file_name large_stringlengths 4 140 | prefix large_stringlengths 0 12.1k | suffix large_stringlengths 0 12k | middle large_stringlengths 0 7.51k | fim_type large_stringclasses 4
values |
|---|---|---|---|---|
mole.go | KeepAliveInterval time.Duration `json:"keep-alive-interval" mapstructure:"keep-alive-interva" toml:"keep-alive-interval"`
ConnectionRetries int `json:"connection-retries" mapstructure:"connection-retries" toml:"connection-retries"`
WaitAndRetry time.Duration `json:"wait-and-retry" mapstructure:"wait-and-retry" toml:"wait-and-retry"`
SshAgent string `json:"ssh-agent" mapstructure:"ssh-agent" toml:"ssh-agent"`
Timeout time.Duration `json:"timeout" mapstructure:"timeout" toml:"timeout"`
SshConfig string `json:"ssh-config" mapstructure:"ssh-config" toml:"ssh-config"`
Rpc bool `json:"rpc" mapstructure:"rpc" toml:"rpc"`
RpcAddress string `json:"rpc-address" mapstructure:"rpc-address" toml:"rpc-address"`
}
// ParseAlias translates a Configuration object to an Alias object.
func (c Configuration) ParseAlias(name string) *alias.Alias {
return &alias.Alias{
Name: name,
TunnelType: c.TunnelType,
Verbose: c.Verbose,
Insecure: c.Insecure,
Detach: c.Detach,
Source: c.Source.List(),
Destination: c.Destination.List(),
Server: c.Server.String(),
Key: c.Key,
KeepAliveInterval: c.KeepAliveInterval.String(),
ConnectionRetries: c.ConnectionRetries,
WaitAndRetry: c.WaitAndRetry.String(),
SshAgent: c.SshAgent,
Timeout: c.Timeout.String(),
SshConfig: c.SshConfig,
Rpc: c.Rpc,
RpcAddress: c.RpcAddress,
}
}
// Client manages the overall state of the application based on its configuration.
type Client struct {
Conf *Configuration
Tunnel *tunnel.Tunnel
sigs chan os.Signal
}
// New initializes a new mole's client.
func New(conf *Configuration) *Client {
cli = &Client{
Conf: conf,
sigs: make(chan os.Signal, 1),
}
return cli
}
// Start kicks off mole's client, establishing the tunnel and its channels
// based on the client configuration attributes.
func (c *Client) Start() error {
// memguard is used to securely keep sensitive information in memory.
// This call makes sure all data will be destroy when the program exits.
defer memguard.Purge()
if c.Conf.Id == "" {
u, err := uuid.NewV4()
if err != nil {
return fmt.Errorf("could not auto generate app instance id: %v", err)
}
c.Conf.Id = u.String()[:8]
}
r, err := c.Running()
if err != nil {
log.WithFields(log.Fields{
"id": c.Conf.Id,
}).WithError(err).Error("error while checking for another instance using the same id")
return err
}
if r {
log.WithFields(log.Fields{
"id": c.Conf.Id,
}).Error("can't start. Another instance is already using the same id")
return fmt.Errorf("can't start. Another instance is already using the same id %s", c.Conf.Id)
}
log.Infof("instance identifier is %s", c.Conf.Id)
if c.Conf.Detach {
var err error
ic, err := NewDetachedInstance(c.Conf.Id)
if err != nil {
log.WithError(err).Errorf("error while creating directory to store mole instance related files")
return err
}
err = startDaemonProcess(ic)
if err != nil {
log.WithFields(log.Fields{
"id": c.Conf.Id,
}).WithError(err).Error("error starting ssh tunnel")
return err
}
} else {
go c.handleSignals()
}
if c.Conf.Verbose {
log.SetLevel(log.DebugLevel)
}
d, err := fsutils.CreateInstanceDir(c.Conf.Id)
if err != nil {
log.WithFields(log.Fields{
"id": c.Conf.Id,
}).WithError(err).Error("error creating directory for mole instance")
return err
}
if c.Conf.Rpc {
addr, err := rpc.Start(c.Conf.RpcAddress)
if err != nil {
return err
}
rd := filepath.Join(d.Dir, "rpc")
err = ioutil.WriteFile(rd, []byte(addr.String()), 0644)
if err != nil {
log.WithFields(log.Fields{
"id": c.Conf.Id,
}).WithError(err).Error("error creating file with rpc address")
return err
}
c.Conf.RpcAddress = addr.String()
log.Infof("rpc server address saved on %s", rd)
} | t, err := createTunnel(c.Conf)
if err != nil {
log.WithFields(log.Fields{
"id": c.Conf.Id,
}).WithError(err).Error("error creating tunnel")
return err
}
c.Tunnel = t
if err = c.Tunnel.Start(); err != nil {
log.WithFields(log.Fields{
"tunnel": c.Tunnel.String(),
}).WithError(err).Error("error while starting tunnel")
return err
}
return nil
}
// Stop shuts down a detached mole's application instance.
func (c *Client) Stop() error {
pfp, err := fsutils.GetPidFileLocation(c.Conf.Id)
if err != nil {
return fmt.Errorf("error getting information about aliases directory: %v", err)
}
if _, err := os.Stat(pfp); os.IsNotExist(err) {
return fmt.Errorf("no instance of mole with id %s is running", c.Conf.Id)
}
cntxt := &daemon.Context{
PidFileName: pfp,
}
d, err := cntxt.Search()
if err != nil {
return err
}
if c.Conf.Detach {
err = os.RemoveAll(pfp)
if err != nil {
return err
}
} else {
d, err := fsutils.InstanceDir(c.Conf.Id)
if err != nil {
return err
}
err = os.RemoveAll(d.Dir)
if err != nil {
return err
}
}
err = d.Kill()
if err != nil {
return err
}
return nil
}
func (c *Client) handleSignals() {
signal.Notify(c.sigs, syscall.SIGINT, syscall.SIGTERM, os.Interrupt)
sig := <-c.sigs
log.Debugf("process signal %s received", sig)
err := c.Stop()
if err != nil {
log.WithError(err).Error("instance not properly stopped")
}
}
// Merge overwrites Configuration from the given Alias.
//
// Certain attributes like Verbose, Insecure and Detach will be overwritten
// only if they are found on the givenFlags which should contain the name of
// all flags given by the user through UI (e.g. CLI).
func (c *Configuration) Merge(al *alias.Alias, givenFlags []string) error {
var fl flags = givenFlags
if !fl.lookup("verbose") {
c.Verbose = al.Verbose
}
if !fl.lookup("insecure") {
c.Insecure = al.Insecure
}
if !fl.lookup("detach") {
c.Detach = al.Detach
}
c.Id = al.Name
c.TunnelType = al.TunnelType
srcl := AddressInputList{}
for _, src := range al.Source {
err := srcl.Set(src)
if err != nil {
return err
}
}
c.Source = srcl
dstl := AddressInputList{}
for _, dst := range al.Destination {
err := dstl.Set(dst)
if err != nil {
return err
}
}
c.Destination = dstl
srv := AddressInput{}
err := srv.Set(al.Server)
if err != nil {
return err
}
c.Server = srv
c.Key = al.Key
kai, err := time.ParseDuration(al.KeepAliveInterval)
if err != nil {
return err
}
c.KeepAliveInterval = kai
c.ConnectionRetries = al.ConnectionRetries
war, err := time.ParseDuration(al.WaitAndRetry)
if err != nil {
return err
}
c.WaitAndRetry = war
c.SshAgent = al.SshAgent
tim, err := time.ParseDuration(al.Timeout)
if err != nil {
return err
}
c.Timeout = tim
c.SshConfig = al.SshConfig
c.Rpc = al.Rpc
c.RpcAddress = al.RpcAddress
return nil
}
// ShowInstances returns the runtime information about all instances of mole
// running on the system with rpc enabled.
func ShowInstances() (*InstancesRuntime, error) {
ctx := context.Background()
data, err := rpc.ShowAll(ctx)
if err != nil {
return nil, err
}
var instances []Runtime
err = mapstructure.Decode(data, &instances)
if err != nil {
return nil, err
}
runtime := InstancesRuntime(instances)
if len(runtime) == 0 {
return nil, fmt.Errorf | random_line_split | |
cliches.go | (match string) *BadTerm {
return &BadTerm{match, "'%s' is a cliche. Avoid it like the plague."}
}
// ShouldNotCliche returns a slice of BadTerm's, none of which should be in the
// a text (case insensitive). See existence_checks.go for details of BadTerms.
func ShouldNotCliche() []TextCheck {
return []TextCheck{
cliche("all hell broke loose"),
cliche("american as apple pie"),
cliche("hobson's choice"),
cliche("i beg to differ"),
cliche("jack of all trades"),
cliche("a chip off the old block"),
cliche("a clean slate"),
cliche("a dark and stormy night"),
cliche("a far cry"),
cliche("a fate worse than death"),
cliche("a fine kettle of fish"),
cliche("a loose cannon"),
cliche("a matter of concern"),
cliche("a penny saved is a penny earned"),
cliche("a tough row to hoe"),
cliche("a word to the wise"),
cliche("ace in the hole"),
cliche("acid test"),
cliche("add insult to injury"),
cliche("against all odds"),
cliche("air your dirty laundry"),
cliche("alas and alack"),
cliche("all fun and games"),
cliche("all in a day's work"),
cliche("all talk, no action"),
cliche("all things being equal"),
cliche("all thumbs"),
cliche("all your eggs in one basket"),
cliche("all's fair in love and war"),
cliche("all's well that ends well"),
cliche("almighty dollar"),
cliche("an axe? to grind"),
cliche("another day, another dollar"),
cliche("armed to the teeth"),
cliche("as a last resort"),
cliche("as luck would have it"),
cliche("as old as time"),
cliche("as the crow flies"),
cliche("at loose ends"),
cliche("at my wits end"),
cliche("at the end of the day"),
cliche("attached hereto"),
cliche("avoid like the plague"),
cliche("babe in the woods"),
cliche("back against the wall"),
cliche("back in the saddle"),
cliche("back to square one"),
cliche("back to the drawing board"),
cliche("bad to the bone"),
cliche("badge of honor"),
cliche("bald faced liar"),
cliche("bald-faced lie"),
cliche("ballpark figure"),
cliche("banging your head against a brick wall"),
cliche("baptism by fire"),
cliche("barking up the wrong tree"),
cliche("bat out of hell"),
cliche("be all and end all"),
cliche("beat a dead horse"),
cliche("beat around the bush"),
cliche("been there, done that"),
cliche("beggars can't be choosers"),
cliche("behind the eight ball"),
cliche("bend over backwards"),
cliche("benefit of the doubt"),
cliche("bent out of shape"),
cliche("best thing since sliced bread"),
cliche("bet your bottom dollar"),
cliche("better half"),
cliche("better late than never"),
cliche("better mousetrap"),
cliche("better safe than sorry"),
cliche("between scylla and charybdis"),
cliche("between a rock and a hard place"),
cliche("between a rock and a hard place"),
cliche("between the devil and the deep blue sea"),
cliche("betwixt and between"),
cliche("beyond the pale"),
cliche("bide your time"),
cliche("big as life"),
cliche("big cheese"),
cliche("big fish in a small pond"),
cliche("big man on campus"),
cliche("bigger they are the harder they fall"),
cliche("bird in the hand"),
cliche("bird's eye view"),
cliche("birds and the bees"),
cliche("birds of a feather flock together"),
cliche("bit the hand that feeds you"),
cliche("bite the bullet"),
cliche("bite the dust"),
cliche("bitten off more than he can chew"),
cliche("black as coal"),
cliche("black as pitch"),
cliche("black as the ace of spades"),
cliche("blast from the past"),
cliche("bleeding heart"),
cliche("blessing in disguise"),
cliche("blind ambition"),
cliche("blind as a bat"),
cliche("blind leading the blind"),
cliche("blissful ignorance"),
cliche("blood is thicker than water"),
cliche("blood sweat and tears"),
cliche("blow a fuse"),
cliche("blow off steam"),
cliche("blow your own horn"),
cliche("blushing bride"),
cliche("boils down to"),
cliche("bolt from the blue"),
cliche("bone to pick"),
cliche("bored stiff"),
cliche("bored to tears"),
cliche("bottomless pit"),
cliche("boys will be boys"),
cliche("bright and early"),
cliche("brings home the bacon"),
cliche("broad across the beam"),
cliche("broken record"),
cliche("brought back to reality"),
cliche("bulk large"),
cliche("bull by the horns"),
cliche("bull in a china shop"),
cliche("burn the midnight oil"),
cliche("burning question"),
cliche("burning the candle at both ends"),
cliche("burst your bubble"),
cliche("bury the hatchet"),
cliche("busy as a bee"),
cliche("but that's another story"),
cliche("by hook or by crook"),
cliche("by no means"),
cliche("call a spade a spade"),
cliche("called onto the carpet"),
cliche("calm before the storm"),
cliche("can of worms"),
cliche("can't cut the mustard"),
cliche("can't hold a candle to"),
cliche("case of mistaken identity"),
cliche("cast aspersions"),
cliche("cat got your tongue"),
cliche("cat's meow"),
cliche("caught in the crossfire"),
cliche("caught red-handed"),
cliche("chase a red herring"),
cliche("checkered past"),
cliche("chomping at the bit"),
cliche("cleanliness is next to godliness"),
cliche("clear as a bell"),
cliche("clear as mud"),
cliche("close to the vest"),
cliche("cock and bull story"),
cliche("cold shoulder"),
cliche("come hell or high water"),
cliche("comparing apples and oranges"),
cliche("conspicuous by its absence"),
cliche("conspicuous by its absence"),
cliche("cool as a cucumber"),
cliche("cool, calm, and collected"),
cliche("cost a king's ransom"),
cliche("count your blessings"),
cliche("crack of dawn"),
cliche("crash course"),
cliche("creature comforts"),
cliche("cross that bridge when you come to it"),
cliche("crushing blow"),
cliche("cry like a baby"),
cliche("cry me a river"),
cliche("cry over spilt milk"),
cliche("crystal clear"),
cliche("crystal clear"),
cliche("curiosity killed the cat"),
cliche("cut and dried"),
cliche("cut through the red tape"),
cliche("cut to the chase"),
cliche("cute as a bugs ear"),
cliche("cute as a button"),
cliche("cute as a puppy"),
cliche("cuts to the quick"),
cliche("cutting edge"),
cliche("dark before the dawn"),
cliche("day in, day out"),
cliche("dead as a doornail"),
cliche("decision-making process"),
cliche("devil is in the details"),
cliche("dime a dozen"),
cliche("divide and conquer"),
cliche("dog and pony show"),
cliche("dog days"),
cliche("dog eat dog"),
cliche("dog tired"),
cliche("don't burn your bridges"),
cliche("don't count your chickens"),
cliche("don't look a gift horse in the mouth"),
cliche("don't rock the boat"),
cliche("don't step on anyone's toes"),
cliche("don't take any wooden nickels"),
cliche("down and out"),
cliche("down at the heels"),
cliche("down in the dumps"),
cliche("down the hatch"),
cliche("down to earth"),
cliche("draw the line"),
cliche("dressed to kill"),
cliche("dressed to the nines"),
cliche("drives me up the wall"),
cliche("dubious distinction"),
cliche("dull | cliche | identifier_name | |
cliches.go |
// ShouldNotCliche returns a slice of BadTerm's, none of which should be in the
// a text (case insensitive). See existence_checks.go for details of BadTerms.
func ShouldNotCliche() []TextCheck {
return []TextCheck{
cliche("all hell broke loose"),
cliche("american as apple pie"),
cliche("hobson's choice"),
cliche("i beg to differ"),
cliche("jack of all trades"),
cliche("a chip off the old block"),
cliche("a clean slate"),
cliche("a dark and stormy night"),
cliche("a far cry"),
cliche("a fate worse than death"),
cliche("a fine kettle of fish"),
cliche("a loose cannon"),
cliche("a matter of concern"),
cliche("a penny saved is a penny earned"),
cliche("a tough row to hoe"),
cliche("a word to the wise"),
cliche("ace in the hole"),
cliche("acid test"),
cliche("add insult to injury"),
cliche("against all odds"),
cliche("air your dirty laundry"),
cliche("alas and alack"),
cliche("all fun and games"),
cliche("all in a day's work"),
cliche("all talk, no action"),
cliche("all things being equal"),
cliche("all thumbs"),
cliche("all your eggs in one basket"),
cliche("all's fair in love and war"),
cliche("all's well that ends well"),
cliche("almighty dollar"),
cliche("an axe? to grind"),
cliche("another day, another dollar"),
cliche("armed to the teeth"),
cliche("as a last resort"),
cliche("as luck would have it"),
cliche("as old as time"),
cliche("as the crow flies"),
cliche("at loose ends"),
cliche("at my wits end"),
cliche("at the end of the day"),
cliche("attached hereto"),
cliche("avoid like the plague"),
cliche("babe in the woods"),
cliche("back against the wall"),
cliche("back in the saddle"),
cliche("back to square one"),
cliche("back to the drawing board"),
cliche("bad to the bone"),
cliche("badge of honor"),
cliche("bald faced liar"),
cliche("bald-faced lie"),
cliche("ballpark figure"),
cliche("banging your head against a brick wall"),
cliche("baptism by fire"),
cliche("barking up the wrong tree"),
cliche("bat out of hell"),
cliche("be all and end all"),
cliche("beat a dead horse"),
cliche("beat around the bush"),
cliche("been there, done that"),
cliche("beggars can't be choosers"),
cliche("behind the eight ball"),
cliche("bend over backwards"),
cliche("benefit of the doubt"),
cliche("bent out of shape"),
cliche("best thing since sliced bread"),
cliche("bet your bottom dollar"),
cliche("better half"),
cliche("better late than never"),
cliche("better mousetrap"),
cliche("better safe than sorry"),
cliche("between scylla and charybdis"),
cliche("between a rock and a hard place"),
cliche("between a rock and a hard place"),
cliche("between the devil and the deep blue sea"),
cliche("betwixt and between"),
cliche("beyond the pale"),
cliche("bide your time"),
cliche("big as life"),
cliche("big cheese"),
cliche("big fish in a small pond"),
cliche("big man on campus"),
cliche("bigger they are the harder they fall"),
cliche("bird in the hand"),
cliche("bird's eye view"),
cliche("birds and the bees"),
cliche("birds of a feather flock together"),
cliche("bit the hand that feeds you"),
cliche("bite the bullet"),
cliche("bite the dust"),
cliche("bitten off more than he can chew"),
cliche("black as coal"),
cliche("black as pitch"),
cliche("black as the ace of spades"),
cliche("blast from the past"),
cliche("bleeding heart"),
cliche("blessing in disguise"),
cliche("blind ambition"),
cliche("blind as a bat"),
cliche("blind leading the blind"),
cliche("blissful ignorance"),
cliche("blood is thicker than water"),
cliche("blood sweat and tears"),
cliche("blow a fuse"),
cliche("blow off steam"),
cliche("blow your own horn"),
cliche("blushing bride"),
cliche("boils down to"),
cliche("bolt from the blue"),
cliche("bone to pick"),
cliche("bored stiff"),
cliche("bored to tears"),
cliche("bottomless pit"),
cliche("boys will be boys"),
cliche("bright and early"),
cliche("brings home the bacon"),
cliche("broad across the beam"),
cliche("broken record"),
cliche("brought back to reality"),
cliche("bulk large"),
cliche("bull by the horns"),
cliche("bull in a china shop"),
cliche("burn the midnight oil"),
cliche("burning question"),
cliche("burning the candle at both ends"),
cliche("burst your bubble"),
cliche("bury the hatchet"),
cliche("busy as a bee"),
cliche("but that's another story"),
cliche("by hook or by crook"),
cliche("by no means"),
cliche("call a spade a spade"),
cliche("called onto the carpet"),
cliche("calm before the storm"),
cliche("can of worms"),
cliche("can't cut the mustard"),
cliche("can't hold a candle to"),
cliche("case of mistaken identity"),
cliche("cast aspersions"),
cliche("cat got your tongue"),
cliche("cat's meow"),
cliche("caught in the crossfire"),
cliche("caught red-handed"),
cliche("chase a red herring"),
cliche("checkered past"),
cliche("chomping at the bit"),
cliche("cleanliness is next to godliness"),
cliche("clear as a bell"),
cliche("clear as mud"),
cliche("close to the vest"),
cliche("cock and bull story"),
cliche("cold shoulder"),
cliche("come hell or high water"),
cliche("comparing apples and oranges"),
cliche("conspicuous by its absence"),
cliche("conspicuous by its absence"),
cliche("cool as a cucumber"),
cliche("cool, calm, and collected"),
cliche("cost a king's ransom"),
cliche("count your blessings"),
cliche("crack of dawn"),
cliche("crash course"),
cliche("creature comforts"),
cliche("cross that bridge when you come to it"),
cliche("crushing blow"),
cliche("cry like a baby"),
cliche("cry me a river"),
cliche("cry over spilt milk"),
cliche("crystal clear"),
cliche("crystal clear"),
cliche("curiosity killed the cat"),
cliche("cut and dried"),
cliche("cut through the red tape"),
cliche("cut to the chase"),
cliche("cute as a bugs ear"),
cliche("cute as a button"),
cliche("cute as a puppy"),
cliche("cuts to the quick"),
cliche("cutting edge"),
cliche("dark before the dawn"),
cliche("day in, day out"),
cliche("dead as a doornail"),
cliche("decision-making process"),
cliche("devil is in the details"),
cliche("dime a dozen"),
cliche("divide and conquer"),
cliche("dog and pony show"),
cliche("dog days"),
cliche("dog eat dog"),
cliche("dog tired"),
cliche("don't burn your bridges"),
cliche("don't count your chickens"),
cliche("don't look a gift horse in the mouth"),
cliche("don't rock the boat"),
cliche("don't step on anyone's toes"),
cliche("don't take any wooden nickels"),
cliche("down and out"),
cliche("down at the heels"),
cliche("down in the dumps"),
cliche("down the hatch"),
cliche("down to earth"),
cliche("draw the line"),
cliche("dressed to kill"),
cliche("dressed to the nines"),
cliche("drives me up the wall"),
cliche("dubious distinction"),
cliche("dull as dishwater"),
cliche | {
return &BadTerm{match, "'%s' is a cliche. Avoid it like the plague."}
} | identifier_body | |
cliches.go | "),
cliche("cry like a baby"),
cliche("cry me a river"),
cliche("cry over spilt milk"),
cliche("crystal clear"),
cliche("crystal clear"),
cliche("curiosity killed the cat"),
cliche("cut and dried"),
cliche("cut through the red tape"),
cliche("cut to the chase"),
cliche("cute as a bugs ear"),
cliche("cute as a button"),
cliche("cute as a puppy"),
cliche("cuts to the quick"),
cliche("cutting edge"),
cliche("dark before the dawn"), | cliche("dime a dozen"),
cliche("divide and conquer"),
cliche("dog and pony show"),
cliche("dog days"),
cliche("dog eat dog"),
cliche("dog tired"),
cliche("don't burn your bridges"),
cliche("don't count your chickens"),
cliche("don't look a gift horse in the mouth"),
cliche("don't rock the boat"),
cliche("don't step on anyone's toes"),
cliche("don't take any wooden nickels"),
cliche("down and out"),
cliche("down at the heels"),
cliche("down in the dumps"),
cliche("down the hatch"),
cliche("down to earth"),
cliche("draw the line"),
cliche("dressed to kill"),
cliche("dressed to the nines"),
cliche("drives me up the wall"),
cliche("dubious distinction"),
cliche("dull as dishwater"),
cliche("duly authorized"),
cliche("dyed in the wool"),
cliche("eagle eye"),
cliche("ear to the ground"),
cliche("early bird catches the worm"),
cliche("easier said than done"),
cliche("easier said than done"),
cliche("easy as pie"),
cliche("eat your heart out"),
cliche("eat your words"),
cliche("eleventh hour"),
cliche("enclosed herewith"),
cliche("even the playing field"),
cliche("every dog has its day"),
cliche("every fiber of my being"),
cliche("everything but the kitchen sink"),
cliche("eye for an eye"),
cliche("eyes peeled"),
cliche("face the music"),
cliche("facts of life"),
cliche("fair weather friend"),
cliche("fall by the wayside"),
cliche("fan the flames"),
cliche("far be it from me"),
cliche("fast and loose"),
cliche("feast or famine"),
cliche("feather your nest"),
cliche("feathered friends"),
cliche("few and far between"),
cliche("fifteen minutes of fame"),
cliche("fills the bill"),
cliche("filthy vermin"),
cliche("fine kettle of fish"),
cliche("first and foremost"),
cliche("fish out of water"),
cliche("fishing for a compliment"),
cliche("fit as a fiddle"),
cliche("fit the bill"),
cliche("fit to be tied"),
cliche("flash in the pan"),
cliche("flat as a pancake"),
cliche("flip your lid"),
cliche("flog a dead horse"),
cliche("fly by night"),
cliche("fly the coop"),
cliche("follow your heart"),
cliche("for all intents and purposes"),
cliche("for free"),
cliche("for the birds"),
cliche("for what it's worth"),
cliche("force of nature"),
cliche("force to be reckoned with"),
cliche("forgive and forget"),
cliche("fox in the henhouse"),
cliche("free and easy"),
cliche("free as a bird"),
cliche("fresh as a daisy"),
cliche("full steam ahead"),
cliche("fun in the sun"),
cliche("garbage in, garbage out"),
cliche("gentle as a lamb"),
cliche("get a kick out of"),
cliche("get a leg up"),
cliche("get down and dirty"),
cliche("get the lead out"),
cliche("get to the bottom of"),
cliche("get with the program"),
cliche("get your feet wet"),
cliche("gets my goat"),
cliche("gilding the lily"),
cliche("gilding the lily"),
cliche("give and take"),
cliche("go against the grain"),
cliche("go at it tooth and nail"),
cliche("go for broke"),
cliche("go him one better"),
cliche("go the extra mile"),
cliche("go with the flow"),
cliche("goes without saying"),
cliche("good as gold"),
cliche("good deed for the day"),
cliche("good things come to those who wait"),
cliche("good time was had by all"),
cliche("good times were had by all"),
cliche("greased lightning"),
cliche("greek to me"),
cliche("green thumb"),
cliche("green-eyed monster"),
cliche("grist for the mill"),
cliche("growing like a weed"),
cliche("hair of the dog"),
cliche("hand to mouth"),
cliche("happy as a clam"),
cliche("happy as a lark"),
cliche("hasn't a clue"),
cliche("have a nice day"),
cliche("have a short fuse"),
cliche("have high hopes"),
cliche("have the last laugh"),
cliche("haven't got a row to hoe"),
cliche("he's got his hands full"),
cliche("head honcho"),
cliche("head over heels"),
cliche("hear a pin drop"),
cliche("heard it through the grapevine"),
cliche("heart's content"),
cliche("heavy as lead"),
cliche("hem and haw"),
cliche("high and dry"),
cliche("high and mighty"),
cliche("high as a kite"),
cliche("his own worst enemy"),
cliche("his work cut out for him"),
cliche("hit paydirt"),
cliche("hither and yon"),
cliche("hold your head up high"),
cliche("hold your horses"),
cliche("hold your own"),
cliche("hold your tongue"),
cliche("honest as the day is long"),
cliche("horns of a dilemma"),
cliche("horns of a dilemma"),
cliche("horse of a different color"),
cliche("hot under the collar"),
cliche("hour of need"),
cliche("icing on the cake"),
cliche("if and when"),
cliche("if the shoe fits"),
cliche("if the shoe were on the other foot"),
cliche("if you catch my drift"),
cliche("in a jam"),
cliche("in a jiffy"),
cliche("in a nutshell"),
cliche("in a pig's eye"),
cliche("in a pinch"),
cliche("in a word"),
cliche("in hot water"),
cliche("in light of"),
cliche("in reference to"),
cliche("in short supply"),
cliche("in the final analysis"),
cliche("in the foreseeable future"),
cliche("in the gutter"),
cliche("in the last analysis"),
cliche("in the long run"),
cliche("in the matter of"),
cliche("in the nick of time"),
cliche("in the thick of it"),
cliche("in your dreams"),
cliche("innocent bystander"),
cliche("it ain't over till the fat lady sings"),
cliche("it goes without saying"),
cliche("it stands to reason"),
cliche("it takes all kinds"),
cliche("it takes one to know one"),
cliche("it's a small world"),
cliche("it's not what you know, it's who you know"),
cliche("it's only a matter of time"),
cliche("ivory tower"),
cliche("jockey for position"),
cliche("jog your memory"),
cliche("joined at the hip"),
cliche("judge a book by its cover"),
cliche("jump down your throat"),
cliche("jump in with both feet"),
cliche("jump on the bandwagon"),
cliche("jump the gun"),
cliche("jump to conclusions"),
cliche("just a hop, skip, and a jump"),
cliche("just the ticket"),
cliche("justice is blind"),
cliche("keep a stiff upper lip"),
cliche("keep an eye on"),
cliche("keep it simple, stupid"),
cliche("keep the home fires burning"),
cliche("keep up with the joneses"),
cliche("keep your chin up"),
cliche("keep your fingers crossed"),
cliche("kick the bucket"),
| cliche("day in, day out"),
cliche("dead as a doornail"),
cliche("decision-making process"),
cliche("devil is in the details"), | random_line_split |
spi_host.rs | 0 => istate_clr: ReadWrite<u32, ISTATE_CLR::Register>),
(0x0014 => _reserved),
(0x1000 => tx_fifo: [WriteOnly<u8>; 128]),
(0x1080 => rx_fifo: [ReadOnly<u8>; 128]),
(0x1100 => @END),
}
}
register_bitfields![u32,
CTRL [ | CSBSU OFFSET(2) NUMBITS(4) [],
/// CSB from SCK hold time in SCK cycles + 1 (defined with respect to
/// the last SCK edge)
CSBHLD OFFSET(6) NUMBITS(4) [],
/// SPI Clk Divider. Actual divider is IDIV+1. A value of 0 gives divide
/// by 1 clock, 1 gives divide by 2 etc.
IDIV OFFSET(10) NUMBITS(12) [],
/// Polarity of CSB signal. 0:active low 1:active high
CSBPOL OFFSET(22) NUMBITS(1) [],
/// Order in which bits of byte are sent. 0: send bit 0 first. 1: send
/// bit 7 first
TXBITOR OFFSET(23) NUMBITS(1) [],
/// Order in which bytes of buffer word are sent.
/// 0: send byte 0 first. 1: send byte 3 first
TXBYTOR OFFSET(24) NUMBITS(1) [],
/// Order in which received bits are packed into byte.
/// 0: first bit received is bit0 1: last bit received is bit 0
RXBITOR OFFSET(25) NUMBITS(1) [],
/// Order in which received bytes are packed into word.
/// 0: first byte received is byte 0 1: first byte received is byte 3
RXBYTOR OFFSET(26) NUMBITS(1) [],
/// SPI Passthrough Mode. 0: Disable, 1: Enable. This is the host side
/// control of whether passthrough is allowed. In order for full
/// passthrough functionality, both the host and device passthrough
/// functionality have to be enabled
ENPASSTHRU OFFSET(27) NUMBITS(1) []
],
XACT [
/// Initiate transaction in buffer
START OFFSET(0) NUMBITS(1) [],
/// Bits-1 in last byte transferred. The default assumes last byte will
/// have 8 bits, this should be sufficient for most usage.
BCNT OFFSET(1) NUMBITS(3) [],
/// Total number of transactions in bytes-1. If 64 bytes are to be
/// transferred, this should be programmed as 63.
SIZE OFFSET(4) NUMBITS(7) [],
/// Poll for ready
RDY_POLL OFFSET(11) NUMBITS(1) [],
/// Delay before polling in PCLK cycles + 1
RDY_POLL_DLY OFFSET(12) NUMBITS(5) []
],
ICTRL [
/// TX interrupt enable
TXDONE OFFSET(0) NUMBITS(1) []
],
ISTATE [
/// TX done interrupt
TXDONE OFFSET(0) NUMBITS(1) []
],
ISTATE_CLR [
/// TX done interrupt clear
TXDONE OFFSET(0) NUMBITS(1) []
]
];
const SPI_HOST0_BASE_ADDR: u32 = 0x4070_0000;
const SPI_HOST1_BASE_ADDR: u32 = 0x4071_0000;
const SPI_HOST0_REGISTERS: StaticRef<Registers> =
unsafe { StaticRef::new(SPI_HOST0_BASE_ADDR as *const Registers) };
const SPI_HOST1_REGISTERS: StaticRef<Registers> =
unsafe { StaticRef::new(SPI_HOST1_BASE_ADDR as *const Registers) };
pub static mut SPI_HOST0: SpiHostHardware = SpiHostHardware::new(SPI_HOST0_REGISTERS);
pub static mut SPI_HOST1: SpiHostHardware = SpiHostHardware::new(SPI_HOST1_REGISTERS);
/// A SPI Host
pub struct SpiHostHardware {
registers: StaticRef<Registers>,
transaction_len: Cell<usize>,
tx_buffer: TakeCell<'static, [u8]>,
rx_buffer: TakeCell<'static, [u8]>,
client: OptionalCell<&'static dyn SpiMasterClient>,
}
impl SpiHostHardware {
const fn new(base_addr: StaticRef<Registers>) -> SpiHostHardware {
SpiHostHardware {
registers: base_addr,
transaction_len: Cell::new(0),
tx_buffer: TakeCell::empty(),
rx_buffer: TakeCell::empty(),
client: OptionalCell::empty(),
}
}
pub fn init(&self) {
self.registers.ctrl.write(
CTRL::CPOL::CLEAR +
CTRL::CPHA::CLEAR +
CTRL::CSBSU::CLEAR +
CTRL::CSBHLD::CLEAR +
CTRL::IDIV.val(2) +
CTRL::CSBPOL::CLEAR +
CTRL::TXBITOR::SET +
CTRL::TXBYTOR::CLEAR +
CTRL::RXBITOR::SET +
CTRL::RXBYTOR::CLEAR +
CTRL::ENPASSTHRU::CLEAR);
self.registers.xact.write(
XACT::START::CLEAR +
XACT::BCNT.val(7) +
XACT::SIZE.val(0) +
XACT::RDY_POLL::CLEAR +
XACT::RDY_POLL_DLY.val(0));
}
fn enable_tx_interrupt(&self) {
self.registers.ictrl.modify(ICTRL::TXDONE::SET);
}
fn disable_tx_interrupt(&self) {
self.registers.ictrl.modify(ICTRL::TXDONE::CLEAR);
}
pub fn handle_interrupt(&self) {
//debug!("SpiHostHardware::handle_interrupt: ISTATE = {:08x}", self.registers.istate.get());
if self.registers.istate.is_set(ISTATE::TXDONE) {
self.registers.istate_clr.write(ISTATE_CLR::TXDONE::SET);
self.client.map(|client| {
self.tx_buffer.take()
.map(|tx_buf| {
self.rx_buffer
.map(|rx_buf| {
self.read_data(rx_buf);
});
client.read_write_done(
tx_buf,
self.rx_buffer.take(),
self.transaction_len.get())
});
});
}
self.disable_tx_interrupt();
}
fn start_transaction(
&self,
write_buffer: Option<&'static mut [u8]>,
read_buffer: Option<&'static mut [u8]>,
transaction_len: usize) -> ReturnCode {
//debug!("SpiHostHardware::start_transaction: transaction_len={}", transaction_len);
// The transaction needs at least one byte.
// It also cannot have more bytes than tx_fifo or rx_fifo is long.
if (transaction_len == 0) ||
(transaction_len > self.registers.tx_fifo.len()) ||
(transaction_len > self.registers.rx_fifo.len()) {
//debug!("SpiHostHardware::start_transaction: Invalid transaction_len={}", transaction_len);
return ReturnCode::ESIZE;
}
self.registers.xact.modify(XACT::BCNT.val(7));
self.registers.xact.modify(XACT::SIZE.val((transaction_len - 1) as u32));
let mut tx_buf_len = 0;
write_buffer.as_ref().map(|tx_buf| {
tx_buf_len = min(tx_buf.len(), transaction_len);
for idx in 0..tx_buf_len {
self.registers.tx_fifo[idx].set(tx_buf[idx]);
}
});
// Clear the TX FIFO for additional bytes not supplied by write_buffer.
// Since we have no control over how many bytes the SPI host reads, we
// want to make sure to not accidentally leak information that made it
// into the TX FIFO beyond the length of the `write_buffer`.
for idx in tx_buf_len..transaction_len {
self.registers.tx_fifo[idx].set(0xff);
}
write_buffer.map(|buf| {
self.tx_buffer.replace(buf);
});
read_buffer.map(|buf| {
self.rx_buffer.replace(buf);
});
self.transaction_len.set(transaction_len);
self.registers.istate_clr.write(ISTATE_CLR::TXDONE::SET);
self.enable_tx_interrupt();
self.registers.xact.modify(XACT::START::SET);
ReturnCode::SUCCESS
}
fn read_data(&self, read_buffer: &mut [u8]) {
let read_len = min(read_buffer.len(), self.transaction_len.get());
for idx in 0..read_len {
let val = self.registers.rx_fifo[idx].get();
read_buffer[idx] = val;
}
}
}
impl SpiHost for SpiHostHardware {
fn spi_device_spi_host_passthrough(&self, enabled: bool) {
self.registers.ctrl.modify(
if | /// CPOL setting
CPOL OFFSET(0) NUMBITS(1) [],
/// CPHA setting
CPHA OFFSET(1) NUMBITS(1) [],
/// CSB to SCK setup time in SCK cycles + 1.5 | random_line_split |
spi_host.rs | (24) NUMBITS(1) [],
/// Order in which received bits are packed into byte.
/// 0: first bit received is bit0 1: last bit received is bit 0
RXBITOR OFFSET(25) NUMBITS(1) [],
/// Order in which received bytes are packed into word.
/// 0: first byte received is byte 0 1: first byte received is byte 3
RXBYTOR OFFSET(26) NUMBITS(1) [],
/// SPI Passthrough Mode. 0: Disable, 1: Enable. This is the host side
/// control of whether passthrough is allowed. In order for full
/// passthrough functionality, both the host and device passthrough
/// functionality have to be enabled
ENPASSTHRU OFFSET(27) NUMBITS(1) []
],
XACT [
/// Initiate transaction in buffer
START OFFSET(0) NUMBITS(1) [],
/// Bits-1 in last byte transferred. The default assumes last byte will
/// have 8 bits, this should be sufficient for most usage.
BCNT OFFSET(1) NUMBITS(3) [],
/// Total number of transactions in bytes-1. If 64 bytes are to be
/// transferred, this should be programmed as 63.
SIZE OFFSET(4) NUMBITS(7) [],
/// Poll for ready
RDY_POLL OFFSET(11) NUMBITS(1) [],
/// Delay before polling in PCLK cycles + 1
RDY_POLL_DLY OFFSET(12) NUMBITS(5) []
],
ICTRL [
/// TX interrupt enable
TXDONE OFFSET(0) NUMBITS(1) []
],
ISTATE [
/// TX done interrupt
TXDONE OFFSET(0) NUMBITS(1) []
],
ISTATE_CLR [
/// TX done interrupt clear
TXDONE OFFSET(0) NUMBITS(1) []
]
];
const SPI_HOST0_BASE_ADDR: u32 = 0x4070_0000;
const SPI_HOST1_BASE_ADDR: u32 = 0x4071_0000;
const SPI_HOST0_REGISTERS: StaticRef<Registers> =
unsafe { StaticRef::new(SPI_HOST0_BASE_ADDR as *const Registers) };
const SPI_HOST1_REGISTERS: StaticRef<Registers> =
unsafe { StaticRef::new(SPI_HOST1_BASE_ADDR as *const Registers) };
pub static mut SPI_HOST0: SpiHostHardware = SpiHostHardware::new(SPI_HOST0_REGISTERS);
pub static mut SPI_HOST1: SpiHostHardware = SpiHostHardware::new(SPI_HOST1_REGISTERS);
/// A SPI Host
pub struct SpiHostHardware {
registers: StaticRef<Registers>,
transaction_len: Cell<usize>,
tx_buffer: TakeCell<'static, [u8]>,
rx_buffer: TakeCell<'static, [u8]>,
client: OptionalCell<&'static dyn SpiMasterClient>,
}
impl SpiHostHardware {
const fn new(base_addr: StaticRef<Registers>) -> SpiHostHardware {
SpiHostHardware {
registers: base_addr,
transaction_len: Cell::new(0),
tx_buffer: TakeCell::empty(),
rx_buffer: TakeCell::empty(),
client: OptionalCell::empty(),
}
}
pub fn init(&self) {
self.registers.ctrl.write(
CTRL::CPOL::CLEAR +
CTRL::CPHA::CLEAR +
CTRL::CSBSU::CLEAR +
CTRL::CSBHLD::CLEAR +
CTRL::IDIV.val(2) +
CTRL::CSBPOL::CLEAR +
CTRL::TXBITOR::SET +
CTRL::TXBYTOR::CLEAR +
CTRL::RXBITOR::SET +
CTRL::RXBYTOR::CLEAR +
CTRL::ENPASSTHRU::CLEAR);
self.registers.xact.write(
XACT::START::CLEAR +
XACT::BCNT.val(7) +
XACT::SIZE.val(0) +
XACT::RDY_POLL::CLEAR +
XACT::RDY_POLL_DLY.val(0));
}
fn enable_tx_interrupt(&self) {
self.registers.ictrl.modify(ICTRL::TXDONE::SET);
}
fn disable_tx_interrupt(&self) {
self.registers.ictrl.modify(ICTRL::TXDONE::CLEAR);
}
pub fn handle_interrupt(&self) {
//debug!("SpiHostHardware::handle_interrupt: ISTATE = {:08x}", self.registers.istate.get());
if self.registers.istate.is_set(ISTATE::TXDONE) {
self.registers.istate_clr.write(ISTATE_CLR::TXDONE::SET);
self.client.map(|client| {
self.tx_buffer.take()
.map(|tx_buf| {
self.rx_buffer
.map(|rx_buf| {
self.read_data(rx_buf);
});
client.read_write_done(
tx_buf,
self.rx_buffer.take(),
self.transaction_len.get())
});
});
}
self.disable_tx_interrupt();
}
fn start_transaction(
&self,
write_buffer: Option<&'static mut [u8]>,
read_buffer: Option<&'static mut [u8]>,
transaction_len: usize) -> ReturnCode {
//debug!("SpiHostHardware::start_transaction: transaction_len={}", transaction_len);
// The transaction needs at least one byte.
// It also cannot have more bytes than tx_fifo or rx_fifo is long.
if (transaction_len == 0) ||
(transaction_len > self.registers.tx_fifo.len()) ||
(transaction_len > self.registers.rx_fifo.len()) {
//debug!("SpiHostHardware::start_transaction: Invalid transaction_len={}", transaction_len);
return ReturnCode::ESIZE;
}
self.registers.xact.modify(XACT::BCNT.val(7));
self.registers.xact.modify(XACT::SIZE.val((transaction_len - 1) as u32));
let mut tx_buf_len = 0;
write_buffer.as_ref().map(|tx_buf| {
tx_buf_len = min(tx_buf.len(), transaction_len);
for idx in 0..tx_buf_len {
self.registers.tx_fifo[idx].set(tx_buf[idx]);
}
});
// Clear the TX FIFO for additional bytes not supplied by write_buffer.
// Since we have no control over how many bytes the SPI host reads, we
// want to make sure to not accidentally leak information that made it
// into the TX FIFO beyond the length of the `write_buffer`.
for idx in tx_buf_len..transaction_len {
self.registers.tx_fifo[idx].set(0xff);
}
write_buffer.map(|buf| {
self.tx_buffer.replace(buf);
});
read_buffer.map(|buf| {
self.rx_buffer.replace(buf);
});
self.transaction_len.set(transaction_len);
self.registers.istate_clr.write(ISTATE_CLR::TXDONE::SET);
self.enable_tx_interrupt();
self.registers.xact.modify(XACT::START::SET);
ReturnCode::SUCCESS
}
fn read_data(&self, read_buffer: &mut [u8]) {
let read_len = min(read_buffer.len(), self.transaction_len.get());
for idx in 0..read_len {
let val = self.registers.rx_fifo[idx].get();
read_buffer[idx] = val;
}
}
}
impl SpiHost for SpiHostHardware {
fn spi_device_spi_host_passthrough(&self, enabled: bool) {
self.registers.ctrl.modify(
if enabled { CTRL::ENPASSTHRU::SET } else { CTRL::ENPASSTHRU::CLEAR });
}
fn wait_busy_clear_in_transactions(&self, enabled: bool) {
self.registers.xact.modify(
if enabled { XACT::RDY_POLL::SET } else { XACT::RDY_POLL::CLEAR });
}
}
impl SpiMaster for SpiHostHardware {
type ChipSelect = bool;
fn set_client(&self, client: &'static dyn kernel::hil::spi::SpiMasterClient) {
self.client.set(client);
}
fn init(&self) {}
fn is_busy(&self) -> bool {
self.registers.istate.is_set(ISTATE::TXDONE)
}
fn read_write_bytes(
&self,
write_buffer: &'static mut [u8],
read_buffer: Option<&'static mut [u8]>,
len: usize,
) -> ReturnCode {
// If busy, don't start
if self.is_busy() {
return ReturnCode::EBUSY;
}
self.start_transaction(Some(write_buffer), read_buffer, len)
}
fn write_byte(&self, _val: u8) {
panic!("write_byte is not implemented");
}
fn read_byte(&self) -> u8 {
panic!("read_byte is not implemented");
}
fn read_write_byte(&self, _val: u8) -> u8 {
panic!("read_write_byte is not implemented");
}
fn specify_chip_select(&self, _cs: Self::ChipSelect) {
// Nothing to be done
}
/// Returns the actual rate set
fn set_rate(&self, _rate: u32) -> u32 | {
panic!("set_rate is not implemented");
} | identifier_body | |
spi_host.rs | byte received is byte 0 1: first byte received is byte 3
RXBYTOR OFFSET(26) NUMBITS(1) [],
/// SPI Passthrough Mode. 0: Disable, 1: Enable. This is the host side
/// control of whether passthrough is allowed. In order for full
/// passthrough functionality, both the host and device passthrough
/// functionality have to be enabled
ENPASSTHRU OFFSET(27) NUMBITS(1) []
],
XACT [
/// Initiate transaction in buffer
START OFFSET(0) NUMBITS(1) [],
/// Bits-1 in last byte transferred. The default assumes last byte will
/// have 8 bits, this should be sufficient for most usage.
BCNT OFFSET(1) NUMBITS(3) [],
/// Total number of transactions in bytes-1. If 64 bytes are to be
/// transferred, this should be programmed as 63.
SIZE OFFSET(4) NUMBITS(7) [],
/// Poll for ready
RDY_POLL OFFSET(11) NUMBITS(1) [],
/// Delay before polling in PCLK cycles + 1
RDY_POLL_DLY OFFSET(12) NUMBITS(5) []
],
ICTRL [
/// TX interrupt enable
TXDONE OFFSET(0) NUMBITS(1) []
],
ISTATE [
/// TX done interrupt
TXDONE OFFSET(0) NUMBITS(1) []
],
ISTATE_CLR [
/// TX done interrupt clear
TXDONE OFFSET(0) NUMBITS(1) []
]
];
const SPI_HOST0_BASE_ADDR: u32 = 0x4070_0000;
const SPI_HOST1_BASE_ADDR: u32 = 0x4071_0000;
const SPI_HOST0_REGISTERS: StaticRef<Registers> =
unsafe { StaticRef::new(SPI_HOST0_BASE_ADDR as *const Registers) };
const SPI_HOST1_REGISTERS: StaticRef<Registers> =
unsafe { StaticRef::new(SPI_HOST1_BASE_ADDR as *const Registers) };
pub static mut SPI_HOST0: SpiHostHardware = SpiHostHardware::new(SPI_HOST0_REGISTERS);
pub static mut SPI_HOST1: SpiHostHardware = SpiHostHardware::new(SPI_HOST1_REGISTERS);
/// A SPI Host
pub struct SpiHostHardware {
registers: StaticRef<Registers>,
transaction_len: Cell<usize>,
tx_buffer: TakeCell<'static, [u8]>,
rx_buffer: TakeCell<'static, [u8]>,
client: OptionalCell<&'static dyn SpiMasterClient>,
}
impl SpiHostHardware {
const fn new(base_addr: StaticRef<Registers>) -> SpiHostHardware {
SpiHostHardware {
registers: base_addr,
transaction_len: Cell::new(0),
tx_buffer: TakeCell::empty(),
rx_buffer: TakeCell::empty(),
client: OptionalCell::empty(),
}
}
pub fn init(&self) {
self.registers.ctrl.write(
CTRL::CPOL::CLEAR +
CTRL::CPHA::CLEAR +
CTRL::CSBSU::CLEAR +
CTRL::CSBHLD::CLEAR +
CTRL::IDIV.val(2) +
CTRL::CSBPOL::CLEAR +
CTRL::TXBITOR::SET +
CTRL::TXBYTOR::CLEAR +
CTRL::RXBITOR::SET +
CTRL::RXBYTOR::CLEAR +
CTRL::ENPASSTHRU::CLEAR);
self.registers.xact.write(
XACT::START::CLEAR +
XACT::BCNT.val(7) +
XACT::SIZE.val(0) +
XACT::RDY_POLL::CLEAR +
XACT::RDY_POLL_DLY.val(0));
}
fn enable_tx_interrupt(&self) {
self.registers.ictrl.modify(ICTRL::TXDONE::SET);
}
fn disable_tx_interrupt(&self) {
self.registers.ictrl.modify(ICTRL::TXDONE::CLEAR);
}
pub fn handle_interrupt(&self) {
//debug!("SpiHostHardware::handle_interrupt: ISTATE = {:08x}", self.registers.istate.get());
if self.registers.istate.is_set(ISTATE::TXDONE) {
self.registers.istate_clr.write(ISTATE_CLR::TXDONE::SET);
self.client.map(|client| {
self.tx_buffer.take()
.map(|tx_buf| {
self.rx_buffer
.map(|rx_buf| {
self.read_data(rx_buf);
});
client.read_write_done(
tx_buf,
self.rx_buffer.take(),
self.transaction_len.get())
});
});
}
self.disable_tx_interrupt();
}
fn start_transaction(
&self,
write_buffer: Option<&'static mut [u8]>,
read_buffer: Option<&'static mut [u8]>,
transaction_len: usize) -> ReturnCode {
//debug!("SpiHostHardware::start_transaction: transaction_len={}", transaction_len);
// The transaction needs at least one byte.
// It also cannot have more bytes than tx_fifo or rx_fifo is long.
if (transaction_len == 0) ||
(transaction_len > self.registers.tx_fifo.len()) ||
(transaction_len > self.registers.rx_fifo.len()) {
//debug!("SpiHostHardware::start_transaction: Invalid transaction_len={}", transaction_len);
return ReturnCode::ESIZE;
}
self.registers.xact.modify(XACT::BCNT.val(7));
self.registers.xact.modify(XACT::SIZE.val((transaction_len - 1) as u32));
let mut tx_buf_len = 0;
write_buffer.as_ref().map(|tx_buf| {
tx_buf_len = min(tx_buf.len(), transaction_len);
for idx in 0..tx_buf_len {
self.registers.tx_fifo[idx].set(tx_buf[idx]);
}
});
// Clear the TX FIFO for additional bytes not supplied by write_buffer.
// Since we have no control over how many bytes the SPI host reads, we
// want to make sure to not accidentally leak information that made it
// into the TX FIFO beyond the length of the `write_buffer`.
for idx in tx_buf_len..transaction_len {
self.registers.tx_fifo[idx].set(0xff);
}
write_buffer.map(|buf| {
self.tx_buffer.replace(buf);
});
read_buffer.map(|buf| {
self.rx_buffer.replace(buf);
});
self.transaction_len.set(transaction_len);
self.registers.istate_clr.write(ISTATE_CLR::TXDONE::SET);
self.enable_tx_interrupt();
self.registers.xact.modify(XACT::START::SET);
ReturnCode::SUCCESS
}
fn read_data(&self, read_buffer: &mut [u8]) {
let read_len = min(read_buffer.len(), self.transaction_len.get());
for idx in 0..read_len {
let val = self.registers.rx_fifo[idx].get();
read_buffer[idx] = val;
}
}
}
impl SpiHost for SpiHostHardware {
fn spi_device_spi_host_passthrough(&self, enabled: bool) {
self.registers.ctrl.modify(
if enabled { CTRL::ENPASSTHRU::SET } else { CTRL::ENPASSTHRU::CLEAR });
}
fn wait_busy_clear_in_transactions(&self, enabled: bool) {
self.registers.xact.modify(
if enabled { XACT::RDY_POLL::SET } else { XACT::RDY_POLL::CLEAR });
}
}
impl SpiMaster for SpiHostHardware {
type ChipSelect = bool;
fn set_client(&self, client: &'static dyn kernel::hil::spi::SpiMasterClient) {
self.client.set(client);
}
fn init(&self) {}
fn is_busy(&self) -> bool {
self.registers.istate.is_set(ISTATE::TXDONE)
}
fn read_write_bytes(
&self,
write_buffer: &'static mut [u8],
read_buffer: Option<&'static mut [u8]>,
len: usize,
) -> ReturnCode {
// If busy, don't start
if self.is_busy() {
return ReturnCode::EBUSY;
}
self.start_transaction(Some(write_buffer), read_buffer, len)
}
fn write_byte(&self, _val: u8) {
panic!("write_byte is not implemented");
}
fn read_byte(&self) -> u8 {
panic!("read_byte is not implemented");
}
fn read_write_byte(&self, _val: u8) -> u8 {
panic!("read_write_byte is not implemented");
}
fn specify_chip_select(&self, _cs: Self::ChipSelect) {
// Nothing to be done
}
/// Returns the actual rate set
fn set_rate(&self, _rate: u32) -> u32 {
panic!("set_rate is not implemented");
}
fn get_rate(&self) -> u32 {
panic!("get_rate is not implemented");
}
fn set_clock(&self, _polarity: ClockPolarity) {
panic!("set_clock is not implemented");
}
fn get_clock(&self) -> ClockPolarity {
panic!("get_clock is not implemented");
}
fn | set_phase | identifier_name | |
spi_host.rs | _reserved),
(0x1000 => tx_fifo: [WriteOnly<u8>; 128]),
(0x1080 => rx_fifo: [ReadOnly<u8>; 128]),
(0x1100 => @END),
}
}
register_bitfields![u32,
CTRL [
/// CPOL setting
CPOL OFFSET(0) NUMBITS(1) [],
/// CPHA setting
CPHA OFFSET(1) NUMBITS(1) [],
/// CSB to SCK setup time in SCK cycles + 1.5
CSBSU OFFSET(2) NUMBITS(4) [],
/// CSB from SCK hold time in SCK cycles + 1 (defined with respect to
/// the last SCK edge)
CSBHLD OFFSET(6) NUMBITS(4) [],
/// SPI Clk Divider. Actual divider is IDIV+1. A value of 0 gives divide
/// by 1 clock, 1 gives divide by 2 etc.
IDIV OFFSET(10) NUMBITS(12) [],
/// Polarity of CSB signal. 0:active low 1:active high
CSBPOL OFFSET(22) NUMBITS(1) [],
/// Order in which bits of byte are sent. 0: send bit 0 first. 1: send
/// bit 7 first
TXBITOR OFFSET(23) NUMBITS(1) [],
/// Order in which bytes of buffer word are sent.
/// 0: send byte 0 first. 1: send byte 3 first
TXBYTOR OFFSET(24) NUMBITS(1) [],
/// Order in which received bits are packed into byte.
/// 0: first bit received is bit0 1: last bit received is bit 0
RXBITOR OFFSET(25) NUMBITS(1) [],
/// Order in which received bytes are packed into word.
/// 0: first byte received is byte 0 1: first byte received is byte 3
RXBYTOR OFFSET(26) NUMBITS(1) [],
/// SPI Passthrough Mode. 0: Disable, 1: Enable. This is the host side
/// control of whether passthrough is allowed. In order for full
/// passthrough functionality, both the host and device passthrough
/// functionality have to be enabled
ENPASSTHRU OFFSET(27) NUMBITS(1) []
],
XACT [
/// Initiate transaction in buffer
START OFFSET(0) NUMBITS(1) [],
/// Bits-1 in last byte transferred. The default assumes last byte will
/// have 8 bits, this should be sufficient for most usage.
BCNT OFFSET(1) NUMBITS(3) [],
/// Total number of transactions in bytes-1. If 64 bytes are to be
/// transferred, this should be programmed as 63.
SIZE OFFSET(4) NUMBITS(7) [],
/// Poll for ready
RDY_POLL OFFSET(11) NUMBITS(1) [],
/// Delay before polling in PCLK cycles + 1
RDY_POLL_DLY OFFSET(12) NUMBITS(5) []
],
ICTRL [
/// TX interrupt enable
TXDONE OFFSET(0) NUMBITS(1) []
],
ISTATE [
/// TX done interrupt
TXDONE OFFSET(0) NUMBITS(1) []
],
ISTATE_CLR [
/// TX done interrupt clear
TXDONE OFFSET(0) NUMBITS(1) []
]
];
const SPI_HOST0_BASE_ADDR: u32 = 0x4070_0000;
const SPI_HOST1_BASE_ADDR: u32 = 0x4071_0000;
const SPI_HOST0_REGISTERS: StaticRef<Registers> =
unsafe { StaticRef::new(SPI_HOST0_BASE_ADDR as *const Registers) };
const SPI_HOST1_REGISTERS: StaticRef<Registers> =
unsafe { StaticRef::new(SPI_HOST1_BASE_ADDR as *const Registers) };
pub static mut SPI_HOST0: SpiHostHardware = SpiHostHardware::new(SPI_HOST0_REGISTERS);
pub static mut SPI_HOST1: SpiHostHardware = SpiHostHardware::new(SPI_HOST1_REGISTERS);
/// A SPI Host
pub struct SpiHostHardware {
registers: StaticRef<Registers>,
transaction_len: Cell<usize>,
tx_buffer: TakeCell<'static, [u8]>,
rx_buffer: TakeCell<'static, [u8]>,
client: OptionalCell<&'static dyn SpiMasterClient>,
}
impl SpiHostHardware {
const fn new(base_addr: StaticRef<Registers>) -> SpiHostHardware {
SpiHostHardware {
registers: base_addr,
transaction_len: Cell::new(0),
tx_buffer: TakeCell::empty(),
rx_buffer: TakeCell::empty(),
client: OptionalCell::empty(),
}
}
pub fn init(&self) {
self.registers.ctrl.write(
CTRL::CPOL::CLEAR +
CTRL::CPHA::CLEAR +
CTRL::CSBSU::CLEAR +
CTRL::CSBHLD::CLEAR +
CTRL::IDIV.val(2) +
CTRL::CSBPOL::CLEAR +
CTRL::TXBITOR::SET +
CTRL::TXBYTOR::CLEAR +
CTRL::RXBITOR::SET +
CTRL::RXBYTOR::CLEAR +
CTRL::ENPASSTHRU::CLEAR);
self.registers.xact.write(
XACT::START::CLEAR +
XACT::BCNT.val(7) +
XACT::SIZE.val(0) +
XACT::RDY_POLL::CLEAR +
XACT::RDY_POLL_DLY.val(0));
}
fn enable_tx_interrupt(&self) {
self.registers.ictrl.modify(ICTRL::TXDONE::SET);
}
fn disable_tx_interrupt(&self) {
self.registers.ictrl.modify(ICTRL::TXDONE::CLEAR);
}
pub fn handle_interrupt(&self) {
//debug!("SpiHostHardware::handle_interrupt: ISTATE = {:08x}", self.registers.istate.get());
if self.registers.istate.is_set(ISTATE::TXDONE) {
self.registers.istate_clr.write(ISTATE_CLR::TXDONE::SET);
self.client.map(|client| {
self.tx_buffer.take()
.map(|tx_buf| {
self.rx_buffer
.map(|rx_buf| {
self.read_data(rx_buf);
});
client.read_write_done(
tx_buf,
self.rx_buffer.take(),
self.transaction_len.get())
});
});
}
self.disable_tx_interrupt();
}
fn start_transaction(
&self,
write_buffer: Option<&'static mut [u8]>,
read_buffer: Option<&'static mut [u8]>,
transaction_len: usize) -> ReturnCode {
//debug!("SpiHostHardware::start_transaction: transaction_len={}", transaction_len);
// The transaction needs at least one byte.
// It also cannot have more bytes than tx_fifo or rx_fifo is long.
if (transaction_len == 0) ||
(transaction_len > self.registers.tx_fifo.len()) ||
(transaction_len > self.registers.rx_fifo.len()) {
//debug!("SpiHostHardware::start_transaction: Invalid transaction_len={}", transaction_len);
return ReturnCode::ESIZE;
}
self.registers.xact.modify(XACT::BCNT.val(7));
self.registers.xact.modify(XACT::SIZE.val((transaction_len - 1) as u32));
let mut tx_buf_len = 0;
write_buffer.as_ref().map(|tx_buf| {
tx_buf_len = min(tx_buf.len(), transaction_len);
for idx in 0..tx_buf_len {
self.registers.tx_fifo[idx].set(tx_buf[idx]);
}
});
// Clear the TX FIFO for additional bytes not supplied by write_buffer.
// Since we have no control over how many bytes the SPI host reads, we
// want to make sure to not accidentally leak information that made it
// into the TX FIFO beyond the length of the `write_buffer`.
for idx in tx_buf_len..transaction_len {
self.registers.tx_fifo[idx].set(0xff);
}
write_buffer.map(|buf| {
self.tx_buffer.replace(buf);
});
read_buffer.map(|buf| {
self.rx_buffer.replace(buf);
});
self.transaction_len.set(transaction_len);
self.registers.istate_clr.write(ISTATE_CLR::TXDONE::SET);
self.enable_tx_interrupt();
self.registers.xact.modify(XACT::START::SET);
ReturnCode::SUCCESS
}
fn read_data(&self, read_buffer: &mut [u8]) {
let read_len = min(read_buffer.len(), self.transaction_len.get());
for idx in 0..read_len {
let val = self.registers.rx_fifo[idx].get();
read_buffer[idx] = val;
}
}
}
impl SpiHost for SpiHostHardware {
fn spi_device_spi_host_passthrough(&self, enabled: bool) {
self.registers.ctrl.modify(
if enabled { CTRL::ENPASSTHRU::SET } else | { CTRL::ENPASSTHRU::CLEAR } | conditional_block | |
campaign-gant-chart.js | rendering performance for large charts.
g.setShowComp(0);
g.setShowTaskInfoLink(0);
g.setShowTaskInfoRes(0);
g.setShowTaskInfoComp(0);
g.setFormatArr('Day', 'Week', 'Month', 'Quarter'); // Even with setUseSingleCell using Hour format on such a large chart can cause issues in some browsers
//(pID, pName, pStart, pEnd, pStyle, pLink, pMile, pRes, pComp, pGroup, pParent, pOpen, pDepend, pCaption, pNotes, pGantt)
for (var i = 0; i < campaignList.length; i++) {
var campaign = campaignList[i];
if(campaignIds.length > 0){
if((campaignIds.indexOf(campaign.id+"") == -1)) continue;
}
//populate campaigns
var startDate = new Date(parseFloat(campaign.startDate));
var startDateMM = startDate.getMonth() + 1;
var startDateDD = startDate.getDate();
var startDateString = startDate.getFullYear() + "-" + (startDateMM < 10 ? ("0" + startDateMM) : startDateMM) + "-" + (startDateDD < 10 ? ("0" + startDateDD) : startDateDD);
var endDate = new Date(parseFloat(campaign.endDate));
var endDateMM = endDate.getMonth() + 1;
var endDateDD = endDate.getDate();
var endDateString = endDate.getFullYear() + "-" + (endDateMM < 10 ? ("0" + endDateMM) : endDateMM) + "-" + (endDateDD < 10 ? ("0" + endDateDD) : endDateDD);
var campaignId = campaign.id;
g.AddTaskItem(new JSGantt.TaskItem(campaignId,
campaign.campaignName, startDateString, endDateString,
'ggroupblack', '#', 0, '-', 0, 1, 0, 0, '', '', '', g));
//populate campaignStages
for (var j = 0; j < campaign.campaignStagesSet.length; j++) {
var campaignStage = campaign.campaignStagesSet[j];
startDate = new Date(parseFloat(campaignStage.startDate));
startDateMM = startDate.getMonth() + 1;
startDateDD = startDate.getDate();
startDateString = startDate.getFullYear() + "-" + (startDateMM < 10 ? ("0" + startDateMM) : startDateMM) + "-" + (startDateDD < 10 ? ("0" + startDateDD) : startDateDD);
endDate = new Date(parseFloat(campaignStage.endDate));
endDateMM = endDate.getMonth() + 1;
endDateDD = endDate.getDate();
endDateString = endDate.getFullYear() + "-" + (endDateMM < 10 ? ("0" + endDateMM) : endDateMM) + "-" + (endDateDD < 10 ? ("0" + endDateDD) : endDateDD);
var stageId = "1111" + campaignStage.id;
g.AddTaskItem(new JSGantt.TaskItem(stageId,
campaignStage.stageName, startDateString, endDateString,
'gtaskyellow', '#', 0, '-', 0, 1, campaignId, 0, '', '', '', g));
//populate campaignSubstages
for (var k = 0; k < campaignStage.campaignSubstagesSet.length; k++) {
var table = "";
var campaignSubstage = campaignStage.campaignSubstagesSet[k];
startDate = new Date(parseFloat(campaignSubstage.startDate));
startDateMM = startDate.getMonth() + 1;
startDateDD = startDate.getDate();
startDateString = startDate.getFullYear() + "-" + (startDateMM < 10 ? ("0" + startDateMM) : startDateMM) + "-" + (startDateDD < 10 ? ("0" + startDateDD) : startDateDD);
endDate = new Date(parseFloat(campaignSubstage.endDate));
endDateMM = endDate.getMonth() + 1;
endDateDD = endDate.getDate();
endDateString = endDate.getFullYear() + "-" + (endDateMM < 10 ? ("0" + endDateMM) : endDateMM) + "-" + (endDateDD < 10 ? ("0" + endDateDD) : endDateDD);
var substageId = "9999" + campaignSubstage.id;
var passDependency = "", failDependency = "";
if((campaignSubstage.ssIdForPass != '-1') && (campaignSubstage.ssIdForPass != '0'))
passDependency = "9999" + campaignSubstage.ssIdForPass + "SS";
if((campaignSubstage.ssIdForFail != '-1') && (campaignSubstage.ssIdForFail != '0'))
failDependency = "9999" + campaignSubstage.ssIdForFail + "FF";
var dependency = passDependency + "," + failDependency;
var substageStatusList = campaignSubstage.campaignSubstageStatusList;
var onEnterCount = 0, sentCount = 0, viewedCount = 0, passCount = 0, failCount = 0, noShowCount = 0;
for(var l = 0; l < substageStatusList.length; l++){
var status = substageStatusList[l];
if(status.onEnter == true) onEnterCount = onEnterCount + 1;
if(status.sent == true) sentCount = sentCount + 1;
if(status.pass == true) passCount = passCount + 1;
if(status.fail == true) failCount = failCount + 1;
if(status.viewed == true) viewedCount = viewedCount + 1;
if(status.noShow == true) noShowCount = noShowCount + 1;
}
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>No. of Users:</span><span class='gTaskText'>" + onEnterCount + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Remainders:</span><span class='gTaskText'>" + campaignSubstage.remainders + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Pass Substage:</span><span class='gTaskText'>" + (((campaignSubstage.ssIdForPass == 0) || (campaignSubstage.ssIdForPass == -1)) ? "Not Assigned" : substageList[campaignSubstage.ssIdForPass]) + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Fail Substage:</span><span class='gTaskText'>" + (((campaignSubstage.ssIdForFail == 0) || (campaignSubstage.ssIdForFail == -1)) ? "Not Assigned" : substageList[campaignSubstage.ssIdForFail]) + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>No-Show :</span><span class='gTaskText'>" + noShowList[campaignSubstage.noShow] + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Sent: </span><span class='gTaskText'>"+sentCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Viewed: </span><span class='gTaskText'>"+viewedCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>No-Show: </span><span class='gTaskText'>"+noShowCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Pass: </span><span class='gTaskText'>"+passCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Fail: </span><span class='gTaskText'>"+failCount+"</span></div>";
| "gtaskpurple", '#', 0, content, 0, 0, stageId, 0, dependency, '', table, g));
}
}
}
g.Draw();
} else {
alert("Error, unable to create Gantt Chart");
}
}
function previewChart(divName){
element = $("#"+divName);
/*$("#downloadChart").show();*/
$("#chartPreviewContainer").show();
$("#printChart").show();
html2canvas(element, {
onrendered: function (canvas) {
var imgsrc = canvas.toDataURL("image/png");
$("#chartPreviewImage").attr('src',imgsrc);
getCanvas = canvas;
}
});
}
function show |
var taskStyleIndex = Math.floor(Math.random() * (taskStyle.length - 1)) + 0;
var content = campaignSubstage.connectType == 0 ? campaignSubstage.contentId : campaignSubstage.connectUrl;
g.AddTaskItem(new JSGantt.TaskItem(substageId,
campaignSubstage.campaignSubStageName, startDateString, endDateString,
| random_line_split |
campaign-gant-chart.js | MM < 10 ? ("0" + startDateMM) : startDateMM) + "-" + (startDateDD < 10 ? ("0" + startDateDD) : startDateDD);
endDate = new Date(parseFloat(campaignStage.endDate));
endDateMM = endDate.getMonth() + 1;
endDateDD = endDate.getDate();
endDateString = endDate.getFullYear() + "-" + (endDateMM < 10 ? ("0" + endDateMM) : endDateMM) + "-" + (endDateDD < 10 ? ("0" + endDateDD) : endDateDD);
var stageId = "1111" + campaignStage.id;
g.AddTaskItem(new JSGantt.TaskItem(stageId,
campaignStage.stageName, startDateString, endDateString,
'gtaskyellow', '#', 0, '-', 0, 1, campaignId, 0, '', '', '', g));
//populate campaignSubstages
for (var k = 0; k < campaignStage.campaignSubstagesSet.length; k++) {
var table = "";
var campaignSubstage = campaignStage.campaignSubstagesSet[k];
startDate = new Date(parseFloat(campaignSubstage.startDate));
startDateMM = startDate.getMonth() + 1;
startDateDD = startDate.getDate();
startDateString = startDate.getFullYear() + "-" + (startDateMM < 10 ? ("0" + startDateMM) : startDateMM) + "-" + (startDateDD < 10 ? ("0" + startDateDD) : startDateDD);
endDate = new Date(parseFloat(campaignSubstage.endDate));
endDateMM = endDate.getMonth() + 1;
endDateDD = endDate.getDate();
endDateString = endDate.getFullYear() + "-" + (endDateMM < 10 ? ("0" + endDateMM) : endDateMM) + "-" + (endDateDD < 10 ? ("0" + endDateDD) : endDateDD);
var substageId = "9999" + campaignSubstage.id;
var passDependency = "", failDependency = "";
if((campaignSubstage.ssIdForPass != '-1') && (campaignSubstage.ssIdForPass != '0'))
passDependency = "9999" + campaignSubstage.ssIdForPass + "SS";
if((campaignSubstage.ssIdForFail != '-1') && (campaignSubstage.ssIdForFail != '0'))
failDependency = "9999" + campaignSubstage.ssIdForFail + "FF";
var dependency = passDependency + "," + failDependency;
var substageStatusList = campaignSubstage.campaignSubstageStatusList;
var onEnterCount = 0, sentCount = 0, viewedCount = 0, passCount = 0, failCount = 0, noShowCount = 0;
for(var l = 0; l < substageStatusList.length; l++){
var status = substageStatusList[l];
if(status.onEnter == true) onEnterCount = onEnterCount + 1;
if(status.sent == true) sentCount = sentCount + 1;
if(status.pass == true) passCount = passCount + 1;
if(status.fail == true) failCount = failCount + 1;
if(status.viewed == true) viewedCount = viewedCount + 1;
if(status.noShow == true) noShowCount = noShowCount + 1;
}
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>No. of Users:</span><span class='gTaskText'>" + onEnterCount + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Remainders:</span><span class='gTaskText'>" + campaignSubstage.remainders + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Pass Substage:</span><span class='gTaskText'>" + (((campaignSubstage.ssIdForPass == 0) || (campaignSubstage.ssIdForPass == -1)) ? "Not Assigned" : substageList[campaignSubstage.ssIdForPass]) + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Fail Substage:</span><span class='gTaskText'>" + (((campaignSubstage.ssIdForFail == 0) || (campaignSubstage.ssIdForFail == -1)) ? "Not Assigned" : substageList[campaignSubstage.ssIdForFail]) + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>No-Show :</span><span class='gTaskText'>" + noShowList[campaignSubstage.noShow] + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Sent: </span><span class='gTaskText'>"+sentCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Viewed: </span><span class='gTaskText'>"+viewedCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>No-Show: </span><span class='gTaskText'>"+noShowCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Pass: </span><span class='gTaskText'>"+passCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Fail: </span><span class='gTaskText'>"+failCount+"</span></div>";
var taskStyleIndex = Math.floor(Math.random() * (taskStyle.length - 1)) + 0;
var content = campaignSubstage.connectType == 0 ? campaignSubstage.contentId : campaignSubstage.connectUrl;
g.AddTaskItem(new JSGantt.TaskItem(substageId,
campaignSubstage.campaignSubStageName, startDateString, endDateString,
"gtaskpurple", '#', 0, content, 0, 0, stageId, 0, dependency, '', table, g));
}
}
}
g.Draw();
} else {
alert("Error, unable to create Gantt Chart");
}
}
function previewChart(divName){
element = $("#"+divName);
/*$("#downloadChart").show();*/
$("#chartPreviewContainer").show();
$("#printChart").show();
html2canvas(element, {
onrendered: function (canvas) {
var imgsrc = canvas.toDataURL("image/png");
$("#chartPreviewImage").attr('src',imgsrc);
getCanvas = canvas;
}
});
}
function showLoader(){
$("#form-loader").css("display","inline-block");
$(".wrapper").css("pointer-events", "none");
$(".wrapper").css("opacity", "0.5");
}
function hideLoader(){
$("#form-loader").css("display","none");
$(".wrapper").css("pointer-events", "");
$(".wrapper").css("opacity", "1");
}
function print(divId){
var contents = $("#"+divId).html();
var frame1 = $('<iframe />');
frame1[0].name = "frame1";
frame1.css({ "position": "absolute", "top": "-1000000px" });
$("body").append(frame1);
var frameDoc = frame1[0].contentWindow ? frame1[0].contentWindow : frame1[0].contentDocument.document ? frame1[0].contentDocument.document : frame1[0].contentDocument;
frameDoc.document.open();
//Create a new HTML document.
var currDate = new Date();
var title = "GanttChart-" + (currDate.getMonth() + 1) + "-" + currDate.getDate() + "-" + currDate.getFullYear();
frameDoc.document.write('<html><head><title>'+title+'</title>');
frameDoc.document.write('</head><body>');
//Append the external CSS file.
//frameDoc.document.write('<link href="style.css" rel="stylesheet" type="text/css" />');
//Append the DIV contents.
frameDoc.document.write(contents);
frameDoc.document.write('</body></html>');
frameDoc.document.close();
setTimeout(function () {
window.frames["frame1"].focus();
window.frames["frame1"].print();
frame1.remove();
}, 500);
}
function expandAllFolders(){
$(".gfoldercollapse").each(function( index ){
var pID = $(this).attr("id").split("_")[1];
console.log(index + ": " + $(this).text() + "\t id : " + pID);
JSGantt.folder(pID, {"vTool":{"vToolCont":{},"moveInterval":20,"fadeInterval":23,"delayTimeout":22}});
});
}
function printChart(divName) | {
console.log("Loading");
showLoader();
previewChart(divName);
setTimeout(function () {
print("chartPreviewContainer");
hideLoader();
}, 3500);
$("#chartPreviewContainer").hide();
} | identifier_body | |
campaign-gant-chart.js | TaskItem(new JSGantt.TaskItem(campaignId,
campaign.campaignName, startDateString, endDateString,
'ggroupblack', '#', 0, '-', 0, 1, 0, 0, '', '', '', g));
//populate campaignStages
for (var j = 0; j < campaign.campaignStagesSet.length; j++) {
var campaignStage = campaign.campaignStagesSet[j];
startDate = new Date(parseFloat(campaignStage.startDate));
startDateMM = startDate.getMonth() + 1;
startDateDD = startDate.getDate();
startDateString = startDate.getFullYear() + "-" + (startDateMM < 10 ? ("0" + startDateMM) : startDateMM) + "-" + (startDateDD < 10 ? ("0" + startDateDD) : startDateDD);
endDate = new Date(parseFloat(campaignStage.endDate));
endDateMM = endDate.getMonth() + 1;
endDateDD = endDate.getDate();
endDateString = endDate.getFullYear() + "-" + (endDateMM < 10 ? ("0" + endDateMM) : endDateMM) + "-" + (endDateDD < 10 ? ("0" + endDateDD) : endDateDD);
var stageId = "1111" + campaignStage.id;
g.AddTaskItem(new JSGantt.TaskItem(stageId,
campaignStage.stageName, startDateString, endDateString,
'gtaskyellow', '#', 0, '-', 0, 1, campaignId, 0, '', '', '', g));
//populate campaignSubstages
for (var k = 0; k < campaignStage.campaignSubstagesSet.length; k++) {
var table = "";
var campaignSubstage = campaignStage.campaignSubstagesSet[k];
startDate = new Date(parseFloat(campaignSubstage.startDate));
startDateMM = startDate.getMonth() + 1;
startDateDD = startDate.getDate();
startDateString = startDate.getFullYear() + "-" + (startDateMM < 10 ? ("0" + startDateMM) : startDateMM) + "-" + (startDateDD < 10 ? ("0" + startDateDD) : startDateDD);
endDate = new Date(parseFloat(campaignSubstage.endDate));
endDateMM = endDate.getMonth() + 1;
endDateDD = endDate.getDate();
endDateString = endDate.getFullYear() + "-" + (endDateMM < 10 ? ("0" + endDateMM) : endDateMM) + "-" + (endDateDD < 10 ? ("0" + endDateDD) : endDateDD);
var substageId = "9999" + campaignSubstage.id;
var passDependency = "", failDependency = "";
if((campaignSubstage.ssIdForPass != '-1') && (campaignSubstage.ssIdForPass != '0'))
passDependency = "9999" + campaignSubstage.ssIdForPass + "SS";
if((campaignSubstage.ssIdForFail != '-1') && (campaignSubstage.ssIdForFail != '0'))
failDependency = "9999" + campaignSubstage.ssIdForFail + "FF";
var dependency = passDependency + "," + failDependency;
var substageStatusList = campaignSubstage.campaignSubstageStatusList;
var onEnterCount = 0, sentCount = 0, viewedCount = 0, passCount = 0, failCount = 0, noShowCount = 0;
for(var l = 0; l < substageStatusList.length; l++){
var status = substageStatusList[l];
if(status.onEnter == true) onEnterCount = onEnterCount + 1;
if(status.sent == true) sentCount = sentCount + 1;
if(status.pass == true) passCount = passCount + 1;
if(status.fail == true) failCount = failCount + 1;
if(status.viewed == true) viewedCount = viewedCount + 1;
if(status.noShow == true) noShowCount = noShowCount + 1;
}
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>No. of Users:</span><span class='gTaskText'>" + onEnterCount + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Remainders:</span><span class='gTaskText'>" + campaignSubstage.remainders + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Pass Substage:</span><span class='gTaskText'>" + (((campaignSubstage.ssIdForPass == 0) || (campaignSubstage.ssIdForPass == -1)) ? "Not Assigned" : substageList[campaignSubstage.ssIdForPass]) + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Fail Substage:</span><span class='gTaskText'>" + (((campaignSubstage.ssIdForFail == 0) || (campaignSubstage.ssIdForFail == -1)) ? "Not Assigned" : substageList[campaignSubstage.ssIdForFail]) + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>No-Show :</span><span class='gTaskText'>" + noShowList[campaignSubstage.noShow] + "</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Sent: </span><span class='gTaskText'>"+sentCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Viewed: </span><span class='gTaskText'>"+viewedCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>No-Show: </span><span class='gTaskText'>"+noShowCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Pass: </span><span class='gTaskText'>"+passCount+"</span></div>";
table += "<div class='gTILine gTIsd'><span class='gTaskLabel'>Fail: </span><span class='gTaskText'>"+failCount+"</span></div>";
var taskStyleIndex = Math.floor(Math.random() * (taskStyle.length - 1)) + 0;
var content = campaignSubstage.connectType == 0 ? campaignSubstage.contentId : campaignSubstage.connectUrl;
g.AddTaskItem(new JSGantt.TaskItem(substageId,
campaignSubstage.campaignSubStageName, startDateString, endDateString,
"gtaskpurple", '#', 0, content, 0, 0, stageId, 0, dependency, '', table, g));
}
}
}
g.Draw();
} else {
alert("Error, unable to create Gantt Chart");
}
}
function previewChart(divName){
element = $("#"+divName);
/*$("#downloadChart").show();*/
$("#chartPreviewContainer").show();
$("#printChart").show();
html2canvas(element, {
onrendered: function (canvas) {
var imgsrc = canvas.toDataURL("image/png");
$("#chartPreviewImage").attr('src',imgsrc);
getCanvas = canvas;
}
});
}
function showLoader(){
$("#form-loader").css("display","inline-block");
$(".wrapper").css("pointer-events", "none");
$(".wrapper").css("opacity", "0.5");
}
function hideLoader(){
$("#form-loader").css("display","none");
$(".wrapper").css("pointer-events", "");
$(".wrapper").css("opacity", "1");
}
function print(divId){
var contents = $("#"+divId).html();
var frame1 = $('<iframe />');
frame1[0].name = "frame1";
frame1.css({ "position": "absolute", "top": "-1000000px" });
$("body").append(frame1);
var frameDoc = frame1[0].contentWindow ? frame1[0].contentWindow : frame1[0].contentDocument.document ? frame1[0].contentDocument.document : frame1[0].contentDocument;
frameDoc.document.open();
//Create a new HTML document.
var currDate = new Date();
var title = "GanttChart-" + (currDate.getMonth() + 1) + "-" + currDate.getDate() + "-" + currDate.getFullYear();
frameDoc.document.write('<html><head><title>'+title+'</title>');
frameDoc.document.write('</head><body>');
//Append the external CSS file.
//frameDoc.document.write('<link href="style.css" rel="stylesheet" type="text/css" />');
//Append the DIV contents.
frameDoc.document.write(contents);
frameDoc.document.write('</body></html>');
frameDoc.document.close();
setTimeout(function () {
window.frames["frame1"].focus();
window.frames["frame1"].print();
frame1.remove();
}, 500);
}
function | expandAllFolders | identifier_name | |
adc.rs | MHz, >5k @ ADCK < 4MHz)
/// inputs.
Long = 1,
}
/// Adc Clock Divisors
///
/// Note 1/16 divisor is only usable for the Bus clock
pub enum ClockDivisor {
/// Source / 1, No divison
_1 = 0,
/// Source / 2
_2 = 1,
/// Source / 4
_4 = 2,
/// Source / 8
_8 = 3,
/// Source / 16
_16 = 4,
}
/// Enabled state
pub struct Enabled;
/// Disabled state
pub struct Disabled;
impl Adc<Enabled> {
/// Poll to determine if ADC conversion is complete.
///
/// Note: This flag is cleared when the sampling mode is changed,
/// interrupts are enabled, [Adc::set_channel] is called, and when [Adc::result] is
/// called (including [Adc::try_result])
pub fn is_done(&self) -> bool {
self.peripheral.sc1.read().coco().bit()
}
/// Poll to determine if ADC conversion is underway
pub fn is_converting(&self) -> bool {
self.peripheral.sc2.read().adact().bit()
}
/// Grab the last ADC conversion result.
pub fn result(&self) -> u16 {
self.peripheral.r.read().adr().bits()
}
/// Poll for conversion completion, if done return the result.
pub fn try_result(&self) -> Option<u16> {
if self.is_done() {
Some(self.result())
} else {
None
}
}
/// Set ADC target channel.
///
/// In Single conversion mode (OneShot), setting the channel begins the conversion. In FIFO mode
/// the channel is added to the FIFO buffer.
///
/// Note: If the channel is changed while a conversion is in progress the
/// current conversion will be cancelled. If in FIFO mode, conversion will
/// resume once the FIFO channels are refilled.
pub fn set_channel<T: Channel<Adc<Enabled>, ID = u8>>(&self, _pin: &T) {
self.peripheral
.sc1
.modify(|_, w| unsafe { w.adch().bits(T::channel()) });
}
/// Set the ADC's configuration
pub fn configure(self, config: AdcConfig) -> Adc<Enabled> {
self.peripheral.sc3.modify(|_, w| {
use pac::adc::sc3::{ADICLK_A, ADIV_A, ADLSMP_A, MODE_A};
w.adiclk()
.variant(match config.clock_source {
AdcClocks::Bus =>
// If divisor is 16, use the Bus / 2 clock source, else use
// the 1:1 Bus clock source
{
match config.clock_divisor {
ClockDivisor::_16 => ADICLK_A::_01,
_ => ADICLK_A::_00,
}
}
AdcClocks::External => ADICLK_A::_10,
AdcClocks::Async => ADICLK_A::_11,
})
.mode()
.variant(match config.resolution {
AdcResolution::_8bit => MODE_A::_00,
AdcResolution::_10bit => MODE_A::_01,
AdcResolution::_12bit => MODE_A::_10,
})
.adlsmp()
.variant(match config.sample_time {
AdcSampleTime::Short => ADLSMP_A::_0,
AdcSampleTime::Long => ADLSMP_A::_1,
})
.adiv()
.variant(match config.clock_divisor {
ClockDivisor::_1 => ADIV_A::_00,
ClockDivisor::_2 => ADIV_A::_01,
ClockDivisor::_4 => ADIV_A::_10,
_ => ADIV_A::_11,
})
.adlpc()
.bit(config.low_power)
});
// It looks like SCGC has to be set before touching the peripheral
// at all, else hardfault. Go back later to confirm that if using external clock
// scgc can be cleared.
// w.adc().variant(match config.clock_source {
// AdcClocks::Bus => ADC_A::_1,
// _ => ADC_A::_0,
// })
Adc {
peripheral: self.peripheral,
_state: PhantomData,
onchip_channels: self.onchip_channels,
}
}
}
impl Adc<Disabled> {
/// Connects the bus clock to the adc via the SIM peripheral, allowing
/// read and write access to ADC registers.
///
/// Any attempt to access ADC registers while disabled results in a
/// HardFault, generated by hardware.
///
/// This also enables the bandgap voltage reference.
pub fn enable(self) -> Adc<Enabled> {
cortex_m::interrupt::free(|_| {
unsafe { &(*pac::SIM::ptr()) }.scgc.modify(|_, w| {
use pac::sim::scgc::ADC_A;
w.adc().variant(ADC_A::_1)
});
// Don't start a conversion (set channel to DummyDisable)
self.peripheral.sc1.modify(|_, w| w.adch()._11111());
// Bandgap. Grab directly, Currently the bandgap isn't implemented
// in [system::PMC]. We will eventually have to pass in the pmc
// peripheral handle as a variable.
unsafe { &(*pac::PMC::ptr()) }
.spmsc1
.modify(|_, w| w.bgbe()._1());
});
Adc {
peripheral: self.peripheral,
_state: PhantomData,
onchip_channels: self.onchip_channels,
}
}
/// Set the ADC's configuration
///
/// This is a sugar method for calling [Adc<Disabled>::enable] followed by
/// [Adc<Enabled>::configure]
pub fn configure(self, config: AdcConfig) -> Adc<Enabled> {
self.enable().configure(config)
}
}
impl<Mode> Adc<Mode> {
/// Not Implemented
pub fn into_interrupt(self) -> Adc<Mode> {
unimplemented!("Interrupt is not yet implemented");
// Adc::<Mode> {
// peripheral: self.peripheral,
// _state: PhantomData,
// onchip_channels: self.onchip_channels,
// }
}
/// Not Implemented
pub fn into_fifo(self, _depth: u8) -> Adc<Mode> {
// self.peripheral
// .sc4
// .modify(|_r, w| w.afdep().bits(depth & 0x7));
// Adc::<Mode> {
// peripheral: self.peripheral,
// _state: PhantomData,
// onchip_channels: self.onchip_channels,
// }
unimplemented!("FIFO is not yet implemented");
}
/// Not Implemented
pub fn into_continuous(self) -> Adc<Mode> {
unimplemented!("Continuous Conversion mode not yet implemented");
}
}
impl OnChipChannels {
/// Request an instance of an on-chip [Vss] channel.
pub fn vss(&mut self) -> Result<Analog<Vss<Input>>, Error> {
self.vss.take().ok_or(Error::Moved)
}
/// Return the instance of [Vss]
pub fn return_vss(&mut self, inst: Analog<Vss<Input>>) {
self.vss.replace(inst);
}
/// Try to grab an instance of the onchip [TempSense] channel.
pub fn tempsense(&mut self) -> Result<Analog<TempSense<Input>>, Error> {
self.temp_sense.take().ok_or(Error::Moved)
}
/// Return the instance of [TempSense]
pub fn return_tempsense(&mut self, inst: Analog<TempSense<Input>>) {
self.temp_sense.replace(inst);
}
/// Try to grab an instance of the onchip [Bandgap] channel.
///
/// The bandgap reference is a fixed 1.16V (nom, Factory trimmed to +/-
/// 0.02V at Vdd=5.0 at 125C) signal that is available to the ADC Module.
/// It can be used as a voltage reference for the ACMP and as an [Analog]
/// channel that can be used to (roughly) check the VDD voltage
pub fn bandgap(&mut self) -> Result<Analog<Bandgap<Input>>, Error> {
self.bandgap.take().ok_or(Error::Moved)
}
/// Return the instance of [Bandgap]
pub fn return_bandgap(&mut self, inst: Analog<Bandgap<Input>>) {
self.bandgap.replace(inst);
}
/// Try to grab an instance of the onchip Voltage Reference High ([VrefH]) channel.
pub fn vref_h(&mut self) -> Result<Analog<VrefH<Input>>, Error> {
self.vref_h.take().ok_or(Error::Moved)
}
/// Return the instance of [VrefH]
pub fn | return_vref_h | identifier_name | |
adc.rs | _freq.integer() / req_adc_freq.integer()) as u8;
let mut output: u8 = 1;
let mut err: i8 = (denom - output) as i8;
let mut err_old: i8 = err;
let max_divisor = match self.clock_source {
AdcClocks::Bus => 16,
_ => 8,
};
while output < max_divisor {
err = (denom - (output << 1)) as i8;
if err.is_negative() {
err = err.abs();
}
if err <= err_old {
output <<= 1;
err_old = err;
} else {
break;
}
}
// I am of the mind that this assert is okay, at least until the input
// clock can be known at compile time.
let ad_clock = source_freq.integer() / output as u32;
assert!(400_000 <= ad_clock);
assert!(
ad_clock
<= match self.low_power {
false => 8_000_000,
true => 4_000_000,
}
);
self.clock_divisor = match output {
1 => ClockDivisor::_1,
2 => ClockDivisor::_2,
4 => ClockDivisor::_4,
8 => ClockDivisor::_8,
_ => ClockDivisor::_16,
}
}
/// Set the divisor directly. panics if divisor isn't supported by the
/// clock source.
///
/// TODO: Refactor to remove assert. Add Clock Source as a type state
pub fn set_divisor(&mut self, divisor: ClockDivisor) {
// divisor can't be 16 unless using the Bus clock
assert!(
!(!matches!(self.clock_source, AdcClocks::Bus) && matches!(divisor, ClockDivisor::_16))
);
self.clock_divisor = divisor;
}
/// Sets the clock source, panics if divisor isn't supported
///
/// TODO: Refactor to remove assert. Add Clock Source as a type state
pub fn set_clock_source(&mut self, clock: AdcClocks) {
// Panic if setting the clock to anything other than Bus if the divisor
// is set to 16
assert!(
!matches!(clock, AdcClocks::Bus) && matches!(self.clock_divisor, ClockDivisor::_16)
);
self.clock_source = clock;
}
}
impl Default for AdcConfig {
fn default() -> AdcConfig {
AdcConfig {
clock_source: AdcClocks::Bus,
clock_divisor: ClockDivisor::_1,
resolution: AdcResolution::_12bit,
sample_time: AdcSampleTime::Short,
low_power: false,
}
}
}
/// Clock types available to the Adc peripheral
///
/// Dividers will be chosen appropriately to suit requested clock rate.
pub enum AdcClocks {
/// Use the incoming Bus Clock
Bus,
/// jkl
External,
/// Available in Wait AND Stop Mode
Async,
}
/// This enum represents the availabe ADC resolutions
///
/// Regardless of resolution chosen, results are always right justified
#[repr(u8)]
pub enum AdcResolution {
/// 8 bit AD conversion mode
_8bit = 0,
/// 10 bit AD conversion mode
_10bit = 1,
/// 12 bit AD conversion mode
_12bit = 2,
}
/// Adc sample time
pub enum AdcSampleTime {
/// Sample for 3.5 ADC clock (ADCK) cycles.
Short = 0,
/// Sample for 23.5 ADC clock (ADCK) cycles.
///
/// Required for high impedence (>2k @ADCK > 4MHz, >5k @ ADCK < 4MHz)
/// inputs.
Long = 1,
}
/// Adc Clock Divisors
///
/// Note 1/16 divisor is only usable for the Bus clock
pub enum ClockDivisor {
/// Source / 1, No divison
_1 = 0,
/// Source / 2
_2 = 1,
/// Source / 4
_4 = 2,
/// Source / 8
_8 = 3,
/// Source / 16
_16 = 4,
}
/// Enabled state
pub struct Enabled;
/// Disabled state
pub struct Disabled;
impl Adc<Enabled> {
/// Poll to determine if ADC conversion is complete.
///
/// Note: This flag is cleared when the sampling mode is changed,
/// interrupts are enabled, [Adc::set_channel] is called, and when [Adc::result] is
/// called (including [Adc::try_result])
pub fn is_done(&self) -> bool {
self.peripheral.sc1.read().coco().bit()
}
/// Poll to determine if ADC conversion is underway
pub fn is_converting(&self) -> bool {
self.peripheral.sc2.read().adact().bit()
}
/// Grab the last ADC conversion result.
pub fn result(&self) -> u16 {
self.peripheral.r.read().adr().bits()
}
/// Poll for conversion completion, if done return the result.
pub fn try_result(&self) -> Option<u16> {
if self.is_done() {
Some(self.result())
} else {
None
}
}
/// Set ADC target channel.
///
/// In Single conversion mode (OneShot), setting the channel begins the conversion. In FIFO mode
/// the channel is added to the FIFO buffer.
///
/// Note: If the channel is changed while a conversion is in progress the
/// current conversion will be cancelled. If in FIFO mode, conversion will
/// resume once the FIFO channels are refilled.
pub fn set_channel<T: Channel<Adc<Enabled>, ID = u8>>(&self, _pin: &T) {
self.peripheral
.sc1
.modify(|_, w| unsafe { w.adch().bits(T::channel()) });
}
/// Set the ADC's configuration
pub fn configure(self, config: AdcConfig) -> Adc<Enabled> {
self.peripheral.sc3.modify(|_, w| {
use pac::adc::sc3::{ADICLK_A, ADIV_A, ADLSMP_A, MODE_A};
w.adiclk()
.variant(match config.clock_source {
AdcClocks::Bus =>
// If divisor is 16, use the Bus / 2 clock source, else use
// the 1:1 Bus clock source
{
match config.clock_divisor {
ClockDivisor::_16 => ADICLK_A::_01,
_ => ADICLK_A::_00,
}
}
AdcClocks::External => ADICLK_A::_10,
AdcClocks::Async => ADICLK_A::_11,
})
.mode()
.variant(match config.resolution {
AdcResolution::_8bit => MODE_A::_00,
AdcResolution::_10bit => MODE_A::_01,
AdcResolution::_12bit => MODE_A::_10,
})
.adlsmp()
.variant(match config.sample_time {
AdcSampleTime::Short => ADLSMP_A::_0,
AdcSampleTime::Long => ADLSMP_A::_1,
})
.adiv()
.variant(match config.clock_divisor {
ClockDivisor::_1 => ADIV_A::_00,
ClockDivisor::_2 => ADIV_A::_01,
ClockDivisor::_4 => ADIV_A::_10,
_ => ADIV_A::_11,
})
.adlpc()
.bit(config.low_power)
});
// It looks like SCGC has to be set before touching the peripheral
// at all, else hardfault. Go back later to confirm that if using external clock
// scgc can be cleared.
// w.adc().variant(match config.clock_source {
// AdcClocks::Bus => ADC_A::_1,
// _ => ADC_A::_0,
// })
Adc {
peripheral: self.peripheral,
_state: PhantomData,
onchip_channels: self.onchip_channels,
}
}
}
impl Adc<Disabled> {
/// Connects the bus clock to the adc via the SIM peripheral, allowing
/// read and write access to ADC registers.
///
/// Any attempt to access ADC registers while disabled results in a
/// HardFault, generated by hardware.
///
/// This also enables the bandgap voltage reference.
pub fn enable(self) -> Adc<Enabled> {
cortex_m::interrupt::free(|_| {
unsafe { &(*pac::SIM::ptr()) }.scgc.modify(|_, w| {
use pac::sim::scgc::ADC_A;
w.adc().variant(ADC_A::_1)
});
| // Don't start a conversion (set channel to DummyDisable)
self.peripheral.sc1.modify(|_, w| w.adch()._11111()); | random_line_split | |
adc.rs | 2bit = 2,
}
/// Adc sample time
pub enum AdcSampleTime {
/// Sample for 3.5 ADC clock (ADCK) cycles.
Short = 0,
/// Sample for 23.5 ADC clock (ADCK) cycles.
///
/// Required for high impedence (>2k @ADCK > 4MHz, >5k @ ADCK < 4MHz)
/// inputs.
Long = 1,
}
/// Adc Clock Divisors
///
/// Note 1/16 divisor is only usable for the Bus clock
pub enum ClockDivisor {
/// Source / 1, No divison
_1 = 0,
/// Source / 2
_2 = 1,
/// Source / 4
_4 = 2,
/// Source / 8
_8 = 3,
/// Source / 16
_16 = 4,
}
/// Enabled state
pub struct Enabled;
/// Disabled state
pub struct Disabled;
impl Adc<Enabled> {
/// Poll to determine if ADC conversion is complete.
///
/// Note: This flag is cleared when the sampling mode is changed,
/// interrupts are enabled, [Adc::set_channel] is called, and when [Adc::result] is
/// called (including [Adc::try_result])
pub fn is_done(&self) -> bool {
self.peripheral.sc1.read().coco().bit()
}
/// Poll to determine if ADC conversion is underway
pub fn is_converting(&self) -> bool {
self.peripheral.sc2.read().adact().bit()
}
/// Grab the last ADC conversion result.
pub fn result(&self) -> u16 {
self.peripheral.r.read().adr().bits()
}
/// Poll for conversion completion, if done return the result.
pub fn try_result(&self) -> Option<u16> {
if self.is_done() {
Some(self.result())
} else {
None
}
}
/// Set ADC target channel.
///
/// In Single conversion mode (OneShot), setting the channel begins the conversion. In FIFO mode
/// the channel is added to the FIFO buffer.
///
/// Note: If the channel is changed while a conversion is in progress the
/// current conversion will be cancelled. If in FIFO mode, conversion will
/// resume once the FIFO channels are refilled.
pub fn set_channel<T: Channel<Adc<Enabled>, ID = u8>>(&self, _pin: &T) {
self.peripheral
.sc1
.modify(|_, w| unsafe { w.adch().bits(T::channel()) });
}
/// Set the ADC's configuration
pub fn configure(self, config: AdcConfig) -> Adc<Enabled> {
self.peripheral.sc3.modify(|_, w| {
use pac::adc::sc3::{ADICLK_A, ADIV_A, ADLSMP_A, MODE_A};
w.adiclk()
.variant(match config.clock_source {
AdcClocks::Bus =>
// If divisor is 16, use the Bus / 2 clock source, else use
// the 1:1 Bus clock source
{
match config.clock_divisor {
ClockDivisor::_16 => ADICLK_A::_01,
_ => ADICLK_A::_00,
}
}
AdcClocks::External => ADICLK_A::_10,
AdcClocks::Async => ADICLK_A::_11,
})
.mode()
.variant(match config.resolution {
AdcResolution::_8bit => MODE_A::_00,
AdcResolution::_10bit => MODE_A::_01,
AdcResolution::_12bit => MODE_A::_10,
})
.adlsmp()
.variant(match config.sample_time {
AdcSampleTime::Short => ADLSMP_A::_0,
AdcSampleTime::Long => ADLSMP_A::_1,
})
.adiv()
.variant(match config.clock_divisor {
ClockDivisor::_1 => ADIV_A::_00,
ClockDivisor::_2 => ADIV_A::_01,
ClockDivisor::_4 => ADIV_A::_10,
_ => ADIV_A::_11,
})
.adlpc()
.bit(config.low_power)
});
// It looks like SCGC has to be set before touching the peripheral
// at all, else hardfault. Go back later to confirm that if using external clock
// scgc can be cleared.
// w.adc().variant(match config.clock_source {
// AdcClocks::Bus => ADC_A::_1,
// _ => ADC_A::_0,
// })
Adc {
peripheral: self.peripheral,
_state: PhantomData,
onchip_channels: self.onchip_channels,
}
}
}
impl Adc<Disabled> {
/// Connects the bus clock to the adc via the SIM peripheral, allowing
/// read and write access to ADC registers.
///
/// Any attempt to access ADC registers while disabled results in a
/// HardFault, generated by hardware.
///
/// This also enables the bandgap voltage reference.
pub fn enable(self) -> Adc<Enabled> {
cortex_m::interrupt::free(|_| {
unsafe { &(*pac::SIM::ptr()) }.scgc.modify(|_, w| {
use pac::sim::scgc::ADC_A;
w.adc().variant(ADC_A::_1)
});
// Don't start a conversion (set channel to DummyDisable)
self.peripheral.sc1.modify(|_, w| w.adch()._11111());
// Bandgap. Grab directly, Currently the bandgap isn't implemented
// in [system::PMC]. We will eventually have to pass in the pmc
// peripheral handle as a variable.
unsafe { &(*pac::PMC::ptr()) }
.spmsc1
.modify(|_, w| w.bgbe()._1());
});
Adc {
peripheral: self.peripheral,
_state: PhantomData,
onchip_channels: self.onchip_channels,
}
}
/// Set the ADC's configuration
///
/// This is a sugar method for calling [Adc<Disabled>::enable] followed by
/// [Adc<Enabled>::configure]
pub fn configure(self, config: AdcConfig) -> Adc<Enabled> {
self.enable().configure(config)
}
}
impl<Mode> Adc<Mode> {
/// Not Implemented
pub fn into_interrupt(self) -> Adc<Mode> {
unimplemented!("Interrupt is not yet implemented");
// Adc::<Mode> {
// peripheral: self.peripheral,
// _state: PhantomData,
// onchip_channels: self.onchip_channels,
// }
}
/// Not Implemented
pub fn into_fifo(self, _depth: u8) -> Adc<Mode> {
// self.peripheral
// .sc4
// .modify(|_r, w| w.afdep().bits(depth & 0x7));
// Adc::<Mode> {
// peripheral: self.peripheral,
// _state: PhantomData,
// onchip_channels: self.onchip_channels,
// }
unimplemented!("FIFO is not yet implemented");
}
/// Not Implemented
pub fn into_continuous(self) -> Adc<Mode> {
unimplemented!("Continuous Conversion mode not yet implemented");
}
}
impl OnChipChannels {
/// Request an instance of an on-chip [Vss] channel.
pub fn vss(&mut self) -> Result<Analog<Vss<Input>>, Error> {
self.vss.take().ok_or(Error::Moved)
}
/// Return the instance of [Vss]
pub fn return_vss(&mut self, inst: Analog<Vss<Input>>) {
self.vss.replace(inst);
}
/// Try to grab an instance of the onchip [TempSense] channel.
pub fn tempsense(&mut self) -> Result<Analog<TempSense<Input>>, Error> {
self.temp_sense.take().ok_or(Error::Moved)
}
/// Return the instance of [TempSense]
pub fn return_tempsense(&mut self, inst: Analog<TempSense<Input>>) {
self.temp_sense.replace(inst);
}
/// Try to grab an instance of the onchip [Bandgap] channel.
///
/// The bandgap reference is a fixed 1.16V (nom, Factory trimmed to +/-
/// 0.02V at Vdd=5.0 at 125C) signal that is available to the ADC Module.
/// It can be used as a voltage reference for the ACMP and as an [Analog]
/// channel that can be used to (roughly) check the VDD voltage
pub fn bandgap(&mut self) -> Result<Analog<Bandgap<Input>>, Error> {
self.bandgap.take().ok_or(Error::Moved)
}
/// Return the instance of [Bandgap]
pub fn return_bandgap(&mut self, inst: Analog<Bandgap<Input>>) | {
self.bandgap.replace(inst);
} | identifier_body | |
adc.rs | _analog] method.
/// Once measurements from that pin are completed it will be returned to an
/// Output that is set high by calling the [Analog::outof_analog] method.
///
/// ```rust
/// let pta0 = gpioa.pta0.into_push_pull_output();
/// pta0.set_high();
/// let mut pta0 = pta0.into_analog(); // pta0 is hi-Z
/// let value = adc.read(&mut pta0).unwrap_or(0);
/// let pta0 = pta0.outof_analog(); // pta0 is push-pull output, set high.
/// ```
///
/// Note: This is a hardware feature that requires effectively no clock cycles
/// to complete. "Manually" reconfiguring the pins to HighImpedence before
/// calling into_analog() is discouraged, but it would not hurt anything.
pub struct Analog<Pin> {
pin: Pin,
}
/// Interface for ADC Peripheral.
///
/// Returned by calling [HALExt::split] on the pac [ADC] structure. Holds state
/// of peripheral.
pub struct Adc<State> {
peripheral: ADC,
_state: PhantomData<State>,
/// Contains the On-Chip ADC Channels, like the MCU's temperature sensor.
pub onchip_channels: OnChipChannels,
}
impl HALExt for ADC {
type T = Adc<Disabled>;
fn split(self) -> Adc<Disabled> {
Adc {
peripheral: self,
_state: PhantomData,
onchip_channels: OnChipChannels {
vss: Some(Analog {
pin: Vss::<Input> { _mode: PhantomData },
}),
temp_sense: Some(Analog {
pin: TempSense::<Input> { _mode: PhantomData },
}),
bandgap: Some(Analog {
pin: Bandgap::<Input> { _mode: PhantomData },
}),
vref_h: Some(Analog {
pin: VrefH::<Input> { _mode: PhantomData },
}),
vref_l: Some(Analog {
pin: VrefL::<Input> { _mode: PhantomData },
}),
},
}
}
}
/// Configuration struct for Adc peripheral.
pub struct AdcConfig {
/// Determines the clock source for the ADC peripheral
///
/// Default is [AdcClocks::Bus]
pub clock_source: AdcClocks,
/// Divides the clock source to get the ADC clock into it's usable range of
/// 400kHz - 8MHz (4MHz in low power mode).
///
/// Default is [ClockDivisor::_1] (no divison)
pub clock_divisor: ClockDivisor,
/// Set the resolution of ADC conversion
///
/// Default is [AdcResolution::_8bit]
pub resolution: AdcResolution,
/// Set ADC sample time.
///
/// Default is [AdcSampleTime::Short]
pub sample_time: AdcSampleTime,
/// Set low power mode
///
/// Default is false.
pub low_power: bool,
}
impl AdcConfig {
/// Calculate the ADC clock divisor
///
/// Uses the current clock source and clock frequency to determine
/// the best divisor to use in order to have minimal error between
/// the ADC clock rate and the desired ADC clock rate.
///
/// Note: This relies on trustworthy values for source_freq and valid
/// values for req_adc_freq. In the future this should know or
/// determine what the current clock frequency is instead of relying
/// on the user to provide it.
pub fn calculate_divisor(&mut self, source_freq: Hertz, req_adc_freq: Hertz) {
let denom: u8 = (source_freq.integer() / req_adc_freq.integer()) as u8;
let mut output: u8 = 1;
let mut err: i8 = (denom - output) as i8;
let mut err_old: i8 = err;
let max_divisor = match self.clock_source {
AdcClocks::Bus => 16,
_ => 8,
};
while output < max_divisor {
err = (denom - (output << 1)) as i8;
if err.is_negative() {
err = err.abs();
}
if err <= err_old {
output <<= 1;
err_old = err;
} else {
break;
}
}
// I am of the mind that this assert is okay, at least until the input
// clock can be known at compile time.
let ad_clock = source_freq.integer() / output as u32;
assert!(400_000 <= ad_clock);
assert!(
ad_clock
<= match self.low_power {
false => 8_000_000,
true => 4_000_000,
}
);
self.clock_divisor = match output {
1 => ClockDivisor::_1,
2 => ClockDivisor::_2,
4 => ClockDivisor::_4,
8 => ClockDivisor::_8,
_ => ClockDivisor::_16,
}
}
/// Set the divisor directly. panics if divisor isn't supported by the
/// clock source.
///
/// TODO: Refactor to remove assert. Add Clock Source as a type state
pub fn set_divisor(&mut self, divisor: ClockDivisor) {
// divisor can't be 16 unless using the Bus clock
assert!(
!(!matches!(self.clock_source, AdcClocks::Bus) && matches!(divisor, ClockDivisor::_16))
);
self.clock_divisor = divisor;
}
/// Sets the clock source, panics if divisor isn't supported
///
/// TODO: Refactor to remove assert. Add Clock Source as a type state
pub fn set_clock_source(&mut self, clock: AdcClocks) {
// Panic if setting the clock to anything other than Bus if the divisor
// is set to 16
assert!(
!matches!(clock, AdcClocks::Bus) && matches!(self.clock_divisor, ClockDivisor::_16)
);
self.clock_source = clock;
}
}
impl Default for AdcConfig {
fn default() -> AdcConfig {
AdcConfig {
clock_source: AdcClocks::Bus,
clock_divisor: ClockDivisor::_1,
resolution: AdcResolution::_12bit,
sample_time: AdcSampleTime::Short,
low_power: false,
}
}
}
/// Clock types available to the Adc peripheral
///
/// Dividers will be chosen appropriately to suit requested clock rate.
pub enum AdcClocks {
/// Use the incoming Bus Clock
Bus,
/// jkl
External,
/// Available in Wait AND Stop Mode
Async,
}
/// This enum represents the availabe ADC resolutions
///
/// Regardless of resolution chosen, results are always right justified
#[repr(u8)]
pub enum AdcResolution {
/// 8 bit AD conversion mode
_8bit = 0,
/// 10 bit AD conversion mode
_10bit = 1,
/// 12 bit AD conversion mode
_12bit = 2,
}
/// Adc sample time
pub enum AdcSampleTime {
/// Sample for 3.5 ADC clock (ADCK) cycles.
Short = 0,
/// Sample for 23.5 ADC clock (ADCK) cycles.
///
/// Required for high impedence (>2k @ADCK > 4MHz, >5k @ ADCK < 4MHz)
/// inputs.
Long = 1,
}
/// Adc Clock Divisors
///
/// Note 1/16 divisor is only usable for the Bus clock
pub enum ClockDivisor {
/// Source / 1, No divison
_1 = 0,
/// Source / 2
_2 = 1,
/// Source / 4
_4 = 2,
/// Source / 8
_8 = 3,
/// Source / 16
_16 = 4,
}
/// Enabled state
pub struct Enabled;
/// Disabled state
pub struct Disabled;
impl Adc<Enabled> {
/// Poll to determine if ADC conversion is complete.
///
/// Note: This flag is cleared when the sampling mode is changed,
/// interrupts are enabled, [Adc::set_channel] is called, and when [Adc::result] is
/// called (including [Adc::try_result])
pub fn is_done(&self) -> bool {
self.peripheral.sc1.read().coco().bit()
}
/// Poll to determine if ADC conversion is underway
pub fn is_converting(&self) -> bool {
self.peripheral.sc2.read().adact().bit()
}
/// Grab the last ADC conversion result.
pub fn result(&self) -> u16 {
self.peripheral.r.read().adr().bits()
}
/// Poll for conversion completion, if done return the result.
pub fn try_result(&self) -> Option<u16> {
if self.is_done() {
Some(self.result())
} else | {
None
} | conditional_block | |
TimeSeries.js | //append each month in the time series as a new object pair to the data variable
for(i=0; i<Object.keys(dates).length; i++){
var new_entry = {};
new_entry.date = dates[i];
new_entry.price = Object.values(crude_prices)[i];
data.push(new_entry);
}
//set up the x and y values - may need to parse dates from YYYYMM to MM-YYYY
var x = d3.scaleTime()
.domain(d3.extent(dates)) //domain of inputs
.range([0, width]); //range of outputs
var y = d3.scaleLinear()
.domain([0, d3.max(prices)+10]) //domain of inputs
.range([height, 0]); //range of outputs
var line = d3.line()
.x(function(d){ return x(d.date); })
.y(function(d){ return y(d.price); });
//append an SVG element to the bottom bar, reshape it to the bottom dimensions, and append <g> tag with margins
var TS_svg = d3.select("#bottom")
.append("svg")
.attr("width", width)
.attr("height", height)
.append("g")
.attr("class","line-chart")
.attr("id", "WTI-chart")
.attr("transform", "translate(" + margin.left + "," + "-"+margin.bottom + ")");
//apend Y Axis
TS_svg.append("g")
.attr("class","y-axis")
.attr("id", "WTI-axis")
.attr("height", height)
.attr("transform", "translate(0,"+margin.top+")")
.call(d3.axisLeft(y));
//append X Axis
TS_svg.append("g")
.attr("class", "x-axis")
.attr("transform", "translate(0,"+margin.top+")")
.attr("stroke","white")
.call(d3.axisBottom(x));
//append the actual time series line
TS_svg.append("path")
.data(data)
.attr("class", "line")
.attr("d", line(data));
//create invisible popup tip box to show on mouseover of timeseries
var tip_box = d3.select("body")
.append("div")
.attr("id", "tip-box")
.style("opacity", 0);
//create invisible dots on the timeline - when moused over, will give the date & price in popup
var dot_labels = function(){
TS_svg.selectAll(".dot")
.data(data)
.enter().append("circle")
.attr("class","dot")
.attr("cx", function(d){ return x(d.date); })
.attr("cy", function(d){ return y(d.price); })
.attr("r", "4px")
.style("opacity",0.0)
.on("mouseover", function(d){
var h = document.getElementById("tip-box").offsetHeight;
var f = d3.timeFormat("%b-%Y");
tip_box.transition()
.duration(200)
.style("opacity",0.9);
tip_box.html(f(d.date) + "<br/>" + d.price.toFixed(3))
.style("left", (d3.event.pageX) + "px")
.style("top", (d3.event.pageY - h) + "px");
})
.on("mouseout",function(d){
tip_box.transition()
.duration(200)
.style("opacity", 0);
});
};
//remove every other Y Axis label to avoid cluttering
d3.select("#WTI-axis").selectAll(".tick text")
.attr("stroke-width", "1px")
.attr("stroke","white")
.attr("class",function(d,i){
//remove
if(i%3 != 0){
d3.select(this).remove();
}
});
//append the marker line that indicates the time state of the model
TS_svg.append("line")
.attr("x1",x(dates[0]))
.attr("y1",0)
.attr("x2",x(dates[0]))
.attr("y1",height)
.attr("stroke-width","4px")
.attr("class","marker-line")
.attr("id","marker-line");
//transition the marker line across of the time series
var marker_transition = function(start){
var T = 0;
for(i=start; i<dates.length; i++){
d3.select(".marker-line")
.transition()
.duration(1500)
.delay(1500*T)
.ease(d3.easeLinear)
.attr("x1", x(dates[i]) )
.attr("x2", x(dates[i]) );
T++;
}
};
marker_transition(1);
//find the index of the nearest value when marker is dragged/dropped on the timeline
var find_nearest = function(dragged_x){
//get the x-axis coordinate for all the dates
var x_dates = dates.map(function(d){ return x(d); });
//get the distance between each coordinate and the dragged_x
var dist = x_dates.map(function(d){ return Math.abs(d - dragged_x); });
//get the index of the smallest distance
return dist.indexOf(Math.min.apply(null,dist));
};
/*
* When the line is dragged, events need to be dispatched to:
* 1) The bar chart
* 2) The map circles
* 3) The Date: MM-YYYY
*/
//make marker line clickable and dragable (needs to also return its time state)
var drag_line = d3.drag()
.on("start",function(d){
//Stop previous transition
d3.select(".marker-line")
.transition()
.duration(0);
//make the line actively clickable
d3.select(this)
.raise()
.classed("active", true);
})
.on("drag",function(d){
//get the date closest to the new x
time_state = dates[find_nearest(d3.event.x)];
//set the x values to the x value of the closest x
d3.select(this)
.attr("x1", x(time_state))
.attr("x2", x(time_state));
//delete and remake circles as the marker line moves
var index = find_nearest(this.getAttribute("x1"));
//propogate the index to the global variable current_timestate
window.current_timestate = index;
call_dispatch(index);
})
.on("end",function(d){
//restart the transition using that nearest index
var index = find_nearest(this.getAttribute("x1"));
//propogate the index to the global variable current_timestate
window.current_timestate = index;
//marker starts moving again when drag stops
marker_transition(index);
//make dot labels again
dot_labels();
//deactivate marker
d3.select(this)
.classed("active",false);
});
d3.select(".marker-line")
.call(drag_line);
dot_labels();
};
var make_Import_TS = function(selected_city){
//Set up margins of graph axes - need to make room for tick labels
var margin = {top: 0, right: 10, bottom: 6, left: 25};
//Set up dimensions of the graph
var width = document.getElementById("bottom").offsetWidth - margin.left - margin.right;
var height = document.getElementById("bottom").offsetHeight - margin.top - margin.bottom;
//get the imports time series for the selected port
var import_data;
Data.objects.forEach(function(circle){
if(circle.circle.City == selected_city){
import_data = circle.circle.Imports;
}
});
var dates = Object.keys(crude_prices).map(function(date){ return parse_dates(date); });
dates = dates.slice(0,dates.length-6); | for(i=0; i<Object.keys(dates).length; i++){
var new_entry = {};
new_entry.date = dates[i];
new_entry.imports = Object.values(import_data)[i];
data.push(new_entry);
}
var imports_x = d3.scaleTime()
.domain(d3.extent(dates))
.range([0, width]);
var imports_scale = d3.scaleLinear()
.domain([d3.min(import_data), d3.max(import_data)])
.range([height, 0]);
var line = d3.line()
.x(function(d){ return imports_x(d.date); })
.y(function(d){ return imports_scale(d.imports); });
var Import_svg = d3.select(".bottom")
.select("svg")
.append("g")
.attr("id","imports-chart")
.attr("transform", "translate(" + margin.left + "," + "-"+margin.bottom + ")");
Import_svg.append("g")
.attr("class","y-axis")
.attr("id", "Imports-axis")
.attr("height", height)
.attr("transform", "translate |
var data =[];
//append each month in the time series as a new object pair to the data variable | random_line_split |
TimeSeries.js | append each month in the time series as a new object pair to the data variable
for(i=0; i<Object.keys(dates).length; i++){
var new_entry = {};
new_entry.date = dates[i];
new_entry.price = Object.values(crude_prices)[i];
data.push(new_entry);
}
//set up the x and y values - may need to parse dates from YYYYMM to MM-YYYY
var x = d3.scaleTime()
.domain(d3.extent(dates)) //domain of inputs
.range([0, width]); //range of outputs
var y = d3.scaleLinear()
.domain([0, d3.max(prices)+10]) //domain of inputs
.range([height, 0]); //range of outputs
var line = d3.line()
.x(function(d){ return x(d.date); })
.y(function(d){ return y(d.price); });
//append an SVG element to the bottom bar, reshape it to the bottom dimensions, and append <g> tag with margins
var TS_svg = d3.select("#bottom")
.append("svg")
.attr("width", width)
.attr("height", height)
.append("g")
.attr("class","line-chart")
.attr("id", "WTI-chart")
.attr("transform", "translate(" + margin.left + "," + "-"+margin.bottom + ")");
//apend Y Axis
TS_svg.append("g")
.attr("class","y-axis")
.attr("id", "WTI-axis")
.attr("height", height)
.attr("transform", "translate(0,"+margin.top+")")
.call(d3.axisLeft(y));
//append X Axis
TS_svg.append("g")
.attr("class", "x-axis")
.attr("transform", "translate(0,"+margin.top+")")
.attr("stroke","white")
.call(d3.axisBottom(x));
//append the actual time series line
TS_svg.append("path")
.data(data)
.attr("class", "line")
.attr("d", line(data));
//create invisible popup tip box to show on mouseover of timeseries
var tip_box = d3.select("body")
.append("div")
.attr("id", "tip-box")
.style("opacity", 0);
//create invisible dots on the timeline - when moused over, will give the date & price in popup
var dot_labels = function(){
TS_svg.selectAll(".dot")
.data(data)
.enter().append("circle")
.attr("class","dot")
.attr("cx", function(d){ return x(d.date); })
.attr("cy", function(d){ return y(d.price); })
.attr("r", "4px")
.style("opacity",0.0)
.on("mouseover", function(d){
var h = document.getElementById("tip-box").offsetHeight;
var f = d3.timeFormat("%b-%Y");
tip_box.transition()
.duration(200)
.style("opacity",0.9);
tip_box.html(f(d.date) + "<br/>" + d.price.toFixed(3))
.style("left", (d3.event.pageX) + "px")
.style("top", (d3.event.pageY - h) + "px");
})
.on("mouseout",function(d){
tip_box.transition()
.duration(200)
.style("opacity", 0);
});
};
//remove every other Y Axis label to avoid cluttering
d3.select("#WTI-axis").selectAll(".tick text")
.attr("stroke-width", "1px")
.attr("stroke","white")
.attr("class",function(d,i){
//remove
if(i%3 != 0){
d3.select(this).remove();
}
});
//append the marker line that indicates the time state of the model
TS_svg.append("line")
.attr("x1",x(dates[0]))
.attr("y1",0)
.attr("x2",x(dates[0]))
.attr("y1",height)
.attr("stroke-width","4px")
.attr("class","marker-line")
.attr("id","marker-line");
//transition the marker line across of the time series
var marker_transition = function(start){
var T = 0;
for(i=start; i<dates.length; i++){
d3.select(".marker-line")
.transition()
.duration(1500)
.delay(1500*T)
.ease(d3.easeLinear)
.attr("x1", x(dates[i]) )
.attr("x2", x(dates[i]) );
T++;
}
};
marker_transition(1);
//find the index of the nearest value when marker is dragged/dropped on the timeline
var find_nearest = function(dragged_x){
//get the x-axis coordinate for all the dates
var x_dates = dates.map(function(d){ return x(d); });
//get the distance between each coordinate and the dragged_x
var dist = x_dates.map(function(d){ return Math.abs(d - dragged_x); });
//get the index of the smallest distance
return dist.indexOf(Math.min.apply(null,dist));
};
/*
* When the line is dragged, events need to be dispatched to:
* 1) The bar chart
* 2) The map circles
* 3) The Date: MM-YYYY
*/
//make marker line clickable and dragable (needs to also return its time state)
var drag_line = d3.drag()
.on("start",function(d){
//Stop previous transition
d3.select(".marker-line")
.transition()
.duration(0);
//make the line actively clickable
d3.select(this)
.raise()
.classed("active", true);
})
.on("drag",function(d){
//get the date closest to the new x
time_state = dates[find_nearest(d3.event.x)];
//set the x values to the x value of the closest x
d3.select(this)
.attr("x1", x(time_state))
.attr("x2", x(time_state));
//delete and remake circles as the marker line moves
var index = find_nearest(this.getAttribute("x1"));
//propogate the index to the global variable current_timestate
window.current_timestate = index;
call_dispatch(index);
})
.on("end",function(d){
//restart the transition using that nearest index
var index = find_nearest(this.getAttribute("x1"));
//propogate the index to the global variable current_timestate
window.current_timestate = index;
//marker starts moving again when drag stops
marker_transition(index);
//make dot labels again
dot_labels();
//deactivate marker
d3.select(this)
.classed("active",false);
});
d3.select(".marker-line")
.call(drag_line);
dot_labels();
};
var make_Import_TS = function(selected_city){
//Set up margins of graph axes - need to make room for tick labels
var margin = {top: 0, right: 10, bottom: 6, left: 25};
//Set up dimensions of the graph
var width = document.getElementById("bottom").offsetWidth - margin.left - margin.right;
var height = document.getElementById("bottom").offsetHeight - margin.top - margin.bottom;
//get the imports time series for the selected port
var import_data;
Data.objects.forEach(function(circle){
if(circle.circle.City == selected_city) |
});
var dates = Object.keys(crude_prices).map(function(date){ return parse_dates(date); });
dates = dates.slice(0,dates.length-6);
var data =[];
//append each month in the time series as a new object pair to the data variable
for(i=0; i<Object.keys(dates).length; i++){
var new_entry = {};
new_entry.date = dates[i];
new_entry.imports = Object.values(import_data)[i];
data.push(new_entry);
}
var imports_x = d3.scaleTime()
.domain(d3.extent(dates))
.range([0, width]);
var imports_scale = d3.scaleLinear()
.domain([d3.min(import_data), d3.max(import_data)])
.range([height, 0]);
var line = d3.line()
.x(function(d){ return imports_x(d.date); })
.y(function(d){ return imports_scale(d.imports); });
var Import_svg = d3.select(".bottom")
.select("svg")
.append("g")
.attr("id","imports-chart")
.attr("transform", "translate(" + margin.left + "," + "-"+margin.bottom + ")");
Import_svg.append("g")
.attr("class","y-axis")
.attr("id", "Imports-axis")
.attr("height", height)
.attr("transform", " | {
import_data = circle.circle.Imports;
} | conditional_block |
installed.rs |
where T: AsRef<str> + 'a,
I: IntoIterator<Item = &'a T>
{
let mut url = String::new();
let mut scopes_string = scopes.into_iter().fold(String::new(), |mut acc, sc| {
acc.push_str(sc.as_ref());
acc.push_str(" ");
acc
});
// Remove last space
scopes_string.pop();
url.push_str(auth_uri);
vec![format!("?scope={}", scopes_string),
format!("&redirect_uri={}",
redirect_uri.unwrap_or(OOB_REDIRECT_URI.to_string())),
format!("&response_type=code"),
format!("&client_id={}", client_id)]
.into_iter()
.fold(url, |mut u, param| {
u.push_str(&percent_encode(param.as_ref(), QUERY_ENCODE_SET));
u
})
}
pub struct InstalledFlow<C> {
client: C,
server: Option<server::Listening>,
port: Option<u32>,
auth_code_rcv: Option<Receiver<String>>,
}
/// cf. https://developers.google.com/identity/protocols/OAuth2InstalledApp#choosingredirecturi
pub enum InstalledFlowReturnMethod {
/// Involves showing a URL to the user and asking to copy a code from their browser
/// (default)
Interactive,
/// Involves spinning up a local HTTP server and Google redirecting the browser to
/// the server with a URL containing the code (preferred, but not as reliable). The
/// parameter is the port to listen on.
HTTPRedirect(u32),
}
impl<C> InstalledFlow<C>
where C: BorrowMut<hyper::Client>
{
/// Starts a new Installed App auth flow.
/// If HTTPRedirect is chosen as method and the server can't be started, the flow falls
/// back to Interactive.
pub fn new(client: C, method: Option<InstalledFlowReturnMethod>) -> InstalledFlow<C> {
let default = InstalledFlow {
client: client,
server: None,
port: None,
auth_code_rcv: None,
};
match method {
None => default,
Some(InstalledFlowReturnMethod::Interactive) => default,
// Start server on localhost to accept auth code.
Some(InstalledFlowReturnMethod::HTTPRedirect(port)) => {
let server = server::Server::http(format!("127.0.0.1:{}", port).as_str());
match server {
Result::Err(_) => default,
Result::Ok(server) => {
let (tx, rx) = channel();
let listening =
server.handle(InstalledFlowHandler { auth_code_snd: Mutex::new(tx) });
match listening {
Result::Err(_) => default,
Result::Ok(listening) => {
InstalledFlow {
client: default.client,
server: Some(listening),
port: Some(port),
auth_code_rcv: Some(rx),
}
}
}
}
}
}
}
}
/// Handles the token request flow; it consists of the following steps:
/// . Obtain a auhorization code with user cooperation or internal redirect.
/// . Obtain a token and refresh token using that code.
/// . Return that token
///
/// It's recommended not to use the DefaultAuthenticatorDelegate, but a specialized one.
pub fn obtain_token<'a, AD: AuthenticatorDelegate, S, T>(&mut self,
auth_delegate: &mut AD,
appsecret: &ApplicationSecret,
scopes: S)
-> Result<Token, Box<Error>>
where T: AsRef<str> + 'a,
S: Iterator<Item = &'a T>
{
let authcode = try!(self.get_authorization_code(auth_delegate, &appsecret, scopes));
let tokens = try!(self.request_token(&appsecret, &authcode));
// Successful response
if tokens.access_token.is_some() {
let mut token = Token {
access_token: tokens.access_token.unwrap(),
refresh_token: tokens.refresh_token.unwrap(),
token_type: tokens.token_type.unwrap(),
expires_in: tokens.expires_in,
expires_in_timestamp: None,
};
token.set_expiry_absolute();
Result::Ok(token)
} else {
let err = io::Error::new(io::ErrorKind::Other,
format!("Token API error: {} {}",
tokens.error.unwrap_or("<unknown err>".to_string()),
tokens.error_description
.unwrap_or("".to_string()))
.as_str());
Result::Err(Box::new(err))
}
}
/// Obtains an authorization code either interactively or via HTTP redirect (see
/// InstalledFlowReturnMethod).
fn get_authorization_code<'a, AD: AuthenticatorDelegate, S, T>(&mut self,
auth_delegate: &mut AD,
appsecret: &ApplicationSecret,
scopes: S)
-> Result<String, Box<Error>>
where T: AsRef<str> + 'a,
S: Iterator<Item = &'a T>
{
let result: Result<String, Box<Error>> = match self.server {
None => {
let url = build_authentication_request_url(&appsecret.auth_uri,
&appsecret.client_id,
scopes,
None);
match auth_delegate.present_user_url(&url, true /* need_code */) {
None => {
Result::Err(Box::new(io::Error::new(io::ErrorKind::UnexpectedEof,
"couldn't read code")))
}
// Remove newline
Some(mut code) => {
code.pop();
Result::Ok(code)
}
}
}
Some(_) => {
// The redirect URI must be this very localhost URL, otherwise Google refuses
// authorization.
let url = build_authentication_request_url(&appsecret.auth_uri,
&appsecret.client_id,
scopes,
Some(format!("http://localhost:{}",
self.port
.unwrap_or(8080))));
auth_delegate.present_user_url(&url, false /* need_code */);
match self.auth_code_rcv.as_ref().unwrap().recv() {
Result::Err(e) => Result::Err(Box::new(e)),
Result::Ok(s) => Result::Ok(s),
}
}
};
self.server.as_mut().map(|l| l.close()).is_some();
result
}
/// Sends the authorization code to the provider in order to obtain access and refresh tokens.
fn request_token(&mut self,
appsecret: &ApplicationSecret,
authcode: &str)
-> Result<JSONTokenResponse, Box<Error>> {
let redirect_uri;
match self.port {
None => redirect_uri = OOB_REDIRECT_URI.to_string(),
Some(p) => redirect_uri = format!("http://localhost:{}", p),
}
let body = form_urlencoded::serialize(vec![("code".to_string(), authcode.to_string()),
("client_id".to_string(),
appsecret.client_id.clone()),
("client_secret".to_string(),
appsecret.client_secret.clone()),
("redirect_uri".to_string(), redirect_uri),
("grant_type".to_string(),
"authorization_code".to_string())]);
let result: Result<client::Response, hyper::Error> = self.client
.borrow_mut()
.post(&appsecret.token_uri)
.body(&body)
.header(header::ContentType("application/x-www-form-urlencoded".parse().unwrap()))
.send();
let mut resp = String::new();
match result {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(mut response) => {
let result = response.read_to_string(&mut resp);
match result {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(_) => (),
}
}
}
let token_resp: Result<JSONTokenResponse, error::Error> = serde_json::from_str(&resp);
match token_resp {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(tok) => Result::Ok(tok) as Result<JSONTokenResponse, Box<Error>>,
}
}
}
#[derive(Deserialize)]
struct JSONTokenResponse {
access_token: Option<String>,
refresh_token: Option<String>,
token_type: Option<String>,
expires_in: Option<i64>,
error: Option<String>,
error_description: Option<String>,
}
/// HTTP handler handling the redirect from the provider.
struct InstalledFlowHandler {
auth_code_snd: Mutex<Sender<String>>,
}
impl server::Handler for InstalledFlowHandler {
fn handle(&self, rq: server::Request, mut rp: server::Response) {
match rq.uri {
uri::RequestUri::AbsolutePath(path) => | {
// We use a fake URL because the redirect goes to a URL, meaning we
// can't use the url form decode (because there's slashes and hashes and stuff in
// it).
let url = hyper::Url::parse(&format!("http://example.com{}", path));
if url.is_err() {
*rp.status_mut() = status::StatusCode::BadRequest;
let _ = rp.send("Unparseable URL".as_ref());
} else {
self.handle_url(url.unwrap());
*rp.status_mut() = status::StatusCode::Ok;
let _ =
rp.send("<html><head><title>Success</title></head><body>You may now \
close this window.</body></html>"
.as_ref());
}
} | conditional_block | |
installed.rs | T, I>(auth_uri: &str,
client_id: &str,
scopes: I,
redirect_uri: Option<String>)
-> String
where T: AsRef<str> + 'a,
I: IntoIterator<Item = &'a T>
{
let mut url = String::new();
let mut scopes_string = scopes.into_iter().fold(String::new(), |mut acc, sc| {
acc.push_str(sc.as_ref());
acc.push_str(" ");
acc
});
// Remove last space
scopes_string.pop();
url.push_str(auth_uri);
vec![format!("?scope={}", scopes_string),
format!("&redirect_uri={}",
redirect_uri.unwrap_or(OOB_REDIRECT_URI.to_string())),
format!("&response_type=code"),
format!("&client_id={}", client_id)]
.into_iter()
.fold(url, |mut u, param| {
u.push_str(&percent_encode(param.as_ref(), QUERY_ENCODE_SET));
u
})
}
pub struct InstalledFlow<C> {
client: C,
server: Option<server::Listening>,
port: Option<u32>,
auth_code_rcv: Option<Receiver<String>>,
}
/// cf. https://developers.google.com/identity/protocols/OAuth2InstalledApp#choosingredirecturi
pub enum InstalledFlowReturnMethod {
/// Involves showing a URL to the user and asking to copy a code from their browser
/// (default)
Interactive,
/// Involves spinning up a local HTTP server and Google redirecting the browser to
/// the server with a URL containing the code (preferred, but not as reliable). The
/// parameter is the port to listen on.
HTTPRedirect(u32),
}
impl<C> InstalledFlow<C>
where C: BorrowMut<hyper::Client>
{
/// Starts a new Installed App auth flow.
/// If HTTPRedirect is chosen as method and the server can't be started, the flow falls
/// back to Interactive.
pub fn new(client: C, method: Option<InstalledFlowReturnMethod>) -> InstalledFlow<C> {
let default = InstalledFlow {
client: client,
server: None,
port: None,
auth_code_rcv: None,
};
match method {
None => default,
Some(InstalledFlowReturnMethod::Interactive) => default,
// Start server on localhost to accept auth code.
Some(InstalledFlowReturnMethod::HTTPRedirect(port)) => {
let server = server::Server::http(format!("127.0.0.1:{}", port).as_str());
match server {
Result::Err(_) => default,
Result::Ok(server) => {
let (tx, rx) = channel();
let listening =
server.handle(InstalledFlowHandler { auth_code_snd: Mutex::new(tx) });
match listening {
Result::Err(_) => default,
Result::Ok(listening) => {
InstalledFlow {
client: default.client,
server: Some(listening),
port: Some(port),
auth_code_rcv: Some(rx),
}
}
}
}
}
}
}
}
/// Handles the token request flow; it consists of the following steps:
/// . Obtain a auhorization code with user cooperation or internal redirect.
/// . Obtain a token and refresh token using that code.
/// . Return that token
///
/// It's recommended not to use the DefaultAuthenticatorDelegate, but a specialized one.
pub fn obtain_token<'a, AD: AuthenticatorDelegate, S, T>(&mut self,
auth_delegate: &mut AD,
appsecret: &ApplicationSecret,
scopes: S)
-> Result<Token, Box<Error>>
where T: AsRef<str> + 'a,
S: Iterator<Item = &'a T>
{
let authcode = try!(self.get_authorization_code(auth_delegate, &appsecret, scopes));
let tokens = try!(self.request_token(&appsecret, &authcode));
// Successful response
if tokens.access_token.is_some() {
let mut token = Token {
access_token: tokens.access_token.unwrap(),
refresh_token: tokens.refresh_token.unwrap(),
token_type: tokens.token_type.unwrap(),
expires_in: tokens.expires_in,
expires_in_timestamp: None,
};
token.set_expiry_absolute();
Result::Ok(token)
} else {
let err = io::Error::new(io::ErrorKind::Other,
format!("Token API error: {} {}",
tokens.error.unwrap_or("<unknown err>".to_string()),
tokens.error_description
.unwrap_or("".to_string()))
.as_str());
Result::Err(Box::new(err))
}
}
/// Obtains an authorization code either interactively or via HTTP redirect (see
/// InstalledFlowReturnMethod).
fn get_authorization_code<'a, AD: AuthenticatorDelegate, S, T>(&mut self,
auth_delegate: &mut AD,
appsecret: &ApplicationSecret,
scopes: S)
-> Result<String, Box<Error>>
where T: AsRef<str> + 'a,
S: Iterator<Item = &'a T>
{
let result: Result<String, Box<Error>> = match self.server {
None => {
let url = build_authentication_request_url(&appsecret.auth_uri,
&appsecret.client_id,
scopes,
None);
match auth_delegate.present_user_url(&url, true /* need_code */) {
None => {
Result::Err(Box::new(io::Error::new(io::ErrorKind::UnexpectedEof,
"couldn't read code")))
}
// Remove newline
Some(mut code) => {
code.pop();
Result::Ok(code)
}
}
}
Some(_) => {
// The redirect URI must be this very localhost URL, otherwise Google refuses
// authorization.
let url = build_authentication_request_url(&appsecret.auth_uri,
&appsecret.client_id,
scopes,
Some(format!("http://localhost:{}",
self.port
.unwrap_or(8080))));
auth_delegate.present_user_url(&url, false /* need_code */);
match self.auth_code_rcv.as_ref().unwrap().recv() {
Result::Err(e) => Result::Err(Box::new(e)),
Result::Ok(s) => Result::Ok(s),
}
}
};
self.server.as_mut().map(|l| l.close()).is_some();
result
}
/// Sends the authorization code to the provider in order to obtain access and refresh tokens.
fn request_token(&mut self,
appsecret: &ApplicationSecret,
authcode: &str)
-> Result<JSONTokenResponse, Box<Error>> {
let redirect_uri;
match self.port {
None => redirect_uri = OOB_REDIRECT_URI.to_string(),
Some(p) => redirect_uri = format!("http://localhost:{}", p),
}
let body = form_urlencoded::serialize(vec![("code".to_string(), authcode.to_string()),
("client_id".to_string(),
appsecret.client_id.clone()),
("client_secret".to_string(),
appsecret.client_secret.clone()),
("redirect_uri".to_string(), redirect_uri),
("grant_type".to_string(),
"authorization_code".to_string())]);
let result: Result<client::Response, hyper::Error> = self.client
.borrow_mut()
.post(&appsecret.token_uri)
.body(&body)
.header(header::ContentType("application/x-www-form-urlencoded".parse().unwrap()))
.send();
let mut resp = String::new();
match result {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(mut response) => {
let result = response.read_to_string(&mut resp);
match result {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(_) => (),
}
}
}
let token_resp: Result<JSONTokenResponse, error::Error> = serde_json::from_str(&resp);
match token_resp {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(tok) => Result::Ok(tok) as Result<JSONTokenResponse, Box<Error>>,
}
}
}
#[derive(Deserialize)]
struct JSONTokenResponse {
access_token: Option<String>,
refresh_token: Option<String>,
token_type: Option<String>,
expires_in: Option<i64>,
error: Option<String>,
error_description: Option<String>,
}
/// HTTP handler handling the redirect from the provider. | impl server::Handler for InstalledFlowHandler {
fn handle(&self, rq: server::Request, mut rp: server::Response) {
match rq.uri {
uri::RequestUri::AbsolutePath(path) => {
// We use a fake URL because the redirect goes to a URL, meaning we
// can't use the url form decode (because there's slashes and hashes and stuff in
// it).
let url = hyper::Url::parse(&format!("http://example.com{}", path));
if url.is_err() {
*rp.status_mut() = status::StatusCode::BadRequest;
let _ = rp.send("Unparseable URL".as_ref());
} else {
self.handle_url(url.unwrap());
*rp.status_mut() = status::StatusCode::Ok;
let _ =
rp.send("<html><head>< | struct InstalledFlowHandler {
auth_code_snd: Mutex<Sender<String>>,
}
| random_line_split |
installed.rs | , I>(auth_uri: &str,
client_id: &str,
scopes: I,
redirect_uri: Option<String>)
-> String
where T: AsRef<str> + 'a,
I: IntoIterator<Item = &'a T>
{
let mut url = String::new();
let mut scopes_string = scopes.into_iter().fold(String::new(), |mut acc, sc| {
acc.push_str(sc.as_ref());
acc.push_str(" ");
acc
});
// Remove last space
scopes_string.pop();
url.push_str(auth_uri);
vec![format!("?scope={}", scopes_string),
format!("&redirect_uri={}",
redirect_uri.unwrap_or(OOB_REDIRECT_URI.to_string())),
format!("&response_type=code"),
format!("&client_id={}", client_id)]
.into_iter()
.fold(url, |mut u, param| {
u.push_str(&percent_encode(param.as_ref(), QUERY_ENCODE_SET));
u
})
}
pub struct InstalledFlow<C> {
client: C,
server: Option<server::Listening>,
port: Option<u32>,
auth_code_rcv: Option<Receiver<String>>,
}
/// cf. https://developers.google.com/identity/protocols/OAuth2InstalledApp#choosingredirecturi
pub enum InstalledFlowReturnMethod {
/// Involves showing a URL to the user and asking to copy a code from their browser
/// (default)
Interactive,
/// Involves spinning up a local HTTP server and Google redirecting the browser to
/// the server with a URL containing the code (preferred, but not as reliable). The
/// parameter is the port to listen on.
HTTPRedirect(u32),
}
impl<C> InstalledFlow<C>
where C: BorrowMut<hyper::Client>
{
/// Starts a new Installed App auth flow.
/// If HTTPRedirect is chosen as method and the server can't be started, the flow falls
/// back to Interactive.
pub fn new(client: C, method: Option<InstalledFlowReturnMethod>) -> InstalledFlow<C> |
match listening {
Result::Err(_) => default,
Result::Ok(listening) => {
InstalledFlow {
client: default.client,
server: Some(listening),
port: Some(port),
auth_code_rcv: Some(rx),
}
}
}
}
}
}
}
}
/// Handles the token request flow; it consists of the following steps:
/// . Obtain a auhorization code with user cooperation or internal redirect.
/// . Obtain a token and refresh token using that code.
/// . Return that token
///
/// It's recommended not to use the DefaultAuthenticatorDelegate, but a specialized one.
pub fn obtain_token<'a, AD: AuthenticatorDelegate, S, T>(&mut self,
auth_delegate: &mut AD,
appsecret: &ApplicationSecret,
scopes: S)
-> Result<Token, Box<Error>>
where T: AsRef<str> + 'a,
S: Iterator<Item = &'a T>
{
let authcode = try!(self.get_authorization_code(auth_delegate, &appsecret, scopes));
let tokens = try!(self.request_token(&appsecret, &authcode));
// Successful response
if tokens.access_token.is_some() {
let mut token = Token {
access_token: tokens.access_token.unwrap(),
refresh_token: tokens.refresh_token.unwrap(),
token_type: tokens.token_type.unwrap(),
expires_in: tokens.expires_in,
expires_in_timestamp: None,
};
token.set_expiry_absolute();
Result::Ok(token)
} else {
let err = io::Error::new(io::ErrorKind::Other,
format!("Token API error: {} {}",
tokens.error.unwrap_or("<unknown err>".to_string()),
tokens.error_description
.unwrap_or("".to_string()))
.as_str());
Result::Err(Box::new(err))
}
}
/// Obtains an authorization code either interactively or via HTTP redirect (see
/// InstalledFlowReturnMethod).
fn get_authorization_code<'a, AD: AuthenticatorDelegate, S, T>(&mut self,
auth_delegate: &mut AD,
appsecret: &ApplicationSecret,
scopes: S)
-> Result<String, Box<Error>>
where T: AsRef<str> + 'a,
S: Iterator<Item = &'a T>
{
let result: Result<String, Box<Error>> = match self.server {
None => {
let url = build_authentication_request_url(&appsecret.auth_uri,
&appsecret.client_id,
scopes,
None);
match auth_delegate.present_user_url(&url, true /* need_code */) {
None => {
Result::Err(Box::new(io::Error::new(io::ErrorKind::UnexpectedEof,
"couldn't read code")))
}
// Remove newline
Some(mut code) => {
code.pop();
Result::Ok(code)
}
}
}
Some(_) => {
// The redirect URI must be this very localhost URL, otherwise Google refuses
// authorization.
let url = build_authentication_request_url(&appsecret.auth_uri,
&appsecret.client_id,
scopes,
Some(format!("http://localhost:{}",
self.port
.unwrap_or(8080))));
auth_delegate.present_user_url(&url, false /* need_code */);
match self.auth_code_rcv.as_ref().unwrap().recv() {
Result::Err(e) => Result::Err(Box::new(e)),
Result::Ok(s) => Result::Ok(s),
}
}
};
self.server.as_mut().map(|l| l.close()).is_some();
result
}
/// Sends the authorization code to the provider in order to obtain access and refresh tokens.
fn request_token(&mut self,
appsecret: &ApplicationSecret,
authcode: &str)
-> Result<JSONTokenResponse, Box<Error>> {
let redirect_uri;
match self.port {
None => redirect_uri = OOB_REDIRECT_URI.to_string(),
Some(p) => redirect_uri = format!("http://localhost:{}", p),
}
let body = form_urlencoded::serialize(vec![("code".to_string(), authcode.to_string()),
("client_id".to_string(),
appsecret.client_id.clone()),
("client_secret".to_string(),
appsecret.client_secret.clone()),
("redirect_uri".to_string(), redirect_uri),
("grant_type".to_string(),
"authorization_code".to_string())]);
let result: Result<client::Response, hyper::Error> = self.client
.borrow_mut()
.post(&appsecret.token_uri)
.body(&body)
.header(header::ContentType("application/x-www-form-urlencoded".parse().unwrap()))
.send();
let mut resp = String::new();
match result {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(mut response) => {
let result = response.read_to_string(&mut resp);
match result {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(_) => (),
}
}
}
let token_resp: Result<JSONTokenResponse, error::Error> = serde_json::from_str(&resp);
match token_resp {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(tok) => Result::Ok(tok) as Result<JSONTokenResponse, Box<Error>>,
}
}
}
#[derive(Deserialize)]
struct JSONTokenResponse {
access_token: Option<String>,
refresh_token: Option<String>,
token_type: Option<String>,
expires_in: Option<i64>,
error: Option<String>,
error_description: Option<String>,
}
/// HTTP handler handling the redirect from the provider.
struct InstalledFlowHandler {
auth_code_snd: Mutex<Sender<String>>,
}
impl server::Handler for InstalledFlowHandler {
fn handle(&self, rq: server::Request, mut rp: server::Response) {
match rq.uri {
uri::RequestUri::AbsolutePath(path) => {
// We use a fake URL because the redirect goes to a URL, meaning we
// can't use the url form decode (because there's slashes and hashes and stuff in
// it).
let url = hyper::Url::parse(&format!("http://example.com{}", path));
if url.is_err() {
*rp.status_mut() = status::StatusCode::BadRequest;
let _ = rp.send("Unparseable URL".as_ref());
} else {
self.handle_url(url.unwrap());
*rp.status_mut() = status::StatusCode::Ok;
let _ =
rp.send("<html><head | {
let default = InstalledFlow {
client: client,
server: None,
port: None,
auth_code_rcv: None,
};
match method {
None => default,
Some(InstalledFlowReturnMethod::Interactive) => default,
// Start server on localhost to accept auth code.
Some(InstalledFlowReturnMethod::HTTPRedirect(port)) => {
let server = server::Server::http(format!("127.0.0.1:{}", port).as_str());
match server {
Result::Err(_) => default,
Result::Ok(server) => {
let (tx, rx) = channel();
let listening =
server.handle(InstalledFlowHandler { auth_code_snd: Mutex::new(tx) }); | identifier_body |
installed.rs | T, I>(auth_uri: &str,
client_id: &str,
scopes: I,
redirect_uri: Option<String>)
-> String
where T: AsRef<str> + 'a,
I: IntoIterator<Item = &'a T>
{
let mut url = String::new();
let mut scopes_string = scopes.into_iter().fold(String::new(), |mut acc, sc| {
acc.push_str(sc.as_ref());
acc.push_str(" ");
acc
});
// Remove last space
scopes_string.pop();
url.push_str(auth_uri);
vec![format!("?scope={}", scopes_string),
format!("&redirect_uri={}",
redirect_uri.unwrap_or(OOB_REDIRECT_URI.to_string())),
format!("&response_type=code"),
format!("&client_id={}", client_id)]
.into_iter()
.fold(url, |mut u, param| {
u.push_str(&percent_encode(param.as_ref(), QUERY_ENCODE_SET));
u
})
}
pub struct InstalledFlow<C> {
client: C,
server: Option<server::Listening>,
port: Option<u32>,
auth_code_rcv: Option<Receiver<String>>,
}
/// cf. https://developers.google.com/identity/protocols/OAuth2InstalledApp#choosingredirecturi
pub enum | {
/// Involves showing a URL to the user and asking to copy a code from their browser
/// (default)
Interactive,
/// Involves spinning up a local HTTP server and Google redirecting the browser to
/// the server with a URL containing the code (preferred, but not as reliable). The
/// parameter is the port to listen on.
HTTPRedirect(u32),
}
impl<C> InstalledFlow<C>
where C: BorrowMut<hyper::Client>
{
/// Starts a new Installed App auth flow.
/// If HTTPRedirect is chosen as method and the server can't be started, the flow falls
/// back to Interactive.
pub fn new(client: C, method: Option<InstalledFlowReturnMethod>) -> InstalledFlow<C> {
let default = InstalledFlow {
client: client,
server: None,
port: None,
auth_code_rcv: None,
};
match method {
None => default,
Some(InstalledFlowReturnMethod::Interactive) => default,
// Start server on localhost to accept auth code.
Some(InstalledFlowReturnMethod::HTTPRedirect(port)) => {
let server = server::Server::http(format!("127.0.0.1:{}", port).as_str());
match server {
Result::Err(_) => default,
Result::Ok(server) => {
let (tx, rx) = channel();
let listening =
server.handle(InstalledFlowHandler { auth_code_snd: Mutex::new(tx) });
match listening {
Result::Err(_) => default,
Result::Ok(listening) => {
InstalledFlow {
client: default.client,
server: Some(listening),
port: Some(port),
auth_code_rcv: Some(rx),
}
}
}
}
}
}
}
}
/// Handles the token request flow; it consists of the following steps:
/// . Obtain a auhorization code with user cooperation or internal redirect.
/// . Obtain a token and refresh token using that code.
/// . Return that token
///
/// It's recommended not to use the DefaultAuthenticatorDelegate, but a specialized one.
pub fn obtain_token<'a, AD: AuthenticatorDelegate, S, T>(&mut self,
auth_delegate: &mut AD,
appsecret: &ApplicationSecret,
scopes: S)
-> Result<Token, Box<Error>>
where T: AsRef<str> + 'a,
S: Iterator<Item = &'a T>
{
let authcode = try!(self.get_authorization_code(auth_delegate, &appsecret, scopes));
let tokens = try!(self.request_token(&appsecret, &authcode));
// Successful response
if tokens.access_token.is_some() {
let mut token = Token {
access_token: tokens.access_token.unwrap(),
refresh_token: tokens.refresh_token.unwrap(),
token_type: tokens.token_type.unwrap(),
expires_in: tokens.expires_in,
expires_in_timestamp: None,
};
token.set_expiry_absolute();
Result::Ok(token)
} else {
let err = io::Error::new(io::ErrorKind::Other,
format!("Token API error: {} {}",
tokens.error.unwrap_or("<unknown err>".to_string()),
tokens.error_description
.unwrap_or("".to_string()))
.as_str());
Result::Err(Box::new(err))
}
}
/// Obtains an authorization code either interactively or via HTTP redirect (see
/// InstalledFlowReturnMethod).
fn get_authorization_code<'a, AD: AuthenticatorDelegate, S, T>(&mut self,
auth_delegate: &mut AD,
appsecret: &ApplicationSecret,
scopes: S)
-> Result<String, Box<Error>>
where T: AsRef<str> + 'a,
S: Iterator<Item = &'a T>
{
let result: Result<String, Box<Error>> = match self.server {
None => {
let url = build_authentication_request_url(&appsecret.auth_uri,
&appsecret.client_id,
scopes,
None);
match auth_delegate.present_user_url(&url, true /* need_code */) {
None => {
Result::Err(Box::new(io::Error::new(io::ErrorKind::UnexpectedEof,
"couldn't read code")))
}
// Remove newline
Some(mut code) => {
code.pop();
Result::Ok(code)
}
}
}
Some(_) => {
// The redirect URI must be this very localhost URL, otherwise Google refuses
// authorization.
let url = build_authentication_request_url(&appsecret.auth_uri,
&appsecret.client_id,
scopes,
Some(format!("http://localhost:{}",
self.port
.unwrap_or(8080))));
auth_delegate.present_user_url(&url, false /* need_code */);
match self.auth_code_rcv.as_ref().unwrap().recv() {
Result::Err(e) => Result::Err(Box::new(e)),
Result::Ok(s) => Result::Ok(s),
}
}
};
self.server.as_mut().map(|l| l.close()).is_some();
result
}
/// Sends the authorization code to the provider in order to obtain access and refresh tokens.
fn request_token(&mut self,
appsecret: &ApplicationSecret,
authcode: &str)
-> Result<JSONTokenResponse, Box<Error>> {
let redirect_uri;
match self.port {
None => redirect_uri = OOB_REDIRECT_URI.to_string(),
Some(p) => redirect_uri = format!("http://localhost:{}", p),
}
let body = form_urlencoded::serialize(vec![("code".to_string(), authcode.to_string()),
("client_id".to_string(),
appsecret.client_id.clone()),
("client_secret".to_string(),
appsecret.client_secret.clone()),
("redirect_uri".to_string(), redirect_uri),
("grant_type".to_string(),
"authorization_code".to_string())]);
let result: Result<client::Response, hyper::Error> = self.client
.borrow_mut()
.post(&appsecret.token_uri)
.body(&body)
.header(header::ContentType("application/x-www-form-urlencoded".parse().unwrap()))
.send();
let mut resp = String::new();
match result {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(mut response) => {
let result = response.read_to_string(&mut resp);
match result {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(_) => (),
}
}
}
let token_resp: Result<JSONTokenResponse, error::Error> = serde_json::from_str(&resp);
match token_resp {
Result::Err(e) => return Result::Err(Box::new(e)),
Result::Ok(tok) => Result::Ok(tok) as Result<JSONTokenResponse, Box<Error>>,
}
}
}
#[derive(Deserialize)]
struct JSONTokenResponse {
access_token: Option<String>,
refresh_token: Option<String>,
token_type: Option<String>,
expires_in: Option<i64>,
error: Option<String>,
error_description: Option<String>,
}
/// HTTP handler handling the redirect from the provider.
struct InstalledFlowHandler {
auth_code_snd: Mutex<Sender<String>>,
}
impl server::Handler for InstalledFlowHandler {
fn handle(&self, rq: server::Request, mut rp: server::Response) {
match rq.uri {
uri::RequestUri::AbsolutePath(path) => {
// We use a fake URL because the redirect goes to a URL, meaning we
// can't use the url form decode (because there's slashes and hashes and stuff in
// it).
let url = hyper::Url::parse(&format!("http://example.com{}", path));
if url.is_err() {
*rp.status_mut() = status::StatusCode::BadRequest;
let _ = rp.send("Unparseable URL".as_ref());
} else {
self.handle_url(url.unwrap());
*rp.status_mut() = status::StatusCode::Ok;
let _ =
rp.send("<html><head | InstalledFlowReturnMethod | identifier_name |
types.go | Group of cluster type
const (
STATIC_CLUSTER ClusterType = "STATIC"
SIMPLE_CLUSTER ClusterType = "SIMPLE"
DYNAMIC_CLUSTER ClusterType = "DYNAMIC"
EDS_CLUSTER ClusterType = "EDS"
)
// LbType
type LbType string
// Group of load balancer type
const (
LB_RANDOM LbType = "LB_RANDOM"
LB_ROUNDROBIN LbType = "LB_ROUNDROBIN"
)
// RoutingPriority
type RoutingPriority string
// Group of routing priority
const (
DEFAULT RoutingPriority = "DEFAULT"
HIGH RoutingPriority = "HIGH"
)
// Cluster represents a cluster's information
type Cluster struct {
Name string `json:"name"`
ClusterType ClusterType `json:"type"`
SubType string `json:"sub_type"` //not used yet
LbType LbType `json:"lb_type"`
MaxRequestPerConn uint32 `json:"max_request_per_conn"`
ConnBufferLimitBytes uint32 `json:"conn_buffer_limit_bytes"`
CirBreThresholds CircuitBreakers `json:"circuit_breakers,omitempty"`
OutlierDetection OutlierDetection `json:"outlier_detection,omitempty"` //not used yet
HealthCheck HealthCheck `json:"health_check,omitempty"`
Spec ClusterSpecInfo `json:"spec,omitempty"`
LBSubSetConfig LBSubsetConfig `json:"lb_subset_config,omitempty"`
TLS TLSConfig `json:"tls_context,omitempty"`
Hosts []Host `json:"hosts"`
}
// HealthCheck is a configuration of health check
// use DurationConfig to parse string to time.Duration
type HealthCheck struct {
HealthCheckConfig
ProtocolCode byte `json:"-"`
Timeout time.Duration `json:"-"`
Interval time.Duration `json:"-"`
IntervalJitter time.Duration `json:"-"`
}
// Host represenets a host information
type Host struct {
HostConfig
MetaData Metadata `json:"-"`
}
// Listener contains the listener's information
type Listener struct {
ListenerConfig
Addr net.Addr `json:"-"`
ListenerTag uint64 `json:"-"`
ListenerScope string `json:"-"`
PerConnBufferLimitBytes uint32 `json:"-"` // do not support config
InheritListener *net.TCPListener `json:"-"`
Remain bool `json:"-"`
LogLevel uint8 `json:"-"`
DisableConnIo bool `json:"-"`
}
// TCPRoute
type TCPRoute struct {
Cluster string
SourceAddrs []CidrRange
DestinationAddrs []CidrRange
SourcePort string
DestinationPort string
}
// CidrRange
type CidrRange struct {
Address string
Length uint32
IpNet *net.IPNet
}
// HealthCheckFilter
type HealthCheckFilter struct {
HealthCheckFilterConfig
CacheTime time.Duration `json:"-"`
}
// FaultInject
type FaultInject struct {
FaultInjectConfig
DelayDuration uint64 `json:"-"`
}
// StreamFaultInject
type StreamFaultInject struct {
Delay *DelayInject `json:"delay"`
Abort *AbortInject `json:"abort"`
UpstreamCluster string `json:"upstream_cluster"`
Headers []HeaderMatcher `json:"headers"`
}
type DelayInject struct {
DelayInjectConfig
Delay time.Duration `json:"-"`
}
type AbortInject struct {
Status int `json:"status"`
Percent uint32 `json:"percentage"`
}
// Router, the list of routes that will be matched, in order, for incoming requests.
// The first route that matches will be used.
type Router struct {
RouterConfig
Metadata Metadata `json:"-"`
}
// RouteAction represents the information of route request to upstream clusters
type RouteAction struct {
RouterActionConfig
MetadataMatch Metadata `json:"-"`
Timeout time.Duration `json:"-"`
}
// Decorator
type Decorator string
// ClusterWeight.
// clusters along with weights that indicate the percentage
// of traffic to be forwarded to each cluster
type ClusterWeight struct {
ClusterWeightConfig
MetadataMatch Metadata `json:"-"`
}
// RetryPolicy represents the retry parameters
type RetryPolicy struct {
RetryPolicyConfig
RetryTimeout time.Duration `json:"-"`
}
// CircuitBreakers is a configuration of circuit breakers
// CircuitBreakers implements json.Marshaler and json.Unmarshaler
type CircuitBreakers struct {
Thresholds []Thresholds
}
type Thresholds struct {
Priority RoutingPriority `json:"priority"`
MaxConnections uint32 `json:"max_connections"`
MaxPendingRequests uint32 `json:"max_pending_requests"`
MaxRequests uint32 `json:"max_requests"`
MaxRetries uint32 `json:"max_retries"`
}
// OutlierDetection not used yet
type OutlierDetection struct {
Consecutive5xx uint32
Interval time.Duration
BaseEjectionTime time.Duration
MaxEjectionPercent uint32
ConsecutiveGatewayFailure uint32
EnforcingConsecutive5xx uint32
EnforcingConsecutiveGatewayFailure uint32
EnforcingSuccessRate uint32
SuccessRateMinimumHosts uint32
SuccessRateRequestVolume uint32
SuccessRateStdevFactor uint32
}
// ClusterSpecInfo is a configuration of subscribe
type ClusterSpecInfo struct {
Subscribes []SubscribeSpec `json:"subscribe,omitempty"`
}
// SubscribeSpec describes the subscribe server
type SubscribeSpec struct {
ServiceName string `json:"service_name,omitempty"`
}
// LBSubsetConfig is a configuration of load balance subset
type LBSubsetConfig struct {
FallBackPolicy uint8 `json:"fall_back_policy"`
DefaultSubset map[string]string `json:"default_subset"`
SubsetSelectors [][]string `json:"subset_selectors"`
}
// TLSConfig is a configuration of tls context
type TLSConfig struct {
Status bool `json:"status"`
Type string `json:"type"`
ServerName string `json:"server_name,omitempty"`
CACert string `json:"ca_cert,omitempty"`
CertChain string `json:"cert_chain,omitempty"`
PrivateKey string `json:"private_key,omitempty"`
VerifyClient bool `json:"verify_client,omitempty"`
InsecureSkip bool `json:"insecure_skip,omitempty"`
CipherSuites string `json:"cipher_suites,omitempty"`
EcdhCurves string `json:"ecdh_curves,omitempty"`
MinVersion string `json:"min_version,omitempty"`
MaxVersion string `json:"max_version,omitempty"`
ALPN string `json:"alpn,omitempty"`
Ticket string `json:"ticket,omitempty"`
Fallback bool `json:"fall_back, omitempty"`
ExtendVerify map[string]interface{} `json:"extend_verify,omitempty"`
}
// AccessLog for making up access log
type AccessLog struct {
Path string `json:"log_path,omitempty"`
Format string `json:"log_format,omitempty"`
}
// FilterChain wraps a set of match criteria, an option TLS context,
// a set of filters, and various other parameters.
type FilterChain struct {
FilterChainMatch string `json:"match,omitempty"`
TLS TLSConfig `json:"tls_context,omitempty"`
Filters []Filter `json:"filters"` // "proxy" and "connection_manager" used at this time
}
// Filter is a config to make up a filter
type Filter struct {
Type string `json:"type,omitempty"`
Config map[string]interface{} `json:"config,omitempty"` |
// TCPProxy
type TCPProxy struct {
StatPrefix string `json:"stat_prefix,omitempty"`
Cluster string `json:"cluster,omitempty"`
IdleTimeout *time.Duration `json:"idle_timeout,omitempty"`
MaxConnectAttempts uint32 `json:"max_connect_attempts,omitempty"`
Routes []*TCPRoute `json:"routes,omitempty"`
}
// WebSocketProxy
type WebSocketProxy struct {
StatPrefix string
IdleTimeout *time.Duration
MaxConnectAttempts uint32
}
// Proxy
type Proxy struct {
Name string `json:"name"`
DownstreamProtocol string `json:"downstream_protocol"`
UpstreamProtocol string `json:"upstream_protocol"`
RouterConfigName string `json:"router_config_name"`
ValidateClusters bool `json:"validate_clusters"`
ExtendConfig map[string]interface{} `json:"extend_config"`
}
// HeaderValueOption is header name/value pair plus option to control append behavior.
type HeaderValueOption struct {
Header *HeaderValue `json:"header"`
Append *bool `json:"append"`
}
// HeaderValue is header name/value pair.
type HeaderValue struct {
Key string `json:"key"`
Value string `json:"value"`
}
// RouterConfiguration is a filter for routers
// Filter type is: "CONNECTION_MANAGER"
type RouterConfiguration struct {
RouterConfigName string `json:"router_config_name"`
VirtualHosts []*VirtualHost `json:"virtual_hosts"`
RequestHeadersToAdd []*HeaderValueOption `json:"request_headers_to_add"`
ResponseHeadersToAdd []*HeaderValueOption `json:"response_headers_to_add"`
ResponseHeadersToRemove []string `json:"response_headers_to_remove"`
}
// VirtualHost is used to make up the route table
type VirtualHost struct {
| }
// Implements of filter config | random_line_split |
server.go | ()
continue
}
latest := kv.configs[len(kv.configs)-1]
kv.mu.RUnlock()
config := kv.masters.Query(latest.Num + 1)
if latest.Num < config.Num {
kv.rf.Start(config)
}
}
}
}
func (kv *ShardKV) migrationChecker() {
t := time.NewTicker(100 * time.Millisecond)
start := time.Now()
for {
select {
case <-kv.ctx.Done():
return
case <-t.C:
kv.mu.RLock()
if kv.waitClean.IsEmpty() {
kv.mu.RUnlock()
return
}
gidShards := kv.waitClean.GetGidShard()
config := kv.waitClean.GetConfig()
if time.Now().Sub(start) > WaitCleanTimeOut {
kv.rf.Start(CheckMigrateShardReply{
ConfigNum: config.Num,
Gid: -1,
Result: ErrWaitCleanTimeOut,
})
} else {
for gid, shardNums := range gidShards {
servers := config.Groups[gid]
args := CheckMigrateShardArgs{
config.Num,
gid,
shardNums,
}
go func(servers []string, args CheckMigrateShardArgs) {
for si := 0; si < len(servers); si++ {
srv := kv.make_end(servers[si])
var reply CheckMigrateShardReply
ok := srv.Call("ShardKV.CheckMigrateShard", &args, &reply)
/*if ok {
DPrintf("ShardKV %d (gid = %d) CheckMigrateShard ok = %v args = %+v reply = %+v\n", kv.me, kv.gid, ok, args, reply)
}*/
if ok && reply.Result == OK {
kv.rf.Start(reply)
return
}
}
}(servers, args)
}
}
kv.mu.RUnlock()
}
}
}
func (kv *ShardKV) migrationHelper() {
t := time.NewTicker(100 * time.Millisecond)
start := time.Now()
for {
select {
case <-kv.ctx.Done():
return
case <-t.C:
kv.mu.RLock()
if kv.waitMigration.IsEmpty() {
kv.mu.RUnlock()
return
}
gidShards := kv.waitMigration.GetGidShards()
config := kv.waitMigration.GetConfig()
if time.Now().Sub(start) > WaitMigrationTimeOut {
kv.rf.Start(MigrateShardReply{
ConfigNum: config.Num,
Gid: -1,
Result: ErrWaitMigrationTimeOut,
})
} else {
for gid, shardNums := range gidShards {
servers := config.Groups[gid]
args := MigrateShardArgs{
config.Num,
gid,
shardNums,
}
go func(servers []string, args MigrateShardArgs) {
for si := 0; si < len(servers); si++ {
srv := kv.make_end(servers[si])
var reply MigrateShardReply
ok := srv.Call("ShardKV.MigrateShard", &args, &reply)
DPrintf("ShardKV %d (gid = %d) MigrateShard ok = %v args = %+v reply = %+v\n", kv.me, kv.gid, ok, args, reply)
if ok && (reply.Result == OK || reply.Result == ErrShardHasBeenCleaned) {
kv.rf.Start(reply)
return
}
}
}(servers, args)
}
}
kv.mu.RUnlock()
}
}
}
func (kv *ShardKV) init() {
kv.mu.Lock()
defer kv.mu.Unlock()
data := kv.persister.ReadSnapshot()
if len(data) == 0 {
kv.lastApplied = 0
kv.database = NewShardDatabase()
kv.lastOpId = make(map[int64]int64)
kv.configs = make([]shardmaster.Config, 1)
kv.configs[0].Groups = map[int][]string{}
kv.waitClean = NewWaitClean()
kv.waitMigration = NewWaitMigration()
} else {
r := bytes.NewBuffer(data)
d := labgob.NewDecoder(r)
kv.lastApplied = 0
kv.database = nil
kv.lastOpId = nil
kv.configs = nil
kv.waitMigration = nil
kv.waitClean = nil
d.Decode(&kv.lastApplied)
d.Decode(&kv.database)
d.Decode(&kv.lastOpId)
d.Decode(&kv.configs)
d.Decode(&kv.waitClean)
d.Decode(&kv.waitMigration)
}
}
func (kv *ShardKV) saveShardKVState(force bool) {
shouldSave := kv.maxraftstate != -1 && (force || kv.persister.RaftStateSize() > kv.maxraftstate)
if shouldSave {
w := new(bytes.Buffer)
e := labgob.NewEncoder(w)
e.Encode(kv.lastApplied)
e.Encode(kv.database)
e.Encode(kv.lastOpId)
e.Encode(kv.configs)
e.Encode(kv.waitClean)
e.Encode(kv.waitMigration)
snapshot := w.Bytes()
kv.rf.SaveSnapshot(kv.lastApplied, snapshot)
}
}
func (kv *ShardKV) stateMachine() {
for {
select {
case <-kv.ctx.Done():
DPrintf("ShardKV %d (gid=%d)stateMachine closed\n", kv.me, kv.gid)
return
case applyMsg := <-kv.applyCh:
if applyMsg.CommandValid {
kv.mu.Lock()
if kv.lastApplied+1 < applyMsg.CommandIndex {
kv.mu.Unlock()
kv.rf.Replay()
} else {
if kv.lastApplied+1 == applyMsg.CommandIndex {
kv.lastApplied++
//DPrintf("ShardKV(gid=%d) %d stateMachine received command %v %+v\n", kv.me, kv.gid, reflect.TypeOf(applyMsg.Command), applyMsg)
switch command := applyMsg.Command.(type) {
case OpArgs:
op := command
result := OpResult{ClientId: op.ClientId, OpId: op.OpId}
switch op.OpType {
case "Get":
shardNum := key2shard(op.Key)
latest := kv.configs[len(kv.configs)-1]
switch {
case op.ConfigNum != latest.Num || latest.Shards[shardNum] != kv.gid:
result.Result = ErrWrongGroup
case kv.waitMigration.IsMigrationShard(shardNum):
result.Result = ErrShardIsMigrating
default:
shard := kv.database.GetShard(shardNum)
if value, ok := shard.Get(op.Key); ok {
result.Result = OK
result.Value = value
} else {
result.Result = ErrNoKey
}
str, _ := json.Marshal(kv.database)
DPrintf("ShardKV(gid=%d) %d shardNum %d database= %s get key:%v result: %s\n", kv.gid, kv.me, shardNum, str, op.Key, result.Result)
kv.saveShardKVState(false)
}
go kv.applyWait.Trigger(result)
case "Put":
shardNum := key2shard(op.Key)
latest := kv.configs[len(kv.configs)-1]
switch {
case op.ConfigNum != latest.Num || latest.Shards[shardNum] != kv.gid:
result.Result = ErrWrongGroup
case kv.waitMigration.IsMigrationShard(shardNum):
result.Result = ErrShardIsMigrating
default:
result.Result = OK
if lastOpId, ok := kv.lastOpId[op.ClientId]; !ok || op.OpId > lastOpId {
shard := kv.database.GetShard(shardNum)
shard.Put(op.Key, op.Value, op.ClientId, op.OpId)
kv.lastOpId[op.ClientId] = op.OpId
kv.saveShardKVState(false)
}
}
go kv.applyWait.Trigger(result)
case "Append":
shardNum := key2shard(op.Key)
latest := kv.configs[len(kv.configs)-1]
switch {
case latest.Shards[shardNum] != kv.gid:
result.Result = ErrWrongGroup
case kv.waitMigration.IsMigrationShard(shardNum):
result.Result = ErrShardIsMigrating
default:
result.Result = OK
if lastOpId, ok := kv.lastOpId[op.ClientId]; !ok || op.OpId > lastOpId | {
shard := kv.database.GetShard(shardNum)
shard.Append(op.Key, op.Value, op.ClientId, op.OpId)
kv.lastOpId[op.ClientId] = op.OpId
kv.saveShardKVState(false)
} | conditional_block | |
server.go | ("ShardKV %d (gid = %d) CheckMigrateShard ok = %v args = %+v reply = %+v\n", kv.me, kv.gid, ok, args, reply)
}*/
if ok && reply.Result == OK {
kv.rf.Start(reply)
return
}
}
}(servers, args)
}
}
kv.mu.RUnlock()
}
}
}
func (kv *ShardKV) migrationHelper() {
t := time.NewTicker(100 * time.Millisecond)
start := time.Now()
for {
select {
case <-kv.ctx.Done():
return
case <-t.C:
kv.mu.RLock()
if kv.waitMigration.IsEmpty() {
kv.mu.RUnlock()
return
}
gidShards := kv.waitMigration.GetGidShards()
config := kv.waitMigration.GetConfig()
if time.Now().Sub(start) > WaitMigrationTimeOut {
kv.rf.Start(MigrateShardReply{
ConfigNum: config.Num,
Gid: -1,
Result: ErrWaitMigrationTimeOut,
})
} else {
for gid, shardNums := range gidShards {
servers := config.Groups[gid]
args := MigrateShardArgs{
config.Num,
gid,
shardNums,
}
go func(servers []string, args MigrateShardArgs) {
for si := 0; si < len(servers); si++ {
srv := kv.make_end(servers[si])
var reply MigrateShardReply
ok := srv.Call("ShardKV.MigrateShard", &args, &reply)
DPrintf("ShardKV %d (gid = %d) MigrateShard ok = %v args = %+v reply = %+v\n", kv.me, kv.gid, ok, args, reply)
if ok && (reply.Result == OK || reply.Result == ErrShardHasBeenCleaned) {
kv.rf.Start(reply)
return
}
}
}(servers, args)
}
}
kv.mu.RUnlock()
}
}
}
func (kv *ShardKV) init() {
kv.mu.Lock()
defer kv.mu.Unlock()
data := kv.persister.ReadSnapshot()
if len(data) == 0 {
kv.lastApplied = 0
kv.database = NewShardDatabase()
kv.lastOpId = make(map[int64]int64)
kv.configs = make([]shardmaster.Config, 1)
kv.configs[0].Groups = map[int][]string{}
kv.waitClean = NewWaitClean()
kv.waitMigration = NewWaitMigration()
} else {
r := bytes.NewBuffer(data)
d := labgob.NewDecoder(r)
kv.lastApplied = 0
kv.database = nil
kv.lastOpId = nil
kv.configs = nil
kv.waitMigration = nil
kv.waitClean = nil
d.Decode(&kv.lastApplied)
d.Decode(&kv.database)
d.Decode(&kv.lastOpId)
d.Decode(&kv.configs)
d.Decode(&kv.waitClean)
d.Decode(&kv.waitMigration)
}
}
func (kv *ShardKV) saveShardKVState(force bool) {
shouldSave := kv.maxraftstate != -1 && (force || kv.persister.RaftStateSize() > kv.maxraftstate)
if shouldSave {
w := new(bytes.Buffer)
e := labgob.NewEncoder(w)
e.Encode(kv.lastApplied)
e.Encode(kv.database)
e.Encode(kv.lastOpId)
e.Encode(kv.configs)
e.Encode(kv.waitClean)
e.Encode(kv.waitMigration)
snapshot := w.Bytes()
kv.rf.SaveSnapshot(kv.lastApplied, snapshot)
}
}
func (kv *ShardKV) stateMachine() {
for {
select {
case <-kv.ctx.Done():
DPrintf("ShardKV %d (gid=%d)stateMachine closed\n", kv.me, kv.gid)
return
case applyMsg := <-kv.applyCh:
if applyMsg.CommandValid {
kv.mu.Lock()
if kv.lastApplied+1 < applyMsg.CommandIndex {
kv.mu.Unlock()
kv.rf.Replay()
} else {
if kv.lastApplied+1 == applyMsg.CommandIndex {
kv.lastApplied++
//DPrintf("ShardKV(gid=%d) %d stateMachine received command %v %+v\n", kv.me, kv.gid, reflect.TypeOf(applyMsg.Command), applyMsg)
switch command := applyMsg.Command.(type) {
case OpArgs:
op := command
result := OpResult{ClientId: op.ClientId, OpId: op.OpId}
switch op.OpType {
case "Get":
shardNum := key2shard(op.Key)
latest := kv.configs[len(kv.configs)-1]
switch {
case op.ConfigNum != latest.Num || latest.Shards[shardNum] != kv.gid:
result.Result = ErrWrongGroup
case kv.waitMigration.IsMigrationShard(shardNum):
result.Result = ErrShardIsMigrating
default:
shard := kv.database.GetShard(shardNum)
if value, ok := shard.Get(op.Key); ok {
result.Result = OK
result.Value = value
} else {
result.Result = ErrNoKey
}
str, _ := json.Marshal(kv.database)
DPrintf("ShardKV(gid=%d) %d shardNum %d database= %s get key:%v result: %s\n", kv.gid, kv.me, shardNum, str, op.Key, result.Result)
kv.saveShardKVState(false)
}
go kv.applyWait.Trigger(result)
case "Put":
shardNum := key2shard(op.Key)
latest := kv.configs[len(kv.configs)-1]
switch {
case op.ConfigNum != latest.Num || latest.Shards[shardNum] != kv.gid:
result.Result = ErrWrongGroup
case kv.waitMigration.IsMigrationShard(shardNum):
result.Result = ErrShardIsMigrating
default:
result.Result = OK
if lastOpId, ok := kv.lastOpId[op.ClientId]; !ok || op.OpId > lastOpId {
shard := kv.database.GetShard(shardNum)
shard.Put(op.Key, op.Value, op.ClientId, op.OpId)
kv.lastOpId[op.ClientId] = op.OpId
kv.saveShardKVState(false)
}
}
go kv.applyWait.Trigger(result)
case "Append":
shardNum := key2shard(op.Key)
latest := kv.configs[len(kv.configs)-1]
switch {
case latest.Shards[shardNum] != kv.gid:
result.Result = ErrWrongGroup
case kv.waitMigration.IsMigrationShard(shardNum):
result.Result = ErrShardIsMigrating
default:
result.Result = OK
if lastOpId, ok := kv.lastOpId[op.ClientId]; !ok || op.OpId > lastOpId {
shard := kv.database.GetShard(shardNum)
shard.Append(op.Key, op.Value, op.ClientId, op.OpId)
kv.lastOpId[op.ClientId] = op.OpId
kv.saveShardKVState(false)
}
}
go kv.applyWait.Trigger(result)
default:
DPrintf("ShardKV %d (gid=%d) stateMachine received wrong opType OpArgs: %+v\n", kv.me, kv.gid, command)
}
case shardmaster.Config:
newConfig := command
oldConfig := kv.configs[len(kv.configs)-1]
if newConfig.Num > oldConfig.Num && kv.waitMigration.IsEmpty() && kv.waitClean.IsEmpty() {
kv.configs = append(kv.configs, newConfig)
if oldConfig.Num > 0 {
kv.waitMigration.Init(shardmaster.Config{
Num: newConfig.Num,
Shards: oldConfig.Shards,
Groups: oldConfig.Groups,
})
kv.waitClean.Init(newConfig)
for shardNum := 0; shardNum < shardmaster.NShards; shardNum++ {
oldGid := oldConfig.Shards[shardNum]
newGid := newConfig.Shards[shardNum]
if kv.gid == oldGid && kv.gid != newGid {
// old shard remove from this group
kv.waitClean.AddGidShard(newGid, shardNum)
}
if kv.gid != oldGid && kv.gid == newGid {
// new shard assign to this group
kv.waitMigration.AddGidShard(oldGid, shardNum)
} | }
// remove shard from kv.Database and store in waitClean
kv.waitClean.StoreCleanData(kv.database)
if !kv.waitMigration.IsEmpty() {
go kv.migrationHelper() | random_line_split | |
server.go | KV {
// call labgob.Register on structures you want
// Go's RPC library to marshall/unmarshall.
kv := new(ShardKV)
kv.me = me
kv.maxraftstate = maxraftstate
kv.make_end = make_end
kv.gid = gid
kv.masters = shardmaster.MakeClerk(masters)
kv.applyCh = make(chan raft.ApplyMsg)
kv.applyWait = NewWait()
kv.persister = persister
ctx, cancel := context.WithCancel(context.Background())
kv.ctx = ctx
kv.close = cancel
kv.init()
kv.rf = raft.Make(servers, me, persister, kv.applyCh)
if !kv.waitMigration.IsEmpty() {
go kv.migrationHelper()
}
if !kv.waitClean.IsEmpty() {
go kv.migrationChecker()
}
go kv.newConfigLearner()
go kv.stateMachine()
return kv
}
func (kv *ShardKV) start(args interface{}) (result string, value string) {
var op OpArgs
if getArgs, ok := args.(GetArgs); ok {
op = OpArgs{
ConfigNum: getArgs.ConfigNum,
ClientId: getArgs.ClientId,
OpId: getArgs.OpId,
Key: getArgs.Key,
Value: "",
OpType: "Get",
}
} else if putAppendArgs, ok := args.(PutAppendArgs); ok {
op = OpArgs{
ConfigNum: putAppendArgs.ConfigNum,
ClientId: putAppendArgs.ClientId,
OpId: putAppendArgs.OpId,
Key: putAppendArgs.Key,
Value: putAppendArgs.Value,
OpType: putAppendArgs.Op,
}
} else {
return fmt.Sprintf("ErrArgsType:%+v", args), ""
}
resultCh := kv.applyWait.Register(op)
defer kv.applyWait.Unregister(op)
_, _, isLeader := kv.rf.Start(op)
if !isLeader {
return ErrWrongLeader, ""
}
t := time.NewTimer(OpTimeout)
select {
case <-kv.ctx.Done():
return ErrShardKVClosed, ""
case <-t.C:
return ErrOpTimeout, ""
case opResult := <-resultCh:
//DPrintf("ShardKV %d return client %d by resultCh result = %+v\n", kv.me, op.ClientId, opResult)
return opResult.Result, opResult.Value
}
}
func (kv *ShardKV) newConfigLearner() {
t := time.NewTicker(100 * time.Millisecond)
for {
select {
case <-kv.ctx.Done():
return
case <-t.C:
kv.mu.RLock()
if !kv.waitClean.IsEmpty() || !kv.waitMigration.IsEmpty() {
// is applying new Config
kv.mu.RUnlock()
continue
}
latest := kv.configs[len(kv.configs)-1]
kv.mu.RUnlock()
config := kv.masters.Query(latest.Num + 1)
if latest.Num < config.Num {
kv.rf.Start(config)
}
}
}
}
func (kv *ShardKV) migrationChecker() | Result: ErrWaitCleanTimeOut,
})
} else {
for gid, shardNums := range gidShards {
servers := config.Groups[gid]
args := CheckMigrateShardArgs{
config.Num,
gid,
shardNums,
}
go func(servers []string, args CheckMigrateShardArgs) {
for si := 0; si < len(servers); si++ {
srv := kv.make_end(servers[si])
var reply CheckMigrateShardReply
ok := srv.Call("ShardKV.CheckMigrateShard", &args, &reply)
/*if ok {
DPrintf("ShardKV %d (gid = %d) CheckMigrateShard ok = %v args = %+v reply = %+v\n", kv.me, kv.gid, ok, args, reply)
}*/
if ok && reply.Result == OK {
kv.rf.Start(reply)
return
}
}
}(servers, args)
}
}
kv.mu.RUnlock()
}
}
}
func (kv *ShardKV) migrationHelper() {
t := time.NewTicker(100 * time.Millisecond)
start := time.Now()
for {
select {
case <-kv.ctx.Done():
return
case <-t.C:
kv.mu.RLock()
if kv.waitMigration.IsEmpty() {
kv.mu.RUnlock()
return
}
gidShards := kv.waitMigration.GetGidShards()
config := kv.waitMigration.GetConfig()
if time.Now().Sub(start) > WaitMigrationTimeOut {
kv.rf.Start(MigrateShardReply{
ConfigNum: config.Num,
Gid: -1,
Result: ErrWaitMigrationTimeOut,
})
} else {
for gid, shardNums := range gidShards {
servers := config.Groups[gid]
args := MigrateShardArgs{
config.Num,
gid,
shardNums,
}
go func(servers []string, args MigrateShardArgs) {
for si := 0; si < len(servers); si++ {
srv := kv.make_end(servers[si])
var reply MigrateShardReply
ok := srv.Call("ShardKV.MigrateShard", &args, &reply)
DPrintf("ShardKV %d (gid = %d) MigrateShard ok = %v args = %+v reply = %+v\n", kv.me, kv.gid, ok, args, reply)
if ok && (reply.Result == OK || reply.Result == ErrShardHasBeenCleaned) {
kv.rf.Start(reply)
return
}
}
}(servers, args)
}
}
kv.mu.RUnlock()
}
}
}
func (kv *ShardKV) init() {
kv.mu.Lock()
defer kv.mu.Unlock()
data := kv.persister.ReadSnapshot()
if len(data) == 0 {
kv.lastApplied = 0
kv.database = NewShardDatabase()
kv.lastOpId = make(map[int64]int64)
kv.configs = make([]shardmaster.Config, 1)
kv.configs[0].Groups = map[int][]string{}
kv.waitClean = NewWaitClean()
kv.waitMigration = NewWaitMigration()
} else {
r := bytes.NewBuffer(data)
d := labgob.NewDecoder(r)
kv.lastApplied = 0
kv.database = nil
kv.lastOpId = nil
kv.configs = nil
kv.waitMigration = nil
kv.waitClean = nil
d.Decode(&kv.lastApplied)
d.Decode(&kv.database)
d.Decode(&kv.lastOpId)
d.Decode(&kv.configs)
d.Decode(&kv.waitClean)
d.Decode(&kv.waitMigration)
}
}
func (kv *ShardKV) saveShardKVState(force bool) {
shouldSave := kv.maxraftstate != -1 && (force || kv.persister.RaftStateSize() > kv.maxraftstate)
if shouldSave {
w := new(bytes.Buffer)
e := labgob.NewEncoder(w)
e.Encode(kv.lastApplied)
e.Encode(kv.database)
e.Encode(kv.lastOpId)
e.Encode(kv.configs)
e.Encode(kv.waitClean)
e.Encode(kv.waitMigration)
snapshot := w.Bytes()
kv.rf.SaveSnapshot(kv.lastApplied, snapshot)
}
}
func (kv *ShardKV) stateMachine() {
for {
select {
case <-kv.ctx.Done():
DPrintf("ShardKV %d (gid=%d)stateMachine closed\n", kv.me, kv.gid)
return
case applyMsg := <-kv.applyCh:
if applyMsg.CommandValid {
kv.mu.Lock()
if kv.lastApplied+1 < applyMsg.CommandIndex {
kv.mu.Unlock()
kv.rf.Replay()
} else {
if kv.lastApplied+1 == applyMsg.CommandIndex {
kv.lastApplied++
//DPrintf("ShardKV(gid=%d) %d stateMachine received command %v %+v\n", kv.me, kv.gid, reflect.TypeOf(applyMsg.Command), applyMsg)
switch command := applyMsg.Command.(type) {
case Op | {
t := time.NewTicker(100 * time.Millisecond)
start := time.Now()
for {
select {
case <-kv.ctx.Done():
return
case <-t.C:
kv.mu.RLock()
if kv.waitClean.IsEmpty() {
kv.mu.RUnlock()
return
}
gidShards := kv.waitClean.GetGidShard()
config := kv.waitClean.GetConfig()
if time.Now().Sub(start) > WaitCleanTimeOut {
kv.rf.Start(CheckMigrateShardReply{
ConfigNum: config.Num,
Gid: -1, | identifier_body |
server.go | KV {
// call labgob.Register on structures you want
// Go's RPC library to marshall/unmarshall.
kv := new(ShardKV)
kv.me = me
kv.maxraftstate = maxraftstate
kv.make_end = make_end
kv.gid = gid
kv.masters = shardmaster.MakeClerk(masters)
kv.applyCh = make(chan raft.ApplyMsg)
kv.applyWait = NewWait()
kv.persister = persister
ctx, cancel := context.WithCancel(context.Background())
kv.ctx = ctx
kv.close = cancel
kv.init()
kv.rf = raft.Make(servers, me, persister, kv.applyCh)
if !kv.waitMigration.IsEmpty() {
go kv.migrationHelper()
}
if !kv.waitClean.IsEmpty() {
go kv.migrationChecker()
}
go kv.newConfigLearner()
go kv.stateMachine()
return kv
}
func (kv *ShardKV) start(args interface{}) (result string, value string) {
var op OpArgs
if getArgs, ok := args.(GetArgs); ok {
op = OpArgs{
ConfigNum: getArgs.ConfigNum,
ClientId: getArgs.ClientId,
OpId: getArgs.OpId,
Key: getArgs.Key,
Value: "",
OpType: "Get",
}
} else if putAppendArgs, ok := args.(PutAppendArgs); ok {
op = OpArgs{
ConfigNum: putAppendArgs.ConfigNum,
ClientId: putAppendArgs.ClientId,
OpId: putAppendArgs.OpId,
Key: putAppendArgs.Key,
Value: putAppendArgs.Value,
OpType: putAppendArgs.Op,
}
} else {
return fmt.Sprintf("ErrArgsType:%+v", args), ""
}
resultCh := kv.applyWait.Register(op)
defer kv.applyWait.Unregister(op)
_, _, isLeader := kv.rf.Start(op)
if !isLeader {
return ErrWrongLeader, ""
}
t := time.NewTimer(OpTimeout)
select {
case <-kv.ctx.Done():
return ErrShardKVClosed, ""
case <-t.C:
return ErrOpTimeout, ""
case opResult := <-resultCh:
//DPrintf("ShardKV %d return client %d by resultCh result = %+v\n", kv.me, op.ClientId, opResult)
return opResult.Result, opResult.Value
}
}
func (kv *ShardKV) newConfigLearner() {
t := time.NewTicker(100 * time.Millisecond)
for {
select {
case <-kv.ctx.Done():
return
case <-t.C:
kv.mu.RLock()
if !kv.waitClean.IsEmpty() || !kv.waitMigration.IsEmpty() {
// is applying new Config
kv.mu.RUnlock()
continue
}
latest := kv.configs[len(kv.configs)-1]
kv.mu.RUnlock()
config := kv.masters.Query(latest.Num + 1)
if latest.Num < config.Num {
kv.rf.Start(config)
}
}
}
}
func (kv *ShardKV) migrationChecker() {
t := time.NewTicker(100 * time.Millisecond)
start := time.Now()
for {
select {
case <-kv.ctx.Done():
return
case <-t.C:
kv.mu.RLock()
if kv.waitClean.IsEmpty() {
kv.mu.RUnlock()
return
}
gidShards := kv.waitClean.GetGidShard()
config := kv.waitClean.GetConfig()
if time.Now().Sub(start) > WaitCleanTimeOut {
kv.rf.Start(CheckMigrateShardReply{
ConfigNum: config.Num,
Gid: -1,
Result: ErrWaitCleanTimeOut,
})
} else {
for gid, shardNums := range gidShards {
servers := config.Groups[gid]
args := CheckMigrateShardArgs{
config.Num,
gid,
shardNums,
}
go func(servers []string, args CheckMigrateShardArgs) {
for si := 0; si < len(servers); si++ {
srv := kv.make_end(servers[si])
var reply CheckMigrateShardReply
ok := srv.Call("ShardKV.CheckMigrateShard", &args, &reply)
/*if ok {
DPrintf("ShardKV %d (gid = %d) CheckMigrateShard ok = %v args = %+v reply = %+v\n", kv.me, kv.gid, ok, args, reply)
}*/
if ok && reply.Result == OK {
kv.rf.Start(reply)
return
}
}
}(servers, args)
}
}
kv.mu.RUnlock()
}
}
}
func (kv *ShardKV) migrationHelper() {
t := time.NewTicker(100 * time.Millisecond)
start := time.Now()
for {
select {
case <-kv.ctx.Done():
return
case <-t.C:
kv.mu.RLock()
if kv.waitMigration.IsEmpty() {
kv.mu.RUnlock()
return
}
gidShards := kv.waitMigration.GetGidShards()
config := kv.waitMigration.GetConfig()
if time.Now().Sub(start) > WaitMigrationTimeOut {
kv.rf.Start(MigrateShardReply{
ConfigNum: config.Num,
Gid: -1,
Result: ErrWaitMigrationTimeOut,
})
} else {
for gid, shardNums := range gidShards {
servers := config.Groups[gid]
args := MigrateShardArgs{
config.Num,
gid,
shardNums,
}
go func(servers []string, args MigrateShardArgs) {
for si := 0; si < len(servers); si++ {
srv := kv.make_end(servers[si])
var reply MigrateShardReply
ok := srv.Call("ShardKV.MigrateShard", &args, &reply)
DPrintf("ShardKV %d (gid = %d) MigrateShard ok = %v args = %+v reply = %+v\n", kv.me, kv.gid, ok, args, reply)
if ok && (reply.Result == OK || reply.Result == ErrShardHasBeenCleaned) {
kv.rf.Start(reply)
return
}
}
}(servers, args)
}
}
kv.mu.RUnlock()
}
}
}
func (kv *ShardKV) init() {
kv.mu.Lock()
defer kv.mu.Unlock()
data := kv.persister.ReadSnapshot()
if len(data) == 0 {
kv.lastApplied = 0
kv.database = NewShardDatabase()
kv.lastOpId = make(map[int64]int64)
kv.configs = make([]shardmaster.Config, 1)
kv.configs[0].Groups = map[int][]string{}
kv.waitClean = NewWaitClean()
kv.waitMigration = NewWaitMigration()
} else {
r := bytes.NewBuffer(data)
d := labgob.NewDecoder(r)
kv.lastApplied = 0
kv.database = nil
kv.lastOpId = nil
kv.configs = nil
kv.waitMigration = nil
kv.waitClean = nil
d.Decode(&kv.lastApplied)
d.Decode(&kv.database)
d.Decode(&kv.lastOpId)
d.Decode(&kv.configs)
d.Decode(&kv.waitClean)
d.Decode(&kv.waitMigration)
}
}
func (kv *ShardKV) | (force bool) {
shouldSave := kv.maxraftstate != -1 && (force || kv.persister.RaftStateSize() > kv.maxraftstate)
if shouldSave {
w := new(bytes.Buffer)
e := labgob.NewEncoder(w)
e.Encode(kv.lastApplied)
e.Encode(kv.database)
e.Encode(kv.lastOpId)
e.Encode(kv.configs)
e.Encode(kv.waitClean)
e.Encode(kv.waitMigration)
snapshot := w.Bytes()
kv.rf.SaveSnapshot(kv.lastApplied, snapshot)
}
}
func (kv *ShardKV) stateMachine() {
for {
select {
case <-kv.ctx.Done():
DPrintf("ShardKV %d (gid=%d)stateMachine closed\n", kv.me, kv.gid)
return
case applyMsg := <-kv.applyCh:
if applyMsg.CommandValid {
kv.mu.Lock()
if kv.lastApplied+1 < applyMsg.CommandIndex {
kv.mu.Unlock()
kv.rf.Replay()
} else {
if kv.lastApplied+1 == applyMsg.CommandIndex {
kv.lastApplied++
//DPrintf("ShardKV(gid=%d) %d stateMachine received command %v %+v\n", kv.me, kv.gid, reflect.TypeOf(applyMsg.Command), applyMsg)
switch command := applyMsg.Command.(type) {
case Op | saveShardKVState | identifier_name |
xor.go | <input type="search" id="codesearchQuery" value="" size="30" onkeydown="return codesearchKeyDown(event);"/>
<form method="GET" action="http://www.google.com/codesearch" id="codesearch" class="search" onsubmit="return codeSearchSubmit();" style="display:inline;">
<input type="hidden" name="q" value=""/> | <span style="color: red">(TODO: remove for now?)</span>
</form>
</td>
</tr>
<tr>
<td>
<span style="color: gray;">(e.g. “pem” or “xml”)</span>
</td>
</tr>
</table> -->
</td>
</tr>
</table>
</div>
<div id="linkList">
<ul>
<li class="navhead"><a href="../../../../index.html">Home</a></li>
<li class="blank"> </li>
<li class="navhead">Documents</li>
<li><a href="../../../../doc/go_tutorial.html">Tutorial</a></li>
<li><a href="../../../../doc/effective_go.html">Effective Go</a></li>
<li><a href="../../../../doc/go_faq.html">FAQ</a></li>
<li><a href="../../../../doc/go_lang_faq.html">Language Design FAQ</a></li>
<li><a href="http://www.youtube.com/watch?v=rKnDgT73v8s">Tech talk (1 hour)</a> (<a href="../../../../doc/go_talk-20091030.pdf">PDF</a>)</li>
<li><a href="../../../../doc/go_spec.html">Language Specification</a></li>
<li><a href="../../../../doc/go_mem.html">Memory Model</a></li>
<li><a href="../../../../doc/go_for_cpp_programmers.html">Go for C++ Programmers</a></li>
<li class="blank"> </li>
<li class="navhead">How To</li>
<li><a href="../../../../doc/install.html">Install Go</a></li>
<li><a href="../../../../doc/contribute.html">Contribute code</a></li>
<li class="blank"> </li>
<li class="navhead">Programming</li>
<li><a href="../../../../cmd/index.html">Command documentation</a></li>
<li><a href="../../../../pkg/index.html">Package documentation</a></li>
<li><a href="../../../index.html">Source files</a></li>
<li class="blank"> </li>
<li class="navhead">Help</li>
<li>#go-nuts on irc.freenode.net</li>
<li><a href="http://groups.google.com/group/golang-nuts">Go Nuts mailing list</a></li>
<li><a href="http://code.google.com/p/go/issues/list">Issue tracker</a></li>
<li class="blank"> </li>
<li class="navhead">Go code search</li>
<form method="GET" action="http://golang.org/search" class="search">
<input type="search" name="q" value="" size="25" style="width:80%; max-width:200px" />
<input type="submit" value="Go" />
</form>
<li class="blank"> </li>
<li class="navhead">Last update</li>
<li>Thu Nov 12 15:48:37 PST 2009</li>
</ul>
</div>
<div id="content">
<h1 id="generatedHeader">Source file /src/pkg/crypto/block/xor.go</h1>
<!-- The Table of Contents is automatically inserted in this <div>.
Do not delete this <div>. -->
<div id="nav"></div>
<!-- Content is HTML-escaped elsewhere -->
<pre>
<a id="L1"></a><span class="comment">// Copyright 2009 The Go Authors. All rights reserved.</span>
<a id="L2"></a><span class="comment">// Use of this source code is governed by a BSD-style</span>
<a id="L3"></a><span class="comment">// license that can be found in the LICENSE file.</span>
<a id="L5"></a><span class="comment">// Encrypt/decrypt data by xor with a pseudo-random data stream.</span>
<a id="L7"></a>package block
<a id="L9"></a>import (
<a id="L10"></a>"io";
<a id="L11"></a>"os";
<a id="L12"></a>)
<a id="L14"></a><span class="comment">// A dataStream is an interface to an unending stream of data,</span>
<a id="L15"></a><span class="comment">// used by XorReader and XorWriter to model a pseudo-random generator.</span>
<a id="L16"></a><span class="comment">// Calls to Next() return sequential blocks of data from the stream.</span>
<a id="L17"></a><span class="comment">// Each call must return at least one byte: there is no EOF.</span>
<a id="L18"></a>type dataStream interface {
<a id="L19"></a>Next() []byte;
<a id="L20"></a>}
<a id="L22"></a>type xorReader struct {
<a id="L23"></a>r io.Reader;
<a id="L24"></a>rand dataStream; <span class="comment">// pseudo-random</span>
<a id="L25"></a>buf []byte; <span class="comment">// data available from last call to rand</span>
<a id="L26"></a>}
<a id="L28"></a>func newXorReader(rand dataStream, r io.Reader) io.Reader {
<a id="L29"></a>x := new(xorReader);
<a id="L30"></a>x.r = r;
<a id="L31"></a>x.rand = rand;
<a id="L32"></a>return x;
<a id="L33"></a>}
<a id="L35"></a>func (x *xorReader) Read(p []byte) (n int, err os.Error) {
<a id="L36"></a>n, err = x.r.Read(p);
<a id="L38"></a><span class="comment">// xor input with stream.</span>
<a id="L39"></a>bp := 0;
<a id="L40"></a>buf := x.buf;
<a id="L41"></a>for i := 0; i < n; i++ {
<a id="L42"></a>if bp >= len(buf) {
<a id="L43"></a>buf = x.rand.Next();
<a id="L44"></a>bp = 0;
<a id="L45"></a>}
<a id="L46"></a>p[i] ^= buf[bp];
<a id="L47"></a>bp++;
<a id="L48"></a>}
<a id="L49"></a>x.buf = buf[bp:len(buf)];
<a id="L50"></a>return n, err;
<a id="L51"></a>}
<a id="L53"></a>type xorWriter struct {
<a id="L54"></a>w io.Writer;
<a id="L55"></a>rand dataStream; <span class="comment">// pseudo-random</span>
<a id="L56"></a>buf []byte; <span class="comment">// last buffer returned by rand</span>
<a id="L57"></a>extra []byte; <span class="comment">// extra random data (use before buf)</span>
<a id="L58"></a>work []byte; <span class="comment">// work space</span>
<a id="L59"></a>}
<a id="L61"></a>func newXorWriter(rand dataStream, w io.Writer) io.Writer {
<a id="L62"></a>x := new(xorWriter);
<a id="L63"></a>x.w = w;
<a id="L64"></a>x.rand = rand;
<a id="L65"></a>x.work = make([]byte, 4096);
<a id="L66"></a>return x;
<a id="L67"></a>}
<a id="L69"></a>func (x *xorWriter) Write(p []byte) (n int, err os.Error) {
<a id="L7 | <input type="submit" value="Code search" /> | random_line_split |
app.js | Chase & Co'], ['McDonald\'s Corporation'], ['Merck & Co., Inc.'], ['Microsoft Corporation'], ['Pfizer Inc'], ['The Coca-Cola Company'], ['The Home Depot, Inc.'], ['The Procter & Gamble Company'], ['United Technologies Corporation'], ['Verizon Communications'], ['Wal-Mart Stores, Inc.']];
for (var i = 0, l = myData.length, rand = Math.random; i < l; i++) {
var data = myData[i];
data[1] = ((rand() * 10000) >> 0) / 100;
data[2] = ((rand() * 10000) >> 0) / 100;
data[3] = ((rand() * 10000) >> 0) / 100;
data[4] = ((rand() * 10000) >> 0) / 100;
data[5] = ((rand() * 10000) >> 0) / 100;
}
//create data store to be shared among the grid and bar series.
var ds = Ext.create('Ext.data.ArrayStore', {
fields : [{
name : 'company'
}, {
name : 'price',
type : 'float'
}, {
name : 'revenue %',
type : 'float'
}, {
name : 'growth %',
type : 'float'
}, {
name : 'product %',
type : 'float'
}, {
name : 'market %',
type : 'float'
}],
data : myData
});
//create radar dataset model.
var chs = Ext.create('Ext.data.JsonStore', {
fields : ['Name', 'Data'],
data : [{
'Name' : 'Price',
'Data' : 100
}, {
'Name' : 'Revenue %',
'Data' : 100
}, {
'Name' : 'Growth %',
'Data' : 100
}, {
'Name' : 'Product %',
'Data' : 100
}, {
'Name' : 'Market %',
'Data' : 100
}]
});
//Radar chart will render information for a selected company in the
//list. Selection can also be done via clicking on the bars in the series.
var radarChart = Ext.create('Ext.chart.Chart', {
margin : '0 0 0 0',
insetPadding : 20,
flex : 1.2,
animate : true,
store : chs,
axes : [{
steps : 5,
type : 'Radial',
position : 'radial',
maximum : 100
}],
series : [{
type : 'radar',
xField : 'Name',
yField : 'Data',
showInLegend : false,
showMarkers : true,
markerConfig : {
radius : 4,
size : 4
},
style : {
fill : 'rgb(194,214,240)',
opacity : 0.5,
'stroke-width' : 0.5
}
}]
});
//create a grid that will list the dataset items.
var gridPanel = Ext.create('Ext.grid.Panel', {
id : 'company-form',
flex : 0.60,
store : ds,
title : 'Company Data',
requires : ['Ext.ux.grid.filter.*'],
features : [{
ftype : 'filters',
local : true
}],
dockedItems : [{
xtype : 'toolbar',
items : [{
xtype : 'combo',
queryMode : 'local',
store : ds,
displayField : 'company',
listeners : {
change : function(me, newVal, oldVal, eOpts) {
console.log(me.getStore());
me.getStore().filter("company", newVal);
}
}
}, {
xtype: 'button',
text: 'reset',
handler: function(me){
console.log("click");
me.up('toolbar').down('combo').getStore().clearFilter();
}
}]
}],
columns : [{
id : 'company',
text : 'Company',
flex : 1,
filterable : true,
sortable : true, | } else if (record.get("price") < 25) {
metaData.style = "background-color:red;";
return '<span style="font-weight:bolder;">' + value + '</span>';
} else {
metaData.style = "background-color:blue;";
}
return '<span style="font-weight:bolder;color:white;">' + value + '</span>';
}
}, {
text : 'Price',
width : 75,
sortable : true,
dataIndex : 'price',
align : 'right',
renderer : function(value, metaData, record, rowIndex, colIndex, store, view) {
if (value > 50) {
metaData.style = "";
return '<span style="color:green;font-weight:bolder;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
} else if (value < 25) {
return '<span style="color:red;font-weight:bolder;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
}
return '<span style="color:blue;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
}
}, {
text : 'Revenue',
width : 75,
sortable : true,
align : 'right',
dataIndex : 'revenue %',
renderer : perc
}, {
text : 'Growth',
width : 75,
sortable : true,
align : 'right',
dataIndex : 'growth %',
renderer : perc
}, {
text : 'Product',
width : 75,
sortable : true,
align : 'right',
dataIndex : 'product %',
renderer : perc
}, {
text : 'Market',
width : 75,
sortable : true,
align : 'right',
dataIndex : 'market %',
renderer : perc
}],
listeners : {
selectionchange : function(model, records) {
var json, name, i, l, items, series, fields;
if (records[0]) {
rec = records[0];
if (!form) {
form = this.up('form').getForm();
fields = form.getFields();
fields.each(function(field) {
if (field.name != 'company') {
field.setDisabled(false);
}
});
} else {
fields = form.getFields();
}
// prevent change events from firing
fields.each(function(field) {
field.suspendEvents();
});
form.loadRecord(rec);
updateRecord(rec);
fields.each(function(field) {
field.resumeEvents();
});
}
}
}
});
//create a bar series to be at the top of the panel.
var barChart = Ext.create('Ext.chart.Chart', {
flex : 1,
shadow : true,
animate : true,
store : ds,
legend : {
position : 'right'
},
axes : [{
type : 'Numeric',
position : 'left',
fields : ['price', 'revenue %', 'growth %'],
minimum : 0,
hidden : true
}, {
type : 'Category',
position : 'bottom',
fields : ['company'],
label : {
renderer : function(v) {
return Ext.String.ellipsis(v, 15, false);
},
font : '9px Arial',
rotate : {
degrees : 330
}
}
}],
series : [{
type : 'column',
axis : 'left',
highlight : true,
// style : {
// fill : '#456d9f'
// },
highlightCfg : {
fill : '#a2b5ca'
},
label : {
contrast : true,
display : 'insideEnd',
field : 'price',
color : '#000',
orientation : 'vertical',
'text-anchor' : 'middle'
},
listeners : {
'itemmouseup' : function(item) {
var | dataIndex : 'company',
renderer : function(value, metaData, record, rowIndex, colIndex, store, view) {
if (record.get("price") > 50) {
metaData.style = "background-color:green;";
return '<span style="font-weight:bolder;">' + value + '</span>'; | random_line_split |
app.js |
var bd = Ext.getBody(), form = false, rec = false, selectedStoreItem = false,
//performs the highlight of an item in the bar series
selectItem = function(storeItem) {
var name = storeItem.get('company'), series = barChart.series.get(0), i, items, l;
series.highlight = true;
series.unHighlightItem();
series.cleanHighlights();
for ( i = 0, items = series.items, l = items.length; i < l; i++) {
if (name == items[i].storeItem.get('company')) {
selectedStoreItem = items[i].storeItem;
series.highlightItem(items[i]);
break;
}
}
series.highlight = false;
},
//updates a record modified via the form
updateRecord = function(rec) {
var name, series, i, l, items, json = [{
'Name' : 'Price',
'Data' : rec.get('price')
}, {
'Name' : 'Revenue %',
'Data' : rec.get('revenue %')
}, {
'Name' : 'Growth %',
'Data' : rec.get('growth %')
}, {
'Name' : 'Product %',
'Data' : rec.get('product %')
}, {
'Name' : 'Market %',
'Data' : rec.get('market %')
}];
chs.loadData(json);
selectItem(rec);
}, createListeners = function() {
return {
// buffer so we don't refire while the user is still typing
buffer : 200,
change : function(field, newValue, oldValue, listener) {
if (rec && form) {
if (newValue > field.maxValue) {
field.setValue(field.maxValue);
} else {
form.updateRecord(rec);
updateRecord(rec);
}
}
}
};
};
// sample static data for the store
var myData = [['3m Co'], ['Alcoa Inc'], ['Altria Group Inc'], ['American Express Company'], ['American International Group, Inc.'], ['AT&T Inc'], ['Boeing Co.'], ['Caterpillar Inc.'], ['Citigroup, Inc.'], ['E.I. du Pont de Nemours and Company'], ['Exxon Mobil Corp'], ['General Electric Company'], ['General Motors Corporation'], ['Hewlett-Packard Co'], ['Honeywell Intl Inc'], ['Intel Corporation'], ['International Business Machines'], ['Johnson & Johnson'], ['JP Morgan & Chase & Co'], ['McDonald\'s Corporation'], ['Merck & Co., Inc.'], ['Microsoft Corporation'], ['Pfizer Inc'], ['The Coca-Cola Company'], ['The Home Depot, Inc.'], ['The Procter & Gamble Company'], ['United Technologies Corporation'], ['Verizon Communications'], ['Wal-Mart Stores, Inc.']];
for (var i = 0, l = myData.length, rand = Math.random; i < l; i++) {
var data = myData[i];
data[1] = ((rand() * 10000) >> 0) / 100;
data[2] = ((rand() * 10000) >> 0) / 100;
data[3] = ((rand() * 10000) >> 0) / 100;
data[4] = ((rand() * 10000) >> 0) / 100;
data[5] = ((rand() * 10000) >> 0) / 100;
}
//create data store to be shared among the grid and bar series.
var ds = Ext.create('Ext.data.ArrayStore', {
fields : [{
name : 'company'
}, {
name : 'price',
type : 'float'
}, {
name : 'revenue %',
type : 'float'
}, {
name : 'growth %',
type : 'float'
}, {
name : 'product %',
type : 'float'
}, {
name : 'market %',
type : 'float'
}],
data : myData
});
//create radar dataset model.
var chs = Ext.create('Ext.data.JsonStore', {
fields : ['Name', 'Data'],
data : [{
'Name' : 'Price',
'Data' : 100
}, {
'Name' : 'Revenue %',
'Data' : 100
}, {
'Name' : 'Growth %',
'Data' : 100
}, {
'Name' : 'Product %',
'Data' : 100
}, {
'Name' : 'Market %',
'Data' : 100
}]
});
//Radar chart will render information for a selected company in the
//list. Selection can also be done via clicking on the bars in the series.
var radarChart = Ext.create('Ext.chart.Chart', {
margin : '0 0 0 0',
insetPadding : 20,
flex : 1.2,
animate : true,
store : chs,
axes : [{
steps : 5,
type : 'Radial',
position : 'radial',
maximum : 100
}],
series : [{
type : 'radar',
xField : 'Name',
yField : 'Data',
showInLegend : false,
showMarkers : true,
markerConfig : {
radius : 4,
size : 4
},
style : {
fill : 'rgb(194,214,240)',
opacity : 0.5,
'stroke-width' : 0.5
}
}]
});
//create a grid that will list the dataset items.
var gridPanel = Ext.create('Ext.grid.Panel', {
id : 'company-form',
flex : 0.60,
store : ds,
title : 'Company Data',
requires : ['Ext.ux.grid.filter.*'],
features : [{
ftype : 'filters',
local : true
}],
dockedItems : [{
xtype : 'toolbar',
items : [{
xtype : 'combo',
queryMode : 'local',
store : ds,
displayField : 'company',
listeners : {
change : function(me, newVal, oldVal, eOpts) {
console.log(me.getStore());
me.getStore().filter("company", newVal);
}
}
}, {
xtype: 'button',
text: 'reset',
handler: function(me){
console.log("click");
me.up('toolbar').down('combo').getStore().clearFilter();
}
}]
}],
columns : [{
id : 'company',
text : 'Company',
flex : 1,
filterable : true,
sortable : true,
dataIndex : 'company',
renderer : function(value, metaData, record, rowIndex, colIndex, store, view) {
if (record.get("price") > 50) {
metaData.style = "background-color:green;";
return '<span style="font-weight:bolder;">' + value + '</span>';
} else if (record.get("price") < 25) {
metaData.style = "background-color:red;";
return '<span style="font-weight:bolder;">' + value + '</span>';
} else {
metaData.style = "background-color:blue;";
}
return '<span style="font-weight:bolder;color:white;">' + value + '</span>';
}
}, {
text : 'Price',
width : 75,
sortable : true,
dataIndex : 'price',
align : 'right',
renderer : function(value, metaData, record, rowIndex, colIndex, store, view) {
if (value > 50) {
metaData.style = "";
return '<span style="color:green;font-weight:bolder;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
} else if (value < 25) {
return '<span style="color:red;font-weight:bolder;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
}
return '<span style="color:blue;">' + | {
if (value > 50) {
metaData.style = "";
return '<span style="color:green;font-weight:bolder;">' + Ext.util.Format.number(value, '0.00 %') + '</span>';
} else if (value < 25) {
return '<span style="color:red;font-weight:bolder;">' + Ext.util.Format.number(value, '0.00 %') + '</span>';
}
return '<span style="color:blue;">' + Ext.util.Format.number(value, '0.00 %') + '</span>';
} | identifier_body | |
app.js |
series.highlight = false;
},
//updates a record modified via the form
updateRecord = function(rec) {
var name, series, i, l, items, json = [{
'Name' : 'Price',
'Data' : rec.get('price')
}, {
'Name' : 'Revenue %',
'Data' : rec.get('revenue %')
}, {
'Name' : 'Growth %',
'Data' : rec.get('growth %')
}, {
'Name' : 'Product %',
'Data' : rec.get('product %')
}, {
'Name' : 'Market %',
'Data' : rec.get('market %')
}];
chs.loadData(json);
selectItem(rec);
}, createListeners = function() {
return {
// buffer so we don't refire while the user is still typing
buffer : 200,
change : function(field, newValue, oldValue, listener) {
if (rec && form) {
if (newValue > field.maxValue) {
field.setValue(field.maxValue);
} else {
form.updateRecord(rec);
updateRecord(rec);
}
}
}
};
};
// sample static data for the store
var myData = [['3m Co'], ['Alcoa Inc'], ['Altria Group Inc'], ['American Express Company'], ['American International Group, Inc.'], ['AT&T Inc'], ['Boeing Co.'], ['Caterpillar Inc.'], ['Citigroup, Inc.'], ['E.I. du Pont de Nemours and Company'], ['Exxon Mobil Corp'], ['General Electric Company'], ['General Motors Corporation'], ['Hewlett-Packard Co'], ['Honeywell Intl Inc'], ['Intel Corporation'], ['International Business Machines'], ['Johnson & Johnson'], ['JP Morgan & Chase & Co'], ['McDonald\'s Corporation'], ['Merck & Co., Inc.'], ['Microsoft Corporation'], ['Pfizer Inc'], ['The Coca-Cola Company'], ['The Home Depot, Inc.'], ['The Procter & Gamble Company'], ['United Technologies Corporation'], ['Verizon Communications'], ['Wal-Mart Stores, Inc.']];
for (var i = 0, l = myData.length, rand = Math.random; i < l; i++) {
var data = myData[i];
data[1] = ((rand() * 10000) >> 0) / 100;
data[2] = ((rand() * 10000) >> 0) / 100;
data[3] = ((rand() * 10000) >> 0) / 100;
data[4] = ((rand() * 10000) >> 0) / 100;
data[5] = ((rand() * 10000) >> 0) / 100;
}
//create data store to be shared among the grid and bar series.
var ds = Ext.create('Ext.data.ArrayStore', {
fields : [{
name : 'company'
}, {
name : 'price',
type : 'float'
}, {
name : 'revenue %',
type : 'float'
}, {
name : 'growth %',
type : 'float'
}, {
name : 'product %',
type : 'float'
}, {
name : 'market %',
type : 'float'
}],
data : myData
});
//create radar dataset model.
var chs = Ext.create('Ext.data.JsonStore', {
fields : ['Name', 'Data'],
data : [{
'Name' : 'Price',
'Data' : 100
}, {
'Name' : 'Revenue %',
'Data' : 100
}, {
'Name' : 'Growth %',
'Data' : 100
}, {
'Name' : 'Product %',
'Data' : 100
}, {
'Name' : 'Market %',
'Data' : 100
}]
});
//Radar chart will render information for a selected company in the
//list. Selection can also be done via clicking on the bars in the series.
var radarChart = Ext.create('Ext.chart.Chart', {
margin : '0 0 0 0',
insetPadding : 20,
flex : 1.2,
animate : true,
store : chs,
axes : [{
steps : 5,
type : 'Radial',
position : 'radial',
maximum : 100
}],
series : [{
type : 'radar',
xField : 'Name',
yField : 'Data',
showInLegend : false,
showMarkers : true,
markerConfig : {
radius : 4,
size : 4
},
style : {
fill : 'rgb(194,214,240)',
opacity : 0.5,
'stroke-width' : 0.5
}
}]
});
//create a grid that will list the dataset items.
var gridPanel = Ext.create('Ext.grid.Panel', {
id : 'company-form',
flex : 0.60,
store : ds,
title : 'Company Data',
requires : ['Ext.ux.grid.filter.*'],
features : [{
ftype : 'filters',
local : true
}],
dockedItems : [{
xtype : 'toolbar',
items : [{
xtype : 'combo',
queryMode : 'local',
store : ds,
displayField : 'company',
listeners : {
change : function(me, newVal, oldVal, eOpts) {
console.log(me.getStore());
me.getStore().filter("company", newVal);
}
}
}, {
xtype: 'button',
text: 'reset',
handler: function(me){
console.log("click");
me.up('toolbar').down('combo').getStore().clearFilter();
}
}]
}],
columns : [{
id : 'company',
text : 'Company',
flex : 1,
filterable : true,
sortable : true,
dataIndex : 'company',
renderer : function(value, metaData, record, rowIndex, colIndex, store, view) {
if (record.get("price") > 50) {
metaData.style = "background-color:green;";
return '<span style="font-weight:bolder;">' + value + '</span>';
} else if (record.get("price") < 25) {
metaData.style = "background-color:red;";
return '<span style="font-weight:bolder;">' + value + '</span>';
} else {
metaData.style = "background-color:blue;";
}
return '<span style="font-weight:bolder;color:white;">' + value + '</span>';
}
}, {
text : 'Price',
width : 75,
sortable : true,
dataIndex : 'price',
align : 'right',
renderer : function(value, metaData, record, rowIndex, colIndex, store, view) {
if (value > 50) {
metaData.style = "";
return '<span style="color:green;font-weight:bolder;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
} else if (value < 25) {
return '<span style="color:red;font-weight:bolder;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
}
return '<span style="color:blue;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
}
}, {
text : 'Revenue',
width : 75,
sortable : true,
align : 'right',
dataIndex : 'revenue %',
renderer : perc
}, {
text : 'Growth',
width : 75,
sortable : true,
align : 'right',
dataIndex : 'growth %',
renderer : perc
}, {
text : 'Product',
width : 75,
sortable : true,
align : 'right',
dataIndex : 'product %',
renderer : perc
}, {
text : 'Market',
width : 75,
sortable : true,
align : 'right',
dataIndex : 'market %',
renderer : perc
}],
listeners : {
selectionchange : function(model, records) {
var json, name, i, l, items, series, fields;
if (records[0]) {
rec = records | {
if (name == items[i].storeItem.get('company')) {
selectedStoreItem = items[i].storeItem;
series.highlightItem(items[i]);
break;
}
} | conditional_block | |
app.js | (value, metaData, record, rowIndex, colIndex, store, view) {
if (value > 50) {
metaData.style = "";
return '<span style="color:green;font-weight:bolder;">' + Ext.util.Format.number(value, '0.00 %') + '</span>';
} else if (value < 25) {
return '<span style="color:red;font-weight:bolder;">' + Ext.util.Format.number(value, '0.00 %') + '</span>';
}
return '<span style="color:blue;">' + Ext.util.Format.number(value, '0.00 %') + '</span>';
}
var bd = Ext.getBody(), form = false, rec = false, selectedStoreItem = false,
//performs the highlight of an item in the bar series
selectItem = function(storeItem) {
var name = storeItem.get('company'), series = barChart.series.get(0), i, items, l;
series.highlight = true;
series.unHighlightItem();
series.cleanHighlights();
for ( i = 0, items = series.items, l = items.length; i < l; i++) {
if (name == items[i].storeItem.get('company')) {
selectedStoreItem = items[i].storeItem;
series.highlightItem(items[i]);
break;
}
}
series.highlight = false;
},
//updates a record modified via the form
updateRecord = function(rec) {
var name, series, i, l, items, json = [{
'Name' : 'Price',
'Data' : rec.get('price')
}, {
'Name' : 'Revenue %',
'Data' : rec.get('revenue %')
}, {
'Name' : 'Growth %',
'Data' : rec.get('growth %')
}, {
'Name' : 'Product %',
'Data' : rec.get('product %')
}, {
'Name' : 'Market %',
'Data' : rec.get('market %')
}];
chs.loadData(json);
selectItem(rec);
}, createListeners = function() {
return {
// buffer so we don't refire while the user is still typing
buffer : 200,
change : function(field, newValue, oldValue, listener) {
if (rec && form) {
if (newValue > field.maxValue) {
field.setValue(field.maxValue);
} else {
form.updateRecord(rec);
updateRecord(rec);
}
}
}
};
};
// sample static data for the store
var myData = [['3m Co'], ['Alcoa Inc'], ['Altria Group Inc'], ['American Express Company'], ['American International Group, Inc.'], ['AT&T Inc'], ['Boeing Co.'], ['Caterpillar Inc.'], ['Citigroup, Inc.'], ['E.I. du Pont de Nemours and Company'], ['Exxon Mobil Corp'], ['General Electric Company'], ['General Motors Corporation'], ['Hewlett-Packard Co'], ['Honeywell Intl Inc'], ['Intel Corporation'], ['International Business Machines'], ['Johnson & Johnson'], ['JP Morgan & Chase & Co'], ['McDonald\'s Corporation'], ['Merck & Co., Inc.'], ['Microsoft Corporation'], ['Pfizer Inc'], ['The Coca-Cola Company'], ['The Home Depot, Inc.'], ['The Procter & Gamble Company'], ['United Technologies Corporation'], ['Verizon Communications'], ['Wal-Mart Stores, Inc.']];
for (var i = 0, l = myData.length, rand = Math.random; i < l; i++) {
var data = myData[i];
data[1] = ((rand() * 10000) >> 0) / 100;
data[2] = ((rand() * 10000) >> 0) / 100;
data[3] = ((rand() * 10000) >> 0) / 100;
data[4] = ((rand() * 10000) >> 0) / 100;
data[5] = ((rand() * 10000) >> 0) / 100;
}
//create data store to be shared among the grid and bar series.
var ds = Ext.create('Ext.data.ArrayStore', {
fields : [{
name : 'company'
}, {
name : 'price',
type : 'float'
}, {
name : 'revenue %',
type : 'float'
}, {
name : 'growth %',
type : 'float'
}, {
name : 'product %',
type : 'float'
}, {
name : 'market %',
type : 'float'
}],
data : myData
});
//create radar dataset model.
var chs = Ext.create('Ext.data.JsonStore', {
fields : ['Name', 'Data'],
data : [{
'Name' : 'Price',
'Data' : 100
}, {
'Name' : 'Revenue %',
'Data' : 100
}, {
'Name' : 'Growth %',
'Data' : 100
}, {
'Name' : 'Product %',
'Data' : 100
}, {
'Name' : 'Market %',
'Data' : 100
}]
});
//Radar chart will render information for a selected company in the
//list. Selection can also be done via clicking on the bars in the series.
var radarChart = Ext.create('Ext.chart.Chart', {
margin : '0 0 0 0',
insetPadding : 20,
flex : 1.2,
animate : true,
store : chs,
axes : [{
steps : 5,
type : 'Radial',
position : 'radial',
maximum : 100
}],
series : [{
type : 'radar',
xField : 'Name',
yField : 'Data',
showInLegend : false,
showMarkers : true,
markerConfig : {
radius : 4,
size : 4
},
style : {
fill : 'rgb(194,214,240)',
opacity : 0.5,
'stroke-width' : 0.5
}
}]
});
//create a grid that will list the dataset items.
var gridPanel = Ext.create('Ext.grid.Panel', {
id : 'company-form',
flex : 0.60,
store : ds,
title : 'Company Data',
requires : ['Ext.ux.grid.filter.*'],
features : [{
ftype : 'filters',
local : true
}],
dockedItems : [{
xtype : 'toolbar',
items : [{
xtype : 'combo',
queryMode : 'local',
store : ds,
displayField : 'company',
listeners : {
change : function(me, newVal, oldVal, eOpts) {
console.log(me.getStore());
me.getStore().filter("company", newVal);
}
}
}, {
xtype: 'button',
text: 'reset',
handler: function(me){
console.log("click");
me.up('toolbar').down('combo').getStore().clearFilter();
}
}]
}],
columns : [{
id : 'company',
text : 'Company',
flex : 1,
filterable : true,
sortable : true,
dataIndex : 'company',
renderer : function(value, metaData, record, rowIndex, colIndex, store, view) {
if (record.get("price") > 50) {
metaData.style = "background-color:green;";
return '<span style="font-weight:bolder;">' + value + '</span>';
} else if (record.get("price") < 25) {
metaData.style = "background-color:red;";
return '<span style="font-weight:bolder;">' + value + '</span>';
} else {
metaData.style = "background-color:blue;";
}
return '<span style="font-weight:bolder;color:white;">' + value + '</span>';
}
}, {
text : 'Price',
width : 75,
sortable : true,
dataIndex : 'price',
align : 'right',
renderer : function(value, metaData, record, rowIndex, colIndex, store, view) {
if (value > 50) {
metaData.style = "";
return '<span style="color:green;font-weight:bolder;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
} else if (value < 25) {
return '<span style="color:red;font-weight:bolder;">' + Ext.util.Format.currency(value, ' $', 2, true) + '</span>';
| perc | identifier_name | |
voice_recognition.py | 1.03, -0.50],
'right': [0.08, -1.0, 1.19, 1.94, -0.67, 1.03, 0.50]
}
}
self._collide_lsub = rospy.Subscriber(
'robot/limb/left/collision_avoidance_state',
CollisionAvoidanceState,
self._update_collision, 'left')
self._collide_rsub = rospy.Subscriber(
'robot/limb/right/collision_avoidance_state',
CollisionAvoidanceState,
self._update_collision, 'right')
self._disable_pub = {
'left': rospy.Publisher(
'robot/limb/left/suppress_collision_avoidance',
Empty, queue_size=10),
'right': rospy.Publisher(
'robot/limb/right/suppress_collision_avoidance',
Empty, queue_size=10)
}
self._rs = baxter_interface.RobotEnable(CHECK_VERSION)
self._enable_pub = rospy.Publisher('robot/set_super_enable',
Bool, queue_size=10)
def _update_collision(self, data, limb):
self._arm_state['collide'][limb] = len(data.collision_object) > 0
self._check_arm_state()
def _check_arm_state(self):
"""
Check for goals and behind collision field.
If s1 joint is over the peak, collision will need to be disabled
to get the arm around the head-arm collision force-field.
"""
diff_check = lambda a, b: abs(a - b) <= self._tuck_threshold
for limb in self._limbs:
angles = [self._arms[limb].joint_angle(joint)
for joint in self._arms[limb].joint_names()]
# Check if in a goal position
untuck_goal = map(diff_check, angles,
self._joint_moves['untuck'][limb])
tuck_goal = map(diff_check, angles[0:2],
self._joint_moves['tuck'][limb][0:2])
if all(untuck_goal):
self._arm_state['tuck'][limb] = 'untuck'
elif all(tuck_goal):
self._arm_state['tuck'][limb] = 'tuck'
else:
self._arm_state['tuck'][limb] = 'none'
# Check if shoulder is flipped over peak
self._arm_state['flipped'][limb] = (
self._arms[limb].joint_angle(limb + '_s1') <= self._peak_angle)
def _prepare_to_tuck(self):
# If arms are in "tucked" state, disable collision avoidance
# before enabling robot, to avoid arm jerking from "force-field".
head = baxter_interface.Head()
start_disabled = not self._rs.state().enabled
at_goal = lambda: (abs(head.pan()) <=
baxter_interface.settings.HEAD_PAN_ANGLE_TOLERANCE)
rospy.loginfo("Moving head to neutral position")
while not at_goal() and not rospy.is_shutdown():
if start_disabled:
[pub.publish(Empty()) for pub in self._disable_pub.values()]
if not self._rs.state().enabled:
self._enable_pub.publish(True)
head.set_pan(0.0, 50.0, timeout=0)
self._tuck_rate.sleep()
if start_disabled:
while self._rs.state().enabled == True and not rospy.is_shutdown():
[pub.publish(Empty()) for pub in self._disable_pub.values()]
self._enable_pub.publish(False)
self._tuck_rate.sleep()
def _move_to(self, tuck, disabled):
if any(disabled.values()):
[pub.publish(Empty()) for pub in self._disable_pub.values()]
while (any(self._arm_state['tuck'][limb] != goal
for limb, goal in tuck.viewitems())
and not rospy.is_shutdown()):
if self._rs.state().enabled == False:
self._enable_pub.publish(True)
for limb in self._limbs:
if disabled[limb]:
self._disable_pub[limb].publish(Empty())
if limb in tuck:
self._arms[limb].set_joint_positions(dict(zip(
self._arms[limb].joint_names(),
self._joint_moves[tuck[limb]][limb])))
self._check_arm_state()
self._tuck_rate.sleep()
if any(self._arm_state['collide'].values()):
self._rs.disable()
return
def supervised_tuck(self):
# Update our starting state to check if arms are tucked
self._prepare_to_tuck()
self._check_arm_state()
# Tuck Arms
if self._tuck == True:
# If arms are already tucked, report this to user and exit.
if all(self._arm_state['tuck'][limb] == 'tuck'
for limb in self._limbs):
rospy.loginfo("Tucking: Arms already in 'Tucked' position.")
self._done = True
return
else:
rospy.loginfo("Tucking: One or more arms not Tucked.")
any_flipped = not all(self._arm_state['flipped'].values())
if any_flipped:
rospy.loginfo(
"Moving to neutral start position with collision %s.",
"on" if any_flipped else "off")
# Move to neutral pose before tucking arms to avoid damage
self._check_arm_state()
actions = dict()
disabled = {'left': True, 'right': True}
for limb in self._limbs:
if not self._arm_state['flipped'][limb]:
actions[limb] = 'untuck'
disabled[limb] = False
self._move_to(actions, disabled)
# Disable collision and Tuck Arms
rospy.loginfo("Tucking: Tucking with collision avoidance off.")
actions = {'left': 'tuck', 'right': 'tuck'}
disabled = {'left': True, 'right': True}
self._move_to(actions, disabled)
self._done = True
return
# Untuck Arms
else:
# If arms are tucked disable collision and untuck arms
if any(self._arm_state['flipped'].values()):
rospy.loginfo("Untucking: One or more arms Tucked;"
" Disabling Collision Avoidance and untucking.")
self._check_arm_state()
suppress = deepcopy(self._arm_state['flipped'])
actions = {'left': 'untuck', 'right': 'untuck'}
self._move_to(actions, suppress)
self._done = True
return
# If arms already untucked, move to neutral location
else:
rospy.loginfo("Untucking: Arms already Untucked;"
" Moving to neutral position.")
self._check_arm_state()
suppress = deepcopy(self._arm_state['flipped'])
actions = {'left': 'untuck', 'right': 'untuck'}
self._move_to(actions, suppress)
self._done = True
return
def clean_shutdown(self):
"""Handles ROS shutdown (Ctrl-C) safely."""
if not self._done:
rospy.logwarn('Aborting: Shutting down safely...')
if any(self._arm_state['collide'].values()):
while self._rs.state().enabled != False:
[pub.publish(Empty()) for pub in self._disable_pub.values()]
self._enable_pub.publish(False)
self._tuck_rate.sleep()
#------------------------------------------------------------------#
def enable_robot(act):
#rospy.init_node('rsdk_robot_enable')
rs = baxter_interface.RobotEnable(CHECK_VERSION)
if act == 'state':
print rs.state()
elif act == 'enable':
rs.enable()
elif act == 'disable':
rs.disable()
elif act == 'reset':
rs.reset()
elif act == 'stop':
rs.stop()
return 0
#------------------------------------------------------------------#
def speak(x):
rospy.wait_for_service('ros_mary')
try:
add_two_ints = rospy.ServiceProxy('ros_mary',ros_mary)
resp1 = add_two_ints(x)
except rospy.ServiceException, e:
print "Service call failed: %s"%e
#------------------------------------------------------------------#
speech = gapi.Speech('sp')
if len(sys.argv)==2:
if sys.argv[1] in gapi.languages.keys():
speech.lang = gapi.languages[sys.argv[1]]
elif sys.argv[1] in gapi.languages.values():
speech.lang = sys.argv[1]
def handler(fileName):
global speech
translator = gapi.Translator(speech.lang, 'en-uk')
try:
cfileName = psw.convert(fileName)
phrase = speech.getText(cfileName)
import os
os.remove(fileName)
os.remove(cfileName)
all_words = phrase.split(' ')
words = phrase.split(' ')
for i in range(len(words)):
words[i] = str(words[i])
all_words[i] = str(all_words[i])
print all_words[i]
print 'the phrase is:',phrase
if 'wake' in words:
| speak('Ready to work!, sir.')
Tuck_arms(False) | conditional_block | |
voice_recognition.py |
self._limbs = ('left', 'right')
self._arms = {
'left': baxter_interface.Limb('left'),
'right': baxter_interface.Limb('right'),
}
self._tuck = tuck_cmd
self._tuck_rate = rospy.Rate(20.0) # Hz
self._tuck_threshold = 0.2 # radians
self._peak_angle = -1.6 # radians
self._arm_state = {
'tuck': {'left': 'none', 'right': 'none'},
'collide': {'left': False, 'right': False},
'flipped': {'left': False, 'right': False}
}
self._joint_moves = {
'tuck': {
'left': [-1.0, -2.07, 3.0, 2.55, 0.0, 0.01, 0.0],
'right': [1.0, -2.07, -3.0, 2.55, -0.0, 0.01, 0.0]
},
'untuck': {
'left': [-0.08, -1.0, -1.19, 1.94, 0.67, 1.03, -0.50],
'right': [0.08, -1.0, 1.19, 1.94, -0.67, 1.03, 0.50]
}
}
self._collide_lsub = rospy.Subscriber(
'robot/limb/left/collision_avoidance_state',
CollisionAvoidanceState,
self._update_collision, 'left')
self._collide_rsub = rospy.Subscriber(
'robot/limb/right/collision_avoidance_state',
CollisionAvoidanceState,
self._update_collision, 'right')
self._disable_pub = {
'left': rospy.Publisher(
'robot/limb/left/suppress_collision_avoidance',
Empty, queue_size=10),
'right': rospy.Publisher(
'robot/limb/right/suppress_collision_avoidance',
Empty, queue_size=10)
}
self._rs = baxter_interface.RobotEnable(CHECK_VERSION)
self._enable_pub = rospy.Publisher('robot/set_super_enable',
Bool, queue_size=10)
def _update_collision(self, data, limb):
self._arm_state['collide'][limb] = len(data.collision_object) > 0
self._check_arm_state()
def _check_arm_state(self):
"""
Check for goals and behind collision field.
If s1 joint is over the peak, collision will need to be disabled
to get the arm around the head-arm collision force-field.
"""
diff_check = lambda a, b: abs(a - b) <= self._tuck_threshold
for limb in self._limbs:
angles = [self._arms[limb].joint_angle(joint)
for joint in self._arms[limb].joint_names()]
# Check if in a goal position
untuck_goal = map(diff_check, angles,
self._joint_moves['untuck'][limb])
tuck_goal = map(diff_check, angles[0:2],
self._joint_moves['tuck'][limb][0:2])
if all(untuck_goal):
self._arm_state['tuck'][limb] = 'untuck'
elif all(tuck_goal):
self._arm_state['tuck'][limb] = 'tuck'
else:
self._arm_state['tuck'][limb] = 'none'
# Check if shoulder is flipped over peak
self._arm_state['flipped'][limb] = (
self._arms[limb].joint_angle(limb + '_s1') <= self._peak_angle)
def _prepare_to_tuck(self):
# If arms are in "tucked" state, disable collision avoidance
# before enabling robot, to avoid arm jerking from "force-field".
head = baxter_interface.Head()
start_disabled = not self._rs.state().enabled
at_goal = lambda: (abs(head.pan()) <=
baxter_interface.settings.HEAD_PAN_ANGLE_TOLERANCE)
rospy.loginfo("Moving head to neutral position")
while not at_goal() and not rospy.is_shutdown():
if start_disabled:
[pub.publish(Empty()) for pub in self._disable_pub.values()]
if not self._rs.state().enabled:
self._enable_pub.publish(True)
head.set_pan(0.0, 50.0, timeout=0)
self._tuck_rate.sleep()
if start_disabled:
while self._rs.state().enabled == True and not rospy.is_shutdown():
[pub.publish(Empty()) for pub in self._disable_pub.values()]
self._enable_pub.publish(False)
self._tuck_rate.sleep()
def _move_to(self, tuck, disabled):
if any(disabled.values()):
[pub.publish(Empty()) for pub in self._disable_pub.values()]
while (any(self._arm_state['tuck'][limb] != goal
for limb, goal in tuck.viewitems())
and not rospy.is_shutdown()):
if self._rs.state().enabled == False:
self._enable_pub.publish(True)
for limb in self._limbs:
if disabled[limb]:
self._disable_pub[limb].publish(Empty())
if limb in tuck:
self._arms[limb].set_joint_positions(dict(zip(
self._arms[limb].joint_names(),
self._joint_moves[tuck[limb]][limb])))
self._check_arm_state()
self._tuck_rate.sleep()
if any(self._arm_state['collide'].values()):
self._rs.disable()
return
def supervised_tuck(self):
# Update our starting state to check if arms are tucked
self._prepare_to_tuck()
self._check_arm_state()
# Tuck Arms
if self._tuck == True:
# If arms are already tucked, report this to user and exit.
if all(self._arm_state['tuck'][limb] == 'tuck'
for limb in self._limbs):
rospy.loginfo("Tucking: Arms already in 'Tucked' position.")
self._done = True
return
else:
rospy.loginfo("Tucking: One or more arms not Tucked.")
any_flipped = not all(self._arm_state['flipped'].values())
if any_flipped:
rospy.loginfo(
"Moving to neutral start position with collision %s.",
"on" if any_flipped else "off")
# Move to neutral pose before tucking arms to avoid damage
self._check_arm_state()
actions = dict()
disabled = {'left': True, 'right': True}
for limb in self._limbs:
if not self._arm_state['flipped'][limb]:
actions[limb] = 'untuck'
disabled[limb] = False
self._move_to(actions, disabled)
# Disable collision and Tuck Arms
rospy.loginfo("Tucking: Tucking with collision avoidance off.")
actions = {'left': 'tuck', 'right': 'tuck'}
disabled = {'left': True, 'right': True}
self._move_to(actions, disabled)
self._done = True
return
# Untuck Arms
else:
# If arms are tucked disable collision and untuck arms
if any(self._arm_state['flipped'].values()):
rospy.loginfo("Untucking: One or more arms Tucked;"
" Disabling Collision Avoidance and untucking.")
self._check_arm_state()
suppress = deepcopy(self._arm_state['flipped']) | else:
rospy.loginfo("Untucking: Arms already Untucked;"
" Moving to neutral position.")
self._check_arm_state()
suppress = deepcopy(self._arm_state['flipped'])
actions = {'left': 'untuck', 'right': 'untuck'}
self._move_to(actions, suppress)
self._done = True
return
def clean_shutdown(self):
"""Handles ROS shutdown (Ctrl-C) safely."""
if not self._done:
rospy.logwarn('Aborting: Shutting down safely...')
if any(self._arm_state['collide'].values()):
while self._rs.state().enabled != False:
[pub.publish(Empty()) for pub in self._disable_pub.values()]
self._enable_pub.publish(False)
self._tuck_rate.sleep()
#------------------------------------------------------------------#
def enable_robot(act):
#rospy.init_node('rsdk_robot_enable')
rs = baxter_interface.RobotEnable(CHECK_VERSION)
if act == 'state':
print rs.state()
elif act == 'enable':
rs.enable()
elif act == 'disable':
rs.disable()
| actions = {'left': 'untuck', 'right': 'untuck'}
self._move_to(actions, suppress)
self._done = True
return
# If arms already untucked, move to neutral location | random_line_split |
voice_recognition.py | self._limbs = ('left', 'right')
self._arms = {
'left': baxter_interface.Limb('left'),
'right': baxter_interface.Limb('right'),
}
self._tuck = tuck_cmd
self._tuck_rate = rospy.Rate(20.0) # Hz
self._tuck_threshold = 0.2 # radians
self._peak_angle = -1.6 # radians
self._arm_state = {
'tuck': {'left': 'none', 'right': 'none'},
'collide': {'left': False, 'right': False},
'flipped': {'left': False, 'right': False}
}
self._joint_moves = {
'tuck': {
'left': [-1.0, -2.07, 3.0, 2.55, 0.0, 0.01, 0.0],
'right': [1.0, -2.07, -3.0, 2.55, -0.0, 0.01, 0.0]
},
'untuck': {
'left': [-0.08, -1.0, -1.19, 1.94, 0.67, 1.03, -0.50],
'right': [0.08, -1.0, 1.19, 1.94, -0.67, 1.03, 0.50]
}
}
self._collide_lsub = rospy.Subscriber(
'robot/limb/left/collision_avoidance_state',
CollisionAvoidanceState,
self._update_collision, 'left')
self._collide_rsub = rospy.Subscriber(
'robot/limb/right/collision_avoidance_state',
CollisionAvoidanceState,
self._update_collision, 'right')
self._disable_pub = {
'left': rospy.Publisher(
'robot/limb/left/suppress_collision_avoidance',
Empty, queue_size=10),
'right': rospy.Publisher(
'robot/limb/right/suppress_collision_avoidance',
Empty, queue_size=10)
}
self._rs = baxter_interface.RobotEnable(CHECK_VERSION)
self._enable_pub = rospy.Publisher('robot/set_super_enable',
Bool, queue_size=10)
def _update_collision(self, data, limb):
|
def _check_arm_state(self):
"""
Check for goals and behind collision field.
If s1 joint is over the peak, collision will need to be disabled
to get the arm around the head-arm collision force-field.
"""
diff_check = lambda a, b: abs(a - b) <= self._tuck_threshold
for limb in self._limbs:
angles = [self._arms[limb].joint_angle(joint)
for joint in self._arms[limb].joint_names()]
# Check if in a goal position
untuck_goal = map(diff_check, angles,
self._joint_moves['untuck'][limb])
tuck_goal = map(diff_check, angles[0:2],
self._joint_moves['tuck'][limb][0:2])
if all(untuck_goal):
self._arm_state['tuck'][limb] = 'untuck'
elif all(tuck_goal):
self._arm_state['tuck'][limb] = 'tuck'
else:
self._arm_state['tuck'][limb] = 'none'
# Check if shoulder is flipped over peak
self._arm_state['flipped'][limb] = (
self._arms[limb].joint_angle(limb + '_s1') <= self._peak_angle)
def _prepare_to_tuck(self):
# If arms are in "tucked" state, disable collision avoidance
# before enabling robot, to avoid arm jerking from "force-field".
head = baxter_interface.Head()
start_disabled = not self._rs.state().enabled
at_goal = lambda: (abs(head.pan()) <=
baxter_interface.settings.HEAD_PAN_ANGLE_TOLERANCE)
rospy.loginfo("Moving head to neutral position")
while not at_goal() and not rospy.is_shutdown():
if start_disabled:
[pub.publish(Empty()) for pub in self._disable_pub.values()]
if not self._rs.state().enabled:
self._enable_pub.publish(True)
head.set_pan(0.0, 50.0, timeout=0)
self._tuck_rate.sleep()
if start_disabled:
while self._rs.state().enabled == True and not rospy.is_shutdown():
[pub.publish(Empty()) for pub in self._disable_pub.values()]
self._enable_pub.publish(False)
self._tuck_rate.sleep()
def _move_to(self, tuck, disabled):
if any(disabled.values()):
[pub.publish(Empty()) for pub in self._disable_pub.values()]
while (any(self._arm_state['tuck'][limb] != goal
for limb, goal in tuck.viewitems())
and not rospy.is_shutdown()):
if self._rs.state().enabled == False:
self._enable_pub.publish(True)
for limb in self._limbs:
if disabled[limb]:
self._disable_pub[limb].publish(Empty())
if limb in tuck:
self._arms[limb].set_joint_positions(dict(zip(
self._arms[limb].joint_names(),
self._joint_moves[tuck[limb]][limb])))
self._check_arm_state()
self._tuck_rate.sleep()
if any(self._arm_state['collide'].values()):
self._rs.disable()
return
def supervised_tuck(self):
# Update our starting state to check if arms are tucked
self._prepare_to_tuck()
self._check_arm_state()
# Tuck Arms
if self._tuck == True:
# If arms are already tucked, report this to user and exit.
if all(self._arm_state['tuck'][limb] == 'tuck'
for limb in self._limbs):
rospy.loginfo("Tucking: Arms already in 'Tucked' position.")
self._done = True
return
else:
rospy.loginfo("Tucking: One or more arms not Tucked.")
any_flipped = not all(self._arm_state['flipped'].values())
if any_flipped:
rospy.loginfo(
"Moving to neutral start position with collision %s.",
"on" if any_flipped else "off")
# Move to neutral pose before tucking arms to avoid damage
self._check_arm_state()
actions = dict()
disabled = {'left': True, 'right': True}
for limb in self._limbs:
if not self._arm_state['flipped'][limb]:
actions[limb] = 'untuck'
disabled[limb] = False
self._move_to(actions, disabled)
# Disable collision and Tuck Arms
rospy.loginfo("Tucking: Tucking with collision avoidance off.")
actions = {'left': 'tuck', 'right': 'tuck'}
disabled = {'left': True, 'right': True}
self._move_to(actions, disabled)
self._done = True
return
# Untuck Arms
else:
# If arms are tucked disable collision and untuck arms
if any(self._arm_state['flipped'].values()):
rospy.loginfo("Untucking: One or more arms Tucked;"
" Disabling Collision Avoidance and untucking.")
self._check_arm_state()
suppress = deepcopy(self._arm_state['flipped'])
actions = {'left': 'untuck', 'right': 'untuck'}
self._move_to(actions, suppress)
self._done = True
return
# If arms already untucked, move to neutral location
else:
rospy.loginfo("Untucking: Arms already Untucked;"
" Moving to neutral position.")
self._check_arm_state()
suppress = deepcopy(self._arm_state['flipped'])
actions = {'left': 'untuck', 'right': 'untuck'}
self._move_to(actions, suppress)
self._done = True
return
def clean_shutdown(self):
"""Handles ROS shutdown (Ctrl-C) safely."""
if not self._done:
rospy.logwarn('Aborting: Shutting down safely...')
if any(self._arm_state['collide'].values()):
while self._rs.state().enabled != False:
[pub.publish(Empty()) for pub in self._disable_pub.values()]
self._enable_pub.publish(False)
self._tuck_rate.sleep()
#------------------------------------------------------------------#
def enable_robot(act):
#rospy.init_node('rsdk_robot_enable')
rs = baxter_interface.RobotEnable(CHECK_VERSION)
if act == 'state':
print rs.state()
elif act == 'enable':
rs.enable()
elif act == 'disable':
rs.disable | self._arm_state['collide'][limb] = len(data.collision_object) > 0
self._check_arm_state() | identifier_body |
voice_recognition.py | {
'tuck': {
'left': [-1.0, -2.07, 3.0, 2.55, 0.0, 0.01, 0.0],
'right': [1.0, -2.07, -3.0, 2.55, -0.0, 0.01, 0.0]
},
'untuck': {
'left': [-0.08, -1.0, -1.19, 1.94, 0.67, 1.03, -0.50],
'right': [0.08, -1.0, 1.19, 1.94, -0.67, 1.03, 0.50]
}
}
self._collide_lsub = rospy.Subscriber(
'robot/limb/left/collision_avoidance_state',
CollisionAvoidanceState,
self._update_collision, 'left')
self._collide_rsub = rospy.Subscriber(
'robot/limb/right/collision_avoidance_state',
CollisionAvoidanceState,
self._update_collision, 'right')
self._disable_pub = {
'left': rospy.Publisher(
'robot/limb/left/suppress_collision_avoidance',
Empty, queue_size=10),
'right': rospy.Publisher(
'robot/limb/right/suppress_collision_avoidance',
Empty, queue_size=10)
}
self._rs = baxter_interface.RobotEnable(CHECK_VERSION)
self._enable_pub = rospy.Publisher('robot/set_super_enable',
Bool, queue_size=10)
def _update_collision(self, data, limb):
self._arm_state['collide'][limb] = len(data.collision_object) > 0
self._check_arm_state()
def _check_arm_state(self):
"""
Check for goals and behind collision field.
If s1 joint is over the peak, collision will need to be disabled
to get the arm around the head-arm collision force-field.
"""
diff_check = lambda a, b: abs(a - b) <= self._tuck_threshold
for limb in self._limbs:
angles = [self._arms[limb].joint_angle(joint)
for joint in self._arms[limb].joint_names()]
# Check if in a goal position
untuck_goal = map(diff_check, angles,
self._joint_moves['untuck'][limb])
tuck_goal = map(diff_check, angles[0:2],
self._joint_moves['tuck'][limb][0:2])
if all(untuck_goal):
self._arm_state['tuck'][limb] = 'untuck'
elif all(tuck_goal):
self._arm_state['tuck'][limb] = 'tuck'
else:
self._arm_state['tuck'][limb] = 'none'
# Check if shoulder is flipped over peak
self._arm_state['flipped'][limb] = (
self._arms[limb].joint_angle(limb + '_s1') <= self._peak_angle)
def _prepare_to_tuck(self):
# If arms are in "tucked" state, disable collision avoidance
# before enabling robot, to avoid arm jerking from "force-field".
head = baxter_interface.Head()
start_disabled = not self._rs.state().enabled
at_goal = lambda: (abs(head.pan()) <=
baxter_interface.settings.HEAD_PAN_ANGLE_TOLERANCE)
rospy.loginfo("Moving head to neutral position")
while not at_goal() and not rospy.is_shutdown():
if start_disabled:
[pub.publish(Empty()) for pub in self._disable_pub.values()]
if not self._rs.state().enabled:
self._enable_pub.publish(True)
head.set_pan(0.0, 50.0, timeout=0)
self._tuck_rate.sleep()
if start_disabled:
while self._rs.state().enabled == True and not rospy.is_shutdown():
[pub.publish(Empty()) for pub in self._disable_pub.values()]
self._enable_pub.publish(False)
self._tuck_rate.sleep()
def _move_to(self, tuck, disabled):
if any(disabled.values()):
[pub.publish(Empty()) for pub in self._disable_pub.values()]
while (any(self._arm_state['tuck'][limb] != goal
for limb, goal in tuck.viewitems())
and not rospy.is_shutdown()):
if self._rs.state().enabled == False:
self._enable_pub.publish(True)
for limb in self._limbs:
if disabled[limb]:
self._disable_pub[limb].publish(Empty())
if limb in tuck:
self._arms[limb].set_joint_positions(dict(zip(
self._arms[limb].joint_names(),
self._joint_moves[tuck[limb]][limb])))
self._check_arm_state()
self._tuck_rate.sleep()
if any(self._arm_state['collide'].values()):
self._rs.disable()
return
def supervised_tuck(self):
# Update our starting state to check if arms are tucked
self._prepare_to_tuck()
self._check_arm_state()
# Tuck Arms
if self._tuck == True:
# If arms are already tucked, report this to user and exit.
if all(self._arm_state['tuck'][limb] == 'tuck'
for limb in self._limbs):
rospy.loginfo("Tucking: Arms already in 'Tucked' position.")
self._done = True
return
else:
rospy.loginfo("Tucking: One or more arms not Tucked.")
any_flipped = not all(self._arm_state['flipped'].values())
if any_flipped:
rospy.loginfo(
"Moving to neutral start position with collision %s.",
"on" if any_flipped else "off")
# Move to neutral pose before tucking arms to avoid damage
self._check_arm_state()
actions = dict()
disabled = {'left': True, 'right': True}
for limb in self._limbs:
if not self._arm_state['flipped'][limb]:
actions[limb] = 'untuck'
disabled[limb] = False
self._move_to(actions, disabled)
# Disable collision and Tuck Arms
rospy.loginfo("Tucking: Tucking with collision avoidance off.")
actions = {'left': 'tuck', 'right': 'tuck'}
disabled = {'left': True, 'right': True}
self._move_to(actions, disabled)
self._done = True
return
# Untuck Arms
else:
# If arms are tucked disable collision and untuck arms
if any(self._arm_state['flipped'].values()):
rospy.loginfo("Untucking: One or more arms Tucked;"
" Disabling Collision Avoidance and untucking.")
self._check_arm_state()
suppress = deepcopy(self._arm_state['flipped'])
actions = {'left': 'untuck', 'right': 'untuck'}
self._move_to(actions, suppress)
self._done = True
return
# If arms already untucked, move to neutral location
else:
rospy.loginfo("Untucking: Arms already Untucked;"
" Moving to neutral position.")
self._check_arm_state()
suppress = deepcopy(self._arm_state['flipped'])
actions = {'left': 'untuck', 'right': 'untuck'}
self._move_to(actions, suppress)
self._done = True
return
def clean_shutdown(self):
"""Handles ROS shutdown (Ctrl-C) safely."""
if not self._done:
rospy.logwarn('Aborting: Shutting down safely...')
if any(self._arm_state['collide'].values()):
while self._rs.state().enabled != False:
[pub.publish(Empty()) for pub in self._disable_pub.values()]
self._enable_pub.publish(False)
self._tuck_rate.sleep()
#------------------------------------------------------------------#
def enable_robot(act):
#rospy.init_node('rsdk_robot_enable')
rs = baxter_interface.RobotEnable(CHECK_VERSION)
if act == 'state':
print rs.state()
elif act == 'enable':
rs.enable()
elif act == 'disable':
rs.disable()
elif act == 'reset':
rs.reset()
elif act == 'stop':
rs.stop()
return 0
#------------------------------------------------------------------#
def speak(x):
rospy.wait_for_service('ros_mary')
try:
add_two_ints = rospy.ServiceProxy('ros_mary',ros_mary)
resp1 = add_two_ints(x)
except rospy.ServiceException, e:
print "Service call failed: %s"%e
#------------------------------------------------------------------#
speech = gapi.Speech('sp')
if len(sys.argv)==2:
if sys.argv[1] in gapi.languages.keys():
speech.lang = gapi.languages[sys.argv[1]]
elif sys.argv[1] in gapi.languages.values():
speech.lang = sys.argv[1]
def | handler | identifier_name | |
_criticizer_base.py | .")
@property
def inputs(self):
self.assert_sampled()
return self._inputs
@property
def representations_full(self) -> tfd.Distribution:
return self._representations_full
@property
def latents_full(self) -> tfd.Distribution:
return self._representations_full
@property
def factors_full(self) -> tf.Tensor:
return self._factors_full
@property
def original_factors_full(self) -> tf.Tensor:
return self._original_factors_full
@property
def representations(self):
r""" Return the learned latent representations `Distribution`
(i.e. the latent code) for training and testing """
self.assert_sampled()
return self._representations
@property
def latents(self):
r""" Return the learned latent representations `Distribution`
(i.e. the latent code) for training and testing """
self.assert_sampled()
return self._representations
@property
def representations_mean(self):
r""" Return the mean of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [z.mean().numpy() for z in self.representations]
@property
def representations_variance(self):
r""" Return the variance of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [z.variance().numpy() for z in self.representations]
def representations_sample(self, n=()):
r""" Return the mean of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [
z.sample(sample_shape=n, seed=self.randint).numpy()
for z in self.representations
]
@property
def reconstructions(self):
r""" Return the reconstructed `Distributions` of inputs for training and
testing """
self.assert_sampled()
return self._reconstructions
@property
def reconstructions_mean(self):
r""" Return the mean of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.mean().numpy() for j in i] for i in self._reconstructions]
@property
def reconstructions_variance(self):
r""" Return the variance of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.variance().numpy() for j in i] for i in self._reconstructions]
def reconstructions_sample(self, n=()):
r""" Return the mean of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.sample(sample_shape=n, seed=self.randint).numpy()
for j in i]
for i in self._reconstructions]
@property
def original_factors(self):
r""" Return the training and testing original factors, i.e. the factors
before discretizing """
self.assert_sampled()
# the original factors is the same for all samples set
return self._original_factors
@property
def n_factors(self):
return self.factors[0].shape[1]
@property
def n_representations(self):
r""" return the number of latent codes """
return self.representations[0].event_shape[0]
@property
def n_codes(self):
r""" same as `n_representations`, return the number of latent codes """
return self.n_representations
@property
def n_train(self):
r""" Return number of samples for training """
return self.factors[0].shape[0]
@property
def n_test(self):
r""" Return number of samples for testing """
return self.factors[1].shape[0]
@property
def factors(self):
r""" Return the target variable (i.e. the factors of variation) for
training and testing """
self.assert_sampled()
return self._factors
@property
def factor_names(self):
self.assert_sampled()
# the dataset is unchanged, always at 0-th index
return np.array(self._factor_names)
@property
def code_names(self):
return np.array([f"Z{i}" for i in range(self.n_representations)])
@property
def random_state(self):
return self._rand
@property
def randint(self):
return self._rand.randint(1e8)
############## proxy to VAE methods
def index(self, factor_name):
r""" Return the column index of given factor_names within the
factor matrix """
return self._factor_names.index(str(factor_name))
def | (self, inputs, mask=None, sample_shape=()):
r""" Encode inputs to latent codes
Arguments:
inputs : a single Tensor or list of Tensor
Returns:
`tensorflow_probability.Distribution`, q(z|x) the latent distribution
"""
inputs = tf.nest.flatten(inputs)[:len(self._vae.encoder.inputs)]
latents = self._vae.encode(inputs[0] if len(inputs) == 1 else inputs,
training=False,
mask=mask,
sample_shape=sample_shape)
# only support single returned latent variable now
for z in tf.nest.flatten(latents):
assert isinstance(z, tfd.Distribution), \
"The latent code return from `vae.encode` must be instance of " + \
"tensorflow_probability.Distribution, but returned: %s" % \
str(z)
return latents
def decode(self, latents, mask=None, sample_shape=()):
r""" Decode the latents into reconstruction distribution """
outputs = self._vae.decode(latents,
training=False,
mask=mask,
sample_shape=sample_shape)
for o in tf.nest.flatten(outputs):
assert isinstance(o, tfd.Distribution), \
"vae decode method must return reconstruction distribution, but " + \
"returned: %s" % str(o)
return outputs
############## Experiment setup
def traversing(self,
indices=None,
min_val=-1.,
max_val=1.,
num=10,
n_samples=2,
mode='linear'):
r"""
Arguments:
indices : a list of Integer or None. The indices of latent code for
traversing. If None, all latent codes are used.
Return:
numpy.ndarray : traversed latent codes for training and testing,
the shape is `[len(indices) * n_samples * num, n_representations]`
"""
self.assert_sampled()
num = int(num)
n_samples = int(n_samples)
assert num > 1 and n_samples > 0, "num > 1 and n_samples > 0"
# ====== indices ====== #
if indices is None:
indices = list(range(self.n_representations))
else:
indices = [int(i) for i in tf.nest.flatten(indices)]
assert all(i < self.n_factors for i in indices), \
"There are %d factors, but the factor indices are: %s" % \
(self.n_factors, str(indices))
indices = np.array(indices)
# ====== check the mode ====== #
all_mode = ('quantile', 'linear')
mode = str(mode).strip().lower()
assert mode in all_mode, \
"Only support %s, but given mode='%s'" % (str(all_mode), mode)
# ====== helpers ====== #
def _traverse(z):
sampled_indices = self._rand.choice(z.shape[0],
size=int(n_samples),
replace=False)
Zs = []
for i in sampled_indices:
n = len(indices) * num
z_i = np.repeat(np.expand_dims(z[i], 0), n, axis=0)
for j, idx in enumerate(indices):
start = j * num
end = (j + 1) * num
# linear
if mode == 'linear':
z_i[start:end, idx] = np.linspace(min_val, max_val, num)
# Gaussian quantile
elif mode == 'quantile':
base_code = z_i[0, idx]
print(base_code)
exit()
# Gaussian linear
elif mode == '':
raise NotImplementedError
Zs.append(z_i)
Zs = np.concatenate(Zs, axis=0)
return Zs, sampled_indices
# ====== traverse through latent space ====== #
z_train, z_test = self.representations_mean
z_train, train_ids = _traverse(z_train)
z_test, test_ids = _traverse(z_test)
return z_train, z_test
def conditioning(self, known={}, logical_not=False, n_samples=None):
r""" Conditioning the sampled dataset on known factors
Arguments:
known : a mapping from index or name of factor to a callable, the
callable must return a list of boolean indices, which indicates
the samples to be selected
logical_not : a Boolean, if True applying the opposed conditioning
of the known factors
n_samples : an Integer (Optional), maximum number of selected samples.
Return:
a new `Criticizer` with the conditioned data and representations
Example:
```
# conditioning on: (1st-factor > 2) and (2nd-factor == | encode | identifier_name |
_criticizer_base.py | representations.")
@property
def inputs(self):
self.assert_sampled()
return self._inputs
@property
def representations_full(self) -> tfd.Distribution:
return self._representations_full
@property
def latents_full(self) -> tfd.Distribution:
return self._representations_full
@property
def factors_full(self) -> tf.Tensor:
return self._factors_full
@property
def original_factors_full(self) -> tf.Tensor:
return self._original_factors_full
@property
def representations(self):
r""" Return the learned latent representations `Distribution`
(i.e. the latent code) for training and testing """
self.assert_sampled()
return self._representations
@property
def latents(self):
r""" Return the learned latent representations `Distribution`
(i.e. the latent code) for training and testing """
self.assert_sampled()
return self._representations
@property
def representations_mean(self):
r""" Return the mean of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [z.mean().numpy() for z in self.representations]
@property
def representations_variance(self):
r""" Return the variance of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [z.variance().numpy() for z in self.representations]
def representations_sample(self, n=()):
r""" Return the mean of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [
z.sample(sample_shape=n, seed=self.randint).numpy()
for z in self.representations
]
@property
def reconstructions(self):
r""" Return the reconstructed `Distributions` of inputs for training and
testing """
self.assert_sampled()
return self._reconstructions
@property
def reconstructions_mean(self):
r""" Return the mean of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.mean().numpy() for j in i] for i in self._reconstructions]
@property
def reconstructions_variance(self):
r""" Return the variance of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.variance().numpy() for j in i] for i in self._reconstructions]
def reconstructions_sample(self, n=()):
r""" Return the mean of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.sample(sample_shape=n, seed=self.randint).numpy()
for j in i]
for i in self._reconstructions]
@property
def original_factors(self):
r""" Return the training and testing original factors, i.e. the factors
before discretizing """
self.assert_sampled()
# the original factors is the same for all samples set
return self._original_factors
@property
def n_factors(self):
return self.factors[0].shape[1]
@property
def n_representations(self):
r""" return the number of latent codes """
return self.representations[0].event_shape[0]
@property
def n_codes(self):
r""" same as `n_representations`, return the number of latent codes """
return self.n_representations
@property
def n_train(self):
r""" Return number of samples for training """
return self.factors[0].shape[0]
@property
def n_test(self):
r""" Return number of samples for testing """
return self.factors[1].shape[0]
@property
def factors(self):
r""" Return the target variable (i.e. the factors of variation) for
training and testing """
self.assert_sampled()
return self._factors
@property
def factor_names(self):
self.assert_sampled()
# the dataset is unchanged, always at 0-th index
return np.array(self._factor_names)
@property
def code_names(self):
return np.array([f"Z{i}" for i in range(self.n_representations)])
@property
def random_state(self):
return self._rand
@property
def randint(self):
return self._rand.randint(1e8)
############## proxy to VAE methods
def index(self, factor_name):
r""" Return the column index of given factor_names within the
factor matrix """
return self._factor_names.index(str(factor_name))
def encode(self, inputs, mask=None, sample_shape=()):
r""" Encode inputs to latent codes
Arguments:
inputs : a single Tensor or list of Tensor
Returns:
`tensorflow_probability.Distribution`, q(z|x) the latent distribution
"""
inputs = tf.nest.flatten(inputs)[:len(self._vae.encoder.inputs)]
latents = self._vae.encode(inputs[0] if len(inputs) == 1 else inputs,
training=False,
mask=mask,
sample_shape=sample_shape) | for z in tf.nest.flatten(latents):
assert isinstance(z, tfd.Distribution), \
"The latent code return from `vae.encode` must be instance of " + \
"tensorflow_probability.Distribution, but returned: %s" % \
str(z)
return latents
def decode(self, latents, mask=None, sample_shape=()):
r""" Decode the latents into reconstruction distribution """
outputs = self._vae.decode(latents,
training=False,
mask=mask,
sample_shape=sample_shape)
for o in tf.nest.flatten(outputs):
assert isinstance(o, tfd.Distribution), \
"vae decode method must return reconstruction distribution, but " + \
"returned: %s" % str(o)
return outputs
############## Experiment setup
def traversing(self,
indices=None,
min_val=-1.,
max_val=1.,
num=10,
n_samples=2,
mode='linear'):
r"""
Arguments:
indices : a list of Integer or None. The indices of latent code for
traversing. If None, all latent codes are used.
Return:
numpy.ndarray : traversed latent codes for training and testing,
the shape is `[len(indices) * n_samples * num, n_representations]`
"""
self.assert_sampled()
num = int(num)
n_samples = int(n_samples)
assert num > 1 and n_samples > 0, "num > 1 and n_samples > 0"
# ====== indices ====== #
if indices is None:
indices = list(range(self.n_representations))
else:
indices = [int(i) for i in tf.nest.flatten(indices)]
assert all(i < self.n_factors for i in indices), \
"There are %d factors, but the factor indices are: %s" % \
(self.n_factors, str(indices))
indices = np.array(indices)
# ====== check the mode ====== #
all_mode = ('quantile', 'linear')
mode = str(mode).strip().lower()
assert mode in all_mode, \
"Only support %s, but given mode='%s'" % (str(all_mode), mode)
# ====== helpers ====== #
def _traverse(z):
sampled_indices = self._rand.choice(z.shape[0],
size=int(n_samples),
replace=False)
Zs = []
for i in sampled_indices:
n = len(indices) * num
z_i = np.repeat(np.expand_dims(z[i], 0), n, axis=0)
for j, idx in enumerate(indices):
start = j * num
end = (j + 1) * num
# linear
if mode == 'linear':
z_i[start:end, idx] = np.linspace(min_val, max_val, num)
# Gaussian quantile
elif mode == 'quantile':
base_code = z_i[0, idx]
print(base_code)
exit()
# Gaussian linear
elif mode == '':
raise NotImplementedError
Zs.append(z_i)
Zs = np.concatenate(Zs, axis=0)
return Zs, sampled_indices
# ====== traverse through latent space ====== #
z_train, z_test = self.representations_mean
z_train, train_ids = _traverse(z_train)
z_test, test_ids = _traverse(z_test)
return z_train, z_test
def conditioning(self, known={}, logical_not=False, n_samples=None):
r""" Conditioning the sampled dataset on known factors
Arguments:
known : a mapping from index or name of factor to a callable, the
callable must return a list of boolean indices, which indicates
the samples to be selected
logical_not : a Boolean, if True applying the opposed conditioning
of the known factors
n_samples : an Integer (Optional), maximum number of selected samples.
Return:
a new `Criticizer` with the conditioned data and representations
Example:
```
# conditioning on: (1st-factor > 2) and (2nd-factor == 3 | # only support single returned latent variable now | random_line_split |
_criticizer_base.py | .")
@property
def inputs(self):
self.assert_sampled()
return self._inputs
@property
def representations_full(self) -> tfd.Distribution:
|
@property
def latents_full(self) -> tfd.Distribution:
return self._representations_full
@property
def factors_full(self) -> tf.Tensor:
return self._factors_full
@property
def original_factors_full(self) -> tf.Tensor:
return self._original_factors_full
@property
def representations(self):
r""" Return the learned latent representations `Distribution`
(i.e. the latent code) for training and testing """
self.assert_sampled()
return self._representations
@property
def latents(self):
r""" Return the learned latent representations `Distribution`
(i.e. the latent code) for training and testing """
self.assert_sampled()
return self._representations
@property
def representations_mean(self):
r""" Return the mean of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [z.mean().numpy() for z in self.representations]
@property
def representations_variance(self):
r""" Return the variance of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [z.variance().numpy() for z in self.representations]
def representations_sample(self, n=()):
r""" Return the mean of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [
z.sample(sample_shape=n, seed=self.randint).numpy()
for z in self.representations
]
@property
def reconstructions(self):
r""" Return the reconstructed `Distributions` of inputs for training and
testing """
self.assert_sampled()
return self._reconstructions
@property
def reconstructions_mean(self):
r""" Return the mean of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.mean().numpy() for j in i] for i in self._reconstructions]
@property
def reconstructions_variance(self):
r""" Return the variance of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.variance().numpy() for j in i] for i in self._reconstructions]
def reconstructions_sample(self, n=()):
r""" Return the mean of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.sample(sample_shape=n, seed=self.randint).numpy()
for j in i]
for i in self._reconstructions]
@property
def original_factors(self):
r""" Return the training and testing original factors, i.e. the factors
before discretizing """
self.assert_sampled()
# the original factors is the same for all samples set
return self._original_factors
@property
def n_factors(self):
return self.factors[0].shape[1]
@property
def n_representations(self):
r""" return the number of latent codes """
return self.representations[0].event_shape[0]
@property
def n_codes(self):
r""" same as `n_representations`, return the number of latent codes """
return self.n_representations
@property
def n_train(self):
r""" Return number of samples for training """
return self.factors[0].shape[0]
@property
def n_test(self):
r""" Return number of samples for testing """
return self.factors[1].shape[0]
@property
def factors(self):
r""" Return the target variable (i.e. the factors of variation) for
training and testing """
self.assert_sampled()
return self._factors
@property
def factor_names(self):
self.assert_sampled()
# the dataset is unchanged, always at 0-th index
return np.array(self._factor_names)
@property
def code_names(self):
return np.array([f"Z{i}" for i in range(self.n_representations)])
@property
def random_state(self):
return self._rand
@property
def randint(self):
return self._rand.randint(1e8)
############## proxy to VAE methods
def index(self, factor_name):
r""" Return the column index of given factor_names within the
factor matrix """
return self._factor_names.index(str(factor_name))
def encode(self, inputs, mask=None, sample_shape=()):
r""" Encode inputs to latent codes
Arguments:
inputs : a single Tensor or list of Tensor
Returns:
`tensorflow_probability.Distribution`, q(z|x) the latent distribution
"""
inputs = tf.nest.flatten(inputs)[:len(self._vae.encoder.inputs)]
latents = self._vae.encode(inputs[0] if len(inputs) == 1 else inputs,
training=False,
mask=mask,
sample_shape=sample_shape)
# only support single returned latent variable now
for z in tf.nest.flatten(latents):
assert isinstance(z, tfd.Distribution), \
"The latent code return from `vae.encode` must be instance of " + \
"tensorflow_probability.Distribution, but returned: %s" % \
str(z)
return latents
def decode(self, latents, mask=None, sample_shape=()):
r""" Decode the latents into reconstruction distribution """
outputs = self._vae.decode(latents,
training=False,
mask=mask,
sample_shape=sample_shape)
for o in tf.nest.flatten(outputs):
assert isinstance(o, tfd.Distribution), \
"vae decode method must return reconstruction distribution, but " + \
"returned: %s" % str(o)
return outputs
############## Experiment setup
def traversing(self,
indices=None,
min_val=-1.,
max_val=1.,
num=10,
n_samples=2,
mode='linear'):
r"""
Arguments:
indices : a list of Integer or None. The indices of latent code for
traversing. If None, all latent codes are used.
Return:
numpy.ndarray : traversed latent codes for training and testing,
the shape is `[len(indices) * n_samples * num, n_representations]`
"""
self.assert_sampled()
num = int(num)
n_samples = int(n_samples)
assert num > 1 and n_samples > 0, "num > 1 and n_samples > 0"
# ====== indices ====== #
if indices is None:
indices = list(range(self.n_representations))
else:
indices = [int(i) for i in tf.nest.flatten(indices)]
assert all(i < self.n_factors for i in indices), \
"There are %d factors, but the factor indices are: %s" % \
(self.n_factors, str(indices))
indices = np.array(indices)
# ====== check the mode ====== #
all_mode = ('quantile', 'linear')
mode = str(mode).strip().lower()
assert mode in all_mode, \
"Only support %s, but given mode='%s'" % (str(all_mode), mode)
# ====== helpers ====== #
def _traverse(z):
sampled_indices = self._rand.choice(z.shape[0],
size=int(n_samples),
replace=False)
Zs = []
for i in sampled_indices:
n = len(indices) * num
z_i = np.repeat(np.expand_dims(z[i], 0), n, axis=0)
for j, idx in enumerate(indices):
start = j * num
end = (j + 1) * num
# linear
if mode == 'linear':
z_i[start:end, idx] = np.linspace(min_val, max_val, num)
# Gaussian quantile
elif mode == 'quantile':
base_code = z_i[0, idx]
print(base_code)
exit()
# Gaussian linear
elif mode == '':
raise NotImplementedError
Zs.append(z_i)
Zs = np.concatenate(Zs, axis=0)
return Zs, sampled_indices
# ====== traverse through latent space ====== #
z_train, z_test = self.representations_mean
z_train, train_ids = _traverse(z_train)
z_test, test_ids = _traverse(z_test)
return z_train, z_test
def conditioning(self, known={}, logical_not=False, n_samples=None):
r""" Conditioning the sampled dataset on known factors
Arguments:
known : a mapping from index or name of factor to a callable, the
callable must return a list of boolean indices, which indicates
the samples to be selected
logical_not : a Boolean, if True applying the opposed conditioning
of the known factors
n_samples : an Integer (Optional), maximum number of selected samples.
Return:
a new `Criticizer` with the conditioned data and representations
Example:
```
# conditioning on: (1st-factor > 2) and (2nd-factor == 3 | return self._representations_full | identifier_body |
_criticizer_base.py |
# main arguments
self._inputs = None
self._factors = None
self._original_factors = None
self._factor_names = None
self._representations = None
self._reconstructions = None
# concatenated train and test
self._representations_full = None
self._factors_full = None
self._original_factors_full = None
# others
self._rand = random_state
self._is_multi_latents = 0
@property
def is_multi_latents(self):
return self._is_multi_latents
@property
def is_sampled(self):
if self._factors is None or self._representations is None:
return False
return True
def assert_sampled(self):
if not self.is_sampled:
raise RuntimeError("Call the `sample_batch` method to sample mini-batch "
"of ground-truth data and learned representations.")
@property
def inputs(self):
self.assert_sampled()
return self._inputs
@property
def representations_full(self) -> tfd.Distribution:
return self._representations_full
@property
def latents_full(self) -> tfd.Distribution:
return self._representations_full
@property
def factors_full(self) -> tf.Tensor:
return self._factors_full
@property
def original_factors_full(self) -> tf.Tensor:
return self._original_factors_full
@property
def representations(self):
r""" Return the learned latent representations `Distribution`
(i.e. the latent code) for training and testing """
self.assert_sampled()
return self._representations
@property
def latents(self):
r""" Return the learned latent representations `Distribution`
(i.e. the latent code) for training and testing """
self.assert_sampled()
return self._representations
@property
def representations_mean(self):
r""" Return the mean of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [z.mean().numpy() for z in self.representations]
@property
def representations_variance(self):
r""" Return the variance of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [z.variance().numpy() for z in self.representations]
def representations_sample(self, n=()):
r""" Return the mean of learned representations distribution
(i.e. the latent code) for training and testing """
self.assert_sampled()
return [
z.sample(sample_shape=n, seed=self.randint).numpy()
for z in self.representations
]
@property
def reconstructions(self):
r""" Return the reconstructed `Distributions` of inputs for training and
testing """
self.assert_sampled()
return self._reconstructions
@property
def reconstructions_mean(self):
r""" Return the mean of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.mean().numpy() for j in i] for i in self._reconstructions]
@property
def reconstructions_variance(self):
r""" Return the variance of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.variance().numpy() for j in i] for i in self._reconstructions]
def reconstructions_sample(self, n=()):
r""" Return the mean of reconstructed distributions of inputs for
training and testing """
self.assert_sampled()
return [[j.sample(sample_shape=n, seed=self.randint).numpy()
for j in i]
for i in self._reconstructions]
@property
def original_factors(self):
r""" Return the training and testing original factors, i.e. the factors
before discretizing """
self.assert_sampled()
# the original factors is the same for all samples set
return self._original_factors
@property
def n_factors(self):
return self.factors[0].shape[1]
@property
def n_representations(self):
r""" return the number of latent codes """
return self.representations[0].event_shape[0]
@property
def n_codes(self):
r""" same as `n_representations`, return the number of latent codes """
return self.n_representations
@property
def n_train(self):
r""" Return number of samples for training """
return self.factors[0].shape[0]
@property
def n_test(self):
r""" Return number of samples for testing """
return self.factors[1].shape[0]
@property
def factors(self):
r""" Return the target variable (i.e. the factors of variation) for
training and testing """
self.assert_sampled()
return self._factors
@property
def factor_names(self):
self.assert_sampled()
# the dataset is unchanged, always at 0-th index
return np.array(self._factor_names)
@property
def code_names(self):
return np.array([f"Z{i}" for i in range(self.n_representations)])
@property
def random_state(self):
return self._rand
@property
def randint(self):
return self._rand.randint(1e8)
############## proxy to VAE methods
def index(self, factor_name):
r""" Return the column index of given factor_names within the
factor matrix """
return self._factor_names.index(str(factor_name))
def encode(self, inputs, mask=None, sample_shape=()):
r""" Encode inputs to latent codes
Arguments:
inputs : a single Tensor or list of Tensor
Returns:
`tensorflow_probability.Distribution`, q(z|x) the latent distribution
"""
inputs = tf.nest.flatten(inputs)[:len(self._vae.encoder.inputs)]
latents = self._vae.encode(inputs[0] if len(inputs) == 1 else inputs,
training=False,
mask=mask,
sample_shape=sample_shape)
# only support single returned latent variable now
for z in tf.nest.flatten(latents):
assert isinstance(z, tfd.Distribution), \
"The latent code return from `vae.encode` must be instance of " + \
"tensorflow_probability.Distribution, but returned: %s" % \
str(z)
return latents
def decode(self, latents, mask=None, sample_shape=()):
r""" Decode the latents into reconstruction distribution """
outputs = self._vae.decode(latents,
training=False,
mask=mask,
sample_shape=sample_shape)
for o in tf.nest.flatten(outputs):
assert isinstance(o, tfd.Distribution), \
"vae decode method must return reconstruction distribution, but " + \
"returned: %s" % str(o)
return outputs
############## Experiment setup
def traversing(self,
indices=None,
min_val=-1.,
max_val=1.,
num=10,
n_samples=2,
mode='linear'):
r"""
Arguments:
indices : a list of Integer or None. The indices of latent code for
traversing. If None, all latent codes are used.
Return:
numpy.ndarray : traversed latent codes for training and testing,
the shape is `[len(indices) * n_samples * num, n_representations]`
"""
self.assert_sampled()
num = int(num)
n_samples = int(n_samples)
assert num > 1 and n_samples > 0, "num > 1 and n_samples > 0"
# ====== indices ====== #
if indices is None:
indices = list(range(self.n_representations))
else:
indices = [int(i) for i in tf.nest.flatten(indices)]
assert all(i < self.n_factors for i in indices), \
"There are %d factors, but the factor indices are: %s" % \
(self.n_factors, str(indices))
indices = np.array(indices)
# ====== check the mode ====== #
all_mode = ('quantile', 'linear')
mode = str(mode).strip().lower()
assert mode in all_mode, \
"Only support %s, but given mode='%s'" % (str(all_mode), mode)
# ====== helpers ====== #
def _traverse(z):
sampled_indices = self._rand.choice(z.shape[0],
size=int(n_samples),
replace=False)
Zs = []
for i in sampled_indices:
n = len(indices) * num
z_i = np.repeat(np.expand_dims(z[i], 0), n, axis=0)
for j, idx in enumerate(indices):
start = j * num
end = (j + 1) * num
# linear
if mode == 'linear':
z_i[start:end, idx] = np.linspace(min_val, max_val, num)
# Gaussian quantile
elif mode == 'quantile':
base_code = z_i[0, idx]
print(base_code)
exit()
# Gaussian linear
elif mode == '':
raise NotImplementedError
Zs.append(z_i)
Zs = | random_state = np.random.RandomState(seed=random_state) | conditional_block | |
patterns.rs | 8..71 'any': fn any<&str>() -> &str
68..73 'any()': &str
74..76 '{}': ()
81..100 'if let...y() {}': ()
88..89 '1': i32
88..89 '1': i32
92..95 'any': fn any<i32>() -> i32
92..97 'any()': i32
98..100 '{}': ()
105..127 'if let...y() {}': ()
112..116 '1u32': u32
112..116 '1u32': u32
119..122 'any': fn any<u32>() -> u32
119..124 'any()': u32
125..127 '{}': ()
132..154 'if let...y() {}': ()
139..143 '1f32': f32
139..143 '1f32': f32
146..149 'any': fn any<f32>() -> f32
146..151 'any()': f32
152..154 '{}': ()
159..180 'if let...y() {}': ()
166..169 '1.0': f64
166..169 '1.0': f64
172..175 'any': fn any<f64>() -> f64
172..177 'any()': f64
178..180 '{}': ()
185..207 'if let...y() {}': ()
192..196 'true': bool
192..196 'true': bool
199..202 'any': fn any<bool>() -> bool
199..204 'any()': bool
205..207 '{}': ()
"###
);
}
#[test]
fn infer_range_pattern() | );
}
#[test]
fn infer_pattern_match_ergonomics() {
assert_snapshot!(
infer(r#"
struct A<T>(T);
fn test() {
let A(n) = &A(1);
let A(n) = &mut A(1);
}
"#),
@r###"
28..79 '{ ...(1); }': ()
38..42 'A(n)': A<i32>
40..41 'n': &i32
45..50 '&A(1)': &A<i32>
46..47 'A': A<i32>(i32) -> A<i32>
46..50 'A(1)': A<i32>
48..49 '1': i32
60..64 'A(n)': A<i32>
62..63 'n': &mut i32
67..76 '&mut A(1)': &mut A<i32>
72..73 'A': A<i32>(i32) -> A<i32>
72..76 'A(1)': A<i32>
74..75 '1': i32
"###
);
}
#[test]
fn infer_pattern_match_ergonomics_ref() {
mark::check!(match_ergonomics_ref);
assert_snapshot!(
infer(r#"
fn test() {
let v = &(1, &2);
let (_, &w) = v;
}
"#),
@r###"
11..57 '{ ...= v; }': ()
21..22 'v': &(i32, &i32)
25..33 '&(1, &2)': &(i32, &i32)
26..33 '(1, &2)': (i32, &i32)
27..28 '1': i32
30..32 '&2': &i32
31..32 '2': i32
43..50 '(_, &w)': (i32, &i32)
44..45 '_': i32
47..49 '&w': &i32
48..49 'w': i32
53..54 'v': &(i32, &i32)
"###
);
}
#[test]
fn infer_pattern_match_slice() {
assert_snapshot!(
infer(r#"
fn test() {
let slice: &[f64] = &[0.0];
match slice {
&[] => {},
&[a] => {
a;
},
&[b, c] => {
b;
c;
}
_ => {}
}
}
"#),
@r###"
11..210 '{ ... } }': ()
21..26 'slice': &[f64]
37..43 '&[0.0]': &[f64; _]
38..43 '[0.0]': [f64; _]
39..42 '0.0': f64
49..208 'match ... }': ()
55..60 'slice': &[f64]
71..74 '&[]': &[f64]
72..74 '[]': [f64]
78..80 '{}': ()
90..94 '&[a]': &[f64]
91..94 '[a]': [f64]
92..93 'a': f64
98..124 '{ ... }': ()
112..113 'a': f64
134..141 '&[b, c]': &[f64]
135..141 '[b, c]': [f64]
136..137 'b': f64
139..140 'c': f64
145..186 '{ ... }': ()
159..160 'b': f64
174..175 'c': f64
195..196 '_': &[f64]
200..202 '{}': ()
"###
);
}
#[test]
fn infer_pattern_match_arr() {
assert_snapshot!(
infer(r#"
fn test() {
let arr: [f64; 2] = [0.0, 1.0];
match arr {
[1.0, a] => {
a;
},
[b, c] => {
b;
c;
}
}
}
"#),
@r###"
11..180 '{ ... } }': ()
21..24 'arr': [f64; _]
37..47 '[0.0, 1.0]': [f64; _]
38..41 '0.0': f64
43..46 '1.0': f64
53..178 'match ... }': ()
59..62 'arr': | {
assert_snapshot!(
infer_with_mismatches(r#"
fn test(x: &i32) {
if let 1..76 = 2u32 {}
if let 1..=76 = 2u32 {}
}
"#, true),
@r###"
9..10 'x': &i32
18..76 '{ ...2 {} }': ()
24..46 'if let...u32 {}': ()
31..36 '1..76': u32
39..43 '2u32': u32
44..46 '{}': ()
51..74 'if let...u32 {}': ()
58..64 '1..=76': u32
67..71 '2u32': u32
72..74 '{}': ()
"### | identifier_body |
patterns.rs | 8..71 'any': fn any<&str>() -> &str
68..73 'any()': &str
74..76 '{}': ()
81..100 'if let...y() {}': ()
88..89 '1': i32
88..89 '1': i32
92..95 'any': fn any<i32>() -> i32
92..97 'any()': i32
98..100 '{}': ()
105..127 'if let...y() {}': ()
112..116 '1u32': u32
112..116 '1u32': u32
119..122 'any': fn any<u32>() -> u32
119..124 'any()': u32
125..127 '{}': ()
132..154 'if let...y() {}': ()
139..143 '1f32': f32
139..143 '1f32': f32
146..149 'any': fn any<f32>() -> f32
146..151 'any()': f32
152..154 '{}': ()
159..180 'if let...y() {}': ()
166..169 '1.0': f64
166..169 '1.0': f64
172..175 'any': fn any<f64>() -> f64
172..177 'any()': f64
178..180 '{}': ()
185..207 'if let...y() {}': ()
192..196 'true': bool
192..196 'true': bool
199..202 'any': fn any<bool>() -> bool
199..204 'any()': bool
205..207 '{}': ()
"###
);
}
#[test]
fn infer_range_pattern() {
assert_snapshot!(
infer_with_mismatches(r#"
fn test(x: &i32) {
if let 1..76 = 2u32 {}
if let 1..=76 = 2u32 {}
}
"#, true),
@r###"
9..10 'x': &i32
18..76 '{ ...2 {} }': ()
24..46 'if let...u32 {}': ()
31..36 '1..76': u32
39..43 '2u32': u32
44..46 '{}': ()
51..74 'if let...u32 {}': ()
58..64 '1..=76': u32
67..71 '2u32': u32
72..74 '{}': ()
"###
);
}
#[test]
fn infer_pattern_match_ergonomics() {
assert_snapshot!(
infer(r#"
struct A<T>(T);
fn test() {
let A(n) = &A(1);
let A(n) = &mut A(1);
}
"#),
@r###"
28..79 '{ ...(1); }': ()
38..42 'A(n)': A<i32>
40..41 'n': &i32
45..50 '&A(1)': &A<i32>
46..47 'A': A<i32>(i32) -> A<i32>
46..50 'A(1)': A<i32>
48..49 '1': i32
60..64 'A(n)': A<i32>
62..63 'n': &mut i32
67..76 '&mut A(1)': &mut A<i32>
72..73 'A': A<i32>(i32) -> A<i32>
72..76 'A(1)': A<i32>
74..75 '1': i32
"###
);
}
#[test]
fn | () {
mark::check!(match_ergonomics_ref);
assert_snapshot!(
infer(r#"
fn test() {
let v = &(1, &2);
let (_, &w) = v;
}
"#),
@r###"
11..57 '{ ...= v; }': ()
21..22 'v': &(i32, &i32)
25..33 '&(1, &2)': &(i32, &i32)
26..33 '(1, &2)': (i32, &i32)
27..28 '1': i32
30..32 '&2': &i32
31..32 '2': i32
43..50 '(_, &w)': (i32, &i32)
44..45 '_': i32
47..49 '&w': &i32
48..49 'w': i32
53..54 'v': &(i32, &i32)
"###
);
}
#[test]
fn infer_pattern_match_slice() {
assert_snapshot!(
infer(r#"
fn test() {
let slice: &[f64] = &[0.0];
match slice {
&[] => {},
&[a] => {
a;
},
&[b, c] => {
b;
c;
}
_ => {}
}
}
"#),
@r###"
11..210 '{ ... } }': ()
21..26 'slice': &[f64]
37..43 '&[0.0]': &[f64; _]
38..43 '[0.0]': [f64; _]
39..42 '0.0': f64
49..208 'match ... }': ()
55..60 'slice': &[f64]
71..74 '&[]': &[f64]
72..74 '[]': [f64]
78..80 '{}': ()
90..94 '&[a]': &[f64]
91..94 '[a]': [f64]
92..93 'a': f64
98..124 '{ ... }': ()
112..113 'a': f64
134..141 '&[b, c]': &[f64]
135..141 '[b, c]': [f64]
136..137 'b': f64
139..140 'c': f64
145..186 '{ ... }': ()
159..160 'b': f64
174..175 'c': f64
195..196 '_': &[f64]
200..202 '{}': ()
"###
);
}
#[test]
fn infer_pattern_match_arr() {
assert_snapshot!(
infer(r#"
fn test() {
let arr: [f64; 2] = [0.0, 1.0];
match arr {
[1.0, a] => {
a;
},
[b, c] => {
b;
c;
}
}
}
"#),
@r###"
11..180 '{ ... } }': ()
21..24 'arr': [f64; _]
37..47 '[0.0, 1.0]': [f64; _]
38..41 '0.0': f64
43..46 '1.0': f64
53..178 'match ... }': ()
59..62 'arr': | infer_pattern_match_ergonomics_ref | identifier_name |
patterns.rs | let (c, d) = (1, "hello");
for (e, f) in some_iter {
let g = e;
}
if let [val] = opt {
let h = val;
}
let lambda = |a: u64, b, c: i32| { a + b; c };
let ref ref_to_x = x;
let mut mut_x = x;
let ref mut mut_ref_to_x = x;
let k = mut_ref_to_x;
}
"#),
@r###"
9..10 'x': &i32
18..369 '{ ...o_x; }': ()
28..29 'y': &i32
32..33 'x': &i32
43..45 '&z': &i32
44..45 'z': i32
48..49 'x': &i32
59..60 'a': i32
63..64 'z': i32
74..80 '(c, d)': (i32, &str)
75..76 'c': i32
78..79 'd': &str
83..95 '(1, "hello")': (i32, &str)
84..85 '1': i32
87..94 '"hello"': &str
102..152 'for (e... }': ()
106..112 '(e, f)': ({unknown}, {unknown})
107..108 'e': {unknown}
110..111 'f': {unknown}
116..125 'some_iter': {unknown}
126..152 '{ ... }': ()
140..141 'g': {unknown}
144..145 'e': {unknown}
158..205 'if let... }': ()
165..170 '[val]': [{unknown}]
166..169 'val': {unknown}
173..176 'opt': [{unknown}]
177..205 '{ ... }': ()
191..192 'h': {unknown}
195..198 'val': {unknown}
215..221 'lambda': |u64, u64, i32| -> i32
224..256 '|a: u6...b; c }': |u64, u64, i32| -> i32
225..226 'a': u64
233..234 'b': u64
236..237 'c': i32
244..256 '{ a + b; c }': i32
246..247 'a': u64
246..251 'a + b': u64
250..251 'b': u64
253..254 'c': i32
267..279 'ref ref_to_x': &&i32
282..283 'x': &i32
293..302 'mut mut_x': &i32
305..306 'x': &i32
316..336 'ref mu...f_to_x': &mut &i32
339..340 'x': &i32
350..351 'k': &mut &i32
354..366 'mut_ref_to_x': &mut &i32
"###
);
}
#[test]
fn infer_literal_pattern() {
assert_snapshot!(
infer_with_mismatches(r#"
fn any<T>() -> T { loop {} }
fn test(x: &i32) {
if let "foo" = any() {}
if let 1 = any() {}
if let 1u32 = any() {}
if let 1f32 = any() {}
if let 1.0 = any() {}
if let true = any() {}
}
"#, true),
@r###"
18..29 '{ loop {} }': T
20..27 'loop {}': !
25..27 '{}': ()
38..39 'x': &i32
47..209 '{ ...) {} }': ()
53..76 'if let...y() {}': ()
60..65 '"foo"': &str
60..65 '"foo"': &str
68..71 'any': fn any<&str>() -> &str
68..73 'any()': &str
74..76 '{}': ()
81..100 'if let...y() {}': ()
88..89 '1': i32
88..89 '1': i32
92..95 'any': fn any<i32>() -> i32
92..97 'any()': i32
98..100 '{}': ()
105..127 'if let...y() {}': ()
112..116 '1u32': u32
112..116 '1u32': u32
119..122 'any': fn any<u32>() -> u32
119..124 'any()': u32
125..127 '{}': ()
132..154 'if let...y() {}': ()
139..143 '1f32': f32
139..143 '1f32': f32
146..149 'any': fn any<f32>() -> f32
146..151 'any()': f32
152..154 '{}': ()
159..180 'if let...y() {}': ()
166..169 '1.0': f64
166..169 '1.0': f64
172..175 'any': fn any<f64>() -> f64
172..177 'any()': f64
178..180 '{}': ()
185..207 'if let...y() {}': ()
192..196 'true': bool
192..196 'true': bool
199..202 'any': fn any<bool>() -> bool
199..204 'any()': bool
205..207 '{}': ()
"###
);
}
#[test]
fn infer_range_pattern() {
assert_snapshot!(
infer_with_mismatches(r#"
fn test(x: &i32) {
if let 1..76 = 2u32 {}
if let 1..=76 = 2u32 {}
}
"#, true),
@r###"
9..10 'x': &i32
18..76 '{ ...2 {} }': ()
24..46 'if let...u32 {}': ()
31..36 '1..76': u32
39..43 '2u32': u32
44..46 '{}': ()
51..74 'if let...u32 {}': ()
58..64 '1..=76': u32
67..71 '2u32': u32
72..74 '{}': ()
"###
);
}
#[test]
fn infer_pattern_match_ergonomics() {
assert_snapshot!(
infer(r#"
struct A<T>(T);
fn test() {
let A(n) = &A(1);
let A(n) = & | infer(r#"
fn test(x: &i32) {
let y = x;
let &z = x;
let a = z; | random_line_split | |
dual_encoder.py | (filename, vocab):
"""
Load glove vectors from a .txt file.
Optionally limit the vocabulary to save memory. `vocab` should be a set.
"""
dct = {}
vectors = array.array('d')
current_idx = 0
with codecs.open(filename, "r", encoding="utf-8") as f:
for _, line in enumerate(f):
tokens = line.split(" ")
word = tokens[0]
entries = tokens[1:]
if not vocab or word in vocab:
dct[word] = current_idx
vectors.extend(float(x) for x in entries)
current_idx += 1
word_dim = len(entries)
num_vectors = len(dct)
tf.logging.info("Found {} out of {} vectors in Glove".format(num_vectors, len(vocab)))
return [np.array(vectors).reshape(num_vectors, word_dim), dct]
def buildEMBMatrix(vocab_dict, glove_dict, glove_vectors, embedding_dim):
initial_embeddings = np.random.uniform(-0.25, 0.25, (len(vocab_dict), embedding_dim)).astype("float32")
for word, glove_word_idx in glove_dict.items():
word_idx = vocab_dict.get(word)
initial_embeddings[word_idx, :] = glove_vectors[glove_word_idx]
return initial_embeddings
FLAGS = tf.flags.FLAGS
def get_embeddings(hparams):
if hparams.glove_path and hparams.vocab_path:
tf.logging.info("Loading Glove embeddings...")
vocab_array, vocab_dict = loadVOCAB(hparams.vocab_path)
glove_vectors, glove_dict = loadGLOVE(hparams.glove_path, vocab=set(vocab_array))
initializer = buildEMBMatrix(vocab_dict, glove_dict, glove_vectors, hparams.embedding_dim)
else:
tf.logging.info("No glove/vocab path specificed, starting with random embeddings.")
initializer = tf.random_uniform_initializer(-0.25, 0.25)
return tf.get_variable("word_embeddings", shape=[hparams.vocab_size, hparams.embedding_dim],
initializer=initializer)
class DualEncoders:
|
logits = self.inference()
probs = tf.sigmoid(logits, name="probs_op")
losses = tf.nn.sigmoid_cross_entropy_with_logits(logits=logits, labels=tf.to_float(self.targets), name="CrossEntropy")
mean_loss = tf.reduce_mean(losses, name="Mean_CE_Loss")
train_op = tf.contrib.layers.optimize_loss(loss=mean_loss,
global_step=self.global_step,
learning_rate=self.learning_rate,
clip_gradients=self.hparams.max_grad_norm,
optimizer=hparams.optimizer)
ema = tf.train.ExponentialMovingAverage(decay=0.99)
mean_loss_ema_op = ema.apply([mean_loss])
with tf.control_dependencies([self.targets]): # update only when train targets passed
train_op_group = tf.group(train_op, mean_loss_ema_op)
self.probs_op = probs
self.train_loss_op = ema.average(mean_loss)
self.train_op = train_op_group
self.train_summaries = tf.summary.merge([tf.summary.scalar("loss", mean_loss),
tf.summary.scalar("learning_rate", self.learning_rate)])
self.val_probs, self.val_summary = self.validation_accuracy(probs, self.val_targets, mean_loss)
def inference(self):
W_emb = get_embeddings(self.hparams)
context_emb = tf.nn.embedding_lookup(W_emb, self.context, name="ContextEmbedding")
utterance_emb = tf.nn.embedding_lookup(W_emb, self.utterance, name="UtteranceEmbedding")
with tf.variable_scope("BidirectionalLSTM"):
argsdict = {"forget_bias": 2.0, "use_peepholes": True, "state_is_tuple": True}
fw_cell = tf.contrib.rnn.LSTMCell(self.hparams.rnn_dim, **argsdict)
bw_cell = tf.contrib.rnn.LSTMCell(self.hparams.rnn_dim, **argsdict)
seq = tf.concat([context_emb, utterance_emb],axis=0)
seqlen = tf.concat([self.context_len,self.utterance_len], axis=0)
_, rnn_states = tf.nn.bidirectional_dynamic_rnn(fw_cell, bw_cell,
inputs=seq,
sequence_length=seqlen,
dtype=tf.float32)
fw_encoding_context, fw_encoding_utter = tf.split(rnn_states[0].h, 2, axis=0)
bw_encoding_context, bw_encoding_utter = tf.split(rnn_states[1].h, 2, axis=0)
encoding_context = tf.concat([fw_encoding_context, bw_encoding_context], axis=1)
encoding_utterance = tf.concat([fw_encoding_utter, bw_encoding_utter], axis=1)
with tf.variable_scope("Prediction"):
M = tf.get_variable(name="M", shape=[2 * self.hparams.rnn_dim, 2 * self.hparams.rnn_dim],
initializer=tf.random_uniform_initializer(-0.25, 0.25))
generated_response = tf.matmul(encoding_context, M)
generated_response = tf.expand_dims(generated_response, 2)
encoding_utterance = tf.expand_dims(encoding_utterance, 2)
logits = tf.matmul(generated_response, encoding_utterance, True)
logits = tf.reshape(logits, [-1])
return logits
def validation_accuracy(self, pred_labels, val_labels, val_loss):
shaped_probs = tf.reshape(pred_labels, [-1, 10])
def get_top(k):
return tf.reduce_mean(tf.cast(tf.nn.in_top_k(shaped_probs, val_labels, k=k), tf.float32))
ema = tf.train.ExponentialMovingAverage(decay=0.99)
top1, top2, top3, top5 = [get_top(k) for k in [1, 2, 3, 5]]
maintain_averages = ema.apply([top1, top2, top3, top5, val_loss])
with tf.control_dependencies([self.val_targets]): # update only when validation targets passed
self.update_averages = tf.group(maintain_averages)
# TODO reset shadow variables between validation sessions
self.val_loss = ema.average(val_loss)
self.top1_av = ema.average(top1)
self.top2_av = ema.average(top2)
self.top3_av = ema.average(top3)
self.top5_av = ema.average(top5)
val_summary = tf.summary.merge([tf.summary.scalar("validation_loss", self.val_loss),
tf.summary.scalar("top1", self.top1_av),
tf.summary.scalar("top2", self.top2_av),
tf.summary.scalar("top3", self.top3_av),
tf.summary.scalar("top5", self.top5_av),
tf.summary.histogram("correct_probs_distribution", shaped_probs[:, 0]),
tf.summary.histogram("incorrect_probs_distribution", shaped_probs[:, 1:])])
return shaped_probs, val_summary
def setSession(self, session):
self._sess = session
def save_model(self, saver, location, step):
saver.save(self._sess, location, global_step=step)
def load_model(self, saver, location):
print("Variable initializaion")
init_op = tf.group(tf.global_variables_initializer(), tf.local_variables_initializer())
self._sess.run(init_op)
ckpt = tf.train.get_checkpoint_state(location)
if ckpt and ckpt.model_checkpoint_path:
print('Restoring model')
saver.restore(self._sess, ckpt.model_checkpoint_path)
def batch_fit(self, batch_dict):
feed_dict = {self.context: batch_dict["context"],
self.context_len: batch_dict["context_len"],
self.utterance: batch_dict["utterance"],
self.utterance_len: batch_dict["utterance_len"],
self.targets: batch_dict["label"]}
train_summary, step, _, loss = self._sess.run([self.train_summaries, self.global_step,
self.train_op, self.train_loss_op], feed_dict=feed_dict)
return loss, step, train_summary
def predict(self, batch_dict):
feed_dict = {self.context: batch_dict["context"],
self.context_len: batch_dict["context_len"],
self.utterance: batch_dict | def __init__(self, hparams):
self.hparams = hparams
self.global_step = tf.Variable(0, trainable=False, name='global_step')
self.learning_rate = tf.train.exponential_decay(
self.hparams.learning_rate, # Base learning rate.
self.global_step, # Current index into the dataset.
self.hparams.decay_step, # Decay step.
self.hparams.decay_rate, # Decay rate.
staircase=self.hparams.staircase, name="learning_rate_decay")
self.optimizer = tf.train.AdamOptimizer(learning_rate=self.learning_rate)
self.context = tf.placeholder(tf.int64, [None, hparams.max_context_len], name="Context")
self.context_len = tf.placeholder(tf.int64, [None], name="ContextLenValue")
self.utterance = tf.placeholder(tf.int64, [None, hparams.max_context_len], name="Utterance")
self.utterance_len = tf.placeholder(tf.int64, [None], name="UtteranceLenValue")
self.targets = tf.placeholder(tf.int64, [None], name="TargetLabels")
self.val_targets = tf.placeholder(tf.int64, [None], name="ValidationLabels") | identifier_body |
dual_encoder.py | VE(filename, vocab):
"""
Load glove vectors from a .txt file.
Optionally limit the vocabulary to save memory. `vocab` should be a set.
"""
dct = {}
vectors = array.array('d')
current_idx = 0
with codecs.open(filename, "r", encoding="utf-8") as f:
for _, line in enumerate(f):
tokens = line.split(" ")
word = tokens[0]
entries = tokens[1:]
if not vocab or word in vocab:
dct[word] = current_idx
vectors.extend(float(x) for x in entries)
current_idx += 1
word_dim = len(entries)
num_vectors = len(dct)
tf.logging.info("Found {} out of {} vectors in Glove".format(num_vectors, len(vocab)))
return [np.array(vectors).reshape(num_vectors, word_dim), dct]
def buildEMBMatrix(vocab_dict, glove_dict, glove_vectors, embedding_dim):
initial_embeddings = np.random.uniform(-0.25, 0.25, (len(vocab_dict), embedding_dim)).astype("float32")
for word, glove_word_idx in glove_dict.items():
word_idx = vocab_dict.get(word)
initial_embeddings[word_idx, :] = glove_vectors[glove_word_idx]
return initial_embeddings
FLAGS = tf.flags.FLAGS
def get_embeddings(hparams):
if hparams.glove_path and hparams.vocab_path:
tf.logging.info("Loading Glove embeddings...")
vocab_array, vocab_dict = loadVOCAB(hparams.vocab_path)
glove_vectors, glove_dict = loadGLOVE(hparams.glove_path, vocab=set(vocab_array))
initializer = buildEMBMatrix(vocab_dict, glove_dict, glove_vectors, hparams.embedding_dim)
else:
tf.logging.info("No glove/vocab path specificed, starting with random embeddings.")
initializer = tf.random_uniform_initializer(-0.25, 0.25)
return tf.get_variable("word_embeddings", shape=[hparams.vocab_size, hparams.embedding_dim],
initializer=initializer)
class DualEncoders:
def __init__(self, hparams):
self.hparams = hparams
self.global_step = tf.Variable(0, trainable=False, name='global_step')
| self.hparams.learning_rate, # Base learning rate.
self.global_step, # Current index into the dataset.
self.hparams.decay_step, # Decay step.
self.hparams.decay_rate, # Decay rate.
staircase=self.hparams.staircase, name="learning_rate_decay")
self.optimizer = tf.train.AdamOptimizer(learning_rate=self.learning_rate)
self.context = tf.placeholder(tf.int64, [None, hparams.max_context_len], name="Context")
self.context_len = tf.placeholder(tf.int64, [None], name="ContextLenValue")
self.utterance = tf.placeholder(tf.int64, [None, hparams.max_context_len], name="Utterance")
self.utterance_len = tf.placeholder(tf.int64, [None], name="UtteranceLenValue")
self.targets = tf.placeholder(tf.int64, [None], name="TargetLabels")
self.val_targets = tf.placeholder(tf.int64, [None], name="ValidationLabels")
logits = self.inference()
probs = tf.sigmoid(logits, name="probs_op")
losses = tf.nn.sigmoid_cross_entropy_with_logits(logits=logits, labels=tf.to_float(self.targets), name="CrossEntropy")
mean_loss = tf.reduce_mean(losses, name="Mean_CE_Loss")
train_op = tf.contrib.layers.optimize_loss(loss=mean_loss,
global_step=self.global_step,
learning_rate=self.learning_rate,
clip_gradients=self.hparams.max_grad_norm,
optimizer=hparams.optimizer)
ema = tf.train.ExponentialMovingAverage(decay=0.99)
mean_loss_ema_op = ema.apply([mean_loss])
with tf.control_dependencies([self.targets]): # update only when train targets passed
train_op_group = tf.group(train_op, mean_loss_ema_op)
self.probs_op = probs
self.train_loss_op = ema.average(mean_loss)
self.train_op = train_op_group
self.train_summaries = tf.summary.merge([tf.summary.scalar("loss", mean_loss),
tf.summary.scalar("learning_rate", self.learning_rate)])
self.val_probs, self.val_summary = self.validation_accuracy(probs, self.val_targets, mean_loss)
def inference(self):
W_emb = get_embeddings(self.hparams)
context_emb = tf.nn.embedding_lookup(W_emb, self.context, name="ContextEmbedding")
utterance_emb = tf.nn.embedding_lookup(W_emb, self.utterance, name="UtteranceEmbedding")
with tf.variable_scope("BidirectionalLSTM"):
argsdict = {"forget_bias": 2.0, "use_peepholes": True, "state_is_tuple": True}
fw_cell = tf.contrib.rnn.LSTMCell(self.hparams.rnn_dim, **argsdict)
bw_cell = tf.contrib.rnn.LSTMCell(self.hparams.rnn_dim, **argsdict)
seq = tf.concat([context_emb, utterance_emb],axis=0)
seqlen = tf.concat([self.context_len,self.utterance_len], axis=0)
_, rnn_states = tf.nn.bidirectional_dynamic_rnn(fw_cell, bw_cell,
inputs=seq,
sequence_length=seqlen,
dtype=tf.float32)
fw_encoding_context, fw_encoding_utter = tf.split(rnn_states[0].h, 2, axis=0)
bw_encoding_context, bw_encoding_utter = tf.split(rnn_states[1].h, 2, axis=0)
encoding_context = tf.concat([fw_encoding_context, bw_encoding_context], axis=1)
encoding_utterance = tf.concat([fw_encoding_utter, bw_encoding_utter], axis=1)
with tf.variable_scope("Prediction"):
M = tf.get_variable(name="M", shape=[2 * self.hparams.rnn_dim, 2 * self.hparams.rnn_dim],
initializer=tf.random_uniform_initializer(-0.25, 0.25))
generated_response = tf.matmul(encoding_context, M)
generated_response = tf.expand_dims(generated_response, 2)
encoding_utterance = tf.expand_dims(encoding_utterance, 2)
logits = tf.matmul(generated_response, encoding_utterance, True)
logits = tf.reshape(logits, [-1])
return logits
def validation_accuracy(self, pred_labels, val_labels, val_loss):
shaped_probs = tf.reshape(pred_labels, [-1, 10])
def get_top(k):
return tf.reduce_mean(tf.cast(tf.nn.in_top_k(shaped_probs, val_labels, k=k), tf.float32))
ema = tf.train.ExponentialMovingAverage(decay=0.99)
top1, top2, top3, top5 = [get_top(k) for k in [1, 2, 3, 5]]
maintain_averages = ema.apply([top1, top2, top3, top5, val_loss])
with tf.control_dependencies([self.val_targets]): # update only when validation targets passed
self.update_averages = tf.group(maintain_averages)
# TODO reset shadow variables between validation sessions
self.val_loss = ema.average(val_loss)
self.top1_av = ema.average(top1)
self.top2_av = ema.average(top2)
self.top3_av = ema.average(top3)
self.top5_av = ema.average(top5)
val_summary = tf.summary.merge([tf.summary.scalar("validation_loss", self.val_loss),
tf.summary.scalar("top1", self.top1_av),
tf.summary.scalar("top2", self.top2_av),
tf.summary.scalar("top3", self.top3_av),
tf.summary.scalar("top5", self.top5_av),
tf.summary.histogram("correct_probs_distribution", shaped_probs[:, 0]),
tf.summary.histogram("incorrect_probs_distribution", shaped_probs[:, 1:])])
return shaped_probs, val_summary
def setSession(self, session):
self._sess = session
def save_model(self, saver, location, step):
saver.save(self._sess, location, global_step=step)
def load_model(self, saver, location):
print("Variable initializaion")
init_op = tf.group(tf.global_variables_initializer(), tf.local_variables_initializer())
self._sess.run(init_op)
ckpt = tf.train.get_checkpoint_state(location)
if ckpt and ckpt.model_checkpoint_path:
print('Restoring model')
saver.restore(self._sess, ckpt.model_checkpoint_path)
def batch_fit(self, batch_dict):
feed_dict = {self.context: batch_dict["context"],
self.context_len: batch_dict["context_len"],
self.utterance: batch_dict["utterance"],
self.utterance_len: batch_dict["utterance_len"],
self.targets: batch_dict["label"]}
train_summary, step, _, loss = self._sess.run([self.train_summaries, self.global_step,
self.train_op, self.train_loss_op], feed_dict=feed_dict)
return loss, step, train_summary
def predict(self, batch_dict):
feed_dict = {self.context: batch_dict["context"],
self.context_len: batch_dict["context_len"],
self.utterance: batch_dict | self.learning_rate = tf.train.exponential_decay( | random_line_split |
dual_encoder.py |
return [vocab, dct]
def loadGLOVE(filename, vocab):
"""
Load glove vectors from a .txt file.
Optionally limit the vocabulary to save memory. `vocab` should be a set.
"""
dct = {}
vectors = array.array('d')
current_idx = 0
with codecs.open(filename, "r", encoding="utf-8") as f:
for _, line in enumerate(f):
tokens = line.split(" ")
word = tokens[0]
entries = tokens[1:]
if not vocab or word in vocab:
dct[word] = current_idx
vectors.extend(float(x) for x in entries)
current_idx += 1
word_dim = len(entries)
num_vectors = len(dct)
tf.logging.info("Found {} out of {} vectors in Glove".format(num_vectors, len(vocab)))
return [np.array(vectors).reshape(num_vectors, word_dim), dct]
def buildEMBMatrix(vocab_dict, glove_dict, glove_vectors, embedding_dim):
initial_embeddings = np.random.uniform(-0.25, 0.25, (len(vocab_dict), embedding_dim)).astype("float32")
for word, glove_word_idx in glove_dict.items():
word_idx = vocab_dict.get(word)
initial_embeddings[word_idx, :] = glove_vectors[glove_word_idx]
return initial_embeddings
FLAGS = tf.flags.FLAGS
def get_embeddings(hparams):
if hparams.glove_path and hparams.vocab_path:
tf.logging.info("Loading Glove embeddings...")
vocab_array, vocab_dict = loadVOCAB(hparams.vocab_path)
glove_vectors, glove_dict = loadGLOVE(hparams.glove_path, vocab=set(vocab_array))
initializer = buildEMBMatrix(vocab_dict, glove_dict, glove_vectors, hparams.embedding_dim)
else:
tf.logging.info("No glove/vocab path specificed, starting with random embeddings.")
initializer = tf.random_uniform_initializer(-0.25, 0.25)
return tf.get_variable("word_embeddings", shape=[hparams.vocab_size, hparams.embedding_dim],
initializer=initializer)
class DualEncoders:
def __init__(self, hparams):
self.hparams = hparams
self.global_step = tf.Variable(0, trainable=False, name='global_step')
self.learning_rate = tf.train.exponential_decay(
self.hparams.learning_rate, # Base learning rate.
self.global_step, # Current index into the dataset.
self.hparams.decay_step, # Decay step.
self.hparams.decay_rate, # Decay rate.
staircase=self.hparams.staircase, name="learning_rate_decay")
self.optimizer = tf.train.AdamOptimizer(learning_rate=self.learning_rate)
self.context = tf.placeholder(tf.int64, [None, hparams.max_context_len], name="Context")
self.context_len = tf.placeholder(tf.int64, [None], name="ContextLenValue")
self.utterance = tf.placeholder(tf.int64, [None, hparams.max_context_len], name="Utterance")
self.utterance_len = tf.placeholder(tf.int64, [None], name="UtteranceLenValue")
self.targets = tf.placeholder(tf.int64, [None], name="TargetLabels")
self.val_targets = tf.placeholder(tf.int64, [None], name="ValidationLabels")
logits = self.inference()
probs = tf.sigmoid(logits, name="probs_op")
losses = tf.nn.sigmoid_cross_entropy_with_logits(logits=logits, labels=tf.to_float(self.targets), name="CrossEntropy")
mean_loss = tf.reduce_mean(losses, name="Mean_CE_Loss")
train_op = tf.contrib.layers.optimize_loss(loss=mean_loss,
global_step=self.global_step,
learning_rate=self.learning_rate,
clip_gradients=self.hparams.max_grad_norm,
optimizer=hparams.optimizer)
ema = tf.train.ExponentialMovingAverage(decay=0.99)
mean_loss_ema_op = ema.apply([mean_loss])
with tf.control_dependencies([self.targets]): # update only when train targets passed
train_op_group = tf.group(train_op, mean_loss_ema_op)
self.probs_op = probs
self.train_loss_op = ema.average(mean_loss)
self.train_op = train_op_group
self.train_summaries = tf.summary.merge([tf.summary.scalar("loss", mean_loss),
tf.summary.scalar("learning_rate", self.learning_rate)])
self.val_probs, self.val_summary = self.validation_accuracy(probs, self.val_targets, mean_loss)
def inference(self):
W_emb = get_embeddings(self.hparams)
context_emb = tf.nn.embedding_lookup(W_emb, self.context, name="ContextEmbedding")
utterance_emb = tf.nn.embedding_lookup(W_emb, self.utterance, name="UtteranceEmbedding")
with tf.variable_scope("BidirectionalLSTM"):
argsdict = {"forget_bias": 2.0, "use_peepholes": True, "state_is_tuple": True}
fw_cell = tf.contrib.rnn.LSTMCell(self.hparams.rnn_dim, **argsdict)
bw_cell = tf.contrib.rnn.LSTMCell(self.hparams.rnn_dim, **argsdict)
seq = tf.concat([context_emb, utterance_emb],axis=0)
seqlen = tf.concat([self.context_len,self.utterance_len], axis=0)
_, rnn_states = tf.nn.bidirectional_dynamic_rnn(fw_cell, bw_cell,
inputs=seq,
sequence_length=seqlen,
dtype=tf.float32)
fw_encoding_context, fw_encoding_utter = tf.split(rnn_states[0].h, 2, axis=0)
bw_encoding_context, bw_encoding_utter = tf.split(rnn_states[1].h, 2, axis=0)
encoding_context = tf.concat([fw_encoding_context, bw_encoding_context], axis=1)
encoding_utterance = tf.concat([fw_encoding_utter, bw_encoding_utter], axis=1)
with tf.variable_scope("Prediction"):
M = tf.get_variable(name="M", shape=[2 * self.hparams.rnn_dim, 2 * self.hparams.rnn_dim],
initializer=tf.random_uniform_initializer(-0.25, 0.25))
generated_response = tf.matmul(encoding_context, M)
generated_response = tf.expand_dims(generated_response, 2)
encoding_utterance = tf.expand_dims(encoding_utterance, 2)
logits = tf.matmul(generated_response, encoding_utterance, True)
logits = tf.reshape(logits, [-1])
return logits
def validation_accuracy(self, pred_labels, val_labels, val_loss):
shaped_probs = tf.reshape(pred_labels, [-1, 10])
def get_top(k):
return tf.reduce_mean(tf.cast(tf.nn.in_top_k(shaped_probs, val_labels, k=k), tf.float32))
ema = tf.train.ExponentialMovingAverage(decay=0.99)
top1, top2, top3, top5 = [get_top(k) for k in [1, 2, 3, 5]]
maintain_averages = ema.apply([top1, top2, top3, top5, val_loss])
with tf.control_dependencies([self.val_targets]): # update only when validation targets passed
self.update_averages = tf.group(maintain_averages)
# TODO reset shadow variables between validation sessions
self.val_loss = ema.average(val_loss)
self.top1_av = ema.average(top1)
self.top2_av = ema.average(top2)
self.top3_av = ema.average(top3)
self.top5_av = ema.average(top5)
val_summary = tf.summary.merge([tf.summary.scalar("validation_loss", self.val_loss),
tf.summary.scalar("top1", self.top1_av),
tf.summary.scalar("top2", self.top2_av),
tf.summary.scalar("top3", self.top3_av),
tf.summary.scalar("top5", self.top5_av),
tf.summary.histogram("correct_probs_distribution", shaped_probs[:, 0]),
tf.summary.histogram("incorrect_probs_distribution", shaped_probs[:, 1:])])
return shaped_probs, val_summary
def setSession(self, session):
self._sess = session
def save_model(self, saver, location, step):
saver.save(self._sess, location, global_step=step)
def load_model(self, saver, location):
print("Variable initializaion")
init_op = tf.group(tf.global_variables_initializer(), tf.local_variables_initializer())
self._sess.run(init_op)
ckpt = tf.train.get_checkpoint_state(location)
if ckpt and ckpt.model_checkpoint_path:
print('Restoring model')
saver.restore(self._sess, ckpt.model_checkpoint_path)
def batch_fit(self, batch_dict):
feed_dict = {self.context: batch_dict["context"],
self.context_len: batch_dict["context_len"],
self.utterance: batch_dict["utterance"],
self.utterance_len: batch_dict["utterance_len"],
self.targets: batch_dict["label"]}
train_summary, step, _, loss = self._sess.run([self.train_summaries, self.global_step,
self.train_op, self.train_loss_op], feed_dict=feed_dict)
return loss, step, train_summary
def predict(self, batch_dict):
feed_dict = {self.context: batch_dict["context"],
| dct[word] = idx | conditional_block | |
dual_encoder.py | vectors = array.array('d')
current_idx = 0
with codecs.open(filename, "r", encoding="utf-8") as f:
for _, line in enumerate(f):
tokens = line.split(" ")
word = tokens[0]
entries = tokens[1:]
if not vocab or word in vocab:
dct[word] = current_idx
vectors.extend(float(x) for x in entries)
current_idx += 1
word_dim = len(entries)
num_vectors = len(dct)
tf.logging.info("Found {} out of {} vectors in Glove".format(num_vectors, len(vocab)))
return [np.array(vectors).reshape(num_vectors, word_dim), dct]
def buildEMBMatrix(vocab_dict, glove_dict, glove_vectors, embedding_dim):
initial_embeddings = np.random.uniform(-0.25, 0.25, (len(vocab_dict), embedding_dim)).astype("float32")
for word, glove_word_idx in glove_dict.items():
word_idx = vocab_dict.get(word)
initial_embeddings[word_idx, :] = glove_vectors[glove_word_idx]
return initial_embeddings
FLAGS = tf.flags.FLAGS
def get_embeddings(hparams):
if hparams.glove_path and hparams.vocab_path:
tf.logging.info("Loading Glove embeddings...")
vocab_array, vocab_dict = loadVOCAB(hparams.vocab_path)
glove_vectors, glove_dict = loadGLOVE(hparams.glove_path, vocab=set(vocab_array))
initializer = buildEMBMatrix(vocab_dict, glove_dict, glove_vectors, hparams.embedding_dim)
else:
tf.logging.info("No glove/vocab path specificed, starting with random embeddings.")
initializer = tf.random_uniform_initializer(-0.25, 0.25)
return tf.get_variable("word_embeddings", shape=[hparams.vocab_size, hparams.embedding_dim],
initializer=initializer)
class DualEncoders:
def __init__(self, hparams):
self.hparams = hparams
self.global_step = tf.Variable(0, trainable=False, name='global_step')
self.learning_rate = tf.train.exponential_decay(
self.hparams.learning_rate, # Base learning rate.
self.global_step, # Current index into the dataset.
self.hparams.decay_step, # Decay step.
self.hparams.decay_rate, # Decay rate.
staircase=self.hparams.staircase, name="learning_rate_decay")
self.optimizer = tf.train.AdamOptimizer(learning_rate=self.learning_rate)
self.context = tf.placeholder(tf.int64, [None, hparams.max_context_len], name="Context")
self.context_len = tf.placeholder(tf.int64, [None], name="ContextLenValue")
self.utterance = tf.placeholder(tf.int64, [None, hparams.max_context_len], name="Utterance")
self.utterance_len = tf.placeholder(tf.int64, [None], name="UtteranceLenValue")
self.targets = tf.placeholder(tf.int64, [None], name="TargetLabels")
self.val_targets = tf.placeholder(tf.int64, [None], name="ValidationLabels")
logits = self.inference()
probs = tf.sigmoid(logits, name="probs_op")
losses = tf.nn.sigmoid_cross_entropy_with_logits(logits=logits, labels=tf.to_float(self.targets), name="CrossEntropy")
mean_loss = tf.reduce_mean(losses, name="Mean_CE_Loss")
train_op = tf.contrib.layers.optimize_loss(loss=mean_loss,
global_step=self.global_step,
learning_rate=self.learning_rate,
clip_gradients=self.hparams.max_grad_norm,
optimizer=hparams.optimizer)
ema = tf.train.ExponentialMovingAverage(decay=0.99)
mean_loss_ema_op = ema.apply([mean_loss])
with tf.control_dependencies([self.targets]): # update only when train targets passed
train_op_group = tf.group(train_op, mean_loss_ema_op)
self.probs_op = probs
self.train_loss_op = ema.average(mean_loss)
self.train_op = train_op_group
self.train_summaries = tf.summary.merge([tf.summary.scalar("loss", mean_loss),
tf.summary.scalar("learning_rate", self.learning_rate)])
self.val_probs, self.val_summary = self.validation_accuracy(probs, self.val_targets, mean_loss)
def inference(self):
W_emb = get_embeddings(self.hparams)
context_emb = tf.nn.embedding_lookup(W_emb, self.context, name="ContextEmbedding")
utterance_emb = tf.nn.embedding_lookup(W_emb, self.utterance, name="UtteranceEmbedding")
with tf.variable_scope("BidirectionalLSTM"):
argsdict = {"forget_bias": 2.0, "use_peepholes": True, "state_is_tuple": True}
fw_cell = tf.contrib.rnn.LSTMCell(self.hparams.rnn_dim, **argsdict)
bw_cell = tf.contrib.rnn.LSTMCell(self.hparams.rnn_dim, **argsdict)
seq = tf.concat([context_emb, utterance_emb],axis=0)
seqlen = tf.concat([self.context_len,self.utterance_len], axis=0)
_, rnn_states = tf.nn.bidirectional_dynamic_rnn(fw_cell, bw_cell,
inputs=seq,
sequence_length=seqlen,
dtype=tf.float32)
fw_encoding_context, fw_encoding_utter = tf.split(rnn_states[0].h, 2, axis=0)
bw_encoding_context, bw_encoding_utter = tf.split(rnn_states[1].h, 2, axis=0)
encoding_context = tf.concat([fw_encoding_context, bw_encoding_context], axis=1)
encoding_utterance = tf.concat([fw_encoding_utter, bw_encoding_utter], axis=1)
with tf.variable_scope("Prediction"):
M = tf.get_variable(name="M", shape=[2 * self.hparams.rnn_dim, 2 * self.hparams.rnn_dim],
initializer=tf.random_uniform_initializer(-0.25, 0.25))
generated_response = tf.matmul(encoding_context, M)
generated_response = tf.expand_dims(generated_response, 2)
encoding_utterance = tf.expand_dims(encoding_utterance, 2)
logits = tf.matmul(generated_response, encoding_utterance, True)
logits = tf.reshape(logits, [-1])
return logits
def validation_accuracy(self, pred_labels, val_labels, val_loss):
shaped_probs = tf.reshape(pred_labels, [-1, 10])
def get_top(k):
return tf.reduce_mean(tf.cast(tf.nn.in_top_k(shaped_probs, val_labels, k=k), tf.float32))
ema = tf.train.ExponentialMovingAverage(decay=0.99)
top1, top2, top3, top5 = [get_top(k) for k in [1, 2, 3, 5]]
maintain_averages = ema.apply([top1, top2, top3, top5, val_loss])
with tf.control_dependencies([self.val_targets]): # update only when validation targets passed
self.update_averages = tf.group(maintain_averages)
# TODO reset shadow variables between validation sessions
self.val_loss = ema.average(val_loss)
self.top1_av = ema.average(top1)
self.top2_av = ema.average(top2)
self.top3_av = ema.average(top3)
self.top5_av = ema.average(top5)
val_summary = tf.summary.merge([tf.summary.scalar("validation_loss", self.val_loss),
tf.summary.scalar("top1", self.top1_av),
tf.summary.scalar("top2", self.top2_av),
tf.summary.scalar("top3", self.top3_av),
tf.summary.scalar("top5", self.top5_av),
tf.summary.histogram("correct_probs_distribution", shaped_probs[:, 0]),
tf.summary.histogram("incorrect_probs_distribution", shaped_probs[:, 1:])])
return shaped_probs, val_summary
def setSession(self, session):
self._sess = session
def save_model(self, saver, location, step):
saver.save(self._sess, location, global_step=step)
def load_model(self, saver, location):
print("Variable initializaion")
init_op = tf.group(tf.global_variables_initializer(), tf.local_variables_initializer())
self._sess.run(init_op)
ckpt = tf.train.get_checkpoint_state(location)
if ckpt and ckpt.model_checkpoint_path:
print('Restoring model')
saver.restore(self._sess, ckpt.model_checkpoint_path)
def batch_fit(self, batch_dict):
feed_dict = {self.context: batch_dict["context"],
self.context_len: batch_dict["context_len"],
self.utterance: batch_dict["utterance"],
self.utterance_len: batch_dict["utterance_len"],
self.targets: batch_dict["label"]}
train_summary, step, _, loss = self._sess.run([self.train_summaries, self.global_step,
self.train_op, self.train_loss_op], feed_dict=feed_dict)
return loss, step, train_summary
def predict(self, batch_dict):
feed_dict = {self.context: batch_dict["context"],
self.context_len: batch_dict["context_len"],
self.utterance: batch_dict["utterance"],
self.utterance_len: batch_dict["utterance_len"]}
return self._sess.run([self.probs_op], feed_dict=feed_dict)
def | validate | identifier_name | |
list_view.rs | parent_base_ref = baseref_from_parent(parent);
let opts = ListViewOpts::define_ctrl_id(opts);
let ctrl_id = opts.ctrl_id;
let context_menu = opts.context_menu;
let new_self = Self(
Arc::new(
Obj {
base: BaseNativeControl::new(parent_base_ref),
opts_id: OptsId::Wnd(opts),
events: ListViewEvents::new(parent_base_ref, ctrl_id),
columns: ListViewColumns::new(),
items: ListViewItems::new(),
context_menu,
},
),
);
new_self.0.columns.set_hwnd_ref(new_self.0.base.hwnd_ref());
new_self.0.items.set_hwnd_ref(new_self.0.base.hwnd_ref());
parent_base_ref.privileged_events_ref().wm(parent_base_ref.creation_wm(), {
let me = new_self.clone();
move |_| { me.create(); 0 }
});
new_self.handled_events(parent_base_ref, ctrl_id);
new_self
}
/// Instantiates a new `ListView` object, to be loaded from a dialog
/// resource with [`HWND::GetDlgItem`](crate::HWND::GetDlgItem).
///
/// **Note:** The optional `context_menu` is shared: it must be destroyed
/// manually after the control is destroyed. But note that menus loaded from
/// resources don't need to be destroyed.
pub fn new_dlg(
parent: &dyn Parent,
ctrl_id: u16,
context_menu: Option<HMENU>) -> ListView
{
let parent_base_ref = baseref_from_parent(parent);
let new_self = Self(
Arc::new(
Obj {
base: BaseNativeControl::new(parent_base_ref),
opts_id: OptsId::Dlg(ctrl_id),
events: ListViewEvents::new(parent_base_ref, ctrl_id),
columns: ListViewColumns::new(),
items: ListViewItems::new(),
context_menu,
},
),
);
new_self.0.columns.set_hwnd_ref(new_self.0.base.hwnd_ref());
new_self.0.items.set_hwnd_ref(new_self.0.base.hwnd_ref());
parent_base_ref.privileged_events_ref().wm_init_dialog({
let me = new_self.clone();
move |_| { me.create(); true }
});
new_self.handled_events(parent_base_ref, ctrl_id);
new_self
}
fn create(&self) {
| match &self.0.opts_id {
OptsId::Wnd(opts) => {
let mut pos = opts.position;
let mut sz = opts.size;
multiply_dpi(Some(&mut pos), Some(&mut sz))?;
self.0.base.create_window( // may panic
"SysListView32", None, pos, sz,
opts.ctrl_id,
opts.window_ex_style,
opts.window_style | opts.list_view_style.into(),
)?;
if opts.list_view_ex_style != co::LVS_EX::NoValue {
self.toggle_extended_style(true, opts.list_view_ex_style);
}
self.columns().add(&opts.columns)?;
Ok(())
},
OptsId::Dlg(ctrl_id) => self.0.base.create_dlg(*ctrl_id).map(|_| ()), // may panic
}
}().unwrap_or_else(|err| PostQuitMessage(err))
}
fn handled_events(&self, parent_base_ref: &Base, ctrl_id: u16) {
parent_base_ref.privileged_events_ref().add_nfy(ctrl_id, co::LVN::KEYDOWN.into(), {
let me = self.clone();
move |p| {
let lvnk = unsafe { p.cast_nmhdr::<NMLVKEYDOWN>() };
let has_ctrl = GetAsyncKeyState(co::VK::CONTROL);
let has_shift = GetAsyncKeyState(co::VK::SHIFT);
if has_ctrl && lvnk.wVKey == co::VK('A' as _) { // Ctrl+A
me.items().set_selected_all(true)
.unwrap_or_else(|err| PostQuitMessage(err));
} else if lvnk.wVKey == co::VK::APPS { // context menu key
me.show_context_menu(false, has_ctrl, has_shift).unwrap();
}
None
}
});
parent_base_ref.privileged_events_ref().add_nfy(ctrl_id, co::NM::RCLICK.into(), {
let me = self.clone();
move |p| {
let nmia = unsafe { p.cast_nmhdr::<NMITEMACTIVATE>() };
let has_ctrl = nmia.uKeyFlags.has(co::LVKF::CONTROL);
let has_shift = nmia.uKeyFlags.has(co::LVKF::SHIFT);
me.show_context_menu(true, has_ctrl, has_shift).unwrap();
None
}
});
}
pub_fn_ctrlid_hwnd_on_onsubclass!(ListViewEvents);
/// Exposes the column methods.
pub fn columns(&self) -> &ListViewColumns {
&self.0.columns
}
/// Returns the context menu attached to this list view, if any.
///
/// The context menu is attached when the list view is created, either by
/// calling [`ListView::new`](crate::gui::ListView::new) or
/// [`ListView::new_dlg`](crate::gui::ListView::new_dlg).
pub fn context_menu(&self) -> Option<HMENU> {
self.0.context_menu
}
/// Retrieves one of the associated image lists by sending an
/// [`LVM_GETIMAGELIST`](crate::msg::lvm::GetImageList) message.
pub fn image_list(&self, kind: co::LVSIL) -> Option<HIMAGELIST> {
self.hwnd().SendMessage(lvm::GetImageList { kind })
}
/// Exposes the item methods.
pub fn items(&self) -> &ListViewItems {
&self.0.items
}
/// Retrieves the current view by sending an
/// [`LVM_GETVIEW`](crate::msg::lvm::GetView) message.
pub fn current_view(&self) -> co::LV_VIEW {
self.hwnd().SendMessage(lvm::GetView {})
}
/// Sets the current view by sending an
/// [`LVM_SETVIEW`](crate::msg::lvm::SetView) message.
pub fn set_current_view(&self, view: co::LV_VIEW) -> WinResult<()> {
self.hwnd().SendMessage(lvm::SetView { view })
}
/// Sets the one of the associated image lists by sending an
/// [`LVM_SETIMAGELIST`](crate::msg::lvm::SetImageList) message.
///
/// Returns the previous image list, if any.
pub fn set_image_list(&self,
kind: co::LVSIL, himagelist: HIMAGELIST) -> Option<HIMAGELIST>
{
self.hwnd().SendMessage(lvm::SetImageList { kind, himagelist })
}
/// Toggles the given extended list view styles by sending an
/// [`LVM_SETEXTENDEDLISTVIEWSTYLE`](crate::msg::lvm::SetExtendedListViewStyle)
/// message.
pub fn toggle_extended_style(&self, set: bool, ex_style: co::LVS_EX) {
self.hwnd().SendMessage(lvm::SetExtendedListViewStyle {
mask: ex_style,
style: if set { ex_style } else { co::LVS_EX::NoValue },
});
}
fn show_context_menu(&self,
follow_cursor: bool, has_ctrl: bool, has_shift: bool) -> WinResult<()>
{
let hmenu = match self.0.context_menu {
Some(h) => h,
None => return Ok(()), // no menu, nothing to do
};
let menu_pos = if follow_cursor { // usually when fired by a right-click
let mut menu_pos = GetCursorPos()?; // relative to screen
self.hwnd().ScreenToClient(&mut menu_pos)?; // now relative to list view
let mut lvhti = LVHITTESTINFO::default(); // find item below cursor, if any
lvhti.pt = menu_pos;
match self.items().hit_test(&mut lvhti) {
Some(idx) => { // an item was right-clicked
if !has_ctrl && !has_shift {
if !self.items().is_selected(idx) {
self.items().set_selected_all(false)?;
self.items().set_selected(true, &[idx])?;
}
self.items().set_focused(idx)?;
}
},
None => { // no item was right-clicked
self.items().set_selected_all(false)?;
},
}
self.hwnd().SetFocus(); // because a right-click won't set the focus by itself
menu_pos
} else { // usually fired by the context meny key
let focused_idx_opt = self.items().focused();
if focused_idx_opt.is_some() && self.items().is_visible(focused_idx_opt.unwrap()) {
let focused_idx = focused_idx_opt.unwrap();
let rc_item = self.items().rect(focused_idx, co::LVIR::BOUNDS)?;
POINT::new(rc_item.left + 16,
rc_item.top | || -> WinResult<()> {
| random_line_split |
list_view.rs | let parent_base_ref = baseref_from_parent(parent);
let opts = ListViewOpts::define_ctrl_id(opts);
let ctrl_id = opts.ctrl_id;
let context_menu = opts.context_menu;
let new_self = Self(
Arc::new(
Obj {
base: BaseNativeControl::new(parent_base_ref),
opts_id: OptsId::Wnd(opts),
events: ListViewEvents::new(parent_base_ref, ctrl_id),
columns: ListViewColumns::new(),
items: ListViewItems::new(),
context_menu,
},
),
);
new_self.0.columns.set_hwnd_ref(new_self.0.base.hwnd_ref());
new_self.0.items.set_hwnd_ref(new_self.0.base.hwnd_ref());
parent_base_ref.privileged_events_ref().wm(parent_base_ref.creation_wm(), {
let me = new_self.clone();
move |_| { me.create(); 0 }
});
new_self.handled_events(parent_base_ref, ctrl_id);
new_self
}
/// Instantiates a new `ListView` object, to be loaded from a dialog
/// resource with [`HWND::GetDlgItem`](crate::HWND::GetDlgItem).
///
/// **Note:** The optional `context_menu` is shared: it must be destroyed
/// manually after the control is destroyed. But note that menus loaded from
/// resources don't need to be destroyed.
pub fn new_dlg(
parent: &dyn Parent,
ctrl_id: u16,
context_menu: Option<HMENU>) -> ListView
{
let parent_base_ref = baseref_from_parent(parent);
let new_self = Self(
Arc::new(
Obj {
base: BaseNativeControl::new(parent_base_ref),
opts_id: OptsId::Dlg(ctrl_id),
events: ListViewEvents::new(parent_base_ref, ctrl_id),
columns: ListViewColumns::new(),
items: ListViewItems::new(),
context_menu,
},
),
);
new_self.0.columns.set_hwnd_ref(new_self.0.base.hwnd_ref());
new_self.0.items.set_hwnd_ref(new_self.0.base.hwnd_ref());
parent_base_ref.privileged_events_ref().wm_init_dialog({
let me = new_self.clone();
move |_| { me.create(); true }
});
new_self.handled_events(parent_base_ref, ctrl_id);
new_self
}
fn create(&self) {
|| -> WinResult<()> {
match &self.0.opts_id {
OptsId::Wnd(opts) => {
let mut pos = opts.position;
let mut sz = opts.size;
multiply_dpi(Some(&mut pos), Some(&mut sz))?;
self.0.base.create_window( // may panic
"SysListView32", None, pos, sz,
opts.ctrl_id,
opts.window_ex_style,
opts.window_style | opts.list_view_style.into(),
)?;
if opts.list_view_ex_style != co::LVS_EX::NoValue {
self.toggle_extended_style(true, opts.list_view_ex_style);
}
self.columns().add(&opts.columns)?;
Ok(())
},
OptsId::Dlg(ctrl_id) => self.0.base.create_dlg(*ctrl_id).map(|_| ()), // may panic
}
}().unwrap_or_else(|err| PostQuitMessage(err))
}
fn handled_events(&self, parent_base_ref: &Base, ctrl_id: u16) {
parent_base_ref.privileged_events_ref().add_nfy(ctrl_id, co::LVN::KEYDOWN.into(), {
let me = self.clone();
move |p| {
let lvnk = unsafe { p.cast_nmhdr::<NMLVKEYDOWN>() };
let has_ctrl = GetAsyncKeyState(co::VK::CONTROL);
let has_shift = GetAsyncKeyState(co::VK::SHIFT);
if has_ctrl && lvnk.wVKey == co::VK('A' as _) { // Ctrl+A
me.items().set_selected_all(true)
.unwrap_or_else(|err| PostQuitMessage(err));
} else if lvnk.wVKey == co::VK::APPS { // context menu key
me.show_context_menu(false, has_ctrl, has_shift).unwrap();
}
None
}
});
parent_base_ref.privileged_events_ref().add_nfy(ctrl_id, co::NM::RCLICK.into(), {
let me = self.clone();
move |p| {
let nmia = unsafe { p.cast_nmhdr::<NMITEMACTIVATE>() };
let has_ctrl = nmia.uKeyFlags.has(co::LVKF::CONTROL);
let has_shift = nmia.uKeyFlags.has(co::LVKF::SHIFT);
me.show_context_menu(true, has_ctrl, has_shift).unwrap();
None
}
});
}
pub_fn_ctrlid_hwnd_on_onsubclass!(ListViewEvents);
/// Exposes the column methods.
pub fn columns(&self) -> &ListViewColumns {
&self.0.columns
}
/// Returns the context menu attached to this list view, if any.
///
/// The context menu is attached when the list view is created, either by
/// calling [`ListView::new`](crate::gui::ListView::new) or
/// [`ListView::new_dlg`](crate::gui::ListView::new_dlg).
pub fn context_menu(&self) -> Option<HMENU> {
self.0.context_menu
}
/// Retrieves one of the associated image lists by sending an
/// [`LVM_GETIMAGELIST`](crate::msg::lvm::GetImageList) message.
pub fn image_list(&self, kind: co::LVSIL) -> Option<HIMAGELIST> {
self.hwnd().SendMessage(lvm::GetImageList { kind })
}
/// Exposes the item methods.
pub fn items(&self) -> &ListViewItems {
&self.0.items
}
/// Retrieves the current view by sending an
/// [`LVM_GETVIEW`](crate::msg::lvm::GetView) message.
pub fn current_view(&self) -> co::LV_VIEW {
self.hwnd().SendMessage(lvm::GetView {})
}
/// Sets the current view by sending an
/// [`LVM_SETVIEW`](crate::msg::lvm::SetView) message.
pub fn set_current_view(&self, view: co::LV_VIEW) -> WinResult<()> {
self.hwnd().SendMessage(lvm::SetView { view })
}
/// Sets the one of the associated image lists by sending an
/// [`LVM_SETIMAGELIST`](crate::msg::lvm::SetImageList) message.
///
/// Returns the previous image list, if any.
pub fn set_image_list(&self,
kind: co::LVSIL, himagelist: HIMAGELIST) -> Option<HIMAGELIST>
{
self.hwnd().SendMessage(lvm::SetImageList { kind, himagelist })
}
/// Toggles the given extended list view styles by sending an
/// [`LVM_SETEXTENDEDLISTVIEWSTYLE`](crate::msg::lvm::SetExtendedListViewStyle)
/// message.
pub fn | (&self, set: bool, ex_style: co::LVS_EX) {
self.hwnd().SendMessage(lvm::SetExtendedListViewStyle {
mask: ex_style,
style: if set { ex_style } else { co::LVS_EX::NoValue },
});
}
fn show_context_menu(&self,
follow_cursor: bool, has_ctrl: bool, has_shift: bool) -> WinResult<()>
{
let hmenu = match self.0.context_menu {
Some(h) => h,
None => return Ok(()), // no menu, nothing to do
};
let menu_pos = if follow_cursor { // usually when fired by a right-click
let mut menu_pos = GetCursorPos()?; // relative to screen
self.hwnd().ScreenToClient(&mut menu_pos)?; // now relative to list view
let mut lvhti = LVHITTESTINFO::default(); // find item below cursor, if any
lvhti.pt = menu_pos;
match self.items().hit_test(&mut lvhti) {
Some(idx) => { // an item was right-clicked
if !has_ctrl && !has_shift {
if !self.items().is_selected(idx) {
self.items().set_selected_all(false)?;
self.items().set_selected(true, &[idx])?;
}
self.items().set_focused(idx)?;
}
},
None => { // no item was right-clicked
self.items().set_selected_all(false)?;
},
}
self.hwnd().SetFocus(); // because a right-click won't set the focus by itself
menu_pos
} else { // usually fired by the context meny key
let focused_idx_opt = self.items().focused();
if focused_idx_opt.is_some() && self.items().is_visible(focused_idx_opt.unwrap()) {
let focused_idx = focused_idx_opt.unwrap();
let rc_item = self.items().rect(focused_idx, co::LVIR::BOUNDS)?;
POINT::new(rc_item.left + 16,
rc_item.top | toggle_extended_style | identifier_name |
list_view.rs | .unwrap_or_else(|err| PostQuitMessage(err));
} else if lvnk.wVKey == co::VK::APPS { // context menu key
me.show_context_menu(false, has_ctrl, has_shift).unwrap();
}
None
}
});
parent_base_ref.privileged_events_ref().add_nfy(ctrl_id, co::NM::RCLICK.into(), {
let me = self.clone();
move |p| {
let nmia = unsafe { p.cast_nmhdr::<NMITEMACTIVATE>() };
let has_ctrl = nmia.uKeyFlags.has(co::LVKF::CONTROL);
let has_shift = nmia.uKeyFlags.has(co::LVKF::SHIFT);
me.show_context_menu(true, has_ctrl, has_shift).unwrap();
None
}
});
}
pub_fn_ctrlid_hwnd_on_onsubclass!(ListViewEvents);
/// Exposes the column methods.
pub fn columns(&self) -> &ListViewColumns {
&self.0.columns
}
/// Returns the context menu attached to this list view, if any.
///
/// The context menu is attached when the list view is created, either by
/// calling [`ListView::new`](crate::gui::ListView::new) or
/// [`ListView::new_dlg`](crate::gui::ListView::new_dlg).
pub fn context_menu(&self) -> Option<HMENU> {
self.0.context_menu
}
/// Retrieves one of the associated image lists by sending an
/// [`LVM_GETIMAGELIST`](crate::msg::lvm::GetImageList) message.
pub fn image_list(&self, kind: co::LVSIL) -> Option<HIMAGELIST> {
self.hwnd().SendMessage(lvm::GetImageList { kind })
}
/// Exposes the item methods.
pub fn items(&self) -> &ListViewItems {
&self.0.items
}
/// Retrieves the current view by sending an
/// [`LVM_GETVIEW`](crate::msg::lvm::GetView) message.
pub fn current_view(&self) -> co::LV_VIEW {
self.hwnd().SendMessage(lvm::GetView {})
}
/// Sets the current view by sending an
/// [`LVM_SETVIEW`](crate::msg::lvm::SetView) message.
pub fn set_current_view(&self, view: co::LV_VIEW) -> WinResult<()> {
self.hwnd().SendMessage(lvm::SetView { view })
}
/// Sets the one of the associated image lists by sending an
/// [`LVM_SETIMAGELIST`](crate::msg::lvm::SetImageList) message.
///
/// Returns the previous image list, if any.
pub fn set_image_list(&self,
kind: co::LVSIL, himagelist: HIMAGELIST) -> Option<HIMAGELIST>
{
self.hwnd().SendMessage(lvm::SetImageList { kind, himagelist })
}
/// Toggles the given extended list view styles by sending an
/// [`LVM_SETEXTENDEDLISTVIEWSTYLE`](crate::msg::lvm::SetExtendedListViewStyle)
/// message.
pub fn toggle_extended_style(&self, set: bool, ex_style: co::LVS_EX) {
self.hwnd().SendMessage(lvm::SetExtendedListViewStyle {
mask: ex_style,
style: if set { ex_style } else { co::LVS_EX::NoValue },
});
}
fn show_context_menu(&self,
follow_cursor: bool, has_ctrl: bool, has_shift: bool) -> WinResult<()>
{
let hmenu = match self.0.context_menu {
Some(h) => h,
None => return Ok(()), // no menu, nothing to do
};
let menu_pos = if follow_cursor { // usually when fired by a right-click
let mut menu_pos = GetCursorPos()?; // relative to screen
self.hwnd().ScreenToClient(&mut menu_pos)?; // now relative to list view
let mut lvhti = LVHITTESTINFO::default(); // find item below cursor, if any
lvhti.pt = menu_pos;
match self.items().hit_test(&mut lvhti) {
Some(idx) => { // an item was right-clicked
if !has_ctrl && !has_shift {
if !self.items().is_selected(idx) {
self.items().set_selected_all(false)?;
self.items().set_selected(true, &[idx])?;
}
self.items().set_focused(idx)?;
}
},
None => { // no item was right-clicked
self.items().set_selected_all(false)?;
},
}
self.hwnd().SetFocus(); // because a right-click won't set the focus by itself
menu_pos
} else { // usually fired by the context meny key
let focused_idx_opt = self.items().focused();
if focused_idx_opt.is_some() && self.items().is_visible(focused_idx_opt.unwrap()) {
let focused_idx = focused_idx_opt.unwrap();
let rc_item = self.items().rect(focused_idx, co::LVIR::BOUNDS)?;
POINT::new(rc_item.left + 16,
rc_item.top + (rc_item.bottom - rc_item.top) / 2)
} else { // no item is focused and visible
POINT::new(6, 10) // arbitrary
}
};
hmenu.TrackPopupMenuAtPoint(
menu_pos, self.hwnd().GetParent()?, self.hwnd())
}
}
//------------------------------------------------------------------------------
/// Options to create a [`ListView`](crate::gui::ListView) programmatically with
/// [`ListView::new`](crate::gui::ListView::new).
pub struct ListViewOpts {
/// Control position within parent client area, in pixels, to be
/// [created](https://docs.microsoft.com/en-us/windows/win32/api/winuser/nf-winuser-createwindowexw).
///
/// Will be adjusted to match current system DPI.
///
/// Defaults to 0 x 0.
pub position: POINT,
/// Control size, in pixels, to be
/// [created](https://docs.microsoft.com/en-us/windows/win32/api/winuser/nf-winuser-createwindowexw).
///
/// Will be adjusted to match current system DPI.
///
/// Defaults to 50 x 50.
pub size: SIZE,
/// List view styles to be
/// [created](https://docs.microsoft.com/en-us/windows/win32/api/winuser/nf-winuser-createwindowexw).
///
/// Defaults to `LVS::REPORT | LVS::NOSORTHEADER | LVS::SHOWSELALWAYS | LVS::SHAREIMAGELISTS`.
pub list_view_style: co::LVS,
/// Extended list view styles to be
/// [created](https://docs.microsoft.com/en-us/windows/win32/api/winuser/nf-winuser-createwindowexw).
///
/// Defaults to `LVS_EX::NoValue`.
pub list_view_ex_style: co::LVS_EX,
/// Window styles to be
/// [created](https://docs.microsoft.com/en-us/windows/win32/api/winuser/nf-winuser-createwindowexw).
///
/// Defaults to `WS::CHILD | WS::VISIBLE | WS::TABSTOP | WS::GROUP`.
pub window_style: co::WS,
/// Extended window styles to be
/// [created](https://docs.microsoft.com/en-us/windows/win32/api/winuser/nf-winuser-createwindowexw).
///
/// Defaults to `WS_EX::LEFT | WS_EX::CLIENTEDGE`.
pub window_ex_style: co::WS_EX,
/// The control ID.
///
/// Defaults to an auto-generated ID.
pub ctrl_id: u16,
/// Context popup menu.
///
/// This menu is shared: it must be destroyed manually after the control is
/// destroyed. But note that menus loaded from resources don't need to be
/// destroyed.
///
/// Defaults to `None`.
pub context_menu: Option<HMENU>,
/// Text and width of columns to be added right away. The columns only show
/// in report mode.
///
/// Defaults to none.
pub columns: Vec<(String, u32)>,
}
impl Default for ListViewOpts {
fn default() -> Self {
Self {
position: POINT::new(0, 0),
size: SIZE::new(50, 50),
list_view_style: co::LVS::REPORT | co::LVS::NOSORTHEADER | co::LVS::SHOWSELALWAYS | co::LVS::SHAREIMAGELISTS,
list_view_ex_style: co::LVS_EX::NoValue,
window_style: co::WS::CHILD | co::WS::VISIBLE | co::WS::TABSTOP | co::WS::GROUP,
window_ex_style: co::WS_EX::LEFT | co::WS_EX::CLIENTEDGE,
ctrl_id: 0,
context_menu: None,
columns: Vec::default(),
}
}
}
impl ListViewOpts {
fn define_ctrl_id(mut self) -> Self {
if self.ctrl_id == 0 | {
self.ctrl_id = auto_ctrl_id();
} | conditional_block | |
main.rs | 32, String) {
let mut score = 0;
let mut mutations = "".to_string();
let mut n = 1;
for (i, j) in seq1.chars().zip(seq2.chars()) {
if i != j {
score += 1;
if score == 1 {
mutations = mutations + &format!("{}{}", n, i);
} else {
mutations = mutations + &format!(" {}{}", n, i);
}
}
n += 1;
}
(score, mutations)
}
fn reverse_complement(seq: &str) -> String {
seq.chars()
.map(|t| match t {
'A' => 'T',
'T' => 'A',
'G' => 'C',
'C' => 'G',
_ => 'N',
}).rev().collect::<String>()
}
fn qual_check(a: &[u8], b: &[u8]) -> bool {
for (i, j) in a.iter().zip(b.iter()) {
if i < j {
continue;
}
return false;
}
return true
}
fn data_stat(results: &HashMap<String, (String, Vec<u8>)>, output_file: &str) -> Result<String, Box<Error>> {
// statistics on the datasets
let wt_pac = "AGAGAAGATTTATCTGAAGTCGTTACGCGAG";
let mut diff_counts : [usize; 31] = [0; 31];
let mut diff_freq : [usize; 31] = [0; 31];
let mut output = try!(File::create(output_file));
let mut pac_stat = HashMap::new();
for (_, pac_info) in results {
let ref pac = pac_info.0;
let ref qual = pac_info.1;
// mutation statistics
let mut index = 0;
let mut distance = 0;
for (i, j) in pac.chars().zip(wt_pac.chars()) {
if qual[index] > 63 && i != j {
diff_freq[index] += 1;
distance += 1;
}
index += 1;
}
diff_counts[distance] += 1;
if distance > 8 {
println!("# {} {}", distance, pac);
}
// pac sites statistics
if pac_stat.contains_key(pac) {
*pac_stat.get_mut(pac).unwrap() += 1;
}
else {
pac_stat.insert(pac, 1);
}
}
println!("# Overall statistics:");
for i in 0..31 {
println!("# {}\t{}", i, diff_counts[i]);
}
println!("# Per-base statistics:");
for i in 0..31 {
println!("# {}\t{}", i, diff_freq[i]);
}
//try!(write!(output, "{}", "# pac counts:\n"));
for (pac, counts) in &pac_stat {
try!(write!(output, "{} {} {}\n", pac, hamming(&pac, &wt_pac), counts));
}
Ok("Done".into())
}
fn | () {
let args : Vec<String> = env::args().collect();
let file1 = fastq::Reader::from_file(&args[1]).unwrap();
let file2 = fastq::Reader::from_file(&args[2]).unwrap();
let mut num_records = 0;
let mut num_duplicates = 0;
let mut num_qual_skip = 0;
let mut results : HashMap<String, (String, Vec<u8>)>= HashMap::new();
let wt_read1 = if &args[3] == "M" {b"ACTAAGTGAGATGAATATGGCGGCACCAAAGGGCAACCGATTTTGGGAGGCCCGCAGTAGTCATGGGCGAAATCCTAAATTCGAATCGCCTGAGGCGCTGTGGGCTGCTTGTTGTGAA"}
else {b"AAGTGAGATGAATATGGCGGCACCAAAGGGCAACCGATTTTGGGAGGCCCGCAGTAGTCATGGGCGAAATCCTAAATTCGAATCGCCTGAGGCGCTGTGGGCTGCTTGTTGTGAATAC"};
for (record1, record2) in file1.records().zip(file2.records()) {
// take read1, filter low quality reads
let read1 = record1.unwrap();
let desc = read1.id().unwrap().split(":").skip(5).collect::<Vec<&str>>();
let description = desc[0].to_string() + ":" + desc[1];
let mut trim = 124;
let mut am = " ".to_string();
for i in 0..120 {
if qual_check(&read1.qual()[i .. i+5], &[63, 63, 63, 63, 63]) {
trim = i+1;
println!("# {} {}: Read 1 trimmed at {}.", num_records, description, trim);
break;
}
}
if trim < 18 {
println!("# {}: Useful read too short. Skipping. L = {}", num_records, trim);
num_qual_skip += 1;
num_records += 1;
continue;
}
// check if the read is the right read
let seq1 = String::from_utf8_lossy(&read1.seq()[0 .. trim]);
let score = |a: u8, b: u8| if a == b {1i32} else {-1i32};
let mut aligner = Aligner::with_capacity(seq1.len(), wt_read1.len(), -5, -1, &score);
let alignment = aligner.global(&seq1[8..seq1.len()].as_bytes(), wt_read1);
if alignment.score < (2 * trim as i32 - 133 - 30) {
println!("# {} {}: wrong read 1 skipping", num_records, description);
println!("# {} {}", &seq1[8..seq1.len()], alignment.score);
num_records += 1;
num_qual_skip += 1;
continue;
}
// identifying AM/WT
if &args[3] == "M" {
if trim < 33 {
println!("# {}: Useful read too short for M. Skipping. L = {}", num_records, trim);
num_qual_skip += 1;
num_records += 1;
continue;
}
// Allowing 1 mismatch
if hamming(&seq1[27 .. 32], "GCGGC") < 2 {
match &seq1[32 .. 33] {
"A" => am = "WT".to_string(),
"G" => am = "AM".to_string(),
_ => am = " ".to_string(),
}
println!("# 1 am_codon = {}", &seq1[27 .. 33]);
}
if am == " " {
for i in 0 .. trim-6 {
if &seq1[i .. i+5] == "GCGGC" {
match &seq1[i+5 .. i+6] {
"A" => am = "WT".to_string(),
"G" => am = "AM".to_string(),
_ => am = " ".to_string(),
}
println!("# 2 am_codon = {}", &seq1[i .. i+6]);
break;
}
}
}
}
// average quality filtering
//let avg_qual = read1.qual().iter().fold(0, |a, &b| a as u32 + b as u32);
//if avg_qual < (125 * 30) { // corresponding to an average quality of 20
// println!("# low quality read 1 skipping: {}", avg_qual);
// continue;
//}
// now deal with read2
let read2 = record2.unwrap();
// average quality filtering
//let avg_qual = read2.qual().iter().fold(0, |a, &b| a as u32 + b as u32);
//if avg_qual < 125*30 {
// println!("# {}: low quality read 2 skipping: {}", num_records, avg_qual);
// num_qual_skip += 1;
// continue;
//}
trim = 124;
for i in 0..119 {
if qual_check(&read2.qual()[i .. i+5], &[63, 63, 63, 63, 63]) {
trim = i+1;
println!("# {} {}: Read 2 trimmed at {}.", num_records, description, i);
break;
}
}
if trim < 80 {
println!("# {}: Useful read too short. Skipping. L = {}", num_records, trim);
num_qual_skip += 1;
num_records += 1;
continue;
}
let seq2 =String::from_utf8_lossy(&read2.seq()[0 .. trim]);
// extract barcodes
let bc1 = &seq1[0 | main | identifier_name |
main.rs | // distance += 1;
// }
// }
// else {
// distance += 1;
// }
// index += 1;
// }
// (distance, dif)
// }
fn hamming(seq1: &str, seq2: &str) -> u32 {
let mut score = 0;
for (i, j) in seq1.chars().zip(seq2.chars()) {
if i != j {
score += 1;
}
}
score
}
fn ham_mutations(seq1: &str, seq2: &str) -> (u32, String) {
let mut score = 0;
let mut mutations = "".to_string();
let mut n = 1;
for (i, j) in seq1.chars().zip(seq2.chars()) {
if i != j {
score += 1;
if score == 1 {
mutations = mutations + &format!("{}{}", n, i);
} else {
mutations = mutations + &format!(" {}{}", n, i);
}
}
n += 1;
}
(score, mutations)
}
fn reverse_complement(seq: &str) -> String {
seq.chars()
.map(|t| match t {
'A' => 'T',
'T' => 'A',
'G' => 'C',
'C' => 'G',
_ => 'N',
}).rev().collect::<String>()
}
fn qual_check(a: &[u8], b: &[u8]) -> bool {
for (i, j) in a.iter().zip(b.iter()) {
if i < j {
continue;
}
return false;
}
return true
}
fn data_stat(results: &HashMap<String, (String, Vec<u8>)>, output_file: &str) -> Result<String, Box<Error>> {
// statistics on the datasets
let wt_pac = "AGAGAAGATTTATCTGAAGTCGTTACGCGAG";
let mut diff_counts : [usize; 31] = [0; 31];
let mut diff_freq : [usize; 31] = [0; 31];
let mut output = try!(File::create(output_file));
let mut pac_stat = HashMap::new();
for (_, pac_info) in results {
let ref pac = pac_info.0;
let ref qual = pac_info.1;
// mutation statistics
let mut index = 0;
let mut distance = 0;
for (i, j) in pac.chars().zip(wt_pac.chars()) {
if qual[index] > 63 && i != j {
diff_freq[index] += 1;
distance += 1;
}
index += 1;
}
diff_counts[distance] += 1;
if distance > 8 {
println!("# {} {}", distance, pac);
}
// pac sites statistics
if pac_stat.contains_key(pac) {
*pac_stat.get_mut(pac).unwrap() += 1;
}
else {
pac_stat.insert(pac, 1);
}
}
println!("# Overall statistics:");
for i in 0..31 {
println!("# {}\t{}", i, diff_counts[i]);
}
println!("# Per-base statistics:");
for i in 0..31 {
println!("# {}\t{}", i, diff_freq[i]);
}
//try!(write!(output, "{}", "# pac counts:\n"));
for (pac, counts) in &pac_stat {
try!(write!(output, "{} {} {}\n", pac, hamming(&pac, &wt_pac), counts));
}
Ok("Done".into())
}
fn main() {
let args : Vec<String> = env::args().collect();
let file1 = fastq::Reader::from_file(&args[1]).unwrap();
let file2 = fastq::Reader::from_file(&args[2]).unwrap();
let mut num_records = 0;
let mut num_duplicates = 0;
let mut num_qual_skip = 0;
let mut results : HashMap<String, (String, Vec<u8>)>= HashMap::new();
let wt_read1 = if &args[3] == "M" {b"ACTAAGTGAGATGAATATGGCGGCACCAAAGGGCAACCGATTTTGGGAGGCCCGCAGTAGTCATGGGCGAAATCCTAAATTCGAATCGCCTGAGGCGCTGTGGGCTGCTTGTTGTGAA"}
else {b"AAGTGAGATGAATATGGCGGCACCAAAGGGCAACCGATTTTGGGAGGCCCGCAGTAGTCATGGGCGAAATCCTAAATTCGAATCGCCTGAGGCGCTGTGGGCTGCTTGTTGTGAATAC"};
for (record1, record2) in file1.records().zip(file2.records()) {
// take read1, filter low quality reads
let read1 = record1.unwrap();
let desc = read1.id().unwrap().split(":").skip(5).collect::<Vec<&str>>();
let description = desc[0].to_string() + ":" + desc[1];
let mut trim = 124;
let mut am = " ".to_string();
for i in 0..120 {
if qual_check(&read1.qual()[i .. i+5], &[63, 63, 63, 63, 63]) {
trim = i+1;
println!("# {} {}: Read 1 trimmed at {}.", num_records, description, trim);
break;
}
}
if trim < 18 {
println!("# {}: Useful read too short. Skipping. L = {}", num_records, trim);
num_qual_skip += 1;
num_records += 1;
continue;
}
// check if the read is the right read
let seq1 = String::from_utf8_lossy(&read1.seq()[0 .. trim]);
let score = |a: u8, b: u8| if a == b {1i32} else {-1i32};
let mut aligner = Aligner::with_capacity(seq1.len(), wt_read1.len(), -5, -1, &score);
let alignment = aligner.global(&seq1[8..seq1.len()].as_bytes(), wt_read1);
if alignment.score < (2 * trim as i32 - 133 - 30) {
println!("# {} {}: wrong read 1 skipping", num_records, description);
println!("# {} {}", &seq1[8..seq1.len()], alignment.score);
num_records += 1;
num_qual_skip += 1;
continue;
}
// identifying AM/WT
if &args[3] == "M" {
if trim < 33 {
println!("# {}: Useful read too short for M. Skipping. L = {}", num_records, trim);
num_qual_skip += 1;
num_records += 1;
continue;
}
// Allowing 1 mismatch
if hamming(&seq1[27 .. 32], "GCGGC") < 2 {
match &seq1[32 .. 33] {
"A" => am = "WT".to_string(),
"G" => am = "AM".to_string(),
_ => am = " ".to_string(),
}
println!("# 1 am_codon = {}", &seq1[27 .. 33]);
}
if am == " " {
for i in 0 .. trim-6 {
if &seq1[i .. i+5] == "GCGGC" {
match &seq1[i+5 .. i+6] {
"A" => am = "WT".to_string(),
"G" => am = "AM".to_string(),
_ => am = " ".to_string(),
}
println!("# 2 am_codon = {}", &seq1[i .. i+6]);
break;
}
}
}
}
// average quality filtering
//let avg_qual = read1.qual().iter().fold(0, |a, &b| a as u32 + b as u32);
//if avg_qual < (125 * 30) { // corresponding to an average quality of 20
// println!("# low quality read 1 skipping: {}", avg_qual);
// continue;
//}
// now deal with read2
let read2 = record2.unwrap();
// average quality filtering
//let avg_qual = read2.qual().iter().fold(0, |a, &b| a as u32 + b as u32);
//if avg_qual < 125*30 {
// println!("# {}: low quality read 2 skipping: {}", num_records, avg_qual);
// num_qual_skip += 1;
// continue;
//}
trim = 124;
for i in 0..119 {
if qual_check(&read2.qual | // if i != j {
// dif.push((index, i, j)); | random_line_split | |
main.rs |
fn ham_mutations(seq1: &str, seq2: &str) -> (u32, String) {
let mut score = 0;
let mut mutations = "".to_string();
let mut n = 1;
for (i, j) in seq1.chars().zip(seq2.chars()) {
if i != j {
score += 1;
if score == 1 {
mutations = mutations + &format!("{}{}", n, i);
} else {
mutations = mutations + &format!(" {}{}", n, i);
}
}
n += 1;
}
(score, mutations)
}
fn reverse_complement(seq: &str) -> String {
seq.chars()
.map(|t| match t {
'A' => 'T',
'T' => 'A',
'G' => 'C',
'C' => 'G',
_ => 'N',
}).rev().collect::<String>()
}
fn qual_check(a: &[u8], b: &[u8]) -> bool {
for (i, j) in a.iter().zip(b.iter()) {
if i < j {
continue;
}
return false;
}
return true
}
fn data_stat(results: &HashMap<String, (String, Vec<u8>)>, output_file: &str) -> Result<String, Box<Error>> {
// statistics on the datasets
let wt_pac = "AGAGAAGATTTATCTGAAGTCGTTACGCGAG";
let mut diff_counts : [usize; 31] = [0; 31];
let mut diff_freq : [usize; 31] = [0; 31];
let mut output = try!(File::create(output_file));
let mut pac_stat = HashMap::new();
for (_, pac_info) in results {
let ref pac = pac_info.0;
let ref qual = pac_info.1;
// mutation statistics
let mut index = 0;
let mut distance = 0;
for (i, j) in pac.chars().zip(wt_pac.chars()) {
if qual[index] > 63 && i != j {
diff_freq[index] += 1;
distance += 1;
}
index += 1;
}
diff_counts[distance] += 1;
if distance > 8 {
println!("# {} {}", distance, pac);
}
// pac sites statistics
if pac_stat.contains_key(pac) {
*pac_stat.get_mut(pac).unwrap() += 1;
}
else {
pac_stat.insert(pac, 1);
}
}
println!("# Overall statistics:");
for i in 0..31 {
println!("# {}\t{}", i, diff_counts[i]);
}
println!("# Per-base statistics:");
for i in 0..31 {
println!("# {}\t{}", i, diff_freq[i]);
}
//try!(write!(output, "{}", "# pac counts:\n"));
for (pac, counts) in &pac_stat {
try!(write!(output, "{} {} {}\n", pac, hamming(&pac, &wt_pac), counts));
}
Ok("Done".into())
}
fn main() {
let args : Vec<String> = env::args().collect();
let file1 = fastq::Reader::from_file(&args[1]).unwrap();
let file2 = fastq::Reader::from_file(&args[2]).unwrap();
let mut num_records = 0;
let mut num_duplicates = 0;
let mut num_qual_skip = 0;
let mut results : HashMap<String, (String, Vec<u8>)>= HashMap::new();
let wt_read1 = if &args[3] == "M" {b"ACTAAGTGAGATGAATATGGCGGCACCAAAGGGCAACCGATTTTGGGAGGCCCGCAGTAGTCATGGGCGAAATCCTAAATTCGAATCGCCTGAGGCGCTGTGGGCTGCTTGTTGTGAA"}
else {b"AAGTGAGATGAATATGGCGGCACCAAAGGGCAACCGATTTTGGGAGGCCCGCAGTAGTCATGGGCGAAATCCTAAATTCGAATCGCCTGAGGCGCTGTGGGCTGCTTGTTGTGAATAC"};
for (record1, record2) in file1.records().zip(file2.records()) {
// take read1, filter low quality reads
let read1 = record1.unwrap();
let desc = read1.id().unwrap().split(":").skip(5).collect::<Vec<&str>>();
let description = desc[0].to_string() + ":" + desc[1];
let mut trim = 124;
let mut am = " ".to_string();
for i in 0..120 {
if qual_check(&read1.qual()[i .. i+5], &[63, 63, 63, 63, 63]) {
trim = i+1;
println!("# {} {}: Read 1 trimmed at {}.", num_records, description, trim);
break;
}
}
if trim < 18 {
println!("# {}: Useful read too short. Skipping. L = {}", num_records, trim);
num_qual_skip += 1;
num_records += 1;
continue;
}
// check if the read is the right read
let seq1 = String::from_utf8_lossy(&read1.seq()[0 .. trim]);
let score = |a: u8, b: u8| if a == b {1i32} else {-1i32};
let mut aligner = Aligner::with_capacity(seq1.len(), wt_read1.len(), -5, -1, &score);
let alignment = aligner.global(&seq1[8..seq1.len()].as_bytes(), wt_read1);
if alignment.score < (2 * trim as i32 - 133 - 30) {
println!("# {} {}: wrong read 1 skipping", num_records, description);
println!("# {} {}", &seq1[8..seq1.len()], alignment.score);
num_records += 1;
num_qual_skip += 1;
continue;
}
// identifying AM/WT
if &args[3] == "M" {
if trim < 33 {
println!("# {}: Useful read too short for M. Skipping. L = {}", num_records, trim);
num_qual_skip += 1;
num_records += 1;
continue;
}
// Allowing 1 mismatch
if hamming(&seq1[27 .. 32], "GCGGC") < 2 {
match &seq1[32 .. 33] {
"A" => am = "WT".to_string(),
"G" => am = "AM".to_string(),
_ => am = " ".to_string(),
}
println!("# 1 am_codon = {}", &seq1[27 .. 33]);
}
if am == " " {
for i in 0 .. trim-6 {
if &seq1[i .. i+5] == "GCGGC" {
match &seq1[i+5 .. i+6] {
"A" => am = "WT".to_string(),
"G" => am = "AM".to_string(),
_ => am = " ".to_string(),
}
println!("# 2 am_codon = {}", &seq1[i .. i+6]);
break;
}
}
}
}
// average quality filtering
//let avg_qual = read1.qual().iter().fold(0, |a, &b| a as u32 + b as u32);
//if avg_qual < (125 * 30) { // corresponding to an average quality of 20
// println!("# low quality read 1 skipping: {}", avg_qual);
// continue;
//}
// now deal with read2
let read2 = record2.unwrap();
// average quality filtering
//let avg_qual = read2.qual().iter().fold(0, |a, &b| a as u32 + b as u32);
//if avg_qual < 125*30 {
// println!("# {}: low quality read 2 skipping: {}", num_records, avg_qual);
// num_qual_skip += 1;
// continue;
//}
trim = 124;
for i in 0..119 {
if qual_check(&read2.qual()[i .. i+5], &[63, 63, 63, 63, 63]) {
trim = i+1;
println!("# {} {}: Read 2 trimmed at {}.", num_records, description, i);
break;
}
}
if trim < 80 {
println!("# {}: Useful read too short. Skipping. | {
let mut score = 0;
for (i, j) in seq1.chars().zip(seq2.chars()) {
if i != j {
score += 1;
}
}
score
} | identifier_body | |
get.go | ]string
Vars []string
}
// Clone clones the config options
func (co *ConfigOptions) Clone() (*ConfigOptions, error) {
out, err := yaml.Marshal(co)
if err != nil {
return nil, err
}
newCo := &ConfigOptions{}
err = yaml.Unmarshal(out, newCo)
if err != nil {
return nil, err
}
return newCo, nil
}
// GetBaseConfig returns the config
func GetBaseConfig(options *ConfigOptions) (*latest.Config, error) {
return loadConfigOnce(options, false)
}
// GetConfig returns the config merged with all potential overwrite files
func GetConfig(options *ConfigOptions) (*latest.Config, error) {
return loadConfigOnce(options, true)
}
// GetRawConfig loads the raw config from a given path
func GetRawConfig(configPath string) (map[interface{}]interface{}, error) {
fileContent, err := ioutil.ReadFile(configPath)
if err != nil {
return nil, err
}
rawMap := map[interface{}]interface{}{}
err = yaml.Unmarshal(fileContent, &rawMap)
if err != nil {
return nil, err
}
return rawMap, nil
}
// GetConfigFromPath loads the config from a given base path
func GetConfigFromPath(generatedConfig *generated.Config, basePath string, options *ConfigOptions, log log.Logger) (*latest.Config, error) {
if options == nil {
options = &ConfigOptions{}
}
configPath := filepath.Join(basePath, constants.DefaultConfigPath)
// Check devspace.yaml
_, err := os.Stat(configPath)
if err != nil {
// Check for legacy devspace-configs.yaml
_, configErr := os.Stat(filepath.Join(basePath, constants.DefaultConfigsPath))
if configErr == nil {
return nil, errors.Errorf("devspace-configs.yaml is not supported anymore in devspace v4. Please use 'profiles' in 'devspace.yaml' instead")
}
return nil, errors.Errorf("Couldn't find '%s': %v", configPath, err)
}
rawMap, err := GetRawConfig(configPath)
if err != nil {
return nil, err
}
loadedConfig, err := ParseConfig(generatedConfig, rawMap, options, log)
if err != nil {
return nil, err
}
// Now we validate the config
err = validate(loadedConfig)
if err != nil {
return nil, err
}
return loadedConfig, nil
}
// loadConfigOnce loads the config globally once
func loadConfigOnce(options *ConfigOptions, allowProfile bool) (*latest.Config, error) {
getConfigOnceMutex.Lock()
defer getConfigOnceMutex.Unlock()
getConfigOnce.Do(func() {
if options == nil {
options = &ConfigOptions{}
}
// Get generated config
generatedConfig, err := generated.LoadConfig(options.Profile)
if err != nil {
getConfigOnceErr = err
return
}
// Check if we should load a specific config
if allowProfile && generatedConfig.ActiveProfile != "" && options.Profile == "" {
options.Profile = generatedConfig.ActiveProfile
} else if !allowProfile {
options.Profile = ""
}
// Set loaded vars for this
options.LoadedVars = LoadedVars
// Load base config
config, err = GetConfigFromPath(generatedConfig, ".", options, log.GetInstance())
if err != nil {
getConfigOnceErr = err
return
}
// Save generated config
err = generated.SaveConfig(generatedConfig)
if err != nil {
getConfigOnceErr = err
return
}
})
return config, getConfigOnceErr
}
func validate(config *latest.Config) error {
if config.Dev != nil {
if config.Dev.Ports != nil {
for index, port := range config.Dev.Ports {
if port.ImageName == "" && port.LabelSelector == nil {
return errors.Errorf("Error in config: imageName and label selector are nil in port config at index %d", index)
}
if port.PortMappings == nil {
return errors.Errorf("Error in config: portMappings is empty in port config at index %d", index)
}
}
}
if config.Dev.Sync != nil {
for index, sync := range config.Dev.Sync {
if sync.ImageName == "" && sync.LabelSelector == nil {
return errors.Errorf("Error in config: imageName and label selector are nil in sync config at index %d", index)
}
}
}
if config.Dev.Interactive != nil {
for index, imageConf := range config.Dev.Interactive.Images {
if imageConf.Name == "" {
return errors.Errorf("Error in config: Unnamed interactive image config at index %d", index)
}
}
}
}
if config.Commands != nil {
for index, command := range config.Commands {
if command.Name == "" {
return errors.Errorf("commands[%d].name is required", index)
}
if command.Command == "" {
return errors.Errorf("commands[%d].command is required", index)
}
}
}
if config.Hooks != nil {
for index, hookConfig := range config.Hooks {
if hookConfig.Command == "" {
return errors.Errorf("hooks[%d].command is required", index)
}
}
}
if config.Images != nil {
for imageConfigName, imageConf := range config.Images {
if imageConfigName == "" {
return errors.Errorf("images keys cannot be an empty string")
}
if imageConf.Image == "" {
return errors.Errorf("images.%s.image is required", imageConfigName)
}
if imageConf.Build != nil && imageConf.Build.Custom != nil && imageConf.Build.Custom.Command == "" {
return errors.Errorf("images.%s.build.custom.command is required", imageConfigName)
}
if imageConf.Image == "" {
return fmt.Errorf("images.%s.image is required", imageConfigName)
}
}
}
if config.Deployments != nil {
for index, deployConfig := range config.Deployments {
if deployConfig.Name == "" {
return errors.Errorf("deployments[%d].name is required", index)
}
if deployConfig.Helm == nil && deployConfig.Kubectl == nil {
return errors.Errorf("Please specify either helm or kubectl as deployment type in deployment %s", deployConfig.Name)
}
if deployConfig.Helm != nil && (deployConfig.Helm.Chart == nil || deployConfig.Helm.Chart.Name == "") && (deployConfig.Helm.ComponentChart == nil || *deployConfig.Helm.ComponentChart == false) {
return errors.Errorf("deployments[%d].helm.chart and deployments[%d].helm.chart.name or deployments[%d].helm.componentChart is required", index, index, index)
}
if deployConfig.Kubectl != nil && deployConfig.Kubectl.Manifests == nil {
return errors.Errorf("deployments[%d].kubectl.manifests is required", index)
}
if deployConfig.Helm != nil && deployConfig.Helm.ComponentChart != nil && *deployConfig.Helm.ComponentChart == true {
// Load override values from path
overwriteValues := map[interface{}]interface{}{}
if deployConfig.Helm.ValuesFiles != nil {
for _, overridePath := range deployConfig.Helm.ValuesFiles {
overwriteValuesPath, err := filepath.Abs(overridePath)
if err != nil {
return errors.Errorf("deployments[%d].helm.valuesFiles: Error retrieving absolute path from %s: %v", index, overridePath, err)
}
overwriteValuesFromPath := map[interface{}]interface{}{}
err = yamlutil.ReadYamlFromFile(overwriteValuesPath, overwriteValuesFromPath)
if err == nil {
merge.Values(overwriteValues).MergeInto(overwriteValuesFromPath)
}
}
}
// Load override values from data and merge them
if deployConfig.Helm.Values != nil {
merge.Values(overwriteValues).MergeInto(deployConfig.Helm.Values)
}
bytes, err := yaml.Marshal(overwriteValues)
if err != nil {
return errors.Errorf("deployments[%d].helm: Error marshaling overwrite values: %v", index, err)
}
componentValues := &latest.ComponentConfig{}
err = yaml.UnmarshalStrict(bytes, componentValues)
if err != nil {
return errors.Errorf("deployments[%d].helm.componentChart: component values are incorrect: %v", index, err)
}
}
}
}
return nil
}
// SetDevSpaceRoot checks the current directory and all parent directories for a .devspace folder with a config and sets the current working directory accordingly
func SetDevSpaceRoot(log log.Logger) (bool, error) | {
cwd, err := os.Getwd()
if err != nil {
return false, err
}
originalCwd := cwd
homedir, err := homedir.Dir()
if err != nil {
return false, err
}
lastLength := 0
for len(cwd) != lastLength {
if cwd != homedir {
configExists := configExistsInPath(cwd)
if configExists {
// Change working directory
err = os.Chdir(cwd)
if err != nil { | identifier_body | |
get.go | , newCo)
if err != nil {
return nil, err
}
return newCo, nil
}
// GetBaseConfig returns the config
func GetBaseConfig(options *ConfigOptions) (*latest.Config, error) {
return loadConfigOnce(options, false)
}
// GetConfig returns the config merged with all potential overwrite files
func GetConfig(options *ConfigOptions) (*latest.Config, error) {
return loadConfigOnce(options, true)
}
// GetRawConfig loads the raw config from a given path
func GetRawConfig(configPath string) (map[interface{}]interface{}, error) {
fileContent, err := ioutil.ReadFile(configPath)
if err != nil {
return nil, err
}
rawMap := map[interface{}]interface{}{}
err = yaml.Unmarshal(fileContent, &rawMap)
if err != nil {
return nil, err
}
return rawMap, nil
}
// GetConfigFromPath loads the config from a given base path
func GetConfigFromPath(generatedConfig *generated.Config, basePath string, options *ConfigOptions, log log.Logger) (*latest.Config, error) {
if options == nil {
options = &ConfigOptions{}
}
configPath := filepath.Join(basePath, constants.DefaultConfigPath)
// Check devspace.yaml
_, err := os.Stat(configPath)
if err != nil {
// Check for legacy devspace-configs.yaml
_, configErr := os.Stat(filepath.Join(basePath, constants.DefaultConfigsPath))
if configErr == nil {
return nil, errors.Errorf("devspace-configs.yaml is not supported anymore in devspace v4. Please use 'profiles' in 'devspace.yaml' instead")
}
return nil, errors.Errorf("Couldn't find '%s': %v", configPath, err)
}
rawMap, err := GetRawConfig(configPath)
if err != nil {
return nil, err
}
loadedConfig, err := ParseConfig(generatedConfig, rawMap, options, log)
if err != nil {
return nil, err
}
// Now we validate the config
err = validate(loadedConfig)
if err != nil {
return nil, err
}
return loadedConfig, nil
}
// loadConfigOnce loads the config globally once
func loadConfigOnce(options *ConfigOptions, allowProfile bool) (*latest.Config, error) {
getConfigOnceMutex.Lock()
defer getConfigOnceMutex.Unlock()
getConfigOnce.Do(func() {
if options == nil {
options = &ConfigOptions{}
}
// Get generated config
generatedConfig, err := generated.LoadConfig(options.Profile)
if err != nil {
getConfigOnceErr = err
return
}
// Check if we should load a specific config
if allowProfile && generatedConfig.ActiveProfile != "" && options.Profile == "" {
options.Profile = generatedConfig.ActiveProfile
} else if !allowProfile {
options.Profile = ""
}
// Set loaded vars for this
options.LoadedVars = LoadedVars
// Load base config
config, err = GetConfigFromPath(generatedConfig, ".", options, log.GetInstance())
if err != nil {
getConfigOnceErr = err
return
}
// Save generated config
err = generated.SaveConfig(generatedConfig)
if err != nil {
getConfigOnceErr = err
return
}
})
return config, getConfigOnceErr
}
func validate(config *latest.Config) error {
if config.Dev != nil {
if config.Dev.Ports != nil {
for index, port := range config.Dev.Ports {
if port.ImageName == "" && port.LabelSelector == nil {
return errors.Errorf("Error in config: imageName and label selector are nil in port config at index %d", index)
}
if port.PortMappings == nil {
return errors.Errorf("Error in config: portMappings is empty in port config at index %d", index)
}
}
}
if config.Dev.Sync != nil {
for index, sync := range config.Dev.Sync {
if sync.ImageName == "" && sync.LabelSelector == nil {
return errors.Errorf("Error in config: imageName and label selector are nil in sync config at index %d", index)
}
}
}
if config.Dev.Interactive != nil {
for index, imageConf := range config.Dev.Interactive.Images {
if imageConf.Name == "" {
return errors.Errorf("Error in config: Unnamed interactive image config at index %d", index)
}
}
}
}
if config.Commands != nil {
for index, command := range config.Commands {
if command.Name == "" {
return errors.Errorf("commands[%d].name is required", index)
}
if command.Command == "" {
return errors.Errorf("commands[%d].command is required", index)
}
}
}
if config.Hooks != nil {
for index, hookConfig := range config.Hooks {
if hookConfig.Command == "" {
return errors.Errorf("hooks[%d].command is required", index)
}
}
}
if config.Images != nil {
for imageConfigName, imageConf := range config.Images {
if imageConfigName == "" {
return errors.Errorf("images keys cannot be an empty string")
}
if imageConf.Image == "" {
return errors.Errorf("images.%s.image is required", imageConfigName)
}
if imageConf.Build != nil && imageConf.Build.Custom != nil && imageConf.Build.Custom.Command == "" {
return errors.Errorf("images.%s.build.custom.command is required", imageConfigName)
}
if imageConf.Image == "" {
return fmt.Errorf("images.%s.image is required", imageConfigName)
}
}
}
if config.Deployments != nil {
for index, deployConfig := range config.Deployments {
if deployConfig.Name == "" {
return errors.Errorf("deployments[%d].name is required", index)
}
if deployConfig.Helm == nil && deployConfig.Kubectl == nil {
return errors.Errorf("Please specify either helm or kubectl as deployment type in deployment %s", deployConfig.Name)
}
if deployConfig.Helm != nil && (deployConfig.Helm.Chart == nil || deployConfig.Helm.Chart.Name == "") && (deployConfig.Helm.ComponentChart == nil || *deployConfig.Helm.ComponentChart == false) {
return errors.Errorf("deployments[%d].helm.chart and deployments[%d].helm.chart.name or deployments[%d].helm.componentChart is required", index, index, index)
}
if deployConfig.Kubectl != nil && deployConfig.Kubectl.Manifests == nil {
return errors.Errorf("deployments[%d].kubectl.manifests is required", index)
}
if deployConfig.Helm != nil && deployConfig.Helm.ComponentChart != nil && *deployConfig.Helm.ComponentChart == true {
// Load override values from path
overwriteValues := map[interface{}]interface{}{}
if deployConfig.Helm.ValuesFiles != nil {
for _, overridePath := range deployConfig.Helm.ValuesFiles {
overwriteValuesPath, err := filepath.Abs(overridePath)
if err != nil {
return errors.Errorf("deployments[%d].helm.valuesFiles: Error retrieving absolute path from %s: %v", index, overridePath, err)
}
overwriteValuesFromPath := map[interface{}]interface{}{}
err = yamlutil.ReadYamlFromFile(overwriteValuesPath, overwriteValuesFromPath)
if err == nil {
merge.Values(overwriteValues).MergeInto(overwriteValuesFromPath)
}
}
}
// Load override values from data and merge them
if deployConfig.Helm.Values != nil {
merge.Values(overwriteValues).MergeInto(deployConfig.Helm.Values)
}
bytes, err := yaml.Marshal(overwriteValues)
if err != nil {
return errors.Errorf("deployments[%d].helm: Error marshaling overwrite values: %v", index, err)
}
componentValues := &latest.ComponentConfig{}
err = yaml.UnmarshalStrict(bytes, componentValues)
if err != nil {
return errors.Errorf("deployments[%d].helm.componentChart: component values are incorrect: %v", index, err)
}
}
}
}
return nil
}
// SetDevSpaceRoot checks the current directory and all parent directories for a .devspace folder with a config and sets the current working directory accordingly
func SetDevSpaceRoot(log log.Logger) (bool, error) {
cwd, err := os.Getwd()
if err != nil {
return false, err
}
originalCwd := cwd
homedir, err := homedir.Dir()
if err != nil {
return false, err
}
lastLength := 0
for len(cwd) != lastLength {
if cwd != homedir | {
configExists := configExistsInPath(cwd)
if configExists {
// Change working directory
err = os.Chdir(cwd)
if err != nil {
return false, err
}
// Notify user that we are not using the current working directory
if originalCwd != cwd {
log.Infof("Using devspace config in %s", filepath.ToSlash(cwd))
}
return true, nil
}
} | conditional_block | |
get.go |
var getConfigOnce sync.Once
var getConfigOnceErr error
var getConfigOnceMutex sync.Mutex
// ConfigExists checks whether the yaml file for the config exists or the configs.yaml exists
func ConfigExists() bool {
return configExistsInPath(".")
}
// configExistsInPath checks wheter a devspace configuration exists at a certain path
func configExistsInPath(path string) bool {
// Needed for testing
if config != nil {
return true
}
// Check devspace.yaml
_, err := os.Stat(filepath.Join(path, constants.DefaultConfigPath))
if err == nil {
return true
}
// Check devspace-configs.yaml
_, err = os.Stat(filepath.Join(path, constants.DefaultConfigsPath))
if err == nil {
return true
}
return false // Normal config file found
}
// ResetConfig resets the current config
func ResetConfig() {
getConfigOnceMutex.Lock()
defer getConfigOnceMutex.Unlock()
getConfigOnce = sync.Once{}
getConfigOnceErr = nil
}
// InitConfig initializes the config objects
func InitConfig() *latest.Config {
getConfigOnceMutex.Lock()
defer getConfigOnceMutex.Unlock()
getConfigOnce.Do(func() {
config = latest.New().(*latest.Config)
})
return config
}
// ConfigOptions defines options to load the config
type ConfigOptions struct {
Profile string
KubeContext string
LoadedVars map[string]string
Vars []string
}
// Clone clones the config options
func (co *ConfigOptions) Clone() (*ConfigOptions, error) {
out, err := yaml.Marshal(co)
if err != nil {
return nil, err
}
newCo := &ConfigOptions{}
err = yaml.Unmarshal(out, newCo)
if err != nil {
return nil, err
}
return newCo, nil
}
// GetBaseConfig returns the config
func GetBaseConfig(options *ConfigOptions) (*latest.Config, error) {
return loadConfigOnce(options, false)
}
// GetConfig returns the config merged with all potential overwrite files
func GetConfig(options *ConfigOptions) (*latest.Config, error) {
return loadConfigOnce(options, true)
}
// GetRawConfig loads the raw config from a given path
func GetRawConfig(configPath string) (map[interface{}]interface{}, error) {
fileContent, err := ioutil.ReadFile(configPath)
if err != nil {
return nil, err
}
rawMap := map[interface{}]interface{}{}
err = yaml.Unmarshal(fileContent, &rawMap)
if err != nil {
return nil, err
}
return rawMap, nil
}
// GetConfigFromPath loads the config from a given base path
func | (generatedConfig *generated.Config, basePath string, options *ConfigOptions, log log.Logger) (*latest.Config, error) {
if options == nil {
options = &ConfigOptions{}
}
configPath := filepath.Join(basePath, constants.DefaultConfigPath)
// Check devspace.yaml
_, err := os.Stat(configPath)
if err != nil {
// Check for legacy devspace-configs.yaml
_, configErr := os.Stat(filepath.Join(basePath, constants.DefaultConfigsPath))
if configErr == nil {
return nil, errors.Errorf("devspace-configs.yaml is not supported anymore in devspace v4. Please use 'profiles' in 'devspace.yaml' instead")
}
return nil, errors.Errorf("Couldn't find '%s': %v", configPath, err)
}
rawMap, err := GetRawConfig(configPath)
if err != nil {
return nil, err
}
loadedConfig, err := ParseConfig(generatedConfig, rawMap, options, log)
if err != nil {
return nil, err
}
// Now we validate the config
err = validate(loadedConfig)
if err != nil {
return nil, err
}
return loadedConfig, nil
}
// loadConfigOnce loads the config globally once
func loadConfigOnce(options *ConfigOptions, allowProfile bool) (*latest.Config, error) {
getConfigOnceMutex.Lock()
defer getConfigOnceMutex.Unlock()
getConfigOnce.Do(func() {
if options == nil {
options = &ConfigOptions{}
}
// Get generated config
generatedConfig, err := generated.LoadConfig(options.Profile)
if err != nil {
getConfigOnceErr = err
return
}
// Check if we should load a specific config
if allowProfile && generatedConfig.ActiveProfile != "" && options.Profile == "" {
options.Profile = generatedConfig.ActiveProfile
} else if !allowProfile {
options.Profile = ""
}
// Set loaded vars for this
options.LoadedVars = LoadedVars
// Load base config
config, err = GetConfigFromPath(generatedConfig, ".", options, log.GetInstance())
if err != nil {
getConfigOnceErr = err
return
}
// Save generated config
err = generated.SaveConfig(generatedConfig)
if err != nil {
getConfigOnceErr = err
return
}
})
return config, getConfigOnceErr
}
func validate(config *latest.Config) error {
if config.Dev != nil {
if config.Dev.Ports != nil {
for index, port := range config.Dev.Ports {
if port.ImageName == "" && port.LabelSelector == nil {
return errors.Errorf("Error in config: imageName and label selector are nil in port config at index %d", index)
}
if port.PortMappings == nil {
return errors.Errorf("Error in config: portMappings is empty in port config at index %d", index)
}
}
}
if config.Dev.Sync != nil {
for index, sync := range config.Dev.Sync {
if sync.ImageName == "" && sync.LabelSelector == nil {
return errors.Errorf("Error in config: imageName and label selector are nil in sync config at index %d", index)
}
}
}
if config.Dev.Interactive != nil {
for index, imageConf := range config.Dev.Interactive.Images {
if imageConf.Name == "" {
return errors.Errorf("Error in config: Unnamed interactive image config at index %d", index)
}
}
}
}
if config.Commands != nil {
for index, command := range config.Commands {
if command.Name == "" {
return errors.Errorf("commands[%d].name is required", index)
}
if command.Command == "" {
return errors.Errorf("commands[%d].command is required", index)
}
}
}
if config.Hooks != nil {
for index, hookConfig := range config.Hooks {
if hookConfig.Command == "" {
return errors.Errorf("hooks[%d].command is required", index)
}
}
}
if config.Images != nil {
for imageConfigName, imageConf := range config.Images {
if imageConfigName == "" {
return errors.Errorf("images keys cannot be an empty string")
}
if imageConf.Image == "" {
return errors.Errorf("images.%s.image is required", imageConfigName)
}
if imageConf.Build != nil && imageConf.Build.Custom != nil && imageConf.Build.Custom.Command == "" {
return errors.Errorf("images.%s.build.custom.command is required", imageConfigName)
}
if imageConf.Image == "" {
return fmt.Errorf("images.%s.image is required", imageConfigName)
}
}
}
if config.Deployments != nil {
for index, deployConfig := range config.Deployments {
if deployConfig.Name == "" {
return errors.Errorf("deployments[%d].name is required", index)
}
if deployConfig.Helm == nil && deployConfig.Kubectl == nil {
return errors.Errorf("Please specify either helm or kubectl as deployment type in deployment %s", deployConfig.Name)
}
if deployConfig.Helm != nil && (deployConfig.Helm.Chart == nil || deployConfig.Helm.Chart.Name == "") && (deployConfig.Helm.ComponentChart == nil || *deployConfig.Helm.ComponentChart == false) {
return errors.Errorf("deployments[%d].helm.chart and deployments[%d].helm.chart.name or deployments[%d].helm.componentChart is required", index, index, index)
}
if deployConfig.Kubectl != nil && deployConfig.Kubectl.Manifests == nil {
return errors.Errorf("deployments[%d].kubectl.manifests is required", index)
}
if deployConfig.Helm != nil && deployConfig.Helm.ComponentChart != nil && *deployConfig.Helm.ComponentChart == true {
// Load override values from path
overwriteValues := map[interface{}]interface{}{}
if deployConfig.Helm.ValuesFiles != nil {
for _, overridePath := range deployConfig.Helm.ValuesFiles {
overwriteValuesPath, err := filepath.Abs(overridePath)
if err != nil {
return errors.Errorf("deployments[%d].helm.valuesFiles: Error retrieving absolute path from %s: %v", index, overridePath, err)
}
overwriteValuesFromPath := map[interface{}]interface{}{}
err = yamlutil.ReadYamlFromFile(overwriteValuesPath, overwriteValuesFromPath)
if err == nil {
merge.Values(overwriteValues).MergeInto(overwriteValuesFromPath)
}
}
}
// Load override values from data and merge them
if deployConfig.Helm | GetConfigFromPath | identifier_name |
get.go |
var getConfigOnce sync.Once
var getConfigOnceErr error
var getConfigOnceMutex sync.Mutex
// ConfigExists checks whether the yaml file for the config exists or the configs.yaml exists
func ConfigExists() bool {
return configExistsInPath(".")
}
// configExistsInPath checks wheter a devspace configuration exists at a certain path
func configExistsInPath(path string) bool {
// Needed for testing
if config != nil {
return true
}
// Check devspace.yaml
_, err := os.Stat(filepath.Join(path, constants.DefaultConfigPath))
if err == nil {
return true
}
// Check devspace-configs.yaml
_, err = os.Stat(filepath.Join(path, constants.DefaultConfigsPath))
if err == nil {
return true
}
return false // Normal config file found
}
// ResetConfig resets the current config
func ResetConfig() {
getConfigOnceMutex.Lock()
defer getConfigOnceMutex.Unlock()
getConfigOnce = sync.Once{}
getConfigOnceErr = nil
}
// InitConfig initializes the config objects
func InitConfig() *latest.Config {
getConfigOnceMutex.Lock()
defer getConfigOnceMutex.Unlock()
getConfigOnce.Do(func() {
config = latest.New().(*latest.Config)
})
return config
}
// ConfigOptions defines options to load the config
type ConfigOptions struct {
Profile string
KubeContext string
LoadedVars map[string]string
Vars []string
}
// Clone clones the config options
func (co *ConfigOptions) Clone() (*ConfigOptions, error) {
out, err := yaml.Marshal(co)
if err != nil {
return nil, err
}
newCo := &ConfigOptions{}
err = yaml.Unmarshal(out, newCo)
if err != nil {
return nil, err
}
return newCo, nil
}
// GetBaseConfig returns the config
func GetBaseConfig(options *ConfigOptions) (*latest.Config, error) {
return loadConfigOnce(options, false)
}
// GetConfig returns the config merged with all potential overwrite files
func GetConfig(options *ConfigOptions) (*latest.Config, error) {
return loadConfigOnce(options, true)
}
// GetRawConfig loads the raw config from a given path | if err != nil {
return nil, err
}
rawMap := map[interface{}]interface{}{}
err = yaml.Unmarshal(fileContent, &rawMap)
if err != nil {
return nil, err
}
return rawMap, nil
}
// GetConfigFromPath loads the config from a given base path
func GetConfigFromPath(generatedConfig *generated.Config, basePath string, options *ConfigOptions, log log.Logger) (*latest.Config, error) {
if options == nil {
options = &ConfigOptions{}
}
configPath := filepath.Join(basePath, constants.DefaultConfigPath)
// Check devspace.yaml
_, err := os.Stat(configPath)
if err != nil {
// Check for legacy devspace-configs.yaml
_, configErr := os.Stat(filepath.Join(basePath, constants.DefaultConfigsPath))
if configErr == nil {
return nil, errors.Errorf("devspace-configs.yaml is not supported anymore in devspace v4. Please use 'profiles' in 'devspace.yaml' instead")
}
return nil, errors.Errorf("Couldn't find '%s': %v", configPath, err)
}
rawMap, err := GetRawConfig(configPath)
if err != nil {
return nil, err
}
loadedConfig, err := ParseConfig(generatedConfig, rawMap, options, log)
if err != nil {
return nil, err
}
// Now we validate the config
err = validate(loadedConfig)
if err != nil {
return nil, err
}
return loadedConfig, nil
}
// loadConfigOnce loads the config globally once
func loadConfigOnce(options *ConfigOptions, allowProfile bool) (*latest.Config, error) {
getConfigOnceMutex.Lock()
defer getConfigOnceMutex.Unlock()
getConfigOnce.Do(func() {
if options == nil {
options = &ConfigOptions{}
}
// Get generated config
generatedConfig, err := generated.LoadConfig(options.Profile)
if err != nil {
getConfigOnceErr = err
return
}
// Check if we should load a specific config
if allowProfile && generatedConfig.ActiveProfile != "" && options.Profile == "" {
options.Profile = generatedConfig.ActiveProfile
} else if !allowProfile {
options.Profile = ""
}
// Set loaded vars for this
options.LoadedVars = LoadedVars
// Load base config
config, err = GetConfigFromPath(generatedConfig, ".", options, log.GetInstance())
if err != nil {
getConfigOnceErr = err
return
}
// Save generated config
err = generated.SaveConfig(generatedConfig)
if err != nil {
getConfigOnceErr = err
return
}
})
return config, getConfigOnceErr
}
func validate(config *latest.Config) error {
if config.Dev != nil {
if config.Dev.Ports != nil {
for index, port := range config.Dev.Ports {
if port.ImageName == "" && port.LabelSelector == nil {
return errors.Errorf("Error in config: imageName and label selector are nil in port config at index %d", index)
}
if port.PortMappings == nil {
return errors.Errorf("Error in config: portMappings is empty in port config at index %d", index)
}
}
}
if config.Dev.Sync != nil {
for index, sync := range config.Dev.Sync {
if sync.ImageName == "" && sync.LabelSelector == nil {
return errors.Errorf("Error in config: imageName and label selector are nil in sync config at index %d", index)
}
}
}
if config.Dev.Interactive != nil {
for index, imageConf := range config.Dev.Interactive.Images {
if imageConf.Name == "" {
return errors.Errorf("Error in config: Unnamed interactive image config at index %d", index)
}
}
}
}
if config.Commands != nil {
for index, command := range config.Commands {
if command.Name == "" {
return errors.Errorf("commands[%d].name is required", index)
}
if command.Command == "" {
return errors.Errorf("commands[%d].command is required", index)
}
}
}
if config.Hooks != nil {
for index, hookConfig := range config.Hooks {
if hookConfig.Command == "" {
return errors.Errorf("hooks[%d].command is required", index)
}
}
}
if config.Images != nil {
for imageConfigName, imageConf := range config.Images {
if imageConfigName == "" {
return errors.Errorf("images keys cannot be an empty string")
}
if imageConf.Image == "" {
return errors.Errorf("images.%s.image is required", imageConfigName)
}
if imageConf.Build != nil && imageConf.Build.Custom != nil && imageConf.Build.Custom.Command == "" {
return errors.Errorf("images.%s.build.custom.command is required", imageConfigName)
}
if imageConf.Image == "" {
return fmt.Errorf("images.%s.image is required", imageConfigName)
}
}
}
if config.Deployments != nil {
for index, deployConfig := range config.Deployments {
if deployConfig.Name == "" {
return errors.Errorf("deployments[%d].name is required", index)
}
if deployConfig.Helm == nil && deployConfig.Kubectl == nil {
return errors.Errorf("Please specify either helm or kubectl as deployment type in deployment %s", deployConfig.Name)
}
if deployConfig.Helm != nil && (deployConfig.Helm.Chart == nil || deployConfig.Helm.Chart.Name == "") && (deployConfig.Helm.ComponentChart == nil || *deployConfig.Helm.ComponentChart == false) {
return errors.Errorf("deployments[%d].helm.chart and deployments[%d].helm.chart.name or deployments[%d].helm.componentChart is required", index, index, index)
}
if deployConfig.Kubectl != nil && deployConfig.Kubectl.Manifests == nil {
return errors.Errorf("deployments[%d].kubectl.manifests is required", index)
}
if deployConfig.Helm != nil && deployConfig.Helm.ComponentChart != nil && *deployConfig.Helm.ComponentChart == true {
// Load override values from path
overwriteValues := map[interface{}]interface{}{}
if deployConfig.Helm.ValuesFiles != nil {
for _, overridePath := range deployConfig.Helm.ValuesFiles {
overwriteValuesPath, err := filepath.Abs(overridePath)
if err != nil {
return errors.Errorf("deployments[%d].helm.valuesFiles: Error retrieving absolute path from %s: %v", index, overridePath, err)
}
overwriteValuesFromPath := map[interface{}]interface{}{}
err = yamlutil.ReadYamlFromFile(overwriteValuesPath, overwriteValuesFromPath)
if err == nil {
merge.Values(overwriteValues).MergeInto(overwriteValuesFromPath)
}
}
}
// Load override values from data and merge them
if deployConfig.Helm.Values != | func GetRawConfig(configPath string) (map[interface{}]interface{}, error) {
fileContent, err := ioutil.ReadFile(configPath) | random_line_split |
charm.py | ATION_NAME = "legend-db"
LEGEND_GITLAB_RELATION_NAME = "legend-sdlc-gitlab"
LEGEND_STUDIO_RELATION_NAME = "legend-sdlc"
SDLC_SERVICE_URL_FORMAT = "%(schema)s://%(host)s:%(port)s%(path)s"
SDLC_CONFIG_FILE_CONTAINER_LOCAL_PATH = "/sdlc-config.yaml"
SDLC_MAIN_GITLAB_REDIRECT_URL = "%(base_url)s/auth/callback"
SDLC_GITLAB_REDIRECT_URI_FORMATS = [
SDLC_MAIN_GITLAB_REDIRECT_URL,
"%(base_url)s/pac4j/login/callback",
]
TRUSTSTORE_PASSPHRASE = "Legend SDLC"
TRUSTSTORE_CONTAINER_LOCAL_PATH = "/truststore.jks"
APPLICATION_CONNECTOR_PORT_HTTP = 7070
APPLICATION_ADMIN_CONNECTOR_PORT_HTTP = 7076
APPLICATION_ROOT_PATH = "/api"
APPLICATION_LOGGING_FORMAT = "%d{yyyy-MM-dd HH:mm:ss.SSS} %-5p [%thread] %c - %m%n"
GITLAB_PROJECT_VISIBILITY_PUBLIC = "public"
GITLAB_PROJECT_VISIBILITY_PRIVATE = "private"
GITLAB_REQUIRED_SCOPES = ["openid", "profile", "api"]
class LegendSDLCServerCharm(legend_operator_base.BaseFinosLegendCoreServiceCharm):
"""Charmed operator for the FINOS Legend SDLC Server."""
def __init__(self, *args):
super().__init__(*args)
# Studio relation events:
self.framework.observe(
self.on[LEGEND_STUDIO_RELATION_NAME].relation_joined, self._on_studio_relation_joined
)
self.framework.observe(
self.on[LEGEND_STUDIO_RELATION_NAME].relation_changed, self._on_studio_relation_changed
)
@classmethod
def _get_application_connector_port(cls):
return APPLICATION_CONNECTOR_PORT_HTTP
@classmethod
def _get_workload_container_name(cls):
return SDLC_CONTAINER_NAME
@classmethod
def _get_workload_service_names(cls):
return [SDLC_SERVICE_NAME]
@classmethod
def _get_workload_pebble_layers(cls):
return {
"sdlc": {
"summary": "SDLC layer.",
"description": "Pebble config layer for FINOS Legend SDLC.",
"services": {
"sdlc": {
"override": "replace",
"summary": "sdlc",
"command": (
# NOTE(aznashwan): starting through bash is needed
# for the classpath glob (-cp ...) to be expanded:
"/bin/sh -c 'java -XX:+ExitOnOutOfMemoryError "
"-XX:MaxRAMPercentage=60 -Xss4M -cp /app/bin/*.jar"
" -Dfile.encoding=UTF8 "
'-Djavax.net.ssl.trustStore="%s" '
'-Djavax.net.ssl.trustStorePassword="%s" '
"org.finos.legend.sdlc.server.LegendSDLCServer "
'server "%s"\''
% (
TRUSTSTORE_CONTAINER_LOCAL_PATH,
TRUSTSTORE_PASSPHRASE,
SDLC_CONFIG_FILE_CONTAINER_LOCAL_PATH,
)
),
# NOTE(aznashwan): considering the SDLC service expects
# a singular config file which already contains all
# relevant options in it (some of which will require
# the relation with DB/Gitlab to have already been
# established), we do not auto-start:
"startup": "disabled",
# TODO(aznashwan): determine any env vars we could pass
# (most notably, things like the RAM percentage etc...)
"environment": {},
}
},
}
}
def _get_jks_truststore_preferences(self):
jks_prefs = {
"truststore_path": TRUSTSTORE_CONTAINER_LOCAL_PATH,
"truststore_passphrase": TRUSTSTORE_PASSPHRASE,
"trusted_certificates": {},
}
cert = self._get_legend_gitlab_certificate()
if cert:
# NOTE(aznashwan): cert label 'gitlab-sdlc' is arbitrary:
jks_prefs["trusted_certificates"]["gitlab-sdlc"] = cert
return jks_prefs
@classmethod
def _get_legend_gitlab_relation_name(cls):
return LEGEND_GITLAB_RELATION_NAME
@classmethod
def _get_legend_db_relation_name(cls):
return LEGEND_DB_RELATION_NAME
def _get_sdlc_service_url(self):
ip_address = legend_operator_base.get_ip_address()
return SDLC_SERVICE_URL_FORMAT % (
{
# NOTE(aznashwan): we always return the plain HTTP endpoint:
"schema": "http",
"host": ip_address,
"port": APPLICATION_CONNECTOR_PORT_HTTP,
"path": APPLICATION_ROOT_PATH,
}
)
def _get_legend_gitlab_redirect_uris(self):
base_url = self._get_sdlc_service_url()
redirect_uris = [fmt % {"base_url": base_url} for fmt in SDLC_GITLAB_REDIRECT_URI_FORMATS]
return redirect_uris
def _get_core_legend_service_configs(self, legend_db_credentials, legend_gitlab_credentials):
# Check DB-related options:
if not legend_db_credentials:
|
legend_db_uri = legend_db_credentials["uri"]
legend_db = legend_db_credentials["database"]
# Check gitlab-related options:
gitlab_project_visibility = GITLAB_PROJECT_VISIBILITY_PRIVATE
if self.model.config["gitlab-create-new-projects-as-public"]:
gitlab_project_visibility = GITLAB_PROJECT_VISIBILITY_PUBLIC
if not legend_gitlab_credentials:
return model.WaitingStatus("no legend gitlab info present in relation yet")
gitlab_client_id = legend_gitlab_credentials["client_id"]
gitlab_client_secret = legend_gitlab_credentials["client_secret"]
gitlab_openid_discovery_url = legend_gitlab_credentials["openid_discovery_url"]
gitlab_project_tag = self.model.config["gitlab-project-tag"]
gitlab_project_creation_group_pattern = self.model.config[
"gitlab-project-creation-group-pattern"
]
# Check Java logging options:
request_logging_level = self._get_logging_level_from_config(
"server-requests-logging-level"
)
server_logging_level = self._get_logging_level_from_config("server-logging-level")
if not all([server_logging_level, request_logging_level]):
return model.BlockedStatus(
"one or more logging config options are improperly formatted "
"or missing, please review the debug-log for more details"
)
# Compile base config:
sdlc_config = {
"applicationName": "Legend SDLC",
"server": {
"rootPath": APPLICATION_ROOT_PATH,
"applicationConnectors": [
{
"type": legend_operator_base.APPLICATION_CONNECTOR_TYPE_HTTP,
"port": APPLICATION_CONNECTOR_PORT_HTTP,
"maxRequestHeaderSize": "128KiB",
}
],
"adminConnectors": [
{
"type": legend_operator_base.APPLICATION_CONNECTOR_TYPE_HTTP,
"port": APPLICATION_ADMIN_CONNECTOR_PORT_HTTP,
}
],
"gzip": {"includedMethods": ["GET", "POST"]},
"requestLog": {
"type": "classic",
"level": request_logging_level,
"appenders": [{"type": "console", "logFormat": "OFF"}],
},
},
"filterPriorities": {
"GitLab": 1,
"org.pac4j.j2e.filter.CallbackFilter": 2,
"org.pac4j.j2e.filter.SecurityFilter": 3,
"CORS": 4,
},
"pac4j": {
"callbackPrefix": "/api/pac4j/login",
"mongoUri": legend_db_uri,
"mongoDb": legend_db,
"clients": [
{
"org.finos.legend.server.pac4j.gitlab.GitlabClient": {
"name": "gitlab",
"clientId": gitlab_client_id,
"secret": gitlab_client_secret,
"discoveryUri": gitlab_openid_discovery_url,
# NOTE(aznashwan): needs to be a space-separated str:
"scope": " ".join(GITLAB_REQUIRED_SCOPES),
}
}
],
"mongoSession": {"enabled": True, "collection": "userSessions"},
"bypassPaths": ["/api/info"],
},
"gitLab": {
"newProjectVisibility": gitlab_project_visibility,
"projectTag": gitlab_project_tag,
"uat": {
"server": {
"scheme": legend_gitlab_credentials["gitlab_scheme"],
"host": "%s:%s"
% (
legend_gitlab_credentials["gitlab_host"],
legend_gitlab_credentials["gitlab_port"],
),
},
"app": {
"id": gitlab_client_id,
"secret": gitlab_client_secret,
"redirectURI": (
SDLC_MAIN_GITLAB_REDIRECT_URL
% {"base_url": self._get_sdlc_service_url()}
),
},
},
},
"projectStructure": {
"projectCreation": {"groupIdPattern": gitlab_project_creation_group_pattern},
"extensionProvider": {
"org.finos.legend.sdlc.server.gitlab.finos."
"FinosGitlabProjectStructureExtensionProvider": {}
| return model.WaitingStatus("no legend db info present in relation yet") | conditional_block |
charm.py | j/login/callback",
]
TRUSTSTORE_PASSPHRASE = "Legend SDLC"
TRUSTSTORE_CONTAINER_LOCAL_PATH = "/truststore.jks"
APPLICATION_CONNECTOR_PORT_HTTP = 7070
APPLICATION_ADMIN_CONNECTOR_PORT_HTTP = 7076
APPLICATION_ROOT_PATH = "/api"
APPLICATION_LOGGING_FORMAT = "%d{yyyy-MM-dd HH:mm:ss.SSS} %-5p [%thread] %c - %m%n"
GITLAB_PROJECT_VISIBILITY_PUBLIC = "public"
GITLAB_PROJECT_VISIBILITY_PRIVATE = "private"
GITLAB_REQUIRED_SCOPES = ["openid", "profile", "api"]
class LegendSDLCServerCharm(legend_operator_base.BaseFinosLegendCoreServiceCharm):
"""Charmed operator for the FINOS Legend SDLC Server."""
def __init__(self, *args):
super().__init__(*args)
# Studio relation events:
self.framework.observe(
self.on[LEGEND_STUDIO_RELATION_NAME].relation_joined, self._on_studio_relation_joined
)
self.framework.observe(
self.on[LEGEND_STUDIO_RELATION_NAME].relation_changed, self._on_studio_relation_changed
)
@classmethod
def _get_application_connector_port(cls):
return APPLICATION_CONNECTOR_PORT_HTTP
@classmethod
def _get_workload_container_name(cls):
return SDLC_CONTAINER_NAME
@classmethod
def _get_workload_service_names(cls):
return [SDLC_SERVICE_NAME]
@classmethod
def _get_workload_pebble_layers(cls):
return {
"sdlc": {
"summary": "SDLC layer.",
"description": "Pebble config layer for FINOS Legend SDLC.",
"services": {
"sdlc": {
"override": "replace",
"summary": "sdlc",
"command": (
# NOTE(aznashwan): starting through bash is needed
# for the classpath glob (-cp ...) to be expanded:
"/bin/sh -c 'java -XX:+ExitOnOutOfMemoryError "
"-XX:MaxRAMPercentage=60 -Xss4M -cp /app/bin/*.jar"
" -Dfile.encoding=UTF8 "
'-Djavax.net.ssl.trustStore="%s" '
'-Djavax.net.ssl.trustStorePassword="%s" '
"org.finos.legend.sdlc.server.LegendSDLCServer "
'server "%s"\''
% (
TRUSTSTORE_CONTAINER_LOCAL_PATH,
TRUSTSTORE_PASSPHRASE,
SDLC_CONFIG_FILE_CONTAINER_LOCAL_PATH,
)
),
# NOTE(aznashwan): considering the SDLC service expects
# a singular config file which already contains all
# relevant options in it (some of which will require
# the relation with DB/Gitlab to have already been
# established), we do not auto-start:
"startup": "disabled",
# TODO(aznashwan): determine any env vars we could pass
# (most notably, things like the RAM percentage etc...)
"environment": {},
}
},
}
}
def _get_jks_truststore_preferences(self):
jks_prefs = {
"truststore_path": TRUSTSTORE_CONTAINER_LOCAL_PATH,
"truststore_passphrase": TRUSTSTORE_PASSPHRASE,
"trusted_certificates": {},
}
cert = self._get_legend_gitlab_certificate()
if cert:
# NOTE(aznashwan): cert label 'gitlab-sdlc' is arbitrary:
jks_prefs["trusted_certificates"]["gitlab-sdlc"] = cert
return jks_prefs
@classmethod
def _get_legend_gitlab_relation_name(cls):
return LEGEND_GITLAB_RELATION_NAME
@classmethod
def _get_legend_db_relation_name(cls):
return LEGEND_DB_RELATION_NAME
def _get_sdlc_service_url(self):
ip_address = legend_operator_base.get_ip_address()
return SDLC_SERVICE_URL_FORMAT % (
{
# NOTE(aznashwan): we always return the plain HTTP endpoint:
"schema": "http",
"host": ip_address,
"port": APPLICATION_CONNECTOR_PORT_HTTP,
"path": APPLICATION_ROOT_PATH,
}
)
def _get_legend_gitlab_redirect_uris(self):
base_url = self._get_sdlc_service_url()
redirect_uris = [fmt % {"base_url": base_url} for fmt in SDLC_GITLAB_REDIRECT_URI_FORMATS]
return redirect_uris
def _get_core_legend_service_configs(self, legend_db_credentials, legend_gitlab_credentials):
# Check DB-related options:
if not legend_db_credentials:
return model.WaitingStatus("no legend db info present in relation yet")
legend_db_uri = legend_db_credentials["uri"]
legend_db = legend_db_credentials["database"]
# Check gitlab-related options:
gitlab_project_visibility = GITLAB_PROJECT_VISIBILITY_PRIVATE
if self.model.config["gitlab-create-new-projects-as-public"]:
gitlab_project_visibility = GITLAB_PROJECT_VISIBILITY_PUBLIC
if not legend_gitlab_credentials:
return model.WaitingStatus("no legend gitlab info present in relation yet")
gitlab_client_id = legend_gitlab_credentials["client_id"]
gitlab_client_secret = legend_gitlab_credentials["client_secret"]
gitlab_openid_discovery_url = legend_gitlab_credentials["openid_discovery_url"]
gitlab_project_tag = self.model.config["gitlab-project-tag"]
gitlab_project_creation_group_pattern = self.model.config[
"gitlab-project-creation-group-pattern"
]
# Check Java logging options:
request_logging_level = self._get_logging_level_from_config(
"server-requests-logging-level"
)
server_logging_level = self._get_logging_level_from_config("server-logging-level")
if not all([server_logging_level, request_logging_level]):
return model.BlockedStatus(
"one or more logging config options are improperly formatted "
"or missing, please review the debug-log for more details"
)
# Compile base config:
sdlc_config = {
"applicationName": "Legend SDLC",
"server": {
"rootPath": APPLICATION_ROOT_PATH,
"applicationConnectors": [
{
"type": legend_operator_base.APPLICATION_CONNECTOR_TYPE_HTTP,
"port": APPLICATION_CONNECTOR_PORT_HTTP,
"maxRequestHeaderSize": "128KiB",
}
],
"adminConnectors": [
{
"type": legend_operator_base.APPLICATION_CONNECTOR_TYPE_HTTP,
"port": APPLICATION_ADMIN_CONNECTOR_PORT_HTTP,
}
],
"gzip": {"includedMethods": ["GET", "POST"]},
"requestLog": {
"type": "classic",
"level": request_logging_level,
"appenders": [{"type": "console", "logFormat": "OFF"}],
},
},
"filterPriorities": {
"GitLab": 1,
"org.pac4j.j2e.filter.CallbackFilter": 2,
"org.pac4j.j2e.filter.SecurityFilter": 3,
"CORS": 4,
},
"pac4j": {
"callbackPrefix": "/api/pac4j/login",
"mongoUri": legend_db_uri,
"mongoDb": legend_db,
"clients": [
{
"org.finos.legend.server.pac4j.gitlab.GitlabClient": {
"name": "gitlab",
"clientId": gitlab_client_id,
"secret": gitlab_client_secret,
"discoveryUri": gitlab_openid_discovery_url,
# NOTE(aznashwan): needs to be a space-separated str:
"scope": " ".join(GITLAB_REQUIRED_SCOPES),
}
}
],
"mongoSession": {"enabled": True, "collection": "userSessions"},
"bypassPaths": ["/api/info"],
},
"gitLab": {
"newProjectVisibility": gitlab_project_visibility,
"projectTag": gitlab_project_tag,
"uat": {
"server": {
"scheme": legend_gitlab_credentials["gitlab_scheme"],
"host": "%s:%s"
% (
legend_gitlab_credentials["gitlab_host"],
legend_gitlab_credentials["gitlab_port"],
),
},
"app": {
"id": gitlab_client_id,
"secret": gitlab_client_secret,
"redirectURI": (
SDLC_MAIN_GITLAB_REDIRECT_URL
% {"base_url": self._get_sdlc_service_url()}
),
},
},
},
"projectStructure": {
"projectCreation": {"groupIdPattern": gitlab_project_creation_group_pattern},
"extensionProvider": {
"org.finos.legend.sdlc.server.gitlab.finos."
"FinosGitlabProjectStructureExtensionProvider": {}
},
},
"logging": {
"level": server_logging_level,
"appenders": [
{
"type": "console",
"logFormat": APPLICATION_LOGGING_FORMAT,
}
],
},
"swagger": {
"title": "Legend SDLC",
"resourcePackage": "org.finos.legend.sdlc.server.resources",
"version": "local-snapshot",
"schemes": [],
},
}
return {SDLC_CONFIG_FILE_CONTAINER_LOCAL_PATH: yaml.dump(sdlc_config)}
def | _on_studio_relation_joined | identifier_name | |
charm.py | _RELATION_NAME = "legend-db"
LEGEND_GITLAB_RELATION_NAME = "legend-sdlc-gitlab"
LEGEND_STUDIO_RELATION_NAME = "legend-sdlc"
SDLC_SERVICE_URL_FORMAT = "%(schema)s://%(host)s:%(port)s%(path)s"
SDLC_CONFIG_FILE_CONTAINER_LOCAL_PATH = "/sdlc-config.yaml"
SDLC_MAIN_GITLAB_REDIRECT_URL = "%(base_url)s/auth/callback"
SDLC_GITLAB_REDIRECT_URI_FORMATS = [
SDLC_MAIN_GITLAB_REDIRECT_URL,
"%(base_url)s/pac4j/login/callback",
]
TRUSTSTORE_PASSPHRASE = "Legend SDLC"
TRUSTSTORE_CONTAINER_LOCAL_PATH = "/truststore.jks"
APPLICATION_CONNECTOR_PORT_HTTP = 7070
APPLICATION_ADMIN_CONNECTOR_PORT_HTTP = 7076
APPLICATION_ROOT_PATH = "/api"
APPLICATION_LOGGING_FORMAT = "%d{yyyy-MM-dd HH:mm:ss.SSS} %-5p [%thread] %c - %m%n"
GITLAB_PROJECT_VISIBILITY_PUBLIC = "public"
GITLAB_PROJECT_VISIBILITY_PRIVATE = "private"
GITLAB_REQUIRED_SCOPES = ["openid", "profile", "api"]
class LegendSDLCServerCharm(legend_operator_base.BaseFinosLegendCoreServiceCharm):
"""Charmed operator for the FINOS Legend SDLC Server."""
def __init__(self, *args):
super().__init__(*args)
# Studio relation events:
self.framework.observe(
self.on[LEGEND_STUDIO_RELATION_NAME].relation_joined, self._on_studio_relation_joined
)
self.framework.observe(
self.on[LEGEND_STUDIO_RELATION_NAME].relation_changed, self._on_studio_relation_changed
)
@classmethod
def _get_application_connector_port(cls):
return APPLICATION_CONNECTOR_PORT_HTTP
@classmethod
def _get_workload_container_name(cls):
return SDLC_CONTAINER_NAME
@classmethod | def _get_workload_service_names(cls):
return [SDLC_SERVICE_NAME]
@classmethod
def _get_workload_pebble_layers(cls):
return {
"sdlc": {
"summary": "SDLC layer.",
"description": "Pebble config layer for FINOS Legend SDLC.",
"services": {
"sdlc": {
"override": "replace",
"summary": "sdlc",
"command": (
# NOTE(aznashwan): starting through bash is needed
# for the classpath glob (-cp ...) to be expanded:
"/bin/sh -c 'java -XX:+ExitOnOutOfMemoryError "
"-XX:MaxRAMPercentage=60 -Xss4M -cp /app/bin/*.jar"
" -Dfile.encoding=UTF8 "
'-Djavax.net.ssl.trustStore="%s" '
'-Djavax.net.ssl.trustStorePassword="%s" '
"org.finos.legend.sdlc.server.LegendSDLCServer "
'server "%s"\''
% (
TRUSTSTORE_CONTAINER_LOCAL_PATH,
TRUSTSTORE_PASSPHRASE,
SDLC_CONFIG_FILE_CONTAINER_LOCAL_PATH,
)
),
# NOTE(aznashwan): considering the SDLC service expects
# a singular config file which already contains all
# relevant options in it (some of which will require
# the relation with DB/Gitlab to have already been
# established), we do not auto-start:
"startup": "disabled",
# TODO(aznashwan): determine any env vars we could pass
# (most notably, things like the RAM percentage etc...)
"environment": {},
}
},
}
}
def _get_jks_truststore_preferences(self):
jks_prefs = {
"truststore_path": TRUSTSTORE_CONTAINER_LOCAL_PATH,
"truststore_passphrase": TRUSTSTORE_PASSPHRASE,
"trusted_certificates": {},
}
cert = self._get_legend_gitlab_certificate()
if cert:
# NOTE(aznashwan): cert label 'gitlab-sdlc' is arbitrary:
jks_prefs["trusted_certificates"]["gitlab-sdlc"] = cert
return jks_prefs
@classmethod
def _get_legend_gitlab_relation_name(cls):
return LEGEND_GITLAB_RELATION_NAME
@classmethod
def _get_legend_db_relation_name(cls):
return LEGEND_DB_RELATION_NAME
def _get_sdlc_service_url(self):
ip_address = legend_operator_base.get_ip_address()
return SDLC_SERVICE_URL_FORMAT % (
{
# NOTE(aznashwan): we always return the plain HTTP endpoint:
"schema": "http",
"host": ip_address,
"port": APPLICATION_CONNECTOR_PORT_HTTP,
"path": APPLICATION_ROOT_PATH,
}
)
def _get_legend_gitlab_redirect_uris(self):
base_url = self._get_sdlc_service_url()
redirect_uris = [fmt % {"base_url": base_url} for fmt in SDLC_GITLAB_REDIRECT_URI_FORMATS]
return redirect_uris
def _get_core_legend_service_configs(self, legend_db_credentials, legend_gitlab_credentials):
# Check DB-related options:
if not legend_db_credentials:
return model.WaitingStatus("no legend db info present in relation yet")
legend_db_uri = legend_db_credentials["uri"]
legend_db = legend_db_credentials["database"]
# Check gitlab-related options:
gitlab_project_visibility = GITLAB_PROJECT_VISIBILITY_PRIVATE
if self.model.config["gitlab-create-new-projects-as-public"]:
gitlab_project_visibility = GITLAB_PROJECT_VISIBILITY_PUBLIC
if not legend_gitlab_credentials:
return model.WaitingStatus("no legend gitlab info present in relation yet")
gitlab_client_id = legend_gitlab_credentials["client_id"]
gitlab_client_secret = legend_gitlab_credentials["client_secret"]
gitlab_openid_discovery_url = legend_gitlab_credentials["openid_discovery_url"]
gitlab_project_tag = self.model.config["gitlab-project-tag"]
gitlab_project_creation_group_pattern = self.model.config[
"gitlab-project-creation-group-pattern"
]
# Check Java logging options:
request_logging_level = self._get_logging_level_from_config(
"server-requests-logging-level"
)
server_logging_level = self._get_logging_level_from_config("server-logging-level")
if not all([server_logging_level, request_logging_level]):
return model.BlockedStatus(
"one or more logging config options are improperly formatted "
"or missing, please review the debug-log for more details"
)
# Compile base config:
sdlc_config = {
"applicationName": "Legend SDLC",
"server": {
"rootPath": APPLICATION_ROOT_PATH,
"applicationConnectors": [
{
"type": legend_operator_base.APPLICATION_CONNECTOR_TYPE_HTTP,
"port": APPLICATION_CONNECTOR_PORT_HTTP,
"maxRequestHeaderSize": "128KiB",
}
],
"adminConnectors": [
{
"type": legend_operator_base.APPLICATION_CONNECTOR_TYPE_HTTP,
"port": APPLICATION_ADMIN_CONNECTOR_PORT_HTTP,
}
],
"gzip": {"includedMethods": ["GET", "POST"]},
"requestLog": {
"type": "classic",
"level": request_logging_level,
"appenders": [{"type": "console", "logFormat": "OFF"}],
},
},
"filterPriorities": {
"GitLab": 1,
"org.pac4j.j2e.filter.CallbackFilter": 2,
"org.pac4j.j2e.filter.SecurityFilter": 3,
"CORS": 4,
},
"pac4j": {
"callbackPrefix": "/api/pac4j/login",
"mongoUri": legend_db_uri,
"mongoDb": legend_db,
"clients": [
{
"org.finos.legend.server.pac4j.gitlab.GitlabClient": {
"name": "gitlab",
"clientId": gitlab_client_id,
"secret": gitlab_client_secret,
"discoveryUri": gitlab_openid_discovery_url,
# NOTE(aznashwan): needs to be a space-separated str:
"scope": " ".join(GITLAB_REQUIRED_SCOPES),
}
}
],
"mongoSession": {"enabled": True, "collection": "userSessions"},
"bypassPaths": ["/api/info"],
},
"gitLab": {
"newProjectVisibility": gitlab_project_visibility,
"projectTag": gitlab_project_tag,
"uat": {
"server": {
"scheme": legend_gitlab_credentials["gitlab_scheme"],
"host": "%s:%s"
% (
legend_gitlab_credentials["gitlab_host"],
legend_gitlab_credentials["gitlab_port"],
),
},
"app": {
"id": gitlab_client_id,
"secret": gitlab_client_secret,
"redirectURI": (
SDLC_MAIN_GITLAB_REDIRECT_URL
% {"base_url": self._get_sdlc_service_url()}
),
},
},
},
"projectStructure": {
"projectCreation": {"groupIdPattern": gitlab_project_creation_group_pattern},
"extensionProvider": {
"org.finos.legend.sdlc.server.gitlab.finos."
"FinosGitlabProjectStructureExtensionProvider": {}
},
| random_line_split | |
charm.py | ATION_NAME = "legend-db"
LEGEND_GITLAB_RELATION_NAME = "legend-sdlc-gitlab"
LEGEND_STUDIO_RELATION_NAME = "legend-sdlc"
SDLC_SERVICE_URL_FORMAT = "%(schema)s://%(host)s:%(port)s%(path)s"
SDLC_CONFIG_FILE_CONTAINER_LOCAL_PATH = "/sdlc-config.yaml"
SDLC_MAIN_GITLAB_REDIRECT_URL = "%(base_url)s/auth/callback"
SDLC_GITLAB_REDIRECT_URI_FORMATS = [
SDLC_MAIN_GITLAB_REDIRECT_URL,
"%(base_url)s/pac4j/login/callback",
]
TRUSTSTORE_PASSPHRASE = "Legend SDLC"
TRUSTSTORE_CONTAINER_LOCAL_PATH = "/truststore.jks"
APPLICATION_CONNECTOR_PORT_HTTP = 7070
APPLICATION_ADMIN_CONNECTOR_PORT_HTTP = 7076
APPLICATION_ROOT_PATH = "/api"
APPLICATION_LOGGING_FORMAT = "%d{yyyy-MM-dd HH:mm:ss.SSS} %-5p [%thread] %c - %m%n"
GITLAB_PROJECT_VISIBILITY_PUBLIC = "public"
GITLAB_PROJECT_VISIBILITY_PRIVATE = "private"
GITLAB_REQUIRED_SCOPES = ["openid", "profile", "api"]
class LegendSDLCServerCharm(legend_operator_base.BaseFinosLegendCoreServiceCharm):
"""Charmed operator for the FINOS Legend SDLC Server."""
def __init__(self, *args):
super().__init__(*args)
# Studio relation events:
self.framework.observe(
self.on[LEGEND_STUDIO_RELATION_NAME].relation_joined, self._on_studio_relation_joined
)
self.framework.observe(
self.on[LEGEND_STUDIO_RELATION_NAME].relation_changed, self._on_studio_relation_changed
)
@classmethod
def _get_application_connector_port(cls):
return APPLICATION_CONNECTOR_PORT_HTTP
@classmethod
def _get_workload_container_name(cls):
return SDLC_CONTAINER_NAME
@classmethod
def _get_workload_service_names(cls):
return [SDLC_SERVICE_NAME]
@classmethod
def _get_workload_pebble_layers(cls):
return {
"sdlc": {
"summary": "SDLC layer.",
"description": "Pebble config layer for FINOS Legend SDLC.",
"services": {
"sdlc": {
"override": "replace",
"summary": "sdlc",
"command": (
# NOTE(aznashwan): starting through bash is needed
# for the classpath glob (-cp ...) to be expanded:
"/bin/sh -c 'java -XX:+ExitOnOutOfMemoryError "
"-XX:MaxRAMPercentage=60 -Xss4M -cp /app/bin/*.jar"
" -Dfile.encoding=UTF8 "
'-Djavax.net.ssl.trustStore="%s" '
'-Djavax.net.ssl.trustStorePassword="%s" '
"org.finos.legend.sdlc.server.LegendSDLCServer "
'server "%s"\''
% (
TRUSTSTORE_CONTAINER_LOCAL_PATH,
TRUSTSTORE_PASSPHRASE,
SDLC_CONFIG_FILE_CONTAINER_LOCAL_PATH,
)
),
# NOTE(aznashwan): considering the SDLC service expects
# a singular config file which already contains all
# relevant options in it (some of which will require
# the relation with DB/Gitlab to have already been
# established), we do not auto-start:
"startup": "disabled",
# TODO(aznashwan): determine any env vars we could pass
# (most notably, things like the RAM percentage etc...)
"environment": {},
}
},
}
}
def _get_jks_truststore_preferences(self):
jks_prefs = {
"truststore_path": TRUSTSTORE_CONTAINER_LOCAL_PATH,
"truststore_passphrase": TRUSTSTORE_PASSPHRASE,
"trusted_certificates": {},
}
cert = self._get_legend_gitlab_certificate()
if cert:
# NOTE(aznashwan): cert label 'gitlab-sdlc' is arbitrary:
jks_prefs["trusted_certificates"]["gitlab-sdlc"] = cert
return jks_prefs
@classmethod
def _get_legend_gitlab_relation_name(cls):
return LEGEND_GITLAB_RELATION_NAME
@classmethod
def _get_legend_db_relation_name(cls):
|
def _get_sdlc_service_url(self):
ip_address = legend_operator_base.get_ip_address()
return SDLC_SERVICE_URL_FORMAT % (
{
# NOTE(aznashwan): we always return the plain HTTP endpoint:
"schema": "http",
"host": ip_address,
"port": APPLICATION_CONNECTOR_PORT_HTTP,
"path": APPLICATION_ROOT_PATH,
}
)
def _get_legend_gitlab_redirect_uris(self):
base_url = self._get_sdlc_service_url()
redirect_uris = [fmt % {"base_url": base_url} for fmt in SDLC_GITLAB_REDIRECT_URI_FORMATS]
return redirect_uris
def _get_core_legend_service_configs(self, legend_db_credentials, legend_gitlab_credentials):
# Check DB-related options:
if not legend_db_credentials:
return model.WaitingStatus("no legend db info present in relation yet")
legend_db_uri = legend_db_credentials["uri"]
legend_db = legend_db_credentials["database"]
# Check gitlab-related options:
gitlab_project_visibility = GITLAB_PROJECT_VISIBILITY_PRIVATE
if self.model.config["gitlab-create-new-projects-as-public"]:
gitlab_project_visibility = GITLAB_PROJECT_VISIBILITY_PUBLIC
if not legend_gitlab_credentials:
return model.WaitingStatus("no legend gitlab info present in relation yet")
gitlab_client_id = legend_gitlab_credentials["client_id"]
gitlab_client_secret = legend_gitlab_credentials["client_secret"]
gitlab_openid_discovery_url = legend_gitlab_credentials["openid_discovery_url"]
gitlab_project_tag = self.model.config["gitlab-project-tag"]
gitlab_project_creation_group_pattern = self.model.config[
"gitlab-project-creation-group-pattern"
]
# Check Java logging options:
request_logging_level = self._get_logging_level_from_config(
"server-requests-logging-level"
)
server_logging_level = self._get_logging_level_from_config("server-logging-level")
if not all([server_logging_level, request_logging_level]):
return model.BlockedStatus(
"one or more logging config options are improperly formatted "
"or missing, please review the debug-log for more details"
)
# Compile base config:
sdlc_config = {
"applicationName": "Legend SDLC",
"server": {
"rootPath": APPLICATION_ROOT_PATH,
"applicationConnectors": [
{
"type": legend_operator_base.APPLICATION_CONNECTOR_TYPE_HTTP,
"port": APPLICATION_CONNECTOR_PORT_HTTP,
"maxRequestHeaderSize": "128KiB",
}
],
"adminConnectors": [
{
"type": legend_operator_base.APPLICATION_CONNECTOR_TYPE_HTTP,
"port": APPLICATION_ADMIN_CONNECTOR_PORT_HTTP,
}
],
"gzip": {"includedMethods": ["GET", "POST"]},
"requestLog": {
"type": "classic",
"level": request_logging_level,
"appenders": [{"type": "console", "logFormat": "OFF"}],
},
},
"filterPriorities": {
"GitLab": 1,
"org.pac4j.j2e.filter.CallbackFilter": 2,
"org.pac4j.j2e.filter.SecurityFilter": 3,
"CORS": 4,
},
"pac4j": {
"callbackPrefix": "/api/pac4j/login",
"mongoUri": legend_db_uri,
"mongoDb": legend_db,
"clients": [
{
"org.finos.legend.server.pac4j.gitlab.GitlabClient": {
"name": "gitlab",
"clientId": gitlab_client_id,
"secret": gitlab_client_secret,
"discoveryUri": gitlab_openid_discovery_url,
# NOTE(aznashwan): needs to be a space-separated str:
"scope": " ".join(GITLAB_REQUIRED_SCOPES),
}
}
],
"mongoSession": {"enabled": True, "collection": "userSessions"},
"bypassPaths": ["/api/info"],
},
"gitLab": {
"newProjectVisibility": gitlab_project_visibility,
"projectTag": gitlab_project_tag,
"uat": {
"server": {
"scheme": legend_gitlab_credentials["gitlab_scheme"],
"host": "%s:%s"
% (
legend_gitlab_credentials["gitlab_host"],
legend_gitlab_credentials["gitlab_port"],
),
},
"app": {
"id": gitlab_client_id,
"secret": gitlab_client_secret,
"redirectURI": (
SDLC_MAIN_GITLAB_REDIRECT_URL
% {"base_url": self._get_sdlc_service_url()}
),
},
},
},
"projectStructure": {
"projectCreation": {"groupIdPattern": gitlab_project_creation_group_pattern},
"extensionProvider": {
"org.finos.legend.sdlc.server.gitlab.finos."
"FinosGitlabProjectStructureExtensionProvider": {}
},
| return LEGEND_DB_RELATION_NAME | identifier_body |
run_test.go | Conn)
sshAgent.Add(key)
}
func removeKeyfromSSHAgent(key ssh.PublicKey) {
aConn, _ := net.Dial("unix", sshAgentSocket)
sshAgent := agent.NewClient(aConn)
sshAgent.Remove(key)
}
func startSSHServer() {
done := make(chan bool, 1)
go func(done chan<- bool) {
glssh.Handle(func(s glssh.Session) {
authorizedKey := ssh.MarshalAuthorizedKey(s.PublicKey())
io.WriteString(s, fmt.Sprintf("public key used by %s:\n", s.User()))
s.Write(authorizedKey)
s.Exit(0)
})
publicKeyOption := glssh.PublicKeyAuth(func(ctx glssh.Context, key glssh.PublicKey) bool {
for _, pubk := range testPublicKeys {
if glssh.KeysEqual(key, pubk) {
return true
}
}
return false
})
fmt.Println("starting ssh server on port 2222...")
done <- true
panic(glssh.ListenAndServe(":2222", nil, publicKeyOption))
}(done)
<-done
}
func TestMakeSigner(t *testing.T) {
tests := []struct {
name string
key mockSSHKey
expected ssh.Signer
}{
{name: "Basic key signer with valid rsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["rsa"],
},
expected: testSigners["rsa"],
},
{name: "Basic key signer with valid dsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["dsa"],
},
expected: testSigners["dsa"],
},
{name: "Basic key signer with valid ecdsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["ecdsa"],
},
expected: testSigners["ecdsa"],
},
{name: "Basic key signer with valid user key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["user"],
},
expected: testSigners["user"],
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
// Write content of the key to the keyname file
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
returned, _ := makeSigner(tt.key.keyname)
if !reflect.DeepEqual(returned, tt.expected) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
os.Remove(tt.key.keyname)
})
}
}
func TestMakeKeyring(t *testing.T) {
tests := []struct {
name string
useagent bool
key mockSSHKey
expected ssh.AuthMethod
}{
{name: "Basic key ring with valid rsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["rsa"],
},
expected: ssh.PublicKeys(testSigners["rsa"]),
},
{name: "Basic key ring with valid dsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey11",
content: testdata.PEMBytes["dsa"],
},
expected: ssh.PublicKeys(testSigners["dsa"]),
},
{name: "Basic key ring with valid ecdsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey12",
content: testdata.PEMBytes["ecdsa"],
},
expected: ssh.PublicKeys(testSigners["ecdsa"]),
},
{name: "Basic key ring with valid user key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey13",
content: testdata.PEMBytes["user"],
},
expected: ssh.PublicKeys(testSigners["user"]),
},
{name: "Basic key ring agent with valid rsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["rsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["rsa"]},
pubkey: testPublicKeys["rsa"],
},
expected: ssh.PublicKeys(testSigners["rsa"]),
},
{name: "Basic key ring agent with valid dsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["dsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["dsa"]},
pubkey: testPublicKeys["dsa"],
},
expected: ssh.PublicKeys(testSigners["dsa"]),
},
{name: "Basic key ring agent with valid ecdsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["ecdsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["ecdsa"]},
pubkey: testPublicKeys["ecdsa"],
},
expected: ssh.PublicKeys(testSigners["ecdsa"]),
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
if tt.useagent == true {
addKeytoSSHAgent(tt.key.privkey)
}
// Write content of the key to the keyname file
if tt.key.keyname != "" {
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
}
returned := makeKeyring(tt.key.keyname, sshAgentSocket, tt.useagent)
// DeepEqual always returns false for functions unless nil
// hence converting to string to compare
check1 := reflect.ValueOf(returned).String()
check2 := reflect.ValueOf(tt.expected).String()
if !reflect.DeepEqual(check1, check2) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
if tt.useagent == true {
removeKeyfromSSHAgent(tt.key.pubkey)
}
if tt.key.keyname != "" {
os.Remove(tt.key.keyname)
}
})
}
}
func TestRun(t *testing.T) {
tests := []struct {
name string
machines []string
user string
cmd string
key mockSSHKey
port int
useagent bool
expected bool
}{
{name: "Basic with valid rsa key",
machines: []string{"localhost"},
port: 2222,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey21",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: true,
},
{name: "Basic with valid rsa key wrong hostname",
machines: []string{"bogushost"},
port: 2222,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey22",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: false,
},
{name: "Basic with valid rsa key wrong port",
machines: []string{"localhost"},
port: 2223,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey23",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: false,
},
{name: "Basic with valid rsa key Google endpoint",
machines: []string{"www.google.com"},
port: 22,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey24",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: false,
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
if tt.useagent == true {
addKeytoSSHAgent(tt.key.privkey)
}
// Write content of the key to the keyname file
if tt.key.keyname != "" {
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
}
returned := Run(Machines(tt.machines),
User(tt.user),
Port(tt.port),
Cmd(tt.cmd),
Key(tt.key.keyname),
UseAgent(tt.useagent),
AgentSocket(sshAgentSocket))
if !(returned == tt.expected) { |
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
| conditional_block | |
run_test.go | aConn, _ := net.Dial("unix", sshAgentSocket)
sshAgent := agent.NewClient(aConn)
sshAgent.Remove(key)
}
func startSSHServer() {
done := make(chan bool, 1)
go func(done chan<- bool) {
glssh.Handle(func(s glssh.Session) {
authorizedKey := ssh.MarshalAuthorizedKey(s.PublicKey())
io.WriteString(s, fmt.Sprintf("public key used by %s:\n", s.User()))
s.Write(authorizedKey)
s.Exit(0)
})
publicKeyOption := glssh.PublicKeyAuth(func(ctx glssh.Context, key glssh.PublicKey) bool {
for _, pubk := range testPublicKeys {
if glssh.KeysEqual(key, pubk) {
return true
}
}
return false
})
fmt.Println("starting ssh server on port 2222...")
done <- true
panic(glssh.ListenAndServe(":2222", nil, publicKeyOption))
}(done)
<-done
}
func TestMakeSigner(t *testing.T) {
tests := []struct {
name string
key mockSSHKey
expected ssh.Signer
}{
{name: "Basic key signer with valid rsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["rsa"],
},
expected: testSigners["rsa"],
},
{name: "Basic key signer with valid dsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["dsa"],
},
expected: testSigners["dsa"],
},
{name: "Basic key signer with valid ecdsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["ecdsa"],
},
expected: testSigners["ecdsa"],
},
{name: "Basic key signer with valid user key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["user"],
},
expected: testSigners["user"],
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
// Write content of the key to the keyname file
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
returned, _ := makeSigner(tt.key.keyname)
if !reflect.DeepEqual(returned, tt.expected) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
os.Remove(tt.key.keyname)
})
}
}
func TestMakeKeyring(t *testing.T) {
tests := []struct {
name string
useagent bool
key mockSSHKey
expected ssh.AuthMethod
}{
{name: "Basic key ring with valid rsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["rsa"],
},
expected: ssh.PublicKeys(testSigners["rsa"]),
},
{name: "Basic key ring with valid dsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey11",
content: testdata.PEMBytes["dsa"],
},
expected: ssh.PublicKeys(testSigners["dsa"]),
},
{name: "Basic key ring with valid ecdsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey12",
content: testdata.PEMBytes["ecdsa"],
},
expected: ssh.PublicKeys(testSigners["ecdsa"]),
},
{name: "Basic key ring with valid user key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey13",
content: testdata.PEMBytes["user"],
},
expected: ssh.PublicKeys(testSigners["user"]),
},
{name: "Basic key ring agent with valid rsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["rsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["rsa"]},
pubkey: testPublicKeys["rsa"],
},
expected: ssh.PublicKeys(testSigners["rsa"]),
},
{name: "Basic key ring agent with valid dsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["dsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["dsa"]},
pubkey: testPublicKeys["dsa"],
},
expected: ssh.PublicKeys(testSigners["dsa"]),
},
{name: "Basic key ring agent with valid ecdsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["ecdsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["ecdsa"]},
pubkey: testPublicKeys["ecdsa"],
},
expected: ssh.PublicKeys(testSigners["ecdsa"]),
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
if tt.useagent == true {
addKeytoSSHAgent(tt.key.privkey)
}
// Write content of the key to the keyname file
if tt.key.keyname != "" {
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
}
returned := makeKeyring(tt.key.keyname, sshAgentSocket, tt.useagent)
// DeepEqual always returns false for functions unless nil
// hence converting to string to compare
check1 := reflect.ValueOf(returned).String()
check2 := reflect.ValueOf(tt.expected).String()
if !reflect.DeepEqual(check1, check2) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
if tt.useagent == true {
removeKeyfromSSHAgent(tt.key.pubkey)
}
if tt.key.keyname != "" {
os.Remove(tt.key.keyname)
}
})
}
}
func TestRun(t *testing.T) {
tests := []struct {
name string
machines []string
user string
cmd string
key mockSSHKey
port int
useagent bool
expected bool
}{
{name: "Basic with valid rsa key",
machines: []string{"localhost"},
port: 2222,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey21",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: true,
},
{name: "Basic with valid rsa key wrong hostname",
machines: []string{"bogushost"},
port: 2222,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey22",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: false,
},
{name: "Basic with valid rsa key wrong port",
machines: []string{"localhost"},
port: 2223,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey23",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: false,
},
{name: "Basic with valid rsa key Google endpoint",
machines: []string{"www.google.com"},
port: 22,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey24",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: false,
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
if tt.useagent == true {
addKeytoSSHAgent(tt.key.privkey)
}
// Write content of the key to the keyname file
if tt.key.keyname != "" {
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
}
returned := Run(Machines(tt.machines),
User(tt.user),
Port(tt.port),
Cmd(tt.cmd),
Key(tt.key.keyname),
UseAgent(tt.useagent),
AgentSocket(sshAgentSocket))
if !(returned == tt.expected) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
if tt.useagent == true {
removeKeyfromSSHAgent(tt.key.pubkey) | } | random_line_split | |
run_test.go | [string]ssh.PublicKey
sshAgentSocket string
)
func init() {
var err error
n := len(testdata.PEMBytes)
testSigners = make(map[string]ssh.Signer, n)
testPrivateKeys = make(map[string]interface{}, n)
testPublicKeys = make(map[string]ssh.PublicKey, n)
for t, k := range testdata.PEMBytes {
testPrivateKeys[t], err = ssh.ParseRawPrivateKey(k)
if err != nil {
panic(fmt.Sprintf("Unable to parse test key %s: %v", t, err))
}
testSigners[t], err = ssh.NewSignerFromKey(testPrivateKeys[t])
if err != nil {
panic(fmt.Sprintf("Unable to create signer for test key %s: %v", t, err))
}
testPublicKeys[t] = testSigners[t].PublicKey()
}
randomStr := fmt.Sprintf("%v", rand.Intn(5000))
socketFile := "/tmp/gosocket" + randomStr + ".sock"
setupSSHAgent(socketFile)
time.Sleep(2 * time.Second)
startSSHServer()
}
func setupSSHAgent(socketFile string) {
done := make(chan string, 1)
a := agent.NewKeyring()
go func(done chan<- string) {
ln, err := net.Listen("unix", socketFile)
if err != nil {
panic(fmt.Sprintf("Couldn't create socket for tests %v", err))
}
defer ln.Close()
// Need to wait until the socket is setup
firstTime := true
for {
if firstTime == true {
done <- socketFile
firstTime = false
}
c, err := ln.Accept()
if err != nil {
panic(fmt.Sprintf("Couldn't accept connection to agent tests %v", err))
}
defer c.Close()
go func(c io.ReadWriter) {
err = agent.ServeAgent(a, c)
if err != nil {
fmt.Sprintf("Couldn't serve ssh agent for tests %v", err)
}
}(c)
}
}(done)
sshAgentSocket = <-done
}
func addKeytoSSHAgent(key agent.AddedKey) {
aConn, _ := net.Dial("unix", sshAgentSocket)
sshAgent := agent.NewClient(aConn)
sshAgent.Add(key)
}
func removeKeyfromSSHAgent(key ssh.PublicKey) {
aConn, _ := net.Dial("unix", sshAgentSocket)
sshAgent := agent.NewClient(aConn)
sshAgent.Remove(key)
}
func startSSHServer() {
done := make(chan bool, 1)
go func(done chan<- bool) {
glssh.Handle(func(s glssh.Session) {
authorizedKey := ssh.MarshalAuthorizedKey(s.PublicKey())
io.WriteString(s, fmt.Sprintf("public key used by %s:\n", s.User()))
s.Write(authorizedKey)
s.Exit(0)
})
publicKeyOption := glssh.PublicKeyAuth(func(ctx glssh.Context, key glssh.PublicKey) bool {
for _, pubk := range testPublicKeys {
if glssh.KeysEqual(key, pubk) {
return true
}
}
return false
})
fmt.Println("starting ssh server on port 2222...")
done <- true
panic(glssh.ListenAndServe(":2222", nil, publicKeyOption))
}(done)
<-done
}
func T | t *testing.T) {
tests := []struct {
name string
key mockSSHKey
expected ssh.Signer
}{
{name: "Basic key signer with valid rsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["rsa"],
},
expected: testSigners["rsa"],
},
{name: "Basic key signer with valid dsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["dsa"],
},
expected: testSigners["dsa"],
},
{name: "Basic key signer with valid ecdsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["ecdsa"],
},
expected: testSigners["ecdsa"],
},
{name: "Basic key signer with valid user key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["user"],
},
expected: testSigners["user"],
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
// Write content of the key to the keyname file
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
returned, _ := makeSigner(tt.key.keyname)
if !reflect.DeepEqual(returned, tt.expected) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
os.Remove(tt.key.keyname)
})
}
}
func TestMakeKeyring(t *testing.T) {
tests := []struct {
name string
useagent bool
key mockSSHKey
expected ssh.AuthMethod
}{
{name: "Basic key ring with valid rsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["rsa"],
},
expected: ssh.PublicKeys(testSigners["rsa"]),
},
{name: "Basic key ring with valid dsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey11",
content: testdata.PEMBytes["dsa"],
},
expected: ssh.PublicKeys(testSigners["dsa"]),
},
{name: "Basic key ring with valid ecdsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey12",
content: testdata.PEMBytes["ecdsa"],
},
expected: ssh.PublicKeys(testSigners["ecdsa"]),
},
{name: "Basic key ring with valid user key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey13",
content: testdata.PEMBytes["user"],
},
expected: ssh.PublicKeys(testSigners["user"]),
},
{name: "Basic key ring agent with valid rsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["rsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["rsa"]},
pubkey: testPublicKeys["rsa"],
},
expected: ssh.PublicKeys(testSigners["rsa"]),
},
{name: "Basic key ring agent with valid dsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["dsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["dsa"]},
pubkey: testPublicKeys["dsa"],
},
expected: ssh.PublicKeys(testSigners["dsa"]),
},
{name: "Basic key ring agent with valid ecdsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["ecdsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["ecdsa"]},
pubkey: testPublicKeys["ecdsa"],
},
expected: ssh.PublicKeys(testSigners["ecdsa"]),
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
if tt.useagent == true {
addKeytoSSHAgent(tt.key.privkey)
}
// Write content of the key to the keyname file
if tt.key.keyname != "" {
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
}
returned := makeKeyring(tt.key.keyname, sshAgentSocket, tt.useagent)
// DeepEqual always returns false for functions unless nil
// hence converting to string to compare
check1 := reflect.ValueOf(returned).String()
check2 := reflect.ValueOf(tt.expected).String()
if !reflect.DeepEqual(check1, check2) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
if tt.useagent == true {
removeKeyfromSSHAgent(tt.key.pubkey)
}
if tt.key.keyname != "" {
os.Remove(tt.key.keyname)
}
})
}
}
func TestRun(t *testing.T) {
tests := []struct {
name string
machines []string
user string
cmd string
key mockSSHKey
port int
useagent bool
expected bool
}{
{name: "Basic with valid rsa key",
machines: []string{"localhost"},
port: 2222,
cmd: "ls",
user: | estMakeSigner( | identifier_name |
run_test.go | (func(ctx glssh.Context, key glssh.PublicKey) bool {
for _, pubk := range testPublicKeys {
if glssh.KeysEqual(key, pubk) {
return true
}
}
return false
})
fmt.Println("starting ssh server on port 2222...")
done <- true
panic(glssh.ListenAndServe(":2222", nil, publicKeyOption))
}(done)
<-done
}
func TestMakeSigner(t *testing.T) {
tests := []struct {
name string
key mockSSHKey
expected ssh.Signer
}{
{name: "Basic key signer with valid rsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["rsa"],
},
expected: testSigners["rsa"],
},
{name: "Basic key signer with valid dsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["dsa"],
},
expected: testSigners["dsa"],
},
{name: "Basic key signer with valid ecdsa key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["ecdsa"],
},
expected: testSigners["ecdsa"],
},
{name: "Basic key signer with valid user key",
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["user"],
},
expected: testSigners["user"],
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
// Write content of the key to the keyname file
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
returned, _ := makeSigner(tt.key.keyname)
if !reflect.DeepEqual(returned, tt.expected) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
os.Remove(tt.key.keyname)
})
}
}
func TestMakeKeyring(t *testing.T) {
tests := []struct {
name string
useagent bool
key mockSSHKey
expected ssh.AuthMethod
}{
{name: "Basic key ring with valid rsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey",
content: testdata.PEMBytes["rsa"],
},
expected: ssh.PublicKeys(testSigners["rsa"]),
},
{name: "Basic key ring with valid dsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey11",
content: testdata.PEMBytes["dsa"],
},
expected: ssh.PublicKeys(testSigners["dsa"]),
},
{name: "Basic key ring with valid ecdsa key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey12",
content: testdata.PEMBytes["ecdsa"],
},
expected: ssh.PublicKeys(testSigners["ecdsa"]),
},
{name: "Basic key ring with valid user key",
useagent: false,
key: mockSSHKey{
keyname: "/tmp/mockkey13",
content: testdata.PEMBytes["user"],
},
expected: ssh.PublicKeys(testSigners["user"]),
},
{name: "Basic key ring agent with valid rsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["rsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["rsa"]},
pubkey: testPublicKeys["rsa"],
},
expected: ssh.PublicKeys(testSigners["rsa"]),
},
{name: "Basic key ring agent with valid dsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["dsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["dsa"]},
pubkey: testPublicKeys["dsa"],
},
expected: ssh.PublicKeys(testSigners["dsa"]),
},
{name: "Basic key ring agent with valid ecdsa key",
useagent: true,
key: mockSSHKey{
keyname: "",
content: testdata.PEMBytes["ecdsa"],
privkey: agent.AddedKey{PrivateKey: testPrivateKeys["ecdsa"]},
pubkey: testPublicKeys["ecdsa"],
},
expected: ssh.PublicKeys(testSigners["ecdsa"]),
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
if tt.useagent == true {
addKeytoSSHAgent(tt.key.privkey)
}
// Write content of the key to the keyname file
if tt.key.keyname != "" {
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
}
returned := makeKeyring(tt.key.keyname, sshAgentSocket, tt.useagent)
// DeepEqual always returns false for functions unless nil
// hence converting to string to compare
check1 := reflect.ValueOf(returned).String()
check2 := reflect.ValueOf(tt.expected).String()
if !reflect.DeepEqual(check1, check2) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
if tt.useagent == true {
removeKeyfromSSHAgent(tt.key.pubkey)
}
if tt.key.keyname != "" {
os.Remove(tt.key.keyname)
}
})
}
}
func TestRun(t *testing.T) {
tests := []struct {
name string
machines []string
user string
cmd string
key mockSSHKey
port int
useagent bool
expected bool
}{
{name: "Basic with valid rsa key",
machines: []string{"localhost"},
port: 2222,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey21",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: true,
},
{name: "Basic with valid rsa key wrong hostname",
machines: []string{"bogushost"},
port: 2222,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey22",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: false,
},
{name: "Basic with valid rsa key wrong port",
machines: []string{"localhost"},
port: 2223,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey23",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: false,
},
{name: "Basic with valid rsa key Google endpoint",
machines: []string{"www.google.com"},
port: 22,
cmd: "ls",
user: "testuser",
key: mockSSHKey{
keyname: "/tmp/mockkey24",
content: testdata.PEMBytes["rsa"],
},
useagent: false,
expected: false,
},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
if tt.useagent == true {
addKeytoSSHAgent(tt.key.privkey)
}
// Write content of the key to the keyname file
if tt.key.keyname != "" {
ioutil.WriteFile(tt.key.keyname, tt.key.content, 0644)
}
returned := Run(Machines(tt.machines),
User(tt.user),
Port(tt.port),
Cmd(tt.cmd),
Key(tt.key.keyname),
UseAgent(tt.useagent),
AgentSocket(sshAgentSocket))
if !(returned == tt.expected) {
t.Errorf("Value received: %v expected %v", returned, tt.expected)
}
if tt.useagent == true {
removeKeyfromSSHAgent(tt.key.pubkey)
}
if tt.key.keyname != "" {
os.Remove(tt.key.keyname)
}
})
}
}
func TestTearDown(t *testing.T) { |
tests := []struct {
name string
id string
}{
{name: "Teardown SSH Agent",
id: "sshAgentTdown"},
}
for _, tt := range tests {
t.Run(tt.name, func(t *testing.T) {
if tt.id == "sshAgentTdown" {
os.Remove(sshAgentSocket)
}
})
}
}
| identifier_body | |
main.rs | window::WindowBuilder::new()
.with_title("starframe test")
.with_inner_size(winit::dpi::LogicalSize {
width: 800.0,
height: 600.0,
}),
);
let state = State::init(&game.renderer.device);
game.run(state);
microprofile::shutdown!();
}
//
// Types
//
pub enum StateEnum {
Playing,
Paused,
}
pub struct State {
scene: Scene,
state: StateEnum,
graph: MyGraph,
player: player::PlayerController,
mouse_mode: MouseMode,
mouse_grabber: MouseGrabber,
physics: phys::Physics,
camera: gx::camera::MouseDragCamera,
shape_renderer: gx::ShapeRenderer,
}
impl State {
fn init(device: &wgpu::Device) -> Self {
State {
scene: Scene::default(),
state: StateEnum::Playing,
graph: MyGraph::new(),
player: player::PlayerController::new(),
mouse_mode: MouseMode::Grab,
mouse_grabber: MouseGrabber::new(),
physics: phys::Physics::with_substeps(10),
camera: gx::camera::MouseDragCamera::new(
gx::camera::ScalingStrategy::ConstantDisplayArea {
width: 20.0,
height: 10.0,
},
),
shape_renderer: gx::ShapeRenderer::new(device),
}
}
fn reset(&mut self) {
self.physics.clear_constraints();
self.graph = MyGraph::new();
}
fn read_scene(&mut self, file_idx: usize) {
let dir = std::fs::read_dir("./examples/testgame/scenes");
match dir {
Err(err) => eprintln!("Scenes dir not found: {}", err),
Ok(mut dir) => {
if let Some(Ok(entry)) = dir.nth(file_idx) {
let file = std::fs::File::open(entry.path());
match file {
Ok(file) => {
let scene = Scene::read_from_file(file);
match scene {
Err(err) => eprintln!("Failed to parse file: {}", err),
Ok(scene) => self.scene = scene,
}
}
Err(err) => eprintln!("Failed to open file: {}", err),
}
}
}
}
}
fn instantiate_scene(&mut self) {
self.scene.instantiate(&mut self.graph, &mut self.physics);
}
}
#[derive(Clone, Copy, Debug)]
pub enum MouseMode {
/// Grab objects with the mouse
Grab,
/// Move the camera with the mouse
Camera,
}
/// The recipes in a scene plus some adjustable parameters.
#[derive(Clone, Debug, serde::Deserialize)]
#[serde(default)]
pub struct Scene {
gravity: [f64; 2],
recipes: Vec<Recipe>,
}
impl Default for Scene {
fn default() -> Self {
Self {
gravity: [0.0, -9.81],
recipes: vec![],
}
}
}
impl Scene {
pub fn read_from_file(file: std::fs::File) -> Result<Self, ron::de::Error> {
use serde::Deserialize;
use std::io::Read;
let mut reader = std::io::BufReader::new(file);
let mut bytes = Vec::new();
reader.read_to_end(&mut bytes)?;
let mut deser = ron::de::Deserializer::from_bytes(bytes.as_slice())?;
Scene::deserialize(&mut deser)
}
pub fn instantiate(&self, graph: &mut crate::MyGraph, physics: &mut phys::Physics) {
for recipe in &self.recipes {
recipe.spawn(graph, physics);
}
}
}
/// The entity graph.
pub struct | {
graph: graph::Graph,
l_pose: graph::Layer<m::Pose>,
l_collider: graph::Layer<phys::Collider>,
l_body: graph::Layer<phys::RigidBody>,
l_shape: graph::Layer<gx::Shape>,
l_player: graph::Layer<player::Player>,
l_evt_sink: sf::event::EventSinkLayer<MyGraph>,
}
impl MyGraph {
pub fn new() -> Self {
let mut graph = graph::Graph::new();
let l_pose = graph.create_layer();
let l_collider = graph.create_layer();
let l_body = graph.create_layer();
let l_shape = graph.create_layer();
let l_player = graph.create_layer();
let l_evt_sinks = graph.create_layer();
MyGraph {
graph,
l_pose,
l_collider,
l_body,
l_shape,
l_player,
l_evt_sink: l_evt_sinks,
}
}
}
//
// State updates
//
impl game::GameState for State {
fn tick(&mut self, dt: f64, game: &Game) -> Option<()> {
microprofile::flip();
microprofile::scope!("update", "all");
//
// State-independent stuff
//
// exit on esc
if game.input.is_key_pressed(Key::Escape, None) {
return None;
}
// adjust physics substeps
if game.input.is_key_pressed(Key::NumpadAdd, Some(0)) {
self.physics.substeps += 1;
println!("Substeps: {}", self.physics.substeps);
} else if game.input.is_key_pressed(Key::NumpadSubtract, Some(0))
&& self.physics.substeps > 1
{
self.physics.substeps -= 1;
println!("Substeps: {}", self.physics.substeps);
}
// mouse controls
if game.input.is_key_pressed(Key::V, Some(0)) {
self.mouse_mode = match self.mouse_mode {
MouseMode::Grab => MouseMode::Camera,
MouseMode::Camera => MouseMode::Grab,
};
println!("Mouse mode: {:?}", self.mouse_mode);
}
match self.mouse_mode {
MouseMode::Grab => {
self.mouse_grabber.update(
&game.input,
&self.camera,
game.renderer.window_size().into(),
&mut self.physics,
&self.graph,
);
}
MouseMode::Camera => {
self.camera
.update(&game.input, game.renderer.window_size().into());
if (game.input).is_mouse_button_pressed(MouseButton::Middle, Some(0)) {
self.camera.pose = uv::DSimilarity2::identity();
}
}
}
// reload
for (idx, num_key) in [
Key::Key1,
Key::Key2,
Key::Key3,
Key::Key4,
Key::Key5,
Key::Key6,
Key::Key7,
Key::Key8,
Key::Key9,
]
.iter()
.enumerate()
{
if game.input.is_key_pressed(*num_key, Some(0)) {
self.reset();
self.read_scene(idx);
self.instantiate_scene();
}
}
// reload current scene
if game.input.is_key_pressed(Key::Return, Some(0)) {
self.reset();
self.instantiate_scene();
}
// spawn stuff also when paused
let random_pos = || {
let mut rng = rand::thread_rng();
m::Vec2::new(
distr::Uniform::from(-5.0..5.0).sample(&mut rng),
distr::Uniform::from(1.0..4.0).sample(&mut rng),
)
};
let random_angle =
|| m::Angle::Deg(distr::Uniform::from(0.0..360.0).sample(&mut rand::thread_rng()));
let random_vel = || {
let mut rng = rand::thread_rng();
[
distr::Uniform::from(-5.0..5.0).sample(&mut rng),
distr::Uniform::from(-5.0..5.0).sample(&mut rng),
]
};
let mut rng = rand::thread_rng();
if game.input.is_key_pressed(Key::S, Some(0)) {
Recipe::DynamicBlock(recipes::Block {
pose: m::IsometryBuilder::new()
.with_position(random_pos())
.with_rotation(random_angle()),
width: distr::Uniform::from(0.6..1.0).sample(&mut rng),
height: distr::Uniform::from(0.5..0.8).sample(&mut rng),
})
.spawn(&mut self.graph, &mut self.physics);
}
if game.input.is_key_pressed(Key::T, Some(0)) {
Recipe::Ball(recipes::Ball {
position: random_pos().into(),
radius: distr::Uniform::from(0.1..0.4).sample(&mut rng),
restitution: 1.0,
start_velocity: random_vel(),
})
.spawn(&mut self.graph, &mut self.physics);
}
match (&self.state, game.input.is_key_pressed(Key::Space, Some(0))) {
//
// Playing or stepping manually
//
(StateEnum::Playing, _) | (StateEnum::Paused, true) => {
if game.input.is_key_pressed(Key::P, Some(0)) {
self.state = StateEnum::Paused;
return Some(());
}
{
microprofile::scope!("update", "physics");
let | MyGraph | identifier_name |
main.rs | window::WindowBuilder::new()
.with_title("starframe test")
.with_inner_size(winit::dpi::LogicalSize {
width: 800.0,
height: 600.0,
}),
);
let state = State::init(&game.renderer.device);
game.run(state);
microprofile::shutdown!();
}
//
// Types
//
pub enum StateEnum {
Playing,
Paused,
}
pub struct State {
scene: Scene,
state: StateEnum,
graph: MyGraph,
player: player::PlayerController,
mouse_mode: MouseMode,
mouse_grabber: MouseGrabber,
physics: phys::Physics,
camera: gx::camera::MouseDragCamera,
shape_renderer: gx::ShapeRenderer,
}
impl State {
fn init(device: &wgpu::Device) -> Self {
State {
scene: Scene::default(),
state: StateEnum::Playing,
graph: MyGraph::new(),
player: player::PlayerController::new(),
mouse_mode: MouseMode::Grab,
mouse_grabber: MouseGrabber::new(),
physics: phys::Physics::with_substeps(10),
camera: gx::camera::MouseDragCamera::new(
gx::camera::ScalingStrategy::ConstantDisplayArea {
width: 20.0,
height: 10.0,
},
),
shape_renderer: gx::ShapeRenderer::new(device),
}
}
fn reset(&mut self) {
self.physics.clear_constraints();
self.graph = MyGraph::new();
}
fn read_scene(&mut self, file_idx: usize) {
let dir = std::fs::read_dir("./examples/testgame/scenes");
match dir {
Err(err) => eprintln!("Scenes dir not found: {}", err),
Ok(mut dir) => {
if let Some(Ok(entry)) = dir.nth(file_idx) {
let file = std::fs::File::open(entry.path());
match file {
Ok(file) => {
let scene = Scene::read_from_file(file);
match scene {
Err(err) => eprintln!("Failed to parse file: {}", err),
Ok(scene) => self.scene = scene,
}
}
Err(err) => eprintln!("Failed to open file: {}", err),
}
}
}
}
}
fn instantiate_scene(&mut self) {
self.scene.instantiate(&mut self.graph, &mut self.physics);
}
}
#[derive(Clone, Copy, Debug)]
pub enum MouseMode {
/// Grab objects with the mouse
Grab,
/// Move the camera with the mouse
Camera,
}
/// The recipes in a scene plus some adjustable parameters.
#[derive(Clone, Debug, serde::Deserialize)]
#[serde(default)]
pub struct Scene {
gravity: [f64; 2],
recipes: Vec<Recipe>,
}
impl Default for Scene {
fn default() -> Self {
Self {
gravity: [0.0, -9.81],
recipes: vec![],
}
}
}
impl Scene {
pub fn read_from_file(file: std::fs::File) -> Result<Self, ron::de::Error> {
use serde::Deserialize;
use std::io::Read;
let mut reader = std::io::BufReader::new(file);
let mut bytes = Vec::new();
reader.read_to_end(&mut bytes)?;
let mut deser = ron::de::Deserializer::from_bytes(bytes.as_slice())?;
Scene::deserialize(&mut deser)
}
pub fn instantiate(&self, graph: &mut crate::MyGraph, physics: &mut phys::Physics) {
for recipe in &self.recipes {
recipe.spawn(graph, physics);
}
}
}
/// The entity graph.
pub struct MyGraph {
graph: graph::Graph,
l_pose: graph::Layer<m::Pose>,
l_collider: graph::Layer<phys::Collider>,
l_body: graph::Layer<phys::RigidBody>,
l_shape: graph::Layer<gx::Shape>,
l_player: graph::Layer<player::Player>,
l_evt_sink: sf::event::EventSinkLayer<MyGraph>,
}
impl MyGraph {
pub fn new() -> Self {
let mut graph = graph::Graph::new();
let l_pose = graph.create_layer();
let l_collider = graph.create_layer();
let l_body = graph.create_layer();
let l_shape = graph.create_layer();
let l_player = graph.create_layer();
let l_evt_sinks = graph.create_layer();
MyGraph {
graph,
l_pose,
l_collider,
l_body,
l_shape,
l_player,
l_evt_sink: l_evt_sinks,
}
}
}
//
// State updates
//
impl game::GameState for State {
fn tick(&mut self, dt: f64, game: &Game) -> Option<()> {
microprofile::flip();
microprofile::scope!("update", "all");
//
// State-independent stuff
//
// exit on esc
if game.input.is_key_pressed(Key::Escape, None) {
return None;
}
// adjust physics substeps
if game.input.is_key_pressed(Key::NumpadAdd, Some(0)) {
self.physics.substeps += 1;
println!("Substeps: {}", self.physics.substeps);
} else if game.input.is_key_pressed(Key::NumpadSubtract, Some(0))
&& self.physics.substeps > 1
{
self.physics.substeps -= 1;
println!("Substeps: {}", self.physics.substeps);
}
// mouse controls
if game.input.is_key_pressed(Key::V, Some(0)) {
self.mouse_mode = match self.mouse_mode {
MouseMode::Grab => MouseMode::Camera,
MouseMode::Camera => MouseMode::Grab,
};
println!("Mouse mode: {:?}", self.mouse_mode);
}
match self.mouse_mode {
MouseMode::Grab => {
self.mouse_grabber.update(
&game.input,
&self.camera,
game.renderer.window_size().into(),
&mut self.physics,
&self.graph,
);
}
MouseMode::Camera => {
self.camera
.update(&game.input, game.renderer.window_size().into());
if (game.input).is_mouse_button_pressed(MouseButton::Middle, Some(0)) {
self.camera.pose = uv::DSimilarity2::identity();
}
}
}
// reload
for (idx, num_key) in [
Key::Key1,
Key::Key2,
Key::Key3,
Key::Key4,
Key::Key5,
Key::Key6,
Key::Key7,
Key::Key8,
Key::Key9,
]
.iter()
.enumerate()
{
if game.input.is_key_pressed(*num_key, Some(0)) {
self.reset();
self.read_scene(idx);
self.instantiate_scene();
}
}
// reload current scene
if game.input.is_key_pressed(Key::Return, Some(0)) {
self.reset();
self.instantiate_scene();
}
// spawn stuff also when paused
let random_pos = || {
let mut rng = rand::thread_rng();
m::Vec2::new(
distr::Uniform::from(-5.0..5.0).sample(&mut rng),
distr::Uniform::from(1.0..4.0).sample(&mut rng),
)
};
let random_angle =
|| m::Angle::Deg(distr::Uniform::from(0.0..360.0).sample(&mut rand::thread_rng())); | distr::Uniform::from(-5.0..5.0).sample(&mut rng),
distr::Uniform::from(-5.0..5.0).sample(&mut rng),
]
};
let mut rng = rand::thread_rng();
if game.input.is_key_pressed(Key::S, Some(0)) {
Recipe::DynamicBlock(recipes::Block {
pose: m::IsometryBuilder::new()
.with_position(random_pos())
.with_rotation(random_angle()),
width: distr::Uniform::from(0.6..1.0).sample(&mut rng),
height: distr::Uniform::from(0.5..0.8).sample(&mut rng),
})
.spawn(&mut self.graph, &mut self.physics);
}
if game.input.is_key_pressed(Key::T, Some(0)) {
Recipe::Ball(recipes::Ball {
position: random_pos().into(),
radius: distr::Uniform::from(0.1..0.4).sample(&mut rng),
restitution: 1.0,
start_velocity: random_vel(),
})
.spawn(&mut self.graph, &mut self.physics);
}
match (&self.state, game.input.is_key_pressed(Key::Space, Some(0))) {
//
// Playing or stepping manually
//
(StateEnum::Playing, _) | (StateEnum::Paused, true) => {
if game.input.is_key_pressed(Key::P, Some(0)) {
self.state = StateEnum::Paused;
return Some(());
}
{
microprofile::scope!("update", "physics");
let grav | let random_vel = || {
let mut rng = rand::thread_rng();
[ | random_line_split |
main.rs | {
#[clap(long)]
labels: bool,
#[clap(long)]
statement_counts: bool,
#[clap(short, long, default_value = "0")]
skip: u64,
#[clap(short, long)]
threads: Option<usize>,
#[clap(required = true)]
paths: Vec<String>,
}
#[derive(Debug, PartialEq, Eq, Copy, Clone)]
pub enum Extra<'a> {
None,
Type(&'a str),
Lang(&'a str),
}
#[derive(Debug, PartialEq, Eq, Copy, Clone)]
pub enum Subject<'a> {
IRI(&'a str),
Blank(&'a str),
}
#[derive(Debug, PartialEq, Eq, Copy, Clone)]
pub enum Object<'a> {
IRI(&'a str),
Blank(&'a str),
Literal(&'a str, Extra<'a>),
}
#[derive(Debug, PartialEq, Eq, Copy, Clone)]
pub struct Statement<'a> {
subject: Subject<'a>,
predicate: &'a str,
object: Object<'a>,
}
pub enum Work {
LINES(u64, Vec<String>),
DONE,
}
pub struct WorkResult {
statement_counts: Option<HashMap<String, u64>>,
}
lazy_static! {
static ref RE: Regex = Regex::new(
r#"(?x)
^
\s*
# subject
(?:
# IRI
(?:<([^>]*)>)
|
# Blank
(?:_:([^\s]+))
)
\s*
# predicate IRI
<([^>]*)>
\s*
# object
(?:
# IRI
(?:<([^>]*)>)
|
# Blank
(?:_:([^\s]+))
|
# literal
(?:
"([^"]*)"
# optional extra
(?:
# language
(?:@([a-zA-Z]+(?:-[a-zA-Z0-9]+)*))
|
# data type
(?:\^\^<([^>]*)>)
)?
)
)
"#
)
.unwrap();
}
pub fn parse<'a>(line: u64, input: &'a str, regex: &Regex) -> Statement<'a> {
let captures = regex
.captures(input)
.unwrap_or_else(|| panic!("Invalid line: {}: {:?}", line, input));
let subject = captures
.get(1)
.map(|object| Subject::IRI(object.as_str()))
.or_else(|| captures.get(2).map(|blank| Subject::Blank(blank.as_str())))
.expect("failed to parse subject");
let predicate = captures.get(3).expect("failed to parse predicate").as_str();
let object = captures
.get(4)
.map(|object| Object::IRI(object.as_str()))
.or_else(|| captures.get(5).map(|blank| Object::Blank(blank.as_str())))
.unwrap_or_else(|| {
let literal = captures.get(6).expect("failed to parse object").as_str();
let extra = captures
.get(7)
.map(|lang| Extra::Lang(lang.as_str()))
.or_else(|| {
captures
.get(8)
.map(|data_type| Extra::Type(data_type.as_str()))
})
.unwrap_or(Extra::None);
Object::Literal(literal, extra)
});
Statement {
subject,
predicate,
object,
}
}
lazy_static_include_str! {
PROPERTIES_DATA => "properties",
IDENTIFIER_PROPERTIES_DATA => "identifier-properties",
LANGUAGES_DATA => "languages",
LABELS_DATA => "labels",
}
lazy_static! {
static ref PROPERTIES: HashSet<&'static str> = line_set(&PROPERTIES_DATA);
}
lazy_static! {
static ref IDENTIFIER_PROPERTIES: HashSet<String> = line_set(&IDENTIFIER_PROPERTIES_DATA)
.iter()
.flat_map(|id| vec![
format!("http://www.wikidata.org/prop/direct/P{}", id),
format!("http://www.wikidata.org/prop/direct-normalized/P{}", id)
])
.collect();
}
lazy_static! {
static ref LANGUAGES: HashSet<&'static str> = line_set(&LANGUAGES_DATA);
}
lazy_static! {
static ref LABELS: HashSet<&'static str> = line_set(&LABELS_DATA);
}
fn line_set(data: &str) -> HashSet<&str> {
data.lines().collect()
}
fn ignored_subject(iri: &str) -> bool {
iri.starts_with("https://www.wikidata.org/wiki/Special:EntityData")
}
fn produce<T: Read>(
running: Arc<AtomicBool>,
skip: u64,
reader: T,
s: &Sender<Work>,
) -> (bool, u64) {
let mut total = 0;
let mut buf_reader = BufReader::new(reader);
let mut lines = Vec::new();
if skip > 0 {
eprintln!("# skipping {}", skip)
}
loop {
if !running.load(Ordering::SeqCst) {
eprintln!("# interrupted after {}", total);
return (false, total);
}
let mut line = String::new();
if buf_reader.read_line(&mut line).unwrap() == 0 {
break;
}
total += 1;
let skipped = total < skip;
if !skipped {
lines.push(line);
if total % BATCH_SIZE == 0 {
s.send(Work::LINES(total, lines)).unwrap();
lines = Vec::new();
}
}
if total % PROGRESS_COUNT == 0 {
let status = if skipped { "skipped" } else { "" };
eprintln!("# {} {}", status, total);
}
}
if !lines.is_empty() {
s.send(Work::LINES(total, lines)).unwrap();
}
(true, total)
}
fn consume(
name: String,
work_receiver: Receiver<Work>,
result_sender: Sender<WorkResult>,
labels: bool,
statement_counts: bool,
) {
let regex = RE.clone();
let lines_path = format!("{}.nt.bz2", name);
let lines_file = File::create(&lines_path)
.unwrap_or_else(|_| panic!("unable to create file: {}", &lines_path));
let mut lines_encoder = BzEncoder::new(BufWriter::new(lines_file), Compression::best());
let mut labels_encoder = if labels {
let labels_path = format!("labels_{}.bz2", name);
let labels_file = File::create(&labels_path)
.unwrap_or_else(|_| panic!("unable to create file: {}", &labels_path));
Some(BzEncoder::new(
BufWriter::new(labels_file),
Compression::best(),
))
} else {
None
};
let mut statement_counter = if statement_counts {
Some(HashMap::new())
} else {
None
};
loop {
match work_receiver.recv().unwrap() {
Work::LINES(number, lines) => {
for line in lines {
handle(
&mut lines_encoder,
labels_encoder.as_mut(),
statement_counter.as_mut(),
number,
line,
®ex,
);
}
lines_encoder.flush().unwrap();
if let Some(labels_encoder) = labels_encoder.as_mut() {
labels_encoder.flush().unwrap()
}
}
Work::DONE => {
eprintln!("# stopping thread {}", name);
lines_encoder.try_finish().unwrap();
if let Some(labels_encoder) = labels_encoder.as_mut() {
labels_encoder.try_finish().unwrap()
}
result_sender
.send(WorkResult {
statement_counts: statement_counter,
})
.unwrap();
return;
}
}
}
}
fn handle<T: Write, U: Write>(
lines_writer: &mut T,
labels_writer: Option<&mut U>,
statement_counter: Option<&mut HashMap<String, u64>>,
number: u64,
line: String,
regex: &Regex,
) -> Option<()> {
let statement = parse(number, &line, regex);
maybe_write_line(lines_writer, &line, statement);
let id = entity(statement.subject)?;
maybe_count_statement(statement_counter, id, statement);
maybe_write_label(labels_writer, id, statement);
None
}
fn maybe_write_line<T: Write>(lines_writer: &mut T, line: &str, statement: Statement) {
if !is_acceptable(statement) {
return;
}
lines_writer.write_all(line.as_bytes()).unwrap();
}
fn maybe_write_label<T: Write>(
labels_writer: Option<&mut T>,
id: &str,
statement: Statement,
) -> Option<()> {
let labels_writer = labels_writer?;
let label = label(statement)?;
labels_writer
.write_fmt(format_args!("{} {}\n", id, label))
.unwrap();
None
}
fn maybe_count_statement(
statement_counter: Option<&mut HashMap<String, u64>>,
id: &str,
statement: Statement,
) -> Option<()> {
let statement_counter = statement_counter?;
direct_property(statement.predicate)?;
*statement_counter.entry(id.to_string()).or_insert(0) += 1;
None
}
fn is_acceptable(statement: Statement) -> bool {
| Opts | identifier_name | |
main.rs | .get(7)
.map(|lang| Extra::Lang(lang.as_str()))
.or_else(|| {
captures
.get(8)
.map(|data_type| Extra::Type(data_type.as_str()))
})
.unwrap_or(Extra::None);
Object::Literal(literal, extra)
});
Statement {
subject,
predicate,
object,
}
}
lazy_static_include_str! {
PROPERTIES_DATA => "properties",
IDENTIFIER_PROPERTIES_DATA => "identifier-properties",
LANGUAGES_DATA => "languages",
LABELS_DATA => "labels",
}
lazy_static! {
static ref PROPERTIES: HashSet<&'static str> = line_set(&PROPERTIES_DATA);
}
lazy_static! {
static ref IDENTIFIER_PROPERTIES: HashSet<String> = line_set(&IDENTIFIER_PROPERTIES_DATA)
.iter()
.flat_map(|id| vec![
format!("http://www.wikidata.org/prop/direct/P{}", id),
format!("http://www.wikidata.org/prop/direct-normalized/P{}", id)
])
.collect();
}
lazy_static! {
static ref LANGUAGES: HashSet<&'static str> = line_set(&LANGUAGES_DATA);
}
lazy_static! {
static ref LABELS: HashSet<&'static str> = line_set(&LABELS_DATA);
}
fn line_set(data: &str) -> HashSet<&str> {
data.lines().collect()
}
fn ignored_subject(iri: &str) -> bool {
iri.starts_with("https://www.wikidata.org/wiki/Special:EntityData")
}
fn produce<T: Read>(
running: Arc<AtomicBool>,
skip: u64,
reader: T,
s: &Sender<Work>,
) -> (bool, u64) {
let mut total = 0;
let mut buf_reader = BufReader::new(reader);
let mut lines = Vec::new();
if skip > 0 {
eprintln!("# skipping {}", skip)
}
loop {
if !running.load(Ordering::SeqCst) {
eprintln!("# interrupted after {}", total);
return (false, total);
}
let mut line = String::new();
if buf_reader.read_line(&mut line).unwrap() == 0 {
break;
}
total += 1;
let skipped = total < skip;
if !skipped {
lines.push(line);
if total % BATCH_SIZE == 0 {
s.send(Work::LINES(total, lines)).unwrap();
lines = Vec::new();
}
}
if total % PROGRESS_COUNT == 0 {
let status = if skipped { "skipped" } else { "" };
eprintln!("# {} {}", status, total);
}
}
if !lines.is_empty() {
s.send(Work::LINES(total, lines)).unwrap();
}
(true, total)
}
fn consume(
name: String,
work_receiver: Receiver<Work>,
result_sender: Sender<WorkResult>,
labels: bool,
statement_counts: bool,
) {
let regex = RE.clone();
let lines_path = format!("{}.nt.bz2", name);
let lines_file = File::create(&lines_path)
.unwrap_or_else(|_| panic!("unable to create file: {}", &lines_path));
let mut lines_encoder = BzEncoder::new(BufWriter::new(lines_file), Compression::best());
let mut labels_encoder = if labels {
let labels_path = format!("labels_{}.bz2", name);
let labels_file = File::create(&labels_path)
.unwrap_or_else(|_| panic!("unable to create file: {}", &labels_path));
Some(BzEncoder::new(
BufWriter::new(labels_file),
Compression::best(),
))
} else {
None
};
let mut statement_counter = if statement_counts {
Some(HashMap::new())
} else {
None
};
loop {
match work_receiver.recv().unwrap() {
Work::LINES(number, lines) => {
for line in lines {
handle(
&mut lines_encoder,
labels_encoder.as_mut(),
statement_counter.as_mut(),
number,
line,
®ex,
);
}
lines_encoder.flush().unwrap();
if let Some(labels_encoder) = labels_encoder.as_mut() {
labels_encoder.flush().unwrap()
}
}
Work::DONE => {
eprintln!("# stopping thread {}", name);
lines_encoder.try_finish().unwrap();
if let Some(labels_encoder) = labels_encoder.as_mut() {
labels_encoder.try_finish().unwrap()
}
result_sender
.send(WorkResult {
statement_counts: statement_counter,
})
.unwrap();
return;
}
}
}
}
fn handle<T: Write, U: Write>(
lines_writer: &mut T,
labels_writer: Option<&mut U>,
statement_counter: Option<&mut HashMap<String, u64>>,
number: u64,
line: String,
regex: &Regex,
) -> Option<()> {
let statement = parse(number, &line, regex);
maybe_write_line(lines_writer, &line, statement);
let id = entity(statement.subject)?;
maybe_count_statement(statement_counter, id, statement);
maybe_write_label(labels_writer, id, statement);
None
}
fn maybe_write_line<T: Write>(lines_writer: &mut T, line: &str, statement: Statement) {
if !is_acceptable(statement) {
return;
}
lines_writer.write_all(line.as_bytes()).unwrap();
}
fn maybe_write_label<T: Write>(
labels_writer: Option<&mut T>,
id: &str,
statement: Statement,
) -> Option<()> {
let labels_writer = labels_writer?;
let label = label(statement)?;
labels_writer
.write_fmt(format_args!("{} {}\n", id, label))
.unwrap();
None
}
fn maybe_count_statement(
statement_counter: Option<&mut HashMap<String, u64>>,
id: &str,
statement: Statement,
) -> Option<()> {
let statement_counter = statement_counter?;
direct_property(statement.predicate)?;
*statement_counter.entry(id.to_string()).or_insert(0) += 1;
None
}
fn is_acceptable(statement: Statement) -> bool {
if PROPERTIES.contains(statement.predicate)
|| IDENTIFIER_PROPERTIES.contains(statement.predicate)
{
return false;
}
match statement.subject {
Subject::Blank(_) => return false,
Subject::IRI(iri) if ignored_subject(iri) => return false,
_ => (),
}
match statement.object {
Object::Blank(_) => return false,
Object::Literal(_, Extra::Lang(lang)) if !LANGUAGES.contains(lang) => return false,
// non-Earth geo coordinates are not supported by some triple stores
Object::Literal(
literal,
Extra::Type("http://www.opengis.net/ont/geosparql#wktLiteral"),
) if literal.starts_with('<') => return false,
_ => (),
}
true
}
fn label(statement: Statement) -> Option<String> {
if !LABELS.contains(statement.predicate) {
return None;
}
if let Object::Literal(label, Extra::Lang(lang)) = statement.object {
if !LANGUAGES.contains(lang) {
return None;
}
return Some(unescape(label));
}
None
}
static ENTITY_IRI_PREFIX: &str = "http://www.wikidata.org/entity/Q";
fn entity(subject: Subject) -> Option<&str> {
if let Subject::IRI(iri) = subject {
iri.strip_prefix(ENTITY_IRI_PREFIX)
} else {
None
}
}
static DIRECT_PROPERTY_IRI_PREFIX: &str = "http://www.wikidata.org/prop/direct/";
fn direct_property(predicate: &str) -> Option<&str> {
predicate.strip_prefix(DIRECT_PROPERTY_IRI_PREFIX)
}
pub fn unescape(s: &str) -> String {
let mut chars = s.chars().enumerate();
let mut res = String::with_capacity(s.len());
while let Some((idx, c)) = chars.next() {
if c == '\\' {
match chars.next() {
None => {
panic!("invalid escape at {} in {}", idx, s);
}
Some((idx, c2)) => {
res.push(match c2 {
't' => '\t',
'b' => '\u{08}',
'n' => '\n',
'r' => '\r',
'f' => '\u{0C}',
'\\' => '\\',
'u' => match parse_unicode(&mut chars, 4) {
Ok(c3) => c3,
Err(err) => {
panic!("invalid escape {}{} at {} in {}: {}", c, c2, idx, s, err);
} | }
},
_ => {
panic!("invalid escape {}{} at {} in {}", c, c2, idx, s);
}
});
continue;
}
};
}
res.push(c);
}
res
}
fn parse_unicode<I>(chars: &mut I, count: usize) -> Result<char, String>
where
| },
'U' => match parse_unicode(&mut chars, 8) {
Ok(c3) => c3,
Err(err) => {
panic!("invalid escape {}{} at {} in {}: {}", c, c2, idx, s, err); | random_line_split |
main.rs | continue;
}
};
}
res.push(c);
}
res
}
fn parse_unicode<I>(chars: &mut I, count: usize) -> Result<char, String>
where
I: Iterator<Item = (usize, char)>,
{
let unicode_seq: String = chars.take(count).map(|(_, c)| c).collect();
u32::from_str_radix(&unicode_seq, 16)
.map_err(|e| format!("could not parse {} as u32 hex: {}", unicode_seq, e))
.and_then(|u| {
std::char::from_u32(u).ok_or_else(|| format!("could not parse {} as a unicode char", u))
})
}
fn main() {
let opts: Opts = Opts::parse();
let labels = opts.labels;
let statement_counts = opts.statement_counts;
let running = Arc::new(AtomicBool::new(true));
let r = running.clone();
ctrlc::set_handler(move || {
if r.load(Ordering::SeqCst) {
exit(1);
}
r.store(false, Ordering::SeqCst);
})
.expect("failed to set Ctrl-C handler");
let start = Instant::now();
let (work_sender, work_receiver) = bounded::<Work>(0);
let (result_sender, result_receiver) = unbounded();
let mut threads = Vec::new();
let thread_count = opts.threads.unwrap_or_else(|| num_cpus::get() * 2);
for id in 1..=thread_count {
let work_receiver = work_receiver.clone();
let result_sender = result_sender.clone();
threads.push(thread::spawn(move || {
consume(
id.to_string(),
work_receiver,
result_sender,
labels,
statement_counts,
)
}));
}
let mut exit_code = 0;
for path in opts.paths {
let file = File::open(&path).expect("can't open file");
let decoder = BzDecoder::new(BufReader::new(file));
eprintln!("# processing {}", path);
let (finished, count) = produce(running.clone(), opts.skip, decoder, &work_sender);
eprintln!("# processed {}: {}", path, count);
if !finished {
exit_code = 1;
break;
}
}
for _ in &threads {
work_sender.send(Work::DONE).unwrap();
}
let mut statement_counter = HashMap::new();
let mut result_count = 0;
for result in result_receiver.iter() {
if let Some(statement_counts) = result.statement_counts {
for (id, count) in statement_counts.iter() {
*statement_counter.entry(id.to_string()).or_insert(0) += count;
}
}
result_count += 1;
if result_count == thread_count {
break;
}
}
if statement_counts {
eprintln!("# entities: {}", statement_counter.len());
let path = "statement_counts.bz2";
let file = File::create(path).unwrap_or_else(|_| panic!("unable to create file: {}", path));
let mut encoder = BzEncoder::new(BufWriter::new(file), Compression::best());
for (id, count) in statement_counter.iter() {
encoder
.write_fmt(format_args!("{} {}\n", id, count))
.unwrap();
}
encoder.try_finish().unwrap();
}
let duration = start.elapsed();
eprintln!("# took {:?}", duration);
exit(exit_code);
}
#[cfg(test)]
mod tests {
use super::*;
use pretty_assertions::assert_eq;
use std::fs::read_to_string;
use std::io::{self, Lines};
use std::path::{Path, PathBuf};
#[test]
fn test_literal_with_type() {
let line = r#"<http://www.wikidata.org/entity/Q1644> <http://www.wikidata.org/prop/direct/P2043> "+1094.26"^^<http://www.w3.org/2001/XMLSchema#decimal> ."#;
assert_eq!(
parse(1, line, &RE),
Statement {
subject: Subject::IRI("http://www.wikidata.org/entity/Q1644"),
predicate: "http://www.wikidata.org/prop/direct/P2043",
object: Object::Literal(
"+1094.26",
Extra::Type("http://www.w3.org/2001/XMLSchema#decimal")
)
}
);
}
#[test]
fn test_literal_with_lang() {
let line = r#"<http://www.wikidata.org/entity/Q177> <http://schema.org/name> "pizza"@en ."#;
assert_eq!(
parse(1, line, &RE),
Statement {
subject: Subject::IRI("http://www.wikidata.org/entity/Q177"),
predicate: "http://schema.org/name",
object: Object::Literal("pizza", Extra::Lang("en"))
}
);
}
#[test]
fn test_literal() {
let line = r#"<http://www.wikidata.org/entity/Q177> <http://www.wikidata.org/prop/direct/P373> "Pizzas" ."#;
assert_eq!(
parse(1, line, &RE),
Statement {
subject: Subject::IRI("http://www.wikidata.org/entity/Q177"),
predicate: "http://www.wikidata.org/prop/direct/P373",
object: Object::Literal("Pizzas", Extra::None)
}
);
}
#[test]
fn test_blank_subject() {
let line = r#"_:foo <bar> <baz>"#;
assert_eq!(
parse(1, line, &RE),
Statement {
subject: Subject::Blank("foo"),
predicate: "bar",
object: Object::IRI("baz")
}
);
}
#[test]
fn test_blank_object() {
let line = r#"<foo> <bar> _:baz"#;
assert_eq!(
parse(1, line, &RE),
Statement {
subject: Subject::IRI("foo"),
predicate: "bar",
object: Object::Blank("baz")
}
);
}
#[test]
fn test_statement_count() {
let a = format!("{}a", ENTITY_IRI_PREFIX);
let b = format!("{}b", ENTITY_IRI_PREFIX);
let first_predicate = format!("{}first", DIRECT_PROPERTY_IRI_PREFIX);
let second_predicate = "second";
let third_predicate = format!("{}third", DIRECT_PROPERTY_IRI_PREFIX);
let first = Statement {
subject: Subject::IRI(a.as_str()),
predicate: first_predicate.as_str(),
object: Object::IRI(""),
};
let second = Statement {
subject: Subject::IRI(b.as_str()),
predicate: second_predicate,
object: Object::IRI(""),
};
let third = Statement {
subject: Subject::IRI(a.as_str()),
predicate: third_predicate.as_str(),
object: Object::IRI(""),
};
let mut counter = HashMap::new();
maybe_count_statement(Some(&mut counter), "a", first);
maybe_count_statement(Some(&mut counter), "b", second);
maybe_count_statement(Some(&mut counter), "a", third);
assert_eq!(counter.len(), 1);
assert_eq!(counter.get("a"), Some(&2));
assert_eq!(counter.get("b"), None);
}
#[test]
fn test_geo_literals() {
assert!(is_acceptable(parse(
1,
r#"<foo> <bar> "Point(4.6681 50.6411)"^^<http://www.opengis.net/ont/geosparql#wktLiteral> ."#,
&RE,
)));
assert!(!is_acceptable(parse(
1,
r#"<foo> <bar> "<http://www.wikidata.org/entity/Q405> Point(-141.6 42.6)"^^<http://www.opengis.net/ont/geosparql#wktLiteral> ."#,
&RE,
)));
}
fn read_lines<P>(filename: P) -> io::Result<Lines<BufReader<File>>>
where
P: AsRef<Path>,
{
let file = File::open(filename)?;
Ok(BufReader::new(file).lines())
}
#[test]
fn test_full() -> Result<(), ()> | {
let dir = env!("CARGO_MANIFEST_DIR");
let mut in_path = PathBuf::from(dir);
in_path.push("test.in.rdf");
let in_path = in_path.as_os_str().to_str().unwrap();
let mut out_path = PathBuf::from(dir);
out_path.push("test.out.rdf");
let out_path = out_path.as_os_str().to_str().unwrap();
let mut lines_writer = Vec::new();
let mut labels_writer = Vec::new();
for (line, number) in read_lines(in_path).unwrap().zip(1u64..) {
let mut line = line.unwrap();
line.push('\n');
handle(
&mut lines_writer,
Some(&mut labels_writer), | identifier_body | |
lease_status.pb.go | i = encodeVarintLeaseStatus(dAtA, i, uint64(m.Lease.Size()))
n1, err := m.Lease.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n1
dAtA[i] = 0x12
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.Timestamp.Size()))
n2, err := m.Timestamp.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n2
if m.State != 0 {
dAtA[i] = 0x18
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.State))
}
if m.Liveness != nil {
dAtA[i] = 0x22
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.Liveness.Size()))
n3, err := m.Liveness.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n3
}
return i, nil
}
func encodeVarintLeaseStatus(dAtA []byte, offset int, v uint64) int {
for v >= 1<<7 {
dAtA[offset] = uint8(v&0x7f | 0x80)
v >>= 7
offset++
}
dAtA[offset] = uint8(v)
return offset + 1
}
func (m *LeaseStatus) Size() (n int) {
var l int
_ = l
l = m.Lease.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
l = m.Timestamp.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
if m.State != 0 {
n += 1 + sovLeaseStatus(uint64(m.State))
}
if m.Liveness != nil {
l = m.Liveness.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
}
return n
}
func sovLeaseStatus(x uint64) (n int) {
for {
n++
x >>= 7
if x == 0 {
break
}
}
return n
}
func sozLeaseStatus(x uint64) (n int) {
return sovLeaseStatus(uint64((x << 1) ^ uint64((int64(x) >> 63))))
}
func (m *LeaseStatus) Unmarshal(dAtA []byte) error {
l := len(dAtA)
iNdEx := 0
for iNdEx < l {
preIndex := iNdEx
var wire uint64
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
wire |= (uint64(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
fieldNum := int32(wire >> 3)
wireType := int(wire & 0x7)
if wireType == 4 {
return fmt.Errorf("proto: LeaseStatus: wiretype end group for non-group")
}
if fieldNum <= 0 {
return fmt.Errorf("proto: LeaseStatus: illegal tag %d (wire type %d)", fieldNum, wire)
}
switch fieldNum {
case 1:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Lease", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if err := m.Lease.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
case 2:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Timestamp", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if err := m.Timestamp.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
case 3:
if wireType != 0 {
return fmt.Errorf("proto: wrong wireType = %d for field State", wireType)
}
m.State = 0
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
m.State |= (LeaseState(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
case 4:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Liveness", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if m.Liveness == nil {
m.Liveness = &Liveness{}
}
if err := m.Liveness.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
default:
iNdEx = preIndex
skippy, err := skipLeaseStatus(dAtA[iNdEx:])
if err != nil {
return err
}
if skippy < 0 {
return ErrInvalidLengthLeaseStatus
}
if (iNdEx + skippy) > l {
return io.ErrUnexpectedEOF
}
iNdEx += skippy
}
}
if iNdEx > l {
return io.ErrUnexpectedEOF
}
return nil
}
func skipLeaseStatus(dAtA []byte) (n int, err error) {
l := len(dAtA)
iNdEx := 0
for iNdEx < l {
var wire uint64
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return 0, io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
wire |= (uint64(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
wireType := int(wire & 0x7)
switch wireType {
case 0:
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return 0, io.ErrUnexpectedEOF
}
iNdEx++
if dAtA[iNdEx-1] < 0x80 {
break
}
}
return iNdEx, nil
case 1:
iNdEx += 8
return iNdEx, nil
case 2:
var length int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if | var l int
_ = l
dAtA[i] = 0xa
i++ | random_line_split | |
lease_status.pb.go | () (dAtA []byte, err error) {
size := m.Size()
dAtA = make([]byte, size)
n, err := m.MarshalTo(dAtA)
if err != nil {
return nil, err
}
return dAtA[:n], nil
}
func (m *LeaseStatus) MarshalTo(dAtA []byte) (int, error) {
var i int
_ = i
var l int
_ = l
dAtA[i] = 0xa
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.Lease.Size()))
n1, err := m.Lease.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n1
dAtA[i] = 0x12
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.Timestamp.Size()))
n2, err := m.Timestamp.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n2
if m.State != 0 {
dAtA[i] = 0x18
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.State))
}
if m.Liveness != nil {
dAtA[i] = 0x22
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.Liveness.Size()))
n3, err := m.Liveness.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n3
}
return i, nil
}
func encodeVarintLeaseStatus(dAtA []byte, offset int, v uint64) int {
for v >= 1<<7 {
dAtA[offset] = uint8(v&0x7f | 0x80)
v >>= 7
offset++
}
dAtA[offset] = uint8(v)
return offset + 1
}
func (m *LeaseStatus) Size() (n int) {
var l int
_ = l
l = m.Lease.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
l = m.Timestamp.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
if m.State != 0 {
n += 1 + sovLeaseStatus(uint64(m.State))
}
if m.Liveness != nil {
l = m.Liveness.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
}
return n
}
func sovLeaseStatus(x uint64) (n int) {
for {
n++
x >>= 7
if x == 0 {
break
}
}
return n
}
func sozLeaseStatus(x uint64) (n int) {
return sovLeaseStatus(uint64((x << 1) ^ uint64((int64(x) >> 63))))
}
func (m *LeaseStatus) Unmarshal(dAtA []byte) error {
l := len(dAtA)
iNdEx := 0
for iNdEx < l {
preIndex := iNdEx
var wire uint64
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
wire |= (uint64(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
fieldNum := int32(wire >> 3)
wireType := int(wire & 0x7)
if wireType == 4 {
return fmt.Errorf("proto: LeaseStatus: wiretype end group for non-group")
}
if fieldNum <= 0 {
return fmt.Errorf("proto: LeaseStatus: illegal tag %d (wire type %d)", fieldNum, wire)
}
switch fieldNum {
case 1:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Lease", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if err := m.Lease.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
case 2:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Timestamp", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if err := m.Timestamp.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
case 3:
if wireType != 0 {
return fmt.Errorf("proto: wrong wireType = %d for field State", wireType)
}
m.State = 0
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
m.State |= (LeaseState(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
case 4:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Liveness", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if m.Liveness == nil {
m.Liveness = &Liveness{}
}
if err := m.Liveness.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
default:
iNdEx = preIndex
skippy, err := skipLeaseStatus(dAtA[iNdEx:])
if err != nil {
return err
}
if skippy < 0 {
return ErrInvalidLengthLeaseStatus
}
if (iNdEx + skippy) > l {
return io.ErrUnexpectedEOF
}
iNdEx += skippy
}
}
if iNdEx > l {
return io.ErrUnexpectedEOF
}
return nil
}
func skipLeaseStatus(dAtA []byte) (n int, err error) {
l := len(dAtA)
iNdEx := 0
for iNdEx < l {
var wire uint64
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return 0, io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
wire |= (uint64(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
wireType := int(wire & 0x7)
switch wireType {
case 0:
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return 0, io.ErrUnexpectedEOF
}
iNdEx++
if dAtA[iNdEx-1] < | Marshal | identifier_name | |
lease_status.pb.go | .Size()))
n2, err := m.Timestamp.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n2
if m.State != 0 {
dAtA[i] = 0x18
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.State))
}
if m.Liveness != nil {
dAtA[i] = 0x22
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.Liveness.Size()))
n3, err := m.Liveness.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n3
}
return i, nil
}
func encodeVarintLeaseStatus(dAtA []byte, offset int, v uint64) int {
for v >= 1<<7 {
dAtA[offset] = uint8(v&0x7f | 0x80)
v >>= 7
offset++
}
dAtA[offset] = uint8(v)
return offset + 1
}
func (m *LeaseStatus) Size() (n int) {
var l int
_ = l
l = m.Lease.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
l = m.Timestamp.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
if m.State != 0 {
n += 1 + sovLeaseStatus(uint64(m.State))
}
if m.Liveness != nil {
l = m.Liveness.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
}
return n
}
func sovLeaseStatus(x uint64) (n int) {
for {
n++
x >>= 7
if x == 0 {
break
}
}
return n
}
func sozLeaseStatus(x uint64) (n int) {
return sovLeaseStatus(uint64((x << 1) ^ uint64((int64(x) >> 63))))
}
func (m *LeaseStatus) Unmarshal(dAtA []byte) error {
l := len(dAtA)
iNdEx := 0
for iNdEx < l {
preIndex := iNdEx
var wire uint64
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
wire |= (uint64(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
fieldNum := int32(wire >> 3)
wireType := int(wire & 0x7)
if wireType == 4 {
return fmt.Errorf("proto: LeaseStatus: wiretype end group for non-group")
}
if fieldNum <= 0 {
return fmt.Errorf("proto: LeaseStatus: illegal tag %d (wire type %d)", fieldNum, wire)
}
switch fieldNum {
case 1:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Lease", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if err := m.Lease.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
case 2:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Timestamp", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if err := m.Timestamp.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
case 3:
if wireType != 0 {
return fmt.Errorf("proto: wrong wireType = %d for field State", wireType)
}
m.State = 0
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
m.State |= (LeaseState(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
case 4:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Liveness", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if m.Liveness == nil {
m.Liveness = &Liveness{}
}
if err := m.Liveness.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
default:
iNdEx = preIndex
skippy, err := skipLeaseStatus(dAtA[iNdEx:])
if err != nil {
return err
}
if skippy < 0 {
return ErrInvalidLengthLeaseStatus
}
if (iNdEx + skippy) > l {
return io.ErrUnexpectedEOF
}
iNdEx += skippy
}
}
if iNdEx > l {
return io.ErrUnexpectedEOF
}
return nil
}
func skipLeaseStatus(dAtA []byte) (n int, err error) {
l := len(dAtA)
iNdEx := 0
for iNdEx < l {
var wire uint64
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return 0, io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
wire |= (uint64(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
wireType := int(wire & 0x7)
switch wireType {
case 0:
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return 0, io.ErrUnexpectedEOF
}
iNdEx++
if dAtA[iNdEx-1] < 0x80 {
break
}
}
return iNdEx, nil
case 1:
iNdEx += 8
return iNdEx, nil
case 2:
var length int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l |
b := dAtA[iNdEx]
iNdEx++
length |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
iNdEx += length
if length < 0 {
return 0, ErrInvalidLengthLeaseStatus
}
return iNdEx, nil
case | {
return 0, io.ErrUnexpectedEOF
} | conditional_block |
lease_status.pb.go | .Size()))
n2, err := m.Timestamp.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n2
if m.State != 0 {
dAtA[i] = 0x18
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.State))
}
if m.Liveness != nil {
dAtA[i] = 0x22
i++
i = encodeVarintLeaseStatus(dAtA, i, uint64(m.Liveness.Size()))
n3, err := m.Liveness.MarshalTo(dAtA[i:])
if err != nil {
return 0, err
}
i += n3
}
return i, nil
}
func encodeVarintLeaseStatus(dAtA []byte, offset int, v uint64) int {
for v >= 1<<7 {
dAtA[offset] = uint8(v&0x7f | 0x80)
v >>= 7
offset++
}
dAtA[offset] = uint8(v)
return offset + 1
}
func (m *LeaseStatus) Size() (n int) {
var l int
_ = l
l = m.Lease.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
l = m.Timestamp.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
if m.State != 0 {
n += 1 + sovLeaseStatus(uint64(m.State))
}
if m.Liveness != nil {
l = m.Liveness.Size()
n += 1 + l + sovLeaseStatus(uint64(l))
}
return n
}
func sovLeaseStatus(x uint64) (n int) {
for {
n++
x >>= 7
if x == 0 {
break
}
}
return n
}
func sozLeaseStatus(x uint64) (n int) {
return sovLeaseStatus(uint64((x << 1) ^ uint64((int64(x) >> 63))))
}
func (m *LeaseStatus) Unmarshal(dAtA []byte) error | fieldNum := int32(wire >> 3)
wireType := int(wire & 0x7)
if wireType == 4 {
return fmt.Errorf("proto: LeaseStatus: wiretype end group for non-group")
}
if fieldNum <= 0 {
return fmt.Errorf("proto: LeaseStatus: illegal tag %d (wire type %d)", fieldNum, wire)
}
switch fieldNum {
case 1:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Lease", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if err := m.Lease.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
case 2:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Timestamp", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if err := m.Timestamp.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
case 3:
if wireType != 0 {
return fmt.Errorf("proto: wrong wireType = %d for field State", wireType)
}
m.State = 0
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
m.State |= (LeaseState(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
case 4:
if wireType != 2 {
return fmt.Errorf("proto: wrong wireType = %d for field Liveness", wireType)
}
var msglen int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
msglen |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
if msglen < 0 {
return ErrInvalidLengthLeaseStatus
}
postIndex := iNdEx + msglen
if postIndex > l {
return io.ErrUnexpectedEOF
}
if m.Liveness == nil {
m.Liveness = &Liveness{}
}
if err := m.Liveness.Unmarshal(dAtA[iNdEx:postIndex]); err != nil {
return err
}
iNdEx = postIndex
default:
iNdEx = preIndex
skippy, err := skipLeaseStatus(dAtA[iNdEx:])
if err != nil {
return err
}
if skippy < 0 {
return ErrInvalidLengthLeaseStatus
}
if (iNdEx + skippy) > l {
return io.ErrUnexpectedEOF
}
iNdEx += skippy
}
}
if iNdEx > l {
return io.ErrUnexpectedEOF
}
return nil
}
func skipLeaseStatus(dAtA []byte) (n int, err error) {
l := len(dAtA)
iNdEx := 0
for iNdEx < l {
var wire uint64
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return 0, io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
wire |= (uint64(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
wireType := int(wire & 0x7)
switch wireType {
case 0:
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return 0, io.ErrUnexpectedEOF
}
iNdEx++
if dAtA[iNdEx-1] < 0x80 {
break
}
}
return iNdEx, nil
case 1:
iNdEx += 8
return iNdEx, nil
case 2:
var length int
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return 0, ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return 0, io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
length |= (int(b) & 0x7F) << shift
if b < 0x80 {
break
}
}
iNdEx += length
if length < 0 {
return 0, ErrInvalidLengthLeaseStatus
}
return iNdEx, nil
case 3 | {
l := len(dAtA)
iNdEx := 0
for iNdEx < l {
preIndex := iNdEx
var wire uint64
for shift := uint(0); ; shift += 7 {
if shift >= 64 {
return ErrIntOverflowLeaseStatus
}
if iNdEx >= l {
return io.ErrUnexpectedEOF
}
b := dAtA[iNdEx]
iNdEx++
wire |= (uint64(b) & 0x7F) << shift
if b < 0x80 {
break
}
} | identifier_body |
writer.rs | (&mut self, arch: Arch) {
self.arch = arch;
}
/// Sets the debug identifier of this SymCache.
pub fn set_debug_id(&mut self, debug_id: DebugId) {
self.debug_id = debug_id;
}
// Methods processing symbolic-debuginfo [`ObjectLike`] below:
// Feel free to move these to a separate file.
/// This processes the given [`ObjectLike`] object, collecting all its functions and line
/// information into the converter.
#[tracing::instrument(skip_all, fields(object.debug_id = %object.debug_id().breakpad()))]
pub fn process_object<'d, 'o, O>(&mut self, object: &'o O) -> Result<(), Error>
where
O: ObjectLike<'d, 'o>,
O::Error: std::error::Error + Send + Sync + 'static,
{
let session = object
.debug_session()
.map_err(|e| Error::new(ErrorKind::BadDebugFile, e))?;
self.set_arch(object.arch());
self.set_debug_id(object.debug_id());
self.is_windows_object = matches!(object.file_format(), FileFormat::Pe | FileFormat::Pdb);
for function in session.functions() {
let function = function.map_err(|e| Error::new(ErrorKind::BadDebugFile, e))?;
self.process_symbolic_function(&function);
}
for symbol in object.symbols() {
self.process_symbolic_symbol(&symbol);
}
self.is_windows_object = false;
Ok(())
}
/// Processes an individual [`Function`], adding its line information to the converter.
pub fn process_symbolic_function(&mut self, function: &Function<'_>) {
self.process_symbolic_function_recursive(function, &[(0x0, u32::MAX)]);
}
/// Processes an individual [`Function`], adding its line information to the converter.
///
/// `call_locations` is a non-empty sorted list of `(address, call_location index)` pairs.
fn process_symbolic_function_recursive(
&mut self,
function: &Function<'_>,
call_locations: &[(u32, u32)],
) {
let string_table = &mut self.string_table;
// skip over empty functions or functions whose address is too large to fit in a u32
if function.size == 0 || function.address > u32::MAX as u64 {
return;
}
let comp_dir = std::str::from_utf8(function.compilation_dir).ok();
let entry_pc = if function.inline {
u32::MAX
} else {
function.address as u32
};
let function_idx = {
let language = function.name.language();
let mut function = transform::Function {
name: function.name.as_str().into(),
comp_dir: comp_dir.map(Into::into),
};
for transformer in &mut self.transformers.0 {
function = transformer.transform_function(function);
}
let function_name = if self.is_windows_object {
undecorate_win_symbol(&function.name)
} else {
&function.name
};
let name_offset = string_table.insert(function_name) as u32;
let lang = language as u32;
let (fun_idx, _) = self.functions.insert_full(raw::Function {
name_offset,
_comp_dir_offset: u32::MAX,
entry_pc,
lang,
});
fun_idx as u32
};
// We can divide the instructions in a function into two buckets:
// (1) Instructions which are part of an inlined function call, and
// (2) instructions which are *not* part of an inlined function call.
//
// Our incoming line records cover both (1) and (2) types of instructions.
//
// Let's call the address ranges of these instructions (1) inlinee ranges and (2) self ranges.
//
// We use the following strategy: For each function, only insert that function's "self ranges"
// into `self.ranges`. Then recurse into the function's inlinees. Those will insert their
// own "self ranges". Once the entire tree has been traversed, `self.ranges` will contain
// entries from all levels.
//
// In order to compute this function's "self ranges", we first gather and sort its
// "inlinee ranges". Later, when we iterate over this function's lines, we will compute the
// "self ranges" from the gaps between the "inlinee ranges".
let mut inlinee_ranges = Vec::new();
for inlinee in &function.inlinees {
for line in &inlinee.lines {
let start = line.address as u32;
let end = (line.address + line.size.unwrap_or(1)) as u32;
inlinee_ranges.push(start..end);
}
}
inlinee_ranges.sort_unstable_by_key(|range| range.start);
// Walk three iterators. All of these are already sorted by address.
let mut line_iter = function.lines.iter();
let mut call_location_iter = call_locations.iter();
let mut inline_iter = inlinee_ranges.into_iter();
// call_locations is non-empty, so the first element always exists.
let mut current_call_location = call_location_iter.next().unwrap();
let mut next_call_location = call_location_iter.next();
let mut next_line = line_iter.next();
let mut next_inline = inline_iter.next();
// This will be the list we pass to our inlinees as the call_locations argument.
// This list is ordered by address by construction.
let mut callee_call_locations = Vec::new();
// Iterate over the line records.
while let Some(line) = next_line.take() {
let line_range_start = line.address as u32;
let line_range_end = (line.address + line.size.unwrap_or(1)) as u32;
// Find the call location for this line.
while next_call_location.is_some() && next_call_location.unwrap().0 <= line_range_start
{
current_call_location = next_call_location.unwrap();
next_call_location = call_location_iter.next();
}
let inlined_into_idx = current_call_location.1;
let mut location = transform::SourceLocation {
file: transform::File {
name: line.file.name_str(),
directory: Some(line.file.dir_str()),
comp_dir: comp_dir.map(Into::into),
},
line: line.line as u32,
};
for transformer in &mut self.transformers.0 {
location = transformer.transform_source_location(location);
}
let name_offset = string_table.insert(&location.file.name) as u32;
let directory_offset = location
.file
.directory
.map_or(u32::MAX, |d| string_table.insert(&d) as u32);
let comp_dir_offset = location
.file
.comp_dir
.map_or(u32::MAX, |cd| string_table.insert(&cd) as u32);
let (file_idx, _) = self.files.insert_full(raw::File {
name_offset,
directory_offset,
comp_dir_offset,
});
let source_location = raw::SourceLocation {
file_idx: file_idx as u32,
line: location.line,
function_idx,
inlined_into_idx,
};
// The current line can be a "self line", or a "call line", or even a mixture.
//
// Examples:
//
// a) Just self line:
// Line: |==============|
// Inlinee ranges: (none)
//
// Effect: insert_range
//
// b) Just call line:
// Line: |==============|
// Inlinee ranges: |--------------|
//
// Effect: make_call_location
//
// c) Just call line, for multiple inlined calls:
// Line: |==========================|
// Inlinee ranges: |----------||--------------|
//
// Effect: make_call_location, make_call_location
//
// d) Call line and trailing self line:
// Line: |==================|
// Inlinee ranges: |-----------|
//
// Effect: make_call_location, insert_range
//
// e) Leading self line and also call line:
// Line: |==================|
// Inlinee ranges: |-----------|
//
// Effect: insert_range, make_call_location
//
// f) Interleaving
// Line: |======================================|
// Inlinee ranges: |-----------| |-------|
//
// Effect: insert_range, make_call_location, insert_range, make_call_location, insert_range
//
// g) Bad debug info
// Line: |=======|
// Inlinee ranges: |-------------|
//
// Effect: make_call_location
let mut current_address = line_range_start;
while current_address < line_range_end {
// Emit our source location at current_address if current_address is not covered by an inlinee.
if next_inline.is_none() || next_inline.as_ref().unwrap().start > current_address {
// "insert_range"
self.ranges.insert(current | set_arch | identifier_name | |
writer.rs | let mut callee_call_locations = Vec::new();
// Iterate over the line records.
while let Some(line) = next_line.take() {
let line_range_start = line.address as u32;
let line_range_end = (line.address + line.size.unwrap_or(1)) as u32;
// Find the call location for this line.
while next_call_location.is_some() && next_call_location.unwrap().0 <= line_range_start
{
current_call_location = next_call_location.unwrap();
next_call_location = call_location_iter.next();
}
let inlined_into_idx = current_call_location.1;
let mut location = transform::SourceLocation {
file: transform::File {
name: line.file.name_str(),
directory: Some(line.file.dir_str()),
comp_dir: comp_dir.map(Into::into),
},
line: line.line as u32,
};
for transformer in &mut self.transformers.0 {
location = transformer.transform_source_location(location);
}
let name_offset = string_table.insert(&location.file.name) as u32;
let directory_offset = location
.file
.directory
.map_or(u32::MAX, |d| string_table.insert(&d) as u32);
let comp_dir_offset = location
.file
.comp_dir
.map_or(u32::MAX, |cd| string_table.insert(&cd) as u32);
let (file_idx, _) = self.files.insert_full(raw::File {
name_offset,
directory_offset,
comp_dir_offset,
});
let source_location = raw::SourceLocation {
file_idx: file_idx as u32,
line: location.line,
function_idx,
inlined_into_idx,
};
// The current line can be a "self line", or a "call line", or even a mixture.
//
// Examples:
//
// a) Just self line:
// Line: |==============|
// Inlinee ranges: (none)
//
// Effect: insert_range
//
// b) Just call line:
// Line: |==============|
// Inlinee ranges: |--------------|
//
// Effect: make_call_location
//
// c) Just call line, for multiple inlined calls:
// Line: |==========================|
// Inlinee ranges: |----------||--------------|
//
// Effect: make_call_location, make_call_location
//
// d) Call line and trailing self line:
// Line: |==================|
// Inlinee ranges: |-----------|
//
// Effect: make_call_location, insert_range
//
// e) Leading self line and also call line:
// Line: |==================|
// Inlinee ranges: |-----------|
//
// Effect: insert_range, make_call_location
//
// f) Interleaving
// Line: |======================================|
// Inlinee ranges: |-----------| |-------|
//
// Effect: insert_range, make_call_location, insert_range, make_call_location, insert_range
//
// g) Bad debug info
// Line: |=======|
// Inlinee ranges: |-------------|
//
// Effect: make_call_location
let mut current_address = line_range_start;
while current_address < line_range_end {
// Emit our source location at current_address if current_address is not covered by an inlinee.
if next_inline.is_none() || next_inline.as_ref().unwrap().start > current_address {
// "insert_range"
self.ranges.insert(current_address, source_location.clone());
}
// If there is an inlinee range covered by this line record, turn this line into that
// call's "call line". Make a `call_location_idx` for it and store it in `callee_call_locations`.
if next_inline.is_some() && next_inline.as_ref().unwrap().start < line_range_end {
let inline_range = next_inline.take().unwrap();
// "make_call_location"
let (call_location_idx, _) =
self.call_locations.insert_full(source_location.clone());
callee_call_locations.push((inline_range.start, call_location_idx as u32));
// Advance current_address to the end of this inlinee range.
current_address = inline_range.end;
next_inline = inline_iter.next();
} else {
// No further inlinee ranges are overlapping with this line record. Advance to the
// end of the line record.
current_address = line_range_end;
}
}
// Advance the line iterator.
next_line = line_iter.next();
// Skip any lines that start before current_address.
// Such lines can exist if the debug information is faulty, or if the compiler created
// multiple identical small "call line" records instead of one combined record
// covering the entire inlinee range. We can't have different "call lines" for a single
// inlinee range anyway, so it's fine to skip these.
while next_line.is_some()
&& (next_line.as_ref().unwrap().address as u32) < current_address
{
next_line = line_iter.next();
}
}
if !function.inline {
// add the bare minimum of information for the function if there isn't any.
self.ranges.entry(entry_pc).or_insert(raw::SourceLocation {
file_idx: u32::MAX,
line: 0,
function_idx,
inlined_into_idx: u32::MAX,
});
}
// We've processed all address ranges which are *not* covered by inlinees.
// Now it's time to recurse.
// Process our inlinees.
if !callee_call_locations.is_empty() {
for inlinee in &function.inlinees {
self.process_symbolic_function_recursive(inlinee, &callee_call_locations);
}
}
let function_end = function.end_address() as u32;
let last_addr = self.last_addr.get_or_insert(0);
if function_end > *last_addr {
*last_addr = function_end;
}
}
/// Processes an individual [`Symbol`].
pub fn process_symbolic_symbol(&mut self, symbol: &Symbol<'_>) {
let name_idx = {
let mut function = transform::Function {
name: match symbol.name {
Some(ref name) => name.clone(),
None => return,
},
comp_dir: None,
};
for transformer in &mut self.transformers.0 {
function = transformer.transform_function(function);
}
let function_name = if self.is_windows_object {
undecorate_win_symbol(&function.name)
} else {
&function.name
};
self.string_table.insert(function_name) as u32
};
match self.ranges.entry(symbol.address as u32) {
btree_map::Entry::Vacant(entry) => {
let function = raw::Function {
name_offset: name_idx,
_comp_dir_offset: u32::MAX,
entry_pc: symbol.address as u32,
lang: u32::MAX,
};
let function_idx = self.functions.insert_full(function).0 as u32;
entry.insert(raw::SourceLocation {
file_idx: u32::MAX,
line: 0,
function_idx,
inlined_into_idx: u32::MAX,
});
}
btree_map::Entry::Occupied(entry) => {
// ASSUMPTION:
// the `functions` iterator has already filled in this addr via debug session.
// we could trace the caller hierarchy up to the root, and assert that it is
// indeed the same function, and maybe update its `entry_pc`, but we don’t do
// that for now.
let _function_idx = entry.get().function_idx as usize;
}
}
let last_addr = self.last_addr.get_or_insert(0);
if symbol.address as u32 >= *last_addr {
self.last_addr = None;
}
}
// Methods for serializing to a [`Write`] below:
// Feel free to move these to a separate file.
/// Serialize the converted data.
///
/// This writes the SymCache binary format into the given [`Write`].
pub fn serialize<W: Write>(mut self, writer: &mut W) -> std::io::Result<()> {
| let mut writer = Writer::new(writer);
// Insert a trailing sentinel source location in case we have a definite end addr
if let Some(last_addr) = self.last_addr {
// TODO: to be extra safe, we might check that `last_addr` is indeed larger than
// the largest range at some point.
match self.ranges.entry(last_addr) {
btree_map::Entry::Vacant(entry) => {
entry.insert(raw::NO_SOURCE_LOCATION);
}
btree_map::Entry::Occupied(_entry) => {
// BUG:
// the last addr should not map to an already defined range
}
}
}
let num_files = self.files.len() as u32;
let num_functions = self.functions.len() as u32;
let num_source_locations = (self.call_locations.len() + self.ranges.len()) as u32; | identifier_body | |
writer.rs | #[tracing::instrument(skip_all, fields(object.debug_id = %object.debug_id().breakpad()))]
pub fn process_object<'d, 'o, O>(&mut self, object: &'o O) -> Result<(), Error>
where
O: ObjectLike<'d, 'o>,
O::Error: std::error::Error + Send + Sync + 'static,
{
let session = object
.debug_session()
.map_err(|e| Error::new(ErrorKind::BadDebugFile, e))?;
self.set_arch(object.arch());
self.set_debug_id(object.debug_id());
self.is_windows_object = matches!(object.file_format(), FileFormat::Pe | FileFormat::Pdb);
for function in session.functions() {
let function = function.map_err(|e| Error::new(ErrorKind::BadDebugFile, e))?;
self.process_symbolic_function(&function);
}
for symbol in object.symbols() {
self.process_symbolic_symbol(&symbol);
}
self.is_windows_object = false;
Ok(())
}
/// Processes an individual [`Function`], adding its line information to the converter.
pub fn process_symbolic_function(&mut self, function: &Function<'_>) {
self.process_symbolic_function_recursive(function, &[(0x0, u32::MAX)]);
}
/// Processes an individual [`Function`], adding its line information to the converter.
///
/// `call_locations` is a non-empty sorted list of `(address, call_location index)` pairs.
fn process_symbolic_function_recursive(
&mut self,
function: &Function<'_>,
call_locations: &[(u32, u32)],
) {
let string_table = &mut self.string_table;
// skip over empty functions or functions whose address is too large to fit in a u32
if function.size == 0 || function.address > u32::MAX as u64 {
return;
}
let comp_dir = std::str::from_utf8(function.compilation_dir).ok();
let entry_pc = if function.inline {
u32::MAX | let language = function.name.language();
let mut function = transform::Function {
name: function.name.as_str().into(),
comp_dir: comp_dir.map(Into::into),
};
for transformer in &mut self.transformers.0 {
function = transformer.transform_function(function);
}
let function_name = if self.is_windows_object {
undecorate_win_symbol(&function.name)
} else {
&function.name
};
let name_offset = string_table.insert(function_name) as u32;
let lang = language as u32;
let (fun_idx, _) = self.functions.insert_full(raw::Function {
name_offset,
_comp_dir_offset: u32::MAX,
entry_pc,
lang,
});
fun_idx as u32
};
// We can divide the instructions in a function into two buckets:
// (1) Instructions which are part of an inlined function call, and
// (2) instructions which are *not* part of an inlined function call.
//
// Our incoming line records cover both (1) and (2) types of instructions.
//
// Let's call the address ranges of these instructions (1) inlinee ranges and (2) self ranges.
//
// We use the following strategy: For each function, only insert that function's "self ranges"
// into `self.ranges`. Then recurse into the function's inlinees. Those will insert their
// own "self ranges". Once the entire tree has been traversed, `self.ranges` will contain
// entries from all levels.
//
// In order to compute this function's "self ranges", we first gather and sort its
// "inlinee ranges". Later, when we iterate over this function's lines, we will compute the
// "self ranges" from the gaps between the "inlinee ranges".
let mut inlinee_ranges = Vec::new();
for inlinee in &function.inlinees {
for line in &inlinee.lines {
let start = line.address as u32;
let end = (line.address + line.size.unwrap_or(1)) as u32;
inlinee_ranges.push(start..end);
}
}
inlinee_ranges.sort_unstable_by_key(|range| range.start);
// Walk three iterators. All of these are already sorted by address.
let mut line_iter = function.lines.iter();
let mut call_location_iter = call_locations.iter();
let mut inline_iter = inlinee_ranges.into_iter();
// call_locations is non-empty, so the first element always exists.
let mut current_call_location = call_location_iter.next().unwrap();
let mut next_call_location = call_location_iter.next();
let mut next_line = line_iter.next();
let mut next_inline = inline_iter.next();
// This will be the list we pass to our inlinees as the call_locations argument.
// This list is ordered by address by construction.
let mut callee_call_locations = Vec::new();
// Iterate over the line records.
while let Some(line) = next_line.take() {
let line_range_start = line.address as u32;
let line_range_end = (line.address + line.size.unwrap_or(1)) as u32;
// Find the call location for this line.
while next_call_location.is_some() && next_call_location.unwrap().0 <= line_range_start
{
current_call_location = next_call_location.unwrap();
next_call_location = call_location_iter.next();
}
let inlined_into_idx = current_call_location.1;
let mut location = transform::SourceLocation {
file: transform::File {
name: line.file.name_str(),
directory: Some(line.file.dir_str()),
comp_dir: comp_dir.map(Into::into),
},
line: line.line as u32,
};
for transformer in &mut self.transformers.0 {
location = transformer.transform_source_location(location);
}
let name_offset = string_table.insert(&location.file.name) as u32;
let directory_offset = location
.file
.directory
.map_or(u32::MAX, |d| string_table.insert(&d) as u32);
let comp_dir_offset = location
.file
.comp_dir
.map_or(u32::MAX, |cd| string_table.insert(&cd) as u32);
let (file_idx, _) = self.files.insert_full(raw::File {
name_offset,
directory_offset,
comp_dir_offset,
});
let source_location = raw::SourceLocation {
file_idx: file_idx as u32,
line: location.line,
function_idx,
inlined_into_idx,
};
// The current line can be a "self line", or a "call line", or even a mixture.
//
// Examples:
//
// a) Just self line:
// Line: |==============|
// Inlinee ranges: (none)
//
// Effect: insert_range
//
// b) Just call line:
// Line: |==============|
// Inlinee ranges: |--------------|
//
// Effect: make_call_location
//
// c) Just call line, for multiple inlined calls:
// Line: |==========================|
// Inlinee ranges: |----------||--------------|
//
// Effect: make_call_location, make_call_location
//
// d) Call line and trailing self line:
// Line: |==================|
// Inlinee ranges: |-----------|
//
// Effect: make_call_location, insert_range
//
// e) Leading self line and also call line:
// Line: |==================|
// Inlinee ranges: |-----------|
//
// Effect: insert_range, make_call_location
//
// f) Interleaving
// Line: |======================================|
// Inlinee ranges: |-----------| |-------|
//
// Effect: insert_range, make_call_location, insert_range, make_call_location, insert_range
//
// g) Bad debug info
// Line: |=======|
// Inlinee ranges: |-------------|
//
// Effect: make_call_location
let mut current_address = line_range_start;
while current_address < line_range_end {
// Emit our source location at current_address if current_address is not covered by an inlinee.
if next_inline.is_none() || next_inline.as_ref().unwrap().start > current_address {
// "insert_range"
self.ranges.insert(current_address, source_location.clone());
}
// If there is an inlinee range covered by this line record, turn this line into that
// call's "call line". Make a `call_location_idx` for it and store it in `callee_call_locations`.
if next_inline.is_some() && next_inline.as_ref().unwrap().start < line_range_end {
let inline_range = next_inline.take().unwrap();
// "make_call_location"
let (call_location_idx, _) =
self.call_locations.insert_full | } else {
function.address as u32
};
let function_idx = { | random_line_split |
CAPM_ab.py |
def get_indexReturns(self):
index = self.Sindex # The index
ind_ret = self.pf.symbols[index].TDs[self.period].get_timeSeriesReturn()
return ind_ret
def get_indexMeanReturn(self):
ind_ret = self.get_indexReturns()
ind_ret = np.mean(ind_ret)
return ind_ret
def get_symbol_ab(self, symbol):
## This function outputs the alpha beta a symbol
index = self.Sindex # The index
sym_ret = self.pf.symbols[symbol].TDs[self.period].get_timeSeriesReturn()
ind_ret = self.get_indexReturns()
# plt.scatter(ind_ret,sym_ret)
coeff = bMl.get_linearRef(ind_ret, sym_ret)
return coeff
def get_all_symbols_ab (self):
symbols = self.pf.symbols.keys()
coeffs = []
for sym in symbols:
coeffs.append(self.get_symbol_ab(sym))
return coeffs
def get_portfolio_ab(self, mode = "normal"):
### This function gets the alpha beta for the portfolio
index = self.Sindex
if (mode == "normal"):
# We calculate it in a gaussian way
returns = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
coeff = bMl.get_linearRef(ind_ret, returns)
if (mode == "gaussian"):
# We calculate by calculating the individual ones first.
# The total coefficient is the sum of all coefficients
coeffs = np.array(self.get_all_symbols_ab())
coeff = coeffs.T.dot(self.allocation)
return coeff
def get_symbol_JensenAlpha(self, symbol, mode = "normal"):
### This function gets the Jensens Alpha of the portolio.
## Which is the alpha of the portfolio, taking into account
## The risk-free rate. Which is what is everything expected to
# Grow.
index = self.Sindex
coeff = self.get_symbol_ab(symbol)
beta = coeff[1]
# print "beta = " + str(beta)
returns = self.get_SymbolReturn(symbol)
ind_ret = self.get_indexReturns()
# It is the difference between what we obtain and the index
# Sum of weighted alphas, taking into account the Riskfree Rate
JensenAlpha = (returns - self.Rf) - beta*(ind_ret - self.Rf)
return JensenAlpha
def get_portfolio_JensenAlpha(self, mode = "normal"):
### This function gets the Jensens Alpha of the portolio.
## Which is the alpha of the portfolio, taking into account
## The risk-free rate. Which is what is everything expected to
# Grow.
index = self.Sindex
coeff = self.get_portfolio_ab(mode = mode)
beta = coeff[1]
# print "beta = " + str(beta)
returns = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
# It is the difference between what we obtain and the index
# Sum of weighted alphas, taking into account the Riskfree Rate
JensenAlpha = (returns - self.Rf) - beta*(ind_ret - self.Rf)
return JensenAlpha
def test_Jensens_Alpha(self, nf = 1):
# Test the gaussianity and confidence of the alpha.
residual = self.get_portfolio_JensenAlpha()
ttest = stats.ttest_1samp(a = residual, # Sample data
popmean = 0) # Pop mean
print "TESTING PORFOLIO"
print np.mean(residual), np.std(residual)
print ttest
## Fit a gaussian and plot it
gl.histogram(residual)
def test_symbol_ab(self,symbol, nf = 1):
## This function tests that the residuals behaves properly.
## That is, that the alpha (how we behave compared to the market)
## has a nice gaussian distribution.
## Slide 7
index = self.Sindex # The index
sym_ret = self.pf.symbols[symbol].TDs[self.period].get_timeSeriesReturn()
ind_ret = self.get_indexReturns()
# Get coefficients for the symbol
coeffs = self.get_symbol_ab(symbol)
##### GET THE RESIDUAL
X = np.concatenate((np.ones((sym_ret.shape[0],1)),sym_ret),axis = 1)
pred = X.dot(np.array(coeffs)) # Pred = X * Phi
pred = pred.reshape(pred.shape[0],1)
residual = pred - ind_ret
print "Mean of residual %f" % np.mean(residual)
### Now we test the residual
print "Statistical test of residual"
ttest = stats.ttest_1samp(a = residual, # Sample data
popmean = 0) # Pop mean
print ttest
######## DOUBLE REGRESSION OF PAGE 7. Early empirical test
Xres = np.concatenate((ind_ret,np.power(residual,2)),axis = 1)
coeff = bMl.get_linearRef(Xres, sym_ret)
print "Early empirical test of CAPM is wrong"
print coeff
hist, bin_edges = np.histogram(residual, density=True)
gl.bar(bin_edges[:-1], hist,
labels = ["Distribution","Return", "Probability"],
legend = [symbol],
alpha = 0.5,
nf = nf)
## Lets get some statistics using stats
m, v, s, k = stats.t.stats(10, moments='mvsk')
n, (smin, smax), sm, sv, ss, sk = stats.describe(residual)
print "****** MORE STATISTIC ************"
print "Mean " + str(sm)
tt = (sm-m)/np.sqrt(sv/float(n)) # t-statistic for mean
pval = stats.t.sf(np.abs(tt), n-1)*2 # two-sided pvalue = Prob(abs(t)>tt)
print 't-statistic = %6.3f pvalue = %6.4f' % (tt, pval)
return coeff
def marketTiming(self,returns = [], ind_ret = [], mode = "Treynor-Mazuy"):
# Investigate if the model is good.
# We put a cuatric term of the error.
returns = ul.fnp(returns)
ind_ret = ul.fnp(ind_ret)
if (returns.size == 0):
returns = self.get_PortfolioReturn()
if (ind_ret.size == 0):
ind_ret = self.get_indexReturns()
# Instead of fitting a line, we fit a parabola, to try to see
# if we do better than the market return. If when Rm is higher, we have
# higher beta, and if when Rm is lower, we have lower beta. So higher
# and lowr return fitting a curve, cuatric,
gl.scatter(ind_ret, returns,
labels = ["Treynor-Mazuy", "Index Return", "Portfolio Return"],
legend = ["Returns"])
## Linear regression:
Xres = ind_ret
coeffs = bMl.get_linearRef(Xres, returns)
Npoints = 10000
x_grid = np.array(range(Npoints))/float(Npoints)
x_grid = x_grid*(max(ind_ret) - min(ind_ret)) + min(ind_ret)
x_grid = x_grid.reshape(Npoints,1)
x_grid_2 = np.concatenate((np.ones((Npoints,1)),x_grid), axis = 1)
y_grid = x_grid_2.dot(np.array(coeffs))
gl.plot(x_grid, y_grid, legend = ["Linear Regression"], nf = 0)
Xres = np.concatenate((ind_ret,np.power(ind_ret,2)),axis = 1)
coeffs = bMl.get_linearRef(Xres, returns)
x_grid_2 = np.concatenate((np.ones((Npoints,1)),x_grid,np.power(x_grid,2).reshape(Npoints,1) ),axis = 1)
y_grid = x_grid_2.dot(np.array(coeffs))
# print y_grid.shape
gl.plot(x_grid, y_grid, legend = ["Quadratic Regression"], nf = 0)
print coeffs
return 1
def get_residuals_ab(self):
# For histogram
import pylab
import scipy.stats as stats
measurements = np.random.normal(loc = 20, scale = 5, size=100)
stats.probplot(measurements, dist="norm", plot=pylab)
pylab.show()
def plot_portfoliocorrab(self, nf = 1):
# This function plots the returns of a symbol compared
# to the index, and computes the regresion and correlation parameters.
index = self.Sindex # The index
sym_ret = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
# Mean and covariance
data = np.concatenate((sym_ret,ind_ret),axis = 1 | if (type(symbol_index) == type(-1)):
# If we are given nothing or a number
# We just stablish the first one
symbol_index = self.pf.symbols.keys()[0]
self.Sindex = symbol_index | identifier_body | |
CAPM_ab.py | self.get_indexReturns()
ind_ret = np.mean(ind_ret)
return ind_ret
def get_symbol_ab(self, symbol):
## This function outputs the alpha beta a symbol
index = self.Sindex # The index
sym_ret = self.pf.symbols[symbol].TDs[self.period].get_timeSeriesReturn()
ind_ret = self.get_indexReturns()
# plt.scatter(ind_ret,sym_ret)
coeff = bMl.get_linearRef(ind_ret, sym_ret)
return coeff
def get_all_symbols_ab (self):
symbols = self.pf.symbols.keys()
coeffs = []
for sym in symbols:
coeffs.append(self.get_symbol_ab(sym))
return coeffs
def get_portfolio_ab(self, mode = "normal"):
### This function gets the alpha beta for the portfolio
index = self.Sindex
if (mode == "normal"):
# We calculate it in a gaussian way
returns = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
coeff = bMl.get_linearRef(ind_ret, returns)
if (mode == "gaussian"):
# We calculate by calculating the individual ones first.
# The total coefficient is the sum of all coefficients
coeffs = np.array(self.get_all_symbols_ab())
coeff = coeffs.T.dot(self.allocation)
return coeff
def get_symbol_JensenAlpha(self, symbol, mode = "normal"):
### This function gets the Jensens Alpha of the portolio.
## Which is the alpha of the portfolio, taking into account
## The risk-free rate. Which is what is everything expected to
# Grow.
index = self.Sindex
coeff = self.get_symbol_ab(symbol)
beta = coeff[1]
# print "beta = " + str(beta)
returns = self.get_SymbolReturn(symbol)
ind_ret = self.get_indexReturns()
# It is the difference between what we obtain and the index
# Sum of weighted alphas, taking into account the Riskfree Rate
JensenAlpha = (returns - self.Rf) - beta*(ind_ret - self.Rf)
return JensenAlpha
def get_portfolio_JensenAlpha(self, mode = "normal"):
### This function gets the Jensens Alpha of the portolio.
## Which is the alpha of the portfolio, taking into account
## The risk-free rate. Which is what is everything expected to
# Grow.
index = self.Sindex
coeff = self.get_portfolio_ab(mode = mode)
beta = coeff[1]
# print "beta = " + str(beta)
returns = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
# It is the difference between what we obtain and the index
# Sum of weighted alphas, taking into account the Riskfree Rate
JensenAlpha = (returns - self.Rf) - beta*(ind_ret - self.Rf)
return JensenAlpha
def test_Jensens_Alpha(self, nf = 1):
# Test the gaussianity and confidence of the alpha.
residual = self.get_portfolio_JensenAlpha()
ttest = stats.ttest_1samp(a = residual, # Sample data
popmean = 0) # Pop mean
print "TESTING PORFOLIO"
print np.mean(residual), np.std(residual)
print ttest
## Fit a gaussian and plot it
gl.histogram(residual)
def test_symbol_ab(self,symbol, nf = 1):
## This function tests that the residuals behaves properly.
## That is, that the alpha (how we behave compared to the market)
## has a nice gaussian distribution.
## Slide 7
index = self.Sindex # The index
sym_ret = self.pf.symbols[symbol].TDs[self.period].get_timeSeriesReturn()
ind_ret = self.get_indexReturns()
# Get coefficients for the symbol
coeffs = self.get_symbol_ab(symbol)
##### GET THE RESIDUAL
X = np.concatenate((np.ones((sym_ret.shape[0],1)),sym_ret),axis = 1)
pred = X.dot(np.array(coeffs)) # Pred = X * Phi
pred = pred.reshape(pred.shape[0],1)
residual = pred - ind_ret
print "Mean of residual %f" % np.mean(residual)
### Now we test the residual
print "Statistical test of residual"
ttest = stats.ttest_1samp(a = residual, # Sample data
popmean = 0) # Pop mean
print ttest
######## DOUBLE REGRESSION OF PAGE 7. Early empirical test
Xres = np.concatenate((ind_ret,np.power(residual,2)),axis = 1)
coeff = bMl.get_linearRef(Xres, sym_ret)
print "Early empirical test of CAPM is wrong"
print coeff | hist, bin_edges = np.histogram(residual, density=True)
gl.bar(bin_edges[:-1], hist,
labels = ["Distribution","Return", "Probability"],
legend = [symbol],
alpha = 0.5,
nf = nf)
## Lets get some statistics using stats
m, v, s, k = stats.t.stats(10, moments='mvsk')
n, (smin, smax), sm, sv, ss, sk = stats.describe(residual)
print "****** MORE STATISTIC ************"
print "Mean " + str(sm)
tt = (sm-m)/np.sqrt(sv/float(n)) # t-statistic for mean
pval = stats.t.sf(np.abs(tt), n-1)*2 # two-sided pvalue = Prob(abs(t)>tt)
print 't-statistic = %6.3f pvalue = %6.4f' % (tt, pval)
return coeff
def marketTiming(self,returns = [], ind_ret = [], mode = "Treynor-Mazuy"):
# Investigate if the model is good.
# We put a cuatric term of the error.
returns = ul.fnp(returns)
ind_ret = ul.fnp(ind_ret)
if (returns.size == 0):
returns = self.get_PortfolioReturn()
if (ind_ret.size == 0):
ind_ret = self.get_indexReturns()
# Instead of fitting a line, we fit a parabola, to try to see
# if we do better than the market return. If when Rm is higher, we have
# higher beta, and if when Rm is lower, we have lower beta. So higher
# and lowr return fitting a curve, cuatric,
gl.scatter(ind_ret, returns,
labels = ["Treynor-Mazuy", "Index Return", "Portfolio Return"],
legend = ["Returns"])
## Linear regression:
Xres = ind_ret
coeffs = bMl.get_linearRef(Xres, returns)
Npoints = 10000
x_grid = np.array(range(Npoints))/float(Npoints)
x_grid = x_grid*(max(ind_ret) - min(ind_ret)) + min(ind_ret)
x_grid = x_grid.reshape(Npoints,1)
x_grid_2 = np.concatenate((np.ones((Npoints,1)),x_grid), axis = 1)
y_grid = x_grid_2.dot(np.array(coeffs))
gl.plot(x_grid, y_grid, legend = ["Linear Regression"], nf = 0)
Xres = np.concatenate((ind_ret,np.power(ind_ret,2)),axis = 1)
coeffs = bMl.get_linearRef(Xres, returns)
x_grid_2 = np.concatenate((np.ones((Npoints,1)),x_grid,np.power(x_grid,2).reshape(Npoints,1) ),axis = 1)
y_grid = x_grid_2.dot(np.array(coeffs))
# print y_grid.shape
gl.plot(x_grid, y_grid, legend = ["Quadratic Regression"], nf = 0)
print coeffs
return 1
def get_residuals_ab(self):
# For histogram
import pylab
import scipy.stats as stats
measurements = np.random.normal(loc = 20, scale = 5, size=100)
stats.probplot(measurements, dist="norm", plot=pylab)
pylab.show()
def plot_portfoliocorrab(self, nf = 1):
# This function plots the returns of a symbol compared
# to the index, and computes the regresion and correlation parameters.
index = self.Sindex # The index
sym_ret = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
# Mean and covariance
data = np.concatenate((sym_ret,ind_ret),axis = 1)
means = np.mean(data, axis = 0)
cov = np.cov(data)
# Regression
coeffs = bMl.get_linearRef(ind_ret, sym_ret)
gl.scatter(ind_ret, sym_ret,
labels = ["Gaussianity study", "Index: " + self.Sindex,"Porfolio"],
legend = ["Returns"],
nf = nf)
## Linear regression:
Xres = ind_ret
coeffs = bMl.get_linearRef(Xres, sym | random_line_split | |
CAPM_ab.py |
self.Sindex = symbol_index
def get_indexReturns(self):
index = self.Sindex # The index
ind_ret = self.pf.symbols[index].TDs[self.period].get_timeSeriesReturn()
return ind_ret
def get_indexMeanReturn(self):
ind_ret = self.get_indexReturns()
ind_ret = np.mean(ind_ret)
return ind_ret
def get_symbol_ab(self, symbol):
## This function outputs the alpha beta a symbol
index = self.Sindex # The index
sym_ret = self.pf.symbols[symbol].TDs[self.period].get_timeSeriesReturn()
ind_ret = self.get_indexReturns()
# plt.scatter(ind_ret,sym_ret)
coeff = bMl.get_linearRef(ind_ret, sym_ret)
return coeff
def get_all_symbols_ab (self):
symbols = self.pf.symbols.keys()
coeffs = []
for sym in symbols:
coeffs.append(self.get_symbol_ab(sym))
return coeffs
def get_portfolio_ab(self, mode = "normal"):
### This function gets the alpha beta for the portfolio
index = self.Sindex
if (mode == "normal"):
# We calculate it in a gaussian way
returns = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
coeff = bMl.get_linearRef(ind_ret, returns)
if (mode == "gaussian"):
# We calculate by calculating the individual ones first.
# The total coefficient is the sum of all coefficients
coeffs = np.array(self.get_all_symbols_ab())
coeff = coeffs.T.dot(self.allocation)
return coeff
def get_symbol_JensenAlpha(self, symbol, mode = "normal"):
### This function gets the Jensens Alpha of the portolio.
## Which is the alpha of the portfolio, taking into account
## The risk-free rate. Which is what is everything expected to
# Grow.
index = self.Sindex
coeff = self.get_symbol_ab(symbol)
beta = coeff[1]
# print "beta = " + str(beta)
returns = self.get_SymbolReturn(symbol)
ind_ret = self.get_indexReturns()
# It is the difference between what we obtain and the index
# Sum of weighted alphas, taking into account the Riskfree Rate
JensenAlpha = (returns - self.Rf) - beta*(ind_ret - self.Rf)
return JensenAlpha
def get_portfolio_JensenAlpha(self, mode = "normal"):
### This function gets the Jensens Alpha of the portolio.
## Which is the alpha of the portfolio, taking into account
## The risk-free rate. Which is what is everything expected to
# Grow.
index = self.Sindex
coeff = self.get_portfolio_ab(mode = mode)
beta = coeff[1]
# print "beta = " + str(beta)
returns = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
# It is the difference between what we obtain and the index
# Sum of weighted alphas, taking into account the Riskfree Rate
JensenAlpha = (returns - self.Rf) - beta*(ind_ret - self.Rf)
return JensenAlpha
def test_Jensens_Alpha(self, nf = 1):
# Test the gaussianity and confidence of the alpha.
residual = self.get_portfolio_JensenAlpha()
ttest = stats.ttest_1samp(a = residual, # Sample data
popmean = 0) # Pop mean
print "TESTING PORFOLIO"
print np.mean(residual), np.std(residual)
print ttest
## Fit a gaussian and plot it
gl.histogram(residual)
def test_symbol_ab(self,symbol, nf = 1):
## This function tests that the residuals behaves properly.
## That is, that the alpha (how we behave compared to the market)
## has a nice gaussian distribution.
## Slide 7
index = self.Sindex # The index
sym_ret = self.pf.symbols[symbol].TDs[self.period].get_timeSeriesReturn()
ind_ret = self.get_indexReturns()
# Get coefficients for the symbol
coeffs = self.get_symbol_ab(symbol)
##### GET THE RESIDUAL
X = np.concatenate((np.ones((sym_ret.shape[0],1)),sym_ret),axis = 1)
pred = X.dot(np.array(coeffs)) # Pred = X * Phi
pred = pred.reshape(pred.shape[0],1)
residual = pred - ind_ret
print "Mean of residual %f" % np.mean(residual)
### Now we test the residual
print "Statistical test of residual"
ttest = stats.ttest_1samp(a = residual, # Sample data
popmean = 0) # Pop mean
print ttest
######## DOUBLE REGRESSION OF PAGE 7. Early empirical test
Xres = np.concatenate((ind_ret,np.power(residual,2)),axis = 1)
coeff = bMl.get_linearRef(Xres, sym_ret)
print "Early empirical test of CAPM is wrong"
print coeff
hist, bin_edges = np.histogram(residual, density=True)
gl.bar(bin_edges[:-1], hist,
labels = ["Distribution","Return", "Probability"],
legend = [symbol],
alpha = 0.5,
nf = nf)
## Lets get some statistics using stats
m, v, s, k = stats.t.stats(10, moments='mvsk')
n, (smin, smax), sm, sv, ss, sk = stats.describe(residual)
print "****** MORE STATISTIC ************"
print "Mean " + str(sm)
tt = (sm-m)/np.sqrt(sv/float(n)) # t-statistic for mean
pval = stats.t.sf(np.abs(tt), n-1)*2 # two-sided pvalue = Prob(abs(t)>tt)
print 't-statistic = %6.3f pvalue = %6.4f' % (tt, pval)
return coeff
def marketTiming(self,returns = [], ind_ret = [], mode = "Treynor-Mazuy"):
# Investigate if the model is good.
# We put a cuatric term of the error.
returns = ul.fnp(returns)
ind_ret = ul.fnp(ind_ret)
if (returns.size == 0):
returns = self.get_PortfolioReturn()
if (ind_ret.size == 0):
ind_ret = self.get_indexReturns()
# Instead of fitting a line, we fit a parabola, to try to see
# if we do better than the market return. If when Rm is higher, we have
# higher beta, and if when Rm is lower, we have lower beta. So higher
# and lowr return fitting a curve, cuatric,
gl.scatter(ind_ret, returns,
labels = ["Treynor-Mazuy", "Index Return", "Portfolio Return"],
legend = ["Returns"])
## Linear regression:
Xres = ind_ret
coeffs = bMl.get_linearRef(Xres, returns)
Npoints = 10000
x_grid = np.array(range(Npoints))/float(Npoints)
x_grid = x_grid*(max(ind_ret) - min(ind_ret)) + min(ind_ret)
x_grid = x_grid.reshape(Npoints,1)
x_grid_2 = np.concatenate((np.ones((Npoints,1)),x_grid), axis = 1)
y_grid = x_grid_2.dot(np.array(coeffs))
gl.plot(x_grid, y_grid, legend = ["Linear Regression"], nf = 0)
Xres = np.concatenate((ind_ret,np.power(ind_ret,2)),axis = 1)
coeffs = bMl.get_linearRef(Xres, returns)
x_grid_2 = np.concatenate((np.ones((Npoints,1)),x_grid,np.power(x_grid,2).reshape(Npoints,1) ),axis = 1)
y_grid = x_grid_2.dot(np.array(coeffs))
# print y_grid.shape
gl.plot(x_grid, y_grid, legend = ["Quadratic Regression"], nf = 0)
print coeffs
return 1
def get_residuals_ab(self):
# For histogram
import pylab
import scipy.stats as stats
measurements = np.random.normal(loc = 20, scale = 5, size=100)
stats.probplot(measurements, dist="norm", plot=pylab)
pylab.show()
def plot_portfoliocorrab(self, nf = 1):
# This function plots the returns of a symbol compared
# to the index, and computes the regresion and correlation parameters.
index = self.Sindex # The index
sym_ret = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
# Mean and covariance
data = np.concatenate((sym_ret,ind_ret),axis = 1)
means = np.mean(data, axis = 0)
cov = np.cov(data)
# Regression
coeffs = bMl.get | symbol_index = self.pf.symbols.keys()[0] | conditional_block | |
CAPM_ab.py | self.get_indexReturns()
ind_ret = np.mean(ind_ret)
return ind_ret
def get_symbol_ab(self, symbol):
## This function outputs the alpha beta a symbol
index = self.Sindex # The index
sym_ret = self.pf.symbols[symbol].TDs[self.period].get_timeSeriesReturn()
ind_ret = self.get_indexReturns()
# plt.scatter(ind_ret,sym_ret)
coeff = bMl.get_linearRef(ind_ret, sym_ret)
return coeff
def get_all_symbols_ab (self):
symbols = self.pf.symbols.keys()
coeffs = []
for sym in symbols:
coeffs.append(self.get_symbol_ab(sym))
return coeffs
def get_portfolio_ab(self, mode = "normal"):
### This function gets the alpha beta for the portfolio
index = self.Sindex
if (mode == "normal"):
# We calculate it in a gaussian way
returns = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
coeff = bMl.get_linearRef(ind_ret, returns)
if (mode == "gaussian"):
# We calculate by calculating the individual ones first.
# The total coefficient is the sum of all coefficients
coeffs = np.array(self.get_all_symbols_ab())
coeff = coeffs.T.dot(self.allocation)
return coeff
def get_symbol_JensenAlpha(self, symbol, mode = "normal"):
### This function gets the Jensens Alpha of the portolio.
## Which is the alpha of the portfolio, taking into account
## The risk-free rate. Which is what is everything expected to
# Grow.
index = self.Sindex
coeff = self.get_symbol_ab(symbol)
beta = coeff[1]
# print "beta = " + str(beta)
returns = self.get_SymbolReturn(symbol)
ind_ret = self.get_indexReturns()
# It is the difference between what we obtain and the index
# Sum of weighted alphas, taking into account the Riskfree Rate
JensenAlpha = (returns - self.Rf) - beta*(ind_ret - self.Rf)
return JensenAlpha
def get_portfolio_JensenAlpha(self, mode = "normal"):
### This function gets the Jensens Alpha of the portolio.
## Which is the alpha of the portfolio, taking into account
## The risk-free rate. Which is what is everything expected to
# Grow.
index = self.Sindex
coeff = self.get_portfolio_ab(mode = mode)
beta = coeff[1]
# print "beta = " + str(beta)
returns = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
# It is the difference between what we obtain and the index
# Sum of weighted alphas, taking into account the Riskfree Rate
JensenAlpha = (returns - self.Rf) - beta*(ind_ret - self.Rf)
return JensenAlpha
def test_Jensens_Alpha(self, nf = 1):
# Test the gaussianity and confidence of the alpha.
residual = self.get_portfolio_JensenAlpha()
ttest = stats.ttest_1samp(a = residual, # Sample data
popmean = 0) # Pop mean
print "TESTING PORFOLIO"
print np.mean(residual), np.std(residual)
print ttest
## Fit a gaussian and plot it
gl.histogram(residual)
def | (self,symbol, nf = 1):
## This function tests that the residuals behaves properly.
## That is, that the alpha (how we behave compared to the market)
## has a nice gaussian distribution.
## Slide 7
index = self.Sindex # The index
sym_ret = self.pf.symbols[symbol].TDs[self.period].get_timeSeriesReturn()
ind_ret = self.get_indexReturns()
# Get coefficients for the symbol
coeffs = self.get_symbol_ab(symbol)
##### GET THE RESIDUAL
X = np.concatenate((np.ones((sym_ret.shape[0],1)),sym_ret),axis = 1)
pred = X.dot(np.array(coeffs)) # Pred = X * Phi
pred = pred.reshape(pred.shape[0],1)
residual = pred - ind_ret
print "Mean of residual %f" % np.mean(residual)
### Now we test the residual
print "Statistical test of residual"
ttest = stats.ttest_1samp(a = residual, # Sample data
popmean = 0) # Pop mean
print ttest
######## DOUBLE REGRESSION OF PAGE 7. Early empirical test
Xres = np.concatenate((ind_ret,np.power(residual,2)),axis = 1)
coeff = bMl.get_linearRef(Xres, sym_ret)
print "Early empirical test of CAPM is wrong"
print coeff
hist, bin_edges = np.histogram(residual, density=True)
gl.bar(bin_edges[:-1], hist,
labels = ["Distribution","Return", "Probability"],
legend = [symbol],
alpha = 0.5,
nf = nf)
## Lets get some statistics using stats
m, v, s, k = stats.t.stats(10, moments='mvsk')
n, (smin, smax), sm, sv, ss, sk = stats.describe(residual)
print "****** MORE STATISTIC ************"
print "Mean " + str(sm)
tt = (sm-m)/np.sqrt(sv/float(n)) # t-statistic for mean
pval = stats.t.sf(np.abs(tt), n-1)*2 # two-sided pvalue = Prob(abs(t)>tt)
print 't-statistic = %6.3f pvalue = %6.4f' % (tt, pval)
return coeff
def marketTiming(self,returns = [], ind_ret = [], mode = "Treynor-Mazuy"):
# Investigate if the model is good.
# We put a cuatric term of the error.
returns = ul.fnp(returns)
ind_ret = ul.fnp(ind_ret)
if (returns.size == 0):
returns = self.get_PortfolioReturn()
if (ind_ret.size == 0):
ind_ret = self.get_indexReturns()
# Instead of fitting a line, we fit a parabola, to try to see
# if we do better than the market return. If when Rm is higher, we have
# higher beta, and if when Rm is lower, we have lower beta. So higher
# and lowr return fitting a curve, cuatric,
gl.scatter(ind_ret, returns,
labels = ["Treynor-Mazuy", "Index Return", "Portfolio Return"],
legend = ["Returns"])
## Linear regression:
Xres = ind_ret
coeffs = bMl.get_linearRef(Xres, returns)
Npoints = 10000
x_grid = np.array(range(Npoints))/float(Npoints)
x_grid = x_grid*(max(ind_ret) - min(ind_ret)) + min(ind_ret)
x_grid = x_grid.reshape(Npoints,1)
x_grid_2 = np.concatenate((np.ones((Npoints,1)),x_grid), axis = 1)
y_grid = x_grid_2.dot(np.array(coeffs))
gl.plot(x_grid, y_grid, legend = ["Linear Regression"], nf = 0)
Xres = np.concatenate((ind_ret,np.power(ind_ret,2)),axis = 1)
coeffs = bMl.get_linearRef(Xres, returns)
x_grid_2 = np.concatenate((np.ones((Npoints,1)),x_grid,np.power(x_grid,2).reshape(Npoints,1) ),axis = 1)
y_grid = x_grid_2.dot(np.array(coeffs))
# print y_grid.shape
gl.plot(x_grid, y_grid, legend = ["Quadratic Regression"], nf = 0)
print coeffs
return 1
def get_residuals_ab(self):
# For histogram
import pylab
import scipy.stats as stats
measurements = np.random.normal(loc = 20, scale = 5, size=100)
stats.probplot(measurements, dist="norm", plot=pylab)
pylab.show()
def plot_portfoliocorrab(self, nf = 1):
# This function plots the returns of a symbol compared
# to the index, and computes the regresion and correlation parameters.
index = self.Sindex # The index
sym_ret = self.get_PortfolioReturn()
ind_ret = self.get_indexReturns()
# Mean and covariance
data = np.concatenate((sym_ret,ind_ret),axis = 1)
means = np.mean(data, axis = 0)
cov = np.cov(data)
# Regression
coeffs = bMl.get_linearRef(ind_ret, sym_ret)
gl.scatter(ind_ret, sym_ret,
labels = ["Gaussianity study", "Index: " + self.Sindex,"Porfolio"],
legend = ["Returns"],
nf = nf)
## Linear regression:
Xres = ind_ret
coeffs = bMl.get_linearRef(Xres | test_symbol_ab | identifier_name |
TableauViz.js | url, options);
}
function exportPDF() {
viz.showExportPDFDialog();
$('.tab-dialog')[0].animate({ 'marginLeft': "-=50px" });
}
function exportData() {
viz.showExportDataDialog();
}
function resetViz() {
viz.revertAllAsync();
}
function showVizButtons() {
var sheets = workbook.getPublishedSheetsInfo();
var divIndividualButtons = $('#vizButtons');
// First clear any buttons that may have been added on a previous load
divIndividualButtons.html("");
// Show 'standard' controls, common to all vizzes
divIndividualButtons.append('<button type="button" onclick="resetViz()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Reset Filters</button>');
divIndividualButtons.append('<button type="button" onclick="exportPDF()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Export PDF</button>');
divIndividualButtons.append('<button type="button" onclick="exportData()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Export Data</button>');
divIndividualButtons.append('<button type="button" onclick="launch_edit()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Edit</button>');
// Only show buttons to switch vizzes if there's more than one
if (sheets.length > 1) {
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
var sheet = sheets[sheetIndex];
divIndividualButtons.append('<button type="button" onclick="switchToViz(\'' + sheet.getName() + '\')" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">See ' + sheet.getName() + '</button>')
}
}
}
function switchToViz(vizName) {
workbook.activateSheetAsync(vizName).then(function (dashboard) {
dashboard.changeSizeAsync({
behavior: tableau.SheetSizeBehavior.AUTOMATIC
});
});
}
function onMarksSelection(marksEvent) {
//filter sheets of selected marks because we dont need to hear events on all of our sheets
if (marksEvent.getWorksheet().getName() == nameOfVizToInteract) {
//get,marksAsync() is a method in the API that will retun a set of the marks selected
return marksEvent.getMarksAsync().then(handleSelectedMarks);
}
}
function handleSelectedMarks(marks) {
| var fixedCloseLabel = "";
var changeFromPriorClose = 0;
var changeFromPriorCloseLabel = "";
var date = "";
for (var markIndex = 0; markIndex < marks.length; markIndex++) {
//getPairs gets tuples of data for the mark. one mark has multiple tuples
var pairs = marks[markIndex].getPairs();
for (var pairIndex = 0; pairIndex < pairs.length; pairIndex++) {
switch (pairs[pairIndex].fieldName) {
case "Company":
company = pairs[pairIndex].value;
break;
case "Date":
date = pairs[pairIndex].formattedValue;
break;
case "SUM(Fixed Close)":
fixedClose += pairs[pairIndex].value;
fixedCloseLabel = pairs[pairIndex].formattedValue;
break;
case "AGG(Change from Prior Close)":
changeFromPriorClose += pairs[pairIndex].value;
changeFromPriorCloseLabel = pairs[pairIndex].formattedValue;
break;
}
}
}
// With all values in memory, let's produce the UI
if (marks.length == 1) {
// When we select a single mark, we can show the individual details
$('#eventPanel').html("Submit <b>" + company + "</b>'s " + date + " trading period for research. The fixed close price was <b>$" + fixedCloseLabel + "</b> with a variance of <b>" + changeFromPriorCloseLabel + "</b>.");
}
else {
// But if more that one mark is selected, we show a summary (average)
var avgFixedClose = Number((fixedClose / marks.length).toFixed(2));
var avgChangeFromPriorCloseLabel = Number((changeFromPriorClose * 100 / marks.length).toFixed(2));
$('#eventPanel').html("Submit <b>" + marks.length + " " + company + "</b>'s trading periods for research. The average fixed close price was <b>$" + avgFixedClose + "</b> & the average variance of <b>" + avgChangeFromPriorCloseLabel + "%</b>.");
}
}
else {
// Save selection in memory and give the user the option to submit
var plural = ((marks.length == 1) ? "it" : "them");
var pluralS = ((selectedMarks.length == 1) ? "" : "s");
$('#eventPanel').html("You've selected <b>" + marks.length + "</b> outlier" + pluralS + "." + " Would you like to submit " + plural + " them for research?");
}
}
function submitMarks()
{
var referrer = viz.getWorkbook().getActiveSheet();
if (referrer.getSheetType() == "dashboard") {
// The active sheets is a dashboard, which is made of several sheets
var sheets = referrer.getWorksheets();
// Iterate over the sheets until we find the correct one and clear the marks
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
if (sheets[sheetIndex].getName() == nameOfVizToInteract) {
sheets[sheetIndex].clearSelectedMarksAsync();
}
}
}
else {
// This is not a dashboard so just clear the sheet's selection
referrer.clearSelectedMarksAsync();
}
tableauWriteBack(selectedMarks);
//var plural = ((selectedMarks.length == 1) ? "" : "s");
//$('#eventPanel').html("Success! <b>" + selectedMarks.length + "</b> selection" + plural + " submitted for research.");
//$('#eventBox').hide(2000);
}
function resetAllMarks() {
var referrer = viz.getWorkbook().getActiveSheet();
if (referrer.getSheetType() == "dashboard") {
// The active sheets is a dashboard, which is made of several sheets
var sheets = referrer.getWorksheets();
// Iterate over the sheets until we find the correct one and clear the marks
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
if (sheets[sheetIndex].getName() == nameOfVizToInteract) {
sheets[sheetIndex].clearSelectedMarksAsync();
}
}
}
else {
// This is not a dashboard so just clear the sheet's selection
referrer.clearSelectedMarksAsync();
}
$('#eventBox').hide(800);
$('#eventPanel').html("");
}
function launch_edit() {
// Adjust UI: Hide Buttons & navigation menu, increase size for edit mode
$('#VizToolbar').hide();
$('body').addClass("sidebar-collapse");
$(".content-wrapper").css("height","1200px");
$("#tableauViz").hide();
// If the URL happens to have a ticket on it, clean it up before loading the edit window
var url_parts = url.split('/t/');
url = tableauServer + '/t/' + url_parts[1];
var edit_location = tableauServer + '/en/embed_wrapper.html?src=' + url + '?:embed=y';
edit_iframe = document.createElement('iframe');
edit_iframe.src = edit_location;
// This makes it not look like an iframe
edit_iframe.style.padding = '0px';
edit_iframe.style.border = 'none';
edit_iframe.style.margin = '0px';
// Also set these with the same values in the embed_wrapper.html page
edit_iframe.style.width = '100%';
edit_iframe.style.height = '100%';
$('#editViz').html(edit_iframe);
$('#editViz').show();
}
function iframe_change(new_url) {
console.log("Old URL received in iframe_change: " + url);
console.log("New URL received in iframe_change: " + new_url);
// Destroy the original edit_iframe so |
// If selection has been cleared, no need to show a message
if (marks.length == 0) {
$('#eventBox').hide(600);
return;
}
// Save selected marks in memory so they can be submitted later
selectedMarks = marks;
$('#eventPanel').html("");
$('#eventBox').show(600);
// Logic for Equities Dashboard is specialized, any other scatterplots also are enabled but in a general sense
if (workbook.getActiveSheet().getName() == 'Individual Equities Dashboard') {
//loop through all the selected marks
var noOrders = 0;
var company = "";
var fixedClose = 0; | identifier_body |
TableauViz.js | url, options);
}
function exportPDF() {
viz.showExportPDFDialog();
$('.tab-dialog')[0].animate({ 'marginLeft': "-=50px" });
}
function exportData() {
viz.showExportDataDialog();
}
function resetViz() {
viz.revertAllAsync();
}
function showVizButtons() {
var sheets = workbook.getPublishedSheetsInfo();
var divIndividualButtons = $('#vizButtons');
// First clear any buttons that may have been added on a previous load
divIndividualButtons.html("");
// Show 'standard' controls, common to all vizzes
divIndividualButtons.append('<button type="button" onclick="resetViz()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Reset Filters</button>');
divIndividualButtons.append('<button type="button" onclick="exportPDF()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Export PDF</button>');
divIndividualButtons.append('<button type="button" onclick="exportData()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Export Data</button>');
divIndividualButtons.append('<button type="button" onclick="launch_edit()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Edit</button>');
// Only show buttons to switch vizzes if there's more than one
if (sheets.length > 1) {
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
var sheet = sheets[sheetIndex];
divIndividualButtons.append('<button type="button" onclick="switchToViz(\'' + sheet.getName() + '\')" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">See ' + sheet.getName() + '</button>')
}
}
}
function switchToViz(vizName) {
workbook.activateSheetAsync(vizName).then(function (dashboard) {
dashboard.changeSizeAsync({
behavior: tableau.SheetSizeBehavior.AUTOMATIC
});
});
}
function onMarksSelection(marksEvent) {
//filter sheets of selected marks because we dont need to hear events on all of our sheets
if (marksEvent.getWorksheet().getName() == nameOfVizToInteract) {
//get,marksAsync() is a method in the API that will retun a set of the marks selected
return marksEvent.getMarksAsync().then(handleSelectedMarks);
}
}
function handleSelectedMarks(marks) {
// If selection has been cleared, no need to show a message
if (marks.length == 0) {
$('#eventBox').hide(600);
return;
}
// Save selected marks in memory so they can be submitted later
selectedMarks = marks;
$('#eventPanel').html("");
$('#eventBox').show(600);
// Logic for Equities Dashboard is specialized, any other scatterplots also are enabled but in a general sense
if (workbook.getActiveSheet().getName() == 'Individual Equities Dashboard') {
//loop through all the selected marks
var noOrders = 0;
var company = "";
var fixedClose = 0;
var fixedCloseLabel = "";
var changeFromPriorClose = 0;
var changeFromPriorCloseLabel = "";
var date = "";
for (var markIndex = 0; markIndex < marks.length; markIndex++) {
//getPairs gets tuples of data for the mark. one mark has multiple tuples
var pairs = marks[markIndex].getPairs();
for (var pairIndex = 0; pairIndex < pairs.length; pairIndex++) {
switch (pairs[pairIndex].fieldName) {
case "Company":
company = pairs[pairIndex].value;
break;
case "Date":
date = pairs[pairIndex].formattedValue;
break;
case "SUM(Fixed Close)":
fixedClose += pairs[pairIndex].value;
fixedCloseLabel = pairs[pairIndex].formattedValue;
break;
case "AGG(Change from Prior Close)":
changeFromPriorClose += pairs[pairIndex].value;
changeFromPriorCloseLabel = pairs[pairIndex].formattedValue;
break;
}
}
}
// With all values in memory, let's produce the UI
if (marks.length == 1) {
// When we select a single mark, we can show the individual details
$('#eventPanel').html("Submit <b>" + company + "</b>'s " + date + " trading period for research. The fixed close price was <b>$" + fixedCloseLabel + "</b> with a variance of <b>" + changeFromPriorCloseLabel + "</b>.");
}
else {
// But if more that one mark is selected, we show a summary (average)
var avgFixedClose = Number((fixedClose / marks.length).toFixed(2));
var avgChangeFromPriorCloseLabel = Number((changeFromPriorClose * 100 / marks.length).toFixed(2));
$('#eventPanel').html("Submit <b>" + marks.length + " " + company + "</b>'s trading periods for research. The average fixed close price was <b>$" + avgFixedClose + "</b> & the average variance of <b>" + avgChangeFromPriorCloseLabel + "%</b>.");
}
}
else {
// Save selection in memory and give the user the option to submit
var plural = ((marks.length == 1) ? "it" : "them");
var pluralS = ((selectedMarks.length == 1) ? "" : "s");
$('#eventPanel').html("You've selected <b>" + marks.length + "</b> outlier" + pluralS + "." + " Would you like to submit " + plural + " them for research?");
}
}
function submitMarks()
{
var referrer = viz.getWorkbook().getActiveSheet();
if (referrer.getSheetType() == "dashboard") {
// The active sheets is a dashboard, which is made of several sheets
var sheets = referrer.getWorksheets();
// Iterate over the sheets until we find the correct one and clear the marks
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
if (sheets[sheetIndex].getName() == nameOfVizToInteract) {
sheets[sheetIndex].clearSelectedMarksAsync();
}
}
}
else {
// This is not a dashboard so just clear the sheet's selection
referrer.clearSelectedMarksAsync();
}
tableauWriteBack(selectedMarks);
//var plural = ((selectedMarks.length == 1) ? "" : "s");
//$('#eventPanel').html("Success! <b>" + selectedMarks.length + "</b> selection" + plural + " submitted for research.");
//$('#eventBox').hide(2000);
}
function resetAllMarks() {
var referrer = viz.getWorkbook().getActiveSheet();
if (referrer.getSheetType() == "dashboard") {
// The active sheets is a dashboard, which is made of several sheets
var sheets = referrer.getWorksheets();
// Iterate over the sheets until we find the correct one and clear the marks
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
if (sheets[sheetIndex].getName() == nameOfVizToInteract) {
sheets[sheetIndex].clearSelectedMarksAsync();
}
}
}
else {
// This is not a dashboard so just clear the sheet's selection
referrer.clearSelectedMarksAsync();
}
$('#eventBox').hide(800);
$('#eventPanel').html("");
}
function la | {
// Adjust UI: Hide Buttons & navigation menu, increase size for edit mode
$('#VizToolbar').hide();
$('body').addClass("sidebar-collapse");
$(".content-wrapper").css("height","1200px");
$("#tableauViz").hide();
// If the URL happens to have a ticket on it, clean it up before loading the edit window
var url_parts = url.split('/t/');
url = tableauServer + '/t/' + url_parts[1];
var edit_location = tableauServer + '/en/embed_wrapper.html?src=' + url + '?:embed=y';
edit_iframe = document.createElement('iframe');
edit_iframe.src = edit_location;
// This makes it not look like an iframe
edit_iframe.style.padding = '0px';
edit_iframe.style.border = 'none';
edit_iframe.style.margin = '0px';
// Also set these with the same values in the embed_wrapper.html page
edit_iframe.style.width = '100%';
edit_iframe.style.height = '100%';
$('#editViz').html(edit_iframe);
$('#editViz').show();
}
function iframe_change(new_url) {
console.log("Old URL received in iframe_change: " + url);
console.log("New URL received in iframe_change: " + new_url);
// Destroy the original edit_iframe so | unch_edit() | identifier_name |
TableauViz.js | Filters</button>');
divIndividualButtons.append('<button type="button" onclick="exportPDF()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Export PDF</button>');
divIndividualButtons.append('<button type="button" onclick="exportData()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Export Data</button>');
divIndividualButtons.append('<button type="button" onclick="launch_edit()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Edit</button>');
// Only show buttons to switch vizzes if there's more than one
if (sheets.length > 1) {
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
var sheet = sheets[sheetIndex];
divIndividualButtons.append('<button type="button" onclick="switchToViz(\'' + sheet.getName() + '\')" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">See ' + sheet.getName() + '</button>')
}
}
}
function switchToViz(vizName) {
workbook.activateSheetAsync(vizName).then(function (dashboard) {
dashboard.changeSizeAsync({
behavior: tableau.SheetSizeBehavior.AUTOMATIC
});
});
}
function onMarksSelection(marksEvent) {
//filter sheets of selected marks because we dont need to hear events on all of our sheets
if (marksEvent.getWorksheet().getName() == nameOfVizToInteract) {
//get,marksAsync() is a method in the API that will retun a set of the marks selected
return marksEvent.getMarksAsync().then(handleSelectedMarks);
}
}
function handleSelectedMarks(marks) {
// If selection has been cleared, no need to show a message
if (marks.length == 0) {
$('#eventBox').hide(600);
return;
}
// Save selected marks in memory so they can be submitted later
selectedMarks = marks;
$('#eventPanel').html("");
$('#eventBox').show(600);
// Logic for Equities Dashboard is specialized, any other scatterplots also are enabled but in a general sense
if (workbook.getActiveSheet().getName() == 'Individual Equities Dashboard') {
//loop through all the selected marks
var noOrders = 0;
var company = "";
var fixedClose = 0;
var fixedCloseLabel = "";
var changeFromPriorClose = 0;
var changeFromPriorCloseLabel = "";
var date = "";
for (var markIndex = 0; markIndex < marks.length; markIndex++) {
//getPairs gets tuples of data for the mark. one mark has multiple tuples
var pairs = marks[markIndex].getPairs();
for (var pairIndex = 0; pairIndex < pairs.length; pairIndex++) {
switch (pairs[pairIndex].fieldName) {
case "Company":
company = pairs[pairIndex].value;
break;
case "Date":
date = pairs[pairIndex].formattedValue;
break;
case "SUM(Fixed Close)":
fixedClose += pairs[pairIndex].value;
fixedCloseLabel = pairs[pairIndex].formattedValue;
break;
case "AGG(Change from Prior Close)":
changeFromPriorClose += pairs[pairIndex].value;
changeFromPriorCloseLabel = pairs[pairIndex].formattedValue;
break;
}
}
}
// With all values in memory, let's produce the UI
if (marks.length == 1) {
// When we select a single mark, we can show the individual details
$('#eventPanel').html("Submit <b>" + company + "</b>'s " + date + " trading period for research. The fixed close price was <b>$" + fixedCloseLabel + "</b> with a variance of <b>" + changeFromPriorCloseLabel + "</b>.");
}
else {
// But if more that one mark is selected, we show a summary (average)
var avgFixedClose = Number((fixedClose / marks.length).toFixed(2));
var avgChangeFromPriorCloseLabel = Number((changeFromPriorClose * 100 / marks.length).toFixed(2));
$('#eventPanel').html("Submit <b>" + marks.length + " " + company + "</b>'s trading periods for research. The average fixed close price was <b>$" + avgFixedClose + "</b> & the average variance of <b>" + avgChangeFromPriorCloseLabel + "%</b>.");
}
}
else {
// Save selection in memory and give the user the option to submit
var plural = ((marks.length == 1) ? "it" : "them");
var pluralS = ((selectedMarks.length == 1) ? "" : "s");
$('#eventPanel').html("You've selected <b>" + marks.length + "</b> outlier" + pluralS + "." + " Would you like to submit " + plural + " them for research?");
}
}
function submitMarks()
{
var referrer = viz.getWorkbook().getActiveSheet();
if (referrer.getSheetType() == "dashboard") {
// The active sheets is a dashboard, which is made of several sheets
var sheets = referrer.getWorksheets();
// Iterate over the sheets until we find the correct one and clear the marks
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
if (sheets[sheetIndex].getName() == nameOfVizToInteract) {
sheets[sheetIndex].clearSelectedMarksAsync();
}
}
}
else {
// This is not a dashboard so just clear the sheet's selection
referrer.clearSelectedMarksAsync();
}
tableauWriteBack(selectedMarks);
//var plural = ((selectedMarks.length == 1) ? "" : "s");
//$('#eventPanel').html("Success! <b>" + selectedMarks.length + "</b> selection" + plural + " submitted for research.");
//$('#eventBox').hide(2000);
}
function resetAllMarks() {
var referrer = viz.getWorkbook().getActiveSheet();
if (referrer.getSheetType() == "dashboard") {
// The active sheets is a dashboard, which is made of several sheets
var sheets = referrer.getWorksheets();
// Iterate over the sheets until we find the correct one and clear the marks
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
if (sheets[sheetIndex].getName() == nameOfVizToInteract) {
sheets[sheetIndex].clearSelectedMarksAsync();
}
}
}
else {
// This is not a dashboard so just clear the sheet's selection
referrer.clearSelectedMarksAsync();
}
$('#eventBox').hide(800);
$('#eventPanel').html("");
}
function launch_edit() {
// Adjust UI: Hide Buttons & navigation menu, increase size for edit mode
$('#VizToolbar').hide();
$('body').addClass("sidebar-collapse");
$(".content-wrapper").css("height","1200px");
$("#tableauViz").hide();
// If the URL happens to have a ticket on it, clean it up before loading the edit window
var url_parts = url.split('/t/');
url = tableauServer + '/t/' + url_parts[1];
var edit_location = tableauServer + '/en/embed_wrapper.html?src=' + url + '?:embed=y';
edit_iframe = document.createElement('iframe');
edit_iframe.src = edit_location;
// This makes it not look like an iframe
edit_iframe.style.padding = '0px';
edit_iframe.style.border = 'none';
edit_iframe.style.margin = '0px';
// Also set these with the same values in the embed_wrapper.html page
edit_iframe.style.width = '100%';
edit_iframe.style.height = '100%';
$('#editViz').html(edit_iframe);
$('#editViz').show();
}
function iframe_change(new_url) {
console.log("Old URL received in iframe_change: " + url);
console.log("New URL received in iframe_change: " + new_url);
// Destroy the original edit_iframe so you can build another one later if necessary
$(edit_iframe).remove();
// Destroy the original Tableau Viz object so you can create new one with URL of the Save(d) As version
viz.dispose();
// Reset the global vizURL at this point so that it all works circularly
// But first remove any embed/authoring attributes from the URL
var url_parts = new_url.split('?');
url = url_parts[0].replace('/authoring', '/views');
// Handle site
if (url.search('/site/') !== -1) {
| url_parts = url.split('#/site/');
url = url_parts[0] + "t/" + url_parts[1];
vizUrlForWebEdit = url;
console.log("URL updated in iframe_change: " + url);
}
| conditional_block | |
TableauViz.js | function exportPDF() {
viz.showExportPDFDialog();
$('.tab-dialog')[0].animate({ 'marginLeft': "-=50px" });
}
function exportData() {
viz.showExportDataDialog();
}
function resetViz() {
viz.revertAllAsync();
}
function showVizButtons() {
var sheets = workbook.getPublishedSheetsInfo();
var divIndividualButtons = $('#vizButtons');
// First clear any buttons that may have been added on a previous load
divIndividualButtons.html("");
// Show 'standard' controls, common to all vizzes
divIndividualButtons.append('<button type="button" onclick="resetViz()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Reset Filters</button>');
divIndividualButtons.append('<button type="button" onclick="exportPDF()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Export PDF</button>');
divIndividualButtons.append('<button type="button" onclick="exportData()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Export Data</button>');
divIndividualButtons.append('<button type="button" onclick="launch_edit()" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">Edit</button>');
// Only show buttons to switch vizzes if there's more than one
if (sheets.length > 1) {
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
var sheet = sheets[sheetIndex];
divIndividualButtons.append('<button type="button" onclick="switchToViz(\'' + sheet.getName() + '\')" class="btn btn-primary" style="min-width:135px; margin-right: 5px; margin-top: 5px;">See ' + sheet.getName() + '</button>')
}
}
}
function switchToViz(vizName) {
workbook.activateSheetAsync(vizName).then(function (dashboard) {
dashboard.changeSizeAsync({
behavior: tableau.SheetSizeBehavior.AUTOMATIC
});
});
}
function onMarksSelection(marksEvent) {
//filter sheets of selected marks because we dont need to hear events on all of our sheets
if (marksEvent.getWorksheet().getName() == nameOfVizToInteract) {
//get,marksAsync() is a method in the API that will retun a set of the marks selected
return marksEvent.getMarksAsync().then(handleSelectedMarks);
}
}
function handleSelectedMarks(marks) {
// If selection has been cleared, no need to show a message
if (marks.length == 0) {
$('#eventBox').hide(600);
return;
}
// Save selected marks in memory so they can be submitted later
selectedMarks = marks;
$('#eventPanel').html("");
$('#eventBox').show(600);
// Logic for Equities Dashboard is specialized, any other scatterplots also are enabled but in a general sense
if (workbook.getActiveSheet().getName() == 'Individual Equities Dashboard') {
//loop through all the selected marks
var noOrders = 0;
var company = "";
var fixedClose = 0;
var fixedCloseLabel = "";
var changeFromPriorClose = 0;
var changeFromPriorCloseLabel = "";
var date = "";
for (var markIndex = 0; markIndex < marks.length; markIndex++) {
//getPairs gets tuples of data for the mark. one mark has multiple tuples
var pairs = marks[markIndex].getPairs();
for (var pairIndex = 0; pairIndex < pairs.length; pairIndex++) {
switch (pairs[pairIndex].fieldName) {
case "Company":
company = pairs[pairIndex].value;
break;
case "Date":
date = pairs[pairIndex].formattedValue;
break;
case "SUM(Fixed Close)":
fixedClose += pairs[pairIndex].value;
fixedCloseLabel = pairs[pairIndex].formattedValue;
break;
case "AGG(Change from Prior Close)":
changeFromPriorClose += pairs[pairIndex].value;
changeFromPriorCloseLabel = pairs[pairIndex].formattedValue;
break;
}
}
}
// With all values in memory, let's produce the UI
if (marks.length == 1) {
// When we select a single mark, we can show the individual details
$('#eventPanel').html("Submit <b>" + company + "</b>'s " + date + " trading period for research. The fixed close price was <b>$" + fixedCloseLabel + "</b> with a variance of <b>" + changeFromPriorCloseLabel + "</b>.");
}
else {
// But if more that one mark is selected, we show a summary (average)
var avgFixedClose = Number((fixedClose / marks.length).toFixed(2));
var avgChangeFromPriorCloseLabel = Number((changeFromPriorClose * 100 / marks.length).toFixed(2));
$('#eventPanel').html("Submit <b>" + marks.length + " " + company + "</b>'s trading periods for research. The average fixed close price was <b>$" + avgFixedClose + "</b> & the average variance of <b>" + avgChangeFromPriorCloseLabel + "%</b>.");
}
}
else {
// Save selection in memory and give the user the option to submit
var plural = ((marks.length == 1) ? "it" : "them");
var pluralS = ((selectedMarks.length == 1) ? "" : "s");
$('#eventPanel').html("You've selected <b>" + marks.length + "</b> outlier" + pluralS + "." + " Would you like to submit " + plural + " them for research?");
}
}
function submitMarks()
{
var referrer = viz.getWorkbook().getActiveSheet();
if (referrer.getSheetType() == "dashboard") {
// The active sheets is a dashboard, which is made of several sheets
var sheets = referrer.getWorksheets();
// Iterate over the sheets until we find the correct one and clear the marks
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
if (sheets[sheetIndex].getName() == nameOfVizToInteract) {
sheets[sheetIndex].clearSelectedMarksAsync();
}
}
}
else {
// This is not a dashboard so just clear the sheet's selection
referrer.clearSelectedMarksAsync();
}
tableauWriteBack(selectedMarks);
//var plural = ((selectedMarks.length == 1) ? "" : "s");
//$('#eventPanel').html("Success! <b>" + selectedMarks.length + "</b> selection" + plural + " submitted for research.");
//$('#eventBox').hide(2000);
}
function resetAllMarks() {
var referrer = viz.getWorkbook().getActiveSheet();
if (referrer.getSheetType() == "dashboard") {
// The active sheets is a dashboard, which is made of several sheets
var sheets = referrer.getWorksheets();
// Iterate over the sheets until we find the correct one and clear the marks
for (var sheetIndex = 0; sheetIndex < sheets.length; sheetIndex++) {
if (sheets[sheetIndex].getName() == nameOfVizToInteract) {
sheets[sheetIndex].clearSelectedMarksAsync();
}
}
}
else {
// This is not a dashboard so just clear the sheet's selection
referrer.clearSelectedMarksAsync();
}
$('#eventBox').hide(800);
$('#eventPanel').html("");
}
function launch_edit() {
// Adjust UI: Hide Buttons & navigation menu, increase size for edit mode
$('#VizToolbar').hide();
$('body').addClass("sidebar-collapse");
$(".content-wrapper").css("height","1200px");
$("#tableauViz").hide();
// If the URL happens to have a ticket on it, clean it up before loading the edit window
var url_parts = url.split('/t/');
url = tableauServer + '/t/' + url_parts[1];
var edit_location = tableauServer + '/en/embed_wrapper.html?src=' + url + '?:embed=y';
edit_iframe = document.createElement('iframe');
edit_iframe.src = edit_location;
// This makes it not look like an iframe
edit_iframe.style.padding = '0px';
edit_iframe.style.border = 'none';
edit_iframe.style.margin = '0px';
// Also set these with the same values in the embed_wrapper.html page
edit_iframe.style.width = '100%';
edit_iframe.style.height = '100%';
$('#editViz').html(edit_iframe);
$('#editViz').show();
}
function iframe_change(new_url) {
console.log("Old URL received in iframe_change: " + url);
console.log("New URL received in iframe_change: " + new |
viz = new tableau.Viz(placeholderDiv, url, options);
}
| random_line_split | |
__init__.py | OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
"""
from __future__ import absolute_import
import six
__author__ = 'xepa4ep, a@toukmanov.ru'
import re
from ..exceptions import Error, RequiredArgumentIsNotPassed, MethodDoesNotExist
from ..rules.contexts import Value, ContextNotFound
from ..rules.case import DummyCase
from tml.strings import to_string, suggest_string
def need_to_escape(options):
""" Need escape string
Args:
options (dict): translation options
Returns:
boolean
""" | return options['escape']
return True
def escape_if_needed(text, options):
""" Escape string if it needed
Agrs:
text (string): text to escape
options (dict): tranlation options (if key safe is True - do not escape)
Returns:
text
"""
if hasattr(text, '__html__'):
# Text has escape itself:
return to_string(text.__html__())
if need_to_escape(options):
return escape(to_string(text))
return to_string(text)
ESCAPE_CHARS = (('&', '&'),
('<', '<'),
('>', '>'),
('"', '"'),
("'", '''))
def escape(text):
""" Escape text
Args:
text: input text
Returns:
(string): escaped HTML
"""
for find, replace in ESCAPE_CHARS:
text = text.replace(find, replace)
return text
class AbstractToken(object):
""" Base token class """
@classmethod
def validate(self, text):
""" Check that string is valid token
Args:
str (string): token string implimentation
Returns:
AbstractToken
"""
raise NotImplementedError()
def execute(self, data, options):
""" Execute token for data with options
data (dict): data
options (dict): execution options
"""
raise NotImplementedError()
class TextToken(AbstractToken):
""" Plain text """
def __init__(self, text):
""" .ctor
Args:
text (string): token text
"""
self.text = text
def execute(self, data, options):
""" Execute token
Returns: (string)
"""
return self.text
@classmethod
def validate(cls, text, language):
""" Validate tokenized string
Args:
text(string): token text
language (Language): token language
Returns:
TextToken|None
"""
if text == '':
# Empty text
return TextToken(text)
if text[0] != '{':
return TextToken(text)
def __str__(self):
return "TextToken[%s]" % self.text
class AbstractVariableToken(AbstractToken):
IS_VARIABLE = '([\$\d\w]+)'
IS_METHOD = '([\$\d\w])'
REGEXP_TOKEN = '^\{%s\}$'
def __init__(self, name):
self.name = name
def fetch(self, data):
try:
if self.name == '$0':
return data
return data[self.name]
except KeyError:
raise RequiredArgumentIsNotPassed(self.name, data)
class VariableToken(AbstractVariableToken):
""" Token for variabel {name} """
# Regext to check objects
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % AbstractVariableToken.IS_VARIABLE)
def __init__(self, name):
"""
Args:
name (string): variable name
"""
self.name = name
def execute(self, data, options):
""" Fetch and escape variable from data
Args:
data (dict): input data
options (dict): translation options
Returns:
string
"""
return escape_if_needed(self.fetch(data), options)
def fetch(self, data):
""" Fetch variable"""
return suggest_string(super(VariableToken, self).fetch(data))
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return VariableToken(m.group(1))
def __str__(self):
return 'VariableToken[%s]' % self.name
class MethodToken(VariableToken):
# Method Token Forms
#
# {user.name}
# {user.name:gender}
HAS_METHOD = '\.(\w*\s*)'
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + HAS_METHOD))
def __init__(self, name, method_name):
VariableToken.__init__(self, name)
self.method_name = method_name
def execute(self, data, options):
""" Fetch and escape variable from data
Args:
data (dict): input data
options (dict): translation options
Returns:
string
"""
obj = self.fetch(data)
if isinstance(obj, dict) and self.method_name in obj: # if dict
return obj[self.method_name]
try:
prop = getattr(obj, self.method_name)
rv = callable(prop) and prop() or prop
return escape_if_needed(rv, options)
except AttributeError:
raise MethodDoesNotExist(self.name, self.method_name)
def fetch(self, data):
""" Fetch variable"""
return super(VariableToken, self).fetch(data)
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return MethodToken(m.group(1), m.group(2))
class RulesToken(AbstractVariableToken):
"""
Token which execute some rules on variable
{count|token, tokens}: count = 1 -> token
count = 100 -> tokens
"""
def __init__(self, name, rules, language):
""" .ctor
Args:
name (string): variable name
rules (string): rules string
language (Language): current language
"""
super(RulesToken, self).__init__(name)
self.rules = rules
self.language = language
TOKEN_TYPE_REGEX = '\|([^\|]{1}(.*))'
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + TOKEN_TYPE_REGEX,))
""" Compiler for rules """
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return cls(m.group(1), m.group(2), language)
def execute(self, data, options):
""" Execute token with var """
return self.language.contexts.execute(self.rules, self.fetch(data)).strip()
def find_context(self, token=None):
token = token or self.name
try:
return self.language.contexts.find_by_code(token)
except ContextNotFound:
return self.language.contexts.find_by_token_name(token)
def __str__(self):
return "RulesToken[%s, choices=%s]" % (self.name, self.rules)
class RulesMethodToken(RulesToken):
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return cls(m.group(1), m.group(2), m.group(3), language)
class CaseToken(RulesToken):
""" Language keys {name::nom} """
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + '\:\:(.*)',))
def __init__(self, name, case, language):
super(RulesToken, self).__init__(name)
self.case = language.cases.get(str(case), DummyCase())
def execute(self, data, options):
""" Execute with rules options """
return escape_if_needed(
suggest_string(self.case.execute(self.fetch(data))), options)
def __str__(self):
return "CaseToken[%s, case=%s]" % (self.name, self.case)
class CaseMethodToken(RulesMethodToken):
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (
AbstractVariableToken.IS_VARIABLE + MethodToken.HAS_METHOD + '\:\:(.*)'))
def __init__(self, name, method_name, case, language):
self.token = MethodToken(name, method_name)
self.case = language.cases.get(str(case), DummyCase())
def execute(self, data, options):
""" Execute with rules options """
return escape_if_needed(
self.case.execute(self.token.execute(data, {'escape': False})), options)
def __str__(self):
return "CaseMethodToken[%s, case=%s]" % (self.name, self.case)
class UnsupportedCase(Error):
def __init__(self, language, case):
self.language = language
self.case = case
def __str__(self):
return 'Language does not support case %s for locale %s' % (self.case, self.language.locale)
class PipeToken(RulesToken):
"""
Token which pipe rules and join it with variable
{count||token, tokens}: count = 1 -> 1 token
count = 100 -> 100 tokens
works like {name||rules} == {name} {name|rules}
"""
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + '\|\|(.*)',))
def __init__(self, name, rules, language):
self.token = VariableToken(name)
self.rules = RulesToken(name, rules, language)
| if 'escape' in options: | random_line_split |
__init__.py | OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
"""
from __future__ import absolute_import
import six
__author__ = 'xepa4ep, a@toukmanov.ru'
import re
from ..exceptions import Error, RequiredArgumentIsNotPassed, MethodDoesNotExist
from ..rules.contexts import Value, ContextNotFound
from ..rules.case import DummyCase
from tml.strings import to_string, suggest_string
def need_to_escape(options):
""" Need escape string
Args:
options (dict): translation options
Returns:
boolean
"""
if 'escape' in options:
return options['escape']
return True
def escape_if_needed(text, options):
""" Escape string if it needed
Agrs:
text (string): text to escape
options (dict): tranlation options (if key safe is True - do not escape)
Returns:
text
"""
if hasattr(text, '__html__'):
# Text has escape itself:
return to_string(text.__html__())
if need_to_escape(options):
return escape(to_string(text))
return to_string(text)
ESCAPE_CHARS = (('&', '&'),
('<', '<'),
('>', '>'),
('"', '"'),
("'", '''))
def escape(text):
""" Escape text
Args:
text: input text
Returns:
(string): escaped HTML
"""
for find, replace in ESCAPE_CHARS:
text = text.replace(find, replace)
return text
class AbstractToken(object):
""" Base token class """
@classmethod
def validate(self, text):
""" Check that string is valid token
Args:
str (string): token string implimentation
Returns:
AbstractToken
"""
raise NotImplementedError()
def execute(self, data, options):
""" Execute token for data with options
data (dict): data
options (dict): execution options
"""
raise NotImplementedError()
class TextToken(AbstractToken):
""" Plain text """
def __init__(self, text):
""" .ctor
Args:
text (string): token text
"""
self.text = text
def execute(self, data, options):
""" Execute token
Returns: (string)
"""
return self.text
@classmethod
def validate(cls, text, language):
""" Validate tokenized string
Args:
text(string): token text
language (Language): token language
Returns:
TextToken|None
"""
if text == '':
# Empty text
return TextToken(text)
if text[0] != '{':
return TextToken(text)
def __str__(self):
return "TextToken[%s]" % self.text
class AbstractVariableToken(AbstractToken):
IS_VARIABLE = '([\$\d\w]+)'
IS_METHOD = '([\$\d\w])'
REGEXP_TOKEN = '^\{%s\}$'
def __init__(self, name):
self.name = name
def fetch(self, data):
try:
if self.name == '$0':
return data
return data[self.name]
except KeyError:
raise RequiredArgumentIsNotPassed(self.name, data)
class VariableToken(AbstractVariableToken):
""" Token for variabel {name} """
# Regext to check objects
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % AbstractVariableToken.IS_VARIABLE)
def __init__(self, name):
"""
Args:
name (string): variable name
"""
self.name = name
def execute(self, data, options):
""" Fetch and escape variable from data
Args:
data (dict): input data
options (dict): translation options
Returns:
string
"""
return escape_if_needed(self.fetch(data), options)
def fetch(self, data):
""" Fetch variable"""
return suggest_string(super(VariableToken, self).fetch(data))
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return VariableToken(m.group(1))
def __str__(self):
return 'VariableToken[%s]' % self.name
class MethodToken(VariableToken):
# Method Token Forms
#
# {user.name}
# {user.name:gender}
HAS_METHOD = '\.(\w*\s*)'
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + HAS_METHOD))
def __init__(self, name, method_name):
VariableToken.__init__(self, name)
self.method_name = method_name
def execute(self, data, options):
""" Fetch and escape variable from data
Args:
data (dict): input data
options (dict): translation options
Returns:
string
"""
obj = self.fetch(data)
if isinstance(obj, dict) and self.method_name in obj: # if dict
return obj[self.method_name]
try:
prop = getattr(obj, self.method_name)
rv = callable(prop) and prop() or prop
return escape_if_needed(rv, options)
except AttributeError:
raise MethodDoesNotExist(self.name, self.method_name)
def fetch(self, data):
|
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return MethodToken(m.group(1), m.group(2))
class RulesToken(AbstractVariableToken):
"""
Token which execute some rules on variable
{count|token, tokens}: count = 1 -> token
count = 100 -> tokens
"""
def __init__(self, name, rules, language):
""" .ctor
Args:
name (string): variable name
rules (string): rules string
language (Language): current language
"""
super(RulesToken, self).__init__(name)
self.rules = rules
self.language = language
TOKEN_TYPE_REGEX = '\|([^\|]{1}(.*))'
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + TOKEN_TYPE_REGEX,))
""" Compiler for rules """
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return cls(m.group(1), m.group(2), language)
def execute(self, data, options):
""" Execute token with var """
return self.language.contexts.execute(self.rules, self.fetch(data)).strip()
def find_context(self, token=None):
token = token or self.name
try:
return self.language.contexts.find_by_code(token)
except ContextNotFound:
return self.language.contexts.find_by_token_name(token)
def __str__(self):
return "RulesToken[%s, choices=%s]" % (self.name, self.rules)
class RulesMethodToken(RulesToken):
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return cls(m.group(1), m.group(2), m.group(3), language)
class CaseToken(RulesToken):
""" Language keys {name::nom} """
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + '\:\:(.*)',))
def __init__(self, name, case, language):
super(RulesToken, self).__init__(name)
self.case = language.cases.get(str(case), DummyCase())
def execute(self, data, options):
""" Execute with rules options """
return escape_if_needed(
suggest_string(self.case.execute(self.fetch(data))), options)
def __str__(self):
return "CaseToken[%s, case=%s]" % (self.name, self.case)
class CaseMethodToken(RulesMethodToken):
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (
AbstractVariableToken.IS_VARIABLE + MethodToken.HAS_METHOD + '\:\:(.*)'))
def __init__(self, name, method_name, case, language):
self.token = MethodToken(name, method_name)
self.case = language.cases.get(str(case), DummyCase())
def execute(self, data, options):
""" Execute with rules options """
return escape_if_needed(
self.case.execute(self.token.execute(data, {'escape': False})), options)
def __str__(self):
return "CaseMethodToken[%s, case=%s]" % (self.name, self.case)
class UnsupportedCase(Error):
def __init__(self, language, case):
self.language = language
self.case = case
def __str__(self):
return 'Language does not support case %s for locale %s' % (self.case, self.language.locale)
class PipeToken(RulesToken):
"""
Token which pipe rules and join it with variable
{count||token, tokens}: count = 1 -> 1 token
count = 100 -> 100 tokens
works like {name||rules} == {name} {name|rules}
"""
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + '\|\|(.*)',))
def __init__(self, name, rules, language):
self.token = VariableToken(name)
self.rules = RulesToken(name, rules, language | """ Fetch variable"""
return super(VariableToken, self).fetch(data) | identifier_body |
__init__.py | OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
"""
from __future__ import absolute_import
import six
__author__ = 'xepa4ep, a@toukmanov.ru'
import re
from ..exceptions import Error, RequiredArgumentIsNotPassed, MethodDoesNotExist
from ..rules.contexts import Value, ContextNotFound
from ..rules.case import DummyCase
from tml.strings import to_string, suggest_string
def need_to_escape(options):
""" Need escape string
Args:
options (dict): translation options
Returns:
boolean
"""
if 'escape' in options:
return options['escape']
return True
def escape_if_needed(text, options):
""" Escape string if it needed
Agrs:
text (string): text to escape
options (dict): tranlation options (if key safe is True - do not escape)
Returns:
text
"""
if hasattr(text, '__html__'):
# Text has escape itself:
return to_string(text.__html__())
if need_to_escape(options):
return escape(to_string(text))
return to_string(text)
ESCAPE_CHARS = (('&', '&'),
('<', '<'),
('>', '>'),
('"', '"'),
("'", '''))
def escape(text):
""" Escape text
Args:
text: input text
Returns:
(string): escaped HTML
"""
for find, replace in ESCAPE_CHARS:
text = text.replace(find, replace)
return text
class AbstractToken(object):
""" Base token class """
@classmethod
def validate(self, text):
""" Check that string is valid token
Args:
str (string): token string implimentation
Returns:
AbstractToken
"""
raise NotImplementedError()
def execute(self, data, options):
""" Execute token for data with options
data (dict): data
options (dict): execution options
"""
raise NotImplementedError()
class TextToken(AbstractToken):
""" Plain text """
def __init__(self, text):
""" .ctor
Args:
text (string): token text
"""
self.text = text
def execute(self, data, options):
""" Execute token
Returns: (string)
"""
return self.text
@classmethod
def validate(cls, text, language):
""" Validate tokenized string
Args:
text(string): token text
language (Language): token language
Returns:
TextToken|None
"""
if text == '':
# Empty text
|
if text[0] != '{':
return TextToken(text)
def __str__(self):
return "TextToken[%s]" % self.text
class AbstractVariableToken(AbstractToken):
IS_VARIABLE = '([\$\d\w]+)'
IS_METHOD = '([\$\d\w])'
REGEXP_TOKEN = '^\{%s\}$'
def __init__(self, name):
self.name = name
def fetch(self, data):
try:
if self.name == '$0':
return data
return data[self.name]
except KeyError:
raise RequiredArgumentIsNotPassed(self.name, data)
class VariableToken(AbstractVariableToken):
""" Token for variabel {name} """
# Regext to check objects
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % AbstractVariableToken.IS_VARIABLE)
def __init__(self, name):
"""
Args:
name (string): variable name
"""
self.name = name
def execute(self, data, options):
""" Fetch and escape variable from data
Args:
data (dict): input data
options (dict): translation options
Returns:
string
"""
return escape_if_needed(self.fetch(data), options)
def fetch(self, data):
""" Fetch variable"""
return suggest_string(super(VariableToken, self).fetch(data))
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return VariableToken(m.group(1))
def __str__(self):
return 'VariableToken[%s]' % self.name
class MethodToken(VariableToken):
# Method Token Forms
#
# {user.name}
# {user.name:gender}
HAS_METHOD = '\.(\w*\s*)'
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + HAS_METHOD))
def __init__(self, name, method_name):
VariableToken.__init__(self, name)
self.method_name = method_name
def execute(self, data, options):
""" Fetch and escape variable from data
Args:
data (dict): input data
options (dict): translation options
Returns:
string
"""
obj = self.fetch(data)
if isinstance(obj, dict) and self.method_name in obj: # if dict
return obj[self.method_name]
try:
prop = getattr(obj, self.method_name)
rv = callable(prop) and prop() or prop
return escape_if_needed(rv, options)
except AttributeError:
raise MethodDoesNotExist(self.name, self.method_name)
def fetch(self, data):
""" Fetch variable"""
return super(VariableToken, self).fetch(data)
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return MethodToken(m.group(1), m.group(2))
class RulesToken(AbstractVariableToken):
"""
Token which execute some rules on variable
{count|token, tokens}: count = 1 -> token
count = 100 -> tokens
"""
def __init__(self, name, rules, language):
""" .ctor
Args:
name (string): variable name
rules (string): rules string
language (Language): current language
"""
super(RulesToken, self).__init__(name)
self.rules = rules
self.language = language
TOKEN_TYPE_REGEX = '\|([^\|]{1}(.*))'
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + TOKEN_TYPE_REGEX,))
""" Compiler for rules """
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return cls(m.group(1), m.group(2), language)
def execute(self, data, options):
""" Execute token with var """
return self.language.contexts.execute(self.rules, self.fetch(data)).strip()
def find_context(self, token=None):
token = token or self.name
try:
return self.language.contexts.find_by_code(token)
except ContextNotFound:
return self.language.contexts.find_by_token_name(token)
def __str__(self):
return "RulesToken[%s, choices=%s]" % (self.name, self.rules)
class RulesMethodToken(RulesToken):
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return cls(m.group(1), m.group(2), m.group(3), language)
class CaseToken(RulesToken):
""" Language keys {name::nom} """
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + '\:\:(.*)',))
def __init__(self, name, case, language):
super(RulesToken, self).__init__(name)
self.case = language.cases.get(str(case), DummyCase())
def execute(self, data, options):
""" Execute with rules options """
return escape_if_needed(
suggest_string(self.case.execute(self.fetch(data))), options)
def __str__(self):
return "CaseToken[%s, case=%s]" % (self.name, self.case)
class CaseMethodToken(RulesMethodToken):
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (
AbstractVariableToken.IS_VARIABLE + MethodToken.HAS_METHOD + '\:\:(.*)'))
def __init__(self, name, method_name, case, language):
self.token = MethodToken(name, method_name)
self.case = language.cases.get(str(case), DummyCase())
def execute(self, data, options):
""" Execute with rules options """
return escape_if_needed(
self.case.execute(self.token.execute(data, {'escape': False})), options)
def __str__(self):
return "CaseMethodToken[%s, case=%s]" % (self.name, self.case)
class UnsupportedCase(Error):
def __init__(self, language, case):
self.language = language
self.case = case
def __str__(self):
return 'Language does not support case %s for locale %s' % (self.case, self.language.locale)
class PipeToken(RulesToken):
"""
Token which pipe rules and join it with variable
{count||token, tokens}: count = 1 -> 1 token
count = 100 -> 100 tokens
works like {name||rules} == {name} {name|rules}
"""
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + '\|\|(.*)',))
def __init__(self, name, rules, language):
self.token = VariableToken(name)
self.rules = RulesToken(name, rules, language | return TextToken(text) | conditional_block |
__init__.py | OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
"""
from __future__ import absolute_import
import six
__author__ = 'xepa4ep, a@toukmanov.ru'
import re
from ..exceptions import Error, RequiredArgumentIsNotPassed, MethodDoesNotExist
from ..rules.contexts import Value, ContextNotFound
from ..rules.case import DummyCase
from tml.strings import to_string, suggest_string
def need_to_escape(options):
""" Need escape string
Args:
options (dict): translation options
Returns:
boolean
"""
if 'escape' in options:
return options['escape']
return True
def escape_if_needed(text, options):
""" Escape string if it needed
Agrs:
text (string): text to escape
options (dict): tranlation options (if key safe is True - do not escape)
Returns:
text
"""
if hasattr(text, '__html__'):
# Text has escape itself:
return to_string(text.__html__())
if need_to_escape(options):
return escape(to_string(text))
return to_string(text)
ESCAPE_CHARS = (('&', '&'),
('<', '<'),
('>', '>'),
('"', '"'),
("'", '''))
def escape(text):
""" Escape text
Args:
text: input text
Returns:
(string): escaped HTML
"""
for find, replace in ESCAPE_CHARS:
text = text.replace(find, replace)
return text
class AbstractToken(object):
""" Base token class """
@classmethod
def validate(self, text):
""" Check that string is valid token
Args:
str (string): token string implimentation
Returns:
AbstractToken
"""
raise NotImplementedError()
def execute(self, data, options):
""" Execute token for data with options
data (dict): data
options (dict): execution options
"""
raise NotImplementedError()
class TextToken(AbstractToken):
""" Plain text """
def __init__(self, text):
""" .ctor
Args:
text (string): token text
"""
self.text = text
def execute(self, data, options):
""" Execute token
Returns: (string)
"""
return self.text
@classmethod
def validate(cls, text, language):
""" Validate tokenized string
Args:
text(string): token text
language (Language): token language
Returns:
TextToken|None
"""
if text == '':
# Empty text
return TextToken(text)
if text[0] != '{':
return TextToken(text)
def __str__(self):
return "TextToken[%s]" % self.text
class AbstractVariableToken(AbstractToken):
IS_VARIABLE = '([\$\d\w]+)'
IS_METHOD = '([\$\d\w])'
REGEXP_TOKEN = '^\{%s\}$'
def __init__(self, name):
self.name = name
def fetch(self, data):
try:
if self.name == '$0':
return data
return data[self.name]
except KeyError:
raise RequiredArgumentIsNotPassed(self.name, data)
class VariableToken(AbstractVariableToken):
""" Token for variabel {name} """
# Regext to check objects
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % AbstractVariableToken.IS_VARIABLE)
def __init__(self, name):
"""
Args:
name (string): variable name
"""
self.name = name
def execute(self, data, options):
""" Fetch and escape variable from data
Args:
data (dict): input data
options (dict): translation options
Returns:
string
"""
return escape_if_needed(self.fetch(data), options)
def fetch(self, data):
""" Fetch variable"""
return suggest_string(super(VariableToken, self).fetch(data))
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return VariableToken(m.group(1))
def __str__(self):
return 'VariableToken[%s]' % self.name
class MethodToken(VariableToken):
# Method Token Forms
#
# {user.name}
# {user.name:gender}
HAS_METHOD = '\.(\w*\s*)'
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + HAS_METHOD))
def __init__(self, name, method_name):
VariableToken.__init__(self, name)
self.method_name = method_name
def execute(self, data, options):
""" Fetch and escape variable from data
Args:
data (dict): input data
options (dict): translation options
Returns:
string
"""
obj = self.fetch(data)
if isinstance(obj, dict) and self.method_name in obj: # if dict
return obj[self.method_name]
try:
prop = getattr(obj, self.method_name)
rv = callable(prop) and prop() or prop
return escape_if_needed(rv, options)
except AttributeError:
raise MethodDoesNotExist(self.name, self.method_name)
def fetch(self, data):
""" Fetch variable"""
return super(VariableToken, self).fetch(data)
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return MethodToken(m.group(1), m.group(2))
class RulesToken(AbstractVariableToken):
"""
Token which execute some rules on variable
{count|token, tokens}: count = 1 -> token
count = 100 -> tokens
"""
def __init__(self, name, rules, language):
""" .ctor
Args:
name (string): variable name
rules (string): rules string
language (Language): current language
"""
super(RulesToken, self).__init__(name)
self.rules = rules
self.language = language
TOKEN_TYPE_REGEX = '\|([^\|]{1}(.*))'
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + TOKEN_TYPE_REGEX,))
""" Compiler for rules """
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return cls(m.group(1), m.group(2), language)
def execute(self, data, options):
""" Execute token with var """
return self.language.contexts.execute(self.rules, self.fetch(data)).strip()
def find_context(self, token=None):
token = token or self.name
try:
return self.language.contexts.find_by_code(token)
except ContextNotFound:
return self.language.contexts.find_by_token_name(token)
def __str__(self):
return "RulesToken[%s, choices=%s]" % (self.name, self.rules)
class RulesMethodToken(RulesToken):
@classmethod
def validate(cls, text, language):
m = cls.IS_TOKEN.match(text)
if m:
return cls(m.group(1), m.group(2), m.group(3), language)
class CaseToken(RulesToken):
""" Language keys {name::nom} """
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + '\:\:(.*)',))
def __init__(self, name, case, language):
super(RulesToken, self).__init__(name)
self.case = language.cases.get(str(case), DummyCase())
def execute(self, data, options):
""" Execute with rules options """
return escape_if_needed(
suggest_string(self.case.execute(self.fetch(data))), options)
def __str__(self):
return "CaseToken[%s, case=%s]" % (self.name, self.case)
class | (RulesMethodToken):
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (
AbstractVariableToken.IS_VARIABLE + MethodToken.HAS_METHOD + '\:\:(.*)'))
def __init__(self, name, method_name, case, language):
self.token = MethodToken(name, method_name)
self.case = language.cases.get(str(case), DummyCase())
def execute(self, data, options):
""" Execute with rules options """
return escape_if_needed(
self.case.execute(self.token.execute(data, {'escape': False})), options)
def __str__(self):
return "CaseMethodToken[%s, case=%s]" % (self.name, self.case)
class UnsupportedCase(Error):
def __init__(self, language, case):
self.language = language
self.case = case
def __str__(self):
return 'Language does not support case %s for locale %s' % (self.case, self.language.locale)
class PipeToken(RulesToken):
"""
Token which pipe rules and join it with variable
{count||token, tokens}: count = 1 -> 1 token
count = 100 -> 100 tokens
works like {name||rules} == {name} {name|rules}
"""
IS_TOKEN = re.compile(AbstractVariableToken.REGEXP_TOKEN % (AbstractVariableToken.IS_VARIABLE + '\|\|(.*)',))
def __init__(self, name, rules, language):
self.token = VariableToken(name)
self.rules = RulesToken(name, rules, language | CaseMethodToken | identifier_name |
FindPoints.py | point[1]<150:
continue
if point[0]>(height-150):
continue
if point[1]>(width-150):
continue
temp_centers.append(point)
min_distance = 300
cgroup = []
## Average centers that are to close together.
for tcenter in temp_centers:
for tcenter2 in temp_centers:
if tcenter==tcenter2: continue
dist = distance(tcenter, tcenter2)
if dist<min_distance:
cgroup = [tcenter, tcenter2]
min_distance = dist
if cgroup==[]:
for tcenter in temp_centers:
centers.append(tcenter)
else:
ncenter = findCentre(cgroup)
centers.append(ncenter)
for tcenter in temp_centers:
if tcenter not in cgroup:
centers.append(tcenter)
else:
centers.append(center)
return centers
def groupCentres(centres):
groups = []
for i in range(len(centres)):
temp_group = [centres[i]]
for j in range(i, len(centres)):
if i==j:
continue
temp_group.append(centres[j])
n = len(temp_group)
if n<3: continue
if n>10: continue
temp_group = orderGroup(temp_group)
gheight, gwidth = dimension_of_group(temp_group, "dimension")
if len(temp_group)!=n: continue
if gheight>1300: continue
if gwidth>2300: continue
groups.append(orderGroup(temp_group))
return groups
def closestGroupSignature(groups, signature, radius):
number_of_matches = 0
bestgroup = []
i = 1
j = 0
for group in groups:
psignature = overlaySignature(signature, group)
match = []
for point in psignature.values():
for centre in group:
if centre[0]<(point[0]+radius) and centre[0]>(point[0]-radius) and centre[1]<(point[1]+radius) and centre[1]>(point[1]-radius):
match.append(centre)
continue
matches = len(match)
if number_of_matches<matches:
bestgroup = group
j = i
number_of_matches = matches
i += 1
return bestgroup
def getPointdiff(point1, point2):
return point1[0]-point2[0], point1[1]-point2[1]
def dimension_of_group(group, return_value="centre"):
max_y = max(group, key=lambda x: x[0])[0]
min_y = min(group, key=lambda x: x[0])[0]
max_x = max(group, key=lambda x: x[1])[1]
min_x = min(group, key=lambda x: x[1])[1]
if return_value=="centre" or return_value=="center":
return [(max_y-min_y)/2+min_y, (max_x-min_x)/2+min_x]
if return_value=="rectangle":
return [[min_y, min_x], [min_y, max_x], [max_y, min_x], [max_y, max_x]]
if return_value=="dimension":
width = distance([min_y, min_x], [min_y, max_x])
height = distance([min_y, min_x], [max_y, min_x])
return height, width
if return_value=="area":
width = distance([min_y, min_x], [min_y, max_x])
height = distance([min_y, min_x], [max_y, min_x])
return width*height
return max_y, min_y, max_x, min_x
def overlaySignature(signature, group):
centre = dimension_of_group(group, "centre")
sign_height, sign_width = dimension_of_group(signature.values(), "dimension")
sign_height = int(sign_height/2)
sign_width = int(sign_width/2)
if (centre[0]-sign_height)<0:
print "Above"
centre[0] += abs(centre[0]-sign_height)+dim/2
if (centre[0]+sign_height)>height:
print "Below"
centre[0] -= abs(height-(centre[0]+sign_height))+dim/2
if (centre[1]-sign_width)<0:
print "Left"
centre[1] += abs(centre[1]-sign_width)+dim/2
if (centre[1]+sign_width)>width:
print "Right"
centre[1] -= abs(width-(centre[1]+sign_width))+dim/2
diff_y, diff_x = getPointdiff(signature['0'], centre)
for point in signature:
if point=='0':
signature['0'] = centre
continue
signature[point] = [signature[point][0]-diff_y, signature[point][1]-diff_x]
return signature
def splitGroup(group):
max_y = max(group, key=lambda x: x[0])[0]
min_y = min(group, key=lambda x: x[0])[0]
max_x = max(group, key=lambda x: x[1])[1]
min_x = min(group, key=lambda x: x[1])[1]
abovecentres = []
belowcentres = []
group = sorted(group, key=lambda x: x[1])
for centre in group:
if abs(centre[0]-max_y)<abs(centre[0]-min_y):
belowcentres.append(centre)
if abs(centre[0]-max_y)>abs(centre[0]-min_y):
abovecentres.append(centre)
b_median = belowcentres[len(belowcentres)/2][0]
a_median = abovecentres[len(abovecentres)/2][0]
belowcentres = filter(lambda x: x[0]<(b_median+400) and x[0]>(b_median-400), belowcentres)
abovecentres = filter(lambda x: x[0]<(a_median+400) and x[0]>(a_median-400), abovecentres)
return abovecentres, belowcentres
def orderGroup(group):
abovecentres, belowcentres = splitGroup(group)
return abovecentres+belowcentres
def control_edge(point, cheight, cwidth):
left = (point[1]-(cwidth/2))
right = (point[1]+(cwidth/2))
top = (point[0]-(cheight/2))
bottom = (point[0]+(cheight/2))
if left<0:
diff = 0-left
left += diff+1
right += diff+1
if right>width:
diff = width-right
left += diff-1
right += diff-1
if top<0:
diff = 0-top
top += diff+1
bottom += diff+1
if bottom>height:
diff = height-bottom
top += diff-1
bottom += diff-1
return top, bottom, left, right
def local_Kmeans(mask, k=1):
blackpixels = np.where(mask==0)
blackpixels = np.matrix(blackpixels)
if len(blackpixels)==0: return [200, 200]
centers = kmeans(blackpixels.T.astype(float), k, iter=20, thresh=1e-08)[0].astype(int)
return centers
def local_center_of_mass(mask):
blackpixels = np.where(mask==0)
blackpixels = np.matrix(blackpixels)
center = np.squeeze(np.asarray(blackpixels.mean(axis=1).astype(int).flatten('C')))
return center
def claim_region(mask, top, bottom, left, right):
mask[top:bottom, left:right] = 255
def testRadius(signature, group, radius, mask, dim):
new_group = []
del signature['0']
for point in signature.values():
match = []
for centre in group:
if centre[0]<(point[0]+radius) and centre[0]>(point[0]-radius) and centre[1]<(point[1]+radius) and centre[1]>(point[1]-radius):
if match==[]:
match = centre
if distance(match, point)>distance(centre, point):
|
if match==[]:
#new_group.append(point)
top, bottom, left, right = control_edge(point, dim, dim)
try:
npoint = local_Kmeans(mask[top:bottom,left:right])[0]
npoint = local_center_of_mass(mask[top:bottom,left:right])
except:
new_group.append(point)
continue
diff_x, diff_y = npoint[0]-(dim/2), npoint[1]-(dim/2)
claim_region(mask, top, bottom, left, right)
new_group.append([point[0]+diff_x, point[1]+diff_y])
else:
top, bottom, left, right = control_edge(point, dim, dim)
claim_region(mask, top, bottom, left, | match = centre | conditional_block |
FindPoints.py | <min_distance:
cgroup = [tcenter, tcenter2]
min_distance = dist
if cgroup==[]:
for tcenter in temp_centers:
centers.append(tcenter)
else:
ncenter = findCentre(cgroup)
centers.append(ncenter)
for tcenter in temp_centers:
if tcenter not in cgroup:
centers.append(tcenter)
else:
centers.append(center)
return centers
def groupCentres(centres):
groups = []
for i in range(len(centres)):
temp_group = [centres[i]]
for j in range(i, len(centres)):
if i==j:
continue
temp_group.append(centres[j])
n = len(temp_group)
if n<3: continue
if n>10: continue
temp_group = orderGroup(temp_group)
gheight, gwidth = dimension_of_group(temp_group, "dimension")
if len(temp_group)!=n: continue
if gheight>1300: continue
if gwidth>2300: continue
groups.append(orderGroup(temp_group))
return groups
def closestGroupSignature(groups, signature, radius):
number_of_matches = 0
bestgroup = []
i = 1
j = 0
for group in groups:
psignature = overlaySignature(signature, group)
match = []
for point in psignature.values():
for centre in group:
if centre[0]<(point[0]+radius) and centre[0]>(point[0]-radius) and centre[1]<(point[1]+radius) and centre[1]>(point[1]-radius):
match.append(centre)
continue
matches = len(match)
if number_of_matches<matches:
bestgroup = group
j = i
number_of_matches = matches
i += 1
return bestgroup
def getPointdiff(point1, point2):
return point1[0]-point2[0], point1[1]-point2[1]
def dimension_of_group(group, return_value="centre"):
max_y = max(group, key=lambda x: x[0])[0]
min_y = min(group, key=lambda x: x[0])[0]
max_x = max(group, key=lambda x: x[1])[1]
min_x = min(group, key=lambda x: x[1])[1]
if return_value=="centre" or return_value=="center":
return [(max_y-min_y)/2+min_y, (max_x-min_x)/2+min_x]
if return_value=="rectangle":
return [[min_y, min_x], [min_y, max_x], [max_y, min_x], [max_y, max_x]]
if return_value=="dimension":
width = distance([min_y, min_x], [min_y, max_x])
height = distance([min_y, min_x], [max_y, min_x])
return height, width
if return_value=="area":
width = distance([min_y, min_x], [min_y, max_x])
height = distance([min_y, min_x], [max_y, min_x])
return width*height
return max_y, min_y, max_x, min_x
def overlaySignature(signature, group):
centre = dimension_of_group(group, "centre")
sign_height, sign_width = dimension_of_group(signature.values(), "dimension")
sign_height = int(sign_height/2)
sign_width = int(sign_width/2)
if (centre[0]-sign_height)<0:
print "Above"
centre[0] += abs(centre[0]-sign_height)+dim/2
if (centre[0]+sign_height)>height:
print "Below"
centre[0] -= abs(height-(centre[0]+sign_height))+dim/2
if (centre[1]-sign_width)<0:
print "Left"
centre[1] += abs(centre[1]-sign_width)+dim/2
if (centre[1]+sign_width)>width:
print "Right"
centre[1] -= abs(width-(centre[1]+sign_width))+dim/2
diff_y, diff_x = getPointdiff(signature['0'], centre)
for point in signature:
if point=='0':
signature['0'] = centre
continue
signature[point] = [signature[point][0]-diff_y, signature[point][1]-diff_x]
return signature
def splitGroup(group):
max_y = max(group, key=lambda x: x[0])[0]
min_y = min(group, key=lambda x: x[0])[0]
max_x = max(group, key=lambda x: x[1])[1]
min_x = min(group, key=lambda x: x[1])[1]
abovecentres = []
belowcentres = []
group = sorted(group, key=lambda x: x[1])
for centre in group:
if abs(centre[0]-max_y)<abs(centre[0]-min_y):
belowcentres.append(centre)
if abs(centre[0]-max_y)>abs(centre[0]-min_y):
abovecentres.append(centre)
b_median = belowcentres[len(belowcentres)/2][0]
a_median = abovecentres[len(abovecentres)/2][0]
belowcentres = filter(lambda x: x[0]<(b_median+400) and x[0]>(b_median-400), belowcentres)
abovecentres = filter(lambda x: x[0]<(a_median+400) and x[0]>(a_median-400), abovecentres)
return abovecentres, belowcentres
def orderGroup(group):
abovecentres, belowcentres = splitGroup(group)
return abovecentres+belowcentres
def control_edge(point, cheight, cwidth):
left = (point[1]-(cwidth/2))
right = (point[1]+(cwidth/2))
top = (point[0]-(cheight/2))
bottom = (point[0]+(cheight/2))
if left<0:
diff = 0-left
left += diff+1
right += diff+1
if right>width:
diff = width-right
left += diff-1
right += diff-1
if top<0:
diff = 0-top
top += diff+1
bottom += diff+1
if bottom>height:
diff = height-bottom
top += diff-1
bottom += diff-1
return top, bottom, left, right
def local_Kmeans(mask, k=1):
blackpixels = np.where(mask==0)
blackpixels = np.matrix(blackpixels)
if len(blackpixels)==0: return [200, 200]
centers = kmeans(blackpixels.T.astype(float), k, iter=20, thresh=1e-08)[0].astype(int)
return centers
def local_center_of_mass(mask):
blackpixels = np.where(mask==0)
blackpixels = np.matrix(blackpixels)
center = np.squeeze(np.asarray(blackpixels.mean(axis=1).astype(int).flatten('C')))
return center
def claim_region(mask, top, bottom, left, right):
mask[top:bottom, left:right] = 255
def testRadius(signature, group, radius, mask, dim):
new_group = []
del signature['0']
for point in signature.values():
match = []
for centre in group:
if centre[0]<(point[0]+radius) and centre[0]>(point[0]-radius) and centre[1]<(point[1]+radius) and centre[1]>(point[1]-radius):
if match==[]:
match = centre
if distance(match, point)>distance(centre, point):
match = centre
if match==[]:
#new_group.append(point)
top, bottom, left, right = control_edge(point, dim, dim)
try:
npoint = local_Kmeans(mask[top:bottom,left:right])[0]
npoint = local_center_of_mass(mask[top:bottom,left:right])
except:
new_group.append(point)
continue
diff_x, diff_y = npoint[0]-(dim/2), npoint[1]-(dim/2)
claim_region(mask, top, bottom, left, right)
new_group.append([point[0]+diff_x, point[1]+diff_y])
else:
top, bottom, left, right = control_edge(point, dim, dim)
claim_region(mask, top, bottom, left, right)
new_group.append(match)
return new_group
def test_content(img, point, dim):
#print img.shape
| top, bottom, left, right = control_edge(point, dim, dim)
img = img[top:bottom,left:right]
labmask = LABMaskImage(img)
hsvmask = HSVMaskImage(img)
mask = combinemasks(labmask, hsvmask)
blackpixels = np.where(mask==0)
blackpixels = np.matrix(blackpixels)
return blackpixels.shape[1] | identifier_body | |
FindPoints.py | (filename, mask, potsize=500):
f = open(filename)
centers = []
for line in f:
info = line.split(" ")[2:]
center = info[2]
center = center.split(",")
center[0] = int(round(float(center[0])))
center[1] = int(round(float(center[1])))
center = center[::-1]
if center[0]<150 or center[1]<150:
print "Centre on the edge, and will therefore be removed"
continue
if center[1]>(width-150) or center[0]>(height-150):
print "Centre on the edge, and will therefore be removed"
continue
size = [int(i) for i in info[1].split("+")[0].split("x")]
if size[0]>potsize:
#centers.append(center)
print "WARNING: Cluster size too big, potential merge of pots detected"
print "Employing K-means on the merged blob to find the pots"
c = (size[0]//potsize)+1
top, bottom, left, right = control_edge(center, potsize, size[0]+100)
npoint = local_Kmeans(mask[top:bottom,left:right], c)
temp_centers = []
for point in npoint:
diff_x, diff_y = point[0]-int(potsize/2), point[1]-int((size[0]+100)/2)
point = [center[0]+diff_x, center[1]+diff_y]
if point[0]<150:
continue
if point[1]<150:
continue
if point[0]>(height-150):
continue
if point[1]>(width-150):
continue
temp_centers.append(point)
min_distance = 300
cgroup = []
## Average centers that are to close together.
for tcenter in temp_centers:
for tcenter2 in temp_centers:
if tcenter==tcenter2: continue
dist = distance(tcenter, tcenter2)
if dist<min_distance:
cgroup = [tcenter, tcenter2]
min_distance = dist
if cgroup==[]:
for tcenter in temp_centers:
centers.append(tcenter)
else:
ncenter = findCentre(cgroup)
centers.append(ncenter)
for tcenter in temp_centers:
if tcenter not in cgroup:
centers.append(tcenter)
else:
centers.append(center)
return centers
def groupCentres(centres):
groups = []
for i in range(len(centres)):
temp_group = [centres[i]]
for j in range(i, len(centres)):
if i==j:
continue
temp_group.append(centres[j])
n = len(temp_group)
if n<3: continue
if n>10: continue
temp_group = orderGroup(temp_group)
gheight, gwidth = dimension_of_group(temp_group, "dimension")
if len(temp_group)!=n: continue
if gheight>1300: continue
if gwidth>2300: continue
groups.append(orderGroup(temp_group))
return groups
def closestGroupSignature(groups, signature, radius):
number_of_matches = 0
bestgroup = []
i = 1
j = 0
for group in groups:
psignature = overlaySignature(signature, group)
match = []
for point in psignature.values():
for centre in group:
if centre[0]<(point[0]+radius) and centre[0]>(point[0]-radius) and centre[1]<(point[1]+radius) and centre[1]>(point[1]-radius):
match.append(centre)
continue
matches = len(match)
if number_of_matches<matches:
bestgroup = group
j = i
number_of_matches = matches
i += 1
return bestgroup
def getPointdiff(point1, point2):
return point1[0]-point2[0], point1[1]-point2[1]
def dimension_of_group(group, return_value="centre"):
max_y = max(group, key=lambda x: x[0])[0]
min_y = min(group, key=lambda x: x[0])[0]
max_x = max(group, key=lambda x: x[1])[1]
min_x = min(group, key=lambda x: x[1])[1]
if return_value=="centre" or return_value=="center":
return [(max_y-min_y)/2+min_y, (max_x-min_x)/2+min_x]
if return_value=="rectangle":
return [[min_y, min_x], [min_y, max_x], [max_y, min_x], [max_y, max_x]]
if return_value=="dimension":
width = distance([min_y, min_x], [min_y, max_x])
height = distance([min_y, min_x], [max_y, min_x])
return height, width
if return_value=="area":
width = distance([min_y, min_x], [min_y, max_x])
height = distance([min_y, min_x], [max_y, min_x])
return width*height
return max_y, min_y, max_x, min_x
def overlaySignature(signature, group):
centre = dimension_of_group(group, "centre")
sign_height, sign_width = dimension_of_group(signature.values(), "dimension")
sign_height = int(sign_height/2)
sign_width = int(sign_width/2)
if (centre[0]-sign_height)<0:
print "Above"
centre[0] += abs(centre[0]-sign_height)+dim/2
if (centre[0]+sign_height)>height:
print "Below"
centre[0] -= abs(height-(centre[0]+sign_height))+dim/2
if (centre[1]-sign_width)<0:
print "Left"
centre[1] += abs(centre[1]-sign_width)+dim/2
if (centre[1]+sign_width)>width:
print "Right"
centre[1] -= abs(width-(centre[1]+sign_width))+dim/2
diff_y, diff_x = getPointdiff(signature['0'], centre)
for point in signature:
if point=='0':
signature['0'] = centre
continue
signature[point] = [signature[point][0]-diff_y, signature[point][1]-diff_x]
return signature
def splitGroup(group):
max_y = max(group, key=lambda x: x[0])[0]
min_y = min(group, key=lambda x: x[0])[0]
max_x = max(group, key=lambda x: x[1])[1]
min_x = min(group, key=lambda x: x[1])[1]
abovecentres = []
belowcentres = []
group = sorted(group, key=lambda x: x[1])
for centre in group:
if abs(centre[0]-max_y)<abs(centre[0]-min_y):
belowcentres.append(centre)
if abs(centre[0]-max_y)>abs(centre[0]-min_y):
abovecentres.append(centre)
b_median = belowcentres[len(belowcentres)/2][0]
a_median = abovecentres[len(abovecentres)/2][0]
belowcentres = filter(lambda x: x[0]<(b_median+400) and x[0]>(b_median-400), belowcentres)
abovecentres = filter(lambda x: x[0]<(a_median+400) and x[0]>(a_median-400), abovecentres)
return abovecentres, belowcentres
def orderGroup(group):
abovecentres, belowcentres = splitGroup(group)
return abovecentres+belowcentres
def control_edge(point, cheight, cwidth):
left = (point[1]-(cwidth/2))
right = (point[1]+(cwidth/2))
top = (point[0]-(cheight/2))
bottom = (point[0]+(cheight/2))
if left<0:
diff = 0-left
left += diff+1
right += diff+1
if right>width:
diff = width-right
left += diff-1
right += diff-1
if top<0:
diff = 0-top
top += diff+1
bottom += diff+1
if bottom>height:
diff = height-bottom
top += diff-1
bottom += diff-1
return top, bottom, left, right
def local_Kmeans(mask, k=1):
blackpixels = np.where(mask==0)
blackpixels = np.matrix(blackpixels)
if len(blackpixels)==0: return [200, 200]
centers = kmeans(blackpixels.T.astype(float), k, iter=20, thresh=1e-08)[0].astype(int)
return centers
| loadcenters | identifier_name | |
FindPoints.py | center = info[2]
center = center.split(",")
center[0] = int(round(float(center[0])))
center[1] = int(round(float(center[1])))
center = center[::-1]
if center[0]<150 or center[1]<150:
print "Centre on the edge, and will therefore be removed"
continue
if center[1]>(width-150) or center[0]>(height-150):
print "Centre on the edge, and will therefore be removed"
continue
size = [int(i) for i in info[1].split("+")[0].split("x")]
if size[0]>potsize:
#centers.append(center)
print "WARNING: Cluster size too big, potential merge of pots detected"
print "Employing K-means on the merged blob to find the pots"
c = (size[0]//potsize)+1
top, bottom, left, right = control_edge(center, potsize, size[0]+100)
npoint = local_Kmeans(mask[top:bottom,left:right], c)
temp_centers = []
for point in npoint:
diff_x, diff_y = point[0]-int(potsize/2), point[1]-int((size[0]+100)/2)
point = [center[0]+diff_x, center[1]+diff_y]
if point[0]<150:
continue
if point[1]<150:
continue
if point[0]>(height-150):
continue
if point[1]>(width-150):
continue
temp_centers.append(point)
min_distance = 300
cgroup = []
## Average centers that are to close together.
for tcenter in temp_centers:
for tcenter2 in temp_centers:
if tcenter==tcenter2: continue
dist = distance(tcenter, tcenter2)
if dist<min_distance:
cgroup = [tcenter, tcenter2]
min_distance = dist
if cgroup==[]:
for tcenter in temp_centers:
centers.append(tcenter)
else:
ncenter = findCentre(cgroup)
centers.append(ncenter)
for tcenter in temp_centers:
if tcenter not in cgroup:
centers.append(tcenter)
else:
centers.append(center)
return centers
def groupCentres(centres):
groups = []
for i in range(len(centres)):
temp_group = [centres[i]]
for j in range(i, len(centres)):
if i==j:
continue
temp_group.append(centres[j])
n = len(temp_group)
if n<3: continue
if n>10: continue
temp_group = orderGroup(temp_group)
gheight, gwidth = dimension_of_group(temp_group, "dimension")
if len(temp_group)!=n: continue
if gheight>1300: continue
if gwidth>2300: continue
groups.append(orderGroup(temp_group))
return groups
def closestGroupSignature(groups, signature, radius):
number_of_matches = 0
bestgroup = []
i = 1
j = 0
for group in groups:
psignature = overlaySignature(signature, group)
match = []
for point in psignature.values():
for centre in group:
if centre[0]<(point[0]+radius) and centre[0]>(point[0]-radius) and centre[1]<(point[1]+radius) and centre[1]>(point[1]-radius):
match.append(centre)
continue
matches = len(match)
if number_of_matches<matches:
bestgroup = group
j = i
number_of_matches = matches
i += 1
return bestgroup
def getPointdiff(point1, point2):
return point1[0]-point2[0], point1[1]-point2[1]
def dimension_of_group(group, return_value="centre"):
max_y = max(group, key=lambda x: x[0])[0]
min_y = min(group, key=lambda x: x[0])[0]
max_x = max(group, key=lambda x: x[1])[1]
min_x = min(group, key=lambda x: x[1])[1]
if return_value=="centre" or return_value=="center":
return [(max_y-min_y)/2+min_y, (max_x-min_x)/2+min_x]
if return_value=="rectangle":
return [[min_y, min_x], [min_y, max_x], [max_y, min_x], [max_y, max_x]]
if return_value=="dimension":
width = distance([min_y, min_x], [min_y, max_x])
height = distance([min_y, min_x], [max_y, min_x])
return height, width
if return_value=="area":
width = distance([min_y, min_x], [min_y, max_x])
height = distance([min_y, min_x], [max_y, min_x])
return width*height
return max_y, min_y, max_x, min_x
def overlaySignature(signature, group):
centre = dimension_of_group(group, "centre")
sign_height, sign_width = dimension_of_group(signature.values(), "dimension")
sign_height = int(sign_height/2)
sign_width = int(sign_width/2)
if (centre[0]-sign_height)<0:
print "Above"
centre[0] += abs(centre[0]-sign_height)+dim/2
if (centre[0]+sign_height)>height:
print "Below"
centre[0] -= abs(height-(centre[0]+sign_height))+dim/2
if (centre[1]-sign_width)<0:
print "Left"
centre[1] += abs(centre[1]-sign_width)+dim/2
if (centre[1]+sign_width)>width:
print "Right"
centre[1] -= abs(width-(centre[1]+sign_width))+dim/2
diff_y, diff_x = getPointdiff(signature['0'], centre)
for point in signature:
if point=='0':
signature['0'] = centre
continue
signature[point] = [signature[point][0]-diff_y, signature[point][1]-diff_x]
return signature
def splitGroup(group):
max_y = max(group, key=lambda x: x[0])[0]
min_y = min(group, key=lambda x: x[0])[0]
max_x = max(group, key=lambda x: x[1])[1]
min_x = min(group, key=lambda x: x[1])[1]
abovecentres = []
belowcentres = []
group = sorted(group, key=lambda x: x[1])
for centre in group:
if abs(centre[0]-max_y)<abs(centre[0]-min_y):
belowcentres.append(centre)
if abs(centre[0]-max_y)>abs(centre[0]-min_y):
abovecentres.append(centre)
b_median = belowcentres[len(belowcentres)/2][0]
a_median = abovecentres[len(abovecentres)/2][0]
belowcentres = filter(lambda x: x[0]<(b_median+400) and x[0]>(b_median-400), belowcentres)
abovecentres = filter(lambda x: x[0]<(a_median+400) and x[0]>(a_median-400), abovecentres)
return abovecentres, belowcentres
def orderGroup(group):
abovecentres, belowcentres = splitGroup(group)
return abovecentres+belowcentres
def control_edge(point, cheight, cwidth):
left = (point[1]-(cwidth/2))
right = (point[1]+(cwidth/2))
top = (point[0]-(cheight/2))
bottom = (point[0]+(cheight/2))
if left<0:
diff = 0-left
left += diff+1
right += diff+1
if right>width:
diff = width-right
left += diff-1
right += diff-1
if top<0:
diff = 0-top
top += diff+1
bottom += diff+1
if bottom>height:
diff = height-bottom
top += diff-1
bottom += diff-1
return top, bottom, left, right
def local_Kmeans(mask, k=1):
blackpixels = np.where(mask==0)
blackpixels = np.matrix(blackpixels)
if len(blackpixels)==0: return [200, 200]
centers = kmeans(blackpixels.T.astype(float), k, iter=20, thresh=1e-08)[0].astype(int)
return centers
def local_center_of_mass(mask):
blackpixels = np.where(mask==0)
black | centers = []
for line in f:
info = line.split(" ")[2:] | random_line_split | |
provider_validation.go | _, pc := range mod.ProviderConfigs {
name := providerName(pc.Name, pc.Alias)
// Validate the config against an empty schema to see if it's empty.
_, pcConfigDiags := pc.Config.Content(&hcl.BodySchema{})
if pcConfigDiags.HasErrors() || pc.Version.Required != nil {
configured[name] = pc.DeclRange
} else {
emptyConfigs[name] = pc.DeclRange
}
}
if mod.ProviderRequirements != nil {
for _, req := range mod.ProviderRequirements.RequiredProviders {
localNames[req.Name] = req.Type
for _, alias := range req.Aliases {
addr := addrs.AbsProviderConfig{
Module: cfg.Path,
Provider: req.Type,
Alias: alias.Alias,
}
configAliases[providerName(alias.LocalName, alias.Alias)] = addr
}
}
}
// collect providers passed from the parent
if parentCall != nil {
for _, passed := range parentCall.Providers {
name := providerName(passed.InChild.Name, passed.InChild.Alias)
passedIn[name] = passed
}
}
parentModuleText := "the root module"
moduleText := "the root module"
if !cfg.Path.IsRoot() {
moduleText = cfg.Path.String()
if parent := cfg.Path.Parent(); !parent.IsRoot() {
// module address are prefixed with `module.`
parentModuleText = parent.String()
}
}
// Verify that any module calls only refer to named providers, and that
// those providers will have a configuration at runtime. This way we can
// direct users where to add the missing configuration, because the runtime
// error is only "missing provider X".
for _, modCall := range mod.ModuleCalls {
for _, passed := range modCall.Providers {
// aliased providers are handled more strictly, and are never
// inherited, so they are validated within modules further down.
// Skip these checks to prevent redundant diagnostics.
if passed.InParent.Alias != "" {
continue
}
name := passed.InParent.String()
_, confOK := configured[name]
_, localOK := localNames[name]
_, passedOK := passedIn[name]
// This name was not declared somewhere within in the
// configuration. We ignore empty configs, because they will
// already produce a warning.
if !(confOK || localOK) {
defAddr := addrs.NewDefaultProvider(name)
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Reference to undefined provider",
Detail: fmt.Sprintf(
"There is no explicit declaration for local provider name %q in %s, so Terraform is assuming you mean to pass a configuration for provider %q.\n\nTo clarify your intent and silence this warning, add to %s a required_providers entry named %q with source = %q, or a different source address if appropriate.",
name, moduleText, defAddr.ForDisplay(),
parentModuleText, name, defAddr.ForDisplay(),
),
Subject: &passed.InParent.NameRange,
})
continue
}
// Now we may have named this provider within the module, but
// there won't be a configuration available at runtime if the
// parent module did not pass one in.
if !cfg.Path.IsRoot() && !(confOK || passedOK) {
defAddr := addrs.NewDefaultProvider(name)
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Missing required provider configuration",
Detail: fmt.Sprintf(
"The configuration for %s expects to inherit a configuration for provider %s with local name %q, but %s doesn't pass a configuration under that name.\n\nTo satisfy this requirement, add an entry for %q to the \"providers\" argument in the module %q block.",
moduleText, defAddr.ForDisplay(), name, parentModuleText,
name, parentCall.Name,
),
Subject: parentCall.DeclRange.Ptr(),
})
}
}
}
if cfg.Path.IsRoot() {
// nothing else to do in the root module
return diags
}
// there cannot be any configurations if no provider config is allowed
if len(configured) > 0 && noProviderConfigRange != nil {
// We report this from the perspective of the use of count, for_each,
// or depends_on rather than from inside the module, because the
// recipient of this message is more likely to be the author of the
// calling module (trying to use an older module that hasn't been
// updated yet) than of the called module.
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Module is incompatible with count, for_each, and depends_on",
Detail: fmt.Sprintf(
"The module at %s is a legacy module which contains its own local provider configurations, and so calls to it may not use the count, for_each, or depends_on arguments.\n\nIf you also control the module %q, consider updating this module to instead expect provider configurations to be passed by its caller.",
cfg.Path, cfg.SourceAddr,
),
Subject: noProviderConfigRange,
})
}
// now check that the user is not attempting to override a config
for name := range configured {
if passed, ok := passedIn[name]; ok {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Cannot override provider configuration",
Detail: fmt.Sprintf(
"The configuration of %s has its own local configuration for %s, and so it cannot accept an overridden configuration provided by %s.",
moduleText, name, parentModuleText,
),
Subject: &passed.InChild.NameRange,
})
}
}
// A declared alias requires either a matching configuration within the
// module, or one must be passed in.
for name, providerAddr := range configAliases {
_, confOk := configured[name]
_, passedOk := passedIn[name]
if confOk || passedOk {
continue
}
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Missing required provider configuration",
Detail: fmt.Sprintf(
"The child module requires an additional configuration for provider %s, with the local name %q.\n\nRefer to the module's documentation to understand the intended purpose of this additional provider configuration, and then add an entry for %s in the \"providers\" meta-argument in the module block to choose which provider configuration the module should use for that purpose.",
providerAddr.Provider.ForDisplay(), name,
name,
),
Subject: &parentCall.DeclRange,
})
}
// You cannot pass in a provider that cannot be used
for name, passed := range passedIn {
childTy := passed.InChild.providerType
// get a default type if there was none set
if childTy.IsZero() {
// This means the child module is only using an inferred
// provider type. We allow this but will generate a warning to
// declare provider_requirements below.
childTy = addrs.NewDefaultProvider(passed.InChild.Name)
}
providerAddr := addrs.AbsProviderConfig{
Module: cfg.Path,
Provider: childTy,
Alias: passed.InChild.Alias,
}
localAddr, localName := localNames[name]
if localName {
providerAddr.Provider = localAddr
}
aliasAddr, configAlias := configAliases[name]
if configAlias {
providerAddr = aliasAddr
}
| if !(localName || configAlias || emptyConfig) {
// we still allow default configs, so switch to a warning if the incoming provider is a default
if providerAddr.Provider.IsDefault() {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Reference to undefined provider",
Detail: fmt.Sprintf(
"There is no explicit declaration for local provider name %q in %s, so Terraform is assuming you mean to pass a configuration for %q.\n\nIf you also control the child module, add a required_providers entry named %q with the source address %q.",
name, moduleText, providerAddr.Provider.ForDisplay(),
name, providerAddr.Provider.ForDisplay(),
),
Subject: &passed.InChild.NameRange,
})
} else {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Reference to undefined provider",
Detail: fmt.Sprintf(
"The child module does not declare any provider requirement with the local name %q.\n\nIf you also control the child | _, emptyConfig := emptyConfigs[name]
| random_line_split |
provider_validation.go | // those providers will have a configuration at runtime. This way we can
// direct users where to add the missing configuration, because the runtime
// error is only "missing provider X".
for _, modCall := range mod.ModuleCalls {
for _, passed := range modCall.Providers {
// aliased providers are handled more strictly, and are never
// inherited, so they are validated within modules further down.
// Skip these checks to prevent redundant diagnostics.
if passed.InParent.Alias != "" {
continue
}
name := passed.InParent.String()
_, confOK := configured[name]
_, localOK := localNames[name]
_, passedOK := passedIn[name]
// This name was not declared somewhere within in the
// configuration. We ignore empty configs, because they will
// already produce a warning.
if !(confOK || localOK) {
defAddr := addrs.NewDefaultProvider(name)
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Reference to undefined provider",
Detail: fmt.Sprintf(
"There is no explicit declaration for local provider name %q in %s, so Terraform is assuming you mean to pass a configuration for provider %q.\n\nTo clarify your intent and silence this warning, add to %s a required_providers entry named %q with source = %q, or a different source address if appropriate.",
name, moduleText, defAddr.ForDisplay(),
parentModuleText, name, defAddr.ForDisplay(),
),
Subject: &passed.InParent.NameRange,
})
continue
}
// Now we may have named this provider within the module, but
// there won't be a configuration available at runtime if the
// parent module did not pass one in.
if !cfg.Path.IsRoot() && !(confOK || passedOK) {
defAddr := addrs.NewDefaultProvider(name)
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Missing required provider configuration",
Detail: fmt.Sprintf(
"The configuration for %s expects to inherit a configuration for provider %s with local name %q, but %s doesn't pass a configuration under that name.\n\nTo satisfy this requirement, add an entry for %q to the \"providers\" argument in the module %q block.",
moduleText, defAddr.ForDisplay(), name, parentModuleText,
name, parentCall.Name,
),
Subject: parentCall.DeclRange.Ptr(),
})
}
}
}
if cfg.Path.IsRoot() {
// nothing else to do in the root module
return diags
}
// there cannot be any configurations if no provider config is allowed
if len(configured) > 0 && noProviderConfigRange != nil {
// We report this from the perspective of the use of count, for_each,
// or depends_on rather than from inside the module, because the
// recipient of this message is more likely to be the author of the
// calling module (trying to use an older module that hasn't been
// updated yet) than of the called module.
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Module is incompatible with count, for_each, and depends_on",
Detail: fmt.Sprintf(
"The module at %s is a legacy module which contains its own local provider configurations, and so calls to it may not use the count, for_each, or depends_on arguments.\n\nIf you also control the module %q, consider updating this module to instead expect provider configurations to be passed by its caller.",
cfg.Path, cfg.SourceAddr,
),
Subject: noProviderConfigRange,
})
}
// now check that the user is not attempting to override a config
for name := range configured {
if passed, ok := passedIn[name]; ok {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Cannot override provider configuration",
Detail: fmt.Sprintf(
"The configuration of %s has its own local configuration for %s, and so it cannot accept an overridden configuration provided by %s.",
moduleText, name, parentModuleText,
),
Subject: &passed.InChild.NameRange,
})
}
}
// A declared alias requires either a matching configuration within the
// module, or one must be passed in.
for name, providerAddr := range configAliases {
_, confOk := configured[name]
_, passedOk := passedIn[name]
if confOk || passedOk {
continue
}
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Missing required provider configuration",
Detail: fmt.Sprintf(
"The child module requires an additional configuration for provider %s, with the local name %q.\n\nRefer to the module's documentation to understand the intended purpose of this additional provider configuration, and then add an entry for %s in the \"providers\" meta-argument in the module block to choose which provider configuration the module should use for that purpose.",
providerAddr.Provider.ForDisplay(), name,
name,
),
Subject: &parentCall.DeclRange,
})
}
// You cannot pass in a provider that cannot be used
for name, passed := range passedIn {
childTy := passed.InChild.providerType
// get a default type if there was none set
if childTy.IsZero() {
// This means the child module is only using an inferred
// provider type. We allow this but will generate a warning to
// declare provider_requirements below.
childTy = addrs.NewDefaultProvider(passed.InChild.Name)
}
providerAddr := addrs.AbsProviderConfig{
Module: cfg.Path,
Provider: childTy,
Alias: passed.InChild.Alias,
}
localAddr, localName := localNames[name]
if localName {
providerAddr.Provider = localAddr
}
aliasAddr, configAlias := configAliases[name]
if configAlias {
providerAddr = aliasAddr
}
_, emptyConfig := emptyConfigs[name]
if !(localName || configAlias || emptyConfig) {
// we still allow default configs, so switch to a warning if the incoming provider is a default
if providerAddr.Provider.IsDefault() {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Reference to undefined provider",
Detail: fmt.Sprintf(
"There is no explicit declaration for local provider name %q in %s, so Terraform is assuming you mean to pass a configuration for %q.\n\nIf you also control the child module, add a required_providers entry named %q with the source address %q.",
name, moduleText, providerAddr.Provider.ForDisplay(),
name, providerAddr.Provider.ForDisplay(),
),
Subject: &passed.InChild.NameRange,
})
} else {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Reference to undefined provider",
Detail: fmt.Sprintf(
"The child module does not declare any provider requirement with the local name %q.\n\nIf you also control the child module, you can add a required_providers entry named %q with the source address %q to accept this provider configuration.",
name, name, providerAddr.Provider.ForDisplay(),
),
Subject: &passed.InChild.NameRange,
})
}
}
// The provider being passed in must also be of the correct type.
pTy := passed.InParent.providerType
if pTy.IsZero() {
// While we would like to ensure required_providers exists here,
// implied default configuration is still allowed.
pTy = addrs.NewDefaultProvider(passed.InParent.Name)
}
// use the full address for a nice diagnostic output
parentAddr := addrs.AbsProviderConfig{
Module: cfg.Parent.Path,
Provider: pTy,
Alias: passed.InParent.Alias,
}
if cfg.Parent.Module.ProviderRequirements != nil {
req, defined := cfg.Parent.Module.ProviderRequirements.RequiredProviders[name]
if defined {
parentAddr.Provider = req.Type
}
}
if !providerAddr.Provider.Equals(parentAddr.Provider) {
// If this module declares the same source address for a different
// local name then we'll prefer to suggest changing to match
// the child module's chosen name, assuming that it was the local
// name that was wrong rather than the source address.
var otherLocalName string
for localName, sourceAddr := range localNames | {
if sourceAddr.Equals(parentAddr.Provider) {
otherLocalName = localName
break
}
} | conditional_block | |
provider_validation.go | providerAddr.Provider.ForDisplay(), name,
name,
),
Subject: &parentCall.DeclRange,
})
}
// You cannot pass in a provider that cannot be used
for name, passed := range passedIn {
childTy := passed.InChild.providerType
// get a default type if there was none set
if childTy.IsZero() {
// This means the child module is only using an inferred
// provider type. We allow this but will generate a warning to
// declare provider_requirements below.
childTy = addrs.NewDefaultProvider(passed.InChild.Name)
}
providerAddr := addrs.AbsProviderConfig{
Module: cfg.Path,
Provider: childTy,
Alias: passed.InChild.Alias,
}
localAddr, localName := localNames[name]
if localName {
providerAddr.Provider = localAddr
}
aliasAddr, configAlias := configAliases[name]
if configAlias {
providerAddr = aliasAddr
}
_, emptyConfig := emptyConfigs[name]
if !(localName || configAlias || emptyConfig) {
// we still allow default configs, so switch to a warning if the incoming provider is a default
if providerAddr.Provider.IsDefault() {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Reference to undefined provider",
Detail: fmt.Sprintf(
"There is no explicit declaration for local provider name %q in %s, so Terraform is assuming you mean to pass a configuration for %q.\n\nIf you also control the child module, add a required_providers entry named %q with the source address %q.",
name, moduleText, providerAddr.Provider.ForDisplay(),
name, providerAddr.Provider.ForDisplay(),
),
Subject: &passed.InChild.NameRange,
})
} else {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Reference to undefined provider",
Detail: fmt.Sprintf(
"The child module does not declare any provider requirement with the local name %q.\n\nIf you also control the child module, you can add a required_providers entry named %q with the source address %q to accept this provider configuration.",
name, name, providerAddr.Provider.ForDisplay(),
),
Subject: &passed.InChild.NameRange,
})
}
}
// The provider being passed in must also be of the correct type.
pTy := passed.InParent.providerType
if pTy.IsZero() {
// While we would like to ensure required_providers exists here,
// implied default configuration is still allowed.
pTy = addrs.NewDefaultProvider(passed.InParent.Name)
}
// use the full address for a nice diagnostic output
parentAddr := addrs.AbsProviderConfig{
Module: cfg.Parent.Path,
Provider: pTy,
Alias: passed.InParent.Alias,
}
if cfg.Parent.Module.ProviderRequirements != nil {
req, defined := cfg.Parent.Module.ProviderRequirements.RequiredProviders[name]
if defined {
parentAddr.Provider = req.Type
}
}
if !providerAddr.Provider.Equals(parentAddr.Provider) {
// If this module declares the same source address for a different
// local name then we'll prefer to suggest changing to match
// the child module's chosen name, assuming that it was the local
// name that was wrong rather than the source address.
var otherLocalName string
for localName, sourceAddr := range localNames {
if sourceAddr.Equals(parentAddr.Provider) {
otherLocalName = localName
break
}
}
const errSummary = "Provider type mismatch"
if otherLocalName != "" {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: errSummary,
Detail: fmt.Sprintf(
"The assigned configuration is for provider %q, but local name %q in %s represents %q.\n\nTo pass this configuration to the child module, use the local name %q instead.",
parentAddr.Provider.ForDisplay(), passed.InChild.Name,
parentModuleText, providerAddr.Provider.ForDisplay(),
otherLocalName,
),
Subject: &passed.InChild.NameRange,
})
} else {
// If there is no declared requirement for the provider the
// caller is trying to pass under any name then we'll instead
// report it as an unsuitable configuration to pass into the
// child module's provider configuration slot.
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: errSummary,
Detail: fmt.Sprintf(
"The local name %q in %s represents provider %q, but %q in %s represents %q.\n\nEach provider has its own distinct configuration schema and provider types, so this module's %q can be assigned only a configuration for %s, which is not required by %s.",
passed.InParent, parentModuleText, parentAddr.Provider.ForDisplay(),
passed.InChild, moduleText, providerAddr.Provider.ForDisplay(),
passed.InChild, providerAddr.Provider.ForDisplay(),
moduleText,
),
Subject: passed.InParent.NameRange.Ptr(),
})
}
}
}
// Empty configurations are no longer needed. Since the replacement for
// this calls for one entry per provider rather than one entry per
// provider _configuration_, we'll first gather them up by provider
// and then report a single warning for each, whereby we can show a direct
// example of what the replacement should look like.
type ProviderReqSuggestion struct {
SourceAddr addrs.Provider
SourceRanges []hcl.Range
RequiredConfigs []string
AliasCount int
}
providerReqSuggestions := make(map[string]*ProviderReqSuggestion)
for name, src := range emptyConfigs {
providerLocalName := name
if idx := strings.IndexByte(providerLocalName, '.'); idx >= 0 {
providerLocalName = providerLocalName[:idx]
}
sourceAddr, ok := localNames[name]
if !ok {
sourceAddr = addrs.NewDefaultProvider(providerLocalName)
}
suggestion := providerReqSuggestions[providerLocalName]
if suggestion == nil {
providerReqSuggestions[providerLocalName] = &ProviderReqSuggestion{
SourceAddr: sourceAddr,
}
suggestion = providerReqSuggestions[providerLocalName]
}
if providerLocalName != name {
// It's an aliased provider config, then.
suggestion.AliasCount++
}
suggestion.RequiredConfigs = append(suggestion.RequiredConfigs, name)
suggestion.SourceRanges = append(suggestion.SourceRanges, src)
}
for name, suggestion := range providerReqSuggestions {
var buf strings.Builder
fmt.Fprintf(
&buf,
"Earlier versions of Terraform used empty provider blocks (\"proxy provider configurations\") for child modules to declare their need to be passed a provider configuration by their callers. That approach was ambiguous and is now deprecated.\n\nIf you control this module, you can migrate to the new declaration syntax by removing all of the empty provider %q blocks and then adding or updating an entry like the following to the required_providers block of %s:\n",
name, moduleText,
)
fmt.Fprintf(&buf, " %s = {\n", name)
fmt.Fprintf(&buf, " source = %q\n", suggestion.SourceAddr.ForDisplay())
if suggestion.AliasCount > 0 {
// A lexical sort is fine because all of these strings are
// guaranteed to start with the same provider local name, and
// so we're only really sorting by the alias part.
sort.Strings(suggestion.RequiredConfigs)
fmt.Fprintln(&buf, " configuration_aliases = [")
for _, addrStr := range suggestion.RequiredConfigs {
fmt.Fprintf(&buf, " %s,\n", addrStr)
}
fmt.Fprintln(&buf, " ]")
}
fmt.Fprint(&buf, " }")
// We're arbitrarily going to just take the one source range that
// sorts earliest here. Multiple should be rare, so this is only to
// ensure that we produce a deterministic result in the edge case.
sort.Slice(suggestion.SourceRanges, func(i, j int) bool {
return suggestion.SourceRanges[i].String() < suggestion.SourceRanges[j].String()
})
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Redundant empty provider block",
Detail: buf.String(),
Subject: suggestion.SourceRanges[0].Ptr(),
})
}
return diags
}
func providerName(name, alias string) string | {
if alias != "" {
name = name + "." + alias
}
return name
} | identifier_body | |
provider_validation.go | (parentCall *ModuleCall, cfg *Config, noProviderConfigRange *hcl.Range) (diags hcl.Diagnostics) {
mod := cfg.Module
for name, child := range cfg.Children {
mc := mod.ModuleCalls[name]
childNoProviderConfigRange := noProviderConfigRange
// if the module call has any of count, for_each or depends_on,
// providers are prohibited from being configured in this module, or
// any module beneath this module.
switch {
case mc.Count != nil:
childNoProviderConfigRange = mc.Count.Range().Ptr()
case mc.ForEach != nil:
childNoProviderConfigRange = mc.ForEach.Range().Ptr()
case mc.DependsOn != nil:
if len(mc.DependsOn) > 0 {
childNoProviderConfigRange = mc.DependsOn[0].SourceRange().Ptr()
} else {
// Weird! We'll just use the call itself, then.
childNoProviderConfigRange = mc.DeclRange.Ptr()
}
}
diags = append(diags, validateProviderConfigs(mc, child, childNoProviderConfigRange)...)
}
// the set of provider configuration names passed into the module, with the
// source range of the provider assignment in the module call.
passedIn := map[string]PassedProviderConfig{}
// the set of empty configurations that could be proxy configurations, with
// the source range of the empty configuration block.
emptyConfigs := map[string]hcl.Range{}
// the set of provider with a defined configuration, with the source range
// of the configuration block declaration.
configured := map[string]hcl.Range{}
// the set of configuration_aliases defined in the required_providers
// block, with the fully qualified provider type.
configAliases := map[string]addrs.AbsProviderConfig{}
// the set of provider names defined in the required_providers block, and
// their provider types.
localNames := map[string]addrs.Provider{}
for _, pc := range mod.ProviderConfigs {
name := providerName(pc.Name, pc.Alias)
// Validate the config against an empty schema to see if it's empty.
_, pcConfigDiags := pc.Config.Content(&hcl.BodySchema{})
if pcConfigDiags.HasErrors() || pc.Version.Required != nil {
configured[name] = pc.DeclRange
} else {
emptyConfigs[name] = pc.DeclRange
}
}
if mod.ProviderRequirements != nil {
for _, req := range mod.ProviderRequirements.RequiredProviders {
localNames[req.Name] = req.Type
for _, alias := range req.Aliases {
addr := addrs.AbsProviderConfig{
Module: cfg.Path,
Provider: req.Type,
Alias: alias.Alias,
}
configAliases[providerName(alias.LocalName, alias.Alias)] = addr
}
}
}
// collect providers passed from the parent
if parentCall != nil {
for _, passed := range parentCall.Providers {
name := providerName(passed.InChild.Name, passed.InChild.Alias)
passedIn[name] = passed
}
}
parentModuleText := "the root module"
moduleText := "the root module"
if !cfg.Path.IsRoot() {
moduleText = cfg.Path.String()
if parent := cfg.Path.Parent(); !parent.IsRoot() {
// module address are prefixed with `module.`
parentModuleText = parent.String()
}
}
// Verify that any module calls only refer to named providers, and that
// those providers will have a configuration at runtime. This way we can
// direct users where to add the missing configuration, because the runtime
// error is only "missing provider X".
for _, modCall := range mod.ModuleCalls {
for _, passed := range modCall.Providers {
// aliased providers are handled more strictly, and are never
// inherited, so they are validated within modules further down.
// Skip these checks to prevent redundant diagnostics.
if passed.InParent.Alias != "" {
continue
}
name := passed.InParent.String()
_, confOK := configured[name]
_, localOK := localNames[name]
_, passedOK := passedIn[name]
// This name was not declared somewhere within in the
// configuration. We ignore empty configs, because they will
// already produce a warning.
if !(confOK || localOK) {
defAddr := addrs.NewDefaultProvider(name)
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Reference to undefined provider",
Detail: fmt.Sprintf(
"There is no explicit declaration for local provider name %q in %s, so Terraform is assuming you mean to pass a configuration for provider %q.\n\nTo clarify your intent and silence this warning, add to %s a required_providers entry named %q with source = %q, or a different source address if appropriate.",
name, moduleText, defAddr.ForDisplay(),
parentModuleText, name, defAddr.ForDisplay(),
),
Subject: &passed.InParent.NameRange,
})
continue
}
// Now we may have named this provider within the module, but
// there won't be a configuration available at runtime if the
// parent module did not pass one in.
if !cfg.Path.IsRoot() && !(confOK || passedOK) {
defAddr := addrs.NewDefaultProvider(name)
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagWarning,
Summary: "Missing required provider configuration",
Detail: fmt.Sprintf(
"The configuration for %s expects to inherit a configuration for provider %s with local name %q, but %s doesn't pass a configuration under that name.\n\nTo satisfy this requirement, add an entry for %q to the \"providers\" argument in the module %q block.",
moduleText, defAddr.ForDisplay(), name, parentModuleText,
name, parentCall.Name,
),
Subject: parentCall.DeclRange.Ptr(),
})
}
}
}
if cfg.Path.IsRoot() {
// nothing else to do in the root module
return diags
}
// there cannot be any configurations if no provider config is allowed
if len(configured) > 0 && noProviderConfigRange != nil {
// We report this from the perspective of the use of count, for_each,
// or depends_on rather than from inside the module, because the
// recipient of this message is more likely to be the author of the
// calling module (trying to use an older module that hasn't been
// updated yet) than of the called module.
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Module is incompatible with count, for_each, and depends_on",
Detail: fmt.Sprintf(
"The module at %s is a legacy module which contains its own local provider configurations, and so calls to it may not use the count, for_each, or depends_on arguments.\n\nIf you also control the module %q, consider updating this module to instead expect provider configurations to be passed by its caller.",
cfg.Path, cfg.SourceAddr,
),
Subject: noProviderConfigRange,
})
}
// now check that the user is not attempting to override a config
for name := range configured {
if passed, ok := passedIn[name]; ok {
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Cannot override provider configuration",
Detail: fmt.Sprintf(
"The configuration of %s has its own local configuration for %s, and so it cannot accept an overridden configuration provided by %s.",
moduleText, name, parentModuleText,
),
Subject: &passed.InChild.NameRange,
})
}
}
// A declared alias requires either a matching configuration within the
// module, or one must be passed in.
for name, providerAddr := range configAliases {
_, confOk := configured[name]
_, passedOk := passedIn[name]
if confOk || passedOk {
continue
}
diags = append(diags, &hcl.Diagnostic{
Severity: hcl.DiagError,
Summary: "Missing required provider configuration",
Detail: fmt.Sprintf(
"The child module requires an additional configuration for provider %s, with the local name %q.\n\nRefer to the module's documentation to understand the intended purpose of this additional provider configuration, and then add an entry for %s in the \"providers\" meta-argument in the module block to choose which provider configuration the module should use for that purpose.",
providerAddr.Provider.ForDisplay(), name,
name,
),
Subject: &parentCall.DeclRange,
})
}
// You cannot pass in a provider that cannot be used
for name, passed := range passedIn {
childTy := passed.InChild.providerType
// get a default type | validateProviderConfigs | identifier_name | |
sup.rs | (no_version)]
Status {
/// A package identifier (ex: core/redis, core/busybox-static/1.42.2)
#[structopt(name = "PKG_IDENT")]
pkg_ident: Option<PackageIdent>,
#[structopt(flatten)]
remote_sup: RemoteSup,
},
/// Gracefully terminate the Habitat Supervisor and all of its running services
#[structopt(usage = "hab sup term [OPTIONS]", no_version)]
Term,
}
// TODO (DM): This is unnecessarily difficult due to the orphan rule and the lack of specialization.
// The `configopt` library could be improved to make this easier.
#[derive(Deserialize, Serialize, Debug)]
struct | (#[serde(with = "serde_string")] NatsAddress);
impl fmt::Display for EventStreamAddress {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result { write!(f, "{}", self.0) }
}
impl FromStr for EventStreamAddress {
type Err = RantsError;
fn from_str(s: &str) -> Result<Self, Self::Err> { Ok(EventStreamAddress(s.parse()?)) }
}
impl ConfigOptToString for EventStreamAddress {}
#[derive(ConfigOptDefaults, Partial, StructOpt, Deserialize)]
#[configopt_defaults(type = "PartialSupRun")]
#[partial(derive(Debug, Default, Deserialize), attrs(serde))]
#[serde(deny_unknown_fields)]
#[structopt(name = "run",
no_version,
about = "Run the Habitat Supervisor",
// set custom usage string, otherwise the binary
// is displayed confusingly as `hab-sup`
// see: https://github.com/kbknapp/clap-rs/blob/2724ec5399c500b12a1a24d356f4090f4816f5e2/src/app/mod.rs#L373-L394
usage = "hab sup run [FLAGS] [OPTIONS] [--] [PKG_IDENT_OR_ARTIFACT]"
)]
#[allow(dead_code)]
pub struct SupRun {
/// The listen address for the Gossip System Gateway
#[structopt(name = "LISTEN_GOSSIP",
long = "listen-gossip",
env = GossipListenAddr::ENVVAR,
default_value = GossipListenAddr::default_as_str())]
listen_gossip: SocketAddr,
/// Start the supervisor in local mode
#[structopt(name = "LOCAL_GOSSIP_MODE",
long = "local-gossip-mode",
conflicts_with_all = &["LISTEN_GOSSIP", "PEER", "PEER_WATCH_FILE"])]
local_gossip_mode: bool,
/// The listen address for the HTTP Gateway
#[structopt(name = "LISTEN_HTTP",
long = "listen-http",
env = HttpListenAddr::ENVVAR,
default_value = HttpListenAddr::default_as_str())]
listen_http: SocketAddr,
/// Disable the HTTP Gateway completely
#[structopt(name = "HTTP_DISABLE", long = "http-disable", short = "D")]
http_disable: bool,
/// The listen address for the Control Gateway. If not specified, the value will be taken from
/// the HAB_LISTEN_CTL environment variable if defined
#[structopt(name = "LISTEN_CTL",
long = "listen-ctl",
env = ListenCtlAddr::ENVVAR,
default_value = ListenCtlAddr::default_as_str())]
listen_ctl: SocketAddr,
/// The organization that the Supervisor and its subsequent services are part of
#[structopt(name = "ORGANIZATION", long = "org")]
organization: Option<String>,
/// The listen address of one or more initial peers (IP[:PORT])
#[structopt(name = "PEER", long = "peer")]
// TODO (DM): This could probably be a different type for better validation (Vec<SockAddr>?)
peer: Vec<String>,
/// If this Supervisor is a permanent peer
#[structopt(name = "PERMANENT_PEER", long = "permanent-peer", short = "I")]
permanent_peer: bool,
/// Watch this file for connecting to the ring
#[structopt(name = "PEER_WATCH_FILE",
long = "peer-watch-file",
conflicts_with = "PEER")]
peer_watch_file: PathBuf,
#[structopt(flatten)]
cache_key_path: CacheKeyPath,
/// The name of the ring used by the Supervisor when running with wire encryption. (ex: hab sup
/// run --ring myring)
#[structopt(name = "RING",
long = "ring",
short = "r",
env = RING_ENVVAR,
conflicts_with = "RING_KEY")]
ring: String,
/// The contents of the ring key when running with wire encryption. (Note: This option is
/// explicitly undocumented and for testing purposes only. Do not use it in a production
/// system. Use the corresponding environment variable instead.) (ex: hab sup run --ring-key
/// 'SYM-SEC-1 foo-20181113185935GCrBOW6CCN75LMl0j2V5QqQ6nNzWm6and9hkKBSUFPI=')
#[structopt(name = "RING_KEY",
long = "ring-key",
env = RING_KEY_ENVVAR,
hidden = true,
conflicts_with = "RING")]
ring_key: Option<String>,
/// Receive Supervisor updates from the specified release channel
#[structopt(name = "CHANNEL", long = "channel", default_value = "stable")]
channel: String,
/// Specify an alternate Builder endpoint. If not specified, the value will be taken from the
/// HAB_BLDR_URL environment variable if defined (default: https://bldr.habitat.sh)
#[structopt(name = "BLDR_URL",
long = "url",
short = "u",
// TODO (DM): These fields are not actual set in the clap macro but I think they should
// env = BLDR_URL_ENVVAR,
// default_value = DEFAULT_BLDR_URL
)]
bldr_url: Url,
/// Use package config from this path, rather than the package itself
#[structopt(name = "CONFIG_DIR", long = "config-from")]
config_dir: Option<PathBuf>,
/// Enable automatic updates for the Supervisor itself
#[structopt(name = "AUTO_UPDATE", long = "auto-update", short = "A")]
auto_update: bool,
/// Used for enabling TLS for the HTTP gateway. Read private key from KEY_FILE. This should be
/// a RSA private key or PKCS8-encoded private key, in PEM format
#[structopt(name = "KEY_FILE", long = "key", requires = "CERT_FILE")]
key_file: Option<PathBuf>,
/// Used for enabling TLS for the HTTP gateway. Read server certificates from CERT_FILE. This
/// should contain PEM-format certificates in the right order (the first certificate should
/// certify KEY_FILE, the last should be a root CA)
#[structopt(name = "CERT_FILE", long = "certs", requires = "KEY_FILE")]
cert_file: Option<PathBuf>,
/// Used for enabling client-authentication with TLS for the HTTP gateway. Read CA certificate
/// from CA_CERT_FILE. This should contain PEM-format certificate that can be used to validate
/// client requests
#[structopt(name = "CA_CERT_FILE",
long = "ca-certs",
requires_all = &["CERT_FILE", "KEY_FILE"])]
ca_cert_file: Option<PathBuf>,
/// Load the given Habitat package as part of the Supervisor startup specified by a package
/// identifier (ex: core/redis) or filepath to a Habitat Artifact (ex:
/// /home/core-redis-3.0.7-21120102031201-x86_64-linux.hart)
// TODO (DM): We could probably do better validation here
#[structopt(name = "PKG_IDENT_OR_ARTIFACT")]
pkg_ident_or_artifact: Option<String>,
// TODO (DM): This flag can eventually be removed.
// See https://github.com/habitat-sh/habitat/issues/7339
#[structopt(name = "APPLICATION", long = "application", hidden = true)]
application: Vec<String>,
// TODO (DM): This flag can eventually be removed.
// See https://github.com/habitat-sh/habitat/issues/7339
#[structopt(name = "ENVIRONMENT", long = "environment", hidden = true)]
environment: Vec<String>,
/// The service group; shared config and topology [default: default]
// TODO (DM): This should set a default value
#[structopt(name = "GROUP", long = "group")]
group: String,
/// Service topology; [default: none]
// TODO (DM): I dont think saying the default is none makes sense here
#[structopt(name = "TOPOLOGY",
long = "topology",
short = "t",
possible_values = &["standalone", "leader"])]
topology: Option<habitat_sup_protocol::types::Topology>,
/// The update strategy; [default: none] [values: none, at-once, rolling]
// TODO (DM): this should set a default_value and | EventStreamAddress | identifier_name |
sup.rs | (no_version)]
Status {
/// A package identifier (ex: core/redis, core/busybox-static/1.42.2)
#[structopt(name = "PKG_IDENT")]
pkg_ident: Option<PackageIdent>,
#[structopt(flatten)]
remote_sup: RemoteSup,
},
/// Gracefully terminate the Habitat Supervisor and all of its running services
#[structopt(usage = "hab sup term [OPTIONS]", no_version)]
Term,
}
// TODO (DM): This is unnecessarily difficult due to the orphan rule and the lack of specialization.
// The `configopt` library could be improved to make this easier.
#[derive(Deserialize, Serialize, Debug)]
struct EventStreamAddress(#[serde(with = "serde_string")] NatsAddress);
impl fmt::Display for EventStreamAddress {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result { write!(f, "{}", self.0) }
}
impl FromStr for EventStreamAddress {
type Err = RantsError;
fn from_str(s: &str) -> Result<Self, Self::Err> { Ok(EventStreamAddress(s.parse()?)) }
}
impl ConfigOptToString for EventStreamAddress {}
#[derive(ConfigOptDefaults, Partial, StructOpt, Deserialize)]
#[configopt_defaults(type = "PartialSupRun")]
#[partial(derive(Debug, Default, Deserialize), attrs(serde))]
#[serde(deny_unknown_fields)]
#[structopt(name = "run",
no_version,
about = "Run the Habitat Supervisor",
// set custom usage string, otherwise the binary
// is displayed confusingly as `hab-sup`
// see: https://github.com/kbknapp/clap-rs/blob/2724ec5399c500b12a1a24d356f4090f4816f5e2/src/app/mod.rs#L373-L394
usage = "hab sup run [FLAGS] [OPTIONS] [--] [PKG_IDENT_OR_ARTIFACT]"
)]
#[allow(dead_code)]
pub struct SupRun {
/// The listen address for the Gossip System Gateway
#[structopt(name = "LISTEN_GOSSIP",
long = "listen-gossip",
env = GossipListenAddr::ENVVAR,
default_value = GossipListenAddr::default_as_str())]
listen_gossip: SocketAddr,
/// Start the supervisor in local mode
#[structopt(name = "LOCAL_GOSSIP_MODE",
long = "local-gossip-mode",
conflicts_with_all = &["LISTEN_GOSSIP", "PEER", "PEER_WATCH_FILE"])]
local_gossip_mode: bool,
/// The listen address for the HTTP Gateway
#[structopt(name = "LISTEN_HTTP",
long = "listen-http",
env = HttpListenAddr::ENVVAR,
default_value = HttpListenAddr::default_as_str())]
listen_http: SocketAddr,
/// Disable the HTTP Gateway completely
#[structopt(name = "HTTP_DISABLE", long = "http-disable", short = "D")]
http_disable: bool,
/// The listen address for the Control Gateway. If not specified, the value will be taken from
/// the HAB_LISTEN_CTL environment variable if defined
#[structopt(name = "LISTEN_CTL",
long = "listen-ctl",
env = ListenCtlAddr::ENVVAR,
default_value = ListenCtlAddr::default_as_str())]
listen_ctl: SocketAddr,
/// The organization that the Supervisor and its subsequent services are part of
#[structopt(name = "ORGANIZATION", long = "org")]
organization: Option<String>,
/// The listen address of one or more initial peers (IP[:PORT])
#[structopt(name = "PEER", long = "peer")]
// TODO (DM): This could probably be a different type for better validation (Vec<SockAddr>?)
peer: Vec<String>,
/// If this Supervisor is a permanent peer
#[structopt(name = "PERMANENT_PEER", long = "permanent-peer", short = "I")]
permanent_peer: bool,
/// Watch this file for connecting to the ring
#[structopt(name = "PEER_WATCH_FILE",
long = "peer-watch-file",
conflicts_with = "PEER")]
peer_watch_file: PathBuf, | /// run --ring myring)
#[structopt(name = "RING",
long = "ring",
short = "r",
env = RING_ENVVAR,
conflicts_with = "RING_KEY")]
ring: String,
/// The contents of the ring key when running with wire encryption. (Note: This option is
/// explicitly undocumented and for testing purposes only. Do not use it in a production
/// system. Use the corresponding environment variable instead.) (ex: hab sup run --ring-key
/// 'SYM-SEC-1 foo-20181113185935GCrBOW6CCN75LMl0j2V5QqQ6nNzWm6and9hkKBSUFPI=')
#[structopt(name = "RING_KEY",
long = "ring-key",
env = RING_KEY_ENVVAR,
hidden = true,
conflicts_with = "RING")]
ring_key: Option<String>,
/// Receive Supervisor updates from the specified release channel
#[structopt(name = "CHANNEL", long = "channel", default_value = "stable")]
channel: String,
/// Specify an alternate Builder endpoint. If not specified, the value will be taken from the
/// HAB_BLDR_URL environment variable if defined (default: https://bldr.habitat.sh)
#[structopt(name = "BLDR_URL",
long = "url",
short = "u",
// TODO (DM): These fields are not actual set in the clap macro but I think they should
// env = BLDR_URL_ENVVAR,
// default_value = DEFAULT_BLDR_URL
)]
bldr_url: Url,
/// Use package config from this path, rather than the package itself
#[structopt(name = "CONFIG_DIR", long = "config-from")]
config_dir: Option<PathBuf>,
/// Enable automatic updates for the Supervisor itself
#[structopt(name = "AUTO_UPDATE", long = "auto-update", short = "A")]
auto_update: bool,
/// Used for enabling TLS for the HTTP gateway. Read private key from KEY_FILE. This should be
/// a RSA private key or PKCS8-encoded private key, in PEM format
#[structopt(name = "KEY_FILE", long = "key", requires = "CERT_FILE")]
key_file: Option<PathBuf>,
/// Used for enabling TLS for the HTTP gateway. Read server certificates from CERT_FILE. This
/// should contain PEM-format certificates in the right order (the first certificate should
/// certify KEY_FILE, the last should be a root CA)
#[structopt(name = "CERT_FILE", long = "certs", requires = "KEY_FILE")]
cert_file: Option<PathBuf>,
/// Used for enabling client-authentication with TLS for the HTTP gateway. Read CA certificate
/// from CA_CERT_FILE. This should contain PEM-format certificate that can be used to validate
/// client requests
#[structopt(name = "CA_CERT_FILE",
long = "ca-certs",
requires_all = &["CERT_FILE", "KEY_FILE"])]
ca_cert_file: Option<PathBuf>,
/// Load the given Habitat package as part of the Supervisor startup specified by a package
/// identifier (ex: core/redis) or filepath to a Habitat Artifact (ex:
/// /home/core-redis-3.0.7-21120102031201-x86_64-linux.hart)
// TODO (DM): We could probably do better validation here
#[structopt(name = "PKG_IDENT_OR_ARTIFACT")]
pkg_ident_or_artifact: Option<String>,
// TODO (DM): This flag can eventually be removed.
// See https://github.com/habitat-sh/habitat/issues/7339
#[structopt(name = "APPLICATION", long = "application", hidden = true)]
application: Vec<String>,
// TODO (DM): This flag can eventually be removed.
// See https://github.com/habitat-sh/habitat/issues/7339
#[structopt(name = "ENVIRONMENT", long = "environment", hidden = true)]
environment: Vec<String>,
/// The service group; shared config and topology [default: default]
// TODO (DM): This should set a default value
#[structopt(name = "GROUP", long = "group")]
group: String,
/// Service topology; [default: none]
// TODO (DM): I dont think saying the default is none makes sense here
#[structopt(name = "TOPOLOGY",
long = "topology",
short = "t",
possible_values = &["standalone", "leader"])]
topology: Option<habitat_sup_protocol::types::Topology>,
/// The update strategy; [default: none] [values: none, at-once, rolling]
// TODO (DM): this should set a default_value and use possible | #[structopt(flatten)]
cache_key_path: CacheKeyPath,
/// The name of the ring used by the Supervisor when running with wire encryption. (ex: hab sup | random_line_split |
texture.rs | Interaction, dstdx: &mut Vector2f,
dstdy: &mut Vector2f) -> Point2f {
let st = self.sphere(&si.p);
// Compute texture coordinate differentials for sphere (u, v) mapping
let delta = 0.1;
let st_deltax = self.sphere(&(si.p + si.dpdx.get() * delta));
*dstdx = (st_deltax - st) / delta;
let st_deltay = self.sphere(&(si.p + si.dpdy.get() * delta));
*dstdy = (st_deltay - st) / delta;
// Handle sphere mapping discontinuity for coordinate differentials
if dstdx[1] > 0.5 { dstdx[1] = 1.0 - dstdx[1]; }
else if (*dstdx)[1] < -0.5 { (*dstdx)[1] = -((*dstdx)[1] + 1.0); }
if dstdy[1] > 0.5 { dstdy[1] = 1.0 - dstdy[1]; }
else if dstdy[1] < -0.5 { dstdy[1] = -(dstdy[1] + 1.0); }
st
}
}
pub struct CylindricalMapping2D {
world_to_texture: Transform
}
impl CylindricalMapping2D {
pub fn new(wtt: &Transform) -> Self {
Self { world_to_texture: *wtt }
}
fn cylinder(&self, p: &Point3f) -> Point2f {
let vec = (
self.world_to_texture.transform_point(p) -
Point3f::new(0.0, 0.0, 0.0))
.normalize();
Point2f::new(PI + vec.y.atan2(vec.x) * INV2_PI, vec.z)
}
}
impl TextureMapping2D for CylindricalMapping2D {
fn map(&self, si: &SurfaceInteraction,
dstdx: &mut Vector2f, dstdy: &mut Vector2f) -> Point2f {
let st = self.cylinder(&si.p);
// Compute texture coordinate differentials for cylinder (u, v) mapping
let delta = 0.1;
let st_deltax = self.cylinder(&(si.p + si.dpdx.get() * delta));
*dstdx = (st_deltax - st) / delta;
let st_deltay = self.cylinder(&(si.p + si.dpdy.get() * delta));
*dstdy = (st_deltay - st) / delta;
// Handle sphere mapping discontinuity for coordinate differentials
if dstdx[1] > 0.5 { dstdx[1] = 1.0 - dstdx[1]; }
else if (*dstdx)[1] < -0.5 { (*dstdx)[1] = -((*dstdx)[1] + 1.0); }
if dstdy[1] > 0.5 { dstdy[1] = 1.0 - dstdy[1]; }
else if dstdy[1] < -0.5 { dstdy[1] = -(dstdy[1] + 1.0); }
st
}
}
pub struct PlannarMapping2D {
vs: Vector3f,
vt: Vector3f,
ds: Float,
dt: Float
}
impl PlannarMapping2D {
pub fn new(vs: &Vector3f, vt: &Vector3f,
ds: Float, dt: Float) -> Self {
Self {
ds,
dt,
vs: *vs,
vt: *vt
}
}
}
impl TextureMapping2D for PlannarMapping2D {
fn map(&self, si: &SurfaceInteraction, dstdx: &mut Vector2f,
dstdy: &mut Vector2f) -> Point2f {
let vec = Vector3f::from(si.p);
*dstdx = Vector2f::new(si.dpdx.get().dot(&self.vs), si.dpdx.get().dot(&self.vt));
*dstdy = Vector2f::new(si.dpdy.get().dot(&self.vs), si.dpdy.get().dot(&self.vt));
Point2f::new(self.ds + vec.dot(&self.vs), self.dt + vec.dot(&self.vt))
}
}
#[enum_dispatch]
pub trait TextureMapping3D {
fn map(&self, si: &SurfaceInteraction, dpdx: &mut Vector3f,
dpdy: &mut Vector3f) -> Point3f;
}
#[enum_dispatch(TextureMapping3D)]
pub enum TextureMapping3Ds {
IdentityMapping3D
}
pub struct IdentityMapping3D {
world_to_texture: Transform
}
impl IdentityMapping3D {
pub fn new(w2t: &Transform) -> Self {
Self { world_to_texture: *w2t }
}
}
impl TextureMapping3D for IdentityMapping3D {
fn map(&self, si: &SurfaceInteraction, dpdx: &mut Vector3f,
dpdy: &mut Vector3f) -> Point3f {
*dpdx = self.world_to_texture.transform_vector(&si.dpdx.get());
*dpdy = self.world_to_texture.transform_vector(&si.dpdy.get());
self.world_to_texture.transform_point(&si.p)
}
}
pub fn lanczos(mut x: Float, tau: Float) -> Float {
x = x.abs();
if x < 1.0e-5 { return 1.0; }
if x > 1.0 { return 0.0; }
x *= PI;
let s = (x * tau).sin() / ( x * tau);
let lanc = x.sin() / x;
s * lanc
}
pub fn noise(x: Float, y: Float, z: Float) -> Float {
let mut ix = x.floor() as usize;
let mut iy = y.floor() as usize;
let mut iz = z.floor() as usize;
let dx = x - ix as Float;
let dy = y - iy as Float;
let dz = z - iz as Float;
// Compute gradient weights
ix &= NOISE_PERM_SIZE - 1;
iy &= NOISE_PERM_SIZE - 1;
iz &= NOISE_PERM_SIZE - 1;
let w000 = grad(ix, iy, iz, dx, dy, dz);
let w100 = grad(ix + 1, iy, iz, dx - 1.0, dy, dz);
let w010 = grad(ix, iy + 1, iz, dx, dy - 1.0, dz);
let w110 = grad(ix + 1, iy + 1, iz, dx - 1.0, dy - 1.0, dz);
let w001 = grad(ix, iy, iz + 1, dx, dy, dz - 1.0);
let w101 = grad(ix + 1, iy, iz + 1, dx - 1.0, dy, dz - 1.0);
let w011 = grad(ix, iy + 1, iz + 1, dx, dy - 1.0, dz - 1.0);
let w111 = grad(ix + 1, iy + 1, iz + 1, dx - 1.0, dy - 1.0, dz - 1.0);
// Compute trilinear interpolation of weights
let wx = noise_weight(dx);
let wy = noise_weight(dy);
let wz = noise_weight(dz);
let x00 = lerp(wx, w000, w100);
let x10 = lerp(wx, w010, w110);
let x01 = lerp(wx, w001, w101);
let x11 = lerp(wx, w011, w111);
let y0 = lerp(wy, x00, x10);
let y1 = lerp(wy, x01, x11);
lerp(wz, y0, y1)
}
pub fn noisep(p: Point3f) -> Float {
noise(p.x, p.y, p.z)
}
fn grad(x: usize, y: usize, z: usize, dx: Float, dy: Float, dz: Float) -> Float {
let mut h = NOISE_PERM[NOISE_PERM[NOISE_PERM[x] + y] + z];
h &= 15;
let u = if h < 8 || h == 12 || h == 13 { dx } else { dy };
let v = if h < 4 || h == 12 || h == 13 { dy } else { dz };
(if (h & 1) != 0 { -u } else { u }) + (if (h & 2) != 0 | { -v } | conditional_block | |
texture.rs | ay = self.cylinder(&(si.p + si.dpdy.get() * delta));
*dstdy = (st_deltay - st) / delta;
// Handle sphere mapping discontinuity for coordinate differentials
if dstdx[1] > 0.5 { dstdx[1] = 1.0 - dstdx[1]; }
else if (*dstdx)[1] < -0.5 { (*dstdx)[1] = -((*dstdx)[1] + 1.0); }
if dstdy[1] > 0.5 { dstdy[1] = 1.0 - dstdy[1]; }
else if dstdy[1] < -0.5 { dstdy[1] = -(dstdy[1] + 1.0); }
st
}
}
pub struct PlannarMapping2D {
vs: Vector3f,
vt: Vector3f,
ds: Float,
dt: Float
}
impl PlannarMapping2D {
pub fn new(vs: &Vector3f, vt: &Vector3f,
ds: Float, dt: Float) -> Self {
Self {
ds,
dt,
vs: *vs,
vt: *vt
}
}
}
impl TextureMapping2D for PlannarMapping2D {
fn map(&self, si: &SurfaceInteraction, dstdx: &mut Vector2f,
dstdy: &mut Vector2f) -> Point2f {
let vec = Vector3f::from(si.p);
*dstdx = Vector2f::new(si.dpdx.get().dot(&self.vs), si.dpdx.get().dot(&self.vt));
*dstdy = Vector2f::new(si.dpdy.get().dot(&self.vs), si.dpdy.get().dot(&self.vt));
Point2f::new(self.ds + vec.dot(&self.vs), self.dt + vec.dot(&self.vt))
}
}
#[enum_dispatch]
pub trait TextureMapping3D {
fn map(&self, si: &SurfaceInteraction, dpdx: &mut Vector3f,
dpdy: &mut Vector3f) -> Point3f;
}
#[enum_dispatch(TextureMapping3D)]
pub enum TextureMapping3Ds {
IdentityMapping3D
}
pub struct IdentityMapping3D {
world_to_texture: Transform
}
impl IdentityMapping3D {
pub fn new(w2t: &Transform) -> Self {
Self { world_to_texture: *w2t }
}
}
impl TextureMapping3D for IdentityMapping3D {
fn map(&self, si: &SurfaceInteraction, dpdx: &mut Vector3f,
dpdy: &mut Vector3f) -> Point3f {
*dpdx = self.world_to_texture.transform_vector(&si.dpdx.get());
*dpdy = self.world_to_texture.transform_vector(&si.dpdy.get());
self.world_to_texture.transform_point(&si.p)
}
}
pub fn lanczos(mut x: Float, tau: Float) -> Float {
x = x.abs();
if x < 1.0e-5 { return 1.0; }
if x > 1.0 { return 0.0; }
x *= PI;
let s = (x * tau).sin() / ( x * tau);
let lanc = x.sin() / x;
s * lanc
}
pub fn noise(x: Float, y: Float, z: Float) -> Float {
let mut ix = x.floor() as usize;
let mut iy = y.floor() as usize;
let mut iz = z.floor() as usize;
let dx = x - ix as Float;
let dy = y - iy as Float;
let dz = z - iz as Float;
// Compute gradient weights
ix &= NOISE_PERM_SIZE - 1;
iy &= NOISE_PERM_SIZE - 1;
iz &= NOISE_PERM_SIZE - 1;
let w000 = grad(ix, iy, iz, dx, dy, dz);
let w100 = grad(ix + 1, iy, iz, dx - 1.0, dy, dz);
let w010 = grad(ix, iy + 1, iz, dx, dy - 1.0, dz);
let w110 = grad(ix + 1, iy + 1, iz, dx - 1.0, dy - 1.0, dz);
let w001 = grad(ix, iy, iz + 1, dx, dy, dz - 1.0);
let w101 = grad(ix + 1, iy, iz + 1, dx - 1.0, dy, dz - 1.0);
let w011 = grad(ix, iy + 1, iz + 1, dx, dy - 1.0, dz - 1.0);
let w111 = grad(ix + 1, iy + 1, iz + 1, dx - 1.0, dy - 1.0, dz - 1.0);
// Compute trilinear interpolation of weights
let wx = noise_weight(dx);
let wy = noise_weight(dy);
let wz = noise_weight(dz);
let x00 = lerp(wx, w000, w100);
let x10 = lerp(wx, w010, w110);
let x01 = lerp(wx, w001, w101);
let x11 = lerp(wx, w011, w111);
let y0 = lerp(wy, x00, x10);
let y1 = lerp(wy, x01, x11);
lerp(wz, y0, y1)
}
pub fn noisep(p: Point3f) -> Float {
noise(p.x, p.y, p.z)
}
fn grad(x: usize, y: usize, z: usize, dx: Float, dy: Float, dz: Float) -> Float {
let mut h = NOISE_PERM[NOISE_PERM[NOISE_PERM[x] + y] + z];
h &= 15;
let u = if h < 8 || h == 12 || h == 13 { dx } else { dy };
let v = if h < 4 || h == 12 || h == 13 { dy } else { dz };
(if (h & 1) != 0 { -u } else { u }) + (if (h & 2) != 0 { -v } else { v })
}
fn noise_weight(t: Float) -> Float {
let t3 = t * t * t;
let t4 = t3 * t;
6.0 * t4 * t - 15.0 * t4 + 10.0 * t3
}
pub fn fbm(
p: &Point3f, dpdx: &Vector3f, dpdy: &Vector3f,
omega: Float, max_octaves: usize) -> Float {
// Compute number of octaves for antialiased FBm
let len2 = dpdx.length_squared().max(dpdy.length_squared());
let n = clamp(-1.0 - 0.5 * log2(len2), 0.0, max_octaves as Float);
let nint = n.floor() as usize;
// Compute sum of octaves of noise for fbm
let (mut sum, mut lambda, mut o) = (0.0, 1.0, 1.0);
for _i in 0..nint {
sum += o * noisep(*p * lambda);
lambda *= 1.99;
o *= omega;
}
let npartial = n - nint as Float;
sum += o * smooth_step(0.3, 0.7, npartial) * noisep(*p * lambda);
sum
}
pub fn turbulence(
p: &Point3f, dpdx: &Vector3f, dpdy: &Vector3f,
omega: Float, max_octaves: usize) -> Float {
// Compute number of octaves for antialiased FBm
let len2 = dpdx.length_squared().max(dpdy.length_squared());
let n = clamp(-1.0 - 0.5 * len2.log2(), 0.0, max_octaves as Float);
let nint = n.floor() as usize;
// Compute sum of octaves of noise for turbulence
let (mut sum, mut lambda, mut o) = (0.0, 1.0, 1.0);
for _i in 0..nint {
sum += o + noisep(*p * lambda).abs();
lambda *= 1.99;
o *= omega;
}
// Account for contributions of clamped octaves in turbulence
let npartial = n - nint as Float;
sum += o + lerp( | smooth_step(0.3, 0.7, npartial),
0.2,
noisep(*p * lambda).abs()); | random_line_split |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.