding protein for molecular motors[@R9], [@R12]. However, interactions between endogenous WT-Htt and molecular motors were not evaluated. We tested interactions by immunoprecipitation and subcellular fractionation ([Fig. 1](#F1){ref-type="fig"}), as previously described[@R13], [@R14]. To avoid overexpression-related artifacts, we used brain tissue from 14 month-old homozygous Hdh*^Q109^* knock-in mice and age-matched controls, which express polyQ-Htt or WT-Htt at endogenous levels[@R15]. At this age, both polyQ-Htt-derived nuclear inclusions and insoluble aggregates are found in the brains of Hdh*^Q109^* knock-in mice[@R15]. Conventional kinesin is a heterotetramer composed of two heavy chains (kinesin-1, KHC) and two light chains (KLC)[@R13]. Antibodies recognizing kinesin-1 (H2) effectively immunoprecipitated kinesin-1 from detergent-soluble brain lysates independent of genotype ([Fig. 1A](#F1){ref-type="fig"}). Kinesin-1 antibodies co-immunoprecipitated KLCs[@R13], [@R14], but failed to co-immunoprecipitate either WT-Htt or polyQ-Htt. Similarly, antibodies against DIC co-immunoprecipitated DHC[@R16], but did not immunoprecipitate WT-Htt or polyQ-Htt ([Fig. 1A](#F1){ref-type="fig"}). Conversely, anti-Htt antibodies immunoprecipitated Htt from both wild type and homozygous Hdh*^Q109^* knock-in mouse brain lysates, but no kinesin-1, KLC, DIC nor DHC could be detected in Htt immunoprecipitates. To detect substoichiometric amounts of Htt associated with conventional kinesin or CDyn, we performed three rounds of immunoprecipitation, sufficient to nearly deplete mouse brain lysates of kinesin-1 ([Fig. 1B](#F1){ref-type="fig"}) or DIC ([Supplemental Fig. 1B](#SD6){ref-type="supplementary-material"}). As in previous studies, marked reductions in kinesin-1 and KLC levels occurred with each immunoprecipitation cycle[@R13], [@R14]. However, Htt levels remained unchanged after three immunoprecipitation cycles, regardless of genotype.
PolyQ-Htt was reported to sequester molecular motors in detergent-insoluble aggregates when overexpressed[@R4], [@R6]. To evaluate this at endogenous levels, brain lysates from wild type and homozygous Hdh*^Q109^* knock-in mice were fractionated into detergent-soluble and insoluble fractions, and partitioning of Htt and molecular motors analyzed by immunoblot ([Supplemental Fig. 1](#SD6){ref-type="supplementary-material"}). WT-Htt and polyQ-Htt levels were comparable in detergent soluble and insoluble fractions, but the bulk of kinesin-1, DHC and DIC were detergent-soluble. Molecular motor levels were similar for wild type and homozygous Hdh*^Q109^* knock-in mice. Thus, WT-Htt and polyQ-Htt expressed at endogenous levels do not interact with molecular motors; so FAT inhibition associated with polyQ-Htt must result from a different mechanism.
JNK activity mediates FAT defects induced by polyQ-Htt {#S3}
------------------------------------------------------
Effects of WT-Htt and polyQ-Htt on FAT were assayed in isolated squid axoplasm[@R8]. Perfusion of WT-Htt showed no effect ([Fig. 2A](#F2){ref-type="fig"}), but perfusion of polyQ-Htt at a concentration 100-1000 times lower than kinesin-1[@R3], [@R8] dramatically inhibited both anterograde (kinesin-dependent) and retrograde (CDyn-dependent) FAT ([Fig. 2B](#F2){ref-type="fig"}). In axoplasm, anterograde FAT of membrane-bounded organelles (MBOs) depends primarily upon conventional kinesin[@R17], which is regulated by phosphorylation[@R7], [@R18], [@R19]. Multiple kinase activities may be deregulated in Huntington's disease[@R20]-[@R22] and inhibition of FAT by pathogenic androgen receptor (polyQ-AR) depends on JNK activation in axoplasm[@R7]. This led us to evaluate the role of JNK in polyQ-Htt-induced inhibition of FAT. Axoplasmic JNK activity was assessed i*n vitro* using recombinant GST-cJun, a well-characterized JNK substrate[@R23] ([Fig. 2C](#F2){ref-type="fig"}). Incubation with axoplasm lysates produced a time-dependent increase in cJun phosphorylation at JNK sites (serines 63/73), reflecting basal JNK activity in axoplasm. Pharmacological properties of endogenous axoplasmic JNK were validated with two JNK inhibitors (SP600125 and JIP peptide)[@R23]. SP600125 is a pharmacological inhibitor of JNK, showing \>20-fold selectivity for JNK over a range of kinases[@R24]. JIP peptide (JNK inhibitor I) is a 20-amino acid peptide derived from a JNK-binding protein, which selectively inhibits JNK, but not p38 activity[@R25]. Both SP600125 and JIP peptide dramatically inhibited cJun phosphorylation, suggesting common pharmacological properties between squid and mammalian JNKs ([Fig. 2C](#F2){ref-type="fig"}).
As with polyQ-AR[@R7], co-perfusion of axoplasm with polyQ-Htt and either SP600125 (500nM, [Fig. 2D](#F2){ref-type="fig"}) or JIP peptide (100 nM, [Fig. 2E](#F2){ref-type="fig"}) blocked effects of polyQ-Htt on FAT, suggesting that polyQ-Htt inhibition of FAT requires JNK activity. In cultured cells, pharmacological inhibitors of histone deacetylase (HDAC) were reported to rescue defects in FAT induced by polyQ-Htt by increasing tubulin acetylation[@R26]. However, coperfusion of polyQ-Htt with the HDAC6 inhibitor BC-6-25 (10μM) (Compound 2[@R27]) did not prevent inhibition of FAT by polyQ-Htt in axoplasm ([Fig. 2F](#F2){ref-type="fig"}). Thus, inhibition of FAT by polyQ-Htt involves activation of endogenous axonal JNK.
PolyQ-Htt expression increases JNK activity {#S4}
-------------------------------------------
Vesicle motility and biochemical assays indicated that JNK activity mediates polyQ-Htt inhibition of FAT. JNK activation involves phosphorylation by upstream mitogen-activated protein kinase kinases (MKKs, typically MKK4/MKK7)[@R28]. Effects of polyQ-Htt on JNK phosphorylation were evaluated in cellular and animal Huntington's models, using antibodies against total JNK (pan-JNK, phosphorylation-independent) or against phosphorylated, catalytically active JNKs (pJNK). Effects of polyQ-Htt expression on JNK activation were evaluated qualitatively after transient transfection ([Fig. 3A](#F3){ref-type="fig"}). NSC34 neuroblastoma cells were transfected with WT-Htt (Q18) or polyQ-Htt (Q56)[@R29]. Immunoblots show exogenous Htt constructs were expressed at levels similar to endogenous Htt. Pan-JNK and pJNK antibodies recognized two major immunoreactive bands (p46 and p54) corresponding to mammalian JNKs in NSC34 cell lysates and striatal mouse tissue ([Fig. 3**A, C**](#F3){ref-type="fig"})[@R30]. Expression levels for both pan-JNK immunoreactive bands were comparable in cells expressing WT-Htt and polyQ-Htt. However, pJNK antibodies showed a clear increase in p54 immunoreactivity in cells expressing polyQ-Htt ([Fig. 3A](#F3){ref-type="fig"}), consistent with previous reports[@R20], [@R22], [@R31].
Differential activation of p54 and p46 JNKs led us to evaluate their identity using antibodies selective for JNK1, JNK2 and JNK3. Specificity was validated by immunoblotting against recombinant GST-tagged JNKs, as well as brain lysates from mice with ablation of individual JNK genes[@R30] ([Fig. 3B](#F3){ref-type="fig"}). Anti-JNK1, 2 and 3 antibodies selectively recognized their target JNK ([Fig. 3B](#F3){ref-type="fig"}), showing no immunoreactivity against brain lysates from mice deleted for that JNK gene ([Fig. 3B](#F3){ref-type="fig"}). We examined JNK expression in striatal tissue from 8 month-old wild-type, heterozygous and homozygous Hdh*^Q109^* mice ([Fig. 3C](#F3){ref-type="fig"}). Hdh*^Q109^* knock-in mice are asymptomatic at this age[@R15]. Phosphorylation of Akt at Ser473 was not affected ([Fig. 3C](#F3){ref-type="fig"}) and pan-JNK immunoreactivity was comparable, regardless of genotype. However, pJNK immunoreactivity was significantly greater in lysates from heterozygous and homozygous Hdh*^Q109^* knock-in mice, relative to wild-type ([Fig. 3C](#F3){ref-type="fig"}). Cortical lysates gave similar results (data not shown). P54 and p46 were differentially activated as observed in transfected cells. P54 showed greater increases in pJNK immunoreactivity than p46 in Hdh*^Q109^* mice relative to wild type in both striatum ([Fig. 3E](#F3){ref-type="fig"}) and cortex (not shown). Consistent with autosomal dominance of HD, JNK activation increased in both heterozygous and homozygous Hdh*^Q109^* mice, but activation was greater in homozygotes than heterozygotes.
Immunoreactivity corresponding to p54 and p46 in NSC34 and striatal lysates mainly corresponded to JNK2/3 and JNK1, respectively ([Fig. 3D](#F3){ref-type="fig"}). An activation ratio ([Fig. 3E](#F3){ref-type="fig"}) was defined as the ratio of pJNK/JNK immunoreactivities for JNK1 (p46) or JNK2/3 (p54). Both JNK1 and JNK2/3 activation ratios were elevated in heterozygotes and homozygotes relative to wild-type brain. JNK1 activity in wild-type mice was 1.097±0.146 (mean ± SEM), whereas JNK1 activity was 1.527±0.061 in homozygotes and 1.342±0.133 in heterozygotes Hdh*^Q109^* mice (n = 4 in all cases). Differences in JNK1 activity between wild-type and Hdh*^Q109^* homozygotes was significant at p≤0.05 in a pooled t-test, but failed to reach significance between wild-type and Hdh*^Q109^* heterozygotes. JNK2/3 activity for wild-type mice was 0.242±0.012 (mean ± SEM), whereas JNK2/3 activity was 0.590±0.055 for homozygotes and 0.440±0.035 for heterozygotes (n = 4 in all cases). JNK2/3 activity increased in both homozygote and heterozygote Hdh*^Q109^* mice relative to WT mice and differences were significant at p≤0.01 in a pooled t-test. Both JNK1 and JNK2/3 activities were increased by polyQ-Htt, but polyQ-Htt had a greater effect on JNK2/3 than JNK1.
JNK3 mediates effects of polyQ-Htt on FAT {#S5}
-----------------------------------------
JNK2/3 is selectively activated in neurons by stress in the presence of constitutive JNK1 activity[@R32], [@R33]. Based on differential activation of JNKs ([Fig. 3A--B](#F3){ref-type="fig"}), effects of specific JNK isoforms on FAT were evaluated. SB203580 differentially affects JNK1 and JNK2/3 *in vitro*[@R24]. At 10μM concentration, SB203580 preferentially inhibits JNK2/3; JNK1 inhibition requires a 10-fold higher concentration[@R23]. Axoplasmic JNK activity was almost eliminated by 100μM SB203580, but significant JNK activity remained with 10μM SB203580 ([Fig. 4A](#F4){ref-type="fig"}). However, 10μM SB203580 completely prevented inhibition of FAT by polyQ-Htt ([Fig. 4B](#F4){ref-type="fig"}), suggesting that polyQ-Htt effects involved JNK2 or JNK3. Significantly, 10μM SB203580 also prevented inhibition of FAT by polyQ-AR[@R7]. JNK isoforms were distinguished using biochemical approaches. JSAP1 is a scaffold protein regulating JNK activation[@R34]. Four JSAP1 isoforms were identified (a,b,c and d), all containing a 17-amino acid JNK binding domain (JBD) homologous to the JIP peptide ([Fig. 4C](#F4){ref-type="fig"}). A 31 amino acid insert in JSAP1c/JSAP1d selectively reduces binding to JNK3[@R34]. As a result, JSAP1d binds JNK3 with lower affinity than JSAP1a, and inhibits JNK3 less efficiently[@R34]. Recombinant JSAP1a (amino acids 115--233) and JSAP1d (amino acids 115--264) polypeptides were expressed and purified, then co-perfused at 5μM with polyQ-Htt ([Fig. 4D](#F4){ref-type="fig"}). Perfusion of JSAP1a and JSAP1d alone had no effect on FAT (not shown). As with JIP peptide ([Fig. 2E](#F2){ref-type="fig"}), co-perfusion of polyQ-Htt and JSAP1a completely prevented inhibition of FAT by polyQ-Htt ([Fig. 4D](#F4){ref-type="fig"}). In contrast, JSAP1d reduced, but did not eliminate polyQ-Htt effects on FAT ([Fig. 4E](#F4){ref-type="fig"}), suggesting JNK3 mediates polyQ-Htt effects in FAT.
Effects of specific JNK isoforms on FAT were evaluated in isolated axoplasm ([Fig. 5](#F5){ref-type="fig"}). The activity of recombinant JNKs was normalized *in vitro* using c-Jun as substrate (data not shown). JNK1 (200nM) did not affect FAT ([Fig. 5A](#F5){ref-type="fig"}), consistent with reports of constitutive JNK1 activity in neurons[@R32], [@R33]. JNK2 (100nM) decreased anterograde FAT rates slightly (1.25 μm/sec, compared to 1.6 μm/sec for control buffer; P≤ 0.01, two-sample *t*-test) ([Fig. 5B](#F5){ref-type="fig"}), but did not affect retrograde FAT ([Fig. 5D](#F5){ref-type="fig"}). As with polyQ-Htt perfusion ([Fig. 5D](#F5){ref-type="fig"}), JNK3 (100nM) inhibited both directions of FAT ([Fig. 5C](#F5){ref-type="fig"}). Quantitative analysis showed that JNK3 inhibited both anterograde (0.9 μm/sec; compared to 1.6 μM/sec in control buffer) and retrograde (1.25 μm/sec, compared to 1.4 μm/sec in control buffer) FAT at p≤ 0.01, two-sample *t*-test, suggesting that JNK3 is principally responsible for polyQ-Htt effects on FAT.
JNK3 phosphorylates kinesin-1 at Ser176 {#S6}
---------------------------------------
JNK3 phosphorylated kinesin-1, but not KLCs[@R7]. Using liquid chromatography tandem mass spectrometry (LC/MS/MS) we mapped residues in kinesin-1 phosphorylated by JNK3 ([Fig. 6](#F6){ref-type="fig"} and [Supplemental Fig. 2](#SD6){ref-type="supplementary-material"}). Kinesin-1 constructs encompassing the first 584 amino acids of kinesin-1C (KHC^584^) were phosphorylated *in vitro* with JNK3 ([Fig. 6B](#F6){ref-type="fig"})[@R7] and compared to non-phosphorylated KHC^584^. Phosphorylated polypeptides were digested with trypsin directly for LC/MS/MS analysis or for phosphopeptide enrichment by IMAC[@R35] and LC/MS/MS analysis ([Supplemental Fig. 2](#SD6){ref-type="supplementary-material"}). Identification of mass spectrometry-generated peptides used the SEQUEST algorithm. KHC^584^ identity was confirmed by identification of multiple kinesin-1C peptides (coverage of 72%) ([Supplemental Fig. 2](#SD6){ref-type="supplementary-material"}). Residual phosphorylation of several peptides was detected (not shown), but using analysis of protease cleavage sites, MS spectra, cross correlation (X-corr) as well as delta correlation (dCn) values, a unique peptide corresponding to amino acids 173-188, was identified with unequivocal evidence of phosphorylation by JNK3 ([Fig. 6A](#F6){ref-type="fig"}, and [Supplemental Fig. 2](#SD6){ref-type="supplementary-material"}). Phosphatase treatment reduced the phosphorylated peak intensity compared to neighboring peaks (not shown). This JNK3-phosphorylated peptide was within the kinesin-1c motor domain and contained two serines ([Fig. 6A](#F6){ref-type="fig"}). LC/MS/MS allowed precise mapping of the specific serine residue carrying the phosphorylation. Tandem mass spectrometry analysis by collision-induced dissociation (CID) indicated that phosphorylation occurs on Ser176, but not Ser175 ([Fig. 6](#F6){ref-type="fig"} and [Supplemental Fig. 2](#SD6){ref-type="supplementary-material"}). Presence of a proline residue adjacent to Ser176 (a hallmark of JNK substrates) supported identification of Ser176 as the JNK3 phosphorylation site. Mass spectrometric analysis of JNK1-phosphorylated KHC^584^ did not reveal phosphorylation at this site ([Supplemental Fig. 3](#SD6){ref-type="supplementary-material"}), consistent with differential effects of JNK1 and JNK3 on FAT ([Fig. 5**A, C**](#F5){ref-type="fig"}). To confirm ESI-LC/MS/MS analysis, site-directed mutagenesis substituted alanine for either Ser175 or Ser176 of KHC^584^ (KHC^584^-S175A and KHC^584^-S176A). Bacterially-expressed mutant proteins were purified ([Fig. 6B](#F6){ref-type="fig"}), then phosphorylated *in vitro* with JNK3, and ^32^P incorporation analyzed by Phosphorimaging. Phosphorylation of KHC^584^-S176A, but not KHC^584^-S175A, was reduced relative to wild-type KHC^584^ by≈30% (KHC^584^-WT, [Fig. 6B](#F6){ref-type="fig"}). Ser176 is conserved among squid, mouse and human kinesin-1s ([Supplemental Fig. 4A](#SD6){ref-type="supplementary-material"}). Levels of ^32^P incorporated in KHC^584^-S176A were consistent with mass spectrometry findings showing partial phosphorylation of KHC^584^*in vitro* at non-conserved residues outside the motor domain (not shown). Ser176 phosphorylation was also detected in kinesin-1 immunoprecipitated from mouse brain (not shown). Together, these data identified Ser176 as a major kinesin-1 residue phosphorylated by JNK3.
Ser176 phosphorylation affects kinesin-1 function {#S7}
-------------------------------------------------
Effects of polyQ-AR on FAT involved JNK activation, increased kinesin-1 phosphorylation and reduced microtubule binding of kinesin-1[@R7]. Ser176 localizes to loop 8, a sequence within the motor domain of kinesin-1 implicated in kinesin-1 interaction with microtubules ([Supplemental Fig. 4B](#SD6){ref-type="supplementary-material"})[@R36], suggesting its phosphorylation might affect kinesin-1 binding to microtubules. NSC34 cells were transiently transfected with WT-Htt, or polyQ-Htt (see [Fig. 3A](#F3){ref-type="fig"}). Total kinesin-1 levels were comparable for untransfected, WT-Htt, and polyQ-Htt-expressing cells ([Fig. 7A](#F7){ref-type="fig"}). However, microtubule-binding assays using the non-hydrolysable ATP analog AMP-PNP[@R7] revealed a reduction in kinesin-1 binding to microtubules in polyQ-Htt-expressing cells relative to WT-Htt-expressing cells ([Fig. 7A](#F7){ref-type="fig"}). Similar effects were observed when using immortalized striatal cell lines derived from wild type and Hdh*^Q109^* mice (not shown). This was consistent with reduced kinesin-1 binding to microtubules in cells expressing polyQ-AR[@R7].
Recombinant KHC^584^ was incubated with 100μM radiolabeled ^32^P-γATP in the presence or absence of active JNK3 ([Fig. 7B](#F7){ref-type="fig"}), then incubated with purified microtubules in the presence of AMP-PNP (2 mM) or 2 mM ATP (to control for non-specific pelleting, not shown). Microtubule pellets (P) and corresponding supernatants (SN) were analyzed by immunoblot to visualize non-phosphorylated KHC^584^ and autoradiography to visualize JNK3-phosphorylated KHC^584^. In the presence of AMP-PNP, kinesin-1 forms a rigor structure with microtubules[@R13]. Virtually all non-phosphorylated KHC^584^ partitioned with microtubules by immunoblot ([Fig. 7B](#F7){ref-type="fig"}), but a large fraction of JNK3-phosphorylated KHC^584^ remained in the SN ([Fig. 7B](#F7){ref-type="fig"}), suggesting that phosphorylation of kinesin-1 by JNK3 inhibits kinesin-1 binding to microtubules. The presence of JNK3-phosphorylated KHC^584^ in P fractions was consistent with residual phosphorylation at residues outside the motor domain. JNK-3 phosphorylation of kinesin-1 reduced binding to microtubules with AMP-PNP by ≈50% ([Supplemental Fig. 5](#SD6){ref-type="supplementary-material"}).
Effects of S176 phosphorylation on kinesin-1 motility *in vivo* were assessed by expressing GFP-tagged, truncated kinesin-1 constructs in cultured hippocampal neurons ([Fig. 8](#F8){ref-type="fig"}). When expressed in hippocampal cells, a GFP-tagged kinesin-1 construct (KHC^560^-GFP -WT) selectively translocates to axon distal ends and accumulates, but not in dendrites, indicating that this motor translocates preferentially along axonal microtubules[@R37]. KHC^560^-GFP-WT translocation is so efficient that little or no fluorescence can be detected within cell bodies or along axons[@R37]. To evaluate whether S176 phosphorylation affects kinesin translocation efficiency, we compared localization of phosphorylation-mimicking construct KHC^560^-GFP-S176E and its unphosphorylatable counterpart KHC^560^-GFP-S176A to that of KHC^560^- GFP-WT by quantitative fluorescence microscopy ([Fig. 8A--F](#F8){ref-type="fig"}). Much less phosphomimetic KHC^560^-GFP-S176E construct accumulated at axonal tips than the KHC^560^-GFP-WT construct (56 ± 2% vs. 87 ±3%, respectively, mean ± SEM; T-test, p \< 0.0001) ([Fig. 8G](#F8){ref-type="fig"}), with more KHC^560^- GFP- S176E fluorescence in cell bodies and faint staining of neurites ([Fig. 8C](#F8){ref-type="fig"}), the expected pattern if a significant fraction of phosphomimetic kinesin-1 were distributed like a soluble protein. Slightly less KHC^560^-GFP-S176A accumulated at axon tips (79% ± 2%) compared to KHC^560^- GFP-WT, but accumulations were still significantly higher than KHC^560^-GFP-S176E (t-test, p\<0.0001) ([Fig. 8G](#F8){ref-type="fig"}). Thus, a mutation of Ser176 mimicking phosphorylation reduces efficiency of processive kinesin-1 translocation in cultured neurons.
DISCUSSION {#S8}
==========
Despite ubiquitous expression of Htt, neuronal cells are uniquely vulnerable to the toxic gain-of-function in polyQ-expansion, suggesting that processes critical for proper neuronal function and survival are selectively altered in HD[@R3]. Axonal transport is essential for neurons, due to their large size and complex functional architecture [@R3]. Significantly, alterations in kinesin-1 function and regulation are associated with various human neuropathologies[@R3], [@R7], [@R38]-[@R40].
Several reports link FAT inhibition to pathogenesis in HD[@R4], [@R5], [@R8] [@R10] and other polyQ-expansion diseases[@R3], [@R7]. For example, overexpression of polyQ-Htt in cultured cells[@R10] and Drosophila[@R4], [@R5] leads to reduced transport and accumulation of vesicular cargos within axons. PolyQ-Htt and polyQ-AR, two otherwise unrelated proteins, similarly inhibit FAT vesicle motility in isolated axoplasm independently of changes in gene transcription or aggregate formation[@R7], [@R8]. Such observations implicate FAT defects in HD pathogenesis, which would partially explain the selective vulnerability of neurons in HD and other polyQ-expanded diseases[@R3].
Several models were proposed to explain the inhibition of FAT induced by polyQ-Htt. Some require physical interactions between Htt and conventional kinesin[@R41] or CDyn subunits[@R9], [@R10], [@R12]. PolyQ-Htt aggregates were proposed to sequester molecular motors[@R4] [@R6], or physically block FAT[@R5], [@R42]. Alternatively, Htt mutations were suggested to interfere with normal functions of Htt as a scaffold linking molecular motors to transported cargoes[@R9], [@R10] [@R11], or to affect the subunit composition and function of molecular motors[@R12]. However, axoplasm experiments indicated that polyQ-Htt inhibited FAT at concentrations 100-1000 fold lower than molecular motors, suggesting activation of enzymatic activities[@R3], [@R7], [@R8].
Cell fractionation and immunoprecipitation evaluated interactions between Htt and molecular motors in brain tissue from wild-type and homozygous Hdh*^Q109^* mice. Regardless of genotype, similar levels of full-length Htt were found in detergent-soluble (S) and detergent-insoluble (I) fractions. In contrast, KHCs, KLCs, DIC and DHC levels were much higher in soluble fractions, suggesting that most molecular motors are not sequestered by polyQ-Htt. Unlike experiments involving Htt overexpression, immunoprecipitation failed to detect interactions between endogenous Htt and kinesin[@R41] or CDyn[@R12] ([Fig. 1](#F1){ref-type="fig"}). Detection of KLCs in KHC- and DHC in DIC-immunoprecipitates confirmed that physiologically relevant protein complexes were preserved[@R13], [@R14]. Such observations are inconsistent with models in which polyQ-Htt inhibits FAT through direct interactions with molecular motors.
Another model proposed that pathogenic polyQ-Htt activates neuronal regulatory pathways that affect FAT[@R3]. Kinesin-1 and CDyn are regulated by phosphorylation of specific motor subunits[@R7], [@R18]. Kinase activities that regulate FAT, including GSK-3[@R43]; Akt[@R44], and JNK[@R20], [@R22], [@R45] are altered in Huntington's and polyQ-AR activates JNK[@R7]. JNK inhibitors blocked polyQ-Htt effects on FAT and JNK activation was documented in polyQ-Htt-expressing cells and Hdh*^Q109^* mice ([Fig. 3](#F3){ref-type="fig"}). JNK activation was more pronounced in homozygous Hdh*^Q109^* mice than heterozygous littermates, but increased in both, consistent with autosomal dominant inheritance of HD. JNK activation in presymptomatic Hdh*^Q109^* mice indicated that this change represents an early event in HD.
Mammals have three JNK genes (JNK1, JNK2 and JNK3)[@R46]. Analysis of JNK in Hdh*^Q109^* mice and polyQ-Htt-transfected cells indicated that polyQ-Htt increased JNK2/3 activity more than JNK1 ([Fig. 3](#F3){ref-type="fig"}), consistent with reports showing constitutive JNK1 activity and selective JNK2/3 activation in neurons with stress[@R32], [@R33]. This prompted us to examine roles for specific JNK isoforms mediating polyQ-Htt effects on FAT. SB203580 inhibits JNK2/3 at 10μM, but JNK1 inhibition requires ≥100μM[@R23]. Significant JNK activity (presumably JNK1) remains in axoplasms treated with 10μM SB203580 ([Fig. 4A](#F4){ref-type="fig"}), but 10μM SB203580 prevented polyQ-Htt effects on FAT ([Fig. 4B](#F4){ref-type="fig"}), suggesting that polyQ-Htt effects on FAT involve JNK2/3. JSAP1 polypeptides further supported a role for JNK3, because JSAP1a, which inhibits all JNKs, preserved FAT effectively, but JSAP1d, with a 31- amino acid insert that selectively interferes with JNK3 binding[@R34] did not ([Fig. 4D--E](#F4){ref-type="fig"}). To evaluate the role of individual JNKs on FAT, effects of active recombinant JNK1, JNK2 and JNK3 on FAT were evaluated in axoplasm. Active JNK1 had no effect on FAT ([Fig. 5A](#F5){ref-type="fig"}), consistent with constitutive JNK1 activity in axons[@R32], [@R33] ([Fig. 4A](#F4){ref-type="fig"}). JNK2 produced a selective, moderate effect on anterograde FAT, but no effect on retrograde FAT. In contrast, JNK3 effects on FAT paralleled those of polyQ-Htt by inhibiting both anterograde and retrograde FAT. Although JNK2 may contribute, JNK3 appears to primarily mediate polyQ-Htt effects on FAT. Notably, JNK3 is preferentially expressed in nervous tissues[@R47] and polyQ-Htt pathology is restricted to neurons.
To provide a molecular basis for FAT inhibition by JNK3, relevant phosphorylation sites were identified. Mass spectrometry mapped JNK3 phosphorylation of kinesin-1 to S176, a conserved residue in the motor domain ([Fig. 6A](#F6){ref-type="fig"}, [Supplemental Fig. 2](#SD6){ref-type="supplementary-material"}--[3](#SD6){ref-type="supplementary-material"}). S176 was also modified in kinesin-1 immunoprecipitated from mouse brain (not shown). Mutagenesis studies confirmed that JNK3 phosphorylated Ser176 ([Fig. 6B](#F6){ref-type="fig"}). JNK1 did not phosphorylate kinesin-1 at Ser176 ([Supplemental Fig. 3](#SD6){ref-type="supplementary-material"}), consistent with unique substrate preferences for JNK3[@R48]. Ser176 was conserved among squid, mouse and human kinesin-1s ([Supplemental Fig. 4A](#SD6){ref-type="supplementary-material"}), validating the squid axoplasm model. Collectively, these data demonstrate that JNK3 activity is elevated in brains of Hdh*^Q109^* mice and axoplasm perfused with polyQ-Htt ([Fig. 3](#F3){ref-type="fig"}--[4](#F4){ref-type="fig"}); that JNK3 phosphorylates kinesin-1 at Ser176 ([Fig.6](#F6){ref-type="fig"} and [Supplemental Fig. 2](#SD6){ref-type="supplementary-material"}--[3](#SD6){ref-type="supplementary-material"}), and that Ser176 modification is sufficient to inhibit trafficking of kinesin-1 ([Fig. 8](#F8){ref-type="fig"}). Antibodies selective for this epitope are under development and should allow us to quantify the fraction of neuronal kinesin-1 modified by JNK3 in HD brains.
Based on the Ser176 position within the motor domain[@R36], we evaluated effects of JNK3 phosphorylation on kinesin-1 binding to microtubules. JNK3-treated recombinant kinesin-1 and kinesin-1 in polyQ-Htt-transfected cells exhibited reduced binding to microtubules ([Fig. 7](#F7){ref-type="fig"}). Further, pseudophosphorylation at Ser176 dramatically decreased kinesin-1 translocation *in vivo* ([Fig. 8](#F8){ref-type="fig"}), indicating that Ser176 phosphorylation interferes with kinesin-1 function.
Our results suggest that polyQ-Htt inhibits FAT by activation of axonal JNKs. Additionally, JNK activation by polyQ-Htt is also consistent with changes in transcription[@R49], and JNKs can be pro-apoptotic[@R30] ([Supplemental Fig. 6](#SD6){ref-type="supplementary-material"}). Significantly, JNK3, and not JNK1, activity mediated polyQ-Htt effects on FAT, providing a partial explanation for selective neuronal vulnerability in HD. JNK1 and JNK2 are ubiquitously expressed, whereas JNK3 is selectively expressed in brain and testes[@R47]. Identification of kinesin-1 as a novel JNK3 substrate provided a molecular basis for changes in FAT consistent with neuron-selective pathology of polyQ-Htt.
In sum, neuronal JNK3 is activated by polyQ-Htt. JNK3 in turn phosphorylates kinesin-1, decreasing its ability to bind microtubules and move cargoes in FAT ([Fig. 8](#F8){ref-type="fig"} and [Supplemental Fig. 6](#SD6){ref-type="supplementary-material"}). Identification of Ser176-phosphorylated kinesin-1 in normal mouse brain suggests a role of JNK3 in a normal pathway for regulating kinesin and delivering specific MBO cargoes to particular neuronal domains. Increased activation of this pathway by polyQ-Htt would lead to reductions in kinesin-based transport, deficits in synaptic and axonal function, and eventual dying-back neuronal degeneration[@R3]. Inhibition of JNK3 sufficed to prevent inhibition of FAT due to polyQ-Htt. These results suggest that elevation of JNK activity and consequent inhibition of FAT may represent primary pathogenic events in Huntington's disease. Further studies should illuminate molecular components mediating JNK activation by polyQ-Htt. Regardless; inhibition of JNK activity to protect FAT represents a promising therapeutic target for treatment of Huntington's disease.
MATERIAL AND METHODS {#S9}
====================
Antibodies and Reagents {#S10}
-----------------------
The following antibodies were used: anti-KHC (H2 clone, Chemicon)[@R13], anti-pan KLCs (63-90 clone, Chemicon)[@R13], anti-dynein intermediate chain (Santa Cruz \#13524), anti-dynein heavy chain (Santa Cruz \#9115), anti-phospho Akt (44-622G, Biosource), anti-Htt (2166, Chemicon), anti-pan-JNK (Upstate \#06-748), anti-JNK1 (Pharmingen \#554268), anti-JNK2 (Cell Signaling \#4672), anti-JNK3 (Cell Signaling \#2305), anti-phospho JNK (Cell Signaling \#9251), anti-GST (Sigma \#G7781), anti-phospho c-Jun (Santa Cruz \#16312), anti-tubulin (DM1A, Sigma). All antibodies were characterized for specificity against the tissues used (see [Supplemental Figure 7](#SD6){ref-type="supplementary-material"}). The following secondary antibodies were used: Jackson 111-035-045 HRP-conjugated goat anti-rabbit, Jackson 115-035-146 HRP-conjugated goat anti-mouse IgG, and Jackson 805-035-180 HRP-conjugated bovine anti-goat IgG.
SB203580, SP600125 (JNK inhibitor II), okadaic acid, staurosporine, K252a, 50nM okadaic acid, microcystin and c-Jun were obtained from Calbiochem. The HDAC inhibitor BC-6-25[@R27] was a generous gift from Alan Kozikowski (UIC). Inhibitor stocks were prepared in DMSO. Active JNK kinases were from Upstate (JNK1 \#14-327, JNK2 \#14-329, and JNK3 \#14-501). His-tagged KHC^584^ protein constructs were expressed in BL21-Codon Plus (DE3) *E. coli* (Stratagene), and purified using Talon beads (Clontech). Trx-tagged JSAP1 polypeptides were expressed and purified as described before[@R34].
Immunoblots {#S11}
-----------
Proteins were separated by SDS-PAGE on 4-12% Bis-Tris gels (NuPage minigels, Invitrogen), using MOPS Running Buffer (Invitrogen) and transferred to PVDF using Towbin buffer supplemented with 10% (v/v) methanol (90 minutes at 400mA using Hoeffer TE22 apparatus). Immunoblots were blocked with 1% (w/v) non-fat dried milk in TBS (25 mM Tris pH 7.2, 2.68 mM KCl, 136.8 mM NaCl). Membranes were incubated with primary antibodies overnight at 4° C in 1% IgG free-BSA (Jackson Immunoresearch), and washed four times with 0.1% Tween-20 in TBS. Primary antibody binding was detected with HRP-conjugated anti-mouse, anti-rabbit or anti-goat antibodies (Jackson Immunoresearch), and visualized by chemiluminescence (ECL, Amersham). Quantitative immunoblotting was performed as before[@R39].
Immunoprecipitation {#S12}
-------------------
Mouse brains from wild-type and Hdh*^Q109^* knock-in mice were homogenized in lysis buffer (LB; 25 mM Tris pH 7.4, 150 mM NaCl, 1% Triton X-100, and mammalian protease inhibitor cocktail (Sigma, 1/100 dilution)\]. Lysates were centrifuged twice for 5 minutes at 55,000 rpm (163,640 g~max~) using a TLA 100.3 rotor (Beckman Instruments, Palo Alto, CA). The resulting supernatant fractions were precleared using a mixture of Protein G agarose beads (Pierce), and non-immune mouse IgG-conjugated Sepharose beads (Jackson Immunoresearch) for 1 hour at RT. 400 μg of each precleared brain lysate were brought to 1 ml with LB, and incubated with 5μg of the appropriate antibody plus 10μl of Protein G agarose beads at 4° C for 3hs. Immunocomplexes were recovered by centrifugation (3000 g~max~ for 30 seconds), washed four times with 1 ml LB, once with 50mM HEPES pH 7.4, and resuspended in Laemmli buffer. For immunodepletion experiments ([Fig. 1B](#F1){ref-type="fig"} and [supplemental Fig. 1B](#SD6){ref-type="supplementary-material"}), precleared mouse brain lysates were subject to three cycles of immunoprecipitation with H2 or DIC antibodies as above. After each immunoprecipitation cycle, a 50μl aliquot of each supernatant was saved for immunoblot analysis, as before[@R13], [@R14].
Vesicle Motility assays in isolated axoplasm {#S13}
--------------------------------------------
Axoplasm was extruded from giant axons of the squid *Loligo pealii* (Marine Biological Laboratory) as described previously[@R7], [@R8]. Recombinant proteins, peptides or inhibitors were diluted into X/2 buffer (175 mM potassium aspartate, 65 mM taurine, 35 mM betaine, 25 mM glycine, 10 mM HEPES, 6.5 mM MgCl~2~, 5 mM EGTA, 1.5 mM CaCl~2~, 0.5 mM glucose, pH 7.2) supplemented with 2-5 mM ATP and 20 μl added to perfusion chambers. Preparations were analyzed on a Zeiss Axiomat with a 100X, 1.3 n.a. objective, and DIC optics. Hamamatsu Argus 20 and Model 2400 CCD camera were used for image processing and analysis. Organelle velocities were measured with a Photonics Microscopy C2117 video manipulator (Hamamatsu).
Recombinant Constructs {#S14}
----------------------
Expression vectors encoding amino acids 1--548 of human Htt with an N-terminal FLAG epitope tag were translated *in vitro* as described previously[@R8], and used for vesicle motility assays. Expression vectors encoding amino acids 1-969 of human Htt (wild type (Q16) and pathogenic (Q46)) with an N-terminal FLAG tag were used for transfection studies ([Fig. 3A](#F3){ref-type="fig"} and [7A](#F7){ref-type="fig"})[@R29]. His-tagged KHC^584^-S176A, KHC^584^-S176A, and GFP-tagged KHC^560^ mutant constructs were generated using the Quick-site mutagenesis kit (Stratagene).
Axoplasmic JNK activity assays {#S15}
------------------------------
For experiments on kinase activity in axoplasm ([Figs. 2C](#F2){ref-type="fig"} and [4A](#F4){ref-type="fig"}), 3- 4 axoplasms were triturated in 280μl of KB buffer (KB: 10mM Hepes pH 7.4, 10mM MgCl~2~, 1mM DTT) minus ATP. Reactions (50μl) were incubated at RT and started by adding ATP (50μM). Aliquots were collected at various time points up to 20 minutes and analyzed by immunoblotting.
Brain Tissue/Cell lysate preparation {#S16}
------------------------------------
Mouse brain tissue and cultured cells were homogenized in ROLB buffer \[10mM Hepes pH7.4, 0,5% Triton X-100, 80mM β-glycerophosphate, 50mM Sodium Fluoride, 2mM Sodium Orthovanadate, 100nM Staurosporine, 100nM K252a, 50nM Okadaic acid, 50nM Microcystin, 100mM Potassium Phosphate and mammalian protease inhibitor cocktail (Sigma)\]. Lysates were clarified by centrifugation, and protein concentration determined using BCA kit (Pierce). All mouse use was under protocols approved by the Institutional Animal Care and Use Committee at UIC and followed NIH guidelines for vertebrate animal use.
NSC34 Cell Culture and Transfection {#S17}
-----------------------------------
NSC34 cells were plated at 10,000 cells/cm^2^ on 10 cm tissue culture dishes for biochemical studies and grown on DMEM containing 1mM glutamine and 10% Fetal Bovine Serum (Hyclone). When cells reached 60-70% confluency, media was replaced by DMEM plus 1mM glutamine, and cells transfected with WT-Htt and polyQ-Htt constructs (1-969)[@R29] using Lipofectamine 2000 (Invitrogen), as previously described[@R39]. JNK activation was evaluated 24h after transfection.
Microtubule-binding Assays {#S18}
--------------------------
NSC34 cells were transfected with WT-Htt and polyQ-Htt constructs as described above. After 24 hours, cells were scraped in BRB80 buffer \[80 mM PIPES pH 7, 1 mM MgCl~2~, 1 mM EGTA, 1 μM staurosporine, 1 μM K252a, 50 nM okadaic acid, 200 nM microcystin, 1/100 dilution of phosphatase inhibitor cocktail II (Calbiochem), and1/100 dilution of mammalian protease inhibitor cocktail (Sigma)\] at 4°C, and homogenized using a 30g syringe (500μl of BRB80/10 cm dish). Lysates were centrifuged at 14,000 rpm in a tabletop centrifuge for 5 minutes, and centrifuged at 55,000 rpm in TLA100.3 rotor for additional 5 minutes. 700 μg of total protein from clarified supernatants were incubated with 0.2 mg of taxol-stabilized microtubules and 2.5 mM AMP-PNP (Sigma) for 30 min at 37 °C. The mixture above was loaded on top of a cushion made of 20% sucrose in BRB80 buffer, and centrifuged for 15 minutes at 50,000 rpm using a Beckman TLA-100.3 rotor at room temperature. Microtubule-enriched pellets were resuspended in Laemmli buffer and analyzed by immunoblotting. For microtubule binding experiments ([Fig. 7B](#F7){ref-type="fig"}), 4μl aliquots of *in vitro*-phosphorylated KHC^584^ (prepared as above) were incubated with 64μg of taxol-stabilized microtubules in BRB80 buffer and either 2mM AMP-PNP or 2mM ATP (100μl total volume). After 30 minutes incubation, these mixtures were centrifuged for 15 minutes at 50,000 rpm over a cushion of 20% in BRB80 in a Beckman TLA-100.3 rotor at 37° C. Pellets and supernatants were collected, and the levels of kinesin in each fraction quantified by phosphorimager scanning of radioactivity or with fluorescently-labeled secondary antibodies.
Kinesin-1 Translocation Assays {#S19}
------------------------------
Accumulation of KHC^560^-GFP-WT and KHC^560^-GFP-S176E constructs in neurites of cultured hippocampal neurons was evaluated as before[@R37].
Statistical Analysis {#S20}
--------------------
All experiments were repeated at least 3 times. Unless otherwise stated, the data was analyzed by ANOVA followed by post-hoc Student-Newman-Keul's test in order to make all possible comparisons. Data was expressed as mean ± SEM and significance was assessed at *p*\<0.05 or 0.01 as noted.
Mouse Brain Fractionation {#S21}
-------------------------
Brains from wild-type (12 months old) and Hdh*^Q109^* knock-in (14 months old) were homogenized in 3mls of HB buffer (50mM Hepes pH 7.4, 150 mM NaCl, 1% Triton X-100) and centrifuged 2X 2,500g for 10 minutes, and 1X at 7,000g for 10 minutes to pellet debris and nuclei. Clarified lysates were spun at 150,000g for 20 minutes, in a Beckman TLA 100.3 rotor at 55,000 RPM. The pellets and supernatant represented detergent insoluble and detergent-soluble fractions, respectively. Detergent insoluble pellets were resuspended in HB. Equal amounts of protein from each fraction were analyzed by immunoblotting.
In vitro Phosphorylation {#S22}
------------------------
*In vitro* phosphorylation experiments (40 μl volume) were performed by incubating KHC^584^ protein constructs (3 μM) with 0.1μM JNK3 (Upstate) or 0.2μM JNK1 (Upstate) in HEM buffer (50 mM HEPES, 12 mM MgSO4, 100 μM ATP pH 7.4), as previously described[@R7]
Mass Spectrometry Studies {#S23}
-------------------------
Phosphorylated KHC^584^ protein was subjected to *in solution* trypsin digestion. Briefly, dried samples were resuspended in 30 mM Hepes, 30 mM NaF in the presence of 1 μg of trypsin (Sigma, proteomics grade) and incubated at 37° C overnight (16-18h). The resulting tryptic peptides were later resuspended in buffer A (5% acetonitrile, 0.4% acetic acid, 0.005% of HFBA in water) for mass spectrometry analysis or prepared for IMAC[@R35]. Samples were analyzed by liquid chromatography on line with a LTQ (a two-dimensional ion trap) instrument equipped with a commercial nanospray source (Thermo Finnigan, San Jose, CA). Samples were automatically loaded by a microautosampler (Famos, LC Packings, Sunnyvale, CA) onto an 11-cm × 100μm fused silica capillary column packed with reverse C18 material (5-μm, 100-Å Magic beads, Michrom Bioresources, Auburn, CA). The solvent system was delivered by an HP1100 pump (Agilent Technologies, Palo Alto, CA). Samples were analyzed by performing full scan followed by tandem MS or MS/MS or MS^2^ of the 5 most intense ions (top 5) by collision induced dissociation (CID). Sample loading, solvent delivery, and scan function were controlled with Xcalibur software (Thermo Finnigan). Liquid chromatography tandem mass spectrometry files were searched using SEQUEST algorithm against a generated database containing KIF5C_Rat and KIF5C_Mouse, among others proteins. SEQUEST search parameters included mass tolerance of ±1.5 Da, trypsin specificity, and differential search for serine, threonine and tyrosine phosphorylation. The generated data set was filtered using INTERACT[@R50] based on the following criteria: delta correlation, dCn: 0.1, X correlation value for +1 peptides ≥ 1.8, +2 ≥ 2.2 and +3 ≥ 3.2.
The authors would like to thank Drs Marcy MacDonald and Marian DiFiglia for knock-in mice and huntingtin constructs, respectively, and Bin Wang for excellent technical assistance. This work was supported by 2007/2008 MBL summer fellowship to GM; an HDSA grant to GM; NIH grants MH066179 to GB; and ALSA, Muscular Dystrophy Association, and NIH (NS23868, NS23320, NS41170) grants to STB.
**Author Contributions**: GAM and STB performed transport and biochemistry experiments and wrote the manuscript; YY, SLP, AK, KL performed transport and biochemistry experiments; KY provided and characterized recombinant JIP; BB, ETC, CB and DH performed Mass Spectrometry studies; and CFH and GB did GFP-kinesin experiments. All authors reviewed and edited the manuscript
Supplementary Material {#S24}
======================
![Endogenous Htt does not interact with molecular motors\
**A**) Detergent-soluble brain lysates obtained from wild type (WT) and 14 month-old Hdh*^Q109^* knock-in (polyQ) mice were immunoprecipitated with antibodies against Htt, kinesin-1 (KHC), or dynein intermediate chains (DIC). Immunoblots of resulting immunoprecipates (IPP) showed that anti-kinesin-1 antibodies (H2[@R13]) effectively precipitated both kinesin-1 heavy (KHC) and light chains (KLC), but failed to precipitate Htt, dynein heavy chain (DHC) or dynein intermediate chain (DIC). Similarly, anti-DIC antibodies (74.1[@R16]) immunoprecipitated DIC and DHC, but not Htt. Conversely, anti-Htt antibodies effectively immunoprecipitated Htt, but not KHC, KLC, DIC or DHC. Immunoprecipitation with non-immune mouse IgG (NMIgG) provided a control for non-specific immunoprecipitation. An aliquot of each brain lysate before immunoprecipitation (Input) was used as a positive control. **B**) Detergent-soluble brain lysates from wild type (WT-Htt) and Hdh*^Q109^* knock-in (polyQ-Htt) mice were subjected to three cycles of immunoprecipitation with antibodies against kinesin-1. Aliquots of each supernatant (SN1-3) were analyzed by immunoblot. Note reductions in both KHC and KLC immunoreactivity with each cycle. In contrast, no change in Htt levels was detected, regardless of mouse genotype. Immunoprecipitations with a non-immune mouse IgG (Ctrl) served as a control for non-specific precipitation of proteins.](nihms115377f1){#F1}
![JNK inhibitors prevent polyQ-Htt-induced FAT inhibition\
Vesicle motility assays in isolated axoplasm show individual velocity measurements (arrowheads) as a function of time. Dark arrowheads and line show anterograde kinesin-dependent FAT rates and reverse grey arrowheads and line show retrograde, cytoplasmic dynein-dependent FAT rates. *In vitro* translated Htt constructs were perfused as before[@R8]. **A**) Perfusion of WT-Htt does not affect FAT[@R8] **B**) Perfusion of polyQ-Htt inhibited both anterograde and retrograde FAT[@R8]. **C**) Endogenous JNK activity in squid axoplasm is revealed by *in vitro* phosphorylation assays. A time-dependent increase in cJun phosphorylation at JNK sites (cJun S63/73) is seen when GST-cJun is incubated with squid axoplasm lysates (Axo). Phosphorylation of GST-cJun is completely inhibited by either SP600125 or JIP peptide (JIP), two well-characterized JNK inhibitors. Anti-GST antibody shows similar GST-cJun levels for each reaction (cJun Total). Co-perfusion of polyQ-Htt with either **D**) SP600125 (500nM) or **E**) JIP peptide (100 μM) completely prevented inhibition of FAT elicited by polyQ-Htt (compare D-E with B). **E**) In contrast, co-perfusion of polyQ-Htt with the histone deacetylase inhibitor BC-6-25[@R27] (10μM) failed to prevent polyQ-Htt effects on FAT. These results indicate that polyQ-Htt-mediated inhibition of FAT involves activation of endogenous axoplasmic JNK.](nihms115377f2){#F2}
{#F3}
![The effects of polyQ-Htt on FAT are mediated by JNK3\
SB203580 blocks the action of pathogenic androgen receptor on FAT[@R8], but SB203580 is a poor inhibitor of JNK1 (IC~50~≥100 μM) and a good inhibitor of JNK2/3 (IC~50~≈10μM)[@R23]. **A**)*In vitro* phosphorylation assays in axoplasm showed a dose-dependent inhibition of axoplasmic JNK activity by SB203580. Notably, significant JNK activity remained in the presence of 10μM SB203580, presumably representing endogenous JNK1 activity. **B**) In contrast, vesicle motility assays in isolated squid axoplasm show that effects of polyQ-Htt on FAT were blocked by SB203580 at 10μM, which is consistent with an action on JNK2/3. **C**) Sequence alignment of a JIP peptide inhibitor (Calbiochem) with portions of JSAP1a and JSAP1d polypeptides[@R34]. The boxed region indicates the highly conserved JNK binding domain (JBD). A 31-aminoacid peptide sequence unique to JSAP1d (underlined) selectively interferes with binding to JNK3[@R34]. **D**) Co-perfusion of polyQ-Htt with JSAP1a (5 μM) which blocks both JNK1 and JNK3 activity, effectively prevents effects of polyQ-Htt on FAT. **E**) Co-perfusion of polyQ-Htt with JSAP1d (5μM), which preferentially inhibits JNK1, only partially blocks polyQ-Htt effects. These results suggest that JNK3 mediates the effects of polyQ-Htt on FAT.](nihms115377f4){#F4}
{ref-type="fig"}) **D**) Bar graphs showing mean FAT rates in axoplasm perfused with active JNKs and polyQ-Htt. Error bars show SEM. Data represent pooled FAT rate measurements between 30-50 min of observation. Anterograde FAT rates after polyQ-Htt perfusion were comparable to those elicited by perfusion of active JNK3 and both JNK3 and polyQ-Htt significantly inhibit retrograde FAT.](nihms115377f5){#F5}
{ref-type="supplementary-material"}). **B**) Recombinant KHC^584^-WT protein was incubated in the presence (+) or absence (-) of active JNK3 and ^32^P-ATP, and analyzed by SDS-PAGE. The ability of JNK3 to phosphorylate KHC^584^ at S175 and S176 was also evaluated using KHC^584^-S175 and KHC^584^-S176A mutants. An autoradiogram (^32^P) showed a dramatic reduction in the phosphorylation of a KHC^584^-S176A (S176A) construct relative to wild type (WT) and KHC^584^-S175A (S175A) constructs (arrow). Coomassie blue (CB) staining showed comparable amounts of KHC^584^ in all lanes. Asterisk indicates autophosphorylated JNK3. These results indicated that S176 is the main residue phosphorylated by JNK3.](nihms115377f6){#F6}
{ref-type="fig"} were analyzed by immunoblot. Total levels (Input) of kinesin-1 (KHC), dynein heavy chain (DHC) and tubulin (Tub) were comparable for untransfected (Ctrl), WT-Htt and polyQ-Htt-expressing cells. However, the fraction of kinesin-1 recovered in association with microtubules was reduced for lysates from polyQ-Htt expressing cells, when compared to untransfected and WT-Htt-expressing cells. **B**) Microtubule-binding assays using recombinant kinesin-1 (KHC^584^). Immunoblot (WB) shows that unphosphorylated KHC^584^ is mainly recovered in association with microtubules (Pellet). An autoradiogram (^32^P) reveals a significant fraction of JNK3-phosphorylated KHC^584^ remains in the supernatant.](nihms115377f7){#F7}
{#F8}
|
The potential of aldehyde dehydrogenase 2 as a therapeutic target in cardiovascular disease.
Mitochondrial aldehyde dehydrogenase (ALDH-2) plays a major role in the ethanol detoxification pathway by removing acetaldehyde. Therefore, ALDH-2 inhibitors such as disulfiram represent the first therapeutic targeting of ALDH-2 for alcoholism therapy. Areas covered: Recently, ALDH-2 was identified as an essential bioactivating enzyme of the anti-ischemic organic nitrate nitroglycerin, bringing ALDH-2 again into the focus of clinical interest. Mechanistic studies on the nitroglycerin bioactivation process revealed that during bioconversion of nitroglycerin and in the presence of reactive oxygen and nitrogen species the active site thiols of ALDH-2 are oxidized and the enzyme activity is lost. Thus, ALDH-2 activity represents a useful marker for cardiovascular oxidative stress, a concept, which has been meanwhile supported by a number of animal disease models. Mechanistic studies on the protective role of ALDH-2 in different disease processes identified the detoxification of 4-hydroxynonenal by ALDH-2 as a fundamental process of cardiovascular, cerebral and antioxidant protection. Expert opinion: The most recent therapeutic exploitation of ALDH-2 includes activators of the enzyme such as Alda-1 but also cell-based therapies (ALDH-bright cells) that deserve further clinical characterization in the future.
|
Electronic cigarettes are proving more effective than conventional nicotine-replacement products. Perhaps that’s why they are meeting so much resistance.
By John Luik
<please run author’s photo with intro>
When I last discussed electronic cigarettes in these columns (“Inconveniently Effective,” Tobacco Reporter, May 2010), the U.S. Food and Drug Administration was furiously trying to prohibit their entry and distribution into the United States. In January, however, Judge Richard Leon ordered the FDA to release the impounded products of two distributors, NJOY and Smoking Everywhere.
The FDA’s position was based on two arguments. First, there was the claim that e-cigarettes should be considered drug-delivery devices—as opposed to tobacco products—and thus subject to FDA regulation. Second, there was claim that e-cigarettes were not safe. In a study, the FDA had examined e-cigarettes from both NJOY and Smoking Everywhere and found carcinogenic nitrosamines in half of the samples. In one sample from Smoking Everywhere, FDA tests found a trace amount of diethylene glycol, a chemical found in antifreeze.
Since this initial skirmish, the e-cigarette industry has continued to win in court. In December 2010, a federal appeals court in Washington ruled in the industry’s favor, and an FDA request to overturn this decision was rejected by the full appeals court in January.
Deeper issues
The entire case against e-cigarettes, however, goes beyond the concerns about safety and the question of whether they are drug devices or tobacco products. The U.K. public health charity Action on Smoking and Health (ASH), for example, advances three arguments against e-cigarettes. According to ASH, e-cigarette users exhale a cloud of “smoke” comprised of chemicals that are toxic and addictive. Second, there is no evidence that e-cigarettes, irrespective of their impact on third parties, are safe for their users. Third, according to ASH, e-cigarettes might lead people to believe that they are safer than conventional cigarettes and may thus recruit new smokers and increase nicotine addiction.
Part of the answer to the health worries surrounding e-cigarettes can be found in two studies. The first was conducted by Dr. Thomas Eissenberg of the Virginia Commonwealth University and funded by the U.S. National Cancer Institute. The second is by Zachary Cahn and Michael Siegel, of the University of California at Berkeley and Boston University, respectively (“Electronic cigarettes as a harm reduction strategy for tobacco control: A step forward or a repeat of past mistakes?” Journal of Public Health Policy, 2010)
Cahn and Siegel located 16 studies that have looked at the components found in the e-cigarette liquid and vapor. They write that the primary components of electronic cigarette cartridges are propylene glycol, glycerin and nicotine. Two of the studies found TSNAs at trace levels—8.2ng/g, which compares with a TSNA level of 8 ng in a typical nicotine patch. More crucially, TSNA levels are significantly lower in e-cigarettes than in regular cigarettes. Aside from TSNAs, Cahn and Siegel note that few, if any, chemicals at levels detected in electronic cigarettes raise serious health concerns. “Although the existing research does not warrant a conclusion that electronic cigarettes are safe in absolute terms, and further clinical studies are needed to comprehensively assess the safety of electronic cigarettes, a preponderance of the available evidence shows them to be much safer than tobacco cigarettes and comparable in toxicity to conventional nicotine replacement products,” the researchers write.
And this is surely the relevant point of comparison. It is not whether e-cigarettes are absolutely safe but whether they are safer than traditional cigarettes and comparable in safety to typical nicotine replacement products.
Eissenberg comes to the e-cigarette issue from a slightly different perspective. His objective was to find out how e-cigarettes affect smokers’ nicotine levels, cigarette cravings and heart rates when compared with tobacco cigarettes.
In the test, 16 smokers who had never used e-cigarettes and who had not smoked for 12 hours smoked either a fake-cigarette, their usual brand or an e-cigarette. The smokers were told to puff normally 10 times. Following this their craving and nicotine levels were assessed for an hour, after which the procedure was repeated.
The results were striking. The nicotine levels in the e-cigarette smokers were not noticeably different than those who smoked fake cigarettes. The mean nicotine level of e-cigarettes smokers was 3.5 ng/ml, while the mean nicotine level of tobacco smokers was 20 ng/ml.
They work
While the media has focused on the fact that the e-cigarettes in this study didn’t appear to deliver much nicotine—with some anti-tobacco activists arguing this is yet another reason to ban them—the more interesting fact about Eissenberg’s research has been ignored: Even though they fail to deliver significant amounts of nicotine, e-cigarettes appear to satisfy smokers’ cravings for cigarettes.
So, contrary to the anti-tobacco lobby’s claim that e-cigarettes increase nicotine addiction, they appear to lessen such addiction. And even if there were an increase in nicotine addiction, it is not nicotine addiction that is the lethal component of conventional cigarettes. Just as methadone prevents some of the horrible effects of heroin addiction without curing the addiction, so e-cigarettes might well prevent some of the risks of cigarette smoking even while leaving smokers addicted.
This leaves only the third claim against e-cigarettes—that they may lead smokers to think that these new products are safer than conventional cigarettes. Given the findings of the mentioned studies, the question is why should this be a problem? Why would the agency regulating cigarettes want smokers to believe that all tobacco and nicotine products carry the same risk? After all, nicotine-replacement products (NRP) are freely sold over the counter and recommended by the anti-tobacco movement and the government as safer alternatives to smoking. How are e-cigarettes different from other NRPs, aside from the fact that they are not manufactured by the pharmaceutical industry, which has hugely supported the anti-smoking movement?
But here, of course, we come to the crux of the issue, as Cahn and Siegel note in their paper. E-cigarettes appear to present no significant risks to their users, or certainly no risks comparable to those presented by conventional smoking. Moreover, they appear to satisfy a smoker’s craving without providing him anywhere near the amount of nicotine found in regular tobacco products. Finally, they look to satisfy the non-pharmacological aspects of smoking by mimicking the “real” smoking experience. One would think this was a rare but complete win-win.
But it is precisely these qualities that doom e-cigarettes with the FDA and the anti-tobacco movement.
First, the anti-tobacco movement and much of the FDA is dominated by individuals who are opposed to harm reduction. A product that reduces tobacco-related harm while still satisfying smokers goes against the prevailing mantra—that the only acceptable option is to quit smoking altogether. Whatever their ability to satisfy the cravings of smokers without delivering much nicotine, e-cigarettes are simply too much like conventional cigarettes.
Second, and more perversely, the anti-tobacco movement will continue to oppose e-cigarettes as a smoking-cessation device because it is captive to the pharmaceutical industry, which provides many of its funds. The main competitors to e-cigarettes are the NRP devices made and marketed by Big Pharma—devices that have proven highly ineffective in sustaining smoking cessation.
The last thing Big Pharma wants is a public health community promoting e-cigarettes as a conventional smoking-cessation device. The real opposition to e-cigarettes then has nothing to do with safety but with competitors’ fears that they might work and compromise their market.
The fact that e-cigarettes might benefit both smokers and public health is a consideration of little or no consequence to them. For a movement that always claims the moral high ground, that’s quite a position.
|
Thoughts
How to Survive a Zombie Apocalypse (Or Any Other Natural Disaster)
TEOTWAWKI is a commonly used acronym among survivalist circles, which stands for “The End Of The World As We Know It”.
All joking of the zombie apocalypse aside, the community that’s growing around this principle is obsessed with survival in extremely terrible and difficult situations, also known as SHTF (sh*t hit the fan) scenarios. Predicted disasters can include all catastrophic weather and political events that will change the world forever – leaving nothing the same.
When we talk about surviving the TEOTWAWKI way, it’s about preparing for difficult situations like nuclear war, weather disasters, electromagnetic pulse, complete financial collapse, and even total gas, water, and electricity collapse. In such events, we all need to be ready to act quickly to ensure survival.
Of course, the secret that “preppers” also know is that it’s better to plan and prepare ahead to ensure the best possible outcome in all situations.
Planning to survive a SHTF event
In order to increase the chances of survival in an undesired difficult situation, it is better to have more than one plan. However, there are some constants in all plans that include preparing for food, water, shelter, and first-aid needs. Basically, surviving in such a situation depends on your ability to be patient and adaptable to sudden adverse changes in your living situation.
Stockpile your basic needed supplies
There are premade sets of survival supplies, first-aid kits, survival foods and bug out bags, or you can sort through what you need to prepare your own items. Lists of needed items are also available to ensure you’ve covered all your bases as you start collecting items.
Choose a safe location
Finalize a spot outside the city and have your family members on board with your plan. Being away from the majority of the population is the best option in such conditions to avoid chaotic law and order situations. With law enforcement stretched thin, and needs abundant, there is likely be an increase in fighting, crimes, looting, and other violent situations.
Do a practice run
Just like you may hold fire evacuation drills at school, work or home to prepare for the worst, doing a dry-run rehearsal will help you prepare to put your skills and knowledge to good use in case of an extreme situation.
Assign certain tasks to each family member. Then, change the responsibilities and do the entire exercise again. This will help you spot who is best at doing which part of the job and make it easier to delegate tasks accordingly. If someone doesn’t seem to be fit for the assigned job, you may change their role. This will be vital in saving time, and possibly lives. Once you have roles assigned try to improve skill by pushing to do the same exercises in lesser time.
Learn everything you can
Increase your knowledge base by reading through expert blogs and to improve readiness. In a severely terrible situation, simply surviving will be a great achievement. We can make the situation livable and survivable for as long as possible by having the basic essentials. All you have to do is seriously plan things ahead and stay prepared.
|
Q:
Docker Elasticsearch on VM
I created a vm with Alpine-3.7 and I am trying to start a container with elasticsearch.
VM memory situation is:
alpine:~/elastic$ free -m
total used free shared buffers cached
Mem: 7483 242 7241 0 34 128
-/+ buffers/cache: 79 7404
Swap: 4095 0 4095
When I try to run elasticsearch I obtain this error:
elasticsearch | OpenJDK 64-Bit Server VM warning: INFO: os::commit_memory(0x0000637299000000, 2555904, 1) failed; error='Operation not permitted' (errno=1)
elasticsearch | OpenJDK 64-Bit Server VM warning: INFO: os::commit_memory(0x00007337ad000000, 2555904, 1) failed; error='Operation not permitted' (errno=1)
elasticsearch | #
elasticsearch | # There is insufficient memory for the Java Runtime Environment to continue.
elasticsearch | # Native memory allocation (mmap) failed to map 2555904 bytes for committing reserved memory.
elasticsearch | # Can not save log file, dump to screen..
elasticsearch | #
elasticsearch | # There is insufficient memory for the Java Runtime Environment to continue.
elasticsearch | # Native memory allocation (mmap) failed to map 2555904 bytes for committing reserved memory.
elasticsearch | # Possible reasons:
elasticsearch | # The system is out of physical RAM or swap space
elasticsearch | # In 32 bit mode, the process size limit was hit
elasticsearch | # Possible solutions:
elasticsearch | # Reduce memory load on the system
elasticsearch | # Increase physical memory or swap space
elasticsearch | # Check if swap backing store is full
elasticsearch | # Use 64 bit Java on a 64 bit OS
elasticsearch | # Decrease Java heap size (-Xmx/-Xms)
elasticsearch | # Decrease number of Java threads
elasticsearch | # Decrease Java thread stack sizes (-Xss)
elasticsearch | # Set larger code cache with -XX:ReservedCodeCacheSize=
elasticsearch | # This output file may be truncated or incomplete.
elasticsearch | #
elasticsearch | # Out of Memory Error (os_linux.cpp:2651), pid=29, tid=0x00007337c59ab700
I dont' copied all the error.
Could anyone help me?
A:
I solved setting this kernel parameter:
kernel.pax.softmode=1
with
# echo 1 > /proc/sys/pax/softmode
Note: for reboots-persistent config add kernel.pax.softmode=1 to /etc/sysctl.conf
Thanks
|
Nuclear waste has been piling up across America with nowhere to go. Congress needs to act
By David G. Victor, Dan Stetson and Jerry Kern
Jan 24, 2019 | 3:05 AM
Nuclear waste is stored in underground containers at the Idaho National Laboratory near Idaho Falls, Idaho on May 11, 2015. (Keith Ridler / Associated Press)
At 74 sites around the country, radioactive waste from the nation’s commercial nuclear reactors is accumulating with no place to go.
The long-standing problem is becoming a logistical and administrative nightmare. Financial pressures are forcing many reactors to close. Thousands of canisters packed with highly radioactive fuel remain.
Advertisement
There are closed nuclear reactors in at least 34 states, including Maine, Florida, Pennsylvania and New York. Some are near big cities, such as the San Onofre plant south of Los Angeles. The sites are monuments to decades of political neglect and mangled nuclear strategy.
But a solution finally appears to be within reach. Thanks to a growing grass-roots movement and new technology, consensus is building in Washington. A bipartisan coalition in Congress may soon be able to update the country’s antiquated nuclear waste laws.
Advertisement
Any new law should allow communities to compete for investment in so-called interim storage.
Share quote & link
At the center of the debate is the Nuclear Waste Policy Act of 1982 — legislation that was predicated on the idea that our nuclear reactors, which reload with fresh fuel every 18 to 24 months, would send their spent fuel toat least one national permanent repository.
The 1982 law was passed with strong support, because the location of any repository was unknown. A few years later, the country settled on Nevada’s Yucca Mountain, about 100 miles from Las Vegas.
Since then, our policy has been hamstrung by opposition in that state, with additional opposition coming from people who object to nuclear power altogether and think, wrongly, that blocking the creation of a permanent storage site would prevent more reactors from being built.
Other countries, including Canada and Finland, have avoided this kind of impasse. They invited local communities to compete for the investment and jobs that would come with a nuclear waste repository. By the time this better approach became conventional wisdom, American politics around nuclear waste had already been thrust into gridlock by Yucca Mountain.
Advertisement
New legislation could rectify all this, and some proposals are already in the works.
To be effective, any new law should allow communities to compete for investment in so-called interim storage. These new sites would be vast holding zones, most likely located in the desert and far from people, where spent fuel can sit in one location (rather than dozens) and await a permanent home.
Sites in New Mexico and Texas are already seeking licenses, enticed by a combination of industrial backers (who will profit) and local, well-informed civic leaders who want the jobs and investment. These sites are betting that Congress will change the law, and when that reform happens, more sites are likely to emerge.
New legislation should also ensure that shuttered sites like San Onofre are first in line to send away their spent fuel, ahead of reactors that are still operating.
Getting the votes for a new law will take some political engineering. Most Republicans want to open Yucca Mountain. They are motivated by stronger support for nuclear power and the $11 billion already spent to engineer the site. Democrats are more circumspect, with many questioning whether Yucca Mountain can withstand the scrutiny of rigorous licensing.
But a growing alliance across the two parties recognizes that the country can’t keep stranding nuclear fuel, especially at reactors that have already closed.
In the last Congress, Republican-written legislation was easily passed in the House. Of the 109 sponsors, 21 were Democrats. Bipartisan support grew as the bill moved through the House and was amended to include more language on interim storage. In the new Congress, a Democratic-written bill could do the same, but with more safeguards that could make Nevada and the left a bit happier.
Just because it now seems possible to fix the nation’s nuclear mess doesn’t mean Congress will deliver. To get it done, the new House will need to focus on legislating, not grandstanding. The not-so-new Senate will need to get proactive. Sens. Lamar Alexander of Tennessee and Dianne Feinstein of California have been forging a compromise in the Senate Appropriations Committee, one that includes support for interim storage. But no serious bill has been drafted in the Senate.
Advertisement
New technologies could help. For instance, a technique that would inject spent nuclear waste into the Earth’s crust — known as deep borehole drilling — is being tested and may offer alternatives to Yucca.
Regions with closed nuclear plants, including in Southern California, need to keep organizing and pressuring their legislators. The industry and the Decommissioning Plants Coalition, a political lobby also known as the Dead Plant Society, must talk less about the mechanics of closing plants and more about making the politics work.
As 2020 campaigning begins in earnest, new legislation on nuclear waste — a topic that has long been a radioactive third rail in American politics — could remind us what bipartisanship looks like.
David G. Victor is a professor of international relations at UC San Diego and a nonresident senior fellow at the Brookings Institution. Dan Stetson is head of the Nicholas Endowment and president emeritus of the Ocean Institute. Jerry Kern is a former member of the Oceanside City Council. Together they lead the San Onofre Community Engagement Panel, a volunteer group working toward the safe closure of the San Onofre Nuclear Generating Station.
Today's Headlines Newsletter
Delivered weekdays
A digest of essential news, insight and analysis from L.A. Times editors.
|
Q:
stopping a nested javascript function running more than once
I'm trying to get a javascript function to run only once. I've seen this question has been asked before, e.g. Function in javascript that can be called only once, but I can't get the solutions in here to work. I'm not sure if it's because I've got nested functions, or whether there's something I'm missing. Essentially, I'm trying to run a function which, when a webpage is scrolled, it:
- runs a little animation on a canvas in the header
- reduces the size of the header
- leaves it at that
But when there is any subsequent scrolling, the animation keeps re-running. Here's a summarised version of the non-working code:
$(document).on("scroll",function(){
var arrange_title = function(){
//some code
};
if($(document).scrollTop()>0){
arrange_title();
arrange_title = function(){};
setTimeout(function(){
$("header").removeClass("large").addClass("small");
},1000);
}
});
I've also tried declaring a global variable, setting it to "false" in a "window.onload" function, then set it to true in an if function that runs the animation (the if function running only if the variable is false), but that doesn't stop it either. Thoughts?
A:
What you're looking for is something along the lines of listenToOnce where the listener fires the one time, but never again. This could be modified to a number of calls, but the logic is like so:
Register the listener.
Then once the listener fires, remove it.
See .off
$(document).on("scroll",function(){
var arrange_title = function(){
//some code
};
if($(document).scrollTop()>0){
arrange_title();
arrange_title = function(){};
setTimeout(function(){
$("header").removeClass("large").addClass("small");
// $(document).off('scroll'); // or here
},1000);
}
$(document).off('scroll'); // remove listener, you can place this in the setTimeout if you wish to make sure that the classes are added/removed
});
|
Chevron Fights Amazon Pollution Verdict In U.S. Court
Outside the New York federal courthouse, Ecuadorians and their supporters gather to protest the Chevron lawsuit. Credit: Samuel Oakford/IPS
NEW YORK, Oct 15 2013 (IPS) – Two years after they were awarded 18 billion dollars by an Ecuadorian court for environmental damage caused by Chevron in the Amazonian rainforest, a group of indigenous villagers and their U.S. lawyer went on trial Tuesday in New York, accused by the oil company of bribery and racketeering.
Chevron was found liable in 2011 for an ecological catastrophe caused by pollution released in the 1970s and 1980s by Texaco, which Chevron acquired in 2001 and for which they agreed to assume legal obligations.
Chevron has refused to pay the penalty.
Because Chevron has no assets in Ecuador, the plaintiffs have attempted to collect the fine abroad.
The New York suit, filed under the RICO statute, a strategy made famous during Mafia prosecutions in the 1970s, seeks to block enforcement of the 2011 decision in U.S. courts, where Chevron maintains ample reserves to foot the bill.
The complaint claims the lawyer, Steven Donziger, and a group of Ecuadorians representing the 30,000 original Amazonian plaintiffs attempted to persuade and corrupt a series of Ecuadorian judges who heard the case in an attempt to extort Chevron.
Donziger and the Ecuadorian defendants deny any wrongdoing and assert the lawsuit is another expensive legal distraction that the 230-billion-dollar corporation can afford to tack onto what has become a 20-year saga of litigation.
Outside the courthouse, Ecuadorians and their supporters gathered to protest the case.
Demonstrators chanted and held photographs depicting shiny, blackened earth, open runoff pits and frail jungle residents who they said were dying from cancers that resulted from the estimated 18 million gallons of crude oil and 18 billion gallons of toxic wastewater that was leaked or illegally pumped into pristine jungle ecosystems around the Lago Agrio field the northwest of the country.
“We’re here in front of the courts against this large corporation,” said one of the defendants, Javier Piaguaje, a Secoya Indian who lives along the heavily polluted and now-ironically named “Aguarico” River.
Dressed in traditional Secoya garb, Piaguaje told the crowd the lasting effects of the spill were ravaging his community.
“Every day, family members and loved ones are sickened because of the contamination,” said Piaguaje.
“We’re here to show what’s really going on in the Amazon,” he added, before turning to enter the courthouse and mount his defence.
The judge in the case, Lewis Kaplan, has long been a thorn in the side of indigenous plaintiffs.
Earlier this month, Kaplan decided Donziger and his co-defendents were not entitled to a trial by jury.
“This trial is a travesty of justice,” said Paul Paz y Miño of Amazon Watch, an environmental justice group that assists the Ecuadorian claim.
“Chevron has spent years to have a trial where the original plaintiffs are not allowed to discuss the evidence,” Paz y Miño told IPS.
“There is absolutely no evidence of fraud on behalf of the plaintiff,” he added.
A spokesperson for the defendants in the New York case, Han Shan, told IPS the lawsuit took a lot of chutzpah on the part of Chevron.
“They’ve done a great job of media and political jujitsu in taking things that we were alleging, Chevron being totally corrupt, putting pressure on judges, bribery, trying to entrap people, using dirty contracters and said that we did it,” said Shan.
In 2009, Diego Borja, a Chevron contractor in Ecuador, was caught trying to entrap the presiding judge, Juan Nunez, by videotaping himself offering Nunez a bribe. Chevron has since paid for Borja to move to the United States and supplies him with a monthly stipend.
The Chevron media relations website was down for maintenance at the time of this article and IPS was unable to reach the company for comment.
However, on the company’s website devoted to the lawsuit, Morgan Crinklaw, a spokesman for Chevron, says, “We believe that any jurisdiction that observes the rule of law will find that the judgment is illegal and unenforceable because it’s a product of fraud.”
The trial taking place in Manhattan hinges in large part on Donziger’s personal diary and hours of outtakes from Joe Berlinger’s 2009 film, “Crude,” which Chevron claims show Donziger considered some of the environment evidence in the lawsuit to be “all smoke and mirrors.”
Donziger has said his quotes were taken out of context.
Judge Kaplan has already decided in favour of Chevron once.
In March 2011, Kaplan issued a global injunction that blocked enforcement of the Ecuadorian judgment, effectively kneecapping indigenous claims.
In January 2012, however, the 2nd U.S. Circuit Court of Appeals in New York overturned the injunction, which opened the door once more for the original plaintiffs to enforce the 18-billion-dollar decision in U.S. courts.
That decision led Chevron team of over 100 lawyers to cobble together a last ditch defence strategy in form of the RICO suit, which they worked hard to have heard in Kaplan’s courtroom.
Shan isn’t optimistic about Kaplan presiding over the case.
“I don’t feel Kaplan will give us a fair hearing,” said Shan. “I think he’s already made up his mind.”
But should Kaplan rule against the indigenous community and issue a global injunction once more, Shan is confident the 2nd Circuit will strike it down.
“The 2nd Circuit has been clear that the U.S. District Court is not an appellate court for the Ecuadorian judiciary and there’s absolutely no jurisdiction for that kind of injunction,” said Shan.
|
Vitter on Natural Gas1 picture
Sen. John Hoeven, R-N.D.; Sen. David Vitter, R-La.; and Rep. Rob Bishop, R-Utah, speak at a press conference about legislation to improve the economy, the 'Energy Production and Project Delivery Act of 2013.'
Sen. John Hoeven, R-N.D.; Sen. David Vitter, R-La.; and Rep. Rob Bishop, R-Utah,...Sen. John Hoeven, R-N.D.; Sen. David Vitter, R-La.; and Rep. Rob Bishop, R-Utah, speak at a press conference about legislation to improve the economy, the 'Energy Production and Project Delivery Act of 2013.'LessMore
|
# Medieval Literature: A Very Short Introduction
VERY SHORT INTRODUCTIONS are for anyone wanting a stimulating and accessible way into a new subject. They are written by experts, and have been translated into more than 40 different languages.
The series began in 1995, and now covers a wide variety of topics in every discipline. The VSI library now contains over 400 volumes—a Very Short Introduction to everything from Psychology and Philosophy of Science to American History and Relativity—and continues to grow in every subject area.
Very Short Introductions available now:
ACCOUNTING Christopher Nobes
ADVERTISING Winston Fletcher
AFRICAN AMERICAN RELIGION Eddie S. Glaude Jr.
AFRICAN HISTORY John Parker and Richard Rathbone
AFRICAN RELIGIONS Jacob K. Olupona
AGNOSTICISM Robin Le Poidevin
ALEXANDER THE GREAT Hugh Bowden
AMERICAN HISTORY Paul S. Boyer
AMERICAN IMMIGRATION David A. Gerber
AMERICAN LEGAL HISTORY G. Edward White
AMERICAN POLITICAL HISTORY Donald Critchlow
AMERICAN POLITICAL PARTIES AND ELECTIONS L. Sandy Maisel
AMERICAN POLITICS Richard M. Valelly
THE AMERICAN PRESIDENCY Charles O. Jones
THE AMERICAN REVOLUTION Robert J. Allison
AMERICAN SLAVERY Heather Andrea Williams
THE AMERICAN WEST Stephen Aron
AMERICAN WOMEN'S HISTORY Susan Ware
ANAESTHESIA Aidan O'Donnell
ANARCHISM Colin Ward
ANCIENT ASSYRIA Karen Radner
ANCIENT EGYPT Ian Shaw
ANCIENT EGYPTIAN ART AND ARCHITECTURE Christina Riggs
ANCIENT GREECE Paul Cartledge
THE ANCIENT NEAR EAST Amanda H. Podany
ANCIENT PHILOSOPHY Julia Annas
ANCIENT WARFARE Harry Sidebottom
ANGELS David Albert Jones
ANGLICANISM Mark Chapman
THE ANGLO‑SAXON AGE John Blair
THE ANIMAL KINGDOM Peter Holland
ANIMAL RIGHTS David DeGrazia
THE ANTARCTIC Klaus Dodds
ANTISEMITISM Steven Beller
ANXIETY Daniel Freeman and Jason Freeman
THE APOCRYPHAL GOSPELS Paul Foster
ARCHAEOLOGY Paul Bahn
ARCHITECTURE Andrew Ballantyne
ARISTOCRACY William Doyle
ARISTOTLE Jonathan Barnes
ART HISTORY Dana Arnold
ART THEORY Cynthia Freeland
ASTROBIOLOGY David C. Catling
ATHEISM Julian Baggini
AUGUSTINE Henry Chadwick
AUSTRALIA Kenneth Morgan
AUTISM Uta Frith
THE AVANT GARDE David Cottington
THE AZTECS Davíd Carrasco
BACTERIA Sebastian G. B. Amyes
BARTHES Jonathan Culler
THE BEATS David Sterritt
BEAUTY Roger Scruton
BESTSELLERS John Sutherland
THE BIBLE John Riches
BIBLICAL ARCHAEOLOGY Eric H. Cline
BIOGRAPHY Hermione Lee
THE BLUES Elijah Wald
THE BOOK OF MORMON Terryl Givens
BORDERS Alexander C. Diener and Joshua Hagen
THE BRAIN Michael O'Shea
THE BRITISH CONSTITUTION Martin Loughlin
THE BRITISH EMPIRE Ashley Jackson
BRITISH POLITICS Anthony Wright
BUDDHA Michael Carrithers
BUDDHISM Damien Keown
BUDDHIST ETHICS Damien Keown
BYZANTIUM Peter Sarris
CANCER Nicholas James
CAPITALISM James Fulcher
CATHOLICISM Gerald O'Collins
CAUSATION Stephen Mumford and Rani Lill Anjum
THE CELL Terence Allen and Graham Cowling
THE CELTS Barry Cunliffe
CHAOS Leonard Smith
CHEMISTRY Peter Atkins
CHILD PSYCHOLOGY Usha Goswami
CHILDREN'S LITERATURE Kimberley Reynolds
CHINESE LITERATURE Sabina Knight
CHOICE THEORY Michael Allingham
CHRISTIAN ART Beth Williamson
CHRISTIAN ETHICS D. Stephen Long
CHRISTIANITY Linda Woodhead
CITIZENSHIP Richard Bellamy
CIVIL ENGINEERING David Muir Wood
CLASSICAL LITERATURE William Allan
CLASSICAL MYTHOLOGY Helen Morales
CLASSICS Mary Beard and John Henderson
CLAUSEWITZ Michael Howard
CLIMATE Mark Maslin
THE COLD WAR Robert McMahon
COLONIAL AMERICA Alan Taylor
COLONIAL LATIN AMERICAN LITERATURE Rolena Adorno
COMEDY Matthew Bevis
COMMUNISM Leslie Holmes
COMPLEXITY John H. Holland
THE COMPUTER Darrel Ince
CONFUCIANISM Daniel K. Gardner
THE CONQUISTADORS Matthew Restall and Felipe Fernández-Armesto
CONSCIENCE Paul Strohm
CONSCIOUSNESS Susan Blackmore
CONTEMPORARY ART Julian Stallabrass
CONTEMPORARY FICTION Robert Eaglestone
CONTINENTAL PHILOSOPHY Simon Critchley
CORAL REEFS Charles Sheppard
CORPORATE SOCIAL RESPONSIBILITY Jeremy Moon
CORRUPTION Leslie Holmes
COSMOLOGY Peter Coles
CRIME FICTION Richard Bradford
CRIMINAL JUSTICE Julian V. Roberts
CRITICAL THEORY Stephen Eric Bronner
THE CRUSADES Christopher Tyerman
CRYPTOGRAPHY Fred Piper and Sean Murphy
THE CULTURAL REVOLUTION Richard Curt Kraus
DADA AND SURREALISM David Hopkins
DANTE Peter Hainsworth and David Robey
DARWIN Jonathan Howard
THE DEAD SEA SCROLLS Timothy Lim
DEMOCRACY Bernard Crick
DERRIDA Simon Glendinning
DESCARTES Tom Sorell
DESERTS Nick Middleton
DESIGN John Heskett
DEVELOPMENTAL BIOLOGY Lewis Wolpert
THE DEVIL Darren Oldridge
DIASPORA Kevin Kenny
DICTIONARIES Lynda Mugglestone
DINOSAURS David Norman
DIPLOMACY Joseph M. Siracusa
DOCUMENTARY FILM Patricia Aufderheide
DREAMING J. Allan Hobson
DRUGS Leslie Iversen
DRUIDS Barry Cunliffe
EARLY MUSIC Thomas Forrest Kelly
THE EARTH Martin Redfern
ECONOMICS Partha Dasgupta
EDUCATION Gary Thomas
EGYPTIAN MYTH Geraldine Pinch
EIGHTEENTH‑CENTURY BRITAIN Paul Langford
THE ELEMENTS Philip Ball
EMOTION Dylan Evans
EMPIRE Stephen Howe
ENGELS Terrell Carver
ENGINEERING David Blockley
ENGLISH LITERATURE Jonathan Bate
ENTREPRENEURSHIP Paul Westhead and Mike Wright
ENVIRONMENTAL ECONOMICS Stephen Smith
EPIDEMIOLOGY Rodolfo Saracci
ETHICS Simon Blackburn
ETHNOMUSICOLOGY Timothy Rice
THE ETRUSCANS Christopher Smith
THE EUROPEAN UNION John Pinder and Simon Usherwood
EVOLUTION Brian and Deborah Charlesworth
EXISTENTIALISM Thomas Flynn
EXPLORATION Stewart A. Weaver
THE EYE Michael Land
FAMILY LAW Jonathan Herring
FASCISM Kevin Passmore
FASHION Rebecca Arnold
FEMINISM Margaret Walters
FILM Michael Wood
FILM MUSIC Kathryn Kalinak
THE FIRST WORLD WAR Michael Howard
FOLK MUSIC Mark Slobin
FOOD John Krebs
FORENSIC PSYCHOLOGY David Canter
FORENSIC SCIENCE Jim Fraser
FORESTS Jaboury Ghazoul
FOSSILS Keith Thomson
FOUCAULT Gary Gutting
FRACTALS Kenneth Falconer
FREE SPEECH Nigel Warburton
FREE WILL Thomas Pink
FRENCH LITERATURE John D. Lyons
THE FRENCH REVOLUTION William Doyle
FREUD Anthony Storr
FUNDAMENTALISM Malise Ruthven
GALAXIES John Gribbin
GALILEO Stillman Drake
GAME THEORY Ken Binmore
GANDHI Bhikhu Parekh
GENES Jonathan Slack
GENIUS Andrew Robinson
GEOGRAPHY John Matthews and David Herbert
GEOPOLITICS Klaus Dodds
GERMAN LITERATURE Nicholas Boyle
GERMAN PHILOSOPHY Andrew Bowie
GLOBAL CATASTROPHES Bill McGuire
GLOBAL ECONOMIC HISTORY Robert C. Allen
GLOBALIZATION Manfred Steger
GOD John Bowker
THE GOTHIC Nick Groom
GOVERNANCE Mark Bevir
THE GREAT DEPRESSION AND THE NEW DEAL Eric Rauchway
HABERMAS James Gordon Finlayson
HAPPINESS Daniel M. Haybron
HEGEL Peter Singer
HEIDEGGER Michael Inwood
HERODOTUS Jennifer T. Roberts
HIEROGLYPHS Penelope Wilson
HINDUISM Kim Knott
HISTORY John H. Arnold
THE HISTORY OF ASTRONOMY Michael Hoskin
THE HISTORY OF LIFE Michael Benton
THE HISTORY OF MATHEMATICS Jacqueline Stedall
THE HISTORY OF MEDICINE William Bynum
THE HISTORY OF TIME Leofranc Holford‑Strevens
HIV/AIDS Alan Whiteside
HOBBES Richard Tuck
HORMONES Martin Luck
HUMAN ANATOMY Leslie Klenerman
HUMAN EVOLUTION Bernard Wood
HUMAN RIGHTS Andrew Clapham
HUMANISM Stephen Law
HUME A. J. Ayer
HUMOUR Noël Carroll
THE ICE AGE Jamie Woodward
IDEOLOGY Michael Freeden
INDIAN PHILOSOPHY Sue Hamilton
INFECTIOUS DISEASE Marta L. Wayne and Benjamin M. Bolker
INFORMATION Luciano Floridi
INNOVATION Mark Dodgson and David Gann
INTELLIGENCE Ian J. Deary
INTERNATIONAL MIGRATION Khalid Koser
INTERNATIONAL RELATIONS Paul Wilkinson
INTERNATIONAL SECURITY Christopher S. Browning
IRAN Ali M. Ansari
ISLAM Malise Ruthven
ISLAMIC HISTORY Adam Silverstein
ITALIAN LITERATURE Peter Hainsworth and David Robey
JESUS Richard Bauckham
JOURNALISM Ian Hargreaves
JUDAISM Norman Solomon
JUNG Anthony Stevens
KABBALAH Joseph Dan
KAFKA Ritchie Robertson
KANT Roger Scruton
KEYNES Robert Skidelsky
KIERKEGAARD Patrick Gardiner
KNOWLEDGE Jennifer Nagel
THE KORAN Michael Cook
LANDSCAPE ARCHITECTURE Ian H. Thompson
LANDSCAPES AND GEOMORPHOLOGY Andrew Goudie and Heather Viles
LANGUAGES Stephen R. Anderson
LATE ANTIQUITY Gillian Clark
LAW Raymond Wacks
THE LAWS OF THERMODYNAMICS Peter Atkins
LEADERSHIP Keith Grint
LIBERALISM Michael Freeden
LINCOLN Allen C. Guelzo
LINGUISTICS Peter Matthews
LITERARY THEORY Jonathan Culler
LOCKE John Dunn
LOGIC Graham Priest
LOVE Ronald de Sousa
MACHIAVELLI Quentin Skinner
MADNESS Andrew Scull
MAGIC Owen Davies
MAGNA CARTA Nicholas Vincent
MAGNETISM Stephen Blundell
MALTHUS Donald Winch
MANAGEMENT John Hendry
MAO Delia Davin
MARINE BIOLOGY Philip V. Mladenov
THE MARQUIS DE SADE John Phillips
MARTIN LUTHER Scott H. Hendrix
MARTYRDOM Jolyon Mitchell
MARX Peter Singer
MATERIALS Christopher Hall
MATHEMATICS Timothy Gowers
THE MEANING OF LIFE Terry Eagleton
MEDICAL ETHICS Tony Hope
MEDICAL LAW Charles Foster
MEDIEVAL BRITAIN John Gillingham and Ralph A. Griffiths
MEDIEVAL LITERATURE Elaine Treharne
MEMORY Jonathan K. Foster
METAPHYSICS Stephen Mumford
MICHAEL FARADAY Frank A. J. L. James
MICROBIOLOGY Nicholas P. Money
MICROECONOMICS Avinash Dixit
MICROSCOPY Terence Allen
THE MIDDLE AGES Miri Rubin
MINERALS David Vaughan
MODERN ART David Cottington
MODERN CHINA Rana Mitter
MODERN FRANCE Vanessa R. Schwartz
MODERN IRELAND Senia Pašeta
MODERN JAPAN Christopher Goto-Jones
MODERN LATIN AMERICAN LITERATURE Roberto González Echevarría
MODERN WAR Richard English
MODERNISM Christopher Butler
MOLECULES Philip Ball
THE MONGOLS Morris Rossabi
MORMONISM Richard Lyman Bushman
MUHAMMAD Jonathan A.C. Brown
MULTICULTURALISM Ali Rattansi
MUSIC Nicholas Cook
MYTH Robert A. Segal
THE NAPOLEONIC WARS Mike Rapport
NATIONALISM Steven Grosby
NELSON MANDELA Elleke Boehmer
NEOLIBERALISM Manfred Steger and Ravi Roy
NETWORKS Guido Caldarelli and Michele Catanzaro
THE NEW TESTAMENT Luke Timothy Johnson
THE NEW TESTAMENT AS LITERATURE Kyle Keefer
NEWTON Robert Iliffe
NIETZSCHE Michael Tanner
NINETEENTH‑CENTURY BRITAIN Christopher Harvie and H. C. G. Matthew
THE NORMAN CONQUEST George Garnett
NORTH AMERICAN INDIANS Theda Perdue and Michael D. Green
NORTHERN IRELAND Marc Mulholland
NOTHING Frank Close
NUCLEAR PHYSICS Frank Close
NUCLEAR POWER Maxwell Irvine
NUCLEAR WEAPONS Joseph M. Siracusa
NUMBERS Peter M. Higgins
NUTRITION David A. Bender
OBJECTIVITY Stephen Gaukroger
THE OLD TESTAMENT Michael D. Coogan
THE ORCHESTRA D. Kern Holoman
ORGANIZATIONS Mary Jo Hatch
PAGANISM Owen Davies
THE PALESTINIAN-ISRAELI CONFLICT Martin Bunton
PARTICLE PHYSICS Frank Close
PAUL E. P. Sanders
PEACE Oliver P. Richmond
PENTECOSTALISM William K. Kay
THE PERIODIC TABLE Eric R. Scerri
PHILOSOPHY Edward Craig
PHILOSOPHY OF LAW Raymond Wacks
PHILOSOPHY OF SCIENCE Samir Okasha
PHOTOGRAPHY Steve Edwards
PHYSICAL CHEMISTRY Peter Atkins
PILGRIMAGE Ian Reader
PLAGUE Paul Slack
PLANETS David A. Rothery
PLANTS Timothy Walker
PLATE TECTONICS Peter Molnar
PLATO Julia Annas
POLITICAL PHILOSOPHY David Miller
POLITICS Kenneth Minogue
POSTCOLONIALISM Robert Young
POSTMODERNISM Christopher Butler
POSTSTRUCTURALISM Catherine Belsey
PREHISTORY Chris Gosden
PRESOCRATIC PHILOSOPHY Catherine Osborne
PRIVACY Raymond Wacks
PROBABILITY John Haigh
PROGRESSIVISM Walter Nugent
PROTESTANTISM Mark A. Noll
PSYCHIATRY Tom Burns
PSYCHOANALYSIS Daniel Pick
PSYCHOLOGY Gillian Butler and Freda McManus
PSYCHOTHERAPY Tom Burns and Eva Burns-Lundgren
PURITANISM Francis J. Bremer
THE QUAKERS Pink Dandelion
QUANTUM THEORY John Polkinghorne
RACISM Ali Rattansi
RADIOACTIVITY Claudio Tuniz
RASTAFARI Ennis B. Edmonds
THE REAGAN REVOLUTION Gil Troy
REALITY Jan Westerhoff
THE REFORMATION Peter Marshall
RELATIVITY Russell Stannard
RELIGION IN AMERICA Timothy Beal
THE RENAISSANCE Jerry Brotton
RENAISSANCE ART Geraldine A. Johnson
REVOLUTIONS Jack A. Goldstone
RHETORIC Richard Toye
RISK Baruch Fischhoff and John Kadvany
RITUAL Barry Stephenson
RIVERS Nick Middleton
ROBOTICS Alan Winfield
ROMAN BRITAIN Peter Salway
THE ROMAN EMPIRE Christopher Kelly
THE ROMAN REPUBLIC David M. Gwynn
ROMANTICISM Michael Ferber
ROUSSEAU Robert Wokler
RUSSELL A. C. Grayling
RUSSIAN HISTORY Geoffrey Hosking
RUSSIAN LITERATURE Catriona Kelly
THE RUSSIAN REVOLUTION S. A. Smith
SCHIZOPHRENIA Chris Frith and Eve Johnstone
SCHOPENHAUER Christopher Janaway
SCIENCE AND RELIGION Thomas Dixon
SCIENCE FICTION David Seed
THE SCIENTIFIC REVOLUTION Lawrence M. Principe
SCOTLAND Rab Houston
SEXUALITY Véronique Mottier
SIKHISM Eleanor Nesbitt
THE SILK ROAD James A. Millward
SLEEP Steven W. Lockley and Russell G. Foster
SOCIAL AND CULTURAL ANTHROPOLOGY John Monaghan and Peter Just
SOCIAL PSYCHOLOGY Richard J. Crisp
SOCIAL WORK Sally Holland and Jonathan Scourfield
SOCIALISM Michael Newman
SOCIOLINGUISTICS John Edwards
SOCIOLOGY Steve Bruce
SOCRATES C. C. W. Taylor
THE SOVIET UNION Stephen Lovell
THE SPANISH CIVIL WAR Helen Graham
SPANISH LITERATURE Jo Labanyi
SPINOZA Roger Scruton
SPIRITUALITY Philip Sheldrake
SPORT Mike Cronin
STARS Andrew King
STATISTICS David J. Hand
STEM CELLS Jonathan Slack
STRUCTURAL ENGINEERING David Blockley
STUART BRITAIN John Morrill
SUPERCONDUCTIVITY Stephen Blundell
SYMMETRY Ian Stewart
TAXATION Stephen Smith
TEETH Peter S. Ungar
TERRORISM Charles Townshend
THEATRE Marvin Carlson
THEOLOGY David F. Ford
THOMAS AQUINAS Fergus Kerr
THOUGHT Tim Bayne
TIBETAN BUDDHISM Matthew T. Kapstein
TOCQUEVILLE Harvey C. Mansfield
TRAGEDY Adrian Poole
THE TROJAN WAR Eric H. Cline
TRUST Katherine Hawley
THE TUDORS John Guy
TWENTIETH‑CENTURY BRITAIN Kenneth O. Morgan
THE UNITED NATIONS Jussi M. Hanhimäki
THE U.S. CONGRESS Donald A. Ritchie
THE U.S. SUPREME COURT Linda Greenhouse
UTOPIANISM Lyman Tower Sargent
THE VIKINGS Julian Richards
VIRUSES Dorothy H. Crawford
WATER John Finney
WILLIAM SHAKESPEARE Stanley Wells
WITCHCRAFT Malcolm Gaskill
WITTGENSTEIN A. C. Grayling
WORK Stephen Fineman
WORLD MUSIC Philip Bohlman
THE WORLD TRADE ORGANIZATION Amrita Narlikar
WORLD WAR II Gerhard L. Weinberg
WRITING AND SCRIPT Andrew Robinson
Available soon:
LIGHT Ian Walmsley
MOUNTAINS Martin F. Price
BLACK HOLES Katherine Blundell
PHILOSOPHY IN THE ISLAMIC WORLD Peter Adamson
THE ENLIGHTENMENT John Robertson
For more information visit our website
www.oup.com/vsi/
Elaine Treharne
# MEDIEVAL LITERATURE
# A Very Short Introduction
Great Clarendon Street, Oxford, OX2 6DP, United Kingdom
Oxford University Press is a department of the University of Oxford. It furthers the University's objective of excellence in research, scholarship, and education by publishing worldwide. Oxford is a registered trade mark of Oxford University Press in the UK and in certain other countries
© Elaine Treharne 2015
The moral rights of the author have been asserted
First edition published in 2015
Impression: 1
All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, without the prior permission in writing of Oxford University Press, or as expressly permitted by law, by licence or under terms agreed with the appropriate reprographics rights organization. Enquiries concerning reproduction outside the scope of the above should be sent to the Rights Department, Oxford University Press, at the address above You must not circulate this work in any other form and you must impose this same condition on any acquirer
Published in the United States of America by Oxford University Press 198 Madison Avenue, New York, NY 10016, United States of America
British Library Cataloguing in Publication Data
Data available
Library of Congress Control Number: 2015935245
ISBN 978–0–19–966849–6
ebook ISBN 978–0–19–164555–6
Printed in Great Britain by Ashford Colour Press Ltd, Gosport, Hampshire
_For my Mum, Iola Treharne_
_and_
_in memory of my Dad, Kenneth Treharne_
# Contents
Acknowledgements
List of illustrations
Introduction: endings and beginnings
1 Literary origins
2 Textual production and performance
3 Literary spaces, literary identities
4 Individual and community
5 The mighty and the monstrous
6 Love and longing
7 Death and judgement
8 Consolidating literary traditions
9 Coda: print and the canon
Further reading
Index
# Acknowledgements
This short work builds on a great deal of wonderful medieval scholarship read and absorbed over thirty years. Because there are no footnotes in these little books, my debt is indicated only in part by the Further reading provided at the end. I thank my fellow medievalists for their dynamism, passion, and inspirational scholarship. Medieval Studies is the best of fields. In particular, I thank Benjamin Albritton, Orietta Da Rold, Jill Frederick, Andrew Prescott, Kathryn Starkey, and Greg Walker for their friendship and support. Special thanks to Dr George Younge, who kindly and perceptively read a draft of this book. I am grateful for the helpful critiques of the OUP readers and my editor, Jenny Nugee. To my family—Andrew, Jonathan, and Isabel Fryett—you are the epitome of patience, joy, and love: thank you.
# List of illustrations
1 Map of early Britain
Map of England, Scotland and Wales, MS Cotton Claudius D. folio 12 verso, 1250, by Matthew Paris. British Library, London, UK/The Stapleton Collection/Bridgeman Images
2 The Ruthwell Cross
© Hugh McKean/Alamy
3 Cambridge, Corpus Christi College 61, folio 1 verso
The Master and Fellows of Corpus Christi College, Cambridge
4 The Cornish drama _The Life of St Meriasek_
By permission of Llyfrgell Genedlaethol Cymru/National Library of Wales
5 _Marvels of the East_ (the _Beowulf_ -manuscript Donestre monster)
© The British Library Board, Cotton Vitellius A. xv, f. 103v
6 London, British Library, Harley 2253
© The British Library Board, Harley 2253, f. 71v
7 London, British Library, Additional 33241, folio 1 verso. _Encomium Emma Reginae_ frontispiece
British Library Board/Topfoto
8 William Caxton's _Preface_ to _Le Morte Darthur_
© The University of Manchester
# Introduction: endings and beginnings
Medieval literature in Britain and Ireland spans over a thousand years from the Fall of Rome in _c_.410 ce to the shifting tides of the Renaissance in the 15th and 16th centuries. This millennium-long period is marked by conversion, conquest, crusade, and cultural innovation, all of which dramatically influenced the literature that emerged, leaving us with a rich and fascinating textual legacy.
At the beginning of the 5th century, Rome fell to the attacking Visigoths sweeping down into Italy from the north. This heralded the gradual demise of one of the greatest empires in world history. The Roman Empire, which at its apogee extended from Northern England to Egypt and the Caspian Sea to the Iberian Peninsula, had become Christian in the 4th century under the emperor Constantine; where countries were subject to imperial rule, Christianity was declared the official religion. Within a century, though, Christianity was under pressure from polytheism, like the northern tribes' veneration of Germanic and Norse gods, and within the next few centuries, Islam began its push across the southern and western Mediterranean.
Britain during these centuries was always at least partly Christian: after the Roman garrisons were called back to Rome in the early 5th century, those parts of Britain that had been under Roman rule remained essentially Christian, until the pagan Angles, Saxons, Jutes, and Frisians, who came from modern day northern Germany, Denmark, and the Low Countries, displaced the indigenous Christian Celts. In the preceding 500 years, though, during its heyday, Rome and its citizens had produced a vast body of literature—both Christian and secular—whose influence has never really waned subsequently; moreover, the Empire had provided a social, military, and administrative coherence to much of Europe and the Mediterranean that is still evident in its material remains from Hadrian's Wall to the ancient cities of Antioch and Marseilles. The decline of Rome effectively led to the fragmentation of Europe, during which time peoples migrated, new nation states were formed, and vernacular languages, like English, German, French, and Spanish eventually took on separate identities that were recorded in writing for the first time from the 7th to the 12th centuries.
The British Isles—that is, the modern Republic of Ireland, Wales, England, Scotland, Northern Ireland, and the smaller islands all around the coast—have complex political and historical stories to tell. For Britain specifically, the centuries immediately following the decline of the Roman Empire gave rise to the countries now defined as Wales, Scotland, and England. During the 5th century, the Angles, Saxons, Jutes, and Frisians, who had initially been invited to assist local kings in the Celts' internecine wars, decided to stay and were joined by others. There was no peaceful rapprochement between these settlers and the Celts, who were pushed back from all parts of Britain to the western fringes of the island. They went on to form the dominant population of Wales (the term itself derived from 'wealas', Old English 'wealh' denoting a 'foreigner, a Celt'), Cornwall, and Brittany.
The Anglo-Saxon invader-settlers formed a variety of kingdoms, and it was not until about the 10th century that England, as we now know it, was established (see Figure 1). Even then, from the late 8th century, there was also the tricky issue of the Vikings to deal with. These Norsemen first invaded in 793, but ultimately settled in the east and north of England, west Wales, eastern Ireland, and parts of Scotland. Indeed, Scotland itself also emerged from competing rivalries—here, chiefly among the Picts, the Scotti, and the English—and faced numerous other tumultuous events into the later Middle Ages.
1. Map of early Britain.
These territorial and political struggles for control in England, Scotland, Wales, and Ireland continued throughout the medieval period, too, though by the 11th century, the boundaries of the countries involved were well established. The Scandinavian Conquest under Cnut in 1016, and the Norman Conquest by William in October 1066, brought notable change to England's government immediately, though the Norman settlement had, over time, a major impact on all areas of Britain and Ireland, and all facets of culture and society.
In these centuries, Britain and Ireland witnessed important innovation, from the establishment of the universities of Oxford, Cambridge, and St Andrews, to the emergence of new religious orders, like the Cistercians and the Dominican and Franciscan Friars. Literacy and bureaucracy increased with each passing century, and urbanization brought about the development of a professional middle class. Trade and travel became more common as the decades progressed, and scholarly and international exchange was part of this process. Towards the end of the medieval period (which came earlier in continental Europe than in the British Isles), composing literature could be a profession for some, with notable authors like the Italians Petrarch, Dante, and Boccaccio making a particularly notable contribution to developing secularized literature. The gradual emergence of Parliament in England, and wholesale shifts in the economy, directly affected by catastrophic events like the Black Death in the 14th century, meant that society in the later Middle Ages had been dramatically altered from that of some 400 years earlier.
# The Dark Ages
Medieval Literature is not solely born of a warrior-obsessed Dark Ages. Indeed, a 'dark' age suggests dimness, a hiatus in high culture, and a lack of accomplishment. Coined first by Italian Renaissance scholars, like Petrarch, to indicate the enlightenment brought about by the re-emergence of classical learning in their 14th- and 15th-century world, the metaphor of the 'Dark Ages' went on to be used, unhelpfully, to describe some or all of the period between the 5th and 15th centuries, when, it was thought, classical learning was subordinated—suppressed even. This is not an accurate view of the period; neither is the modern disparaging use of the word 'medieval' helpful. These unfavourable labels cannot be applied realistically to an entire millennium, nor do they represent the period and its peoples.
Considering the medieval period as a whole means being able to scan the immense variety and complexity of literary production in its fullness, a fullness that includes multiple languages (including Cornish, English, French, Irish, Latin, Old Norse, Welsh), many thousands of manuscripts and inscribed textual objects, and very different cultures of literacy. Manuscripts exist from the British Isles as early as the 7th century, but even these texts were pre-empted by runic, Ogham, and Pictish inscriptions on various artefacts. The runic alphabet, the Germanic _fuþorc_ (named after the initial six characters), belonged to the Anglo-Saxons and other Germanic tribes before the Anglo-Saxons settled on the island of Britain. This alphabet consisted of about thirty graphs shaped ideally for carving. Each of these both had its own meaning and represented a sound. Thus, _þ_ , a character that was adopted into the Old English writing system, represented <th> and is called 'thorn', which means precisely that—'thorn'. Another graph, _ƿ_ , called _wynn_ , was used in Old English writings to represent the modern graph <w>, and _wynn_ itself means 'joy'.
Runic writing was associated not only with literacy, but also a meditative sensibility, a wisdom that reflected the specialized access of only a very few people to reading and writing. To be able to read, and then to write, implied a high level of education that necessarily set those skilled in these arts apart from the vast majority of others. This is true in all literature cultures, including early Celtic societies in Wales, Ireland, the southwest of England, Scotland and the Isle of Man. There, Ogham script dating from about the 4th century onwards was used to record Irish and British texts in sequences of linear strokes or dots carved individually across and down a central vertical line. Some Ogham stones are, rather helpfully, bilingual and include Latin alongside the Ogham script, which helps as an interpretation aid. Most of these objects inscribe names of people together with some brief details about the land of these people or their lineage. People's desire to leave some record of having existed here in this world is often the impetus for the earliest writings, as true in terms of inscription on stone and bone markers and objects as it is for fully-fledged 'literature' a few hundred years later.
# Early literary issues
'Literature', derived from Latin 'litteratura' meaning 'use, or systems, of writing', is represented in its earliest British and Irish forms in these signs of the Ogham and Runic inscriptions. The function and meaning of many such inscriptions are mysterious, but no less 'literary' for that. One is a very famous 8th-century rectangular whalebone casket called the Franks Casket, discovered in the 19th century and now in the British Museum, though one panel is in Florence. On this box, illustrative scenes carved in relief are framed by lines of runes and roman letters.
Made in Northumbria, the Franks Casket raises issues that can illuminate the literary Middle Ages as a whole. The casket's juxtaposition of the legendary Germanic smith, Weland, on the left-hand side of the front panel with the birth of Christ on the right might have reminded viewers of the conversion of some of the Germanic peoples from paganism to Christianity. This took place in parts of Northern Europe, beginning for the Anglo-Saxons at the end of the 6th century (remembering, though, that the British and Irish Celts had been Christian since the 4th century). From the perspective of the Franks Casket as a whole object, the runic and roman letters carved around the panels in a mixture of Old English and Latin show the richness, multilingualism, and complexity of this early literary culture.
On another scale, the Ruthwell Cross, made around 700 ce, is a monumental preaching cross, now preserved inside Ruthwell Church, near Dumfries in Scotland (see Figure 2). This area was originally part of Anglo-Saxon England in the early medieval period, and this cross has carved panels that show a combination of Christian and Germanic cultures, including Christ trampling the beasts, Mary Magdalene attending to Christ, Saints Anthony and Paul, and vine-scrolls. Runic and roman alphabet inscriptions frame some of these scenes, and a remarkable runic inscription is written around some panels, with words that herald the longer, 10th-century Old English poem about Jesus' crucifixion and resurrection— _The Dream of the Rood_. These runes tell of a courageous Christ, ready to ascend the Cross to redeem mankind: 'geredæ hinæ God almehttig | þa he walde of galgu gistiga | modig fore allæ men' ('God almighty stripped himself, | when he wanted to climb the Cross, | brave before all men'). On the Ruthwell Cross, we see the combination of image and word, Germanic rune and Christian subject, anonymous authors and artists, public communal text and demand for personal contemplation. These components illustrate aspects of literary production that remain throughout the medieval period, though in different combinations at different times.
This was a period of gradual change, then; of long-lived traditions like those around the pagan Germanic polytheistic religion coming into direct contact with the powerful Christian mission. Very few people were literate, but the letters familiar to those who were educated had prestige and power. Literary and artistic production in the Middle Ages was often the responsibility of monasteries and those associated with the church, but it is seldom known when or where a good number of the surviving texts and objects were made, or, indeed, by whom or for whom they were created. Authors are more often than not anonymous, the audiences unknowable, and inherited learning—'auctoritee' ('authority')—immensely significant. As a result, the literary remains we do have are almost always a challenge and can be quite difficult to interpret. Like the damaged Ruthwell Cross, many of the medieval texts that have been left to modern readers are incomplete or fragmentary; some exist only in copies made much later; some are known to have existed, but are now lost. But, that said, _all_ is not lost; plenty of textual relics survive.
2. The Ruthwell Cross.
# The big questions
From the beginnings of the medieval period, the same big questions that all of humanity asks play a major role in the composition of poetry, prose, and drama. Despite the foreignness of early languages, and the occasional distance created by social and political _mores_ no longer seen in our contemporary world, the familiarity of the subject matter of medieval literature underpins much of the literary composition: the need to declare victory and praise those in power, to mourn loss, to enact laws; the desire to utter truths and acquire wisdom; the urge to express love or hatred.
Writers, from the unknown poet(s) of the Ruthwell Cross to the most famous of authors, Geoffrey Chaucer, in his magisterial 14th-century romance _Troilus and Criseyde_ , showed through their literary creations that the things of this world are transient, mutable, uncertain, and that humans pass through this world in the blink of an eye. What, then, is life for? What purpose do humans serve? How can those in power seek to control those around them? How do we attain peace, salvation? How can we strive to live a meaningful life? Literature of the Middle Ages addresses these questions through a variety of genres in a multitude of languages and forms.
# Box 1 Welsh literature
While very few early texts survive before _c_.1100, the evidence that does exist from later manuscripts suggests that the earliest works in Welsh, attributable to Taliesin and Aneirin, might be dated to the 6th century. Welsh authors wrote in Latin throughout the period: Gildas is the first known writer; and Nennius' 9th-century _Historia Brittonum_ (containing the primary reference to King Arthur), for example, provides initial evidence for a literary tradition in Wales. Welsh poems of the later 9th or early 10th centuries are recorded in the margins of a Latin verse version of the Gospels; and the remains of _englynion_ (Welsh verse) also survive in the upper margin of a stunning manuscript of Augustine's _De Trinitate_ made in the 11th century.
After the 12th century, Welsh texts survive in many manuscripts. Welsh poetry flourished in the High Middle Ages, patronized, and also written, by princes and the gentry. Among the most famous poets are Dafydd ap Gwilym and Iolo Goch. Welsh prose in many genres exists, too, including prophecies, histories, lawcodes, and romances. Perhaps the most famous medieval work is the set of texts known as the _Mabinogion_ , which relates the mythological history of the Celts.
For Siôn Cent, a 15th-century Welsh poet (see Box 1), life is concerned with appreciating how transitory all earthly things are and yet how glorious the heroes or infamous the sinners of the past. 'Mae'r byd oll? Mawr bu dwyllwr' he states ('Where's all the world? It's been a deceiver') in his poem, _Hud a Lliw y Byd_ ( _The Illusion of this World_ ). He asks of all the great subjects of literature: Where's Adam? Where's Arthur, Alexander, Guinevere, Vivien, Herod, Charlemagne, King Richard, Owain, Brutus?
Felly'r byd hwn, gwn ganwaith,
_That's this world, I know it well,_
hud a lliw, nid gwiw ein gwaith.
_magic and colour; our work's of no avail._
For Siôn Cent, the only certainty and value to life is the maintenance of a keen eye on the afterlife, on learning to concentrate not on worldly goods and the acquisition of knowledge or splendour, but on being faithful and loyal to God. While this pervasive religious core that inspires so much of the literature produced in the Middle Ages can be tricky for modern readers, it should be considered one of the ways in which medieval people tried to understand and fathom their place in the world. The same desire to know the meaning of life and how we fit in with this world around us is yet an unbroken thread connecting all humanity. It is a desire expressed in riddles and elegies, sermons and morality plays, romances and histories, and it is to an explication of these that we now turn.
# Chapter 1
# Literary origins
The history of medieval literature in the British Isles begins at an end, the end of the society belonging to the Britons, as far as the historian Gildas was concerned in his _De excidio et conquestu Britanniae_ ( _On the Ruin and Conquest of Britain_ ). This early medieval author, writing in Latin around 550 ce, tells the story of the coming of the Anglo-Saxons in 450 ce and the consequent demise of the British nation, framing these momentous historical events within the context of a divine plan. The Britons, who had been Christianized under Roman imperial rule in the earlier 4th century, had not, according to Gildas, lived the godly lives they should.
Gildas thus shows in his part-history, part-sermon, how God sought to punish the sinful British through their subordination to the Anglo-Saxon invaders. For Gildas, writing in Latin (see Box 2), trained in the early Celtic Christian church, the Britons' momentous defeat at the swords of the Anglo-Saxons came about through 'God being willing to purify his family'. Gildas reveals that in seeking protection for the country after the Roman army left, the British king, Vortigern, and his counsellors, effectively 'sealed its doom by inviting in among them like wolves into the sheep-fold, the fierce and impious Saxons, a race hateful both to God and men, to repel the invasions of the northern nations. Nothing was ever so pernicious to our country, nothing was ever so unlucky.'
# Box 2 Anglo-Latin literature
Throughout the medieval period, Latin was the language of the church, the language of learning, and the language that bound all of western Europe together. Almost all those who lived in Britain and Ireland after Christianization would have heard and participated to some degree in Latinate culture—even if it was only to say an approximate version of the _Pater noster_ , the Lord's Prayer. Complex relationships between Latin and the other literary languages of the British Isles are seen in the production of many manuscripts with Latin main texts, and glosses in English or Welsh or Irish; in the translation and adaptation of major Latin works in various vernaculars; and in the macaronic verse of the later Middle Ages, which provides a perfect metrical and stylistic balance between languages.
Every conceivable genre of literature survives in Latin, including the most obvious kinds of liturgical and didactic texts to histories, regulatory works, administrative documents, and lawcodes. Some of the greatest theological and philosophical writers were products of and contributors to the medieval worldview, such as Bede, Anselm, and Robert Grossteste; and a good deal of the most informative and entertaining medieval writing is found in the historical and observational works of authors such as William of Malmesbury, Gerald of Wales, and Ranulf Higden.
Reading the demise of the Romano-Celtic world as God's retribution for the Britons' own inattention to living a Christian life was Gildas's way of understanding the terrible events of the later 5th and earlier 6th centuries. This period of displacement and resettlement will have been a gradual process, but the relative paucity of Celtic words in Old, Middle, and Modern English suggests minimal contact between Anglo-Saxons and Celts on any equal cultural footing. A few Celtic words in English survive: 'brock' ('badger'), 'binn' ('basket'), 'dry' ('magician'). In addition, the frequent relabelling of place-names and topography by Anglo-Saxons suggests that the subordination of the Celts was fairly comprehensive. Surviving place-names of Celtic origin include 'Cornwall', 'Carlisle', 'cumb(e)' for a 'valley', and 'London'.
The low number of words and place-names from Celtic is in sharp contrast to the many hundreds of words that were introduced into English from Latin, particularly once the Anglo-Saxons had been Christianized. The unequal relationship between the Celtic population and the Anglo-Saxon colonists might also be suggested through literary sources. A troubling riddle from the important 10th-century Old English manuscript, the Exeter Book (Exeter Cathedral Library, 3501), reveals, rather bawdily, one particular role of a _wealh_ ('foreigner', 'Welsh person') in later Anglo-Saxon England. The object of the riddle (known as Riddle 12) speaks for itself in the first person, giving clues to its identity:
Fotum Ic fere, foldan slite,
_I travel by foot, slice the ground,_
grene wongas, þenden Ic gæst bere.
_the green fields, as long as I bear a spirit._
Gif me feorh losað, fæste binde
_If I lose my life, I bind fast_
swearte Wealas, hwilum sellan men.
_dark Welshmen, sometimes better men._
Hwilum Ic deorum drincan selle
_Sometimes I give a brave warrior drink_
beorne of bosme; hwilum mec bryd triedeð
_from my breast; sometimes a stately bride treads_
felawlonc fotum; hwilum feorran broht
_her foot on me; sometimes, brought far from Wales,_
wonfeax Wale wegeð ond þyð;
_a dark-haired Welsh woman shakes and presses me;_
dol druncmennen, deorcum nihtum,
_some stupid, drunken slave-girl, on dark nights_
wæteð in wætre, wyrmeð hwilum
_wets me in water, she warms me pleasantly_
fægre to fyre; me on fæðme sticaþ
_for a while by the fire; a lustful hand grabs me_
hygegalan hond, hwyrfeð geneahhe,
_in an embrace, and moves me about frequently,_
swifeð me geond sweartne. Saga hwæt Ic hatte
_then sweeps me through that blackness. Say what I am called,_
þe Ic lifgende lond reafige,
_I who living ravage the land,_
ond æfter deaþe dryhtum þeowige.
_and after death serve the elite multitudes._
This riddle is deliberately full of sexual innuendo and double entendre, which presumably titillated, entertained, and taught the reader-listener the art of seeing multiple meanings in words and phrases. The subject of the poem reveals it is about a once-living thing that now serves to restrain Welsh slaves; as a container for drink; or as a hot-water bottle, filled by a Welsh slave girl; or as a brush for her dark hair. While alive (and free, in contrast to the slaves), the riddle-subject is an ox; after death, it serves the multitudes as leather or ox-hide, the most flexible of products. So integrated into the social life of the early Middle Ages was servitude, though, that slaves of both sexes are casually inserted into a riddlic game centred on the multiple potential uses of disguised objects.
Contact and cultural exchange between Celts and Anglo-Saxons continued (King Alfred's 9th-century adviser and biographer was Asser, the Welsh bishop of St David's in Wales, for example), though it is complex and often difficult to trace. Something of the complexity can be discerned from extant literary texts, which are predominantly written in Latin in the earliest centuries after the arrival of the Anglo-Saxons, though literature in all languages will also have been transmitted orally.
# On origins
For Gildas, the arrival of the Anglo-Saxons was catastrophic. If the relative unimportance of Celtic languages in the development of English and the casual mention of enslaved Welsh is convincing evidence, the Anglo-Saxon 'settlement' was, indeed, a catastrophe for the subordinated peoples. For the prolific author Bede (673–735), a monk-priest writing in 8th-century northeast England at the monastery of Wearmouth-Jarrow, one people's crisis was another's opportunity. From his _Historia ecclesiastica gentis Anglorum_ ( _Ecclesiastical History of the English People_ ), completed in 731, we discover most of what there is to learn about the early centuries of British history. Bede provides an account of the arrival of the Anglo-Saxons, and the foundation of England up to his time, helping to provide an idea of what constituted Englishness. The _Ecclesiastical History_ was influential immediately, and considered by King Alfred to be among 'the books most necessary for all men to know'. It was translated from Latin into Old English in the late 9th or early 10th century, and copied many times thereafter.
Numerous significant events are marked in the course of this substantial work, and none is of greater canonical status than Bede's narration of the arrival of the Anglo-Saxons at the request of Vortigern, echoing Gildas in aspects of the story. With geographical specificity (see Figure 1) and the pinpointing of person by name and descent, Bede comments in Book 1, Chapter xv (here from the Old English version) that:
They came from among the three most powerful Germanic tribes, those of the Saxons, the Angles and the Jutes. The people in Kent and in the Isle of Wight are of Jutish origin. From the Saxons, that is from that land which is called Saxony, come those in Essex, Sussex, and Wessex. And from the Angles come the East Anglians and Middle Anglians and Mercians and all the people of Northumbria. That land which is called Angeln is between Jutland and Saxony. It is said that from the time they left there until the present day that it remains deserted. The first of their leaders and commanders were two brothers, Hengest and Horsa. They were the sons of Wihtgysl, whose father was called Wihta, this Wihta's father was named Woden, from whose lineage many tribes of royal races claimed their origin.
Bede also describes the destruction that was heaped by the Anglo-Saxons, 'with the righteous judgement of God', upon the island's Celtic inhabitants, the 'graceless people', in collaboration with the Pictish tribes in the far north. This critically important work establishes the major account of the earliest foundation of the English nation in an authorial act that deliberately unites the peoples of England into one nation under God and the Roman church.
This focus was especially important during the decades in which Bede lived and practised his religious life. In 597, St Augustine was sent by Pope Gregory the Great to convert the pagan Angles and Saxons in the south of England, who, prior to conversion, worshipped the pantheon of northern gods. Yet, at the same time as those in Kent, Sussex, Wessex, and East Anglia were gradually becoming Christian, another branch of Christianity was already firmly rooted in the west and north, brought from Ireland via the holy island of Iona. This Celtic Christianity competed with the Roman version during the 7th century, to be settled in favour of the Roman tradition at the Synod of Whitby in 664.
Celtic traditions, reconciled with the Roman, were exemplified in the single person of the Lindisfarne hermit, St Cuthbert. Although he had been raised to practise Celtic Christianity, he was present when the English church chose Roman Christianity at Whitby. Bede wrote about Cuthbert's pious and ascetic life in Book IV of the _Ecclesiastical History_. Bede had also written a pair of biographies focused on Cuthbert before this—'both in heroic verse and also in prose'. These saintly biographies, or hagiographies, were among the most prolific genres of the medieval period, and they often drew on earlier stories growing in length and complexity as the text was transmitted through the centuries.
Such was the fame of both Bede and Cuthbert that their intertwined histories continue to be well known throughout the centuries since. Bede, as one of the Church Fathers, was the only named Englishman in Dante's early 14th-century Italian epic, _The Divine Comedy_ (in _Paradiso_ , Canto X); and Cuthbert still remains the patron saint of northern England. He is interred at Durham Cathedral close to Bede, and it was during the translation of Cuthbert's remains at Durham in 1104 that his grave was found to contain a number of artefacts associated with him that survive to this day. Among these finds is the 'literature' that would have been a permanent part of Cuthbert's life, the sacred words of the Gospel of John, a manuscript of which was found at the head of Cuthbert's body when he was translated. This small hand-sized book, written in Latin in the late 7th century, is now known as 'The St Cuthbert Gospel' and it is the earliest Western book still in its original binding. Bought by the British Library in 2012 from its former owners for £7,000,000, the little book, fully digitized for all to see on the British Library's website, attests to the significance of the early Anglo-Saxons' spiritual, literary, and cultural legacy.
# Mixing traditions
As well as this early Latin written tradition, a great many texts in the medieval period—especially vernacular poetic works—were often not copied down for years, sometimes centuries, after their initial composition. These include works in Celtic languages other than Welsh and Irish, like Pictish and Scottish Gaelic (perhaps derived from Irish Gaelic), or poems and stories in Old Norse—the other major Germanic language in the British Isles after the late 9th century. As such, our idea of literary production is skewed by what survives in the record, and the date of a manuscript's text may not correlate at all with the date of a work's composition and initial transmission. Sometimes, only whispers of dynamic earlier literary traditions can be traced through the written texts.
A notable example of a vernacular textual remnant is undoubtedly _Cædmon's Hymn_ , the survival of which we owe to scribes writing in a context very close to Bede's own. Students who learn Old English Literature (see Box 3) at university level will certainly encounter this short poem. Within a very short time around the year of Bede's death in 735, scribes copied two Latin manuscripts of the _Ecclesiastical History_. In the Moore Bede (Cambridge, University Library, Kk. 5. 16) and the St Petersburg Bede (Saint Petersburg, National Library of Russia, lat. Q. v. I. 18), scribes working on these books added the Old English version of the poem sung by Cædmon as recorded in Latin in the Bede narrative. Bede tells us that a cowherd at the monastery of Whitby in the modern-day county of Yorkshire was at a drinking-party with his friends when the harp approached him, being passed around for partygoers to use to create poetry that would thus be musically accompanied. Cædmon the cowherd left the party, embarrassed because he could not sing the extemporary poetic-songs beloved of the Anglo-Saxons and other northern European peoples. Cædmon went back to his shed to tend to his animals and fell asleep, only to have a vision of an angel, who demanded that he sing something ('Cædmon, sing me hwæthwugu'):
# Box 3 Old English literature
'Old English' is the name given to the language and the literature of the Anglo-Saxons, peoples who, from their Germanic origins in northern Europe, settled the area roughly the same as modern-day England from about 450 ce. Anglo-Saxon England lasted up to the Norman Conquest in about 1066, but Old English literature continued to be produced and used into the early 13th century.
Hundreds of manuscripts containing Old English survive, principally from the 9th century onwards, when King Alfred of Wessex (d. 899) initiated a major educational reform that resulted in the writing of Old English. Old English comprised the West Saxon, Northumbrian, Anglian, Mercian, and Kentish dialects; but most surviving texts are written in West Saxon. The range of works is astonishing: from religious and secular poems to sermons and saints' lives, historical, medical, legal, and didactic prose. Most of what remains is anonymous, though a few authors' names are known, such as Cynewulf, Alfred, Ælfric, Byrhtferth, and Wulfstan. Four main books containing the majority of Old English alliterative verse exist (the _Beowulf_ -manuscript, the Exeter Book, the Junius Manuscript, and the Vercelli Book), and poetry constitutes 10 per cent of the overall corpus.
'Ne con Ic noht singan; ond Ic for þon of þeossum gebeorscipe ut eode, ond hider gewat, for þon Ic naht singan ne cuðe.' Eft he cwæð, se ðe wið hine sprecende wæs: 'Hwæðre þu me aht singan.' Þa cwæð he, 'Hwæt sceal Ic singan?' Cwæð he: 'Sing me frumsceaft.'
_'I'm not able to sing anything; and because of that, I went out of the beer-party, and came here, because I don't know how to sing anything'. Again [the angel] spoke, he who was talking with him: 'Nevertheless, you can sing something for me.' Then he said, 'What shall I sing?' He said: 'Sing to me about the creation.'_
This rather charmingly told exchange between Cædmon and the visiting angel sets the scene for the earliest surviving Christian poem in English, miraculously uttered by a new talent who was subsequently made famous throughout the community. And while the poem that Cædmon sang was incorporated by Bede into his _Ecclesiastical History_ in Latin, those contemporary scribes who imported the vernacular versions clearly felt it essential to have the original rendition present within the story.
So it is that at the apposite point in the narrative, at folio 107 recto of the St Petersburg Bede, one of the manuscript's scribes wrote the poem in Northumbrian dialect in the lower margin. When it is laid out as verse in the way that modern editors prefer, it reads:
Nu scilun herga hefenricæs Uard,
_Now we should praise the heavenly kingdom's Guardian,_
Metudæs mehti and his modgithanc,
_the Measurer's might and his conception,_
uerc Uuldurfadur, sue he uundra gihuæs,
_the work of the glorious Father, as he for every wonder,_
eci Dryctin, or astelidæ.
_eternal Lord, established a beginning._
He ærist scop aeldu barnum
_He first shaped for sons of men_
hefen to hrofæ, halig Sceppend;
_heaven as a roof, holy Creator;_
tha middingard moncynnæs Uard,
_then middle-earth, mankind's Guardian,_
eci Dryctin, æfter tiadæ
_eternal Lord, afterwards adorned,_
firum foldu, Frea allmehtig.
_the earth for men, Lord almighty._
This poem is without parallel in terms of its significance as the beginning of canonical English literature. Cædmon's miraculous outpouring of praise for God's creation effectively and evocatively melds two quite disparate traditions in a way that provided a precedent for the majority of English poetry written up to the end of the Anglo-Saxon period, and intermittently thereafter. It is fitting that the combination of Christian, and not pagan Germanic, theme and Germanic alliterative verse-form emerges in a paean to God. This is reminiscent of the Latin hymns beloved of the early Irish missionaries, like Columbanus (543–615), who founded monasteries on the European mainland, and Columba (521–97), who founded the monastery at Iona, in Scotland.
In Cædmon's verse, the alliterative-accentual form, typical of Germanic verse and rhythmically mimicking the patterns of natural speech, is adapted for Christian purposes for the first time. The alliteration binding the stressed syllables of the first and second half-lines permits key words to be heavily emphasized; in the first three lines, for instance, the alliterating syllables are those nouns and adjectives beginning with <h>, <m>, and <u> (pronounced as <w>). The demands of alliteration are such that multiple synonyms or near-synonyms are required for the principal persons or ideas. Here, God is 'guardian', 'creator', 'father', 'lord'; he is 'mighty', 'eternal', 'holy', and 'almighty'.
Structure is given to the sequence by main words providing the 'head stave' at the first stressed syllable of the second half-line: _hefenricæs_ ('of the heavenly kingdom'), _modgithanc_ ('conception'), _uundra_ ('of the wonders'), _or_ ('beginning') and this word is the most emphatic of all. The caesura in the middle of the verse-line creates a dramatic pause, but the pause—shown as a space in modern editions of this poetry—never occurs as an actual space in the manuscripts themselves; instead, all early English poetry is laid out in the manuscript as if it were prose. But this slight pause in the verse-line's delivery is ideal for oral performance, as Cædmon proved the day after his nighttime vision, when he sang the Creation song for the wise monks at the abbey of Whitby. In this and later performances as a singer of religious verse, Cædmon gained fame sufficient to be enshrined in Bede's national history, thereby providing an originary legend for the significant corpus of vernacular poetry that emerged in the centuries following.
# Chapter 2
# Textual production and performance
Unlike modern mass-produced books and documents printed on machine-made paper, each medieval book or document or note is unique, hand-made, and handwritten by a scribe with a feather-quill or reed pen and ink. Practice versions of texts or preliminary work might be inscribed with a stylus into a wax tablet, which could then be heated, smoothed and used again, or copied quickly onto scraps of membrane. Final versions of a text were usually the careful products of those who had been trained to write formally by teachers, who would most often be monks, priests, or nuns. Children and novices would be taught in ecclesiastical schools or aristocratic households. In the later centuries, secular schools emerged to teach those who already had sufficient social standing to attain an education. All the books and documents produced by those with training in writing were prepared in similar ways.
From around the 1st century bce, animal skin (and in the Mediterranean, papyrus) was used as the main substrate for textual production, though inscribed objects and large carved memorials exist too, ranging from stone crosses, to ivory combs, wooden tally sticks, embellished book-covers, woven textiles, and many other artefacts. Books and documents, though, were generally made from parchment (sheepskin), vellum (calfskin), or goatskin. It was a complicated, costly, and time-consuming job to manufacture skins for writing, but this in itself reveals a great deal about how valued textual production and curation was. Throughout the medieval period in the British Isles, and up until the 14th century when hand-made paper began to be increasingly employed in writing environments, books and documents were written on skin by highly trained scribes, to be read by the privileged literate elite. But as the centuries passed, those numbers of readers and writers grew significantly, and with that growth came a much greater demand for texts and books, increasing the scale of manufacture, changing the modes of production, and effecting new means of dissemination.
# Making books
As is clear from looking at the earliest works that survive from the medieval British Isles, the majority of texts produced were religious or legal in nature. When Christianity arrived in the south of England in the last years of the 6th century, the missionaries probably brought with them books from Rome that would be used to preach conversion. Thereafter, sermons, the Gospels, and instructional and teaching texts were all essential in the spread of the new religion and were produced by religious scribes in writing offices known as scriptoria. These varied in size, depending on the institution's wealth and population. The scribes regarded their work as part of their _opus Dei_ , 'God's work'. This could be quite physical and arduous in the depths of a chilly winter, when scribes sat writing in drafty carrels, struggling to see their exemplar in the dimming light, as they wrote biblical and didactic works to venerate God.
From the very late 6th and 7th centuries, for example, a number of books influenced by Celtic Christianity survive. The Cathach of St Columba, though damaged, contains beautiful decorated initial capitals surrounded by red dots, an archetypal Celtic motif, seen also in other Celtic-inspired manuscripts. This Cathach, a Psalter or Book of Psalms, hung around the neck of a holy man and was used apotropaically; that is, to bless and seek protection for fighting forces before a battle. The Book of Durrow, written perhaps at Iona or in Northumbria in the 7th century, is the oldest complete gospel-book from the British Isles, and, like the few other famous books of the 7th and 8th centuries, it shows great influence from the Celtic tradition of illustration and decoration.
Monastic and other ecclesiastical institutions manufactured medieval books until at least the 12th century, and among the most highly venerated manuscripts to survive from the medieval period are the oldest, like London, British Library, Cotton Nero D. iv, known as the Lindisfarne Gospels. This large book was produced in early 8th-century Northumbria, and is fully digitized on the British Library's website. Written by the scribe Eadfrith, the Gospels were richly illuminated in gold and coloured inks made from precious materials. Carpet-pages filled with geometrical decoration face the first folio of each Gospel, to create extraordinarily complex and visually demanding openings. A manuscript like the Lindisfarne Gospels was expensive and resource heavy, and the value of the book was deeply felt even at that time by the community of monks that produced it. When the monks fled from the Vikings' attacks on Lindisfarne, they took the book, as one of their treasures, with them.
Gospel-books, and other major liturgical works, often belonged to the institution rather than a particular individual, and became showpieces for the religious establishments that made them. In the 12th century, very large, elaborately illuminated bibles were manufactured at great expense in what might be regarded as the apogee of book production within the monastic tradition. Sometimes, these may have been dedicated to wealthy patrons, or brought out on display in the church and shown to noble visitors to impress them. At this time, too, the production of some books became the responsibility of professional scribes and artists, like the famous 12th-century artist Master Hugo, who travelled between institutions to make a living in the expert manufacture of books.
Thousands of other books and documents were made besides these highly decorated, expensive volumes, typically made by wealthy institutions and nowadays seen in exhibitions in manuscript repositories around the world. The 'average' manuscript—as if any handmade object can be 'average'—is a portable, plain artefact, containing texts that were essential for the needs of the user or owner. Ownership of books was restricted either to those who belonged to religious communities, or to those in noble households, or, by the 13th century, to students who attended the newly instituted universities of Oxford and Cambridge, who were often engaged in a religious life themselves. At this time, too, book production methods changed with many books becoming smaller, as handwriting became more compressed and the page layout changed. This made the production of books cheaper and more commercially viable. With the book becoming a commodity for wider audiences, writing shops came into existence to cater for the much greater demand for texts.
# Textual communities
Traceable textual communities in the earlier Middle Ages tended to be dominated by religious communities of monks, nuns, and canons and those who were their congregations. Some form of literacy was expected of people in holy orders, since they were needed to pray, to practise pastoral care for those souls in their charge, and to be the producers of the books needed for the promulgation of a learned, Christian message. This remained true throughout the medieval period. But, as the centuries progressed noble secular households, including first and foremost the king's court, became important patrons of and audiences for literature, often fostering an elite literate culture, and helping to establish new forms of textual production.
In the post-Conquest period, after about 1100, French literature (see Box 4) began to be produced in England, partly as a result of the precedent of a long English vernacular tradition, and partly as a result of the keen literary interests of aristocratic and religious women. Henry I's second wife, Adeliza of Louvain, was a keen patron of literature: she was the dedicatee of one of the earliest French texts written in England in the first quarter of the 12th century, Benedeit's _Le Voyage de Saint Brendan_ , a poem in octosyllabic rhyming couplets (eight-syllable pairs of lines). The narrative was based on Latin legends of the 6th-century Irish saint, which told the story of his journeys and encounters with extraordinary creatures, people, and places, including a glimpse of heaven.
# Box 4 French literature
Inspired perhaps by the long-standing literary tradition they discovered in England, the Normans who conquered in 1066 began to produce works in their own language from about _c_.1100. This vibrant corpus of literature is also known as Anglo-Norman, or insular French, or French of England, and it differs from continental French in having its own traditions and trends. Saints' lives and histories predominated in the first part of the 12th century, but from the second half of the century, romances, lyrics, and lays proliferated.
From the 13th century until at least the 15th, there is an astonishingly innovative and varied corpus of prose, poetic, and dramatic texts written in French. Since French was the language of the monarchy, aristocracy, government, law, some clerical institutions, and scholarship, it had a major impact on the trajectory of British and Irish literature and culture. Its importance is seen in the very large number of French words taken into English between the 12th and the later 14th centuries.
After the 15th century, English began to displace French as the language of literary production in England, though French maintained its prestige. The relationship between the various languages and their late medieval written traditions is only now becoming clear with new research generating an appreciation for the importance of French.
The empress Matilda, daughter of Henry I and mother of Henry II, was keen to foster literature in the 12th century, too, as was Eleanor of Aquitaine, wife of Henry II, and one of the most important figures in the cultural renaissance of the 12th century. Eleanor patronized Wace, the author of the French _Roman de Rou_ , the _Brut_ , and the verse lives of Saints Nicholas and Margaret. Constance, the wife of the Lincolnshire lord Ralf Fitzgilbert, was the patron of the French _Estoire des Engleis_ , written by Geoffrey Gaimar in the mid-12th century. This _Estoire_ was the first translation into the vernacular of Geoffrey of Monmouth's famous _Historia regum Britanniae_ ( _History of the Kings of Britain_ ), completed in 1137. Evidence suggests a female interest in historiography and especially the history of Britain and its royal lineage, together with romance in its earliest phases.
In the later centuries, textual communities became more varied still. From university students to professional householders, as literacy became more widespread, so owners and users of books diversified. The main producer and first owner of the 13th-century multilingual manuscript, Oxford, Bodleian Library, Digby 86, was a secular educated man who lived in the west of England. He copied most of the manuscript over a period of time, aiming to include literary and religious works, predominantly in French, that he might have read to his entire household. Thus, as was so often the case, one book probably had a large audience, who would have participated communally through listening, rather than through direct and personal reading.
Throughout rural communities and towns, one important form of literacy was not necessarily highly expert; rather, it was 'functional' or pragmatic. Tradespeople and those with some rudimentary education knew enough to get by and might have been able to write their name, or understand significant phrases. These textual communities grew in number and in proficiency by the end of the Middle Ages, paralleling the emergence of a large and productive middle class. Evidence for this kind of literacy comes from many texts, including Chaucer's late 14th-century _Canterbury Tales_. This engaging and animated work depicts a diverse group of fictional pilgrims each of whom is meant to tell a story to the other assembled characters as they make their way to Canterbury on their pilgrimage. Among these figures are the Summoner, a minor cleric, who can parrot Latin phrases; a Reeve, who manages his lord's estates; and other professional characters including the Guildsmen, the Wife of Bath, and the Merchant all of whom would have some access to texts, even if, like the Wife of Bath, they were not that proficient as readers themselves.
# Composing and performing
As well as accessing texts through reading, medieval textual communities functioned without tangible books. These were oral or auditory cultures; that is, audiences who participated in the telling of tales and singing of songs through performance, or who heard the narration of secular literature and religious messages in different kinds of environments through the words of poets and preachers, storytellers and teachers. Many labels exist to describe the oral performers of a particular medieval cultural group: _scops_ and bards were the early tellers of tales for the Anglo-Saxons and the Celts; skalds were the poets of the Old Norse traditions. By the 12th century, the French troubadours and trouvères travelled through European courts and noble households singing the love lyrics and _lais_ that played such a major role in literary composition in the late Middle Ages. Later, in the 14th and 15th centuries, highly organized and collaborative dramatic performers emerged onto the streets of the city or village, filling the open spaces with spectacle and noise.
Within the oral and auditory community, one text or one image could have far greater impact than can be measured by surviving instances of that text. Or, single surviving texts, like the single early Welsh riddlic text, _Kat Godeu_ , 'The Battle of the Trees', from the _Llyfr Taliesin_ ( _Book of Taliesin_ ), attest to what might have been a much more prolific literary tradition. Moreover, with performance, the transient mode of delivery to a crowd that is live and present, but then disperses, often leaves no physical trace of its happening. This appears to be the way in which early textual traditions functioned in all societies: through oral dissemination of a text only much later recorded in writing.
In the case of the early medieval British bard, Taliesin, poems attributed to his authorship date from the late 6th century, but are not found in manuscript form until the 14th century, when they were copied into the _Llyfr Taliesin_ (Aberystwyth, National Library of Wales, Peniarth 2, which is fully digitized on the National Library's website). Quite what the 'original' compositions of this bard and his fellow British poets (known as _Y Cynfeirdd_ ) were really like is impossible to deduce and 'authorship' becomes an impossibly difficult concept to prove. In the form in which they survive, these poems concern themselves with the heroic ethos in which they were culturally situated, but they clearly also speak to the 14th-century audience that produced and received these works. In _Gwaith Argoed Llwyfain_ ( _The Affair of Argoed Llwyfain_ ), Taliesin writes in praise of the British king Urien Rheged and his son Owain, 'the wounder of the east', relating their battle victories:
Atorelwis Uryen vd yr echwyd,
_Then Urien, the lord of Yrechwydd, shouted out,_
'O byd ymgyfaruot am gerenhyd
_'If there's to be gathering to talk of peace,_
dyrchafwn eidoed oduch mynyd
_let us raise our banners on the mountain_
ac am porthwn wyneb oduch emyl.
_and raise our faces above the shield's edge._
A dyrchafwn peleidyr oduch pen gwyr
_Let us raise spears above men's heads_
a chyrchwn fflamdwyn yny luyd
_and fall on Fflamddwyn among his hosts_
a lladwn ac ef ae gyweithyd!'
_and kill both him and his company!'_
This rousing speech, which apparently took place in battle during the later 6th century, is clearly a poetic affirmation—rich in rhyme and alliteration—of Urien's warrior prowess and leadership over his men. In Taliesin's poem, Urien's speech insists on the literal and metaphorical rising up of his men and their weapons in order to crush the enemy from a moral and physical height. Taliesin proclaims that until the day he dies he will praise Urien, and such ancient eulogy, known as _hengerdd_ in the Welsh tradition, survives in all the Celtic and Germanic cultures in the medieval period. Professional poets from the earliest to the latest time in medieval society were paid by patrons to regale the whole community with skilful narrations of war-deeds, the better to encourage the listeners in their resolve and desire for victory. They were deeply knowledgeable about history, poetic formulas, and style, and about communities, their ancestry, and their affiliations.
Similarly, then, legend and the careful remembrance of national narratives going back for generations played a major part in the survival and transmission of the great Irish prose saga, the _Táin Bó Cúailnge_ ( _The Cattle Raid of Cooley_ ), which survives in manuscripts from the 12th century, though its historical context is perhaps a millennium earlier. These early texts, in both poetry and prose, survive principally because they were passed from teller to teller, evolving and transforming as they continued to entertain and teach. This method of dissemination and the communal understanding that texts were not _fixed_ , as they tend to seem through print, means that medieval literature can be thought of as part of a fluid, changing, and dynamic process. This is true whether one or more versions of a work exist in written form. And because texts were regarded as still-living and authors were often not known, many scribes became part of the authorial process, editing texts both deliberately and inadvertently as they effectively created new versions of the words they had received from an exemplar.
This shifting literary culture seen in Welsh and Irish literary production is also witnessed in all other literary contexts in the Middle Ages. In terms of manuscript variation, a most dramatic example is Chaucer's _Canterbury Tales_ , which exists in over eighty unique manuscripts and fragments, dating from _c_.1400 onwards. None of these versions is the same as any other and, indeed, some of the variations between the manuscripts' texts and sequences of texts are very notable. Since not one manuscript is written by Chaucer himself, scholars of the _Tales_ research how close to Chaucer's authorial intentions the texts in these manuscripts might be, and how much scribe-editors influenced the production of their respective versions. The same issues of 'who wrote the manuscript' and 'how close is the text to authorial intention' affect many texts, including those that exist in only one manuscript. With the Arthurian romance _Sir Gawain and the Green Knight_ , for example, no one knows who the author of the poem was, or when or how it was written. Later literary categories of 'originality', 'date of composition', 'authoritative text', and 'authorship' are thus more complex for medieval literature, but, interestingly, such openness gives readers a great deal of interpretative flexibility, too.
# Textual settings
Just as the circumstances surrounding the 'origin' of a literary work are very murky, either because no 'original' exists and the author is unknown, or because we do not know where or when a work's life began, so, too, the environments in which texts were accessed are often unclear. It is likely that medieval communal audiences were privy to public performances of heroic works and romances, mythical tale-tellings, magnificent oral recitations, and spiritual declamations that lived on in the mind and collective memory.
In the mead-hall of Germanic society, which lasted well into the 11th century in England, or the courtly hall of the regional nobleman, audiences gathered over a meal to be entertained and inspired by works like, respectively, the satirical 12th- or 13th-century Welsh prose _Breuddwyd Rhonabwy_ ( _The Dream of Rhonabwy_ ), or the 15th-century romance, _The Awyntyrs of Arthure_ ( _Adventures of Arthur_ ). Some literary works contain a self-representational moment, where their own origins are declaimed. _Widsith_ , an Old English fragmentary verse about the poet whose name means 'far-journey', begins with the narration of himself in the third person which illustrates the reception he can expect from listeners in the lord's hall, who would reward him with treasure and patronage:
Widsith spoke, unlocked his word-hoard,
he who had travelled most of all men
through tribes and nations across the earth
had often gained great treasure in hall.
Widsith's story is a good reminder of the importance of the social gathering as the place of critical information exchange and communal recollection.
The gathering of the community to hear texts read aloud continued into the modern era, particularly because books were expensive and relatively rare and because levels of literacy ranged variously from exceptionally low to only partial to accomplished until the mandatory education of children in the 19th century. A picture of Geoffrey Chaucer on the first folio of a 15th-century manuscript, Cambridge, Corpus Christi College 61 (see Figure 3), shows him reading his great romance, _Troilus and Criseyde_ , from a raised dais to King Richard II and an assembly of some two or three dozen courtiers. Obviously, in all performance circumstances like this, some would hear or see better than others, depending on seating or vantage point. In the case of medieval dramas like the York Corpus Christi Plays, or the Chester Mystery Plays performed in the streets from at least the 15th century, if not earlier (and, for the last few decades, performed live in the streets of these modern cities once more), audience participation matters for the plays' literal, social, and spiritual success. From this physical and real-time participation in re-enacted moments of Christ's life, the opportunity for a personal engagement with the key episodes in New Testament history are obviously a critical element of the event and it is to the reader's responses that Chapter 3 will turn.
3. Cambridge, Corpus Christi College 61, folio 1 verso.
# Chapter 3
# Literary spaces, literary identities
# Reading and hearing
In contrast to the hurly-burly of the pageant wagons in the medieval street plays, in the 21st century we might tend initially to think of accessing a text as a solitary experience, even though many public stagings of texts still occur (like cinema-goers' experiences, for instance). In the Middle Ages, textual access could also include the effort of an individual reader, who might generally have articulated the words of the text out loud. This seems to have been the norm for the solo reader.
Nevertheless, the audience of a text—whether private or public, silent or noisy—is asked to engage with that text, to identify with or mull over the contents of the work. This is not to suggest that all textual participants have the _same_ experience, even in the setting of a single public performance. Any individual's reception of a text depends on many different factors including their position in the audience, or the audibility of speaker, and the knowledge, understanding, and concentration that the listener-viewer brings to bear on the experience. Authors also employ particular tactics to encourage the formation of a collective response and build a common frame of reference. The opening lines of the Old English epic poem _Beowulf_ , written down in _c_.1010 (in the manuscript London, British Library, Cotton Vitellius A. xv), insist on a pre-existing body of shared knowledge among the imagined audience:
Hwæt, we Gardena in geardagum,
_Listen, we heard of the Spear-Danes in olden days,_
þeodcyninga þrym gefrunon,
_of the glory of the people's kings,_
hu ða æþelingas ellen fremedon.
_how the princes performed courageous deeds._
In this opening to the poem, the performer (perhaps in dramatic mode in the hall of a noble person) encourages unity among his listeners by the use of the pronoun 'we' and the claim that everyone has 'heard' about the Spear-Danes already; everyone shares these events in tribal history and legend. In its 3,182 lines, the poem creates a world that focuses on three major encounters between Beowulf and ferocious monsters. The ethos that pervades the poem, both in the choice of vocabulary and in the narrative it constructs, is the Germanic Heroic Code of loyalty, bravery, heroism, and the giving and receiving of treasure by lord and thane (or warrior). These opening lines establish this code, anticipating the potential audience's participation. All of this is effectively implied by 'we'.
Beyond _Beowulf_ and other works about the heroic individual's role in society, it is also very common to encounter the rhetoric of inclusion when the author seeks to bring the intended audience into the text. Authors will seek agreement to win the reader or audience member over, and perhaps win promotion, acclaim, or patronage at the same time. In this, the success of a text was partly dependent on the space of performance: the appropriateness of the venue mattered. The ambience of a provincial lord's hall might have made the dramatic rehearsal of battle-song a moment of group glory; or conversely, an elegy, lamenting the loss of a recently deceased person, could inspire some truly moving moments for the individual or group.
Geoffrey Chaucer's elegiac _Book of the Duchess_ was written in or just after 1369, for Henry III's son, John of Gaunt. It commemorates John's young wife, Blanche, who had died of the plague, though the cause is not mentioned in this formal poem. Notably, this work comes at a critical moment in the history of literary production in England, as Chaucer chose very deliberately to write his first major poem for the royal court in English, not French, which had been the language of prestige and status since the late 11th century. While the poem is a public statement of sorrow, read to an assembled group of sympathetic nobles, it is also moving and delicate, drawing inspiration from earlier writers, like the classical Latin author, Ovid, and Chaucer's contemporary, Guillaume de Machaut, a French poet.
In _The Book of the Duchess_ , Chaucer maintains the balance between courtly decorum and personal elegy by casting the poem as a dream vision, in which the poet meets and converses with the mournful Black Knight (representing John of Gaunt), who reveals the death of his 'lady swete, | That was so fair, so fresh, so fre'. Through the remembrance of falling in love, and the articulation of Blanche's sweetness and nobility, the poem becomes a celebration of love, a small consolation for substantial loss, presumably delivered within the courtly context where Blanche was most well known.
A much earlier eulogistic poem praising the achievements of a well-known figure is the early and lengthy Irish _Elegy for St Columba_ ( _Amra Choluim Chille_ ), composed by St Dallan in the 6th century, though it only survives in manuscripts from the 12th century. It was read out to an assembly of Irish lords, which we learn from the author's declaration about his motivation: that he wishes to attain heaven through the work's public performance, and hopes, too, to promote the patronage of poets in Ireland (see Box 5). This poem is partly self-reflexive, calling attention to its own performative wonder by lauding the miraculous voice of the saint that could resound far and wide:
Son a gotha Coluim Cille
_The sound of Colum Cille's voice,_
mór a binne húas cech cléir:
_great was its sweetness above every company:_
co cend cóic cét déc céimmend
_as far away as fifteen hundred paces,_
aidblib réimmend ed ba réil.
_a vastness of courses, it was clear._
Rather like the story of Cædmon the cowherd, whose sudden ability to sing was a sign of God's grace, the story of Columba's resounding voice told to an appreciative audience of nobles could hardly disadvantage the skilful poet. That _this_ is the miracle, too—the capacity for the saint's voice to be heard so widely—suggests the importance of oral dissemination to medieval culture throughout Britain and Ireland, the significance of the message being heard.
# Box 5 Irish literature
Irish literature in the native language and in Latin flourished from very early in the period: Ogham inscriptions survive; and Christian legends were transmitted into manuscripts from the 8th century, attesting to the highly literate culture of the Irish. Irish influence extended far beyond the island, because of Christian missionaries on the European continent and in northern and western Britain. Poetry and prose in Irish survive in quantity from the 12th century onwards, and a good deal of the material written down in the High Middle Ages can be dated earlier, giving important evidence for the foundational stories of the Irish kingdoms. These include the great cycles of legendary and mythological texts like the _Cycles of the Kings_ and the _Fenian Cycle_.
A notable piece of Irish literature is the poem _Pangur Bán_ , written in the 9th century by an Irish monk while he was in Reichenau Abbey in south Germany. The poet addresses his cat, Pangur Bán, praising the cat's skill at catching mice and relating that skill to his own as a scribe, who turns 'darkness into light' through his work. This humorous poem highlights something of the diversity of Irish literature, with its substantial sustained corpus of Christian and secular poetry and prose.
But, more privately, the witticisms and stylistic complexity of a Latin verse satirizing the church might most profitably be transmitted to a group of trained and educated persons in the scholarly setting of the university or a monastic institution. One such set of texts, which are 'goliardic' (belonging to the genre of satirical poems aimed against the church, and written in the 12th and 13th centuries by itinerant scholars), exists in a manuscript anthology that probably belonged to a Benedictine monk, William of Winchester, in the 13th century—London, British Library, Harley 978 (fully digitized on the British Library website). Other literary works in this manuscript include a hunting tract, medical treatises, and the music and lyrics for a Middle English song, _Sumer is icumen in_ , with its Latin counterpart, _Perspice, Christicola_ ('See, O Christ').
The manuscript also contains the important French _Lais_ and _Fables_ of Marie de France, an author living and writing in England in the later 12th century. The _Lais_ , dedicated by Marie to Henry II (d. 1189) are short Arthurian narratives about chivalric love—that is, the love of knights and their ladies, containing thematic conventions such as loyalty and betrayal, disguise and revelation, and the intervention of supernatural elements. Stories of these events, or _aventures_ , were originally composed and performed musically by Breton minstrels. Marie's intention in putting together these _Lais_ , such as _Lanval, Yonec_ , and _Chevrefoil_ , as she declares in her Prologue, was to bring life to these ancient tales. Within this single manuscript context, then, while the diverse collection of entertaining, didactic, and instructive works suggest the book was specifically made for the interests of its individual owner or primary user, a number of texts seem to demand public and even courtly performance, indicating a multitude of possible contexts of textual delivery.
# Capturing audiences, creating history
In the wonderfully entertaining and deeply humorous late 12th-century work, _De nugis curialium_ ( _Trifles of Courtiers_ ), Walter Map (d. 1209/10) regales his audience of like-minded male clerics at court with a treasure-trove of legend, historical narrative, and contemporary detail that represents the wide range of knowledge an educated person could acquire. Map was a well-connected churchman from the Marches of Wales, who studied at Paris and rose to become archdeacon of Oxford. His intention in writing _De nugis_ was apparently to inspire and inform. He likens the assiduous reader, the 'lover of wisdom', to a busy bee that draws something from everything it lands upon. But not so the ungodly:
non sic: sed oderunt antequam audierint, vilipendunt antequam appendant, ut sicut in sordibus sunt sordescat adhuc. Solum ex hoc placeo quod vetusta loquor. Libetne tamen nuper actis aurem dare parumper?
_not so: they hate before they have heard; they disparage before they deliberate, so that as they are filthy, they become filthier still. The only merit is that I tell of ancient things. Will you please, though, for a little while, give ear to a story of recent times?_
By humorously derogating the ignorant, ungodly person, whose lack of willingness to learn is likened to being filthy, Map forms a desire in his audience to be more akin to the busy learner. In this request for his listener or reader to pay attention for a little longer, Map deftly creates a respondent who can only say 'yes', if _they_ wish to be among the pursuers of wisdom. Such rhetoric consolidates the relationship between writer and listener-reader, a rhetoric that wittily sought the audience's approval and compliance, a rhetoric that persuaded.
To a greater or lesser extent, all literature seeks to engage, inform, and persuade. In order to engage an audience, a literary work has to grab the audience's attention and reveal something worth hearing. Literature can play a significant role in shaping an audience's thoughts, ideas, and sense of itself, and throughout the Middle Ages among the most important genres was the chronicle or history. This form of writing was important from the early medieval period onwards, as exemplified by the Latin histories of Gildas or Bede, for example. Histories help to promote a sense of identity by focusing on specific events and people that are deemed the most significant for a nation or a group with common interests. Generally, a historian's work is denoted by an effort to tell a form of the truth, though it is seldom the case that any writing is actually objective. In the Middle Ages, in particular, as scholars recognize and debate, there is often a blurring of the boundaries between truth and fiction, between factual prose and the imaginative reconstruction of events.
We can go back to the Anglo-Saxon period momentarily to see this exemplified in the earliest manuscript of _The Anglo-Saxon Chronicle_. This work was begun in the late 9th century, and, through a number of manuscript witnesses, it tells the history of England from biblical times to the middle of the 12th century. It had a diverse audience of religious and lay people and its influence was wide-ranging, as we shall see. The _Chronicle_ gives a year-by-year account of important events, though some years are blank, and most focus is on male religious figures, kings, and noblemen. Poems are occasionally embedded within the _Chronicle_ , forming an integral part of the usually factual framework.
Among these is _The Battle of Brunanburh_ , an alliterative poem which tells the story of King Athelstan's glorious victory over the Vikings, the men of the north, and the Scots in 937. Revelling in the bloodshed of the battlefield, the poet makes out of Athelstan's victory an event of national and historical significance resounding throughout the island. He directly links the glorious Athelstan with his Anglo-Saxon settler-ancestors who destroyed the (sinful, and thus divinely punished) Welsh and took control of large parts of the island:
Never was there a greater slaughter
of people killed on this island
by the sword's edge, even up until now
or before this, of which the books of ancient scholars
tell us; that is since from the east
the Angles and Saxons arrived up
over the broad seas to seek Britain,
proud warriors, they overcame the Welsh,
noble warriors, eager for glory, they conquered the country.
Set within the context of the _Chronicle's_ prose annals, _The Battle of Brunanburh_ is framed by the achievements of Athelstan's reign in its entirety (924–40). This poem has distinctive nationalistic overtones, seeking to unite and to promote a sense of the shared triumphant destiny of the English in the 10th century. It certainly shows these 10th-century Anglo-Saxons were keenly aware of their historical past. Within the _Chronicle_ , though, this past is intermingled with fiction, too, creating for these early medieval kings of England an ancestry that went back to the Bible, but via the mythical Woden, the mythical Beaw, Noah, and Adam.
Such ancient origins for the English kings not only validated their right to the throne, but also sacralized it: they ruled with a traceable inheritance of more than thirty generations to the original divinely created man. Obviously preposterous, such originary myths nevertheless bolstered the monarchy in turbulent times, and helped to consolidate the dynasty. Other originary myths encouraging a cohesive national or tribal identity and enhancing pride in the achievements and prowess of ancestors are produced throughout medieval Europe. Such stories were passed on orally for hundreds of years—memorized and retold: embellished, expanded, and eventually written down for posterity.
The Irish _Táin Bó Cúailnge_ ( _The Cattle Raid of Cooley_ ), one version of which is written down in the 12th century _Lebor Laignech_ ( _Book of Leinster_ ), refers to very early Celtic society, via these multiple retellings over the centuries. It relates the story of an attempt by Queen Medb to acquire the famous Brown Bull of Cooley, so she can equal the possessions of her husband, King Ailill. There follows a complex sequence of events that pitch warriors of Medb's kingdom of Connacht against other warriors from throughout Ireland. The bull is eventually acquired for Medb, but in the process some of the most heroic fighters from all sides are killed, including the Ulsterman Cú Chulainn—the greatest hero of them all, descended from a god. This heroic tale, like others from Irish and shared Scottish literature, and like stories from early England and Wales in the period, focuses a great deal on the customs and ways of life of a society that is far earlier than the date of the work's survival in writing, suggesting how important to the Irish the transmission of this early culture was for their own sense of themselves and their history.
# Identifying with literary heroes
As the Middle Ages progressed, these national narratives develop into fuller histories from the 12th century onwards. This later period also sees the evolution of chivalric and historical romance, when heroes are knights who undertake tasks for the sake of love and pursue spiritual and personal growth through individual achievement. In the simplest terms, this is in contrast to the more social and communal ethos of the warrior in earlier heroic poetry and prose. Where, for example, Beowulf fights to save his entire nation from a fire-breathing dragon, in the late 14th-century courtly romance by Chaucer, _The Knight's Tale_ , the two knightly protagonists fight for the hand of the beautiful Emelye. _The Knight's Tale_ is set in Athens in classical times (a 'Matter of Rome' romance) and is based on the _Teseida_ , written by the Italian poet Boccaccio in _c_.1341. Chaucer's lengthy narrative begins with the claim that the _Tale_ is composed 'as olde stories tellen us' ('as old histories tell us'), providing authenticity for his story and lending an air of truth to his fiction.
In a similar manner, medieval historians themselves recounted the deeds of kings and bishops in full narratives, fleshing out sparse factual detail with imagined dialogue, and stories of relevant legends and myths. Henry of Huntingdon's _Historia Anglorum_ ( _History of England_ ), which ends with events in 1154, drew upon all manner of sources in its composition, including ecclesiastical documents, poetry, other chronicles, and saints' lives. This amalgamation of different kinds of source materials of originally varying perspective and intended function illustrates something very interesting about medieval literature; namely, the permeability of genres and the flexibility of composition.
The 12th century thus saw the burgeoning of the romance, a major genre with multiple sub-genres, which quickly established itself as a favourite of the aristocracy, especially from the reign of Henry II and his wife Eleanor of Aquitaine. The courtly romance—with its attention to love, fellowship, loyalty, generosity, and piety of the chivalric knightly code—was cultivated by the French royalty and noble families in Britain and Ireland in the High Middle Ages, and provided a certain audience for narratives of knightly deeds and tales of pure love. Romance often used historical or pseudo-historical figures from real and imagined past cultures to demonstrate then-contemporary ideals, providing moral instruction through positive example and assisting in creating a sense of shared identity and shared values among the audience.
Romance protagonists demonstrated the aspirations of actual courtly life; and some of the greatest heroes in medieval literature emerge at this time, such as Lancelot, Gawain, Horn, and Guy of Warwick, and, the most inspiring of all heroes—King Arthur (all 'Matter of Britain' romance protagaonists). From the middle of the 12th century onwards, this appropriation of British historical figures into French, Latin, and English poetry and prose is part of a larger pattern of the recasting of history, legend, and myth into new narrative forms. These texts were read and understood in a broader cultural context of multilingualism, settlement, and regional or national interests. Surviving texts from legislation to charters and histories at this time suggest efforts to codify and structure new societies that were emerging as a result of conquest, most dramatically exemplified by the Normans' Conquest of England in 1066, and their subsequent efforts to colonize the Irish and the Welsh. From the later 12th to the early 16th centuries, British and Irish societies embraced multilingualism, innovative forms of literary expression, new administrative processes, the foundation of chartered towns, the rise of the merchant classes, the institutionalization of the church and its methods of pastoral care, new religious orders, and the gradual development of complex literacies. Such was the transformation of later medieval culture.
In Wales, writing in Welsh in the 12th and 13th centuries was diverse, but much of it effectively created a sense of national identity, even while other languages were in use in Wales—from the Latin of churchmen and women, to the French of the nobility, and the English of many, particularly along the Marches. Rather like the emergence in 12th-century Ireland of some of the major manuscripts containing Irish texts, so too, in the same period of colonization by the Normans, Welsh works of literature, old and new, emulative and innovative, emerged in writing.
It is to the post-Conquest period (1066–1200) that the Four Branches of the _Mabinogi_ can be dated, as well as the _Brut y Tywysogion_ ( _Chronicle of the Princes_ ); and some of the greatest poetry in medieval Welsh. A family of court poets that flourished at this time were Meilyr Brydydd ap Mabon (1081–1137), his son Gwalchmai ap Meilyr, and _his_ sons Meilyr ap Gwalchmai and Einion. All were the poets of princes, rewarded by their aristocratic patrons for the work that they created. In this, they are part of a larger group of poets known as _Y Gogynfeirdd_. Their concerns are praise of those whose courts they inhabit, concern for their own souls, appreciation of their country and the traditions in which they work, and the deliberate nurturing of a collective identity distinctively Welsh.
# Hybrid cultures
An author whose work illustrates the difficulties of using terms like 'national' or even 'regional identity' in this period is the Welsh-Norman eminent churchman and scholar Gerald of Wales, or Giraldus Cambrensis (1146–1223). His two most famous Latin works are journeys through Wales and Ireland. In 1185, he accompanied Prince John (later King John) on an expedition to Ireland, which he then described in his _Topographia Hibernica_ ( _Topography of Ireland_ ). The _Itinerarium Cambriae_ ( _Itinerary through Wales_ ), which he wrote in 1191, detailed his journey with Baldwin, Archbishop of Canterbury, when they attempted to drum up support for the Third Crusade.
In these works, the dynamics of a mixed heritage, a climate of conquest, and the views of an erudite man about those less learned come to the fore. These are tempered by a keen wit and keen eye, and, in the case of writing on his own Welsh land and people, Gerald clearly does identify with some of what he sees some of the time. But he is also discerning in his literate sensibilities, sufficient to give us an insight into contemporary poetry and national literate cultures with their own modes of composing. It is perhaps at this time that the expression of difference begins to be analysed and confidently stated. Indeed, so significant are Gerald's observations, since he makes important distinctions as well as comparisons, that it is worth giving the full flavour of what he has to say in the _Itinerary_ Book I, Chapter xii:
In their narrative poems and their formal speeches [the Welsh] are so inventive and ingenious that they produce works of art when using their native tongue that are at once wonderful and very original, both in the words and the sentiments expressed. Thus one will find many poets in Wales, whom they call bards... They delight in alliteration in preference to any other rhetorical device, and especially the kind which links together the first letters or syllables of words... Here are two examples in Welsh:
Dychaun Dyu da dy unic.
_God will provide comfort for the lonely man._
Erbyn dibuilh puilh paraut.
_Guard yourself against evil desire._
Here are three in English:
God is togedere gamen and wisdom.
_Entertainment and wisdom are good together._
Ne hat nocht al sor isaid, ne al sorghe atwite.
_There is nothing to be had by uttering every sorrow, or blaming others for misfortune._
Betere is red thene rap, and liste thene lither streignthe.
_Being prepared is better than haste and caution than misplaced strength._
... This device of alliteration does not occur in any other language that I know of as much as it is in English and Welsh. It is surprising, indeed, that French, which is so well adorned in other respects, should never make full use of this particular one, whereas other languages have so entirely adopted it. I cannot believe that the Welsh and the English, so different and antagonistic to each other, could ever have consciously agreed in the use of this rhetorical figure.
Gerald's provision of this information in his _Itinerary_ is useful and important in a number of ways. He demonstrates, first of all, his own high level of learning and literary understanding. Despite writing in Latin throughout all of his oeuvre, here, and elsewhere, he acknowledges the existence and value of the various major written vernaculars in play in his own lifetime: French, Welsh, English, and indeed, he talks about northern England, where the language was influenced by Danish and Norwegian. More than this, though, he makes explicit literary difference, as exemplified through language and style, a difference that can be drawn along national and regional lines. Part of what makes identity important here, then, is that we learn more about who we are by understanding who we are not.
Gerald explicitly wants his audience to see and understand the ways in which poetic traditions and rhetoric can be allied to national literary forms that, for the English and Welsh who are normally at odds, function through shared alliterative patterning. The English poetic style that he chooses to demonstrate is not the English that would dominate in the 13th century—verse that rhymed, influenced by the French tradition; but, rather, the English of the Anglo-Saxon tradition. And these are verse-lines, some extracted from larger works, that might most pertinently be thought of as somewhat proverbial, idiomatic, with a gnomic function; that is, they are embedded in popular literary culture, well-known universal truths—common sense, as we might think of it.
# Regional identity through dialect
Literary identities forged through language, but also style of composition, retained great significance throughout the later medieval period, particularly because Britain and Ireland were not just multilingual, but, within that, multidialectal, too. In England after the 12th century, the native Old English language began to change dramatically, partly because of the influx of French, Latin, and, to a lesser extent, Scandinavian loanwords; and partly because scribal training in a standardized English writing no longer happened. Spelling, word choice, and grammar, rather than being a kind of authorized version like late West Saxon, became instead more dependent on the personal choices of author and scribe, heavily influenced by the forms particular to regions of a writer or scribe's origin. At the same time, regular French language use increased during the 13th and 14th centuries to include not just the aristocracy and educated elite, but also the emergent bourgeoisie and merchant classes (see Box 6).
# Box 6 Middle English literature
Middle English flourished in the 14th and 15th centuries, but notable texts were composed as early as _c_.1170, when the penitential verse, _Poema morale_ , was written. By 1200, the standard literary language (late West Saxon) had broken down, and English texts from the 13th to the 15th centuries are written in the dialect of their authors and scribes, so spelling and vocabulary tend to vary considerably.
From 1170, verse had multiple metrical forms, including rhyme, often influenced by French. Many notable poetic and prose works survive from this highly dynamic multilingual and multicultural time in English literary production, and authors such as Geoffrey Chaucer, William Langland, and Thomas Malory are especially important. As was typical of the period, authors built on the works of earlier authorities; Layamon's early 13th-century chronicle, _Brut_ , adapted the work of earlier writers in Latin (Geoffrey of Monmouth) and French (Wace) to tell the poetic history of Britain, founded by Brutus of Troy. As literacy increased, personal compendia of poetry and prose illustrate the extension of manuscript production from the ecclesiastical institution into the nobility's households. Large numbers of religious tracts, books of sermons, histories, and romances are among the many texts created during this rich period of literary production.
Added to this linguistic fluidity was the preference in specific regions for particular forms of poetry; that is, regionalization of literature became an important and notable feature of English in the later part of the Middle Ages. So, for example, poetry known as tail-rhyme verse was popular in the East Anglian region of England in the 14th and 15th centuries. The opening of the 15th-century poem _Athelston_ , which is a romance set in a fictionalized world of the Anglo-Saxons, shows this kind of tail-rhyme where the rhyme scheme is aabccb:
Lord, þat is off myƺtys most,
_Lord, that is of mightiness most,_
Fadyr and sone and holy gost,
_Father and son and holy ghost._
Bryng us out off synne.
_Bring us out of sin._
And lene us grace so forto wyrke
_And grant us grace so that we work_
To love boþe God and holy kyrke,
_To love both God and holy church,_
Þat we may hevene wynne.
_That we may heaven win._
In contrast to this rhyme scheme in the east, non-rhyming alliterative verse dominated in the west and north of England, in an arguably unbroken tradition from the Anglo-Saxon period. Other, newer forms of poetry were also developed in parallel, like the octosyllabic rhyming couplets (eight syllable lines paired through rhyme) of the Nun of Barking's French _La Vie d'Édouard le confesseur_ , or the later Rhyme Royal of Chaucer's major romance, _Troilus and Criseyde_.
So it is that by the later 14th century, what had once been a fairly consistent style and dialect of English literary production had become diverse in terms of sound, spelling, vocabulary, and poetic style. When English became firmly re-established as a major chosen literary medium (having been subordinated to French and Latin) around the reign of Richard II (d. 1399), what appeared could be identified by dialect. Thus, the three greatest English poetic works of the High Middle Ages—Chaucer's _Canterbury Tales, Sir Gawain and the Green Knight_ , and _Piers Plowman_ —while roughly contemporary, are yet very different to look at and to read.
A number of versions of the long religious and didactic poem known as _Piers Plowman_ exist, written over many years of effort by a certain William Langland in the 1360s to, perhaps, the late 1380s. The poem concerns the search for Truth (God) by the protagonist and dreamer, Will, who represents Everyman. He has an innovative sequence of dream visions in which he encounters real and allegorical characters on his journey, including the king and his court, Conscience, Reason, and a ploughman named Piers. The poem itself is set in the west of England, and is written in alliterative verse, with two half-lines linked by stressed syllables which begin with the same sound: <s> in line 1 below, <sh> in line 2, <h> in line 3, and so on. The effect of this is that, in great lines of poetry (and _Piers Plowman_ is great poetry), the sound of the alliterating syllables generally supports and helps to emphasize and reinforce the meaning. In this spring opening then, a _reverdie_ in literary terms, the softly articulated consonants help set a peaceful, contemplative scene, only broken in line 6 by the more abrasive repetition of <f>.
In a somer seson, whan softe was the sonne,
_In a summer season, when the sun was soft_ ,
I shoop me into shroudes as I a sheep were,
_I dressed myself as if I were a shepherd_
In habite as an heremite unholy of werkes;
_In the outfit of a hermit, unholy in deeds_ ;
Wente wide in this world wondres to here.
_I went widely through this world to hear marvels._
Ac on a May morwenynge on Malverne hilles
_But on a May morning in the Malvern Hilles_
Me bifel a ferly, of fairye me thoghte.
_I had a vision; it seemed to be otherworldly._
In another contemporary text by an anonymous author, alliterative verse is also used. This text is the 2,530-line, four-part Arthurian romance, _Sir Gawain and the Green Knight_ , which survives uniquely in London, British Library, Cotton Nero A. x. It was probably written for the household of a noble person somewhere in the northwest of England towards the end of the 14th century, and it is one of the most compelling and action-packed poems of any period. The form of this poem, while alliterative, is designed around a stanza, which ends with a short bob and a four-line wheel; the bob generally contains matter of great significance. What is also notable about _Sir Gawain_ and the three poems in the same manuscript ( _Patience, Cleanness_ , and _Pearl_ ) is how different its dialect is from _Piers Plowman_ or from Chaucer's English; this is partly due to a much higher percentage of the vocabulary in _Sir Gawain_ being of Scandinavian, or Old Norse, origin. This makes it, on an initial reading, quite difficult to access now, since a great deal of the vocabulary has died out. Lines 134–40 in Fitt (Part) 1 begin with the quietening down of Arthur's court at Camelot as the New Year celebratory feast is served. As the knights and their ladies eat their meal, there is a sudden interruption:
For uneþe watz þe noyce not a whyle sesed,
_For hardly had the noise been ceased a moment_ ,
And þe fyrst cource in þe court kyndely served,
_And the first course of the meal in the court politely served,_
Þer hales in at þe halle dor an aghlich mayster,
_When there rushes in at the hall door a fearsome lord,_
On þe most on þe molde on mesure hyghe;
_One of the biggest on the earth in measure of height;_
Fro þe swyre to þe swange so sware and so þik,
_From the neck to the middle so sturdy and thick-set_
And his lyndes and his lymes so longe and so grete,
_And his loins and his limbs so long and so great_
Half-etayn in erde I hope þat he were.
_That half-giant on earth I believed that he could be._
Not only is this half-giant terrifyingly huge, fearsome, and impolite in breaking into the feast, but, as the poem's audience quickly learns, he is also green from head to toe and he is riding a green horse. The poem's focus on identity is more than literary here: who belongs to the world of the human and who does not? How does a community deal with antagonistic interlopers? What happens when the ethics and the _mores_ of an entire system like the chivalric code with its courtly ideals cannot be maintained? This poem, like many others in the languages of later medieval Britain and Ireland, seeks through entertainment and instruction to address these key social and cultural questions.
# Chapter 4
# Individual and community
# Collective ideals
In _Sir Gawain and the Green Knight_ and _Piers Plowman_ , contemporary late 14th-century poems that are widely studied still, the poets examine how the individual represents and espouses the values of their society. _Sir Gawain_ is a great Arthurian romance derived, in part, from Celtic and French literary tradition and English originary myth claiming the foundation of Britain through Brutus, whose ancestor was Aeneas. Gawain represents the court of King Arthur in his arduous solo quest to find the Green Knight. His shield, painted with a pentangle and an image of the Virgin Mary, reminds Gawain and the poem's audience of the significance of the chivalric values of 'fraunchyse', 'felawschyp', 'cortaysye', 'pité', and 'clannes' ('generosity', 'fellowship', 'courtesy', 'piety', and 'cleanness' or 'purity'), and of a life lived while adhering resolutely to Christian virtues.
As the representative of the court of Arthur, it is Gawain's duty to uphold the whole community's value-system, and to reinforce it through his actions. Among the many foci of the poem is the issue of whether or not Gawain maintains his integrity, or, at least, whether his desire to save his own life by concealing a truth is sufficient to undo him as the epitome of the chivalric code. The poem demands the engagement and judicious response of an informed audience familiar with the courtly _mores_ under scrutiny; a demand that is also required of a 21st-century audience.
What _Sir Gawain and the Green Knight_ illustrates, too, is the poet's interest in the single, thinking man. Gawain's actions are certainly knightly; he defends King Arthur's honour when he comes forward in court to meet the challenge of an exchange of axe-blows offered by the Green Knight (the Beheading Game). He decapitates the Green Knight, who promptly (and both alarmingly and hilariously) picks up his head and rides out of court, reminding Gawain to find and meet him a year hence. Gawain sets out courageously on his quest for the Green Knight from whom he must receive an axe-stroke in return. But Gawain's actions are not necessarily unflinchingly heroic as the story unfolds. He stays at a castle, hosted by a knight, Bertilak (whose magical alter ego is the Green Knight), and we are shown something of Gawain's fallibility when he seeks to protect his life by keeping a girdle with supposed magical powers given to him by the wife of his host. As the Green Knight gets ready to bring down the axe on the neck of the kneeling Gawain, the poet reveals the absolute humanness of the knight:
Bot Gawayn on þat giserne glyfte hym bysyde
_But Gawain on that battle-axe glanced sideways_
As hit com glydande adoun on glode hym to schende,
_As it came gliding down in a flash to destroy him,_
And schranke a lytel with þe schulderes for þe scharp yrne.
_And shrank a little with his shoulders from the sharp steel._
The swiftness of this sequence (emphasized and supported by the alliterating syllables) reveals a knight in fear for his life, an insight into an individual response that is entirely understandable. Easy to empathize with, too, perhaps, is Gawain's shame when he is caught out and called a coward by the Green Knight, who knows that his wife gave Gawain the girdle. But this individual shame that Gawain feels is dismissed by Arthur's court when Gawain returns and tells his story, showing them the girdle—his 'token of untrawþe' ('token of infidelity') that he now wears permanently. His fellow courtiers see instead his courage and true virtue in taking on and surviving the challenge of the Green Knight and take it as an honour to the court and the ethos of the Round Table. They thus adopt the girdle as a token of their collective support for Gawain, recognizing in the valiant actions of the individual the renown of the community.
Many other medieval romances highlight the actions of individual knights working on behalf of their community through the solo quest. Anglo-Norman families in the later 12th and 13th centuries seemed particularly keen on stories that spoke to them of England as they sought to establish their new English heritage. The community depicted in some of these romances (like _Lai d'Haveloc_ or _Havelock the Dane_ and _Boeve_ or _Bevis of Hampton_ ) could be an entire kingdom. This is the case in the 13th-century Middle English poem _King Horn_ , adapted from a now-lost French poem, which must itself have been related to one of the best surviving insular French poems, the _Roman de Horn_ ( _Romance of Horn_ ), written around 1170 by a certain Thomas.
Horn, as a king in search of vengeance for the death of his father and loss of his kingdom, travels overseas with his group of dedicated followers, a small band of trusted warriors who are similar to the Germanic Heroic _comitatus_ (lord's troop of warriors) from the earlier medieval period. He helps another king in battles against enemies, and falls in love with the king's daughter. To prove himself, Horn alone undertakes his exploits and hand-to-hand combat against treacherous opponents and giant antagonists, and after journeying from place to place, and rescuing his beloved from an enforced marriage, he regains his country, dividing all the spoils among his most faithful comrades. The poem represents an effective commingling of the epic—with its grand scale and geography of the text—and the romantic, with the love interest, and the themes of exile and return, loyalty and betrayal.
Horn is always instantly recognizable to those he encounters as a noble and heroic character, because he is beautiful; and the action of this poem is rapidly told, particularly in the English version where there is sparse detail and little character delineation. This early romance essentially demonstrates the ideal hero's resilient engagement with villainous enemies (such as the gigantic Saracens, typical villains in the French poetic 'songs of deeds', the c _hansons de geste_ ). In these narratives with the happy ending necessary in romance, virtue eventually defeats vice; nobility of character and courageous action is victorious over evil. Evil takes the form of the non-Christian in these romances, such that the aspirations of a religiously inspired Christian community are embodied in the pious efforts of the knight.
The 12th century, then, sees a very important literary-cultural shift from the Germanic Heroic demonstrations of lordly treasure-giving, absolute loyalty between lord and _comitatus_ , and public declarations and acts of bravery, to the more privately motivated individual quests of knights, who fight for their king, certainly, but also for the love of a lady. The audience were entertained and educated through these poems; their aspirations and desires are reflected in them, too. These romances' emphases on the knightly, the chivalric, and love are inspired predominantly by French literature—the songs and stories of the itinerant troubadour (southern French) or trouvère (northern) as they were adapted into longer narrative form.
One of the most famous continental romance writers was Chrétien de Troyes, a French trouvère, who was associated with the court of Marie de Champagne, the daughter of Eleanor of Aquitaine. Chrétien built on the fundamentally important Arthurian legend established earlier in the 12th century by Geoffrey of Monmouth. This was the first work to establish the legend of Arthur and to create the myth of the foundation of Britain by Brutus, descendant of Aeneas. Geoffrey of Monmouth's work was adapted into French by the Plantagenet court poet Wace in the 1150s. It was Wace who introduced the Round Table into the narrative.
Geoffrey of Monmouth and Wace, among others, initiated the immensely significant literary tradition of the Arthurian tale that was taken up by Chrétien around the 1170s, when his highly influential cycle included _Yvain, Perceval, Lancelot_ , and _Eric and Enide_. These Arthurian romances appeared to have particular purchase in royal courtly circles in France and England at first, but the genre of romance more generally became highly popular in the context of noble families. These families included regional baronial households, the homes of nobles, and, increasingly, the homes of wealthy professionals within the context of rapidly developing urbanization. Any one or more of these audiences might have been happy to receive the early 13th-century version of Arthur's story written in English by Layamon, and included in his adventure-packed alliterative poem, the _Brut_.
# On proper conduct
Some of the Welsh prose texts regarded as part of the collection known as the _Mabinogi_ (or _Mabinogion_ , as their 19th-century editor, Charlotte Guest, called them) share at least a common source with Chretien de Troyes's work. In the Welsh tradition, the _Three Romances_ ( _Y Tair Rhamant_ )— _Owain, Peredur_ , and _Geraint and Enid_ —are a subset of the group of eleven stories that nowadays form the _Mabinogi_ , datable to the later 11th and 12th centuries. Single stories exist in six different manuscripts or fragments of manuscripts, the earliest of which is from the second half of the 13th century; that is, much later than the probable dates of the prose works' original, oral compositions. These anonymous narratives have different authors, and they relate legends about Welsh kings and princes and their families, who must deal with various opponents and troubles, some involving magic and the otherworld.
The lively and sometimes complicated plots instruct the audience in patience, perseverance, and self-reliance. Some of them, such as the Four Branches, focus on a variety of protagonists from Wales, England, and Ireland, with legendary and mythical elements that are ancient, told and retold by the keepers of stories, the _cyfarwyddyd._ One character—Pryderi—appears in all Four Branches. In the first branch, he is the son born to Pwyll, lord of Dyfed, and Rhiannon, the 'Great Queen'. Pryderi disappears on the night of his birth, and is found and brought up by others, only to be restored in adulthood to his parents, his mother having been accused of murder at his disappearance. In the second branch, he is one of the warriors who survives conflict between the British and the Irish kings, Bran and Matholwch. In the third, Pryderi and his mother fight a sequence of enchantments, overcoming all manner of obstacles; and in the fourth branch, Pryderi dies in a war between Welsh kingdoms. He seems to have been, perhaps like Arthur himself, an early Welsh hero, who makes appearances in texts other than the _Mabinogi_ , such as the _Book of Taliesin_ , and the _Spoils of Annwn_.
The catalogue poem _Englynion y Beddau_ ( _Verses of the Graves_ ) lists where Wales's great heroes are buried and one of them is Pryderi. It is contained in the mid-13th-century _Llyfr Du Caerfyrddin_ ( _Black Book of Carmarthen_ , digitized in full as Aberystwyth, National Library of Wales, Peniarth 1). Arthur also appears among this group of Welsh warrior elite, along with Pryderi, King of Dyfed, and Gwallwg, an early Welsh warrior, nephew of Caradwc:
En Aber Gwenoli y mae bet Pryderi
_At Aber Gwenoli is the grave of Pryderi_
yny terev tonnev tir:
_where the waves beat against the land;_
yg Karrauc bet Gwallauc Hir.
_at Carrawg is the grave of Gwallawg Hir._
Perhaps this list of the 'graves of the great' functions more poignantly than a lengthy romance narrative? The grave ties the legendary hero to the land and makes the legend real: an embodiment of ancient steadfastness and courage that can be visited and marked. The _Verses of the Graves_ , with its long list of short _englynion_ , operates as a kind of incantation to call up collective memories; a piling up of the splendour of the dead who rest, remembered, among the living. The single scribe of Peniarth 1, who may have been an Augustinian canon at Carmarthen in south Wales, seems to have worked on this manuscript for years, himself piling up texts that served to please and instruct and tell histories. As a canon writing such an overwhelmingly legible manuscript it might have been his intention to read the anthology aloud to edify a local Welsh-speaking population and to inspire them communally with the knowledge of heroes, at a time when those people were most in need of a sense of their country's historical glories.
# Building a communion
Canons, monks, and secular clergy in the medieval period were duty-bound by their Christian mission to create social stability and unity through the preaching of God's word. Gospels, sermons, saints' lives, and other religious books, like Confessionals and Penitentials, exist in abundance. In the Anglo-Saxon period, Old English sermons form the largest generic corpus of vernacular material that survives. Similarly, saints' lives were written, translated, and copied throughout the period. Far from being a dull read, saints' lives can be closely allied with romance, because both genres share particular features in common, including the hero (or heroine) who resists all forms of torment in a quest to stay resolutely on God's side. Indeed, in a very popular romance like _Gui de Warewic_ ( _Guy of Warwick_ ), or others like _Octavian_ or _The King of Tars_ , significant elements of the saint's life (or the hagiographic) inform aspects of the plot and characterization, including the Christian hero's long-suffering, his pious spirituality, and his devotional acts alongside his valiant deeds. The wide dissemination of these romances suggests a broad audience for the saintly hero.
Whereas a great many medieval poems tend to be anonymously composed, with sermons and saints' lives a good number of authors are known, including Rhygyfarch ap Sulien, a Welsh cleric at Llanbadarn Fawr in the later 11th century, who wrote a Latin _Life of St David_ ; William of Malmesbury, the prodigious 12th-century monk and historiographer, who translated an English _Life of St Wulfstan_ into Latin (among many other works); and Clemence of Barking, a female hagiographer, who wrote the octosyllabic verse _Vie de Sainte Catherine_ , a French life of St Catherine of Alexandria, in the late 12th century. The hagiographic genre had very great appeal in all the languages of the Middle Ages. In English, Ælfric, Abbot of Eynsham (d. 1010), wrote a sequence of saints' lives in a form of vernacular alliterative prose for the entire church year; and a cycle of saints' lives, the _Golden Legend_ , composed in Latin by the Italian Jacobus de Voragine, became one of the most important works of devotion throughout later medieval Europe.
In the 15th century, the poet and friar Osbern Bokenham (d. _c_.1464) wrote the _Legendys of Hooly Wummen_. It narrates thirteen narratives of female saints, some of which are written for specific patrons in the East Anglian area in which Bokenham lived and worked. These individual saints' lives, written to inspire devotion, include the most beloved holy women: Margaret, Katherine, Agnes, Lucy, Anne, Dorothy, and Cecilia. A number of these were legendary female virgin martyrs, executed in the period of the Roman persecutions of Christians in the 3rd or early 4th centuries. The lives tend to follow a similar pattern and can seem quite formulaic; thus, the saints are beautiful young Christians desired by older heathen men, who torture the women to try and break their will, only to fail as the women are protected by God. The persecutors resort to extreme brutality, and usually decapitation of the saint. The saint performs miracles throughout her ordeal and posthumously.
It is fascinating to know that these saints' lives were required reading matter for aristocratic young women and these hagiographies were also regularly read out at the appropriate saint's festival in the church year. A saint like Margaret, who was imprisoned by her torturer, and supposedly swallowed by a dragon sent by the Devil, became the patron saint of women in childbirth, presumably because she burst, unharmed, out of the dragon's stomach when she made the sign of the cross. Quite how medieval women were supposed to live up to the high standards of resolve and fortitude exemplified by these (often fictional) saints is an interesting question; the fact that these lives were loved by readers in this period suggests a desire to witness and participate in stories that illustrated courage and resilience through suffering, and always ended happily (as in romance, indeed) with heavenly repatriation.
There is no doubt that women were significant consumers of female saints' lives. Evidence exists in a variety of forms: in the collections of work specifically for female audiences, such as the English _Katherine-Group_ of Lives of Katherine, Margaret, and Juliana. These were associated with female communities of anchoresses (religious women who undertook a life of isolated contemplation of God) in the West Midlands at the beginning of the 13th century. In Chaucer's writings, too, it is clear that women and hagiography were closely associated; in the _Canterbury Tales_ , the Second Nun tells a standard hagiography of St Cecilia's suffering and salvation; and in _Troilus and Criseyde_ , Criseyde glibly says she should be reading holy saints' lives.
Large collections of saints' lives, like the multi-manuscript cycle the _South English Legendary_ , written by multiple authors in the late 13th and 14th centuries, had a major impact, suggesting that knowing about the lives of sanctified individuals contributed considerably to a communal ideal of religious devotion. Local saints' lives were composed, too, promoting institutions and bringing in visitors from all over a region in veneration of the saint; thus, a number of hagiographies and references to Irish saints, such as Brigid, Patrick, and Molaise, occur in the 15th-century Irish _Book of Lismore_ ( _Leabhar Mhic Cárthaigh Riabhaigh_ ), for example. These books themselves suggest a devoted community of worshippers, and attempts to build a sense of shared history and common heritage through text.
# From communion to community
The symbiotic relationship between the individual and the community both within a text and as a result of textual remembrance is of great importance, particularly in a period where personal literacy—the ability to pick up a text and read it oneself—was a scarce skill. Public Christian communities took many forms from boisterous church congregations to small groups of attentive devotees.
The _Ancrene Wisse_ , or _Ancrene Riwle_ , is a _Guide for Anchoresses_ associated with the _Katherine Group_ of saints' lives, and another text on virginity called _Hali Meiðhad_ ( _Holy Maidenhood_ ). The _Ancrene Wisse_ was written by a male religious author to assist three aristocratic women in their avowed lives as contemplatives, shut up in a cell-like room attached to a church with a squint to allow them to peer into the church and participate remotely in the community. Such medieval anchor-holds are still to be seen adjacent to churches such as Skipton, in Yorkshire.
The _Ancrene Wisse_ , composed _c_.1225, was remarkably popular and survives in English in eleven manuscript versions, as well as in four translations into French and four into Latin, and it was also adapted for male anchorites and for larger groups of religious solitaries. It exemplifies rather well the ways in which the individual functioned as part of a larger community, while, to an extent, being cut off from that community. The author creates the _Guide_ to instruct the anchoresses in how they should live both their outer, bodily lives and their inner, spiritual lives. They are advised about what they should wear: 'wel mei don of ower clað beo hit hwit, beo hit blac, bute hit beo unorne' ('it matters not whether your clothes are white or black, except that they are plain'); that they should not have jewellery; and that they can keep no animals, except a cat. The writer advises that they should build their own small textual community by reading to the women serving the needs of the anchoress: 'ƺe ancres ahen þis leaste stucche reden to ower wummen euche wike eanes aþet ha hit cunnen' ('You anchoresses ought to read this last section [on the Outer Rule] to your women once each week until they know it'). In teaching the _Guide_ , the adviser points out, the anchoress will be sure to learn it and keep it devoutly herself.
This public display, intended to teach, inspire, and encourage the adherence to a faithful Christian life, also motivates the most communal of literature: drama. Dramatic performances of moments from the Christian story had long been part of the liturgy or church service, but in the later Middle Ages organized dramas became an established part of urban and village life. In particular cases, these were put on by the laity for the laity (often Guildsmen of the town were responsible for specific parts), and centred on the life and events of Christ, or the exemplary Christian.
Two plays survive from medieval Dublin in Ireland: _The Play of the Sacrament_ , and the earlier 15th-century English morality play _The Pride of Life_. In England, the York Cycle of mystery plays, which are now performed every four years, emerged in the later 14th century as a sequence of dramatic pageants on wagons performed through the city, on or around the day of the procession on the Corpus Christi feast. These wagons were each sponsored by one of the craft guilds to perform the highlights of the Christian story from the Creation to the Nativity, to the Crucifixion, to the Last Judgement. The wagons would be driven around the town, stopping to perform the pageant at a particular station in sequence lasting all day and into the night.
Other towns—notably Chester, Coventry, and Wakefield—also have surviving dramatic cycle texts, among the most studied being the _Second Shepherd's Play_ , written by the Wakefield Master, and contained within the Towneley manuscript along with the other thirty-one relatively brief Wakefield plays. There are moments of absolute comedy in this play, as there are in many others, for comedy compels attention and instructs without seeming to. Yet other cycle plays survive from East Anglian centres, where the dramas were generally performed on open-air stages, rather than wagons. Further plays exist that are less about biblical events and salvation history, and more about morality, where characters represent types, or the whole of humanity, such as Humankind in _The Castle of Perserverance_ , a morality play from the early 15th century.
Three mystery plays in a Cornish trilogy, the _Ordinalia_ , focus on the Origin of the World, the Passion of Christ, and the Resurrection of the Lord ( _Ordinale de origine mundi, Passio Domini Nostri Jhesu Christi_ , and _Ordinale de Resurrexione Domini_ ) (see Box 7). These survive in three manuscript versions, the earliest of which is Oxford, Bodleian Library, Bodley 791. Performed over three days, these plays urged an audience to understand the basic episodes in the Christian tradition by showing the events to assembled individuals in a large public space. Through humour and fast-paced dialogue, the plays provide huge entertainment as well as core salvific instruction.
This trilogy was written down in the later 14th century, and while it is composed predominantly in Middle Cornish, there are also bits and pieces of Latin, English, and French. Linking all three parts of the _Ordinalia_ is the story of the Holy Rood, the tree upon which Christ was crucified. Legend has it this tree grew from a seed that came from the Tree of the Knowledge of Good and Evil in the Garden of Eden. The seed was buried with Adam and grew into a tree itself—the same tree that was subsequently brought to the Temple of Solomon, and thereafter used to crucify Christ.
# Box 7 Cornish literature
Very little literary evidence exists from medieval Cornwall before the 12th century. A rare survival is the Bodmin Gospels, a manuscript dated to the later 9th century and possibly made in Brittany, but owned by St Petroc's in Cornwall. The book was used to record the manumitting ceremony freeing slaves and it contains names and vocabulary that attest to written Cornish in this early period.
It is many hundreds of years more before substantial Cornish literary texts survive in written form. Three such manuscripts contain a sequence known as the Cornish _Ordinalia_ —three mystery plays performed outdoors from the 14th century. The existence of these few remarkable works suggests that there was a lively religious poetic and dramatic tradition in Cornwall. And just as remarkably, only a few years ago, a substantial Cornish saint's life with its part-Arthurian narrative was discovered in a 16th-century manuscript bequeathed to the National Library of Wales: NLW MS 23849D. The Middle Cornish _Beunans Ke_ ( _The Life of St Ke_ ) tells the story of Saint Kea who mediated between King Arthur and Mordred, reminding readers of the significance of the Arthurian legend to Celtic literary history.
In Cornish, too, is the rare survival of a saint's life written as a drama: that of St Meriasek, a Breton saint. _Beunans Meriasek_ is contained in an early 16th-century paper manuscript (Aberystwyth, National Library of Wales, Peniarth 105B (see Figure 4)), and tells the story of the saint's life, miraculous abilities, and death, as bishop of Vannes. As is the case with the _Ordinalia_ , the framework of the drama—the rubrics and directions for the performers—is cast multilingually, using Latin and English, as well as Cornish, suggesting a mixed community of players were accessing this text.
4. _Beunans Meriasek_ , the Cornish drama _The Life of St Meriasek_ , Aberystwyth, National Library of Wales, Peniarth 105B, folio 5r.
# Chapter 5
# The mighty and the monstrous
# Order and chaos
In medieval societies, religious and secular literature built communities by encouraging and persuading individuals to behave in certain ways, to absorb particular sets of knowledge, and to emulate similar ideals. There is more to it than this, but prescriptive and proscriptive texts exist in all surviving records from the earliest centuries. Some texts are explicitly proscriptive; sermons and a good deal of religious material could be thought of as exhorting against impious and amoral thoughts, words, and deeds in no uncertain terms; and simply forbidding actions that were thought to encourage waywardness, witchcraft, and the abandonment of societally acceptable norms. Other texts, though, like the dynamic and engaging drama that emerged in the 14th and 15th centuries, could proscribe by demonstrating the consequence of evil personified, or by creating visually and aurally repellent enactments of dreadful deeds. Those who maintained control—the church, the elite, local government—persistently sought to maintain order and deter disruptive, immoral, or anti-social behaviour.
Order comes from the delineation of propriety, the regulation of society, the measuring and marking of territory, and the acknowledgement by the majority of what is acceptable. For early British and Irish people, this would be reflected in settlements being established and borders being respected and remembered. Christian processions at Rogationtide walked along the boundaries of the local parish (and 'beating the bounds' still happens in some townships like Laugharne in south Wales); legal charters written in Latin often included clauses describing in great detail the landmarks that denoted the perimeter of the land being granted.
Burghs, villages, towns, cities, and countries followed laws, whether familial, tribal, local, regional, or national. What lay on the other side of the boundary of these laws resulted in 'outlaws', those who lived beyond order, beyond the familiar, beyond the known. In places inhabited by outlaws, or areas that were unmapped and uninhabited, there lay the dangers of the unknown and people, or things, or spaces that were out of control. As the centuries have progressed, those unknown regions have become further and further removed as exploration reveals much of the world; but still, deep sea, darkest forest, and outer space itself remain marginal, unquantifiable, and potentially (in films, on television, in fiction) filled with monstrosities and imminent disaster.
For the medieval world, the unknown, and thus the potentially monstrous, was closer to home. Without streetlights, without clearly demarcated and deforested landscape, there was a genuine darkness at night that is often difficult to emulate now. It was so much easier to get lost on journeys when there were no compasses, no signs, and sometimes no clear roads to follow. So, the spaces that were safe were inside walls, fences, houses, societies, whereas wilder, uncultivated landscape threatened. In _Sir Gawain and the Green Knight_ , when Gawain makes his way to meet the Green Knight, he leaves the warmth of Camelot and enters a forest only to be challenged by countless monsters and wild creatures.
The shadowy land in between places of civilized order presents wonderful opportunities for authors' imaginations. In the Anglo-Saxon literary tradition, many texts can be singled out for attention, including the earliest English romance, _Apollonius of Tyre_ (in Cambridge, Corpus Christi College, 201, datable to about 1050), which problematizes monstrosity by having as its primary antagonist someone who should be the epitome of order and rule: a king, Antiochus. He commits incest with his daughter and then kills successive noblemen to cover his tracks, and by so doing, he provides an excellent foil to the hero of the prose tale—Apollonius.
As with many romances, the plot is complex, driven by motifs of exile and return, loyalty and treachery, love and vengeance. This same classical narrative provided the source for Shakespeare's _Pericles_ , but was also treated by John Gower—Chaucer's contemporary and friend—an exceptionally talented author, who wrote in Latin, French, and English. Gower included the story in his major English poem, the _Confessio amantis_ ( _The Lover's Confession_ ), a consolatory work comprised of a sequence of verse tales, dated to 1390. In the _Confessio_ , Antiochus in Apollonius of Tyre is used to exemplify the dangers of lechery. The audience is told that Antiochus' wife has died and:
His doghter, which was piereles
_His daughter, who was without comparison_
Of beauté, duelte aboute him stille;
_In beauty, dwelled with him still;_
Bot whanne a man hath welthe at wille,
_But when a man has wealth in abundance,_
The fleissh is frele and falleth ofte.
_The flesh is frail and fails often._
And that this maide, tendre and softe,
_And so this maiden, tender and soft,_
Which in hire fadres chambres duelte,
_Who dwelled in her father's chambers,_
Withinne a time wiste and felte
_Soon knew and experienced_
For likinge and concupiscence,
_Because of desire and physical lust,_
Withoute insihte of conscience,
_Without insight from conscience,_
The fader so with lustes blente,
_The father, so blinded with lust,_
That he caste al his hole entente
_That he set his entire intent_
His oghne doghter for to spille.
_Upon the rape of his own daughter._
There are multiple levels of horror and monstrosity in Gower's depiction of Antiochus, which, line by line, seems to explain the premeditation of his depravity, building up rationalizing of the awful deed and his ghastly intention ('I'm a king and I can have anything; my flesh is weak; she's so beautiful; I really want her; I can have what I want'). 'Conscience', which should guide him, is absent; intellectual insight and spiritual sight are lacking, so that he is simply, but horribly, driven by bodily urges to rape his _own_ daughter.
The repulsive actions of Antiochus and his inability to curb his overwhelming physical desires highlight one of the key aspects of monstrosity for medieval writers. In sermons throughout the centuries, preachers railed against permitting the seven (sometimes eight) deadly sins to take hold. Wrath, Lechery, Gluttony, Envy, Avarice, Sloth, and Pride feature in countless tracts, didactic poems, plays, and saints' lives. In many depictions and lists, Pride heads the sins; in others, it is Gluttony. Indeed, a list put together by the early theologian Isidore of Seville outlines whole nations' associations with particular sins: _Ira brittorum, stultitia saxonum, libido scottorum, crudelitas pictorum_ ('the anger of the Britons; the foolishness of the Saxons; the lust of the Scots [the _Scotti_ are the Irish]; the inhumanity of the Picts').
Asserting the monstrosity of whole races was (and is) one way in which colonizers, or proponents of particular dominant religious beliefs, seek to oppress or control others. William of Malmesbury, probably the finest 12th-century historiographer, in his explication of the Norman divine right to rule through conquest, reviles the English for their drunkenness with its attendant witlessness and loss of national status. In his great Latin _Deeds of the Kings of the English_ , the _Gesta regum Anglorum_ , which he finished in 1125, he writes in Book 1 that for the English: 'Drinking communally was done by all, and in this habit they made no distinction between night and day... There followed the vices that accompany drunkenness... eating food that encouraged intoxication and drinking until they caused themselves to throw up.' For Malmesbury, it was the Normans' ability to control themselves that distinguished them from the conquered, sinful English, though he laments, too, the loss of the Anglo-Saxon realm to the Normans.
# Size matters
Excess and lack of control, lack of _order_ in one's own demeanour, created a major form of monstrosity from within society, roundly condemned by authorities, particularly those in the church and particularly those who sought to regulate. In medieval romance, the monstrous outsider was often depicted as a 'Saracen', a universalized type of opponent, instigated by the Christian Crusades against the Muslims for control of the Holy Land in the eastern Mediterranean. These campaigns, beginning in 1096 and lasting all the way into the 15th century, became a major subject of European romance literature, many narratives featuring knightly battles against monstrous Saracens. Through these depictions of ideal knightly heroism, white European crusaders were given models for ostensible right behaviour, and spiritual encouragement for their religious wars.
The oldest surviving version of a _chanson de geste_ ('song of heroic deeds') is the 12th-century French _La Chanson de Roland, The Song of Roland_ (Oxford, Bodleian Library, Digby 23). In this poem, after Charlemagne's army has been engaged in battle against the Saracen in Spain, Roland, the hero of the story, is ambushed by Saracens, and boldly fights to his death, but not before he has blown his ivory horn (the _Olifant_ ) to summon Charlemagne to take revenge. While many of the Saracen enemy are depicted as worthy opponents—noble and beautiful, though damned—others, like Falsaron in _laisse_ 94, brother to the Muslim king, Marsilla, are gigantic, monstrous:
Suz cel nen at plus encrisme felun;
_There is no more hardened felon on earth;_
Entre les dous oilz mult out large le front,
_Between his two eyes was a very large space,_
Grant demi pied mesurer i pout hom.
_It measures at least a half-foot._
While Falsaron's heathenness is a focus for the poet, the evidence provided for his being a 'hardened felon' is his size, emphasized by the single lingering detail (synecdoche) of the enormous gap between his eyes. The implication is that if the gap between his eyes is six inches, then how big is the rest of him? He looms vast and monstrous into the text.
Later medieval romances in English, French, Welsh, and their multiple reflexes, continue the theme of the Saracen enemy who is overcome by the Christian hero. In texts such as the _Romance of Horn, Guy of Warwick, Richard Coeur de Lion, Otuel, The Sultan of Babylon_ , and _Beues of Hampton_ , the gigantic Saracen is a type, delineated by his monstrous appearance or his skin colour, manifesting, in these good versus evil formulae, inner debility and sinfulness. The Christian protagonist is usually able to demonstrate his overwhelming superiority in a display of combat and virtuous speech that is lauded by the poet. In this way, literary texts contributed to a systematic derogation of the exoticized enemy, bolstering the social and cultural ideals and efforts promoted by European kings, aristocracy, prelates, and popes for centuries. The formulaic nature of this scene though could also, effectively, be appropriated symbolically for the denigration and attempted conquest of any enemy.
Earlier texts explored the nature of monstrosity with startling effect, too, and none more so than the epic Anglo-Saxon poem _Beowulf_. In this poem, the eponymous hero, and greatest of all warriors, Beowulf, arrives at Heorot, the hall of the Danish king, Hroðgar. He comes to help Hroðgar defeat the monster, Grendel, who has attacked and killed Danish warriors for the previous twelve years. Grendel is a complex monster, not least because he is eternally damned through a direct relationship with Cain, the first murderer in the Bible. We are told that Grendel 'carried God's wrath' (' _Godes yrre bær_ ') suggesting, ambiguously, that Grendel is the carrier of God's wrath against the very people he attacks, and/or that God is angry with Grendel. He is also depicted as an outsider, haunting the moors, excluded from the joys of the warriors' hall. This may not have elicited a great deal of sympathy from Anglo-Saxon audiences sitting in a hall listening to the poem being recited, conscious of the absolute darkness just beyond the door. It does, though, problematize the nature of evil, the depiction of the monstrous. From a modern perspective, especially, some contemporary readers wonder whether, if monstrosity is innate and inherited, the monster is to blame for its actions? If the monster is permanently outcast, why would it not seek some kind of revenge?
The _Beowulf_ -poet creates in Grendel one of the all-time most spectacular monsters. He is a monster about whom we know very specific details, released gradually in the course of the long poem. We learn that he has the name Grendel (who named him?); that he is a fiend from hell ('feond on helle'); that he is man-shaped; that he attacks at night; we know he is an 'āglǽca' ('a monster', or, confusingly 'a hero'). We learn from Beowulf's first speech at Heorot that Grendel is a 'fierce monster' who eschews weapons and that:
byreð blodig wæl, byrgean þenceð,
_[Grendel] will carry off the bloody corpse, intending to taste it,_
eteð angenga unmurnlice
_the one who goes alone will eat without remorse_
Grendel is solitary, it seems, and cannibalistic and huge, carrying off thirty warriors in the first attack, years ago. In Grendel's attack on Heorot, where Beowulf now lies waiting, additional details are offered that heighten the terror: Grendel breaks off the door of the hall at the lightest touch; he feels immense rage intending to kill all the warriors in Beowulf's troop who are asleep; and from his eyes emanates 'ligge gelicost leoht unfæger' ('an ugly light, most like a flame').
Descriptive detail also continues _after_ the fight in Heorot, when Beowulf (himself somewhat monstrous as the strongest of men on earth) recounts his victory not once, but twice—to Hroðgar in the morning, and again to his uncle, King Hygelac, on his return to Geatland. This drip-feeding of detail is surely more frightening than receiving the full picture all at once. We are never quite sure what Grendel really looks like, which provides wonderful opportunities for the imagination—terror's most useful tool—to take over. And just in case we were minded to construct and dismiss him as an outright bedevilled demon, we are introduced to Grendel's mother the night after Beowulf's victory. She is nameless, but comes to seek vengeance for the death of her son, as she should according to the ethos of the Germanic Heroic code.
Elements of humanness and the supernatural, of demonic lineage and familial love combine to create these two troubling and unknowable monsters in _Beowulf_. A third monster—a fifty-foot fire-breathing treasure-hoarding dragon—that finally defeats Beowulf seems less problematic somehow. It might be, then, the proximity of the monstrous to the human that creates the most disruption to the status quo. This would be true geographically, as much as in terms of physical relatedness. The most successful aliens in modern science fiction, whether in books or films, are depicted as human-like with, perhaps, two legs, a body, and a head, and it is their encounters with humans that bring conflict and terror.
# Encountering and transforming
In taking the gamble of travelling into unmapped and potentially untamable spaces, the medieval explorer could not have known what he or she would encounter. From the classical period, at least, when Pliny discussed the strange and wonderful human races in India and Africa, numerous literary works survive that appear to provide orientation for the interested traveller, sharing some of the creatures they describe in common.
These works extend to maps like the glorious and enormous Hereford map of the world, the _Mappa mundi_ , the margins of which are filled with the unusual bodies of the peoples that one could hope (or fear) to meet. Audiences can see or hear about people-like races such as the headless Brixontes, whose eyes and mouth are in their chests; the Homodubii, who are humanlike from head to navel and like a donkey from the waist down. The traveller need not fear the Homodubii, because they run away if they see or hear anyone nearby. The Donestre are also part-human, part-animal, and can speak every language known to humankind (see Figure 5); with this linguistic aptitude, they lure the unwary traveller into their trap, and proceed to devour their prey, except for the head, over which the Donestre then weep. Monstrous women—Amazonians (like the race of women defeated by Theseus in Chaucer's _Knight's Tale_ )—have distorted bodies, and clearly threaten men with whom they come into contact.
Writers and artists lingered over the depiction of these curiosities. Whole, cogent tales were concocted to provide contexts that appeared truthful. The illustrated text called the _Marvels of the East_ in the _Beowulf_ -manuscript (Figure 5) lists the monsters that one might meet in the region of the Red Sea. An immensely popular narrative, the _Letter of Prester John_ , circulated widely in Europe; and in the second half of the 14th century, the French _Book of John Mandeville_ appeared, translated into Middle English within decades, as well as Irish, Welsh, Latin, and many other languages. Cast as personal histories with a first-person, eyewitness narrator, these texts are predominantly fictional, but supply numerous geographic and factual elements. Rather like _Alexander to Aristotle_ in the _Beowulf_ manuscript, and the whole buoyant tradition of _Alexander_ -romances, real places, from Europe to India to Egypt, are juxtaposed with fantastical inhabitants to entertain, inform, and simultaneously misinform. They remind medieval audiences of the benefits of being in familiar places as well, contrarily, as whetting the appetite of the adventurous.
5. _Marvels of the East_ , London, British Library, Cotton Vitellius A. xv, folio 103 verso (the _Beowulf_ -manuscript Donestre monster).
Journeys in medieval literature almost always involved discovery. In the real journeys of Gerald of Wales through Wales and through Ireland, he encountered a wide range of people, stories, and curiosities that he was not able to explain. In the questing exploits of great heroes, such as the Arthurian knights, or heroes in nations' originary myths, inexplicable creatures and grotesque characters populate the landscape. In the early Irish Ulster Cycle's _Togail Bruidne Da Derga_ ( _The Destruction of the Hostel of Da Derga_ ), Cichuil is a monstrous woman, with enlarged genitals, whose one-eyed, one-footed, and one-handed husband is a swineherd, called Fer Caille. This couple is paralleled by Cymydei Cymeinfoll and Llasar Llaes Gyfnewid, who flee from Ireland to the Welsh court of King Bendigeidfran, carrying the Pair Dadeni (magic cauldron of rebirth), which they present as a gift. This narrative is part of the second branch _Mabinogi of Branwen_ , and the numbers of parallel motifs and characters show the close relationship between Irish and Welsh literature—the Celtic tradition.
There is no doubt that the magical or supernatural was thought of as potentially monstrous; elements of the otherworldly with its refusal to comply with the order and familiarity of the real world could also be regarded as threatening and portentous. Indeed, the Latin root of 'monster' is _monstrum_ , 'portent, warning, prodigy', and at its simplest and least threatening, the monstrous is someone or something _different_ from the norm. In the case of the 14th-century English poem _Sir Orfeo_ , the supernatural is very present in the shape of the Otherworld, which breaks into the natural order of the world of Orfeo and his wife, Heroudis. This poem is a Breton lay, a short form of romance, which typically contains elements of the magical and supernatural. It exists in three manuscripts, the earliest of which is Edinburgh, National Library of Scotland, Advocates 19. 2. 1, the Auchinleck Manuscript, dated to _c_.1330 (see Box 8).
This genre of Breton lay derives from the form developed by Marie de France in her late 12th-century French _Lais_ , and it may be that a lost French _Lay of Orfeo_ influenced the Middle English text. _Sir Orfeo_ brilliantly reveals the nature of medieval textual composition through adaptation and transformation. Its inspiration is the story of Orpheus and Eurydice from Ovid's _Metamorphoses_ , a myth that also appears in Boethius' _Consolation of Philosophy_ (translated in the 9th century by King Alfred and his scholars, and in the 14th by Geoffrey Chaucer), and in Walter Map's _De nugis curialium_. The _Liber monstrorum_ contains a reference to Orfeus; and, much later, in the 15th century, Robert Henryson (1460–1500), a Scottish _makar_ (a court poet, like the Welsh bards), also writes a verse poem, _Orpheus and Euridice_.
In the traditional Ovidian versions of the myth, which includes Henryson's retelling, Orpheus loses his wife Eurydice to the king of the Underworld, but he wins her back through his superlative harp-playing. However, on exiting the Underworld, he does what the king forbade him to—he looks back at his wife coming behind him—and he loses her forever. In _Sir Orfeo_ , Orfeo (now a king with his capital at Winchester) loses his wife to the malevolent Faery King with his Otherworld, which dystopically parallels Orfeo's own kingdom and castle. Orfeo abandons everything and lives as a penitent in the forest with only his harp to remind him of happier days. He sees his wife with the Faeries and follows them back to the Otherworld, where he wins her back by playing his harp. In this story, Eurydice and Orfeo both make it back to Winchester and they resume their life happily after the ten-year hiatus.
# Box 8 Scottish literature
Scotland has long been a nexus for significant cross-cultural exchange. Originally inhabited by the Picts in the north, in the 5th century, the Scotti (or Gaels), an eastern Irish tribe, settled in the west of Scotland. From the later 8th century, Scandinavian immigration was important; and the influence of the Anglo-Saxons and, subsequently, the French, all played major roles in Scottish culture and literature. Apart from place-names and some Pictish inscriptions, early literature includes the Latin _Life of St Columba_ , the Irish saint who founded Iona in 563, whose _Life_ was written by Adomnán in the 7th century. Scottish poets also travelled to Ireland to work for royal and ecclesiastical patrons; and early Welsh poetry is also intertwined in the long history of Celtic literature across the British Isles.
This complex network of languages and influences is seen in the 16th-century Book of the Dean of Lismore, a manuscript containing works written in Scots Gaelic, as well as Middle Scots, and Latin. This reflects the vibrant literary culture of Scotland from the 14th century onwards, when English, French, and Latin literature was written and performed in Scotland, beginning, most notably with John Barbour's Middle Scots _Brus_. The 15th century witnessed the emergence of the _makars_ , a significant group of court poets writing in English, such as Dunbar and Henryson, whose corpora of work are highly renowned.
This sophisticated, evocative, and engaging poem of just 604 lines intertwines classical myth with contemporary courtly references, a 14th-century setting, and Celtic traditions and superstitions involving Faeries. Influencing the composition of _Sir Orfeo_ , as with the medieval _Tristan_ stories, are the Irish narratives of the _aithed_ , the 'abducted, the taken', where humans were stolen by the Faeries to be left in a sort of limbo state. The depiction of these bodies, lying around the walls of the castle, is monstrous indeed. In _Sir Orfeo_ , Orfeo gazes on all manner of people who had been brought to the Otherworld, and who 'seemed dead and yet were not': the headless body; some bodies without arms; some horribly wounded; some bound up in madness; some still armed and sitting on their horses; some strangled while feasting; some drowned; some burnt; some insane; women in the midst of childbirth; and then his own wife, in a still-life, taken as she slept under a magically grafted tree. This is a scene akin to the depictions of the Temples in Chaucer's _Knight's Tale_ , where violent images dominate; but here in _Sir Orfeo_ , it suggests that behind the most glittering environment, and the most courteous etiquette, lies the monstrous in a continuous backdrop to life's fragile joys.
The rapid transformation of the happy human to this seemingly permanent state of neither one thing nor the other is also, perhaps, its own kind of monstrous event. And within this definition of the monstrous or supernatural we might consider the werewolf, Bisclavret, who, in his human form, is a noble Breton baron in Marie de France's late 12th-century _lai_ of that name; and Merlin, the wizard, who is able to transform himself into a variety of guises in the contemporary _Estoire de Merlin_ ; and other shape-shifters, like the devil who disguises himself as a duke in order to impregnate the mother of Sir Gowther in the 15th-century tail-rhyme poem _Sir Gowther_ ; as well as Bertilak, the nobleman who hosts Sir Gawain, and then transforms into the Green Knight; and, finally, there is the old hag in Chaucer's _Wife of Bath's Tale_ (another Breton lay), who magically becomes a beautiful young woman to please her new husband, forced into marriage with her.
The monstrous takes many forms, including forms with no defined shape, or a mysteriously changeable shape, or a shape that is strange and extraordinary, like the arguing birds in the lively 13th-century avian debate, _The Owl and the Nightingale_. The monstrous—like St Christopher or Bisclavret—need not be demonic. There is a more common tendency, though, especially within a Christian context, for that which is not beautiful to be considered inwardly corrupt and thus outwardly monstrous. In effect, the monstrous becomes, in the hands of Christian ideologues, a tool for suppression; and in the hands of the literature of entertainment, a mechanism for exciting curiosity, but also, conversely, instructing audiences that it's sometimes preferable to want to stay among the people one knows.
# Chapter 6
# Love and longing
# From elegiac to lyric
In the earliest years of the medieval period, a predominantly warrior society was gradually Christianized; heroic and religious verse was composed alongside didactic, encyclopedic, legal, and historical prose and poetry; and the formation of community was paramount. We hear the voices of individuals only rarely, and most commonly then in the elegiac mode, where the major themes are loss, sorrow, and resignation. This is not the classical elegy with its strict metre, but rather a genre with grief at its heart. In the Welsh 9th-century Heledd cycle, for example, Heledd laments the loss of her beloved brother, Cynddylan, focusing on the shrieking eagle flying high above the battleground, looking for his corpse-flesh:
Eryr Pengwern penngarn llwyt, heno
_Eagle of Pengwern, grey-crested, tonight_
aruchel y atleis,
_its shriek is high,_
eidic am gic a gereis.
_eager for flesh I loved._
Eryr Pengwern penngarn llwyt, heno
_Eagle of Pengwern, grey-crested, tonight_
aruchel y euan
_its call is high,_
eidic am gic Kynddylan.
_eager for for Cynddylan's flesh._
Eryr Pengwern penngarn llwyt, heno
_Eagle of Pengwern, grey-crested, tonight_
aruchel y adaf
_its claw is high,_
eidic am gic a garaf.
_eager for flesh I love._
Left alone to mourn the death of Cynddylan in battle against the English Mercians at Shrewsbury, the controlled sparseness and subtle repetition of the verse serve to emphasize Heledd's grief. The use of the motif of the eagle, a Beast of Battle eager for carrion that flies high and joyful while she is sunk low in mourning, is particularly striking. More typical of the medieval elegy (particularly those uttered by women in a Europe-wide literary tradition called _Frauenlieder_ , 'women's songs') is the collapse of time within the narrative of the poem, a collapse that might be said to typify grief and disbelief; here, this is noted only in the movement from the past tense in the first stanza to the present tense in the third stanza, so discreetly signalling the potential endlessness of her love and thus her infinite lament for Cynddylan.
Poems similar to this exist also in Old English, but spoken there by unknown women ( _The Wife's Lament, Wulf and Eadwacer_ ). In these two short poetic works, the contexts of loss are neither explicit nor retrievable, but the searing pain of apparently permanent isolation and anguish is lyrically intense and immediately understood. Other English elegies ( _The Wanderer, The Seafarer, The Ruin_ ) bemoan the loss of a lord or community, and highlight the transience of earthly life by using the _Ubi sunt?_ ('Where are they?') motif: 'Where has the horse gone? Where has the man gone? Where have the treasure-givers gone?' asks the Wanderer, as he moves through a temporal world bereft of all that he has loved.
It is apparent from reading these short poems written down in the 10th century, as well as other texts, that the Anglo-Saxons were thoroughly equipped to write movingly and evocatively using the first person 'I'. However, it is sometimes stated by scholars that 'love', subjectivity, and the concept of individuality are not evident in this earlier literature, which, to a greater or lesser extent, can also be regarded as reflecting the culture that produced it. What creates this response is the contrast between the heroic subject matter of these earlier texts and the romantic focus of many works that are created in the post-Conquest period, after about 1100.
The lyrical voice, it is said, emerges in British and Irish writings with the invention of what is _labelled_ the 'lyric', a short poetic form that spread from France throughout Europe in the 12th century. Its main theme was specifically romantic love. The chivalric code replaced the heroic; the courtly replaced the _comitatus_ ; the lyrical voice took on a life of its own. The lyric might best be described in the words of the 19th-century intellectual John Ruskin as 'the expression by the poet of his own feelings'.
The origin both of the term 'lyric' and its method of composition lies in music; these short poems with a subject-speaker uttering his or her own thoughts and emotions would originally be accompanied by the harp or the lyre. The French itinerant trouvères and troubadours who sought patronage for their compositions not only produced _chansons de geste_ and other forms of romance, but also shorter lyrics.
So popular was the form that many hundreds of lyrics survive from throughout the British Isles in all the major languages. These can be categorized broadly as secular; religious—that is, devotional, penitential, moral; and political and satirical. There are multiple varieties of lyric, too, including the _carole_ (a joyful song or hymn, which might originally have been danced to), the _pastourelle_ (focusing on the countryside, the pastoral), the _reverdie_ (a song which celebrates the return of spring), and the _ballade_ (three verses each with the same one-line refrain). These new forms of romantic poetry focused on idealizing the service to, and love of, a lady, instead of depicting the love of a warrior for his lord, as with much of the secular poetry previously. Such romantic themes, vocabulary, and imagery could also be deployed effectively and affectively to describe an individual's absolute devotion to the Virgin Mary or Christ.
Lyrics could range widely in terms of subject matter and form. Some of the earliest in English are those of Godric of Finchale, a hermit, who composed three lyrical hymns that were included in his Latin biography by Reginald of Coldingham: the _Libellus de vita et miraculis Sancti Godrici, heremitae de Finchale_ ( _Book of the Life and Miracles of Saint Godric, hermit of Finchale_ ). One lyric was sung by Godric to St Nicholas; another was sung _to_ Godric by his deceased sister, Burgwine, when she appeared in a vision to reassure him of her salvation.
But lyrics, even ones about death, were not always so spiritually expressed. The late 13th-century Cambridge, Trinity College B. 14. 39 is a collection of over forty works written in English, Latin, and French. It was probably written in western England for a multilingual individual to use in his or her devotions. The short and pithy _When the Turf is your Tower_ swiftly deals with life, reminding the reader-listener that this world's joys are worth nothing when we're dead:
Wen þe turuf is þi tuur,
_When the turf is your tower,_
And þi put is þi bour,
_And the grave is your bedroom_
Þi wel and þi wite þrote
_Your skin and your white throat_
Sculen wormes to note.
_Shall be good for the worms._
Wat helpit þe þenne
_What help for you then will be_
Al þe worilde wunne?
_All the world's joys?_
Here, the direct approach (directed to any reader, but particularly pertinent to an aristocratic woman, concerned about the beauty of her skin and white throat) rather brutally reminds everyone of the imminence and certainty of death. Indeed, many lyrics from the period, echoing the concerns of the preacher in church, are keen to ensure that death, with its attendant horrors, remains in sight, but with a promise of _celestial_ joys for those who lead a good, Christian life.
# Love of a lady
In the mid-11th-century English romance _Apollonius of Tyre_ , the hero Apollonius falls in love with Arcestrate, a princess, but only once she has made her love for him utterly apparent, declaring: 'I love the shipwrecked man who was betrayed by misadventure; but in case you hesitate about this statement, it is Apollonius, my teacher, that I want.' Arcestrate gets what she most desires; she gets Apollonius. In the copying of this classical romance in Cambridge, Corpus Christi College, 201, the scribe-compiler may well have been reflecting literary and cultural changes that were already under way in England, inspired by Norman influences or French speakers at Edward the Confessor's court. Certainly, by the 12th century, courtly love becomes a major theme in romance and all its associated genres, including hagiography and history.
Courtly love belongs very much to the chivalric ethos, an ideal of nobility and proper knightly behaviour to which the aristocracy aspired. The aristocracy and those committed to the church were the dominant elites from the secular and religious orders, and courtly love had quite an impact on both. The medieval knight had to prove himself as a martial expert; he had also to prove himself emotionally and spiritually. In this idealized, and often nostalgic, world, the inspiration for the knight's determination to test himself and to perform courageously and virtuously came from the love of his chosen lady, whose favour he won through his devotion.
The medieval knight fought and loved for himself, then, as much as for his king and fellow knights. Romances, in particular, were an important genre, entertaining audiences of men and women, but, more significantly, informing them, too. At the court of Henry II and Eleanor of Aquitaine (1154–89), French romances both reflected and contributed to the social and intellectual _mores_ of the nobles; the knight owed allegiance and loyalty to his lord _and_ to his lady, to whom, in addition, he was to promise complete obedience.
The love that emerged from this relationship between a knight and his lady was the purest love: _fin'amor_ (or _fine amor_ ). It brought about an exaltation of the lovers, and especially a bettering of the knight, but its loss or diminution was devastating. This topos of suffering for love results in the transformation of the lovesick that can be so devastating as to cause their appearance to alter dramatically, or can even bring about death. The legend of Tristan and Iseut, which may have been influenced by earlier Irish legends, was written in French in the second half of the 12th century. Two versions that now exist only in fragmentary form were composed: one by Beroul; the other, a more courtly version, by Thomas of Britain. The narrative proved to have wide appeal, and it was translated into prose, and into many different languages, including Middle English and Welsh.
Tristan and Iseut's is a story that questions the ideal of romantic love in relation to the realities of aristocratic life. In the poetic version of the story, Tristan is a knight sent to Ireland to bring Iseut back to marry his uncle, Mark, king of Cornwall. Tristan and Iseut fall in love with each other after drinking a potion, but even so, Iseut marries Mark and continues her relationship with Tristan. Mark eventually finds out and determines to execute the lovers, but Tristan manages to save himself and rescue Iseut and they escape, eventually returning and making peace with Mark. Tristan marries a different Lady Iseut in Brittany, but swears to maintain chastity in that marriage.
One day, when he is severely wounded, he calls for his original Iseut to come and heal him, but his wife lies and tells him she did not come. He dies of sorrow; and the first Iseut, who arrives too late, dies too. Their union in death is their final respite in Thomas of Britain's version, written in octosyllabic rhyming couplets:
Embrace le, si s'estent,
_She embraces and stretches out by him,_
baise li la buche e la face,
_kisses his mouth and his face,_
e molt estreit a li l'enbrace.
_and holds him tightly to her._
Cors a cors, buche a buche estent,
_Body to body, mouth to mouth she lies,_
sun spirit a itant rent,
_she renders up her spirit now_
e murt dejuste lui iussi
_and, in this way next to him, dies_
pur la dolur de sun ami.
_for sorrow of her friend._
It's easy to read swiftly through the sequence of movements leading to the double death here. But the actions, which would be sexual in another context (embracing, lying next to, kissing, holding tightly, body to body, mouth to mouth), are profoundly sad and moving: she clings to the corpse of her life's love. That the only resolution for the adulterous courtly lovers is death is a worrying message, perhaps. Yet the all-consuming and absolute love Tristan and Iseut share has its own tragic nobility evoked in this scene, especially, in their embrace of death. The story's popularity, too, illustrates how much it engaged writers and audiences, including Marie de France, who retold part of it in her _lai Chevrefoil._
Within the many lyrics that survive, the romance heroine features often as the subject of male desire. Dafydd ap Gwilym, the noble Welsh bard writing in the mid-14th century, poured out his love for the married Morfudd in a sequence of poems. In _Morfudd fel yr Haul_ ( _Morfudd like the Sun_ ), he describes her as his 'pure girl', his 'dazzling girl', his 'noble, clever girl', his 'darling', 'the procurer of May', but her beauty is also a 'golden web'; she is deceitful, a trickster, and beyond his reach. She brings the spring, when all thoughts turn to love and procreation (and anticipation of the fun of the pilgrimage, as Chaucer tells us in the opening of _The Canterbury Tales_ ). 'Gŵyr obryn serchgerdd o'm pen', Dafydd ap Gwilym proclaims: 'She knows how to get a love song from my lips.' This, and many other, poets' love is not always so courtly, though. In _Y Rhugl Groen_ ( _The Rattle Bag_ ), he tell us he is in the middle of 'conferring' with a girl 'dan wŷdd rhwng mynydd a maes' ('under green trees between mountain and meadow') after some mead and, to his extreme annoyance, their intercourse is interrupted by a shepherd with a rattle bag and the girl runs away.
In numerous other lyrics, the sexuality of women forms the main focus of the male viewers' obsession, especially when spring arrives. London, British Library, Harley 2253, a manuscript written in about 1340 (see Figure 6), contains 116 Latin, French, and English texts, among them a whole host of lyrics that represent the full range of possibilities of the form: religious, secular, penitential, moral, and political. Many of these texts in Harley 2253 centre on women. Four ribald French _fabliaux_ , such as _Le Chevalier qui fist les cuns parler_ ( _The Knight who Makes Cunts Talk_ ), use romance diction and themes, but in a bawdy and explicitly misogynistic sexual context, like Chaucer's _Reeve's Tale_.
6. London, British Library, Harley 2253, folio 71 verso.
Less overtly anti-feminist, in the English _Alysoun_ , the poet sings to the heroine mentioning her brown eyebrows, lovely countenance, and tiny waist, declaring that he will die if he cannot have her, before launching into a trite refrain. In _Advice to Women_ , the poet warns women that when spring returns, women should beware of men, who just want their money and virginity. Women's beauty and desirability dominates these secular lyrics, creating of them objects to be worshipped, but also possessed and subdued.
# Speaking of love
One of the most beautiful and complex female lovers is Criseyde in Chaucer's _Troilus and Criseyde_ , written in the 1380s (see Figure 3). Using Boccaccio's _Il filostrato_ as a source, and inspired by the classical Ovid and later, medieval writers, Chaucer dramatically, but respectfully, adapts his _auctoritees_ ('authorities') to provide a lively and compelling narrative. Chaucer sets his great love story in ancient Troy at the time of the Siege of Troy, though this is a Troy re-envisioned as a bustling medieval London.
In the five books that comprise this lengthy masterpiece, Chaucer sustains over 8,000 lines of Rhyme Royal stanzas (lines with five metrical feet in stanzas of seven lines, rhyming ababbcc). This is the story of love, and of truth in love, a story of the constancy of God's love that endures beyond the whims of fortune, and human separation, loss, and death. Troilus struck by the god of love falls deeply in love with the young widow, Criseyde, and instantly feels the pain that accompanies desire:
'If no love is, O god, what fele I so?
_'If love it's not, O God, what feel I so?_
And if love is, what thing and whiche is he?'
_And if love it is, what sort of thing is it?'_
The lovers' physical union is aided by Criseyde's uncle and Troilus' confidant, Pandarus, but then Criseyde is sent to the Greek camp, where she pledges herself to another man, despite promising Troilus that she would return to him. When she does not come back, Troilus throws himself into battle, and is killed by Achilles. In the eighth sphere (a sort of ancients' heaven), Troilus realizes that love's permanence is not achieved in mortal things, even though loving is part of human nature. Chaucer closes his love story with tender reminders of the beauty of love in both its physical and spiritually redemptive qualities:
O yonge fresshe folkes, he or she,
_O young fresh people, he or she,_
In which that love up groweth with your age,
_In whom love grows as you get older,_
Repeyreth hoom from worldly vanitee,
_Come home from worldly vanity,_
And of your herte up-casteth the visage
_And cast up your heart's countenance_
To thilke god that after his image
_To that same God who in his own image_
Yow made; and thinketh al nis but a fayre
_Made you; and think all is but a market-place_
This world, that passeth sone as floures fayre.
_In this world, that passes as quickly as fair flowers._
Chaucer's emphasis at the end of his poem on the naturalness and beauty of love ('yonge fresshe folkes', 'floures fayre') results in a positive depiction of love. This is despite the ostensible illicitness of Troilus and Criseyde's consummation of their love, and despite Criseyde's inability to keep her promise. Troilus' ascent to a place where he can discern that all earthly things are transient confirms the potential joy of capacious love.
It seems that this same message of love's magnificence and its redemptive qualities underpins Sir Thomas Malory's depiction of his greatest lovers, Lancelot and Guinevere. The story of King Arthur, Queen Guinevere, the Knights of the Round Table and the Quest for the Holy Grail is told in the magnificent 15th-century romance _Le Morte Darthur_ , completed, Malory reveals, while he was a 'knight prisoner' in 1469, during the turmoil of the Wars of the Roses.
Basing some of his twenty-one-book prose narrative on earlier English and French authorities, Malory makes this tragic tale of chivalry, loyalty, private love, guilt, and public shame entirely his own. He chooses not only English as his medium, but also the gravitas of prose to underscore the 'historical' nature of his expansive and fast-moving story. Through realistic dialogue, Malory depicts the love between Lancelot and Guinevere as noble, for, in courtly love, the most worthy knight can surely only love the most noble lady. When discovered by Mordred and other knights, who aim to publicly accuse the lovers of treason, Lancelot touchingly sums up his loyalty and his hope for salvation through Guinevere's intercession:
Then he took the queen in his arms, and kissed her, and said: 'Most noble Christian queen, I beseech you as ye have been ever my special good lady, and I at all times your true poor knight unto my power, and as I never failed you in right nor in wrong sithen the first day King Arthur made me knight, that ye will pray for my soul if that I here be slain... '
It is not Lancelot who is slain ultimately, but Arthur, whose death is the result of the war caused by Mordred's public demand for retribution against Lancelot. And while Guinevere is Lancelot's 'earthly joy', penance is required for the downfall of Arthur's kingdom brought about by their love. Both take up a religious life to seek perfection and atone for the death of Arthur. The heartbreaking final books of _Le Morte Darthur_ recount the deaths of Guinevere and Lancelot: she 'peerless', and he 'the courteoust knight', 'the truest friend', the 'meekest', the 'gentlest', the 'sternest'.
# Love of the lord and lady
This spiritual aspect of love was not new in the 14th and 15th centuries. The 12th century brought about innovation in spiritual devotion that was closely allied with the emergence of romantic love. There is a new articulation and appreciation of the individual's relationship with fellow humans and with God and the community of saints. In the later medieval period, poignant images of Christ's suffering and his broken body begin to dominate artistic and literary depictions. The anguish of his mother, Mary, features prominently, too. By focusing on the heartache and wounds of these holy figures, authors and artists sought to engender in their audiences a desire to emulate and venerate Jesus and Mary's spiritual perfection; a desire that the faithful Christian learn to love wholly.
Romance imagery and diction were appropriated for spiritual work. Language that might be associated with a courtly woman was adapted for the Virgin Mary; the pleading courtly lover was transformed into the penitent worshipper. The 13th-century lyric from Cambridge, Trinity College, B. 14. 39, _Of One That is So Fair and Bright_ , demonstrates the flexibility of language and the expected multilingualism of a well-educated medieval reader-listener. It is written in macaronic verse; that is, verse that moves between languages while maintaining all rhetorical effects. Here the meaning of a verse-line of English is expanded and enhanced by the short Latin prayer-like verse-line that follows:
For on þat is so feir ant brist
_Of one that is so fair and bright_
Velud maris stella,
_Like the star of the sea,_
Bristore þen þe daiis list,
_Brighter than the day's light_ ,
Parens et puella,
_Mother and maiden;_
I crie þe grace of þe.
_I cry to you for grace from you._
Levedi, priie þi sone for me,
_Lady, pray to your son for me,_
Tam pia,
_So holy,_
Þat I mote come to þe,
_That I might come to you,_
Maria.
This personal plea to a beautiful, holy Virgin Mary, who is asked to intercede for the penitent, anticipates the deep love between the supplicant and the saint. This personal love, expressed in the first-person 'I' to draw in all reader-listeners, has its most magnificent appearance in English surprisingly early, in the 10th-century _Dream of the Rood_ , which details, over 156 lines, the entirety of salvation history, with a focus on its crux, the redemption of mankind through Christ's crucifixion. When the visionary sees an immeasurable cross in the sky above, covered in gold, adored by creation, his or her response is adoration suffused with contrition: 'Syllic wæs se sigebeam ond Ic synnum fah' ('Glorious was the tree of victory and I stained with sins'). This tightly controlled verse-line, dense with profound theological complexity, juxtaposes glory with sin (through the <s> alliteration) to highlight that the sinner can be saved from their horrific position through recognition of the victory of Christ over the Devil.
The ability of the visionary to participate in potential salvation through contemplation of and empathy with Christ and Mary's suffering is evinced most dramatically in the mystical writings that _The Dream of the Rood_ heralds. These reach their apogee in the 14th- and 15th-century works of Walter Hilton _(_ 1340–96, who wrote _The Scale of Perfection_ ); the anonymous author of _The Cloud of Unknowing_ ; the Yorkshire hermit Richard Rolle ( _c_.1290–1349); the anchoress Julian of Norwich ( _c_.1342–1416); and the pilgrim and visionary Margery Kempe ( _c_.1373–1439).
Mysticism involves a loving intimacy with Christ, dependent on sustained meditative focus in order to begin to attain spiritual union with God. It is a tradition that can be traced back to the earliest period in church history through the writings of major theologians. In the High Middle Ages, though, its practitioners were sometimes secular and, notably, female. Mystical Christianity emphasizes an emotional bond with God and the saints that insists on an affective piety, a fervent pious response that is inspired by reflecting hard on the sufferings of Christ in his humanity.
The language adopted in uttering this relationship is often sensual, reminiscent of romantic love in its yearning and desire. Rolle says, in his _Ego dormio_ , written in the 1340s:
Jhesu, Jhesu, Jhesu, til þe it es þat I morne,
_Jesus, Jesus, Jesus, it is for you that I mourn,_
For my lyfe and my lyvyng, when may I hethen torne?
_Because, my life and my living, when can I return there [to you]?_
Jhesu, my dere and my drewry, delyte ert þou to synge;
_Jesus, my dear and my bounty, delight are you to sing;_
Jhesu, my myrth, my melody, when will þow cum, my Keyng?
_Jesus, my mirth, my melody, when will you come, my king?_
Jhesu, my hele and my hony, my whart and my comfortyng,
_Jesus, my help and my honey, my health and my comforting,_
Jhesu, I covayte forto dy when it es þi payng.
_Jesus, I covet death when it is your pleasing._
This zealous love demanding the frequent repetition of the lover's name is touching and clearly overwhelming for the speaker. _The Book of Margery Kempe_ , dictated to a scribe-editor in the 15th century by the 'creature', as she calls herself, reveals in the _Proem_ how overwhelming she found her contemplation and envisioning of Christ: 'Sche knew and undyrstod many secret and prevy thyngys... And often tymes, while sche was kept wyth swech holy spechys and dalyawns, sche schuld so wepyn and sobbyn þat many men wer gretly awondyr, for thei wysten ful lytyl how homly ower Lord was in hyr sowle.' ('She knew and understood many secret and private things... And oftentimes, while she was kept with such holy speeches and conversations [with Jesus], she would weep and sob so that many people were greatly amazed, because they knew very little about how at home the Lord was in her soul.') Margery points out the surprised reaction of those around her, and that was the mildest of responses that she received. She became quite notorious in her daily life and her travels, as she tells us, and she sought spiritual advice from the highly regarded female mystic Julian of Norwich.
Julian's own work, _Revelations of Divine Love_ (written down in the 1390s), describes her visions of Christ and his Passion, focusing on the divine love that she saw as underpinning everything. In a tenet for all time she wrote (chapter 27):
In my folly, afore this time often I wondered why by the great foreseeing wisdom of God the beginning of sin was not letted: for then, methought, all should have been well. This stirring was much to be forsaken, but nevertheless mourning and sorrow I made therefor, without reason and discretion.
But Jesus, who in this Vision informed me of all that is needful to me, answered by this word and said: 'It behoved that there should be sin; but all shall be well, and all shall be well, and all manner of thing shall be well.'
It is this promise of all being well that encouraged many to strive for salvation despite war, plague, famine, and injustice, and that inspired writers to seek to save themselves and those for whom they wrote.
# Chapter 7
# Death and judgement
# Desiring salvation
Chaucer's _Retraction_ , or _Retracciouns_ , is appended to _The Parson's Tale_ , the final text in _The Canterbury Tales_. Immediately before the _Retraction_ , the scribe tells the reader-listener that Chaucer has finished his _Tales_ : 'Heere taketh the makere of this book his leve.' Chaucer then talks directly to his audience, advising them that if there is anything among his writings that they like, they should thank the Lord Jesus, but that if there is something that displeases them or that might be considered offensive, they attribute it to Chaucer's lack of knowledge, not his deliberate intent:
And if ther be any thyng that displese hem, I preye hem also that they arrete it to the defaute of myn unkonnynge and nat to my wyl, that wolde ful fayn have seyd bettre if I hadde had konnynge. For oure book seith, 'Al that is writen is writen for oure doctrine', and that is myn entente... Lord Jhesu Crist... sende me grace to biwayle my giltes and to studie to the salvacioun of my soule...
_And if there's anything that displeases them, I pray also that they'll attribute it to the fault of my ignorance and not to my will, and that I'd have said better if I had had the ability. For our book says, 'All that is written is written for our doctrine', and that is my intention... Lord Jesus Christ... send me grace to lament my sins and to meditate upon the salvation of my soul..._
The _Retraction_ actually names books that Chaucer seeks to revoke, among them the romance _Troilus and Criseyde_ , the _Book of the Duchess_ , and those of the _Canterbury Tales_ 'that sownen into synne' ('that tend toward sin'). The translation of Boethius' _Consolation of Philosophy_ (the _Boece_ ), the hagiographies, sermons, moral, and devotional writings that Chaucer wrote should, he tells us, be considered as lending him grace to hope for the salvation of his soul.
Importantly, this confessional statement immediately follows the moral and penitential _Parson's Tale_. The Parson delivers this long prose tale just outside Canterbury at the end of the pilgrims' journey from London during which many of the varied and lively pilgrims have told their tales. Chaucer has taken pains to narrate all the tales of the pilgrims precisely, according to the exact words they used. Since they are from many different classes and walks of life (from the Knight to the Ploughman, Wife of Bath to the Prioress, Squire to Summoner), his audience has been entertained with tales appropriate to the tellers: bawdy _fabliaux_ juxtaposed with romance; saints' lives; beast fables; sermons; and moral exempla. Now, it appears in the _Retraction_ that Chaucer worries for his soul, though given how naive and tongue-in-cheek Chaucer's narrator-persona has been in the course of _The Canterbury Tales_ , many scholars doubt the earnestness of this short coda.
It is difficult to tell whether or not Chaucer was genuine in his stated desire for salvation and his concern about his work's potential for leading audiences into sin. Many other authors in the medieval period intervened in their texts to request forgiveness or beseech their audience's prayers (Augustine, Bede, Denis Piramus in his 12th-century French _Life of St Edmund_ , Gerald of Wales), suggesting that this act was something of a literary device. But, while at the least such an action might be authors hedging their bets, it seems equally possible that a summative statement asking for grace and salvation would be genuine, given how pervasive Christianity was in the British Isles throughout this period, and how immersed in it individuals were.
Centuries earlier, Cynewulf, the 9th- or 10th-century author of Old English religious and hagiographic poetry, gave his name in runes towards the end of his _Fates of the Apostles._ By doing this, he writes himself into the poem about the acts of Christ's disciples, and becomes the last name in the catalogue of apostles. He also makes himself known to his audience, and explicitly seeks his audience's assistance in finding comfort and salvation, just as Chaucer seeks grace and the hope of salvation from Christ, Mary, and the saints.
Similarly, the Welsh author Meilyr Brydydd who was poet to Gruffydd ap Cynan, the prince of Gwynedd, begins his beautiful thirty-eight-line _Marwysgafn Feilyr Brydydd_ ('Deathbed Song') with a Latin exhortation to God beseeching the recognition of his true Lord:
_Rex Regum_ , rhebydd rhwydd Ei foli,
_King of kings, lord easy to praise_ ,
I'm arglwydd uchaf archaf weddi:
_I ask this prayer of my highest lord:_
Gwledig gwlad orfod goruchel wenrod,
_Country-conquering ruler of the best and holy land,_
Gwrda, gwna gymod rhyngod a mi.
_Noble lord, make peace between you and me._
These declarations suggest that a lifetime's writing, and especially the very act of writing deeply religious works, could be sufficient to inspire the writer spiritually. Writing and its performance—as in the mystical corpus of texts—could transform the individual from a state of sinfulness to a state of grace.
# Preaching salvation
From the earliest days of the church in the 1st century, teaching the basic tenets of belief and preaching God's word to the assembled were the fundamental responsibilities of those in religious orders. Indeed, the success of Christianity in the conversion period and later (6th century onwards) depended on the provision of books and texts from which preachers and teachers could instruct and evangelize. As such, religious poetry and prose, including materials specifically designed for use in church services, dominate all other kinds of textual production through the first sixteen or seventeen centuries of Christianity.
Most ecclesiastical institutions with access to a scribe, even indirectly (and many had whole teams of scribes), had copies of liturgical books used by bishops, monks, nuns, and priests to assist them in officiating services and sacraments; and patristic writings from which those in holy orders studied and drew inspiration. Abbots, abbesses, bishops, and priors delivered sermons to the brothers and sisters in the abbey or convent, sometimes in Latin; or, at other times, in one of the vernaculars. Ralph D'Escures, early 12th-century Archbishop of Canterbury, reveals that he delivered sermons to his monks in French first, before having them transcribed into Latin for a more public delivery.
The majority of texts that survive, then, are sermons and saints' lives, composed, copied, adapted, and sometimes memorized to be delivered in the language or dialect appropriate to the specific part of the British Isles, or specific institutional context. Writers often used and reused parts of earlier existing works, and cited (or mis-cited) authoritative sources, like Augustine, Bede, or Gregory the Great, to validate and elevate their work among fellow religious and parishioners.
Within the many hundreds of parishes, everyone was supposed to attend church, though perhaps many were not as regular in their churchgoing as the church wished. At many points in their lives, the average parishioner would hear the homiletic and hagiographic literature produced for Sundays and feast-days, and this could be poetry, as well as prose. Here, one thinks particularly of the work of a writer like the Augustinian canon Orm, who wrote the _Ormulum_ , a 19,000-line English cycle of verse homilies (a homily explains a scriptural verse, whereas a sermon instructs or admonishes), in the last third of the 12th century; or, arguably, William Langland, whose great 14th-century dream vision, _Piers Plowman_ , exemplifies, in brilliant alliterative verse, many homiletic characteristics, and includes within its narrative sermons delivered by allegorical characters trying to teach the assembled crowds.
The writer-speaker sought to bring the faithful to a greater grace; or to convince the sinner to repent; or to encourage the doubtful and exhausted member of the congregation to hope and strive harder for God in their thoughts, words, and deeds. Many collections of sermons survive from the earlier medieval period, testifying to the essential requirement for these texts. They survive particularly in Latin, but also in nearly all other languages of the period; and extant books of sermons increase dramatically from the 13th century.
By the 13th century, preaching was just one tool in a renewed programme of religious instruction initiated by the Catholic church at the Third and Fourth Lateran Councils in 1179 and 1215 that focused on tackling sin, encouraging confession and penitence, and enhancing Christian education. The Fourth Lateran Council, in particular, tried to improve education within the church. In its Clause 22, the Council made the annual confession and taking of communion mandatory for every Christian. As we shall see, this inspired the most prolific composition and dissemination of confessional manuals and pastoral guides for centuries to come and this literature was often then adapted into the form of sermons.
Sermons might not appear to be the most engaging of literature, but a great sermon writer entertained, educated, and motivated his audience. A host of rhetorical devices was used to organize and elucidate essential doctrine, and useful exempla were employed to make the teaching memorable. Poetry in the vernacular could appear in the middle of Latin instruction; handbooks teaching preachers how to write circulated widely; _artes praedicandi_ —the art of preaching—was a major concern for clerical writers. New religious orders, like the Friars—both Franciscan and Dominican (founded in 1209 and 1214, respectively)—engaged in pastoral work in Britain and Ireland from the 13th century onwards.
Friars were particularly renowned for the excellence and variety of their mandated preaching, and many small multilingual books survive that seem to have been made for and used by Franciscan friars, particularly; one such manuscript, London, British Library, Harley 913, produced in Ireland in the first half of the 14th century, contains verse sermons, didactic poems and lyrics, and _The Land of Cockayne_ , an English poem that satirizes the monastic life through its depiction of a topsy-turvy world. And Oxford, Bodleian Library, Rawlinson poet. 241, a later 13th-century anthology is typical of many manuscripts of this period that contain Latin and French sermons and poems, with the odd smattering of English verse. In medieval books, then, genre was not always as clearly categorized as it tends to be nowadays. Scribes and editors of texts often brought together all the kinds of materials that were needed for the books' users to go about their work in the community.
# Punishing and persecuting
... wearð þes þeodscipe swyþe forsyngod þurh mænigfealde synna and þurh fela misdæda: þurh morðdæda and þurh mandæda, þurh gitsunga and þurh gifernessa, þurh stala and þurh strudunga...
_... this nation has become very sinful through various sins and through many misdeeds: through deadly sins and through crimes, through avarice and through greediness, through theft and pillaging..._
So Wulfstan of York, contemporary of Ælfric, thundered in his 1014 _Sermo lupi ad Anglos_ ( _Sermon of the Wolf to the English_ ) to an assembled congregation of nobles and prelates: 'the nation has become sinful', 'let us _often_ consider the great judgement to which we must all come, and eagerly defend ourselves against the boiling fire of hell-torment'.
The idea of perpetual torment in hell was a real fear, confirmed for congregations throughout the Middle Ages by the fist-banging exhortatory sermons they would have heard on occasion, and by the images of suffering souls painted onto church walls. The Fourth Lateran Council's insistence on confession made the emphasis on sinfulness and repentance particularly notable. God's anger at the sins of the nation became evident at times of famine, plague, civil war, illness, and obvious social injustice; these terrible events were present throughout the medieval period, and none more so than in the 13th to 15th centuries.
Fear of death and what would come afterwards, especially for the sinner, haunted writers throughout this period. In sermons, preachers dwelled on the horrors of hell. Certain categories of hell were especially reserved for particular sins: liars are told they will stand for all eternity up to their necks in excrement while chewing off their own tongues which are regurgitated whole, and so it goes on. Murderers, gluttons, and fornicators have pertinent punishments. All will be dragged by demons into the mouth of hell on Judgement Day. On the pageant-wagons of later medieval and early modern drama, hellmouth (through which all sinners entered hell) appeared as a monstrous face entertainingly accompanied by smoke and flames and deliberate chaos, and through which devils poured out uproariously into the attendant crowd.
In _Body and Soul_ texts (sometimes depicted as dreams experienced by a living narrator), which exist in all languages in this period, the Soul—knowing that Judgement Day will not go well for it—berates the dead Body for its lack of restraint in life. The Body for its part blames the failures of the Soul as the superior spiritual authority. The 15th-century _Leabhar Breac_ (Dublin, Royal Irish Academy, 23 P 16) contains such a debate in Middle Irish, exemplifying an Irish tradition that was highly influential. In a lively encounter between the distressed Soul (who has seen what its eternal punishment will be) and the Body, the Soul shrieks:
'A choland chruaid, a thempuil diabuil, a tégdais dub dorcha dona diabulda, a thopur brén, a chuli chrum, a chiste comthinoil cech pheccaid.'
' _O stubborn body, temple of the devil, black, black, miserable, devilish abode, stinking well, nest of worms, treasure of the collection of every sin._ '
This extraordinary attack goes on to detail the decay of the body, 'abode of the black-blue beetles', the soul berating the body for the torture it now receives among the devils. The Body fights back, excoriating the Soul ('you stinking puddle, you noose leading captive the body at the instigation of the devil') for not receiving God's word. The preacher, presumably revelling in this brilliant, dramatic dialogue, makes sharp the contrast between the dark hellish eternity of the damned, and the 'melody of song, with quiring of angels' that will meet the saved.
Such dynamic depiction of the effects of sin extended to the dramatization of the sins themselves, which in sermons and poems were often personified to tremendous effect. In _Piers Plowman_ , Passus V (the fifth part of Langland's 14th-century dream vision sequence), the audience is shown the most magnificent procession of the Seven Deadly Sins, each portrayed satirically as if a member of contemporary society. Sir Gluttony is shown with Clement the Cobbler and Betty the Butcher in the pub eating, drinking, laughing, and singing:
And seten so til evensong, and songen umwhile
_And they sat like that until it was time for Evensong, and they sung for a while_
Til Gloton hadde glubbed a galon and a gille.
_Until Glutton had glugged a gallon and a gill._
His guttes bigonne to goþelen as two gredy sowes;
_His guts began to rumble like two greedy sows';_
He pissed a potel in a Paternoster-while,
_And he pissed a pot-full in the time it takes to say the 'Our Father'_
And blew his rounde ruwet at his ruggebones ende...
_And he blew his round trumpet at his arse end..._
... And whan he drouƺ to þe dore, þanne dymmed hise eiƺen;
_And when he got close to the door, then his eyes dimmed;_
He thrumbled on þe þresshfold and þrew to þe erþe.
_He stumbled on the threshold and fell to the ground._
Clement þe Cobelere kauƺte hym by þe myddel
_Clement the Cobbler caught him by the middle_
For to liften hym olofte, and leyde hym on his knowes.
_And lifted him up, and laid him on this knees_ ,
Ac Gloton was a gret cherl and a grym in þe liftyng,
_But Gluttony was a huge churl and a grim thing in lifting_ ,
And kouƺed up a cawdel in Clementes lappe.
_And he threw up a mess in Clement's lap._
On the one hand, this is hilarious; on the other, it is disgusting and repellent, wasteful and careless. The hilarity, though, is sharply undercut by the reminders of what these Sins should be doing: attending Evensong service at church, instead of sitting in the pub all day into the evening; and _saying_ the _Pater Noster_ in search for forgiveness, rather than pissing and farting grotesquely. Moreover, gluttony was widely regarded as a cause of the Fall of Man, when Eve greedily took the apple in Eden. Even Chaucer's corrupt Pardoner begins his sermon-tale with the exclamation 'O glotonye, full of cursedness! | O cause first of our confusion!'
In addition to the use of sermons and didactic poetry for teaching, terrifying, and offering the means of salvation for audiences, the church and secular state sought to suppress sinful and anti-social behaviour through lawcodes, lay and ecclesiastical, and by confession to a priest followed by instruction. Confessionals and Penitentials that detailed sins and penances circulated in the early medieval period, and Irish influence on these tracts was particularly significant. Penitential acts from prayer to pilgrimage were always important, but after the Fourth Lateran Council in 1215, greater efforts were made to educate the laity to ensure at least they know their _Pater noster, Ave Maria_ , and Creed. Manuscripts throughout the High Middle Ages contain these texts, often written as marginal additions to major texts in order to prompt the pastor in his work.
Numerous treatises in the later 12th and 13th centuries were written, too, that helped churchmen perform confession and teach their parishioners. These were widely circulated throughout the country. Gerald of Wales's _Gemma ecclesiastica_ helped rural churchmen in their duties. Thomas of Chobham's _Summa confessorum_ and William de Montibus' poetic _Peniteas cito peccator_ are early examples of how to understand and conduct confession, and ensure its efficacy. St Edmund of Abingdon's French _Le Merure de Seinte Eglise_ had a big impact, as did William of Pagula's _Oculum sacerdotis_ ; Guillaume Peyraut's _Summa de vitiis et virtutibus_ ; and another Dominican, Lorens D'Orléans's French _Somme le roi_ , written in 1279. Many of these Latin and French treatises were subsequently translated into English and other languages. The 14th-century _Book of Vices and Virtues_ derived from _Somme le roi_ ; and Dan Michael's prose _Ayenbit of Inwit_ ( _Remorse of Conscience_ ), written in 1340 also used the French treatise as its main source. Dan Michael reveals
Þet þis boc is ywrite mid Engliss of Kent;
_That this book is written with English of Kent;_
Þis boc is ymad vor lewede men,
_This book is made for unlearned people_ ,
Vor vader and vor moder and vor oþer ken.
_For a father and a mother and for other kin_.
By making Latin confessional and penitential literature available in French, English, and, to a lesser extent, the other British and Irish vernaculars, the 'lewed', the non-clerical Christian would be encouraged to help themselves: to learn how to reflect on and repent for their sins; and how to engage with basic doctrine. Dan Michael's _Ayenbit_ might not have been as popular as he intended, given that it only survives in one manuscript copy, but other works survive in multiple copies, attesting to their wide dissemination.
A late 14th-century manual of basic doctrinal instruction, _The Lay Folks' Catechism_ , exists in almost thirty manuscript versions with a wide geographical spread. It is associated with the instructional programme of Archbishop Thoresby of York, which itself built on earlier similar injunctions and helped pave the way for a sustained vernacular theology. Certainly, the translation into English meant a broader audience could access the learning it contains. The _Catechism_ , in its many forms, and like so many other works in Latin and French in the 13th to 15th centuries, seeks to enumerate the most elementary parts of the Christian faith: the Ten Commandments; the Seven Deadly Sins; the Seven Acts of Mercy; the Seven Virtues; the Seven Sacraments; and the Fourteen Articles of Faith. These fundamental aspects of religious practice were reinforced by whole cycles of wall paintings, such as that in Hoxne Church in Suffolk, which dynamically illustrates the Seven Sins and Seven Acts of Mercy in adjacent paintings on the wall of the nave. This made religious learning, in essence at least, accessible to all in ways that Latin services and priestly mediation did not always facilitate.
# From superstition to persecution
Not all religious or religious-like practice was condoned by the Catholic church; not all converts to Christianity in the early period were thoroughly convinced. The wonderful Old English heroic poem _The Wanderer_ details the lonely existence of a warrior without a lord, a man without friends or family. It is focused on the inexorability of fate, the capriciousness of fortune, expressing loss and nostalgia in an apparently unremittingly hopeless monologue until its final line and a half, where the poet suddenly recognizes that his hope lies in focusing on the stability of heaven and the grace of God. Good outcomes could often be attributed to fate, or to the intercession of a saint, but were also assisted by charms or textual amulets. Charms exist to ward off dwarfs, infection, and cysts. Protection was sought when setting out on a journey, and to assist against the loss of property. These charms are often copied into manuscripts that probably have an ecclesiastical origin, and it is difficult for modern scholars to determine what might have been the relationship between orthodox religious practices and what we'd commonly regard as 'superstition' now.
There existed in popular religion a kind of authorized superstition that amounted to promulgating a knowledge of good and bad omens; or using days of the week or patterns of weather to forecast the future ('prognostications' that had a lengthy and established textual tradition); or warding off a potentially terrible childbirth by wearing an amulet with a bit of the _Passion of St Margaret_ in it. There was, though, a thin line between this and practices that were outrightly condemned by the church to the point of persecution and attempts at eradication. Even fiction-writing could be regarded suspiciously (which might have contributed towards Chaucer's _Retraction_ ). The noise of minstrelsy could, according to Robert Mannyng of Brunne in his 14th-century manual, _Handlyng Synne_ , result in the minstrel's death through divine retribution, if the minstrel 'desturbled the bensoun | And the gode mannys devocyoun' (disturbed the prayers and the good man's devotions'). Tournaments, miracle plays, and frivolous things were also breeding grounds for sin, and warned against by instructional texts. But the greatest danger was not to be a Christian at all, or to be a Christian with beliefs and practices that differed from those propagated by the central channels of the church.
In fictional romances which idealized the chivalric code and the love of the knight for his lady, the stereotypical antagonist was often the Saracen, the Muslim. This figure was sometimes depicted as noble, able to be converted to Christianity; sometimes depicted as demonic, bestialized, orientalized, and overcome by the hero. Most vitriol in all texts—religious or secular—was saved for the heretic and the Jew. In Ælfric's 10th-century _Passion of St Edmund_ , based on Abbo of Fleury's Latin _Passio Sancti Edmundi_ , Ælfric specifically condemns the wolf-like, slaughterous Viking killers of Edmund, claiming that they are 'united with the devil', and deliberately associating them with the Jews who killed Jesus.
This idea of the Jews as killers of Christ led to increasing levels of persecution as the Middle Ages progressed, culminating in their expulsion from England in 1290 by royal edict. Allied to this terrible act, the frequent anti-Semitism of medieval writers extended to narrating stories of the Jews as killers of Christian children: the 'blood libel'. The monk Thomas of Norwich wrote a large Latin _Life and Miracles of St William of Norwich_ , completed in the 1170s, and told the story of a young boy who, it was alleged, was ritually murdered by the Jews of the city. A similar story appears in Chaucer's _Canterbury Tales_ , when the Prioress tells a tale that is unremittingly anti-Semitic, reflecting a very problematic aspect of medieval culture that demands a modern audience's judicious scrutiny and thoughtful approach.
The Jews, then, were expelled in 1290, but the powerful church and state did not only persecute those of a different religion. In the later 14th and 15th centuries, more than a hundred years prior to the Reformation, John Wycliffe ( _c_.1324–84) and his followers, the Wycliffites or Lollards, caused immense concern to the established church. Wycliffe, an Oxford theologian, held many views at odds with then-contemporary church practice; he argued that priests (like Chaucer's Parson in _The Canterbury Tales_ ) should live simple lives and own no property.
The corruption of the church was at the forefront of social concerns at that time; the Peasants' Revolt in 1381 argued for some of the reforms Wycliffe had in mind. He maintained that there was no need for the church to control and mediate people's spiritual lives in the ways it did and that a lay priesthood should be permitted. He particularly advocated access to the Bible in the vernaculars of the people. Wycliffe found support among the nobility, including John of Gaunt—a patron of Chaucer's—some writers, and many ordinary Christians, who, after 1382, became known as Lollards. They began to be actively persecuted by anxious church authorities in the early 1400s. Wycliffite writings survive in Latin and in English, and include texts like _Pierce the Ploughman's Crede_ , translations of the Bible, and many sets of sermons. Other writings, like the dialogue _Dives et pauper_ , Langland's _Piers Plowman_ , and, indeed, Chaucer's _Canterbury Tales,_ have come under scholarly scrutiny in trying to detect Lollard sympathies.
# Chapter 8
# Consolidating literary traditions
# Singing of princes
Professional poets depended for their livelihood on their patrons and their skill. In all medieval literary contexts thus far, we have seen those who worked for the local nobility, or sometimes the king: the Anglo-Saxon _scop_ , the Old Norse skald, the Welsh _Gogynfeirdd_ (early poets), the Irish _file_ , and the later Scottish _makar._ For the Celts, their poetic tradition was bardic; their practitioners, then as now, were _bards_. Across these earlier cultures, the teller of tales was important to the way society functioned and celebrated itself. The Anglo-Saxon poem _Deor_ , written down in about 970, is a self-advertisement for its own poet and tells us a little about the status of the self-employed professional literary figure. The speaker, Deor, reveals that he was well employed until recently, with a loyal lord and rewards for his skill when he would sing with the harp, praising his patron. Now his job and his land have been given to a 'leoðcræftig monn' (man skilled in poetic craft), called Heorrenda: poetry was a competitive business.
In _Beowulf_ , the Anglo-Saxon professional poet plies his trade in the king's hall where all the warriors gather for the feast, together with some of the noblewomen. The poet regales the assembled crowd with legends of heroes, like Sigemund the dragonslayer, and great wars or national events; he has a stock of learning and poetic formula at his disposal and he works deftly to create an engaging and pertinent verse narrative from his store of knowledge. Much of what the _scop_ sings brings history into the present, and in so doing, creates a larger heroic context for Beowulf's exploits, or those of other warriors and kings.
Praise-poetry existed in all cultures, sung at the courts of kings and nobles to entertain, encourage, and gain renown and reward for the poet. The Old Norse skalds (see Box 9) of the Danish King Cnut's court in England (1016–35) wrote remarkable praise-poetry in honour of Cnut as the defeater of the English line of kings. Although this poetry was not written down until much later, there is no doubt of its creation being contemporary with Cnut himself. One of these skalds, Óttarr svarti, writes about the dynastic takeover that Cnut effected in 1016 when he took over the kingdom from Edmund Ironside, grandson of Edgar the Peaceable:
Herskjöld bart ok helduð | You carried the warshield
---|---
hilmir, ríkr af slíku; | prince, and prevailed;
hykkat, þengill, þekkðust | I do not think, lord, you
þik kyrrsetu mikla. | cared much for sitting in peace.
AEtt drap, Jóta dróttinn, | Lord of the Jótar [Cnut], struck the kin
Játgeirs í för þeiri; | of Edgar on that expedition;
þveit rakt—þrár est heitinn— | ruler's son [Cnut], you dealt them
þeim, stillis konr, illan. | a harsh blow; you are called defiant.
In complex poetry, alliterating, condensed, and rhetorically powerful, Cnut's reputation as the greatest of warriors is consolidated through the piling up of kingly heroic references.
Analogous to skaldic poets in service to kings and their courts is the work of the early Welsh poets of perhaps the 6th century: Taliesin who wrote in praise of Urien, king of Rheged; and Aneirin, the author of _Y Gododdin_. These early exponents of poetic art influenced the metre and method of the creations of later poets, the 12th-century _beirdd y twysogion_ ('bards of the princes'). Among these was Cynddelw Brydydd Mawr ('the great poet', 1155–1200), court poet of Prince Madog ap Maredudd; and Gwalchmai ap Meilyr (1130–80), who wrote in praise of the king of Gwynedd, Owain. Some of these poets wielded considerable power and became significant members of the household.
# Box 9 Old Norse literature
Like all medieval vernacular literary traditions, Old Norse literature existed in oral form well before it was recorded in writing. It has a complicated history, made more complex by the geographical and cultural range of Old Norse, which includes not just Britain and Ireland, but also all the Scandinavian countries, including Iceland and Greenland. Within Anglo-Saxon England, the similarity of Old Norse and Old English languages means that the influence of Old Norse after the 9th century is difficult to detect. Certainly, English writings of the 10th century and later contain Old Norse loanwords and some stylistic similarities have been noted. Later texts still, such as the 12th-century verse sermon cycle the _Ormulum_ , and the 14th-century romance _Sir Gawain and the Green Knight_ , are quite indebted to Scandinavian influences.
The first Anglo-Scandinavian king of England, Cnut, who reigned from 1016 to 1035, encouraged the production of Old Norse verse by highly specialized poets called skalds. Similarly, the earls and bishops of the Scottish Isles, such as Orkney, patronized and composed courtly poetry in the 12th and 13th centuries, which was captured in writing by the later medieval authors of Icelandic sagas and poetry. Indeed, the centuries-old settlement in the British Isles of many Scandinavians had an immeasurably important impact on English; many everyday words like 'skin', 'they', 'sister', 'law', and 'husband' are Old Norse in origin.
Those who wrote the most highly elevated poetry—like the skalds and the Irish _filidh_ —might have close relationships with their patrons. And the level of sophisticated poetry that they wrote was demanding not just of the poet, but also of his audience. The expectation was clearly that those listening were able to understanding elusive references, dense metaphor, and clever collocation. Clearly, for this work, the most proficient and highest class of poets was patronized by great and, sometimes, royal households who would provide reward and a public space for the poets to perform their work.
The practice of royalty and nobles maintaining their own poet continued in Wales, Ireland, England, and Scotland throughout the Middle Ages and into the early modern period. In Wales, after the Conquest of 1282 and the death of the last prince, Llewelyn ap Gruffydd, the patronage of poetry moved to the houses of the gentry, who (together with members of the clergy) employed the _cywyddwyr_ (later medieval poets, who flourished from about 1300 into the 16th century) to compose for them. Great Welsh poets in the later Middle Ages include not only Dafydd ap Gwilym, but also Iolo Goch, Guto'r Glyn, Tudur Aled, and Lewys Glyn Cothi. These poets wrote on a host of subjects, including inspirational poems about the bravery of contemporary Welshmen in battles. Iolo Goch's panegyric _Syr Hywel y Fwyall_ ('Sir Hywel of the Axe') focuses on Sir Hywel ap Gruffudd's defence of Criccieth Castle when 'he put a bridle on the French king's head':
Annwyl fydd gan ŵyl einiort,
_He'll be loved by the gentle romancer,_
aml ei feirdd, a mawl i'w fort.
_his poets are many, his table is praised._
This reference to Hywel as being a worthy subject for the romancer (a writer of romance narrative), and a patron of many poets, is a reminder, too, that just as the best writers had the most generous patrons, so those patrons gathered together materials from a variety of sources into books that they commissioned for their household. There is no doubt that having the best poets writing for them and having the most accomplished literary figures among their households gave additional cultural and social status to the elite, and glorified their own learning and their achievements.
# 'Men take of it heed'
In the later 14th century, Geoffrey Chaucer was associated with the court of Richard II. As we saw, Chaucer wrote _The Book of the Duchess_ for John of Gaunt; and the _Legend of Good Women_ was written for Richard II's wife, Anne of Bohemia. Chaucer's contemporary, a fellow courtly writer and Privy Seal clerk, Thomas Hoccleve (1367–1426), produced his very popular work the _Regiment of Princes_ in about 1410 for the future King Henry V. This poem instructs a prince, though a long series of examples, how to rule justly and legitimately. In directly addressing Henry V in the _Regiment_ , Hoccleve reminds his royal patron:
In al my book yee schul nat see ne fynde
_Throughout my book you shall not see or find_
That I youre deedes lakke or hem despreise.
_That I lessen your deeds or fail to praise them._
Hoccleve had other patrons, too, including Humphrey of Gloucester, youngest son of Henry IV, and some of these royal figures were patrons of numerous writers, especially writers whose works were written in English. There was a wide audience for vernacular writings, and English writers could thus assist in getting particular messages—intellectual or political—across.
Prior to his accession to the throne, Henry V commissioned the prolific poet and monk of Bury St Edmunds John Lydgate ( _c_.1370–1451) to write _Troy Book_. This poem of over 30,000 lines, completed in eight years by 1420, tells a moralizing story of the Trojan wars, which builds on previous versions of the well-established theme. It also seeks to build a new narrative of rightful lineage for the Lancastrian line (Henry IV had usurped Richard II). Lydgate wrote hundreds of other texts, too, in a wide variety of genres and he, like Hoccleve, was fully aware of the debt owed to Chaucer in providing a firm setting for English as a major literary medium for public poetry. A portrait of Chaucer is included in one of the early manuscripts of Hoccleve's _Regiment of Princes_ , which lends authority to Hoccleve's work.
Both Hoccleve and Lydgate praised Chaucer explicitly in their own works, demonstrating not only his recognized authority and brilliance, but also claiming validation as his successors. Indeed, Hoccleve claimed that Chaucer tried to teach him how to write poetry. Lydgate, on the other hand, never met Chaucer, but his own merits as a writer were quickly established. He followed his _Troy Book_ with the _Siege of Thebes_ in 1422 and both poems make a case for the worthiness of chivalry. His works included anti-Lollard writings, confirming his role as a major orthodox author in his own right, who helped to promote both the monarchy and the established church against opponents. To this end, his moral writings, his saints' lives, and his numerous other religious works, such as _The Life of Our Lady_ , mark him out as one of the most productive authors of the late Middle Ages.
The impact of Chaucer's writing had a wide reach. Almost immediately his influence was felt in Scotland, with the composition of _The Kingis Quair_ ('The King's Book'), apparently written by the Scottish King James I, after his capture at the age of 11 by the English in 1406. He was imprisoned for eighteen years, and writes about his experiences in this semi-autobiographical poem. _The Kingis Quair_ shows that the writer knew Chaucer's oeuvre very well, and was familiar with Lydgate's _Temple of Glass._ The author writes a dedication to Chaucer and to John Gower, multilingual author of _Mirour de l'omme, Vox clamantis_ , and _Confessio amantis_. James lauds their work and hopes to benefit from their association:
Unto impnis of my maisteris dere,
_To the poems of my dear masters,_
Gowere and Chaucere, that on the steppis satt
_Gower and Chaucer, so that on the steps sat_
Of rethorike quhill thai were lyvand here,
_Of rhetoric while they were living here_
Superlative as poetis laureate
_Superlative as poets laureate_
In moralitee and eloquence ornate,
_In morality and ornate eloquence,_
I recommend my buk in lynis sevin,
_I recommend my book in seven-line stanzas,_
And eke thair saulis unto the blisse of Hevin.
_And also their souls into the bliss of Heaven._
He also commends their souls to heaven, while recommending his book to sit on the steps of the poets laureate. His use of seven-line stanzas—Rhyme Royal—emulated a form perfected by Chaucer in his romance _Troilus and Criseyde_. Like _The Knight's Tale_ in Chaucer's _Canterbury Tales, The King is Quair_ examines themes influenced by Boethius' _Consolation of Philosophy_ and courtly love, but does so in a self-conscious and subjective mode of expression.
# The flowering of national literatures
The royal association with Scottish literature illustrated by the writing of _The Kingis Quair_ led to an extensive commissioning or patronage of literary works within the Scottish court itself later in the 15th century. The courtly poets of Scotland were known as the _makars_ , and they also make clear their debt to Chaucer, whom they sought to emulate in their own work. This group of scholar-poets included Robert Henryson ( _c_.1460–1500), who produced a version of the _Orpheus and Euridice_ myth, as well as fables, and, most notably, the _Testament of Cresseid_ , which seeks to reconfigure Chaucer's _Troilus and Criseyde_ by, among other aspects, completing the earlier work.
Henryson's contemporary William Dunbar ( _c_.1460–1520), like his earlier English counterparts, was closely allied with the royal court; James IV of Scotland was patron of Dunbar, who became a public poet, writing religious and secular works, as well as satirical verse, addressed at a variety of targets. In his _Lament for the Makaris_ , Dunbar eulogizes great poets that have preceded him, including Chaucer, Gower, Barbour, Robert Henryson, and others. In it, he laments the brevity of life and the pointlessness of worldly glory, recognizing—as so many other medieval texts do—that all humanity turns to dust; Death spares no one. Repeating the cohering refrain, every four lines, _Timor Mortis conturbat me_ ('Fear of death disturbs me') he talks of Death as 'petuously devour | The noble Chaucer, of makaris flour, | The Monk of Bury, and Gower, all three' ('devouring noble Chaucer, the flower of poets, Lydgate and Gower, all three'), Dunbar simultaneously bemoans the passing of the great, while celebrating, in poetry, their eternal greatness. He writes himself into this long line of literary wonders in the production of this poem, which survives in a number of manuscript versions.
What is especially notable about Chaucer, Lydgate, and Hoccleve in this period from _c_.1390 is that they attest to a renewed vigour in English literary composition and transmission, but this is now a literary endeavour that is supported _in English_ by kings and the aristocracy. These authors all built on the prose and poetry of earlier writers to adapt and transform well-loved narratives into contemporary works, many with political resonances, and many directly addressed to monarchs and nobles. As interesting is the popularity of these great stories more broadly. Whereas other works exist in only one copy (like the romance _Sir Gawain and the Green Knight_ and the three religious texts in the same manuscript, _Cleanness, Pearl_ , and _Patience_ ; or the 15th-century poem _Athelston_ ), the works of Chaucer, Lydgate, and Hoccleve and Langland's religious masterpiece _Piers Plowman_ tend to survive in multiple copies, suggesting that numerous noble households, or ecclesiastical institutions, wanted to commission copies. The status of the book as a marker of culture and education led to significant demand, a demand that resulted from increased male and female literacy and that could be met in abundance once printing got underway from 1485 in Britain.
# Ordering books, writing lives
The role of women is critical in any discussion of the flowering of the arts and their commissioning of books is important throughout the centuries. In the earlier Middle Ages, King Alfred reveals that it was his _mother_ who encouraged his love of the written word and sought to make literacy a desirable skill in her son while he was still a young prince. Queen Emma, wife of King Cnut, commissioned the writing of the _Encomium Emmae reginae_ in the 1040s, some years after Cnut died, in order to promote herself and her husband's reputation (see Figure 7). This Latin praise-text in honour of the queen does all it can to depict Cnut and Emma in a glorious light, using classical sources to elevate its subjects and seeking, through its rhetoric, to protect the interests of the queen at a time when her power at court was coming to an end. The fact that this _Encomium_ was written in Latin prose replete with Virgilian echoes suggests that Emma was herself learned, multilingual, and politically astute. From the known commissioning of texts, it is possible to deduce a considerable amount about the abilities of the intended audience, or, at least, the image those commissioners wish to project.
Religious materials were also written at the request of women. Ailred of Rievaulx wrote the Latin _De institutione inclusarum_ in about 1160 for his sister and other religious women who separated themselves from the world in religious contemplation. Before about 1272, Friar Thomas Hales wrote his _Love-Ron_ ( _Love-Song_ ) after a religious woman, perhaps a nun, asked for a devotional song to encourage her in her chosen life as a virgin. Hales advises his addressee to sing the song about the rectitude of purity and the life of devotion to Christ in order to memorize it, to help her come to heaven where she would be led into the bridal chamber of God.
7. London, British Library, Additional 33241, folio 1 verso. _Encomium Emma Reginae_ frontispiece.
Throughout Britain and Ireland in the Middle Ages, increasing numbers of those families with money and some education made or commissioned whole books—anthologies of religious and secular verse and prose, often produced multilingually. One such book is the largest medieval literary book, the Vernon Manuscript now at the Bodleian Library in Oxford, compiled in around 1400 and containing 370 texts. It was written for someone, perhaps in the West Midlands, whose identity is not known, because their coat of arms in the manuscript was never completed.
Other owners are known, giving invaluable information about particular readers' interests. In Scotland, the Earl of Orkney commissioned the making of Oxford, Bodleian Library, Arch. Selden B. 24 in the 1480s, a manuscript of poetry that contains _The Kingis Quair_ , alongside Hoccleve's _Mother of God_ , and a good many Chaucerian poems including _Troilus and Criseyde._ This type of 'household' book was regularly produced from the closing years of the 14th century onwards, as it became more common for wealthy families to own manuscripts and documents, and, in many cases, participate in their creation.
The Findern Manuscript (Cambridge University Library, Ff. 1. 6), belonging originally to the Findern family in Derbyshire, and dated to the mid-15th century, shows the interests of women readers, whose names are written into the margins of the manuscript. The manuscript contains works by Chaucer and Gower, but also includes some lyrical poems that might have been written by women poets, one of which is a lament for the absence of a loved one.
Such absence is treated pragmatically by one of the writers in the Paston family, whose extensive collection of letters and legal documents gives a wonderful insight into life in the turbulent 15th century. These papers belonging to three generations of the family from Norfolk attests to the expansion and importance of literacy at this time. Among the family members was Agnes Paston, who in the 1440s and 1450s devoted time to writing to her children once they had left home. In her letters to her son John, who was living in London, she tells him all her gossip, recounting words she exchanged with angry neighbours and letting him know the local news. In lively (and my modernized) prose, she narrates that
On Tuesday, Sir Jon Henyngham went to his church and heard three masses, and came home again never merrier, and said to his wife that he would go say a little devotion in his garden and then he would dine. And forthwith he felt a fainting in his leg and sat down. This was at nine of the clock, and he was dead before noon.
Other letters are less dramatic: Agnes informs John of the various legal cases with which she is involved; reminds him to settle his accounts; and sends him love and blessings. But these kinds of text, rare practical and everyday demonstrations of literacy, remind us of the lives and concerns of real medieval people, whose lives we can indirectly detect in the vibrant and diverse poetry and prose that forms the great canons of British and Irish literature.
# Chapter 9
# Coda: print and the canon
When William Caxton brought printing to London in 1485 from the continent where it had been flourishing for some thirty years, his choice to print in the vernaculars of England—English and French—consolidated the linguistic decisions made by many manuscript authors and compilers for hundreds of years. It was a choice based on the knowledge that this new textual tradition would thrive among the middle-class and aristocratic populace whose literacy was more assured in their own languages than in the scholarly Latin of centuries past.
As significant as language choice, though, were Caxton's actual selections of the texts to be printed in English in England. In choosing to publish Chaucer's _Canterbury Tales_ and Malory's _Le Morte Darthur_ , Caxton helped to consolidate what would go on to become fundamental works in the English literary canon. Since Malory's manuscript of _Le Morte Darthur_ was lost after being used by Caxton until its extraordinary rediscovery at Winchester College in 1934 (see Figure 8), Caxton's printed edition also meant that the romance remained in circulation for the intervening centuries. In his Preface to the edition of _Le Morte Darthur_ , Caxton reveals that he
had accomplished and finished divers histories as well of contemplation as of other historial and worldly acts of great conquerors and princes, and also certain books of ensamples and doctrine.
8. William Caxton's _Preface_ to his printed edition of Thomas Malory's _Le Morte Darthur_.
He recounts the other great heroes—the Nine Worthies (Hector, Alexander the Great, Julius Caesar; Joshua, David, and Judas Maccabeus; Charlemagne, Godfrey of Bouillon, and Arthur), who populate the great tales of the period. But denying the accusations of fiction made against Arthur and his legends, however, Caxton recognizes Arthur as 'first and chief of the Christian men'. He privileges the 'Matter of Britain', and the truth of a good story.
Like Chaucer in his _Retraction_ , Caxton claims that 'all is written for our doctrine'; that is, he publishes the works he prints for the education of the audience, who should 'do after the good and leave the evil'. In choosing the good, he helped establish the excellence of early literary culture as it moved from manuscript to print and from the Middle Ages to a renaissance. The medieval in all of its manifestations has never subsequently ceased to fascinate, instruct, delight, shock, engage, move, and inspire.
# Further reading
# Introduction: endings and beginnings
Carruthers, G., and L. McIlvanney (ed.), _The Cambridge Companion to Scottish Literature_ (Cambridge: Cambridge University Press, 2012).
Crawford, Robert, _Scotland's Books: The Penguin History of Scottish Literature_ (London: Penguin, 2012).
Gantz, Jeffrey, _Early Irish Myths and Sagas_ (London: Penguin, 1982).
Lapidge, Michael, _Anglo-Latin Literature, 900–1066_ (London: Hambledon Press, 1972).
Pearsall, D., _Old and Middle English Poetry_ , The Routledge History of English Literature I (London: Routledge, 1977).
Rigg, A. G., _A History of Anglo-Latin Literature, 1066–1422_ (Cambridge: Cambridge University Press, 2006).
Williams, Gwyn (ed. and trans.), _The Burning Tree: Poems from the First Thousand Years of Welsh Verse_ (London: Faber and Faber, 1956).
# Chapter 1: Literary origins
Pulsiano, Phillip and Elaine Treharne (eds.), _A Companion to Anglo-Saxon Literature_ (Oxford: Wiley-Blackwell, 2001).
Solopova, Elizabeth and Stuart D. Lee, _Key Concepts in Medieval Literature_ , Palgrave Key Concepts (London: Palgrave Macmillan, 2007).
Treharne, Elaine (ed.), _Anthology of Old and Middle English, c.890–1450_ , 3rd edn (Oxford: Wiley-Blackwell, 2009).
Wallace, David (ed.), _The Cambridge History of Medieval English Literature_ (Cambridge: Cambridge University Press, 1999).
# Chapter 2: Textual production and performance
Galloway, Andrew (ed.), _The Cambridge Companion to Medieval English Culture_ (Cambridge: Cambridge University Press, 2011).
Hanna III, Ralph, _Introducing English Medieval Book History_ , Exeter Medieval Texts and Studies (Exeter: Exeter University Press, 2013).
Johnson, David and Elaine Treharne (eds.), _Readings in Medieval Texts: Interpreting Old and Middle English Literature_ (Oxford: Oxford University Press, 2005).
Owen-Crocker, Gale (ed.), _Working with Anglo-Saxon Manuscripts_ (Exeter: Exeter University Press, 2009).
Treharne, Elaine and Greg Walker (eds.), _The Oxford Handbook to Medieval Literature in English_ (Oxford: Oxford University Press, 2010).
# Chapter 3: Literary spaces, literary identities
Clanchy, M., _From Memory to Written Record_ , 3rd edn (Oxford: Wiley-Blackwell, 2013).
Johnston, Dafydd, and Richard Loomis (trans.), _Medieval Welsh Poems: An Anthology_ (Binghamton, NY: Medieval and Renaissance Texts and Studies, 1992).
Lees, Clare (ed.), _The Cambridge History of Early Medieval English Literature_ (Cambridge: Cambridge University Press, 2013).
Manguel, Alberto, _A History of Reading_ (London: Penguin, 1996).
Ní Bhrolcháin, Muireann, _Introduction to Early Irish Literature_ (Dublin: Four Courts Press, 2009).
Taylor, Andrew, _Textual Situations: Three Medieval Manuscripts and Their Readers_ (Philadelphia: University of Pennsylvania Press, 2002).
# Chapter 4: Individual and community
Ashe, Laura, _Early Fiction in England_ (London: Penguin, 2015).
Barron, W. R. J., _English Medieval Romance_ (London: Longman, 1987).
Brown, Peter (ed.), _A Companion to Medieval English Literature and Culture, c.1350–c.1500_ (Oxford: Wiley-Blackwell, 2009).
Fulton, Helen (ed.), _A Companion to Arthurian Literature_ (Oxford: Wiley-Blackwell, 2009).
Hays, R., et al. (ed.), _Records of Early English Drama; Dorset & Cornwall_ (Toronto: Toronto University Press, 1999).
Johnston, Dafydd, _A Pocket Guide: The Literature of Wales_ (Cardiff: University of Wales Press, 1994).
Walker, Greg (ed.), _Medieval Drama: An Anthology_ (Oxford: Wiley-Blackwell, 2000).
Woolf, R., _The English Mystery Play_ s (London: Routledge & Kegan Paul, 1972).
# Chapter 5: The mighty and the monstrous
Burrow, J. A., _Essays on Medieval Literature_ (Oxford: Clarendon Press, 1984).
Cohen, Jeffrey Jerome, _Monster Theory: Reading Culture_ (Minneapolis: University of Minnesota Press, 1996).
Echard, Siân (ed.), _A Companion to Gower_ (Cambridge: D. S. Brewer, 2004).
Fulk, R. D. (ed. and trans.), _The Beowulf Manuscript_ , Dumbarton Oaks Medieval Library (Cambridge, Mass.: Harvard University Press, 2010).
Hibbard, Laura A., _Medieval Romance in England_ (New York: Burt Franklin, 1963).
Krueger, Roberta L. (ed.), _The Cambridge Companion to Medieval Romance_ (Cambridge: Cambridge University Press, 2000).
Sims-Williams, Patrick, _Irish Influence on Medieval Welsh Literature_ (Oxford: Oxford University Press, 2011).
Treharne, Elaine, _Gluttons for Punishment: The Drunk and Disorderly in Old English Sermons_ , The Annual Brixworth Lecture (Leicester: University of Leicester, 2007).
# Chapter 6: Love and longing
Ashe, Laura, _Fiction and History in England, 1066–1200_ (Cambridge: Cambridge University Press, 2007).
Crane, Susan, _Insular Romance: Politics, Faith, and Culture in Anglo-Norman and Middle English Literature_ (Berkeley: University of California Press, 1986).
Duncan, T. G. (ed.), _A Companion to the Middle English Lyric_ (Cambridge: D. S. Brewer, 2005).
Fein, Susanna (ed.), _Studies in the Harley Manuscript: The Scribes, Contents, and Social Contexts of British Library MS Harley 2253_ (Kalamazoo, Mich.: Western Michigan University, 2000).
Field, P. J. C. (ed.), _Malory Le Morte Darthur_ , 2 vols (Cambridge: D. S. Brewer, 2013).
Huws, Daniel, _Medieval Welsh Manuscripts_ (Cardiff: University of Wales Press and National Library of Wales, 2000).
Kennedy, Ruth and Simon Meecham-Jones (eds.), _Writers of the Reign of Henry II: Twelve Essays_ , The New Middle Ages (London: Palgrave Macmillan, 2006).
Klinck, Anne (ed.), _The Old English Elegies: A Critical Edition and Genre Study_ (Montreal: McGill University Press, 2001).
Woolf, R., _English Religious Lyric in the Middle Ages_ (Oxford: Clarendon Press, 1968; repr. 1998).
# Chapter 7: Death and judgement
Atkinson, Robert (ed. and tr.). _The Passions and the Homilies from Leabhar Breac: Text, Translation, and Glossary_. Todd Lecture Series II (Dublin: Royal Irish Academy, 1887).
Benson, Larry D. (ed.), _The Riverside Chaucer_ , 3rd edn (Oxford: Oxford University Press, 1988).
Brooke, Rosalind and Christopher, _Popular Religion in the Middle Ages: Western Europe, 1000–1300_ (London: Thames and Hudson, 1984).
Minnis, A. J., _Medieval Theory of Authorship: Scholastic Literary Attitudes in the Later Middle Ages_ (London: Scolar Press, 1984).
Owst, G. R., _Preaching in Medieval England_ (Cambridge: Cambridge University Press, 1926).
Spencer, Helen Leith, _English Preaching in the Late Middle Ages_ (Oxford: Clarendon Press, 1993).
Wright, C. D., _The Irish Tradition in Old English Literature_ (Cambridge: Cambridge University Press, 1993).
# Chapter 8: Consolidating literary traditions
Clancy, Thomas O. (ed.), _The Triumph Tree: Scotland's Earliest Poetry, 550–1350_ (Edinburgh: Cannongate, 2008).
Edwards, A. S. G., _A Companion to Middle English Prose_ (Cambridge: D. S. Brewer, 2004).
McCash, June Hall (ed.), _The Cultural Patronage of Medieval Women_ (Athens, Ga.: University of Georgia Press, 1996).
Meale, Carole, _Women and Literature in Britain, 1150–1500_ (Cambridge: Cambridge University Press, 1993).
Parry, Thomas, ed. _The Oxford Book of Welsh Verse_ (Oxford: Oxford University Press, 1962).
Townend, Matthew (ed.), _Editions of Skaldic Poems: Skaldic Poetry of the Scandinavian Middle Ages_ , 1 and 2 (Turnhout: Brepols, 2012).
Walker, David, _Medieval Wales_ (Cambridge: Cambridge University Press, 1990; repr. 1999).
# Chapter 9: Coda: print and the canon
Hellinga, Lotte and J. B. Trapp (eds.), _The Cambridge History of the Book in Britain, Volume III: 1400–1557_ (Cambridge: Cambridge University Press, 2000).
Kuskin, William, _Symbolic Caxton: Literary Culture and Print Capitalism_ (Notre Dame, Ind.: University of Notre Dame Press, 2008).
# Index
A
Abbo of Fleury
Aberystwyth, National Library of Wales
23849D
Peniarth 1 –
Peniarth 105B –
Adeliza of Louvain
Adomnan
_Advice to Women_ –
Ælfric, abbot of Eynsham ,
_Passion of St Edmund_
Ailred of Rievaulx, _De institutione inclusarum_
_aithed_ ('the abducted, taken')
Alexander-romances
_Alexander to Aristotle_
Alfred, king of Wessex , , , ,
alliterative verse –, –, –
_Alysoun_
anchoress –
_Ancrene Wisse_ –
Aneirin, _Y Gododdin_
_Anglo-Saxon Chronicle_ –
Anglo-Saxon settlement –, –
Anne of Bohemia
anonymous authorship , , , , , ,
_Anra Choluim Chille_
_Apollonius of Tyre_ –,
Arthur, King of the Britons , , , , –, , ,
Arthurian literature , –, , –, , –
Athelstan, King –
_Athelston_ ,
_auctoritee_ (authority) ,
audiences , , –, , –, , ,
female audience –
Augustine of Hippo , ,
Augustine, St (missionary to England)
authorship , –, , , ,
_Awyntyrs of Arthure_
_Ayenbit of Inwit_ (Dan Michael) –
B
Baldwin, Archbishop of Canterbury
_ballade_
Barbour, John, _Brus_
bards, bardic culture –, , , , –
_Battle of Brunanburh_ –
beast of battle
Bede –, , ,
_Ecclesiastical History of the English People_ –,
Benedeit, _Le Voyage de Saint Brendan_ –
_Beowulf_ , –, , –, –
_Beroul_
_Beunans Ke_ ( _Life of St Ke_ )
_Beunans Meriasek_ ,
_Bisclavret_ –
Black Death
Boccaccio
_Teseida_
_Il Filostrato_
Bodmin Gospels
Body and Soul debates –
Boethius, _Consolation of Philosophy_ , ,
_Boeve_
Book of the Dean of Lismore
Book of Durrow
_Book of John Mandeville_
Book of Taliesin ,
_Book of Virtues and Vices_
_Breuddwyd Rhonabwy_ ( _Dream of Rhonabwy_ )
_Brut_ , , ; _see also_ Barbour; Layamon; Wace
_Brut y Tywysogion_
Brutus , , ,
C
_Cædmon's Hymn_ –,
Cambridge
Corpus Christi College 201 ,
Corpus Christi College 61
Trinity College, B. 14. 39 , –
University Library, Ff. 1. 16 (Findern Manuscript)
University Library, Kk. 5. 16 (Moore Bede) –
_caritas_ –
Carmarthen
_carole_ –
_Castle of Perseverance_
Caxton, William , ,
Celts and Celtic culture , –, , , , , , , ; _see also_ languages
_chanson de geste_ ,
_Chanson de Roland_ –
Charlemagne ,
charms
charters
Chaucer, Geoffrey , , , –, , –
_Book of the Duchess_
_Canterbury Tales_ , –, –, , , , –, , , , , ,
_Legend of Good Women_
_Retraction_ , ,
_Troilus and Criseyde_ , , , –, , ,
Chester Mystery Plays ,
_Chevrefoil_ ,
chivalric code , –, ,
Chrétien de Troyes –
Christopher, St
chronicles –,
_Cleanness_
Clemence of Barking, _Vie de Sainte Catherine_
_Cloud of Unknowyng_
Cnut –, ,
Columba
Cathach of –
_Elegy for_ –
_Life of_
Columbanus
_comitatus_ –,
communal text –
community , , , –
confessionals ,
Cornish _see_ languages
courtly love , –, –,
crusades , –
Cuthbert, Gospelbook of –
cycles of drama –
Cycles of the Kings
_cyfarwyddyd_
Cynddylan –
Cynewulf, _Fates of the Apostles_
_cywyddwyr_
D
Dafydd ap Gwilym ,
_Morfudd fel yr Haul_
_Y Rhugl Groen_
Dallan, St –
Dante
_Divine Comedy_
'Dark Ages' –
_Deor_
devil
_Dives et pauper_
drama –, , –
_Dream of the Rood, The_ ,
Dunbar, William, _Lament for the Makaris_
E
Edward the Confessor
Eleanor of Aquitaine , , ,
elegy –, –
Emma, Queen, _Encomium Emmae Reginae_ ,
English _see_ languages
_Englynion y Beddau_ ( _Verses of the Graves_ ) –
epic , –, ,
_Estoire de Merlin_
Exeter Book of Old English Poetry –
F
_fabliau_ ,
Falsaron
Fenian Cycle
_file_ (Irish poet) ,
_fin'amor_ –; _see also_ courtly love
Four Branches _see_ _Mabinogi_
Franks Casket –
_Frauenlieder_
French _see_ languages
friars ,
_fuþorc_ (runes) –,
G
Gaimar, Geoffrey
genre , , , , , –, , , –, ,
Geoffrey of Monmouth , , –
Gerald of Wales
_Gemma ecclesiastica_
_Itinerarium Cambriae_ –,
_Topographia Hibernica_ –
Germanic Heroic Code , –, ,
Gildas , –, ,
gnomic literature
Godric of Finchale, lyrics
goliardic literature
Gospels , , , ,
Gower, John –,
_Confessio amantis_ –
Guest, Charlotte
Guillaume de Machaut
_Gui de Warewic_ ( _Guy of Warwick_ ) ,
Gwallwg
H
Hales, Thomas, _Love-Ron_
_Hali Meiðhad_
_Havelock the Dane_
heaven , , , , ,
Heledd Cycle –
hell , –
Henry I –
Henry II , ,
Henry IV
Henry V
Henry of Huntingdon, _Historia Anglorum_
Henryson, Robert –, –
Hereford, _Mappa Mundi_
heroic verse , , –, , , , ,
Hilton, Walter, _Scale of Perfection_
Hoccleve, Thomas, _Regiment of Princes_ , , –,
Hoxne
I
identity –,
Iolo Goch
_Sir Hywel y Fwyall_
Irish _see_ languages
Isidore of Seville
J
Jacobus de Voragine, _Golden Legend_
James I of Scotland, _Kingis Quair_ –,
Jews
John of Gaunt , ,
Julian of Norwich
_Revelations of Divine Love_
K
_Katherine Group_
_King Horn_ , –
_King of Tars_ –
knights , , , –, , –
Knights of the Round Table , , –; _see also_ Arthurian literature
L
_Land of Cockayne_
Langland, William
_Piers Plowman_ –, , , –, ,
languages and writing systems
Cornish , , ,
English, Middle , , –, –,
English, Old , , , –, , –, , , , , ,
French , , –, , , , –, , , , –, , , , ,
Gaelic ,
Irish –, , , –, –, , , , , , , –, ,
Latin –, , –, –, –, , –, , –, , , , , , –, ,
Ogham –,
Old Norse (or Scandinavian) , , , , , , –
Pictish , ,
Scottish , , , , , , , –
Welsh , , –, , , –, , –, –, , , , ,
_Lanval_
Lateran Councils , ,
Latin _see_ languages
Laugharne
law , , ,
_Lay Folks' Catechism_
Layamon, _Brut_ ,
lays , –,
_Leabhar Breac_
_Leabhar Mhic Cárthaigh Riabhaigh_ ( _Book of Lismore_ )
_Lebor Laignech_ ( _Book of Leinster_ )
_Letter of Prester John_
_Liber monstrorum_
Lindisfarne Gospels
_Llyfr Du Caerfyrddin_ ( _Black Book of Carmarthen_ )
London, British Library
Cotton Nero A. x ( _Gawain_ -manuscript) –
Cotton Nero D. iv (Lindisfarne Gospels)
Cotton Vitellius A. xv ( _Beowulf_ -manuscript) –, ,
Harley 913
Harley 978 –
Harley 2253 , ,
Lydgate, John –
_Life of our Lady_
_Siege of Thebes_
_Temple of Glass_
_Troy Book_
lyric , , –, –, ,
M
_Mabinogi_ , , –,
makars , ,
Malory, Thomas
_Le Morte Darthur_ –, , ,
manuscript production –,
Manuscripts
Aberystwyth, National Library of Wales _see_ Aberystwyth, National Library of Wales
Cambridge _see_ Cambridge
Dublin, Royal Irish Academy 23 P 16
Edinburgh, National Library of Scotland, Advocatesx 19. 2. 1 (Auchinleck Manuscript)
Exeter, Cathedral Library, 3501 (Exeter Book) –
London, British Library _see_ London, British Library
Oxford, Bodleian Library _see_ Oxford, Bodleian Library
St Petersburg, National Library of Russia, lat. Q. v. I. 18 –
Margaret, St –
Margery Kempe –
_Book of Margery Kempe, The_
Marie de Champagne
Marie de France, _Fables_ –
_Lais_ –, , ,
_Marvels of the East_ ,
Matilda, Empress and Queen
'Matter of Britain', romance ,
'Matter of Rome', romance
Meilyr Brydydd
Merlin
monstrosity –
multilingualism and multidialectalism , –, , , , , , –
music , , , , –
mysticism –,
N
national identity –
Nine Worthies
Norman Conquest , , ,
Nun of Barking, _La Vie d'Edouard le confesseur_
O
_Of One That is So Fair and Bright_ –
oral literature , –, , , , , ; _see also_ performance
_Ordinalia_ , ,
_Orfeo_ –
origin myths –, –, , –, ,
Orkney
Orm, _Ormulum_ ,
Osbern Bokenham, _Legendys of Hooly Wummen_
Óttarr svarti
Ovid ,
_Metamorphoses_
_Owl and the Nightingale, The_
Oxford, Bodleian Library
Arch. Selden B. 24
Bodley 791 ( _Ordinalia_ ) –
Digby 23
Rawlinson poet. 241
P
_Pangur Bán_
Paston, Agnes –
_pastourelle_
_Patience_
patronage , –, , , –, , , , , –
_Pearl_
Peasants' Revolt
penitentials –
_Perspice Christicola_
Petrarch ,
performance –, ,
of writing
Picts ,
_Pierce the Ploughman's Crede_
_Piers Plowman_ _see_ Langland
_Play of the Sacrament_ –
_Poema Morale_
poetic form –
poets –
praise poetry –
preaching –; _see also_ sermons; saints' lives
_Pride of Life_ –
print –
prognostications
Pryderi, King of Dyfed
R
Ralph d'Escures
Reginald of Coldingham
regionalization –
religious orders , –, –
_reverdie_ ,
Rhygyfarch ap Sulien, _Life of St David_
Rhyme Royal , ,
Richard II , ,
Richard Rolle, _Ego Dormio_
Robert Mannyng of Brunne, _Handlyng Synne_ –
Rome
romance –, , –, –, , –
Renaissance ,
Ruskin, John
Ruthwell Cross , ,
S
saints' lives (hagiography) , –, , –, ,
salvation –
Saracen , –,
_scop_ , –
Scotti ,
Scottish literature _see_ languages
scribes –, –, , , ,
_Seafarer, The_
_Second Shepherd's Play_
sermons –, , , –
shape-shifting –
sin –
Siôn Cent –
_Sir Gawain and the Green Knight_ , , –, , , ,
_Sir Gowther_
skald (Old Norse poet), skaldic culture , –
_Somme le roi_
_South English Legendary_ –
_Spoils of Annwn_
_Sumer is icumen in_
supernatural –
T
tail-ryhme verse
_Táin Bó Cúailnge_ –,
Taliesin –
textual communities –
Thomas, _Roman de Horn_
Thomas of Britain, _Tristan and Iseut_ –
Thomas of Chobham, _Summa confessorum_
Thomas of Norwich, _Life and Miracles of St William_
Tristan
troubadour ,
trouvère ,
U
_Ubi sunt?_ –
Ulster Cycle
universities ,
Urien –,
V
Vikings , ,
Vernon Manuscript
W
Wace , , ,
Wakefield master
Wales and Welsh , , –, ; _see also_ languages
Walter Map, _De nugis curialium_ –,
_Wanderer, The_ ,
Weland the Smith
West Saxon
_When the Turf is your Tower_ –
_Widsith_
_Wife's Lament_
William of Malmesbury ,
_Gesta regum Anglorum_
_Vita Wulfstani_
William of Winchester
Winchester Malory –
_Wulf and Eadwacer_
Wulfstan of York, _Sermo Lupi ad Anglos_ –
Wycliffe, John
Y
_Y Gogynfeirdd_
_Y Tair Rhamant_ ( _Three Romances_ )
_Yonec_
York Corpus Christi Plays
# SOCIAL MEDIA
# Very Short Introduction
Join our community
www.oup.com/vsi
• Join us online at the official Very Short Introductions **Facebook** page.
• Access the thoughts and musings of our authors with our online **blog**.
• Sign up for our monthly **e-newsletter** to receive information on all new titles publishing that month.
• Browse the full range of Very Short Introductions online.
• Read **extracts** from the Introductions for free.
• Visit our library of **Reading Guides**. These guides, written by our expert authors will help you to question again, why you think what you think.
• If you are a teacher or lecturer you can order inspection copies quickly and simply via our website.
# Table of Contents
1. Cover page
2. Halftitle page
3. Series page
4. Title page
5. Copyright page
6. Dedication page
7. Contents
8. Acknowledgements
9. List of illustrations
10. Introduction: endings and beginnings
1. The Dark Ages
2. Early literary issues
3. The big questions
11. Chapter 1 Literary origins
1. On origins
2. Mixing traditions
12. Chapter 2 Textual production and performance
1. Making books
2. Textual communities
3. Composing and performing
4. Textual settings
13. Chapter 3 Literary spaces, literary identities
1. Reading and hearing
2. Capturing audiences, creating history
3. Identifying with literary heroes
4. Hybrid cultures
5. Regional identity through dialect
14. Chapter 4 Individual and community
1. Collective ideals
2. On proper conduct
3. Building a communion
4. From communion to community
15. Chapter 5 The mighty and the monstrous
1. Order and chaos
2. Size matters
3. Encountering and transforming
16. Chapter 6 Love and longing
1. From elegiac to lyric
2. Love of a lady
3. Speaking of love
4. Love of the lord and lady
17. Chapter 7 Death and judgement
1. Desiring salvation
2. Preaching salvation
3. Punishing and persecuting
4. From superstition to persecution
18. Chapter 8 Consolidating literary traditions
1. Singing of princes
2. 'Men take of it heed'
3. The flowering of national literatures
4. Ordering books, writing lives
19. Chapter 9 Coda: print and the canon
20. Further reading
21. Index
22. Social Media
## Landmarks
1. Cover
2. Title page
3. Table of Contents
## Pages
1. i
2. ii
3. iii
4. iv
5. v
6. vi
7. vii
8. viii
9. ix
10. x
11. xi
12. xii
13. xiii
14. xiv
15. xv
16. xvi
17. xvii
18. xviii
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
139.
140.
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
151.
152.
153.
154.
155.
156.
157.
158.
159.
160.
|
Photoelectric and Spectroscopic Observations Related to a Possible Optical Counterpart for Pulsar CP 1919+21.
Spectroscopic observations of the two stars near the pulsar CP 1919+21 are not sufficiently conclusive to permit an identification of either object with the source of the radio pulses. However, our most extensive series of photometric observations of a region of sky near the radio source position, which region includes the brighter of the two stars, suggests an approximately sinusoidal variation. It is significant that the period of the variation is double the period of the radio pulsations.
|
544 U.S. 1029
MONCRIEFv.UNITED STATES.
No. 04-1316.
Supreme Court of United States.
May 16, 2005.
1
C. A. 5th Cir. Reported below: 133 Fed. Appx. 924.
2
Certiorari granted, judgments vacated, and cases remanded for further consideration in light of United States v. Booker, 543 U.S. 220 (2005).
|
/*
* Copyright 2015-present Open Networking Foundation
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package org.onosproject.virtualbng;
import static org.slf4j.LoggerFactory.getLogger;
import java.nio.ByteBuffer;
import org.osgi.service.component.annotations.Activate;
import org.osgi.service.component.annotations.Component;
import org.osgi.service.component.annotations.Deactivate;
import org.osgi.service.component.annotations.Reference;
import org.osgi.service.component.annotations.ReferenceCardinality;
import org.onlab.packet.ARP;
import org.onlab.packet.Ethernet;
import org.onlab.packet.Ip4Address;
import org.onlab.packet.MacAddress;
import org.onosproject.core.ApplicationId;
import org.onosproject.core.CoreService;
import org.onosproject.net.ConnectPoint;
import org.onosproject.net.flow.DefaultTrafficSelector;
import org.onosproject.net.flow.DefaultTrafficTreatment;
import org.onosproject.net.flow.TrafficSelector;
import org.onosproject.net.flow.TrafficTreatment;
import org.onosproject.net.packet.DefaultOutboundPacket;
import org.onosproject.net.packet.InboundPacket;
import org.onosproject.net.packet.PacketContext;
import org.onosproject.net.packet.PacketPriority;
import org.onosproject.net.packet.PacketProcessor;
import org.onosproject.net.packet.PacketService;
import org.slf4j.Logger;
/**
* When the upstream gateway which is outside local SDN network wants to send
* packets to our local public IP addresses, it will send out ARP requests to
* get the MAC address of each public IP address. Actually, there are no hosts
* configured with those public IP addresses, so this class is to emulate the
* behavior of the non-existed hosts and return ARP replies.
* <p>
* Since we will rewrite the destination MAC address in the switch before
* traffic packets go to the destination, so the MAC address can be any number.
* We manually configured a random MAC address for this purpose in the vBNG
* configuration file.
* </p>
*/
@Component(immediate = true)
public class VirtualPublicHosts {
private final Logger log = getLogger(getClass());
private static final String APP_NAME =
"org.onosproject.virtualbng.VirtualPublicHosts";
@Reference(cardinality = ReferenceCardinality.MANDATORY)
protected CoreService coreService;
@Reference(cardinality = ReferenceCardinality.MANDATORY)
protected PacketService packetService;
@Reference(cardinality = ReferenceCardinality.MANDATORY)
protected VbngConfigurationService vbngConfigService;
private ApplicationId appId;
private ArpRequestProcessor processor = new ArpRequestProcessor();
@Activate
public void activate() {
appId = coreService.registerApplication(APP_NAME);
packetService.addProcessor(processor, PacketProcessor.director(6));
requestIntercepts();
log.info("vBNG virtual public hosts started");
}
@Deactivate
public void deactivate() {
withdrawIntercepts();
packetService.removeProcessor(processor);
processor = null;
log.info("vBNG virtual public hosts Stopped");
}
/**
* Request packet in via PacketService.
*/
private void requestIntercepts() {
TrafficSelector.Builder selector = DefaultTrafficSelector.builder();
// Only IPv4 is supported in current vBNG.
selector.matchEthType(Ethernet.TYPE_ARP);
packetService.requestPackets(selector.build(),
PacketPriority.REACTIVE, appId);
}
/**
* Cancel request for packet in via PacketService.
*/
private void withdrawIntercepts() {
TrafficSelector.Builder selector = DefaultTrafficSelector.builder();
// Only IPv4 is supported in current vBNG.
selector.matchEthType(Ethernet.TYPE_ARP);
packetService.cancelPackets(selector.build(),
PacketPriority.REACTIVE, appId);
}
/**
* This class filters out the ARP request packets, generates the ARP
* reply packets, and emits those packets.
*/
private class ArpRequestProcessor implements PacketProcessor {
@Override
public void process(PacketContext context) {
InboundPacket pkt = context.inPacket();
Ethernet ethPkt = pkt.parsed();
// Only handle the ARP packets
if (ethPkt == null || ethPkt.getEtherType() != Ethernet.TYPE_ARP) {
return;
}
ARP arpPacket = (ARP) ethPkt.getPayload();
// Only handle ARP request packets
if (arpPacket.getOpCode() != ARP.OP_REQUEST) {
return;
}
Ip4Address targetIpAddress = Ip4Address
.valueOf(arpPacket.getTargetProtocolAddress());
// Only handle an ARP request when the target IP address inside is
// an assigned public IP address
if (!vbngConfigService.isAssignedPublicIpAddress(targetIpAddress)) {
return;
}
MacAddress virtualHostMac =
vbngConfigService.getPublicFacingMac();
if (virtualHostMac == null) {
return;
}
ConnectPoint srcConnectPoint = pkt.receivedFrom();
Ethernet eth = ARP.buildArpReply(targetIpAddress,
virtualHostMac,
ethPkt);
TrafficTreatment.Builder builder =
DefaultTrafficTreatment.builder();
builder.setOutput(srcConnectPoint.port());
packetService.emit(new DefaultOutboundPacket(
srcConnectPoint.deviceId(),
builder.build(),
ByteBuffer.wrap(eth.serialize())));
}
}
}
|
Berlin Platz für Massen statt zwei Klassen: Bernd Riexinger will die besseren Plätze los werden. Doch die Bahn meint: Viel wäre damit nicht gewonnen. Die privilegierten Sitze hat sie nicht ohne Grund.
Schneller ist sie nicht, aber angenehmer: Mit der 1. Klasse im Regio kommen Pendler meist entspannter ins Büro. Mehr Platz, mehr Ruhe - zum Arbeiten oder für ein Nickerchen.
Nun heißt es: Hinweg die Glastüren mit der "1"! "Die sollten einfach für alle geöffnet werden", fordert Linke-Chef Bernd Riexinger. Sein Ziel: die Abschaffung der 1. Klasse im Nahverkehr. "Dann hätten wir auf einen Schlag mehr Kapazität für alle - und zwar praktisch gratis."
Doch so einfach ist es nicht. Widerspruch folgte prompt. "Sozialistische Gleichmacherei", sieht der Bahnbeauftragte der Bundesregierung, Enak Ferlemann. "Grober Unfug", kommentierte der Fahrgastverband Pro Bahn und der Verband deutscher Verkehrsunternehmen schloss sich an. Die Bahn selbst machte deutlich, dass es nicht viel bringen würde, die privilegierten Plätze auszubauen.
Was genau stört Riexinger? "Wir leisten es uns, in überfüllten Regionalexpressen fast leere Waggons mit Wagen der 1. Klasse mitzuschleppen", erklärte der Linke-Politiker dem Redaktionsnetzwerk Deutschland (RND). Bus und Bahn müssten aber für alle gut werden, nicht "überfüllt für die einen und fast leer für die anderen". Die 1. Klasse gehöre abgeschafft, im Bus gebe es sie ja auch nicht.
Allerdings gibt es gar nicht mehr so viele 1.-Klasse-Plätze wie früher. S-Bahn-Kunden finden sie noch in Frankfurt, Stuttgart, Hannover, Leipzig, Rostock und in den Netzen Rhein-Neckar und Rhein-Ruhr. In Regionalzügen sind ganze Wagen für die besseren Plätze - wie von Riexinger beschrieben - äußerst selten. Es sind meist kleinere Bereiche oder einzelne Etagen in Doppelstockwagen.
Die Deutsche Bahn fährt zwei Drittel aller Regionalzüge in Deutschland. 6,5 Prozent ihrer rund eine Million Sitzplätze sind nach Konzernangaben noch der 1. Klasse vorbehalten. "Der Anteil der 1.-Klasse-Kapazitäten ist über die Jahre zurückgegangen, allerdings wird dieses Angebot weiterhin in vielen Regionen nachgefragt", sagte ein Sprecher.
Manchmal sind die Sitze nicht breiter als in der 2. Klasse. Die Bahn geht davon aus, dass ein Ende der 1. Klasse nur "sehr geringfügig", mehr Plätze bringen würde. "Wenn ich mehr Platz schaffen will, brauche ich längere Züge", sagte der Ehrenvorsitzende des Verbands Pro Bahn, Karl-Peter Naumann. Die 1. Klasse aber müsse bleiben. Gerade auf längeren Strecken und im Berufsverkehr schätzten Fahrgäste die Aussicht auf freie Sitzplätze und ruhiges Arbeiten.
Fahre in einem Zug mal ein Wagen mit weniger 1.-Klasse-Plätzen als vorgesehen, gingen sofort Kundenbeschwerden ein, sagte ein Sprecher des Verkehrsverbunds Berlin-Brandenburg. Der Verbund bestellt im Auftrag der Länder, Landkreise und Städte Verkehrsleistungen für die Region. So ist es bundesweit: Eisenbahnunternehmen statten ihre Züge so aus, wie es die öffentlichen Auftraggeber der Region möchten.
Anders ist es im Fernverkehr mit ICE und Intercity, den die Bahn auf eigene Rechnung betreibt. Dort ist die 1. Klasse fester Bestandteil der Züge. Mit Gratis-Zeitungen, Bedienung am Platz, unbegrenztem WLAN im ICE und Zugang zu exklusiven Wartebereichen (Lounge) am Bahnhof. Das soll helfen, Geschäftsreisende aus dem Flieger in den Zug zu locken - so wie es auch das Ziel ist, autofahrenden Pendlern mit guten Regionalzügen das Bahnfahren schmackhaft zu machen.
Bei der Buchung für ICE und Intercity macht die Bahn ihren 2.-Klasse-Kunden inzwischen die besseren Plätze schmackhaft. So bietet sie etwa für schwach ausgelastete Züge zu relativ geringen Aufpreisen Erste-Klasse-Plätze an. Das soll den Verdienst pro Kunde steigern. Der Bahnbeauftragte Ferlemann sieht es so: "Wenn jemand für breitere Sitze und mehr Platz bezahlen will, so soll man das Reisen doch so ermöglichen."
Ähnlich Niedersachsens Ministerpräsident Stephan Weil: "Wenn es genug Menschen gibt, die gerne auf diese Art und Weise fahren wollen, dann soll es auch ein entsprechendes Angebot geben", sagt der SPD-Politiker. "Und wenn die Kunden zweiter Klasse fahren wollen, dann muss es genügend Züge und Waggons geben für die zweite Klasse."
Riexinger selbst erhält als Bundestagsabgeordneter eine Bahncard 100 für die 1. Klasse. Seither reist er auch 1. Klasse, wie er auf Nachfrage erklärte. "Gerade wenn die zweite Klasse überfüllt ist, ergibt es ja wenig Sinn, wenn ich dann noch einen weiteren Platz belege."
|
Q:
How can I prevent a third party from calling certain methods?
I have an assembly which is being developed to create a facade around some potentially sensitive functionality and I want to allow a third party to call some of the methods contained within it but not others.
How can I prevent the third party calling unauthorised methods given they will have access to the entire DLL (I'm not concerned about them seeing the code, just executing it)?
This has to be compatible with the .net compact framework so unfortunately using the StrongNameIdentityPermission attribute is not possible.
A:
I think you should ship two Facade implementations, one for 'internal' consumers which exposes all methods and another external that exposes only the sub-set. You can achieve this whilst maintaining only one code base by having two separate build processes. One technique that springs to mind is to use compiler directives to exclude a method from the external build, or mark it internal if it is required by other public methods. If you do ship sensitive methods with internal modifiers you may also want to implement obfuscation.
EDIT
Perhaps it would be cleaner, rather than having directives around each method to use partial classes, define a partial class for the sensitive methods and put the entire class implementation in a directive.
public partial class MyClass
{
public void NonSensitive(){}
}
#if INTERNAL_BUILD
public partial class MyClass
{
public void Sensitive(){}
}
#endif
You can have this partial class in the same or a separate file, which might be a nice level of separation as you could prepend the file name x_Sensitive.cs or similar.
|
Q:
Ugly combination of generator expression with for loop
The following appears in my Python 2.6 code:
for src, dst in ([s,d] for s in universe for d in universe if s != d):
Can I do much better? What I particularly don't like is that I'm in effect specifying the same pair twice, once for the for loop and again for the generator expression. I'm uncertain whether I'd prefer:
for src, dst in itertools.product(universe, universe):
if src != dst:
Is there a way to express this loop concisely?
universe happens to be a list, if it makes any difference. Order of iteration doesn't matter.
A:
You could use simple nested for-loops:
for src in universe:
for dst in universe:
if src == dst:
continue
...
I'd say this is the most easy to read syntax in this case.
A:
I suggest keeping it entirely functional or entirely with comprehensions. Here's an implementation that's entirely functional.
import itertools
import operator
def inner_product(iterable):
"the product of an iterable with itself"
return itertools.product(iterable, repeat=2)
def same(pair):
"does this pair contain two of the same thing?"
return operator.is_(*pair)
universe = 'abcd'
pairs = inner_product(universe)
unique_pairs = itertools.ifilterfalse(same, pairs)
for pair in unique_pairs:
print pair
"""
('a', 'b')
('a', 'c')
('a', 'd')
('b', 'a')
('b', 'c')
('b', 'd')
('c', 'a')
('c', 'b')
('c', 'd')
('d', 'a')
('d', 'b')
('d', 'c')
"""
|
Energy-efficient glass startup Soladigm announced today that it has nabbed $30 million in third-round equity financing, led by DBL Investors and Nano Dimension.
Soladigm makes electrochromics glass that automatically adjusts tint, which can reduce visual glare and cut cooling and heating costs for commercial buildings. The company was among several winners announced last month in the Ecoimagination challenge, a GE and venture capital-backed contest for clean energy startups.
Soladigm says that, with the new cash, it’s ready to go into high-volume commercial production via its $130 million factory in Olive Branch, Miss., for which the company received a $40 million loan from the state, as well as $4 million in project improvement incentives.
As we’ve previously noted, smart glass is something of a mini-trend within the overall wave of interest in greening commercial buildings. Top construction materials and glass company Saint-Gobain is also betting on the appeal of smart glass. Earlier this month, that company invested $80 million in smart glass-maker Sage Electrochromics, which has won a $72 million conditional loan guarantee from the government and is planning to build a plant in Minnesota.
The latest Soladigm round was led by DBL Investors and Nano Dimension, and included investment from GE, Khosla Ventures and Sigma Partners.
Tags: ecoimagination, electrochromics, smart glass
Companies: Dbl Investors, GE, Khosla Ventures, Nano Dimension, Sigma Partners, Soladigm
Copyright 2010 VentureBeat. All Rights Reserved.
|
fails:Hash#hash generates a hash for recursive hash structures
fails:Hash#hash returns the same hash for recursive hashes
fails:Hash#hash returns the same hash for recursive hashes through arrays
|
Q:
Is it possible to call debug_traceTransaction from nodejs?
Following answer (https://ethereum.stackexchange.com/a/9437/4575) [ 1 ] guide us to call debug_trace through using geth:
As documented in debug.traceTransaction(...), you can only access this API call using the geth JavaScript console or the JSON-RPC API. There
is no web3 API that I know of. There are some unofficial extension
web3 APIs, but I don't know if debug.traceTransaction is supported by
these. Looks like you have to use JSON-RPC to access this data.
but I was wondering is it possible to call debug_Transaction inside nodejs ?
I tried the steps on https://ethereum.stackexchange.com/a/9462/4575 [ 2 ] but it seems does not work for me and this answer seems contradict with the previous answer I have lined on [ 1 ].
var web3 = new Web3();
web3.setProvider(new web3.providers.HttpProvider('http://localhost:8545'));
web3.currentProvider.sendAsync({
method: "debug_traceTransaction",
params: ['<transaction_id>', {}],
jsonrpc: "2.0",
id: "2"
}, function (err, result) {
console.log( result );
});
Output result:
{ jsonrpc: '2.0',
id: '2',
error:
{ code: -32601,
message: 'The method debug_traceTransaction does not exist/is not available' } }
Thank you for your valuable time and help.
A:
(Here is the same response as the one I added to the question referenced above)
If I start geth using the following command line:
Iota:~ user$ geth --rpc console
And I try to execute the following curl command:
Iota:~ user$ curl localhost:8545 -X POST --header 'Content-type: application/json' --data '{"jsonrpc":"2.0", "method":"debug_traceTransaction", "params":["0x3684f071b34da1116282ee88a106a8f2a266d273ef7d8964957f65128fb58d77", {}], "id":1}'
I get the following result:
{"jsonrpc":"2.0","id":1,"error":{"code":-32601,"message":"The method debug_traceTransaction does not exist/is not available"}}
If instead I start geth with the following command:
Iota:~ user$ geth --rpc --rpcapi "eth,net,web3,debug" console
And I run the same curl command, I get the transaction trace as shown below:
{"jsonrpc":"2.0","id":1,"result":{"gas":45480,"returnValue":"0000000000000000000000000000000000000000000000000000000000000001","structLogs":[{"pc":0,"op":"PUSH1","gas":76741,"gasCost":3,"depth":1,"error":null,"stack":[],"memory":null,"storage":{}},{"pc":2,"op":"PUSH1","gas":76738,"gasCost":3,"depth":1,"error":null,"stack":["0000000000000000000000000000000000000000000000000000000000000060"],"memory":null,"storage":{}},{ ...
Also note that you cannot get the debug_traceTransaction information from the section of the blockchain that you have --fast synced.
So, you just need to add the --rpcapi "eth,net,web3,debug" command line option.
Update Responding To Comment Below
@Avatar, please check out https://github.com/tjade273/web3_ipc/blob/master/index.js#L328-L335 . See also Why can't I connect by IPC? and Connect to node via IPC as these use the same library.
|
Paul Kimmage spent last week preparing for a date with the international cycling federation, the UCI. He is fielding phone calls, meeting lawyers and reflecting on his 20-plus years as a journalist. This past year has had its ups and downs, or rather, downs and ups. After 10 years of service, the Sunday Times of London made redundant the Irishman this January in as part of overall cost-cutting measures. Around two weeks later, a summons arrived.
“Talk about timing,” Kimmage said on Thursday after meeting with lawyers. “It was not great to say the least. The timing made it a bit cruel.”
The UCI is seeking 8,000 Swiss francs ($8200AUD) and a public apology from Kimmage. President Pat McQuaid and former president, Hein Verbruggen claim, according to Ireland’s Sunday Independent, Kimmage was “dishonest” in accusing them of “having knowingly tolerated tests, of being dishonest people, of not having a sense of responsibility, of not applying the same rules to everyone.”
Kimmage wrote Rough Ride after he retired from cycling in 1989, which revealed the sport’s doping issues, and began working as a journalist. The UCI is more interested in his recent work. In 2011, he highlighted that the UCI allegedly received payments from Lance Armstrong (around $125,000 in 2002) and claims that it overlooked his positive test from the 2001 Tour de Suisse. He also spoke of it in an interview with France’s L’Equipe in July 2011.
This summer he thought the storm blew over. He thought the UCI forgot about him given the Lance Armstrong doping case. However, on September 19, he received a subpoena to appear in a Swiss district court, face-to-face with McQuaid and Verbruggen.
He was at his lowest point all year, he could not tell his wife for two days and was worried about the impact the case would have on three children. A couple days later, though, the Velocity.com, Cyclismas.com, and the world got behind Kimmage and a ChipIn fund was established for his defence fund. It is up to $45,840 ($44,200AUD) and enables him to face the UCI fairly on December 12.
Cycling Tips: What have the last days been like for you?
Paul Kimmage: I’ve gone from being extremely fatigued and frustrated by it to being extremely energised by it. Now I can go there and put up a defence, which wasn’t a possibility a week ago.
CT: Why is the UCI going after you?
PK: I’m astonished. I’m astonished by it. I don’t see the sense in coming after me. If they truly wanted a good name restored to them and if they truly wanted compensation for that, then they would’ve gone after L’Equipe and the Sunday times. [It] was quite vindictive and it was all about keeping me quite, getting a gagging order on me. They just want to shut me up and give me a public slap.
CT: They say you caused them ‘annoyance’ and that their ‘reputation has been seriously damaged’ by articles. Do you agree?
PK: I think their reputation has been damaged by the fact they’ve been at the helm at the professional cycling, between the two of them, for more than 20 years. If it was any other profession, if you were to apply their incompetence, they would’ve been sacked years ago. … You can argue whether I’ve done the damage or if they have done it to themselves, they’re more than capable of doing that to themselves, and I’ve shown that over the years. In their governance of the sport, they’ve been absolutely pathetic.
CT: Would it be easier just to apologise?
PK: I could never apologise to either of those gentlemen, that would be a betrayal of everything I stood for in the last 20 years. The notion that I would apologise in the first place is laughable, the notion that can do so now, given how many people have stood up for me and have put their hands in their pockets for me, make it even more improbable.
CT: How have you prepared for the case?
PK: It’s only now that I’m able to get some legal competence on my side and that I can actually sit down and defend this properly. I’ve spent the last two days looking at that and trying to get the right guys onboard. I hope to try to finalise it now, for them to explain to me how the process works and to take it from there.
CT: What do you make of all the support you’ve received?
PK: I’m absolutely astonished. It’s the most gratifying that has ever happened to me in my career as a journalist. It’s really nice when people tell you they read your pieces and give their support, but when people put their hands in their pocket for you and take out money and say, ‘This is for you. Go and defend that case.’ That takes that support to a completely new level.
CT: Are people are standing up to the UCI by supporting your fund?
PK: Essentially, it’s not about me. Outside of my immediate circle of friends, I believe everybody else, that’s what it’s about. It’s about [the UCI’s] incompetence.
CT: Will it be enough money?
PK: I’ll be governed by what the lawyers say. I know what I want to do, the defence I want to make and that would involve some pretty good witnesses. … My intention would be to fill a Boeing 747 full of people. I know that won’t actually be enough, in terms of people who’ve been disenfranchised and have witnessed how badly the sport’s been run first hand. I know a Boeing 747 won’t be enough, but I hope maybe to get two or three.
CT: Would you consider Tyler Hamilton?
PK: That would be the obvious place to start.
CT: The UCI brought in the biological passport and acts against dopers. Is it a good or bad force in cycling?
PK: The fact that we’re going to be sitting across from each other in a court room in a couple of months time is indicative of how I feel about what sort of job they’ve done, which again, I think it’s an utter disgrace for the last 20 years.
CT: They introduced the biological passport…
PK: There’s nothing wrong with that, that’s great, that’s fantastic. The biological passport and all the other controls are absolutely fantastic, but they are utterly fucking worthless when it’s selective. In terms of, ‘Oh, we are not going to chase him, we are going to chase him.’ Or, ‘We can’t run with that positive test but we can definitely run with those positives.’ When you are in a situation like that or you have stuff like that happening, all the other stuff is worthless.
CT: Are the tests better in a third party’s hands, like WADA?
PK: Absolutely.
CT: McQuaid said at the Worlds, “A certain number of you [journalists] are so focused on doping that you don’t see what else is going around, and cycling does suffer from that perception.” Are journalists writing too much about doping?
PK: I would ask Pat to go and do a random poll of sports fans, ask them what their presentation of cycling is and what their perception of the Tour de France is and see what the result of that poll would be. … I think you know the answer of that already.
CT: How much change do you think you’ve brought to the sport?
PK: I believed when Rough Ride was published in 1990 that it was going to change everything. I believe that book was going to absolutely transform the doping problem in the sport, and here we are 22 years later and the reality is that it changed absolutely nothing. As much as I’d like to tell you I had a fantastic influence on the sport and I’ve been change for the good of the sport, the truth is it’s nothing.
CT: Can the UCI do more?
PK: They could’ve started 22 years ago by reading what I wrote back then, by implementing the changes I suggested. That would’ve been a start. I’m not sure whether Hein Verbruggen can’t read or just doesn’t read. Clearly, he didn’t read Rough Ride. … I suggest that was where the start of the battle was lost, back in 1990.
CT: Does the UCI need to make changes in-house?
PK: I don’t think it is possible to work within that system. I don’t know how you could set up an independent system that would be different from the one that is there now. I would hope that there are some people within in there that could start the change. I do know what needs to happen, Mr Verbruggen and Mr McQuaid need to go straight away. That’s the start of it.
CT: What motivates you to keep at the doping side of the sport?
PK: I’m insane. Maybe I am. I don’t know. I do and have asked a lot lately, certainly a lot during the summer. What difference does it make? No difference, maybe. Don’t get me wrong, in this last week I’ve had my reward. What I found out is that I actually have made a difference in terms of energising people and educating people in this world, creating awareness about the real problem being there. In terms of addressing the actual problem itself, no, I haven’t, but in terms of the general public and trying to give them a sense of what’s wrong, I know now that I have made a difference. That is extremely gratifying.
CT: Have many journalists too complacent in the past?
PK: Do I think they’re too complacent? I think there are a lot of reasons why this sport is in this position, at the top of that list is the way it’s been governed. But the role that the media has played is at the top of that list as well. The degree to which we are complicit in the problem, as well, I would never ignore that. That has definitely been a huge part of the problem. I’m talking back to the 80s and 90s.
CT: Are the journalists not writing all they know?
PK: Yes. When they are not asking questions and not holding Verbruggen and now McQuaid account for what’s happening in the sport, with doping in the sport and generally. They just carry on and do what they want basically.
CT: Looking back, would you have done anything differently in your career as a journalist?
PK: I thank the lord that the first thing I did when I retired was that I wrote that book. I absolutely thank god that I did that, anything good anything decent I archived as a journalist stems from the moment I decided to do that. It was difficult because I was quite popular in the sport and I left the sport on my terms, looking to go into a good job, it was a difficult call at the time, but I thank god I did that. I wouldn’t change it.
——————-
UPDATE (Sept. 2, 2012): The UCI issued a statement today in which it sought to clarify its position regarding its current legal actions against Paul Kimmage:
|
Website Kucoin Launchpad Tokoin (TOKO) IEO Not Verified Tokoin is a blockchain-based platform with a mission to build digital profiles, digital bookkeeping, access to business support institutions through Tokoin’s mobile applications that are ready to advance your business and your life. IMPORTANT: By investing in this business you agree to our Disclaimer. All information including our rating, is provided merely for informational purposes. CryptoTotem does not provide investment advice. Overview Project industry Finance Services & Banking Product type Cryptocurrency Founded Indonesia Technical details Tokoin is a platform that establishes the digital business identity and reputation of micro, small & medium enterprises (MSME) as acceptable credibility scoring for suppliers and financial institutions. Tokoin aims to: - Build a digital business identity for MSME that represents a valid business reputation - Build a digital ledger for MSME that records real-time transaction data and provides opportunities to distribute the data to the relevant parties in the ecosystem, hence monetizing their data. - Build a digital ledger for MSME that records real-time transaction data and provides opportunities to distribute the data to the relevant parties in the ecosystem, hence monetizing their data. - Grow opportunities by lowering transaction costs, increasing buying power, and providing the previously inaccessibles access for business partnership - Suppress the financial inclusion barriers Charts 1h 24h 7d 14d 30d 1y Price Market Cap 24h 7d 14d 30d 60d 90d 180d 365d Max EUR BTC ETH
Click here to try again Unable to load chart data. What is Tokoin Tokoin is a platform that establishes business identity as an acceptable reputation in the business ecosystem. Tokoin presents a better modern business ecosystem that offers valuable partnerships to address inclusive growth. As a platform, Tokoin captures and processes business information from the users as a valuable asset, which, in our ecosystem, translates into a marker for the trusted reputation of the businesses, including but not limited to MSMEs, as our users. This enables them to access previously inaccessible financial business services from providers, which act as our partners. Therefore, Tokoin links the business and financial sectors to launch a scheme of financial inclusion. The partnerships formed in Tokoin will subsequently contribute to the national economic growth. Tokoin’s platform issues TOKO on the blockchain as a means of interaction between participants. TOKO is used as an incentive when a participant in the ecosystem submits transaction data and validates the data. Also, it is a prerequisite for using certain services on Tokoin platform, including the business insights service provided by Tokoin. Products TokoBITS TokoBITS (Blockchain Integrated Transaction System) is a super application that uses a point-of-sale system that makes it easy for you to manage and run a business. Using blockchain technology, TokoBITS translates the data stored in the app into create digital ledgers and digital business profiles that will facilitate businesses. This data will be used as a credit rating for businesses, especially MSMEs, to gain access to financial intermediaries, suppliers and service services in the blockchain-based Tokoin ecosystem. My-T Wallet Toko Wallet is the first official digital wallet from Tokoin where you can store and transfer your TOKO token. Besides TOKO, you can also manage multiple cryptocurrencies including Bitcoin and Ethereum. Check your balance, transaction history, and securely send and receive cryptocurrencies in this all-in-one crypto app! TokoBook TokoBook is a digital bookkeeping application to manage financial records, including accounts payable and receivable for personal and business accounts. TokoBITS (Blockchain Integrated Transaction System) is a super application that uses a point-of-sale system that makes it easy for you to manage and run a business. Using blockchain technology, TokoBITS translates the data stored in the app into create digital ledgers and digital business profiles that will facilitate businesses. This data will be used as a credit rating for businesses, especially MSMEs, to gain access to financial intermediaries, suppliers and service services in the blockchain-based Tokoin ecosystem.Toko Wallet is the first official digital wallet from Tokoin where you can store and transfer your TOKO token. Besides TOKO, you can also manage multiple cryptocurrencies including Bitcoin and Ethereum. Check your balance, transaction history, and securely send and receive cryptocurrencies in this all-in-one crypto app!TokoBook is a digital bookkeeping application to manage financial records, including accounts payable and receivable for personal and business accounts. Details IEO (Kucoin Launchpad): Aug 23, 2019 - Aug 23, 2019
Token supply: 2,000,000,000 TOKO
Total tokens for sale: 700,000,000 TOKO
Soft cap: 8,000,000 USD
Hard cap: 25,000,000 USD
Raised: 1,000,000 USD
Legal Blockchain Platform: Ethereum
Country limitations: Singapore
Registration country: Indonesia
Token info Ticker: TOKO
Type: Cryptocurrency
Token standard: ERC-20
Token price in USD: 1 TOKO = 0.054 USD
Token distribution:
ICO Contributors - 35%
Industry Fund - 40%
Treasury - 10%
Team & Early Contributors - 10%
Advisors - 5%
Funds allocation:
Product Development - 50%
Marketing & BD - 35%
Operations - 10%
Reserve - 5%
Tokoin Roadmap 1 2018 Q3 TOKOIN Project Start 2 2018 Q4 TOKOIN Token on Private Sale and Pre-Sale TOKOIN Wallet development & distribution 3 2019 Q1 Grand Launching TOKOIN TOKOIN Token on crowd sale 4 2019 Q2 Onboard Blockchain Advisor for TOKOIN ecosystem POC Launch on TestNet 5 2019 Q3 Onboard Warehousing partners to TOKOIN ecosystem Onboard Financial Partners to TOKOIN ecosystem Expand local operations to 10 tier-1 cities in Indonesia 6 2019 Q4 Launch Data Reputation engine Launch Data Visualization platform Launch Partner Suite platform Onboard 50,000 users on TOKOIN ecosystem 7 2020 Q1 Launch dApps on MainNet Launch TOKOIN POS System Launch Data Exchange platform for token stacking and loyalty program Expand local operations to all capital cities in Indonesia Onboard 10,000 users on TOKOIN POS system 8 2020 Q2 Launch TOKOIN POS System Expand pilot hyper-local operations to Thailand Onboard 1000 users to TOKOIN ecosystem on regional hyper-local market Develop AI Solutions for TOKOIN to scale Operations 9 2020 Q3 Expand hyper-local operations to Vietnam and Philippines Onboard 500,000 users to TOKOIN Ecosystem on Indonesia market Expand local operations to 10 top tier-one cities in Indonesia Onboard 50,000 users on TOKOIN ecosystem 10 2020 Q4 Deploying AI as part of Business Intelligence Capabilities Introducing Forecast & Prediction platform into TOKOIN ecosystem 11 2021 Q1 Integration of AI solutions for Financing and Logistics partners 12 2021 Q2 Expansion of hyper-local operations to other potential emerging markets On-board 10,000 users on Tokoin’s hyper-local ecosystem Project team Reiner Rahardja CEO, CO-Founder Eddy Christian COO Welly Salim CTO Ignasius Michael General Manager Adi Darda Gaudiamo Creative Head Michael Handoko VP Commercial Stephanus Andreas Finance & Business Development Silvia Permatasari Operations Social media MVP User rating: 5/5 ( 1 ) 1
Tokoin rating 7.8 Claim admin rights for this project 2.8 / 5 2.8 / 5 NA NA 8.1 / 10 8.1 / 10 TOKO PRICE TOKO/USD TOKO in BTC price Tokoin Price Tokoin ROI Market Cap Market Cap Dominance Trading Volume Volume / Market Cap 24h Low / 24h High 7d Low / 7d High Market Cap Rank All-Time High All-Time Low Tokoin/Bitcoin Ratio TOKO CALCULATOR TOKO USD EUR BTC ETH Tokoin NEWS Tweets by BitTorrent ICO's and Cryptocurrency MyEtherWallet Review (MEW V5) Ethereum's Original Web Wallet ICO's and Cryptocurrency Trezor Model T Review: Hardware Wallet by SatoshiLabs TOKO MARKETS
|
Floral induction by 2,3,5-triiodobenzoic acid in Impatiens balsamina, a qualitative short-day plant.
Floral buds were initiated in Impatiens balsamina plants treated with 2,3,5-triiodobenzoic acid (TIBA) and kept under non-inductive 16- and 24-hr photoperiods, although much later than under inductive 8-hr photoperiods. TIBA did not affect extension growth to any appreciable extent but decreased the number of nodes on the main shoot under 8-hr and increased it under 16- and 24-hr photoperiods. Its effect on the development of lateral buds varied with photoperiod. TIBA-induced flowering resembles gibberellin-induced one, but its mechanism is not clear.
|
Introduction
============
Levodopa has remained the gold standard treatment for the characteristic motor symptoms of Parkinson's disease (PD) for over 30 years.[@b1-cia-4-109] When administered with a dopamine decarboxylase inhibitor (DDCI), levodopa is still the most effective treatment for the cardinal motor symptoms of PD.[@b2-cia-4-109] Its effects are quick and it is well tolerated in the short to medium term.[@b3-cia-4-109] However, the long-term use of levodopa is limited by treatment-emergent motor fluctuations and dyskinesias that can be both challenging to manage and a significant source of disability for patients. The motor complications of levodopa are relatively common, occurring in about 10% of patients per year of treatment, so that by 5 years approximately 50% and by 10 years nearly 100% of patients have developed them.[@b4-cia-4-109] Concerns over the possibility of levodopa-induced motor complications are especially relevant for younger patients with longer life expectancies.
The management of dyskinesias and motor fluctuations in PD patients treated with levodopa is challenging, but a number of guidelines and approaches are available. There is increasing evidence that dopamine agonists may be given in lieu of levodopa to manage motor symptoms of Parkinson's disease and to reduce complications.[@b5-cia-4-109] This approach would delay the need for levodopa and provide more continuous dopamine stimulation and therefore also delay the emergence of motor complications. For motor fluctuations specifically, options include increasing the dose of levodopa, using controlled release levodopa, adjunctive therapy with a dopamine agonist, or using subcutaneous apormorphine for rescue.[@b5-cia-4-109] In other cases it may be appropriate to add other adjunctive medications in an attempt to directly or indirectly offset motor fluctuations and/or to reduce the dose of levodopa required for symptom control.
Levodopa crosses the blood--brain barrier after oral administration, where it is decarboxylated by aromatic acid decarboxylase in the brain and periphery to produce dopamine. Levodopa is typically administered with a DDCI to reduce peripheral metabolism, reducing peripheral dopaminergic side effects (eg, postural hypotension, nausea), and increasing the amount of levodopa reaching the brain. When given in this way, 5% to 10% of levodopa reaches the brain. When decarboxylation is blocked, levodopa is metabolized predominantly to 3-*O*-methyldopa (3-OMD) by catechol-*O*-methyltransferase (COMT), a selective and ubiquitous enzyme involved in the catabolism of levodopa.[@b6-cia-4-109] In the brain, COMT metabolizes levodopa to 3-OMD and dopamine to homovanillic acid.[@b7-cia-4-109] In the periphery, COMT is involved in the conversion of levodopa to 3-OMD. Based on this mechanism, it was posited that inhibiting COMT would result in less degradation of levodopa, and that, when administered with a DDCI, would increase levodopa bioavailability, CNS delivery, and continuity of dopamine stimulation. As a result the dose of levodopa required for therapeutic efficacy could be reduced, and this lower exposure to levodopa should delay or prevent motor complications.
Tolcapone is a potent, selective and reversible inhibitor of COMT in the periphery.[@b8-cia-4-109] It also exerts COMT inhibition in the brain, but the relevance of this effect to its efficacy in PD is less clear.[@b9-cia-4-109] Treatment with tolcapone has been shown to widen the therapeutic window for levodopa as expected, by reducing the doses needed for symptom control.
This review will provide an overview of the pharmacology of tolcapone as it relates to both efficacy and safety, and will then describe literature from clinical trials on the efficacy of tolcapone as adjunctive therapy in fluctuating and stable patients with PD.
Pharmacology
============
Tolcapone is typically administered in oral daily doses of 100 mg or 200 mg tid. The pharmacokinetics of the 100 mg and 200 mg doses show similar pharmacokinetics alone or in combination with levodopa plus a DDCI.[@b10-cia-4-109]--[@b12-cia-4-109] In studies with healthy volunteers tolcapone shows linear pharmacokinetics over the 50 to 400 mg dose range.[@b13-cia-4-109] The pharmacokinetics of tolcapone are the same in healthy volunteers as in patients with PD.[@b14-cia-4-109]
After oral administration tolcapone is rapidly absorbed, with 60% bioavailability due to first pass metabolism.[@b15-cia-4-109] It reaches peak plasma concentration in 30 minutes to 2 hours. Tolcapone is highly plasma protein bound (more than 99.9%) and thus has restricted distribution.[@b13-cia-4-109] Tolcapone undergoes extensive metabolism, primarily through glucuronidation to inactive 3-O-β,D-glucuronic acid conjugate, with 0.5% of drug excreted unchanged.[@b13-cia-4-109],[@b16-cia-4-109]
Tolcapone is eliminated fairly quickly, with an elimination half-life of 1.6 to 3.4 hours.[@b17-cia-4-109] The area under the tolcapone plasma-concentration time curve is dose-dependent,[@b10-cia-4-109] and its pharmacokinetics do not vary in the presence of food, after single vs repeated doses, or as a function of age.[@b18-cia-4-109] There is no evidence of pharmacodynamic tolerance after repeated dosing.[@b19-cia-4-109] There is little accumulation of the methylated metabolite of tolcapone after long-term administration.
Tolcapone reversibly decreases S-COMT activity in erythrocytes in a dose-dependent manner, with a rapid time to maximum inhibition of less than 2 hours. After oral doses of 100 mg or 200 mg, maximum COMT inhibition is 72% and 80%, respectively and returns to baseline approximately 18 hours after the 200 mg dose.[@b10-cia-4-109],[@b11-cia-4-109] COMT inhibition with tolcapone leads to dose-dependent increases in the plasma half-life of levodopa as well as its area under the curve (AUC),[@b10-cia-4-109],[@b11-cia-4-109] without impacting C~max~ or T~max~. Factor et al[@b20-cia-4-109] showed that administration of tolcapone led to an 80% increase in the half-life of levodopa. Other studies have shown that tolcapone in doses of 100 or 200 mg increase the bioavailability of levodopa by as much as 2.1 fold in both healthy volunteers and patients with Parkinson's disease.[@b21-cia-4-109] Consequently, levodopa levels are more continuous (less fluctuating), which should reduce the development of dyskinesias.[@b22-cia-4-109],[@b23-cia-4-109] Indeed, clinical trials in PD have confirmed that tolcapone tid enhances the benefit of levodopa.[@b8-cia-4-109]
In addition, tolcapone has been shown to lower the elevated homocysteine levels associated with levodopa/DDCI treatment in patients with Parkinson's disease,[@b24-cia-4-109] which may have the added benefit of reducing long-term degenerative changes and dementia associated with hyperhomocysteinemia.
The safety and tolerability of tolcapone have been the subject of much discussion and debate since its initial arrival on the market in 1997/1998 based on elevated liver transminases and hepatotoxicity in a small number of initial patients[@b25-cia-4-109] and during post-marketing studies.[@b26-cia-4-109] A number of authors have pointed out that these patients were not managed per protocol and that some were continued on tolcapone in spite of liver function tests that dictated otherwise.[@b27-cia-4-109] Nevertheless, these f indings led to the withdrawal of tolcapone in Europe and in Canada, and a black box warning in the US. The warning required that physicians only use tolcapone after considering or trying other medications, that patients provide informed consent prior to being treated, and that liver enzymes be monitored according to a rigorous schedule. Importantly, the warning mandated that tolcapone therapy be terminated if liver enzymes exceeded the upper limits of normal even once during the treatment period. In the ensuing 7 years and 40,000 more patient years of tolcapone use, no additional occurrences of fatal hepatotoxicity have been linked to the treatment. In light of this, a reconsideration of tolcapone led to its reintroduction into Europe and a re-evaluation of monitoring guidelines by FDA.
Indeed, more recent data have suggested that tolcapone may have a wider safety window than previously believed.[@b26-cia-4-109] For example, a review of tolcapone global safety conducted by Valeant Pharmaceuticals International (data on file) showed that severe hepatocellular damage occurred in only 0.04% of patients over the past 7 years; most of those showing signs of liver toxicity showed elevated liver transaminases but no clinical signs or symptoms.
A review by Olanow[@b28-cia-4-109] of 1535 patients with PD showed that half of the patients that continued on tolcapone showed normalization of ALT/AST within 1 to 3 months as compared to 2 to 3 weeks for those who discontinued the drug. These findings suggest that nonresponders may be identified early in the course of any liver abnormalities, and can be switched to a different medication as indicated. In another study, 677 patients who had never received levodopa were randomly assigned to either placebo add-on therapy or tolcapone add-on therapy to standard doses of levodopa.[@b29-cia-4-109] Liver function elevations at the upper limit of normal (ULN) occurred in 20.2% and 27.5% of patients in the placebo and active treatment groups, respectively; increases greater than 3 times the ULN occurred in 1.2 and 1.7% of patients. No serious hepatoxicity was recorded.
The mechanism of tolcapone-induced hepatoxicity is not known but may relate to abnormalities in mitochondrial respiration in hepatocytes due to uncoupling of oxidative phosphorylation.[@b30-cia-4-109] Tolcapone-induced hepatotoxicity could also be related to elevated catecholamine levels in patients receiving other drugs with adrenergic receptor-mediated toxicity.[@b31-cia-4-109]
Current recommendations suggest performing liver function tests before starting tolcapone, and avoiding its use in patients with evidence of liver disease or who have had two aminotransferease levels above the ULN. Aminotransferase should be monitored every 2 weeks during first year of treatment, every 4 weeks for the next 6 months and then every 8 weeks thereafter.[@b32-cia-4-109],[@b13-cia-4-109]
Tolcapone may also produce dopaminergic side effects related to the increased availability of levodopa, including most notably dyskinesia but also nausea, dizziness, orthostatic hypotension, vomiting, anorexia, sleep disorders, somnolence and hallucinations. These side effects can usually be reduced by reducing the dose of levodopa.[@b3-cia-4-109] Tolcapone can also cause significant diarrhea, headache, abdominal pain and urine discoloration.[@b33-cia-4-109],[@b34-cia-4-109]
Use as adjunctive therapy
=========================
Tolcapone is indicated for patients with idiopathic, fluctuating PD who are being treated with levodopa plus a DDCI,[@b13-cia-4-109] but the specifics differ in the United States and elsewhere. In the United States, tolcapone is specifically indicated for patients who are not responding to or are not candidates for other adjunctive treatment. In Europe, tolcapone is indicated for patients who are either not responding to the other COMT inhibitor or who are intolerant to this type of medication.[@b32-cia-4-109] Treatment should be discontinued in patients who fail to show substantial benefit within the first 3 weeks of treatment.[@b13-cia-4-109],[@b32-cia-4-109] Although tolcapone also is efficacious in patients with stable PD, this class of drug is not recommended for stable patients. In addition, tolcapone is not meant to be used in early untreated patients not taking levodopa/DDCI.[@b17-cia-4-109] Although tolcapone has been shown to inhibit central COMT, its clinical efficacy seems to be mainly mediated through inhibition of peripheral COMT and depends on concomitant use of exogenous levodopa.[@b17-cia-4-109]
The efficacy of oral tolcapone as adjunctive therapy has been shown in several studies over a period of 3 weeks to 3 months in both stable patients and those with motor fluctuations.[@b26-cia-4-109] Tolcapone has been shown to significantly reduce 'off' time in Parkinson's patients with motor fluctuations[@b20-cia-4-109],[@b34-cia-4-109]--[@b38-cia-4-109] and to increase motor function in Parkinson's patients with and without fluctuations.[@b39-cia-4-109],[@b26-cia-4-109]
In a more recent, multicenter, randomized, placebo-controlled parallel group study by Lees and colleages,[@b29-cia-4-109] investigators sought to evaluate the safety and efficacy of adjunctive therapy with tolcapone (100 mg tid; n = 355) vs placebo (n = 342) in patients with early Parkinson's disease treated with levodopa. Patients were assessed for efficacy (UPDRS) monthly for 6 months and then every 3 months, and for safety (liver function tests) at weeks 2, 3, 6, 9, and 12 months. The mean total dose of levodopa over the course of the study was higher in the placebo group (306 mg) than the tolcapone group (284). Although the authors found changes in liver enzymes as shown in previous studies, these changes were transient even when the tolcapone was continued; a large number of patients had slightly high transaminases at baseline but did not go on to develop hepatotoxicity. Another recent study has shown that 6 months of treatment with 200 mg tolcapone plus levodopa/DDCI plus selegiline can promote significant improvement in memory and attention in patients with advanced PD.[@b40-cia-4-109]
Studies also have been done to directly compare tolcapone to another COMT inhibitor on the market, entacapone, or to explore the impact of switching from one of these agents to another. In one study comparing tolcapone (n = 14) to entacapone (n = 11) in PD patients with motor fluctuations, tolcapone was associated with greater reduction in UPDRS motor score and complication subscores (−5.07 vs 2.46, p \< 0.02), duration of 'off' periods (1 hour vs 0.27 hour p \< 0.03), and levodopa dose requirement (−400 mg vs 179.2, p \< 0.04).[@b20-cia-4-109]
Another study (N = 40)[@b41-cia-4-109] in severe PD looked at the effects of switching from entacapone to tolcapone. During tolcapone treatment, 'on' time increased by 15% whereas during entacapone treatment it increased by 8%; similarly, 'off' time was reduced by 16% and 7% in the tolcapone and entacapone groups, respectively. Tolcapone was associated with significantly greater reduction of levodopa dose compared to entacapone (p = 0.05) and was also superior with respect to 'wearing off ' severity and relevant clinical improvement (70%--73% for tolcapone vs 56% for entacapone).[@b29-cia-4-109]
In a double-blind study by Pahwa and colleagues, patients treated with entacapaone were randomly assigned to continue treatment with entacapone (n = 75) or to switch to tolcapone (n = 75). As in the Lees et al study[@b29-cia-4-109] 'on' time increased by more than 1 hour per day in 43% of patients treated with entacapone and 53% of those treated with tolcapone, and by more than 3 hours per day in 13% and 25% of those groups, respectively. Whereas 39% of patients on tolcapone showed moderate to marked improvement, only 25% of patients on entacapone showed an improvement of this magnitude.
In the SWITCH study, motor function was assessed in patients who had switched from entacapone to tolcapone; those that switched had at least 3 hours of additional 'on'time (p = 0.018) and had clinically, but not statistically, significant moderate or marked improvement on the Investigator Global Assessment. More of the tolcapone responders had long-term benefits compared to entacapone. In stable patients, tolcapone showed an overall global improvement of 77% after 4 weeks.[@b26-cia-4-109]
Conclusion
==========
Based on what is known about the neurobiology underlying PD, the pharmacology responsible for both the beneficial and unwanted effects of levodopa, and its clarified safety profile, tolcapone appears to be a rational adjunctive therapy for patients treated with levodopa who do not respond to entacapone. Tolcapone may have a role in PD patients with motor fluctuations despite treatment with entacapone and/or monoamine oxidase B.
**Disclosures**
The author has no conflicts of interest to disclose.
|
Q:
Laravel sharing values from a form in views
I have a project in Laravel, where I want 2 values, resulted after post method from a form, to become global variables in all my views with special prefix.
My code in controller:
public function to_dashboard(UserLocationRequest $request)
{
$my_company_id = $request->my_company_id;
$my_branch_id = $request->my_branch_id;
View::share('my_company_id', $my_company_id);
View::share('my_branch_id', $my_branch_id);
return Redirect('employee/dashboard');
}
After this code I have errors:
'Undefined variable: my_company_id'
'Undefined variable: my_branch_id'
How can I do that, to propagate these 2 values in all my views?
Or how to send these values to my route.php and become global variables with View::share after submitting the form?
A:
The way I will do it is using session in Laravel 5.
You put your values in session key Session::put('key', 'value'); like:
Session::put('my_company_id', $my_company_id);
Session::put('my_branch_id', $my_branch_id);
Then you can fetch the values from any where in Laravel:
$my_company_id = Session::get('my_company_id');
$my_branch_id = Session::get('my_branch_id');
I hope this cover your request.
|
Eveready G45 Golf ECO Halogen Bulbs are an environmentally friendly version of every day popular bulbs. All Eveready low energy ECO halogen bulbs use UV stop glass – this reduces the bleaching effects of Ultra Violet radiation on mate...
The Philips Hue Wireless Bulb features a standard B22 Bayonet light fitting for easy installation and is the ideal replacement or addition to your Hue home lighting set-up. Philips Hue and Friends of Hue lighting ranges offer a convenient way to instantly create the perfect mood in your home. Hue lights, LED strips and bulbs are controlled via the free Hue app, which gives you freedom to turn them
The Philips Hue Wireless Bulb features a standard E27 light fitment for easy installation and is the ideal replacement or addition to your Hue home lighting set-up. Philips Hue and Friends of Hue lighting ranges offer a convenient way to instantly create the perfect mood in your home. The Friends of Hue range is compatible with the Samsung SmartThings range and Apple HomeKit. Hue lights, LED
The Original turntable is reminiscent of the legendary 1965 Philips AG4131 record player and features a high-efficiency speaker a dynamically balanced turntable as well as Bluetooth wireless streaming and USB ripping for MP3 recording. Audio-in for portable music playback The Audio-in connectivity allows direct playback of Audio-in content from portable media players. Besides the benefit of
The Original turntable is reminiscent of the legendary 1965 Philips AG4131 record player and features a high-efficiency speaker a dynamically balanced turntable as well as Bluetooth wireless streaming and USB ripping for MP3 recording. Audio-in for portable music playback The Audio-in connectivity allows direct playback of Audio-in content from portable media players. Besides the benefit of
American Classic Puppy Series Rope Ball puppy toy with squeaker is very soft and cuddly. Puppy toys are designed for safe, durable, pet play. Strong plush fabric, double stitched with embroidered details and no small parts to swallow.
Borussia Dortmund Fanwear Ball Black PUMAs Official Licensed Fanwear gives every fan the possibility to wear his or her team colours in any occasion. The Borussia Dortmund Fanwear Ball is suitable for both training and fun games with friends. The combination of the TPU casing with rubber bladder and machine stitching gives the ball a soft feel, excellent shape, bounce and flight characteristics
Take a dress shirt (or even t-shirt) add this necklace and watch your look elevate instantly out of the ordinary. A perfect piece for parties and special occasions. Matching bracelet and earrings available
|
This week, something different. We speak to astronaut Scott Kelly, who went up to space a man and came back a Rhesus monkey. Just kidding, that didn’t happen at all. Listen to find out the real story. PLUS: We talk to Lynn Levy, star producer of the Gimlet show The Habitat.
Check out the full transcript here: http://bit.ly/2LEvaf7
Selected readings:
This episode has been produced by Romilla Karnick, Wendy Zukerman, and senior producer Kaitlyn Sawrey, with help from Rose Rimler and Shruti Ravindran. We’re edited by Blythe Terrell. With additional help from Lynn Levy and Peter Bresnan. Fact checking by Michelle Harris. Mix and sound design by Emma Munger. Music written by Bobby Lord and Emma Munger. Recording help from Mark Bramhill. Extra thanks to Susan Bailey, Alan Hargens, Chris Mason, the Zukerman Family and Joseph Lavelle Wilson.
|