Split (1)

train · 262k rows

text stringlengths 253 685k
National Geographic Education Fellow Jon Waterhouse writes from Louisiana's Gulf Coast that, for some residents who rely on marine life for a living, reports that we're past the worst of the Deepwater Horizon oil spill's consequences don't ring true. By Jon Waterhouse All is not right with the world--not in Louisiana, at least. As the BP disaster in the Gulf has all but disappeared from the news, we discover that the stories of the twin environmental catastrophes here--first Katrina, then the oil spill--are far from finished. We are here to speak with Gulf residents about the personal impact of BP and its partners' mind-boggling errors, and in so doing we're learning that the consequences are on-going. This story still needs to be told. Our arrival in New Orleans began pleasantly. A delightful young lady named Ashley met me and my wife Mary at the rental car counter. Her friendly demeanor and outgoing personality implied that she came from a healthy background and enjoyed a good life. This assessment prompted us to bulldoze right on in with a big question for her: "So, how did Hurricane Katrina affect you?" Her answer was unexpected. "My family lived in an area of Belle Chasse that is now completely gone." Surprised, we listened intently as she discussed the horror of this storm and how it affected her life and the lives of her family, her neighbors, and her friends. She told us that her grandparents survived the hurricane, but the aftermath of the disaster proved too much for her grandfather, and within two months, he had passed away. "Many of our friends never came back. We were all just normal families before Katrina." Ashley's upbeat demeanor gave no hint of the self-pity, resentment, or emotional trauma that we might expect from someone who had endured the nightmare that we casually refer to as "Katrina." As Ashley continued to tell us of her experience, she referenced her grandmother frequently, and quoted her as she described the spirit of her family. "It happened, we're still here, we're strong, and we're movin' on." Mary and I found Ashley's resilient outlook on life inspiring, and we were pretty amped after the conversation. We wondered if this was indicative of the spirit of the people of Louisiana, and if the responses we would receive about the oil disaster would be as optimistic. Time would tell. We had not even left the airport. Our good friend and walking/paddling companion, John Francis (aka the "Planetwalker"), joined us in New Orleans for his first visit to the Gulf area, and had arranged for the three of us to meet LaTosha Brown. John met LaTosha when she spoke at the TEDxOilSpill event in Washington, D.C. last June, where experts just returning from the Gulf spill area reported their findings. LaTosha directs the Gulf Coast Fund, a non-profit created after Hurricanes Katrina and Rita hit the region. At breakfast, she described for us the current state of the Gulf. We learned that contrary to what we might conclude from recent news reports--or lack thereof--life for Gulf coast residents is not even close to "normal," and it seems that it may never be. LaTosha also shared some data with which we were unfamiliar: More than 27,000 abandoned oil and gas wells lie beneath the Gulf of Mexico. More than 1,200 oil rigs in the Gulf currently sit idle. *Prior to this disaster, oil leases and other payments from the oil in the Gulf represented the second largest deposits into the National Treasury after those coming from taxpayers via the Internal Revenue Service. Armed with this information and the names of a few Gulf residents from LaTosha, we set out for Grand Isle, Louisiana--a sort of ground zero for the Deepwater Horizon disaster--to witness what progress was being made in the giant clean-up effort. As we approached Grand Isle, we called Karen Hopkins, the first person on LaTosha's list. Karen is clearly anxious for our arrival. When we finally sat down with her, Karen announced unprompted that she was "not an environmentalist." Rather, she pronounced herself a "conservative conservationist. I never in my wildest dreams would have imagined I'd sit down with radical, tree-hugging liberals, but we are now working side by side together like family. Hard-core Republicans, native Americans, ethnic Vietnamese--you name it, we are all Gulf residents and we are fighting for our lives here. One of my new best friends is a liberal and I just love her. We have set aside our politics because we have a common concern for what has happened. Our only focus when it comes to our differences is ignoring them. We know that in this oil spill there, is no room for politics because politics divide." For Karen, sadness and despair over a lost way of life for many in the Gulf had clearly turned to a smoldering-hot anger. She and her husband, a commercial fisherman, no longer cry, she told us. "We just sob. Day after day we look at what happened, look at the oil in these waters and sob. But now we're pissed. This is not right and if I die trying, I'm going to be damn sure BP makes it right." She states that as soon as the announcement came that the leaking well was successfully capped, the national media who had been "packed in like sardines on Grand Isle, government officials, and all other concerned parties" were gone. BP was gone, too. "But the oil is still here. It's right over there." Karen explains that BP took many of the fishermen whose livelihood went away with the oil and put them to work cleaning up. The fisherman had more at stake than BP did, and their performance exceeded BP's expectations. Karen says this wasn't a good thing. "That meant they (BP) had to do something with all that oil that was getting cleaned up." So, she tells us, the fishermen were told to go home, and that was that. Since the sudden departure of the clean-up effort and the journalists reporting and filming it, Karen told us she had been relentless in her research regarding the current state of the spill zone. She provided us with document after document pertaining to water quality and testing methods, and said her findings differed substantially from those of the various experts who were supplying results for BP to give residents and fishermen. She continued to question testing methods and BP's proclamations that Gulf shrimp and fish were now safe to eat. "I will never eat Gulf shrimp again. Never," she said. As we continued our talk with Karen, her employer, Dean Blanchard, appeared. Dean was more than happy to share his thoughts on what had happened in the Gulf. In response to Karen's remark about never eating shrimp again, Dean added, "I've been doing this for 51 years. I was born into a fishing family and you can bet that we know when fish is good and when it's bad. The seagulls and other birds will always eat anything we toss out, good or bad, always. But they won't touch these shrimp. The birds won't touch 'em. Hell, the flies won't even lay their eggs on 'em. Now what does that tell you?" John asked Dean what he wanted from BP and its drilling partners to make this right. Dean simply stated, "The truth." Jon Waterhouse is director of the Yukon River Inter-Tribal Watershed Council, a National Geographic Education Fellow, and an avid paddler. The views expressed in this article are those of our guest blogger Jon Waterhouse and not necessarily those of the National Geographic Society. Mary Marshall and John Francis contributed to this report. Photos by Jon Waterhouse Gulf oil spill coverage: http://news.nationalgeographic.com/news/gulf-oil-spill-news/
Snakes are one of the animals that can be found in almost all places, except in Antarctica and its surroundings. Snakes are also feared because they can cause serious harm, injury, and even death to the human population. Not only on land, snakes can also be found in the sea. Compared to land snakes, sea snakes are generally more shy and timid. However, sea snakes are known to have venom that is lethal to humans in very small amounts. Although most sea snakes are more venomous than land snakes, the number of humans injured by sea snakes is less due to infrequent contact with humans. In fact, many of them have never had any human contact at all. Even so, you still need to be aware of the presence of these snakes while in the water. The following will discuss some of the most dangerous sea snakes. 1. Olive-headed sea snake The olive-headed sea snake is considered one of the most venomous snakes in the world. This snake has a length of up to 1 m, the body is yellow to cream with dark brown stripes, and the head is olive. This snake lives in the west-central Pacific Ocean and the Indian Ocean. They prefer to hunt at night and only occasionally come out of hiding during the day to breathe. They rarely bite people, but their bites are highly venomous and can be fatal. 2. Yellow-bellied sea snake The yellow-bellied sea snake was first discovered in the 1700s. They are sea snakes endemic to the West Coast of North America, North South America, Southeast Asia, and the coast of Africa. This snake can only grow as long as 89 cm as an adult. Very small indeed, but according to the Owlcation page , this sea snake is very dangerous and has the ability to injure and kill humans with relative ease. 3. Beaked sea snake This snake has a strong body, wide back, and a short and thick tail. It has a head slightly wider than the anterior part of the body and faint dark markings forming a series of transverse bands. According to Ecology Asia, the beaked sea snake is considered one of the most venomous snakes in the genus Hydrophis. They are also very aggressive. It is estimated that this snake is responsible for nine out of every ten deaths from sea snake bites. 4. Hardwicke's sea snake This snake can be found throughout the waters of the Persian Gulf, Indian Ocean, South China Sea, and parts of the Pacific. This snake is easily recognizable because of its short body, has a sturdy neck and head, wide nostrils, and a relatively uniform olive or dark gray color. Hardwicke's sea snake is a species of highly venomous snake in the family Elapidae, according to the Owlcation page . They are usually not aggressive, but are actually capable of injuring humans around them with ease. 5. Zweifel beaked snake The Zweifel's beaked is endemic to the waters of Papua New Guinea and the coast of Australia. When mature, this snake can reach 1.5 meters in length, making it one of the largest sea snakes in the world. This snake can be easily identified by its elongated head, round snout, and grayish-brown color. They are highly venomous snakes from the Elapidae family. According to the DoveMed page , snake bites are usually painless and so often go unnoticed. However, its bite can cause life-threatening fatal poisoning if not treated quickly and properly. Snake venom consists of a mixture of potent neurotoxins and myotoxins, which can cause systemic symptoms, such as severe fatigue, muscle weakness, respiratory failure, and complete paralysis. Symptoms of a snakebite usually appear a few hours after the bite. 6. Banded sea kraits Banded sea kraits are sea snakes that like to hunt eels. Reported by the Oceana page , they paralyze their prey with a strong poison and swallow it whole. These snakes are available in abundance in the oceans. In fact, sometimes, they are caught in fishing nets or traps. Although these snakes have a strong venom, they are docile snakes that often prefer not to bite. 7. Dubois reef The Dubois reef sea snake lives around New Caledonia, Papua New Guinea, and the northern coast of Australia. They have a brown base color with a net-like pattern. According to the AZ Animals page, this snake has shorter fangs, but can release a very strong venom. The Dubois reef sea snake is a very dangerous species, even capable of injuring and killing humans with just one bite. This snake is believed to be active mainly at dawn and dusk, making it a crepuscular species. For those of you who like underwater activities, as much as possible avoid touching animals or plants that are there. Because you don't know if they are dangerous and can hurt you. Moreover, marine animals are more likely to attack and injure them when they are disturbed.
Focus Groups are a great method of obtaining information from your target audience as an alternative to surveys. A focus group is a controlled group interview of samples from a target audience facilitated by researchers. Depending on the kind of data you wish to obtain, a focus group can be an excellent resource for a business as it gives you deeper insights into a particular subject or product that you are researching. In conducting research, it's crucial to take note of one's objectives, as those goals can also determine what kind of research methods you can use. If you need specific insights that cannot be picked up by mere observation, then qualitative methods such as focus group discussions (FGDs) will serve your purpose well. How Is It Done? Focus group research is done by first gathering participants determined by researchers and management as part of a research plan, and they will be given various controlled questions by a moderator. These questions prompt conversations between participants about the subject of the session, such as a product. The researchers take note of the conversations and questions the participants have while also observing the way they react and interact with the product and among themselves. Why a Focus Group Is Good for Your Research As mentioned previously, a focus group is a great asset for research as it will help you understand your target audience's preferences better. A focus group probes its participants' perceptions and beliefs about a particular subject. This provides you invaluable information that you can use to create or improve your product or service. This group interview typically lasts no more than 90 minutes to maintain the interest of participants. Within this short amount of time, a huge amount of data can be recorded as the researchers can also study the participants' facial expressions, reactions, body language and other non-verbal signs. These data can be used in various design aspects, such as interface design, and many more areas. Conversations between the participants and the moderator can go further to reveal more insights that you may have not previously thought about. This can contain information such as top-of-mind features they want to have, competitor activity, and industry information, among others. Once you have plenty of great insights about your customers and their preferences, you can maximise the use of information obtained from FGDs. Market Research Focus Group Vs Usability Testing As with every research method, there are times using a focus group is optimal and when it is not. As an example, FGD is a good tool when conducting market research. A market research focus group can help you discover which groups of people are best targeted for your market. On the other hand, finding out if your target market can make full use of your product requires another type of research. For such purposes, usability testing is a great way to find out if your intended users are satisfied with the products and services you are offering. These two research methods are radically different in terms of purpose and results, but both complement each other as it pushes you to focus on what your customer wants. The Do's And Don'ts of a Focus Group When conducting an FGD, there are, of course, do's and don'ts that you need to be mindful about. For example, it's always best to be modest and objective in facilitating the group, maintaining a balanced, cooperative atmosphere. Being impartial to the study will also invite the participants to share their thoughts with you more honestly. Another thing to do is be empathetic with people; try and make them feel comfortable with the discussion by praising and thanking them for participating in the study. Some other things you need to keep in mind is that you should not ask leading questions or questions that suggest that you're looking for a specific answer. "Yes or no" questions are also not advisable as these questions don't open up a discussion. Another thing to keep note of is to allow them to speak freely without interruption, always welcome their contributions, and encourage them to freely express their opinions. After reading this article, you might think that you might want to conduct a focus group discussion for your research. One easy way to do this is to work with highly reliable researchers or research agencies that can get you the results that you need. When looking for people to conduct a focus group discussion, Singapore based agencies like User Experience Researchers Singapore (USER) can be your best investment. We at USER SG can provide you with all the talent necessary to conduct a successful focus group. Feel free to reach out to us and enquire at https://www.user.com.sg/contact/
What is hex file format for PIC18F devices? HEX FILE FORMAT FOR PIC18F DEVICES A Microchip format Hex file is an extended Intel Hex file with code, data, configuration bytes and user ID included. You need to select output file type as INHX32. This is 32-bit addressing as Configuration bytes are stored above 64KB, which is the limit for 8-bit Intel Hex format, INHX8. What is the HEX file format for a microchip? These directives will add the Configuration bytes to the output Hex file, which is described next. A Microchip format Hex file is an extended Intel Hex file with code, data, configuration bytes and user ID included. You need to select output file type as INHX32. Why do we need Intel HEX file format? We often come across a problem where an understanding of Intel Hex file format will help in solving a programming issue or technical point. Intel Hex format is a standard layout for files produced by assemblers or C compilers when they compile your source code. It is used by device programmers to program the target microcontroller with your code. How big is a hex file on a PIC microcontroller? The newer PIC16F1xxx devices are bigger, with the latest having 64KB of program space. To accommodate this larger flash memory, the other data in the hex file was moved above 64KB and Extended or Linear addressing is required to access this – see PIC18F section for a full description of these addressing modes. What should be included in a PIC HEX file? Microchip have scored a winner over Atmel AVR by including all the information required to program a PIC microcontroller in one Hex file. This includes code, EEPROM data, User bytes (User ID) and most importantly, configuration words. How to find PIC16F examples in microchip C? PIC16F examples in Microchip C or assembler use __Config directive, for example, Check your compiler documentation for more details. Configuration bit names vary from PIC device to PIC device, see "Special Features of CPU section" in PIC device datasheets for details about configuration bytes.
Bringing a hospital bed into your home can greatly improve comfort and mobility for individuals with medical needs. Whether it's for temporary recovery or long-term care, properly setting up, using, and maintaining a hospital bed is crucial for ensuring safety and comfort. In this guide, we'll walk you through the steps to effectively manage a hospital bed in a home environment. Setting Up the Hospital Bed: Choose the right location: Select a spacious area in the home where the hospital bed can be placed without obstructing movement. Ensure there's easy access to electrical outlets for powering the bed. Assembly: Follow the manufacturer's instructions carefully to assemble the bed. This typically involves attaching the headboard, footboard, side rails, and adjusting the bed height to the desired level. Make sure all components are securely fastened. Mattress selection: Choose a suitable mattress that meets the patient's needs, whether it's for pressure relief, comfort, or specialized medical requirements. Ensure the mattress fits the bed frame properly to prevent sliding or gaps. Install safety features: If the bed comes with side rails, ensure they are properly installed and adjusted to prevent falls. Test the locking mechanisms to ensure they are secure. Using the Hospital Bed: Adjusting the bed position: Most hospital beds come with adjustable features such as the head, foot, and overall height. Adjust these settings according to the patient's comfort and medical requirements. Ensure the bed is in a position that allows easy access for caregiving tasks. Transfer assistance: When transferring the patient in or out of the bed, use proper lifting techniques or assistive devices such as transfer belts or hoists to prevent injuries to both the caregiver and the patient. Bed controls: Familiarize yourself with the bed's control panel, which typically includes buttons or switches for adjusting the bed height, raising/lowering the head and foot sections, and activating any additional features such as massage or vibration. Daily care routine: Make the bed every day to maintain cleanliness and comfort. Use linens that are soft, breathable, and easy to clean. Regularly inspect the mattress and bed frame for any signs of wear or damage. Maintaining the Hospital Bed: Regular cleaning: Wipe down the bed frame, side rails, and control panel regularly with a mild detergent and water solution to prevent the buildup of dirt and germs. Follow the manufacturer's guidelines for cleaning and disinfecting specific components. Check for wear and tear: Inspect the bed regularly for any signs of wear, loose screws, or malfunctioning parts. Replace worn-out components promptly to ensure the bed remains safe and functional. Lubrication: If the bed has movable parts such as adjustable height mechanisms or side rails, apply lubricant as recommended by the manufacturer to keep them operating smoothly. Professional servicing: Schedule regular maintenance checks with a qualified technician to ensure the bed is functioning correctly and meets safety standards. Address any repairs or adjustments promptly to prevent further damage or accidents.
fruitless Definition - 1failing to achieve the desired results; unproductive or useless - 2not producing fruit; barren Using fruitless: Examples Take a moment to familiarize yourself with how "fruitless" can be used in various situations through the following examples! Their efforts to find a solution proved fruitless. The search for survivors was fruitless. The tree remained fruitless for years. The meeting was fruitless as no agreement was reached. fruitless Synonyms and Antonyms Synonyms for fruitless Antonyms for fruitless Summary: fruitless in Brief The term 'fruitless' [ˈfruːtləs] refers to something that fails to achieve the desired results, or is unproductive or useless. It can also mean not producing fruit or being barren, as in 'The tree remained fruitless for years.' Synonyms include 'unproductive,' 'futile,' and 'pointless,' while antonyms include 'productive' and 'fruitful.' Examples of usage include 'Their efforts to find a solution proved fruitless' and 'The search for survivors was fruitless.'
The lottery is a low-odds game of chance in which winners are selected by random drawing. Prizes are often monetary, but may be in the form of goods and services. In addition to being a popular form of gambling, lotteries have also been used for decision-making in sports team drafts and the allocation of scarce medical treatment. They are a common method of raising public funds for a variety of projects, including schools, roads, libraries, churches and canals. People are drawn to the lottery for its perceived promise of wealth, but studies have shown that winning the jackpot is highly unlikely. It's important to understand the odds of winning a lottery so you can make informed decisions about purchasing tickets. Lotteries are generally considered harmless, but some argue that they prey on the economically disadvantaged by encouraging them to spend money they don't have. This spending can have devastating consequences for families and communities, especially if they are addicted to the thrill of winning. However, research shows that the vast majority of lottery participants do not consider the purchase of a ticket to be an addictive behavior. Although there are many theories about the odds of winning a lottery, it's impossible to know for sure what your chances are. You can, however, increase your odds of winning by choosing numbers that are not likely to be picked by other players. The odds of winning the lottery depend on how many numbers you choose and how quickly those numbers are chosen. To improve your odds, look for "singletons," or numbers that appear only once on the ticket. It is also possible to maximize your chances of winning by picking numbers that are less common, such as birthdays or ages. This can help you avoid having to split the prize with other winners. For example, a woman won the Mega Millions jackpot in 2016 by using her family's birthdays and the number seven. In the United States, Powerball and Mega Millions are two of the most popular lotteries. Both games offer large prizes and big brand names, which draw in the crowds. However, you should be aware that there is a much lower chance of winning if you purchase a ticket for a smaller lottery. While there's no scientific way to predict whether your ticket will win, you can learn about lottery statistics by reading the press releases posted by the lottery. Many lotteries will release detailed information about how many applications they receive for specific entry dates and other demand-related information. Another source of lottery statistics is the "singletons" graph, which shows how often each digit appears on the winning tickets. This type of graph is particularly useful for finding out if there is a pattern in the winning numbers. The best way to interpret the chart is to mark the spots where each digit has appeared. A cluster of "singletons" indicates a high probability that a winning ticket will be found in that location.
With the self-watering pots, your watering duties will be greatly reduced. Sunday, March 28, 2021 April 2021 Edible Garden Planner With the self-watering pots, your watering duties will be greatly reduced. Saturday, March 27, 2021 Keep the harvest going, do succession planting Sunday, March 21, 2021 Spring edible garden Chickweed and purslane are both chock full of nutrition but are on the invasive side. They will completely overrun a pot. A good option is to give each a pot of their own and be vigorous in pulling any volunteers that appear in other pots. Edible, nutritious "weeds" In the cool days of spring, dandelions have a mild taste and are great salad greens. As temperatures rise, harvest the new leaves for salads and the mature leaves can be used for wilted greens. Grow Cultivated Dandelions 7 Ways Dandelion Tea Can Be Good for Your Health I love adding chives and green onions to spring salads. Everything in the allium (onion/garlic) family is tasty and healthy. You can use common chives or garlic chives; both are perennial herbs that come back year after year. Chives also have beautiful flowers that are edible. Common chives have pretty lavender flowers while garlic chives have white flowers. I have both in my garden. Add chives to your garden My favorite onion is the Egyptian walking onion because it does so well in my garden, it is a perennial and it propagates continuously through division and it's cool bulbets that form on the tips of its stems in summer. I use the bottoms for a cooking onion and the tops as you would chives. Egyptian walking onions Arugula is a green that gets spicier as it warms up outside. It has a peppery flavor to my tastebuds. I grow rocket arugula because it is a perennial so comes back year after year. It grows wild in the Italian countryside. I just snip off what I want to add to each salad. Another perennial green is Alba and Fordhook chard. They are two of the hardiest chards. Most of the pretty colored chards likely will not make it through our Midwest winters. There is one variety, Magenta Magic, that does show good hardiness. For year round steamed greens, grow chard! Sprouting broccoli is another green that can survive winters. Sprouting broccoli- a year round fav The leaves taste just like broccoli year round and the florets are a nice bonus in the early summer. The wonderful thing about perennial greens is that they are the first ones up in the spring so you get super early, fresh from the garden salads before anyone else! There are quite a few to choose from. Want a vegetable and fruit garden that you only have to plant once? Try perennials! Other spring greens include Asian flat cabbages like tat-soi and mustard greens. I think lace leaf red and yellow mustards are very pretty and a great add to any salad. Giant Red mustard is a great self-seeding variety that grows very large, maroon colored leaves. You can harvest when they are small for salads or large for wilted greens. Lettuce and spinach are a mainstay of my garden. I try and get as many months of fresh salads as I can. In the late winter, I start planting lettuce and spinach seeds and plants. In late spring, I resow heat tolerant varieties. I sow the seed and cover lightly with soil. In early fall, I sow cold hardy varieties. Standby lettuce varieties are Simpson Elite, Red Romaine, Red Sails, and Oakleaf. I begin to harvest when there are 6-8 leaves on the plant. I take the outer leaves so the plant will continue to put on more leaves, extending the harvest for months. I grow a row of spinach and a couple of rows of lettuce. If you are growing spinach for cooking, you'll need many plants; as much as will cover a 4' by 6' area. I grow only for fresh use. I use fast growers like chard, dandelion and kale for cooked/steamed greens. Grow spinach-a super nutritious, easy green Everything you need to know about growing lettuce If you are a fan of stronger and sturdier greens, there are also the chicories, endives, escaroles and radicchios. There are a variety of colors and textures to choose from. They are grown as you would lettuce. Chicories and radicchios are perennials so as long as you harvest the outer leaves, you'll have the plants year after year. A spring garden would not be complete without radishes. They grow super fast. I like the flavor of the white radishes. For radishes, sow 1/2" deep in loose soil. Many recommend sowing with carrots as the radishes will be harvested before the carrots start developing their root and both like the same soil. If you are more of a turnip or beet fan, you can plant turnips or beets in with the radishes. I usually grow a short row of radishes, beets and turnips combined. I let me carrots go to seed and now I have volunteer carrots all over the garden. Easy to grow crispy, peppery radishes Grow crunchy, colorful carrots practically year round All about beautiful beets All about turnips For artichoke lovers, spring is the season to put out your artichoke plants. Artichokes are perennials and may not bud in the first season. Be sure you get plants rated for your zone. Violetta is a variety that is hardy up to Zone 6. Plant after danger of frost, but early enough that it will still receive 10-12 days of temperatures under 50 degrees F. It has to have this level of cold to induce budding. I like growing purple, blue and rose potatoes because they are unusual and you don't see them in the store that often. They should be planted 4-6 weeks before your last frost. That is mid-March for our area. We like growing them in potato boxes my husband made. We plant the tubers at the bottom of the box and just add soil as the leaves and stems grow. Time to plant potatoes, even if you only have a patio You can transplant any fruit trees or shrubs in the spring. This is the season for strawberries. Give them room to run. Strawberries can fruit at different times so you can pick a variety to get an extended harvest. I like Alpine strawberries. They are small, but give many fruits over a long period of time and are very sweet. Fruit for small spaces If you really have spring fever and starting seeds indoors just isn't scratching the itch, you can start peas outdoors right now. You can start greens and root vegetables under cover as soon as the soil is workable. Extend the season with protection for plants Saturday, March 20, 2021 What's happening in the late March edible garden Overwintering cabbage and broccoli \| Sunday, March 14, 2021 Edible transplants have arrived! Sunday, March 14, 2021 For those that don't have a lot of time, are just getting started in gardening or just want a jump on harvests, transplants have arrived at the big box stores! I start seed and buy transplants every year. This time of year, I will purchase spinach plants and interesting lettuces. I have seeds started as well, but purchasing plants will give me bigger plants to start harvesting from in a couple of weeks. Sunday, March 7, 2021 Time to start beets, broccoli and cauliflower seeds indoors Beets, broccoli and cauliflower are a cool season crops and great for spring gardens. Beets are typically sown in place in the garden or pot, but can be started from seeds indoors and moved outdoors. Saturday, March 6, 2021 Time to plant kohlrabi seeds Kohlrabi is a cool season lover and great for spring gardens. It is the oldest member of the cabbage family so it is sown at the same time as cabbage. It has a similar taste as broccoli. All parts, including the bulb, are edible. Tuesday, March 2, 2021 What to plant in the March edible garden March garden bed, ready for planting \| Seedlings started in an Aerogarden hydroponic system \|
Unleashing the Secrets to Successfully Cultivate Passion Fruit at Home Passion fruit, with its vibrant colors and distinct sweet-tart flavor, is a tropical fruit that has gained popularity worldwide. It is not only delicious but also packed with nutrients like vitamins A and C, fiber, and antioxidants. While passion fruit can be found in most grocery stores, cultivating it at home can be a rewarding experience. In this article, we will uncover the secrets to successfully cultivate passion fruit at home. 1. Choosing the Right Variety Before starting your passion fruit cultivation journey, it's crucial to select the right variety for your climate and growing conditions. There are two main types of passion fruit: Purple Passionfruit (Passiflora edulis) and Yellow Passionfruit (Passiflora edulis f. flavicarpa). Purple Passionfruit is more commonly cultivated for its superior taste and aroma. Consider consulting local nurseries or agricultural extension offices to determine which variety thrives best in your region. Climatic factors such as temperature, humidity, and rainfall play significant roles in successful cultivation. 2. Selecting a Suitable Location Once you've chosen the variety, find an ideal location in your garden that receives plenty of sunlight (at least six hours per day) and has well-drained soil. Passion fruit plants require warmth for optimal growth and should be protected from strong winds as they can cause damage to delicate vines. 3. Preparing the Soil Prepare the soil before planting by removing weeds, rocks, or any other debris that may obstruct root development. Passion fruit plants prefer slightly acidic soil with a pH level of 6-6.5. Enhance the soil's fertility by adding organic matter like compost or well-rotted manure. This will nourish the plants with essential nutrients while improving drainage and water-holding capacity. 4. Planting Your Passion Fruit Vine It's advisable to start growing passion fruit from already established plants rather than seeds. Visit local nurseries or garden centers to purchase a healthy, disease-free vine. Dig a hole slightly larger than the plant's root ball and gently place the vine in it. Backfill the hole with soil, ensuring that the plant is at the same level as it was in its container. Water thoroughly after planting to settle the soil around the roots. 5. Providing Adequate Support Passion fruit plants are vigorous climbers that require strong support structures to grow vertically. Install trellises, fences, or sturdy poles with wires for the vines to cling onto. As they grow, guide and train the tendrils along the support structure to prevent damage and promote upward growth. 6. Watering and Fertilizing Proper watering is essential for passion fruit cultivation. The plants need consistently moist soil but should not be waterlogged. A regular watering schedule is recommended, especially during dry periods or when fruits are developing. Apply a balanced fertilizer every few months during the growing season (spring and summer) to supply essential nutrients for healthy growth and abundant fruit production. Avoid excessive use of nitrogen-based fertilizers as they may promote vegetative growth at the expense of fruiting. 7. Pruning and Maintenance Regular pruning is crucial for maintaining passion fruit plants' health, shape, and productivity. Prune away dead or damaged growth, thin out crowded areas to improve air circulation, and remove any suckers growing from the base of the plant. Pruning also helps control diseases and pests by reducing hiding spots and improving sunlight penetration throughout the plant canopy. 8. Harvesting Ripe Passion Fruit Patience is key when waiting for your passion fruit to ripen! The fruits typically take about six months from flowering to maturity. Ripe passion fruits usually fall off on their own when gently touched or twisted. Another indication of ripeness is a change in skin color – purple varieties turn deep purple, and yellow varieties develop a golden hue. Harvest the fruits promptly to avoid overripening or decay. Cultivating passion fruit at home can be an exciting and rewarding experience. By selecting the right variety, providing suitable growing conditions, and following proper care and maintenance techniques, you can successfully grow delicious passion fruits in your own garden. So, unleash your inner gardener and get ready to enjoy the flavors of this tropical delight!
Inant of the intracellular LLO level.45,49,79 Previous research have discovered that the nature of the N-terminal residue of LLO doesn't manage the rate of its intracytosolic degradation,85 but Pamer and coworkers demonstratedlandesbioscienceHuman vaccines immunotherapeutics013 Landes Bioscience. Usually do not distribute.that the immunodominant CTL epitope (LLO919) is in a position to induce the cytosolic degradation of LLO along with a specific significant histocompatibility complex (MHC) class I-restricted immune response.45-53 Although a recent study located that LLO is usually a substrate in the ubiquitin-dependent N-end rule pathway, which recognizes LLO by means of its N-terminal Lys residue,55 the part in the LLO919 epitope is vital within the ubiquitin-proteasome-mediated proteolysis pathway. Through the intracellular multiplication of L. monocytogenes in infected mice, a marked Th1-based CTL response can be generated. Additionally, of the abundant epitopes presented by the H-2Kd MHC class I molecule, LLO919 elicits a powerful dominant response.51,52,86-88 Additionally, a prior study that aimed to Mcl-1 Inhibitor medchemexpress identify the LLO919 determinant that participates in bacterial pathogenesis revealed the value in the 919 area inside the proteolytic degradation and hemolytic activity of LLO employing site-directed mutagenesis to make mutations in the epitope or the two clusters of positive charges that flank the epitope (Fig. 1B).53 For that reason, LLO919, as a robust immunodominant epitope that may be closely correlated using the induction of LLO degradation, is capable to elicit marked CTL-restricted immune responses. This obtaining may well render LLO an appealing immunomodulatory molecule for novel anti-tumor vaccine styles. The MHC class II-restricted T cell epitope LLO21526 was identified early.50 In that study, the researchers made use of an attenuated Salmonella vaccine-Listeria infection model to analyze the capacity of the T cell epitopes of LLO to induce epitope-specific T cell responses and located that LLO 21526 could possibly be efficiently Nav1.7 Antagonist review processed and presented to T cells as element of a Salmonella flagellin-epitope fusion protein.50 A prior study showed that endosomes obtained from resting and IFN–activated macrophages containing intact LLO and LLO191 fragments could elicit an LLO18901-specific CD4 + T cell response.54 Lately, a study showed that compared with tested cognate peptides, LLO tended to be one of the strongest generators of CD4 + T cell responses.89 Owing to its salient CD4 + T cell epitopes, like LLO19001, LLO is capable of eliciting CD4 + T cell responses at unprecedented femtomolar/picomolar ([fM]/[pM]) levels and is about 3000000 times more efficient than the homologous peptides.89 Even though there was 1 amino acid variation along the length from the CD4 + T cell epitopes applied in these two studies, there is certainly no doubt that this area might be successfully processed inside the MHC class II-restricted antigen presentation pathway. The generation of tumor-specific CTL responses would be the main concentrate of anti-tumor vaccines, whose efficacy is dependent upon the successful presentation of tumor antigens by MHC class I molecules. Therefore, the interaction in between LLO, which can be in a position to disrupt acidic internalized vacuoles and effectively enter the ubiquitin-proteasome degradation pathway, and the method of tumor antigen presentation by MHC class I molecules is an alternative for the development of novel anti-tumor vaccines. LLO is really a robust immunogenic molecule and has the capability to promote adaptive immunity dominated.
How did you discover MCBAs? Bile acids were first described chemically in 1849, and Heinrich Wieland was awarded a Nobel Prize in 1927 for comprehensively describing their chemistry. This description included the final step of their synthesis — the conjugation of the amino acids taurine or glycine by our liver. Almost a century later, our discovery has revealed that the amino-acid conjugation of bile acids is a much more complex process than previously thought, and that much of it is done by our microbiome. We identified these molecules while studying the global effects of the microbiome on the biochemistry of an entire animal. We did this by comparing the metabolites in germ-free and normal mice using advanced metabolomics technologies developed in the Dorrestein lab. We dissected 29 different organs from germ-free and normal mice and compared the two groups, seeking to identify molecules unique to the microbiome. After a year of searching this massive dataset, we identified three unknown bile acids unique to the mice with a microbiome. Analysis of mass-spectrometry data elegantly revealed that these molecules had unique amino acids conjugated to the bile acid core. We quickly realized that, unlike most conjugated bile acids, these MCBAs originated from gut microbes rather than the liver. What will your project explore? Biology doesn't just happen; there is likely some selective pressure on the gut microbiome for the ability to make these molecules, but the question is why? In this next project, we hope to determine how MCBAs are made and how they affect the human gut. The project has three dimensions. Firstly, we know that the gut bacterium Enterocloster bolteae can conjugate multiple bile acids, so we will mine its genome to find the enzyme responsible. Secondly, we want to find out why MCBAs are prevalent in stools from humans and other mammals, particularly early in life, and to examine the role they may play in health. We have detected MCBAs via metabolomic analysis of 1,400 faecal samples collected from developing infants by our collaborator Julie Lumeng at the University of Michigan. We hope to link their presence in faeces with developmental and health outcomes of this infant population. This work will be led by my graduate student, Douglas Guzior. Finally, we plan to use a new knockout mouse model we have established here at Michigan State University to further explore the effects of MCBAs on the developing mouse gut. What is special about this knockout mouse model? The previously mentioned taurine- and glycine-conjugated bile acids are made by a liver enzyme called bile acid–coenzyme A:amino acid N-acyltransferase (BAAT). Our guts and those of mice are full of taurine- or glycine-conjugated bile acids made by BAAT — this confounds our study of the microbial ones, which are around 10 to 50 times less abundant. We have, therefore, developed a BAAT knockout mouse in our lab that lacks these taurine- and glycine-conjugated bile acids. By introducing MCBAs to the guts of these BAAT knockout mice, we will be able to study their biology more independently. Clearing out the highly abundant, liver-conjugated bile acids will allow us to study aspects of gastrointestinal health and disease that may be unique to MCBAs. This BAAT knockout model will have several applications beyond this project. For example, because the pathogens of many gut infections, including cholera and Clostridioides difficile, germinate only in the presence of particular conjugated bile acids, this mouse could be a useful model to study these diseases. Are MCBAs a positive or negative influence on the gut? They may be both, and it may depend on the amino acid. A diverse complement of amino acids are conjugated to bile acids by bacteria, and the resulting MCBAs have very different chemical properties. For example, we have evidence that if bacteria use a large hydrophobic amino acid like phenylalanine, the molecule becomes a potent antimicrobial. That antimicrobial activity will be lost if the bacteria conjugate with, say, serine, which is a smaller, hydrophilic amino acid. We know that MCBAs are abundant in Crohn's disease patients, but we don't yet know if that is a cause or consequence. They are also more abundant in mice fed a high-fat diet, but again we don't know why. MCBAs may be good for us or they may be bad; the chemistry of the conjugation could matter a lot. How might MCBAs be useful? We think they, or the bacteria that make them, may make good drug candidates — the 'bugs as drugs' idea. You could engineer bacterial activity to produce a particular MCBA with useful properties. For example, we know that certain bile acids are bad for us and it would be advantageous to excrete them in our stool. We have evidence that MCBAs are readily excreted in faeces, so if we could engineer a bacterium to conjugate harmful bile acids and facilitate their excretion, it could serve as a treatment for many diseases. What are your plans for future research? In the short term, we hope to improve our understanding of bile-acid signalling and metabolism and show how MCBAs interact with and affect the host. The broader, long-term goal is to use this knowledge to develop new probiotics. If we can use the bacteria that make MCBAs to generate molecules with specific beneficial properties, these could provide novel treatment options. On a final note, I never envisioned I would study the gut microbiome! I had been mostly working on lung diseases until this point. As a message to other young scientists: if you discover something unique in your research, pursue it, even if it seems to be outside your field — these are by far the most exciting moments in science.
Understanding music theory is an essential part of learning to play the piano. Knowing the basics of music theory can help you read music more easily, improvise, and compose your own music. Some essential music theory concepts for piano players include scales, chords, and intervals. Learning to read sheet music and understanding the symbols used in sheet music is also critical for piano players. Your comment will be posted after it is approved. Leave a Reply. \| AuthorJodi Ann Russell, Ed.D., M.M., B.M., N.C.T.M. is an expert piano instructor who emphasizes mindfulness, relaxation, creativity and technique in personalized piano lessons and master classes online. Archives April 2024 Categories \|
CNC machining capabilities facilitate the attainment of exceedingly precise outcomes, with select machines achieving accuracies as fine as +/-0.0025mm. Nevertheless, executing milling operations at the utmost precision level of CNC machinery entails significant expenses and time investments. This underscores the criticality of CNC machining tolerances. Given the varying precision requirements across different components, it is prudent for designers to specify the precise dimensions and tolerances essential for each part. What Do Tolerances Signify? Tolerances serve as benchmarks denoting the requisite level of precision for the manufacturing of a given part. Specifically within CNC machining, tolerances delineate the permissible degree of deviation in the final dimensions or measured values of custom machined parts. CNC machine shops gauge components using numerical parameters, typically prefaced with a ± symbol. For instance, a tolerance of ±0.001″ assigned to a 2.550-inch part signifies that the manufactured piece may have a length ranging between 2.549" and 2.551". Similarly, a part measuring 1.5 inches in height, with a tolerance requirement of ±0.005", mandates final dimensions falling within the range of 1.495" and 1.505" to meet quality standards. Stipulating standard or non-standard tolerances in engineering drawings provides CNC machining services and machinists with guidance on the requisite precision levels for part production. Tighter tolerances—characterized by smaller numerical values—demand greater precision, while looser tolerances—indicated by larger numerical values—entail comparatively less stringent precision requirements. Common Types of Tolerances in CNC Machining Standard Tolerances Machinists often adhere to standard CNC tolerances for commonly manufactured parts. This includes specific accuracy for elements like threads, pins, and pipes. Many milling services provide international standards of around +/-0.1mm, especially when customers do not specify their own tolerance levels. For a comprehensive view, refer to the detailed CNC machining chart. The scope of these standards is typically defined by various international organizations, including the International Organization for Standardization (ISO), the American Society of Mechanical Engineers (ASME), and the American National Standards Institute (ANSI). Bilateral Tolerances When employing bilateral tolerance, the deviation from the given dimension can be either negative or positive, allowing the part to be slightly larger or smaller than stated. An example is +/- 0.06mm, indicating that the machined part can be 0.06mm shorter or longer than the specified measurement. Such specifications are typically applied to exterior dimensions. Geometric Dimensioning and Tolerancing (GD&T) GD&T tolerances are much more thorough than the other systems of machining tolerances. It highlights the measurements and allowable deviations. It also outlines specific geometric characteristics for the machined part such as how flat it should be, its concentricity, and its true position. GD&T tolerances are often used for parts that have extremely precise dimensions. Unilateral Tolerances Unilateral tolerances permit deviations exclusively in one direction, either only positive or only negative. For example, a tolerance specified as +0.00/-0.06mm indicates that the finished part can be up to 0.06 mm smaller, but not larger, than the stated measurement. Such tolerances are typically employed in designs where a part must fit into another component. Ensuring the part does not exceed the specified dimensions is crucial, as a larger size would prevent it from fitting into its intended position. Limit Tolerances A limit tolerance is expressed as a range of values, where the part is fine as long as the measurement falls between that range. 13 – 13.5mm for example is a limit tolerance for CNC machining indicating that the part must have a measurement that falls between the upper and the lower limit (13mm is the upper limit and 13.5mm is the lower limit). Considerations for Selecting Tolerances in CNC Machining In CNC machining, precision in tolerances is imperative to ensure optimal part performance. The criticality of dimensional variations impacting a part's functionality underscores the importance of understanding tolerance thresholds, particularly in components like critical engine parts where precision is paramount. Conversely, some parts may tolerate marginally greater deviations without compromising functionality. When to Opt for Tight Tolerances The necessity for tighter tolerances varies across different features of a component. While the overall structure may not require strict tolerances, specific areas such as fitting or joining points demand high precision. Industries requiring precision, like aerospace and medical devices, necessitate complex tolerances to ensure flawless functionality within intricate assemblies. Enhanced accuracy in machining processes reduces error margins, vital for components interacting closely with others, where mismatches can lead to operational inefficiencies or safety hazards. Cost Implications of Tight Requirements However, achieving precision tolerances can escalate machining time and costs. Maintaining exacting standards, like ±0.001", strains CNC tools and increases wear, particularly in mass production scenarios. While a new tool may meet these standards initially, sustaining precision over repeated use becomes challenging, necessitating frequent tool changes or adjustments. This extends production times and elevates costs, especially for projects requiring numerous parts to stringent standards. Tolerances Depend on Material Characteristics Different materials exhibit unique properties that directly impact the achievable tolerance levels in CNC machining. These factors include: Achieving high precision in machining softer materials presents challenges due to their propensity to undergo dimensional changes upon contact with cutting tools. Thus, meticulous attention is necessary when working with softer materials to maintain accuracy. Materials with rough textures pose challenges during machining, as they accelerate tool wear and compromise dimensional accuracy. Managing abrasive materials often entails frequent tool changes to uphold precision throughout the machining process. Heat Stability Primarily affecting non-metallic materials, heat buildup during machining can distort shapes, limiting the applicable processes. Understanding heat stability is crucial in selecting appropriate machining techniques for specific materials. Choice of Manufacturing Methods The selection of CNC machines significantly influences manufacturing outcomes, as each machine possesses distinct capabilities and limitations. Understanding a machine's tolerance capacity is paramount, as it determines its suitability for producing different parts. Complex designs or tight tolerance requirements may necessitate supplementary operations to achieve desired precision. Given the intricacy of parts with stringent tolerances, meticulous inspection procedures are indispensable. Comprehensive inspection involves utilizing specialized measurement tools such as calipers, micrometers, optical comparators, and coordinate measuring machines (CMMs). This rigorous verification process ensures the quality and reliability of the final product, albeit at the expense of additional time and resources. How to Determine Optimal Tolerance Levels Sometimes, identifying the suitable degree of precision poses a nuanced challenge. Particularly for product or part designers, it is imperative to establish the acceptable variation range for dimensions, as this knowledge profoundly influences manufacturing decisions, project timelines, and costs. The following guidance aims to facilitate your decision-making process: Consider the Functional Requirements of Your Part The functional role of your part typically dictates the requisite precision during machining processes. Parts operating autonomously, without integration into larger systems, often necessitate less stringent tolerances in manufacturing. Given the increased expense associated with tighter tolerances, it is prudent to prioritize them only when indispensable. If your part's functionality does not mandate exceptional precision, selecting standardized tolerance levels Seeking a Reputable CNC Machining Partner Achieving precise tolerances in manufacturing necessitates collaboration with a trusted CNC machining company. Engaging in comprehensive discussions with manufacturing specialists regarding project objectives and specifications is essential to determine the optimal tolerances. Typically, engineers or part designers delineate these tolerances before engaging a CNC machining or rapid prototyping service, facilitating smoother production processes and cost efficiencies. It's imperative to note that the absence of specified tolerances when submitting a part for production often results in CNC services defaulting to their standard tolerance, typically around ±0.1 mm (±0.004 in.). While this variance may seem negligible to the untrained eye, it can significantly impact the assembly fit of the final product. For instance, a hole smaller by merely 0.005 inches can complicate the integration of its corresponding part unnecessarily. BOYI: Your Premier Partner for CNC Machining Solutions BOYI upholds machining standards in line with ISO 2768, adhering meticulously to ISO 2768-m for metals and ISO 2768-c for plastics. We excel in meeting specialized precision requirements, ensuring exact compliance with your specified parameters through our cutting-edge machining technologies. CNC Workshop: Situated in Shenzhen, China, our expansive manufacturing facility boasts a diverse array of CNC machines, including 3-axis, 4-axis, and 6-axis variants. Furthermore, we offer a variety of surface finishes for our CNC machined components. Beyond CNC machining, we extend a suite of manufacturing capabilities to our global clientele. Comprehensive Quality Assurance: Our CNC machining services encompass thorough quality inspections, material certifications, and comprehensive dimensional analyses accompanied by detailed reports. Leveraging state-of-the-art metrology tools, our full-dimensional CNC inspection process guarantees that prototypes and final parts precisely meet your specified requirements and tolerances. In essence, we meticulously verify and validate adherence to your specifications, ensuring unparalleled accuracy in every component we deliver. Contact Us: Should you have inquiries regarding CNC machining tolerances or seek further insights into BOYI's CNC machining services, feel free to reach out to a member of our manufacturing team without hesitation. We'd love to hear from you Let's Start A New Project Today Get Instant Quote Reach us through - No.23, Anshan 5th Road, Qingdao, China, qingdao, shandong 266000, CN - +86 19862621237 - email@example.com
Personal injuries can sometimes become devastating. A person may experience trauma for many years to come and even for the rest of their lives. When someone causes an injury, the victim needs to hold the at-fault party responsible. Knowing how to seek fair compensation allows victims to get the justice they deserve. Table Of Contents How Can Victims Protect Their Rights? Injured victims must work to protect their rights at all times. When insurance companies are involved, the adjuster will do everything possible to lowball the offer. To protect their rights to fair compensation, injured victims should seek help from Curtis Legal Group. Getting legal assistance allows injured victims the guidance they need for making the right decisions. Working with a lawyer allows individuals the opportunity to learn about their rights and the laws that govern personal injury cases. Injured people need to schedule a consultation appointment with a personal injury lawyer so they can learn about their options. The following offers insight into some of the benefits a person will experience by working with a lawyer. Get to know more about personal injury lawyer , visit maho-prentice.com/. - Personal injury lawyers understand the legal process and all it entails. For injured victims, the process of pursuing fair compensation can become overwhelming quickly. Having legal guidance will assist victims in making sound decisions. - Another benefit to hiring a lawyer is that the lawyer knows the case value of the victim. While it is simple for victims to add up their medical bills, it becomes more arduous to determine the value of pain and suffering. Getting a clear idea of their case value will ensure the victim does not settle for less than they deserve. - Although personal injury lawyers cannot offer any sort of guarantee, those who seek legal help improve their odds of winning their cases and being awarded fair compensation. Lawyers offer an aggressive approach to settling injury claims. - Another substantial benefit of seeking legal help is the ability to go to trial. Although a person could take their case to trial without a lawyer, this often leads to adverse outcomes. A lawyer represents their client through the entire trial process. Schedule a Consultation Appointment First After seeking medical care, one of the first things an injured party should do is schedule a consultation appointment with a lawyer. Many personal injury lawyers offer free consultation appointments for new clients. A consultation appointment proves informative, giving individuals the knowledge they need to proceed with their cases. Once the injured party hires a lawyer, the lawyer takes over every step in the process of seeking fair compensation. They investigate the injuries, gather evidence, and begin pursuing the insurance company and at-fault party. The goal of the lawyer is to get the highest level of fair compensation available for their client. Get Started Right Away Immediately after an injury, the statute of limitations time clock begins ticking. The injured party can no longer pursue compensation once the statute of limitations has passed. Now is the time to get started. With help from a lawyer, the process of pursuing compensation becomes easier for injured victims.
Quality Assurance of Distance Learning [Archives:2003/684/Education] By Dr. Bashar Ghazi Askar [email protected] Distance learning has its roots in America, Europe, Canada, and Australia since seventies of the last century. However, it has begun to establish its roots in the Asian countries. Early this century it has commenced to find its way toward the Arab world. Distance learning is not a traditional classroom regular program of the known universities, but is based on certain system designs, approval and review procedures, all of which pour into student assessment and quality control assessment. The providing institution of such programs is responsible for ensuring that programs to be offered at a distance are so designed that the academic standards of awards will be demonstrably comparable with those of awards delivered by the traditional institutions in other ways and be consistent with any relevant benchmark information recognized within the UK or USA. In designing distance learning programs of study, and any component modules, a providing university should ensure on the one hand explicit and reasoned coherence, the aims and intended learning outcomes, and, on the other hand, the strategies for teaching at a distance, the scope of the learning materials and the modes and criteria of assessment. It is significant that the providing university ensures that programs of study and component modules once designed and in use, are monitored, reviewed and subject to re-approval regularly. The university should ensure that the content of all learning materials remains current and relevant and that learning materials, teaching strategies and forms of assessment are modified in the light of findings from feedback. The providing university is responsible for ensuring that each distance learning program of study is delivered in a manner that provides, in practice, a learning opportunity which gives a fair and responsible chance of achieving the academic standards for successful completion. Learning at a distance should be treated as an activity involving all participants in the system. Monitoring, supervision, review and feedback are used regularly just like the traditional system of the universities to enhance all components of teaching, learning and the system of delivery. Quality control assessment for the distance learning programs under counseling and guidance of supervising professors is of great importance. Otherwise the programs do not meet the academic requirements and the standards of the traditional universities' programs. Students enrolled on the distance learning programs now and then are asked to attend or write or participate in seminars through the mail, fax, telephone or the Internet. Such participation provides an opportunity toward more direct contact with the supervising professors working in the field. There should be an interaction between the student and the program selected for study. The relationship between achievement and assessment, academic progress and accumulation of credits are of great significance as well. In this sense, establishing an academic standard and quality in the program design, approval and review procedures are an imparative that providing institutions fulfill for students enrolled in distance learning programs.
Glaucoma is the leading cause of blindness in the world. It affects 78M people every year – expected to grow to 111M by 2040. More than 11 million people will be blinded due to glaucoma this year (13% of all glaucoma patients)1,2,3. There is no cure yet – there are only treatments to relieve symptoms. Advance of the disease can be substantially slowed through proper treatment. It's very important to act early because lost vision cannot be regained. The most common surgical procedure used in open-angle glaucoma is a trabeculectomy (also known as filtration surgery). This procedure is invasive, requires years of surgical experience and is associated with relatively high complication and failure rates as well as prolonged visual instability. Most patients are initially treated with topical medication, but often this option is insufficient to reach the appropriate IOP, or is not tolerated due to side effects. Furthermore, in many third world countries medications are too costly and a one-time intervention is necessary. Also, low patient compliance with medications is a serious problem in Glaucoma. Thus frequently, surgery becomes necessary. Healing and scarring are the main obstacles for long term IOP control after filtration surgery. Antimetabolites such as 5-Fluorouracil (5-FU) and Mitomycin C (MMC) are frequently used to reduce scarring and improve drainage. The use of these substances is potentially hazardous and requires high expertise to prevent overfiltration and hypotony. Therefore there is a need to widen the existing surgical options for Glaucoma. Interventional Glaucoma means acting sooner & safer. Minimally Invasive Micro Sclerostomy is fast, accessible & effective. It works by inserting a specially designed cutting tool into the sclera & removing a small channel of tissue. This channel will remain open & contentiously drain, effectively reducing IOP buildup. MIMS® is a rapid & minimal procedure at the forefront of Interventional Glaucoma treatments. Fewer complications allows for effective IOP management. MIMS® is a lightweight surgical system intended for use by trained professional ophthalmologists. It's easy to learn remotely, intuitive to operate & requires fewer staff to assist in non- surgical environments. A central control screen demonstrates the parameters & a foot pedal initiates the handheld needle movement. 1. Tham YC, Li X, Wong TY, Quigley HA, Aung T, Cheng CY. Global prevalence of glaucoma and projections of glaucoma burden through 2040: a systematic review and meta-analysis. Ophthalmology. 2014 Nov;121(11):2081-90. doi: 10.1016/j.ophtha.2014.05.013. Epub 2014 Jun 26. PMID: 24974815. 2. Glaucoma Information Statistics – Glaucoma Information (glaucomapatients.org), 2024 3. Allison K, Patel D, Alabi O. Epidemiology of Glaucoma: The Past, Present, and Predictions for the Future. Cureus. 2020 Nov 24;12(11):e11686. doi: 10.7759/cureus.11686. PMID: 33391921; PMCID: PMC7769798.
Introduction: In the dynamic landscape of industrial processes and construction, the pursuit of excellence is unceasing. In this article, we delve into practical tips and methods that empower manufacturers, engineers, and builders to elevate their practices. From streamlining workflows to selecting the right materials, let's explore how small adjustments can yield significant gains in productivity and reliability. 1. Streamline Workflows with Lean Principles: It involves precise formulations and controlled reactions. Implement lean manufacturing principles to minimize waste, optimize resource utilization, and reduce production time. Identify bottlenecks, eliminate unnecessary steps, and create a seamless flow from raw materials to finished products. 2. Material Selection Matters: When working with structural steel, choose wisely. Consider factors such as load-bearing capacity, corrosion resistance, and ease of fabrication. Opt for high-quality steel grades that meet project specifications. Remember, the right material ensures durability and structural integrity. 3. Precision in Measurement and Mixing: In custom chemical batch manufacturing, accuracy is paramount. Invest in calibrated instruments for precise measurements. Follow standardized procedures during mixing and blending. Even minor deviations can impact product quality and consistency. 4. Safety Protocols Are Non-Negotiable: Whether handling chemicals or erecting steel beams, safety comes first. Train your team rigorously on safety protocols. Use personal protective equipment (PPE) and adhere to industry guidelines. A secure work environment prevents accidents and ensures smooth operations. 5. Collaborate Across Disciplines: Bridging the gap between engineers, chemists, and construction professionals enhances outcomes. Discuss challenges, share insights, and learn from each other. Cross-disciplinary collaboration fosters innovation and problem-solving. 6. Embrace Technology and Automation: Leverage software for process optimization. Monitor production lines, track inventory, and analyze data. Automation reduces human error and accelerates tasks. 7. Sustainable Practices for Long-Term Impact: Sustainability matters in both fields. Opt for eco-friendly chemicals and explore recycled steel options. Minimize waste, recycle byproducts, and invest in energy-efficient processes. Responsible practices benefit the environment and your bottom line. 8. Material Storage and Handling: Properly store chemicals and steel materials. Follow guidelines for temperature control, humidity, and ventilation. Avoid exposure to direct sunlight or extreme conditions. Well-maintained storage ensures material integrity. 9. Batch Documentation and Traceability: Maintain detailed records for each chemical batch. Document raw material sources, quantities, production dates, and quality checks. Traceability is essential for troubleshooting and quality assurance. 10. Surface Preparation for Steel: Before welding or painting, prepare steel surfaces meticulously. Remove rust, scale, and contaminants. Proper surface treatment ensures strong welds and optimal coating adhesion. 11. Calibration of Instruments: Regularly calibrate measuring instruments used in chemical processes. Accurate measurements impact product consistency. Similarly, ensure that gauges and measuring tools for steel fabrication are calibrated. 12. Emergency Response Plans: Develop contingency plans for chemical spills, leaks, or steel-related accidents. Train personnel on emergency procedures. Quick and effective responses prevent escalation. 13. Supplier Relationships: Cultivate strong relationships with chemical suppliers and steel manufacturers. Understand their capabilities, lead times, and quality standards. Reliable suppliers contribute to smooth operations.
In right this moment's enterprise world, buyer care service performs an necessary position in guaranteeing loyalty and buyer satisfaction. Understanding and analyzing the feelings expressed throughout interactions might help improve the standard of buyer care. Sentiment evaluation on buyer care audio knowledge acts as a strong device for reaching this purpose. On this complete information, we'll discover the complexities of conducting sentiment evaluation on buyer care audio recordings, offering an in depth roadmap for implementation. Studying Targets - Be taught to construct a Flask internet utility that makes use of AWS. - Be taught the process of conducting sentiment evaluation. - Be taught the calculations concerned in sentiment evaluation. - Perceive the best way to extract the required knowledge and acquire insights from this evaluation. This text was revealed as part of the Knowledge Science Blogathon. Process of Performing Sentiment Evaluation Stage 1: Making ready the Knowledge Understanding the Activity: To carry out sentiment evaluation on the shopper care audios out there and supply insights from the outcomes. Making a Flask Utility: Constructing a Flask internet utility that makes use of Amazon Internet Companies (AWS) comprehend to do evaluation. This utility is the muse for our undertaking. Importing Audio Recordings: The decision recording needs to be saved in a database like an AWS S3 bucket to begin the evaluation. Creating Consumer Interface: Making a user-friendly interface may be very essential. That is achieved utilizing CSS, HTML, and JavaScript. This interface helps customers to pick names, dates, and occasions. Getting the Inputs: Consumer inputs like Names, Starting Date and Time, and Finish Date and Time are captured to customise the evaluation course of. Fetching Recordings: Steering to fetch recordings from the S3 bucket inside the chosen time interval is given. Audio Transcription: The center of sentiment evaluation lies within the transcribed textual content. This part explores how AWS Transcribe converts spoken phrases from the out there recordings into textual content for Stage 2: Analyzing the Knowledge Performing Sentiment Evaluation: Analyzing the transcribed textual content is necessary for this information. Step one of this part is to divide giant volumes of textual content into manageable chunks. The subsequent step is to carry out sentiment evaluation on every chunk. Calculating Sentiment Metrics: The subsequent is to derive significant insights. We'll calculate the common of all sentiment scores and calculate the Web Promoter Rating (NPS). NPS is a essential metric that quantifies buyer or worker loyalty. The components for NPS is as follows: NPS = ((Whole Positives / Whole Data) – (Whole Negatives / Whole Data)) * 100 Creating Pattern Charts: This helps to Perceive traits over time. We'll information you to create visible pattern charts that illustrate the progress of sentiment scores. These charts will cowl optimistic, unfavourable, combined, and impartial values and NPS. End result Web page: On the closing step of our evaluation, we'll create a consequence web page that showcases the results of our evaluation. This web page will current a report on sentiment metrics, pattern charts, and actionable insights drawn from buyer care interactions. Now let's start our sentiment evaluation, following the above process. Importing Obligatory Libraries On this part, we import important Python libraries which are basic to constructing our Flask utility, interacting with AWS companies, and performing varied different duties. from flask import Flask, render_template, request import boto3 import json import time import urllib.request import requests import os import pymysql import re import sys import uuid from datetime import datetime import json import csv from io import StringIO import urllib Importing Audio Recordings Earlier than beginning our name recording evaluation, the recordings have to be simply accessible. Storing the recordings in areas resembling an AWS S3 bucket helps in simple retrieval. On this examine, we now have uploaded the worker and buyer recordings as separate recordings in a single folder. Creating Consumer Interface Utilizing CSS, HTML, and JavaScript, a visually interesting consumer interface is created for this utility. This helps the consumer to pick inputs resembling Names and dates from the offered widgets. Getting the Inputs We use our Flask utility to get data from the consumer. To do that, we use the POST methodology to collect particulars like worker names and date ranges. We will then analyze the feelings of each the worker and the shopper. In our demonstration, we're utilizing the worker's name recordings for evaluation. We will additionally use the decision recordings of the shoppers who work together with the worker as an alternative of the worker's calls. We will use the next code for this. @app.route('/fetch_data', strategies=['POST']) def fetch_data(): title = request.type.get('title') begin_date = request.type.get('begin_date') begin_time = request.type.get('begin_time') begin_datetime_str = f"{begin_date}T{begin_time}.000Z" print('Start time:',begin_datetime_str) end_date = request.type.get('end_date') end_time = request.type.get('end_time') end_datetime_str = f"{end_date}T{end_time}.000Z" Fetching Recordings To start our evaluation, we have to get the audio recordings from their saved location. Whether or not they're in an AWS S3 bucket or another database, we now have to observe sure steps to get these recordings, particularly for a selected time interval. We should always be sure we offer the proper folders containing the recordings of workers or clients. This instance reveals the best way to get recordings from an S3 bucket. # Initialize the S3 consumer s3 = boto3.consumer('s3') # Specify the S3 bucket title and the prefix (listing) the place your recordings are saved prefix = 'recordings/' response = s3.list_objects_v2(Bucket=bucket_name, Prefix=prefix) # Iterate by means of the objects and fetch them for obj in response.get('Contents', []): # Get the important thing (object path) key = obj['Key'] # Obtain the item to a neighborhood file local_filename = key.cut up('/')[-1] s3.download_file(bucket_name, key, local_filename) print(f"Downloaded {key} to {local_filename}") besides Exception as e: print(f"An error occurred: {e}") Audio Transcription Turning spoken phrases from audio into textual content is difficult. We use a helpful device referred to as Amazon Internet Companies (AWS) Transcribe to do that job mechanically. However earlier than that, we clear the audio knowledge by eradicating components the place nobody is speaking and altering conversations in different languages to English. Additionally, if there are a number of folks speaking in a recording, we have to separate their voices and solely concentrate on the one we wish to analyze. Nevertheless, for the interpretation half to work, we'd like our audio recordings in a format that may be accessed by means of an internet hyperlink. The code and rationalization beneath will present you ways this all works. Implementation Code: transcribe = boto3.consumer('transcribe', region_name=AWS_REGION_NAME) def transcribe_audio(audio_uri): job_name_suffix = str(uuid.uuid4()) # Generate a novel job title utilizing timestamp timestamp = str(int(time.time())) transcription_job_name = f'Transcription_{timestamp}_{job_name_suffix}' settings = { 'ShowSpeakerLabels': True, 'MaxSpeakerLabels': 2 response = transcribe.start_transcription_job( Media={'MediaFileUri': audio_uri}, transcription_job_name = response['TranscriptionJob']['TranscriptionJobName'] # Anticipate the transcription job to finish whereas True: response = transcribe.get_transcription_job( standing = response['TranscriptionJob']['TranscriptionJobStatus'] if standing in ['COMPLETED', 'FAILED']: print("Transcription in progress...") transcript_text = None if standing == 'COMPLETED': transcript_uri = response['TranscriptionJob']['Transcript']['TranscriptFileUri'] with urllib.request.urlopen(transcript_uri) as url: transcript_json = json.masses(url.learn().decode()) transcript_text = transcript_json['results']['transcripts'][0]['transcript'] print("Transcription accomplished efficiently!") print('Transribed Textual content is:', transcript_text) print("Transcription job failed.") # Examine if there are any transcripts (if empty, skip sentiment evaluation) if not transcript_text: print("Transcript is empty. Skipping sentiment evaluation.") return None return transcript_text Job Initialization: Specify a novel title and language code (on this case, 'en-US' for English) to provoke an AWS Transcribe job. Transcription Settings: We outline settings for the transcription job, together with choices to indicate speaker labels and specify the utmost variety of speaker labels (helpful for multi-speaker audio). Begin Transcription: The job will get began utilizing the start_transcription_job methodology. It asynchronously transcribes the offered audio. Monitor Job Progress: We periodically test the standing of the transcription job. It could possibly be in progress, accomplished, or failed. We pause and await completion earlier than continuing. Entry Transcription Textual content: As soon as the job is accomplished efficiently, we entry the transcribed textual content from the offered transcript URI. This textual content is then out there for sentiment evaluation. Performing Sentiment Evaluation Sentiment evaluation is a giant deal in our evaluation work. It's all about understanding the emotions and context within the written textual content that comes from turning audio into phrases. To deal with a lot of textual content, we break it into smaller components. Then, we use a device referred to as AWS Comprehend, which is nice at determining if the textual content sounds optimistic, unfavourable, impartial, or if it's a mixture of these emotions. Implementation Code: def split_text(textual content, max_length): # Cut up the textual content into chunks of most size chunks = [] begin = 0 whereas begin < len(textual content): finish = begin + max_length chunks.append(textual content[start:end]) begin = finish return chunks def perform_sentiment_analysis(transcript): transcript = str(transcript) # Outline the utmost size for every chunk max_chunk_length = 5000 # Cut up the lengthy textual content into smaller chunks text_chunks = split_text(transcript, max_chunk_length) # Carry out sentiment evaluation utilizing AWS Comprehend comprehend = boto3.consumer('comprehend', region_name=AWS_REGION_NAME) sentiment_results = [] confidence_scores = [] # Carry out sentiment evaluation on every chunk for chunk in text_chunks: response = comprehend.detect_sentiment(Textual content=chunk, LanguageCode="en") sentiment_counts = { # Iterate over sentiment outcomes for every chunk for sentiment in sentiment_results: sentiment_counts[sentiment] += 1 # Decide the bulk sentiment aws_sentiment = max(sentiment_counts, key=sentiment_counts.get) # Calculate common confidence scores average_neutral_confidence = spherical( sum(rating['Neutral'] for rating in confidence_scores) / len(confidence_scores), 4) average_mixed_confidence = spherical( sum(rating['Mixed'] for rating in confidence_scores) / len(confidence_scores), 4) average_positive_confidence = spherical( sum(rating['Positive'] for rating in confidence_scores) / len(confidence_scores), 4) average_negative_confidence = spherical( sum(rating['Negative'] for rating in confidence_scores) / len(confidence_scores), 4) return { 'aws_sentiment': aws_sentiment, 'average_positive_confidence': average_positive_confidence, 'average_negative_confidence': average_negative_confidence, 'average_neutral_confidence': average_neutral_confidence, 'average_mixed_confidence': average_mixed_confidence Breaking Down the Textual content: To deal with lots of textual content extra simply, we cut up the transcript into smaller components that we are able to handle higher. We'll then look into these smaller components one after the other. Understanding Feelings: We use AWS Comprehend to determine the feelings (like optimistic, unfavourable, impartial, combined) in every of those smaller components. It additionally tells us how positive it's about these feelings. Preserving Depend of Feelings: We observe down what number of occasions every emotion comes up in all these smaller components. This helps us know what most individuals are feeling general. Discovering Confidence: We calculate a mean rating for the way positive AWS Comprehend is concerning the feelings it finds. This helps us see how assured the system is in its outcomes. Calculating Sentiment Metrics After performing sentiment evaluation on particular person chunks of textual content, we proceed to calculate significant sentiment metrics. These metrics present insights into the general sentiment and buyer or worker notion. Implementation Code: consequence = perform_sentiment_analysis(transcript) def sentiment_metrics(consequence): # Initialize variables to retailer cumulative scores total_positive_score = 0 total_negative_score = 0 total_neutral_score = 0 total_mixed_score = 0 # Counters for every sentiment class count_positive = 0 count_negative = 0 count_neutral = 0 count_mixed = 0 # Course of the fetched knowledge and calculate metrics for document in consequence: sentiment_value = aws_sentiment positive_score = average_positive_confidence negative_score = average_negative_confidence neutral_score = average_neutral_confidence mixed_score = average_mixed_confidence # Depend occurrences of every sentiment class if sentiment_value == 'POSITIVE': count_positive += 1 elif sentiment_value == 'NEGATIVE': count_negative += 1 elif sentiment_value == 'NEUTRAL': count_neutral += 1 elif sentiment_value == 'MIXED': count_mixed += 1 # Calculate cumulative scores total_sentiment_value = max(sentiment_value) total_positive_score += positive_score total_negative_score += negative_score total_neutral_score += neutral_score total_mixed_score += mixed_score # Calculate averages total_records = len(consequence) overall_sentiment = total_sentiment_value average_positive = total_positive_score / total_records if total_records > 0 else 0 average_negative = total_negative_score / total_records if total_records > 0 else 0 average_neutral = total_neutral_score / total_records if total_records > 0 else 0 average_mixed = total_mixed_score / total_records if total_records > 0 else 0 # Calculate NPS provided that there are data if total_records > 0: NPS = ((count_positive/total_records) - (count_negative/total_records)) * 100 NPS_formatted = "{:.2f}%".format(NPS) NPS_formatted = "N/A" # Create a dictionary to retailer the calculated metrics metrics = { "total_records": total_records, "overall_sentiment": overall_sentiment, "average_positive": average_positive, "average_negative": average_negative, "average_neutral": average_neutral, "average_mixed": average_mixed, "count_positive": count_positive, "count_negative": count_negative, "count_neutral": count_neutral, "count_mixed": count_mixed, "NPS": NPS_formatted return metrics Cumulative Scores: We begin by organising some variables to maintain observe of the overall scores for optimistic, unfavourable, impartial, and combined emotions. These scores will add up as we undergo all of the analyzed components. Counting Sentiments: We maintain counting what number of occasions every sort of emotion reveals up, similar to we did after we had been determining the emotions earlier. Discovering Averages: We work out the common scores for feelings and the general temper based mostly on what most individuals appear to be feeling. We additionally calculate one thing referred to as the Web Promoter Rating (NPS) utilizing a particular components we talked about earlier. Creating Pattern Charts To see how feelings change over time, we create pattern charts. These are like photos that visually signify whether or not feelings are rising or reducing. They assist corporations determine any patterns and use this data to make good choices based mostly on knowledge. Knowledge Aggregation: We calculate the common sentiment scores and NPS values for every week. These values are saved in dictionary format and will likely be used to create pattern charts. Calculating Week Quantity: For every audio recording, we decide the week by which it occurred. That is necessary for organizing knowledge into weekly traits. Calculating Averages: We calculate the common sentiment scores and NPS values for every week. These values will likely be used to create pattern charts. Results of the Sentiment Evaluation After the evaluation, we are able to create the consequence web page, as proven beneath. This web page offers the general report, like the overall variety of recordings, complete name length, and so forth. Additionally, it shows charts representing the common scores and traits. We will additionally seize unfavourable scores and their particulars individually. In right this moment's fast-paced enterprise world, understanding what clients really feel is essential. It's like having a secret device to make clients happier. Sentiment evaluation of audio name recordings helps to realize insights into buyer interactions. This text defined the steps of conducting sentiment evaluation, from turning audio into textual content to creating pattern charts. First, we used instruments like AWS Transcribe to assist us convert spoken phrases from these audio transcriptions into readable textual content. The sentiment evaluation then assessed the feelings and context and categorized them as optimistic, unfavourable, impartial, or combined sentiments. The sentiment metrics concerned aggregating scores and calculating the Web Promoter Rating (NPS), which might then be plotted on charts and graphs to determine points, monitor progress, and enhance loyalty. Key Takeaways - Sentiment evaluation is a strong device for companies to grasp suggestions, make enhancements, and ship buyer experiences. - Sentiment adjustments over time might be visualized by pattern charts, serving to organizations make data-driven choices. Steadily Requested Questions Ans. Sentiment evaluation determines the emotional tone and context of textual content knowledge utilizing the NLP method. In buyer care, the sort of evaluation helps organizations perceive how clients really feel about their services or products. It's essential as a result of it offers actionable insights into buyer satisfaction and permits companies to enhance their companies based mostly on buyer suggestions. It helps to see how workers are interacting with clients. Ans. Audio transcription is the method of changing spoken phrases in audio into written textual content. In sentiment evaluation, it's the very first thing we do. We use instruments like AWS Transcribe to vary what folks say in a name into phrases a pc can perceive. After that, we are able to take a look at the phrases to see how folks really feel. Ans. Sentiments are often categorized into 4 most important classes: Constructive, Unfavorable, Impartial, and Blended. "Constructive" signifies a optimistic sentiment or satisfaction. "Unfavorable" displays dissatisfaction or a unfavourable sentiment. "Impartial" says lack of optimistic and unfavourable sentiment, and "Blended" means mixing up optimistic and unfavourable feelings within the textual content. Ans. NPS is a quantity that tells us how a lot folks like an organization or service. We discover it by taking the proportion of people that prefer it (optimistic) and subtracting the proportion of people that don't prefer it (unfavourable). The components seems like this: NPS = ((Constructive Folks / Whole Folks) – (Unfavorable Folks / Whole Folks)) * 100. The next NPS means extra blissful clients. Ans. Pattern charts are like photos that present how folks's emotions change over time. They assist corporations see if clients are getting happier or sadder. Firms can use pattern charts to search out patterns and see whether or not their enhancements work. Pattern charts assist corporations make good selections and might test their adjustments to make clients blissful. The media proven on this article shouldn't be owned by Analytics Vidhya and is used on the Writer's discretion.
With years of experience as a family run business, Elite Garage Door & Gate Repair Of Seattle has secured and repaired many garage doors in homes and businesses in the area. We understand that malfunctions and damage can arise at any time and we have put together this handy Garage Door FAQ tool to assist you in identifying and accessing the situation. Should you have any other concerns or queries, please contact a dedicated and trained specialise directly on 206.934.1234. The incessant clanking and rattling of a garage door can be more than just a nuisance; it can disrupt peace and quiet within the home and annoy neighbors. Fortunately, there are several strategies homeowners can employ to minimize noise from Garage Door Rollers and tracks. In this guide, we'll explore effective solutions for quieting your garage door and restoring tranquility to your living space. Adding windows to a garage door can significantly enhance the overall appearance of your home's exterior while providing practical benefits such as increased natural light and improved ventilation. Many homeowners are drawn to incorporating windows into their garage doors for a more visually appealing and welcoming facade. Whether you prefer traditional designs or contemporary styles, garage door windows offer a versatile way to customize the look of your garage while enhancing its functionality. Customizing the design of your garage door allows you to tailor its appearance to complement your home's architectural style and reflect your taste. Modern garage door manufacturers offer various design options, including materials, colors, styles, and decorative elements. Whether you prefer the timeless elegance of traditional carriage house doors, the sleek sophistication of contemporary aluminum doors, or the rustic charm of wood doors, there's a design to suit every aesthetic preference. Modern garage doors often come conveniently equipped with electronic components and smart technologies. However, these systems can malfunction, leading to operational issues. Warning signs include a non-responsive remote, flickering lights, or erratic behavior of smart features. Homeowners will learn when it's time to seek professional expertise to diagnose and address electronic and technological malfunctions for a seamless garage door experience. In conclusion, being vigilant about the signs indicating potential garage door issues is key to preventing major breakdowns and ensuring the longevity of your garage door system. Garage doors may last for decades if they are properly constructed and maintained. The user may figure out how long it will last and whether or not it needs any upkeep based on its lifetime. Choosing a stable garage door will be much easier with this information. However, garages often have insufficient lighting, making it difficult to traverse the space, causing eye strain while working on do-it-yourself tasks, and increasing the risk of falling and injury, owing to the fact that lighting plays an essential part in both your work and the overall atmosphere. Many residents say garage doors are integral to many Western Australian homes. This massive piece of equipment makes it simple to enter your house by just pressing a button. Additionally, it raises your home's curb appeal. Even if we don't give it much thought, we nevertheless rely on our garage doors daily. Also, it is a protective barrier to keep our automobiles and personal things safe in our garage. Automated garage doors have made life a whole lot easier. You no longer have to go through the tedious task of manually opening and closing your door. A press of one button and the door magically opens by itself. However, as is with every piece of machinery, a garage door can have multiple complications. One of them is a faulty door sensor. Have you ever wondered why your Garage Door Reverses when something comes in its path? There must be some mechanism for it. If that's what you are thinking, you are right! Each garage door has a safety sensor that protects it from closing onto anything in its path. As a rule of thumb, garage door openers are essential devices that tend to survive for many years to come. The typical lifetime of a garage door opener is 10 to 15 years, but if you maintain the rollers and springs regularly, you may get 20 years or more out of one. Buying a new garage door opener may be justified by the more excellent safety, security, and convenience that newer versions provide. If you accidentally back into your garage door and damage its panels, there's nothing to be ashamed of. It is common for people to hit the accelerator instead of the brake when taking vehicles out or for cars to crash into doors during the winter because they slide on the slippery ice. However, you should be concerned with dealing with this problem straight away. As we mentioned earlier, not doing so can cause serious security issues (and affect your home's curb appeal). A garage door is, without a doubt, a necessity in any household. It is used quite often throughout the day to access the garage. Moving vehicles in and out of the garage is a daily thing. Hence, the importance of the door can be deduced from this. However, have you ever thought about what movements each garage door part makes that opens or closes it? Have you ever wondered what this constant movement and application of force might do to these different parts? Let's look at a few tips to deal with a noisy garage door. The answers to all these questions are mentioned below in detail.
As a practitioner in the field of speech therapy, continuous improvement and staying updated with the latest research is crucial for providing the best possible care to your students. One seminal piece of research that can significantly enhance your understanding and skills is "Speech and Cortical Functioning," reviewed by Mary Lois Marckworth. This blog will delve into the key takeaways from this research and how you can apply them in your practice. Understanding the Research "Speech and Cortical Functioning" is a collection of papers presented at a symposium held at the University of British Columbia in 1972. The symposium aimed to scrutinize the underlying phonetic theory of Chomsky and Halle's "Sound Pattern of English." Despite some gaps in the publication, the research provides valuable insights into various aspects of speech physiology, acoustics, and perception. Key Takeaways for Practitioners The research highlights several areas that are particularly relevant for speech therapists: - Speech Physiology: Understanding the control mechanisms of speech production, including respiratory and laryngeal control, is crucial. Peter MacNeilage's paper discusses these aspects in detail, providing a foundation for therapists to better understand the physical processes involved in speech. - Acoustics of Speech: Osamu Fujimura's paper offers a comprehensive overview of methods for observing normal speech production and current functional models. This information is invaluable for therapists looking to refine their diagnostic and therapeutic techniques. - Units of Speech Perception: Use Lehiste's work on the units of speech perception can help therapists understand how different segments of speech are processed by the brain, aiding in the development of more effective intervention strategies. Applying the Research in Your Practice Here are some practical steps to implement the findings from this research: - Incorporate New Techniques: Utilize the methods discussed in the research to observe and analyze speech production in your students. This can help you identify specific areas that need improvement and tailor your therapy sessions accordingly. - Stay Updated: The field of speech therapy is ever-evolving. Make it a habit to read up on the latest research and attend relevant conferences and webinars. This will ensure that you are always equipped with the most current knowledge and techniques. - Collaborate and Network: Engage with other professionals in the field to share insights and strategies. Networking can provide you with new perspectives and ideas that you can incorporate into your practice. Encouraging Further Research While the research presented in "Speech and Cortical Functioning" is comprehensive, it also highlights the need for further investigation. For instance, the absence of Brenda Milner's paper on speech and cortical functioning is a gap that future research could address. As practitioners, contributing to and staying engaged with ongoing research is essential for the advancement of the field. To read the original research paper, please follow this link: Speech and Cortical Functioning.
Back Pain Specialist Low back pain is one of the most common conditions which people seek medical treatment. It can affect a person's quality of life and ability to perform work and family obligations. The treatment options for low back pain are vast, from chiropractic therapy to surgery. Dr. Koppel has over 20 years of experience in treatment low back conditions utilizing the latest minimally invasive therapeutic modalities. Treatment of Low Back Pain Dr. Koppel has developed a systematic approach to low back pain. Many interventional physicians perform epidural steroid injections, which may or may not be the right treatment option. All patients undergo a comprehensive evaluation to make sure that the right treatment is performed which will diagnose and treat the condition. The treatment of low back pain must be individualized per each patient's distinctive condition. Epidural Steroid Injections are the most common treatment performed for low back pain. It may, however, be overutilized. Our approach is to perform an individualized diagnostic and therapeutic workup of the pain condition. A vast number of treatments exist, including Trigger points, Facet and Sacroiliac Joint Injections, Selective Nerve Blocks, Radiofrequency Ablation, Diskography and Percutaneous Disk Decompression. These must be used appropriately and selectively to achieve the best outcome in the soonest time possible. Have a Question Dr. Koppel has excellent outcomes in treating pain with intervention therapy. For free consultations for Regenerative therapies visit... What are other causes of Low Back Pain? Lumbar Facet Disease The lumbar facets are the joints which run throughout the spine. Low back pain arising from facet conditions are as, if not more common than disk disease. Treating Vertebrogenic Neck & Low-Back Pain The Sacroiliac joints are the lowest joint in the spine, and commonly missed as a cause of low back pain Sacroiliac Joint Injection for Chronic Low Back and Buttock Pain Sciatica due to pinched nerves Disk herniations causing pinched nerves will cause sciatica. There are many nonsurgical options to treat this condition Chronic muscle pain Muscle pain is extremely common and can be very painful as well. Only with a thorough examination can this be differentiated from other causes of back pain
Homeowners associations (HOAs) take the lead in fostering a sense of shared responsibility and consistency in their communities. However, conflicts may occur when owners renovate or modify their homes without proper permits. Understanding the HOA's role in situations like these can help navigate a smooth resolution in these circumstances. Protecting property values and community standards HOAs have the right to regulate renovations made on the exterior of homes to keep a harmonious appearance in the neighborhood. Guidelines are in place to ensure changes will align with the established architectural style. By keeping home exteriors uniform, a HOA helps maintain the community's aesthetic and real estate values. Ensuring structural safety and code compliance More than its visual values, certain modifications can pose structural risks. Structural changes, such as adding a second story or modifying load-bearing walls, must comply with Texas building codes. While not a building inspector, the HOA often has access to qualified professionals who can review proposed house plans and make sure these adhere to state safety regulations. Resolving disputes amicably The HOA's role extends beyond simply enforcing rules. If a property owner can't see eye-to-eye with a HOA over construction or renovation projects, the two can take their dispute to court. Texas law mandates a fair and transparent process involving mediation or a hearing before a designated committee. Through these processes, the homeowner and the HOA can present their cases. Hearings allow a neutral party to find a resolution that adheres to the governing documents and Texas law. It's important to understand that the HOA's role isn't to be an adversary. It acts on behalf of the entire community, ensuring the well-being and continued value of everyone's property. While adhering to established procedures and pursuing solutions within the framework of the HOA's governing documents can be an efficient course of action, some disagreements may escalate to a legal dispute. In such cases, the homeowner and the HOA are entitled to seek legal counsel.
Half life questions \| Nursing School Essays 1. Radioactive isotope X has a half-life of 7 days. If 598 MCi of substance X is released into the environment, how much will remain after 33 days? 2. If a sample of I-131 is allowed to sit for 48 days some of the radioactive material will have undergone decay. If the half-life of I-131 is 8 days and the sample started out with a content of 600MCi, what is the content at the end of 48 days?
LAPIP, or Laser-Assisted Periodontal Therapy, is an innovative and minimally invasive treatment option for managing gum disease, also known as periodontitis. In this article, we'll delve into what LAPIP entails, how it works, and its benefits for patients seeking effective periodontal care. What is LAPIP? LAPIP is a type of periodontal laser treatment specifically designed to target and eradicate bacteria and infected tissue in the gums surrounding teeth affected by periodontitis. Unlike traditional gum surgery, which involves cutting and suturing, LAPIP utilizes advanced laser technology to achieve precise and targeted removal of diseased tissue while promoting the regeneration of healthy gum tissue. How Does LAPIP Work? During the LAPIP procedure, a specially calibrated dental laser is used to access and disinfect the pockets of infection that have formed between the gums and the teeth. The laser energy selectively targets and destroys the harmful bacteria causing the gum disease, while simultaneously stimulating the body's natural healing response. Key components of the LAPIP treatment process include: - Diagnosis: Before undergoing LAPIP treatment, patients undergo a comprehensive periodontal evaluation to assess the severity of their gum disease and determine the extent of treatment needed. - Laser Therapy: During the LAPIP procedure, the dental laser is used to access the periodontal pockets and remove diseased tissue. The laser energy also helps to disinfect the pockets and promote the formation of a stable blood clot, which serves as a scaffold for new tissue growth. - Healing: Following LAPIP treatment, the body's natural healing mechanisms kick in, allowing for the regeneration of healthy gum tissue and the reattachment of the gums to the teeth. Over time, this leads to a reduction in pocket depth and improved periodontal health. Benefits of LAPIP: - Minimally Invasive: LAPIP is minimally invasive compared to traditional gum surgery, as it does not involve cutting or suturing of the gums. This results in less discomfort, swelling, and downtime for patients. - Preservation of Healthy Tissue: Unlike traditional surgery, which may require the removal of healthy gum tissue along with diseased tissue, LAPIP selectively targets and removes only the infected tissue, preserving as much healthy tissue as possible. - Faster Healing: The laser energy used in LAPIP treatment helps to stimulate the body's natural healing processes, resulting in faster and more predictable healing compared to traditional methods. - Reduced Risk of Complications: LAPIP has been shown to have a lower risk of post-operative complications such as infection and gum recession compared to traditional gum surgery. - Effective Results: Studies have demonstrated that LAPIP is highly effective in treating gum disease and can lead to significant improvements in periodontal health and stability. In conclusion, LAPIP is a cutting-edge periodontal laser treatment that offers numerous advantages over traditional gum surgery. By harnessing the power of laser technology, LAPIP provides patients with a minimally invasive, highly effective, and predictable solution for managing gum disease and preserving periodontal health. If you're experiencing symptoms of gum disease or have been diagnosed with periodontitis, consider consulting with a qualified periodontist to see if LAPIP may be the right treatment option for you.
A Companion Guide to The River Quintet Series Young Lives in a Changing World - $6.99 - $6.99 Publisher Description The Companion Guide provides the teacher with a practical approach for understanding and utilizing The River Quintet series in grades 7 through 12. It starts with a focus on the value and suitability of the five historical novels for middle and high school readers. It points out the correlation of the geographical and cultural settings (northeastern woodlands, New Netherland, early Hartford, CT, and England) to a Social Studies curriculum, and shows how its literary aspects can complement an English Language Arts curriculum. Assessment questions cover both plot content and areas of critical thinking. The Guide also suggests classroom activities for students of all abilities and concludes with an extensive reference section that contains websites of some of the Iroquois and Algonquin nations featured in the series.
- Institute of Immunology and Infection Research, School of Biological Sciences, University of Edinburgh, Edinburgh, United Kingdom CD4+ αβ T-cells are key mediators of the immune response to a first Plasmodium infection, undergoing extensive activation and splenic expansion during the acute phase of an infection. However, the clonality and clonal composition of this expansion has not previously been described. Using a comparative infection model, we sequenced the splenic CD4+ T-cell receptor repertoires generated over the time-course of a Plasmodium chabaudi infection. We show through repeat replicate experiments, single-cell RNA-seq, and analyses of independent RNA-seq data, that following a first infection - within a highly polyclonal expansion - T-effector repertoires are consistently dominated by TRBV3 gene usage. Clustering by sequence similarity, we find the same dominant clonal signature is expanded across replicates in the acute phase of an infection, revealing a conserved pathogen-specific T-cell response that is consistently a hallmark of a first infection, but not expanded upon re-challenge. Determining the host or parasite factors driving this conserved response may uncover novel immune targets for malaria therapeutic purposes. Although protective natural immunity against clinical malaria is slow to develop and requires years of repeated exposure (1), protection against severe disease is obtained after a more limited number of symptomatic infections (2, 3). The acquisition of this naturally acquired immunity is mediated by both antibody [reviewed in (4, 5)] and T-cell responses (6); the latter being crucial for B-cell class switching and affinity maturation. As well as guiding the humoral response, CD4+ T-cells play a key role in restricting the growth and pathogenesis of blood-stage Plasmodium through cytokine secretion and macrophage activation [reviewed in (7)]. However, the antigenic drivers and developmental dynamics underlying this naturally acquired immunity remain poorly understood, presenting major challenges for effective vaccine design. In animal models of malaria, a Plasmodium infection in previously unexposed individuals initially produces a massive expansion of CD4+ T-cells in the spleen (8, 9), a major site of the developing immune response (10). The size of this response, together with the generation of a highly diverse range of cellular responses, suggests that the splenic expansion of CD4+ populations is highly polyclonal, as opposed to the expansion of a minor (oligoclonal) subset of the repertoire. However, it is not known whether this expansion is primarily a non-specific response, such as a result of cytokine-driven bystander activation, or whether it is dominated by antigen-specific responses generated through classic TCR-engagement mediated clonal expansion. Spectratyping (CDR3 length analysis) of T-cell receptor (TCR) β chain repertoires induced by the rodent malaria Plasmodium berghei has previously detected a unique TCRβ CDR3 length signature enhanced over the course of infection, suggesting that there may be a clonal response to specific antigenic peptides (11). In agreement with this, an expanded fraction of CD4+ T-cells and fast-responding cytokine secretors that respond to a secondary challenge has been observed following a Plasmodium chabaudi (AJ) infection in mice, indicating initial priming by the parasite, and the presence of pathogen-specific T-cells within the CD4+ T-cell population (9). Alternatively, there is evidence from P. falciparum, that the PfEMP1 binding domain, CIDR-1α, stimulates CD4+ T-cells non-specifically through TCR-independent pathways (12), and that regulatory T-cell (Treg) proliferation during an infection can be induced in an antigen non-specific manner (13). Non-specific proliferation of T-cells due to cross-reactivity in response to P. falciparum antigens has also been reported (14). Overall, proliferation is likely to be a combination of activation dynamics. However, whether a detectable clonal malaria-specific CD4+ T cell response that is conserved between individuals, and thus a potential focal target for therapeutics, is induced, has not previously been demonstrated. Advances in high-throughput TCR repertoire sequencing techniques now allow deep profiling of immune responses. This approach has been used to ascertain clonality of T-cell responses, identify expanded T-cell clones and determine if conserved or 'public' responses between individuals are generated following antigenic stimulation [reviewed in (15)]. Repertoire sequencing thus provides a novel, immune-focused approach to delineate the clonality of the developing immune response to a malaria infection. Here, using bulk TCRβ repertoire sequencing we examine the dynamics and clonal structure of the splenic CD4+ T-cell repertoires generated during infection with the well-established mouse malaria model Plasmodium chabaudi (AS). By comparing serially blood passaged (SBP) and recently mosquito-transmitted (MT) P. chabaudi infections, Spence et al. (8) demonstrated that vector transmission of P. chabaudi intrinsically modified parasite gene expression in asexual blood-stage parasites, eliciting an altered host immune response that in turn regulates parasite virulence. In this model, infection with SBP parasites leads to hyperparasitaemia with more severe disease during the acute phase of infection. In contrast, mosquito transmission (MT) attenuates parasite growth and virulence, through a mechanism associated with epigenetic reprogramming of the expression of the subtelomeric multigene families, including the variant surface antigen (VSA) family. We have used this comparative model to compare TCR repertoires integral to an immune response that rapidly controls parasite growth, against a less effective response that fails to control parasite replication and induces immunopathology (8, 16). We have sequenced the T-naive (TN), T-effector (TE), T-effector memory (TEM) and T-central memory (TCM) CD4+ splenic TCRβ repertoires elicited in mice over the time-course of both MT and SBP P. chabaudi infections. We report, for both infection types, that the TE expansion seen during the acute phase of a P. chabaudi infection is highly polyclonal. However, within this diverse expansion, a conserved pathogen-specific response characterized by TRBV3 gene usage consistently dominates the effector repertoire following a first infection, and we further profile this response using single-cell RNA-seq. Materials and Methods Mice Infections All procedures were carried out in accordance with UK Home Office regulations (Animals Scientific Procedures Act, 1986; project license number 70/8,546 and P04ABDCAA) and were approved by the Ethical Review Body of the University of Edinburgh. C57Bl/6 mice were bred and housed under specific pathogen free conditions at the University of Edinburgh and subjected to regular pathogen monitoring by sentinel screening. Mice were housed with at least one companion in individually ventilated cages furnished with autoclaved woodchip, fun tunnel and tissue paper at 21°C ± 2°C under a reverse light-dark cycle (light, 19.00 – 07.00; dark, 07.00 – 19.00) at a relative humidity of 55% ± 10%. P. chabaudi (AS) parasites were obtained from the European Malaria Reagent Repository at the University of Edinburgh. Eight- to 10-week-old C57Bl/6 female mice were infected with P. chabaudi (AS) by intra-peritoneal injection of 1x105 parasitized erythrocytes that had either been maintained by serial blood-passage over a high number of generations (SBP) or undergone a single passage following mosquito transmission (MT) as per Spence et al. (17). Each transmission group consisted of five cages of five mice, with five unchallenged mice from the same cohort used as experimental controls. Mice (n=5 per transmission group) were euthanized on days 6, 10, 20, 40, and 60 post-infection. In a repeat experiment, mice (n=4 per time-point) were infected with MT P. chabaudi (AS)-GFP (18) by intra-peritoneal injection of 1x105 parasitized erythrocytes, and were euthanized at days 4, 7, 11, and 14 post-infection. For the re-challenge experiment, mice were infected with MT P. chabaudi (AS)-GFP by intra-peritoneal injection of 1x105 parasitized erythrocytes. Mice (n=4) underwent a homologous re-challenge at day 60 post infection and were euthanized 7 days post re-challenge (day 67). To eliminate chronic infection before re-challenge, 0.288 mg/ml of chloroquine diphosphate salt (Sigma), supplemented with glucose for palatability, was dissolved in drinking water daily for 10 days, from day 30 to day 40 post-infection (19). For the single-cell RNA-seq experiment, mice (n=2) were infected with MT P. chabaudi (AS)-GFP by intra-peritoneal injection of 1x105 parasitized erythrocytes, and euthanized at day 7 post-infection. Cell Sorting CD4+ splenic T-cell populations of interest were isolated by FACS using a BD FACSAria III instrument, according to gates described by Spence et al. (8): TN (CD62L+ CD127+), TE (CD62L- CD127-), TEM, (CD44HI CD127+ CD62L-) (20), and TCM (CD44HI CD127+ CD62L+) (Supplementary Figure 1). For the repeat and re-challenge experiments, only TE and TN populations were isolated. Cells were sorted into 50 µl FACS buffer and stored at -80°C until processing. For the single-cell experiment, CD3+ CD4+ splenocytes were sorted in to 100 µl 0.04% BSA in PBS, to generate the single-cell suspension required for 10x Genomics sequencing. Unbiased Bulk TCR Amplification and Sequencing RNA was extracted from CD4+ splenic T-cell populations of interest using Dynabeads mRNA purification kit (ThermoFisher Scientific). cDNA was synthesized from each RNA preparation by adding the following to each sample: 4 µl First-strand Buffer, 2 µl 10mM dNTP mix, 2 µl 20mM DTT and 2 µl SMART-PTO2 oligo (5' AAGCAGTGGTATCAACGGAGAGTACATrGrGr 3'), 0.5 µl RNase inhibitor (Clontech 2313A), and 2 µl (100 U/µl) SMARTScribe reverse transcriptase (Clontech). For the repeat experiments, unique molecular identifiers (UMIs) (21) were incorporated during cDNA synthesis by replacing the template-switch oligo with 2 µl SMARTNNN oligo (5'AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTTrGrGrG 3'). Samples were then incubated at 42°C for 70 min, before the reaction was terminated by heating at 70°C for 10 min. cDNA synthesized with SMARTNNN oligos were treated with 1 μl of Uracil DNA glycosylase (5 U/μl, New England Biolabs) and incubated for 15 min at 37°C. PCR was then used to generate TCRβ V-region amplicons, using indexed forward primers composed of the SMART synthesis oligo sequence fused to a P7 Illumina tag, and a reverse primer within the TCR-C region fused to a P5 Illumina tag (P5-mTCRBrev3: 5' AATGATACGGCGACCACCGAGATCTACACCTTGGGTGGAGTCACATTTCT 3'). Amplified products were purified by extraction from excised agarose gel bands. Single-end 1x400bp and asymmetric 100bp+400bp (to incorporate UMIs) sequencing was performed on an Illumina MiSeq platform. Bulk TCR Repertoire Analyses Bulk TCR sequence data was initially processed using MiGEC (22) and MiXCR (23) software with default settings. Samples were excluded from further analyses if the repertoire contained fewer than 10,000 total reads after processing, as this was indicative of poor sample preservation or preparation. A combination of custom pipelines of Python scripts and VDJtools software (24) was used to analyze and plot the MiXCR output. Statistical analyses were performed using SciPy Python software (25). A TCR clone was defined by 100% amino acid sequence identity of the CDR3 region, and IMGT nomenclature used for gene usage. Only in-frame (functional) CDR3s were analyzed. A modified version of the Swarm algorithm (26) was used to cluster highly homologous CDR3 amino sequences, with identical V-gene usage, within 1 amino-acid mismatch of each other. The Gliph2 package (27) was also used to identify enriched amino acid motifs within the contact region of CDR3 sequences; the unchallenged T-naïve repertoires were used to make custom murine reference files for this. Network analyses was undertaken using Gephi (28) software (v0.9.2). Generation probability of TCRs (Pgen) was calculated using OLGA (29). Publicly Available RNA-Seq Data Analyses Raw FASTQ files from RNA-seq data obtained from the spleens of C57Bl/6 mice infected with blood-stage Plasmodium chabaudi (AS) and Plasmodium chabaudi (CB) were downloaded from the ArrayExpress archive: ENA - ERP004042 and ENA - ERP005730 respectively. For comparison of infection with other pathogens, raw FASTQ files of RNA-seq data obtained from whole blood of C57Bl/6 mice infected with a variety of pathogens, were downloaded from the NCBI short read archive, under accession SRR7821557. Normalized Trbv3 gene expression values were also obtained from Singhania et al. (30). RNA-seq data was aligned using MiXCR (23) software, and a combination of custom pipelines of Python scripts and VDJtools software (24) was used to analyze and plot the MiXCR output. Single-Cell Sequencing, Data Processing, and Analyses Two barcoded cDNA libraries were prepared from sorted samples using the Chromium Single Cell 5' Library Kit v2 (31). Full length V(D)J segments were enriched from amplified cDNA with primers specific to the TCR constant region using the Chromium Single Cell V(D)J Enrichment Kit – Mouse T-Cell. Sequencing was performed using the High-Output v2.5 Kit on a NextSeq 550 platform. Initial processing of sequence files, including mapping of reads to the mouse reference genome (GRCm38), generation of count matrixes and assembly of TCR alpha and beta chains, was carried out using CellRanger 3.1.0. To exclude potential multiplets, poor quality cells or non T-cells, single T-cells were identified by the expression of a single productive beta chain. Barcodes lacking a beta chain or assigned to multiple were excluded, leaving data from 3,333 single T-cells (1,658 and 1,675 from mouse 1 and 2 respectively). Downstream analyses were performed in R using Seurat 3.1.5 (32). Genes expressed in fewer than three cells, as well as all Trav/j and Trbv/d/j genes were excluded. Cells expressing fewer than 200, or over 3,000 genes and/or more than 5% mitochondrial genes were removed. The filtered matrix was normalized using Seurat's LogNormalize with default parameters and the top 2,000 variable genes were identified using the FindVariableFeatures 'vst' method, before centering and scaling of the matrix. Dimensionality reduction by PCA was carried out and the top 30 principal components were used as input for graph-based clustering. Clusters were visualized by UMAP. A small, poorly Cd4-expressing cluster was identified, and these cells were excluded as contaminants. The above normalization and clustering steps were repeated with the remaining 2,976 cells (1,491 and 1,485 from mouse 1 and 2 respectively). Differential gene expression analysis using the Wilcoxon rank sum test through FindAllMarkers was used to identify marker genes for each cluster. Mice were infected with P. chabaudi (AS) parasitized erythrocytes from donor mice infected with either recently MT or SBP parasites, and followed for 60 days of infection. For repeat experiments, only MT parasites were used, as these represent a less artificial experimental model. At each time point, spleens were harvested and CD4+ splenic T-cells populations of interest were isolated by FACS before RNA was extracted, reverse transcribed, and TCRβ chains amplified and sequenced. TRBV3 Gene Usage Dominates a Highly Polyclonal T-Effector Expansion Consistent with previously published data for P. chabaudi (8, 33), CD4+ splenic T-effectors (TE) reached maximum levels of expansion in the acute phase of infection, increasing by up to 10-fold. Expansion coincided with the peak of parasitemia and contracted back to pre-challenged levels between days 20 and 40 post-infection (Figures 1A, B). We first hypothesized that if the TE expansion in the acute phase of infection was solely the result of non-specific activation, V gene usage and V/J allele usage within the TE repertoire would mirror that of TN repertoires, despite the vast cellular proliferation. Thus, there would be no change in the distribution of V or V/J allele usage post parasite-challenge. However, a distinct increase in TRBV3 gene usage was observed during the acute phase of infection, differentiating challenged TE repertoires from both unchallenged TN and TE repertoires, and from challenged TE repertoires at later time-points (Figures 2A, B, Supplementary Figure 2). For MT infections during the acute phase, TRBV3 encoded on average 23.7% (± 2.03 95% CI) of the effector repertoire at day 6 and 21.6% (± 2.21 95% CI) at day 10 post-infection, compared to only 7.6% (± 0.47, 95% CI) of the unchallenged naïve repertoire. This finding was repeated in a second independent experiment (Supplementary Figure 3), and through analysis of publicly available RNA-seq data for P. chabaudi (AS) and P. chabaudi (CB) (accession E-ERAD-221 and E-ERAD-289 respectively, Supplementary Figure 4). This increase in TRBV3 usage was more delayed in SBP challenged repertoires, and not apparent until day 10 post-challenge, where at its peak it encoded 17.2% (± 2.54, 95% CI) of the TE repertoire. Figure 1 Dynamics of P. chabaudi infection: T-effector expansion coincides with peak parasitemia. (A) Parasitaemia of C57Bl/6 mice infected with either serially blood passaged (SBP) (red) or recently MT (blue) 5 x105 P. chabaudi parasitized erythrocytes, n=5 mice per infection type per time point, shaded area depicts 95% CI. (B) Phenotypic profiling of CD4+ T cells as determined by FACS. Representative frequencies over the time course of infection of T-naïve CD4+ T cells (CD62L+ CD127+), T-effector CD4+ T cells (TE) (CD62L- CD127-), effector memory (TEM) (CD44HI CD127+ CD62L-) and central memory (TCM) (CD44HI CD127+ CD62L+) CD4+T cells. Unchallenged control mice are also represented. Figure 2 TE repertoires have dominant TRBV3 gene usage during the TE expansion in acute phase of a P. chabaudi infection. (A) Clustermap displays TRBV gene proportional usage for individual splenic CD4+ T-cell receptor (TCR) repertoires from challenged acute TE repertoires (gold), challenged late phase TE repertoires (purple) and unchallenged TN and TE repertoires (green). Each column is a unique TRBV gene and each row an individual repertoire. (B) Circos plots show V/J gene usage from a representative repertoire of i) a challenged MT TE repertoire at day 6 post-infection and ii) an unchallenged TN repertoire. Band width is proportional to usage frequency. (C) Mean proportion of each V/J allelic combination in unchallenged TN repertoires versus challenged TE repertoires at days 6 and 10 post-infection for mice infected with (i) MT parasites (blue) and (ii) SBP parasites (red). Each point represents a unique V/J combination. (D) Heatmaps depict proportional usage of each V/J allelic combination (columns) for individual replicate mice (rows) for (i) unchallenged TN repertoires and acute TE MT repertoires and (ii) unchallenged TN repertoires and acute TE SBP repertoires. Data for both days 6 and 10 post-infection are displayed. Horizontal color bar indicates TRBV gene used in the V/J combination. For V/J allele combination usage, an overall strong positive correlation between challenged TE and unchallenged TN repertoires was evident during the effector expansion, indicating a highly polyclonal response with broad expansion of the naïve precursor pool. However, three specific TRBV3/J allelic combinations, TRBV3-TRBJ1-1, TRBV3-TRBJ2-4 and TRBV3-TRBJ2-7, were disproportionately increased in challenged TE repertoires of mice infected with MT parasites at both days 6 and day 10, and for SBP infections by day 10 post-infection (Figure 2C). This specific V/J usage was conserved across all individual replicate mice infected with MT parasites during the acute phase of infection (Figure 2D) and was evident in the repeat experiment (Supplementary Figures 5A, Biii). During the late phase of infection, as the TE population contracted, this conserved V/J signature was lost in both infection types (Supplementary Figures 5Bi, Bii). Changes in diversity of a TCR repertoire following pathogen exposure are indicative of the extent to which clonal expansion within a repertoire has occurred (34). To assess the diversity of the acute CD4+ TE expansion response at the clonal level, repertoire diversity was calculated using Simpson's diversity index on age-matched (35) and size-matched repertoires from the repeat experiment. This allowed us to sample an equal number of UMI-labeled cDNA molecules for the precise normalization required for comparing diversity metrics (36). Although unchallenged TN repertoires were, as expected, significantly more diverse than challenged TE repertoires (Figure 3A, p<0.01), the TE repertoires after challenge were still highly polyclonal – with the most abundant clone taking up on average only 0.72% (± 0.11%) of the repertoire compared to 0.112% (± 0.01%) in TN unchallenged repertoires (Figure 3B). Figure 3 Splenic TE repertoires elicited by Plasmodium chabaudi are highly diverse. (A) Simpson's Diversity Index (SI) for UMI-size matched unchallenged TN (green) and acute MT TE repertoires (blue). SI varies from 0 to 1, and for T-cell receptor (TCR) repertoires represents the probability that identical TCRs (as determined by identical CDR3 amino acid sequence) will be drawn from the repertoire with two independent draws. SI of 0 therefore represents maximal diversity. (B) Each point in the strip plot represents a clone and the percentage of repertoire they occupy, for individual replicate mice for TN unchallenged repertoires (green) and MT TE repertoires (blue). Data for (A, B) was normalized by down-sampling to 5000 UMI. (C) Similarity between replicate repertoires is demonstrated using the Jaccard index, a normalized sharing metric which represents the degree of clonal overlap between repertoires. Jaccard index varies form 0 (no similarity) to 1 (identical repertoires). TE replicate repertoires are more similar to each other in the acute phase of infection for both infection types. (D) Multi-dimensional-scaling (MDS) analysis using Jaccard similarity index of TE repertoires for unchallenged (yellow), MT (blue) and SBP (red) repertoires. Data for (C, D) was normalized by down-sampling to 104 reads and calculated on weighted data to include clonotype frequency. T-Effector Repertoires Have Greater Similarity During Acute Infection If a pathogen-specific response is elicited at the clonal level, we would expect challenged TE repertoires of replicate mice to contain an increased number of shared clones, and to therefore be more similar to each other than unchallenged repertoires. To examine the degree of repertoire sharing between replicate mice, the Jaccard index, a similarity or 'overlap' metric was used, matching at the CDR3 amino acid sequence level. Over the course of infection, for each infection type, similarity between replicates was significantly altered (one-way ANOVA, MT: p<0.001, SBP: p<0.001) (Figure 3C), with replicates being more similar to each other in the acute phase of infection than at later time-points. MT repertoires were also more similar to each other during the acute phase than SBP infections (day 6: t=2.6, p=0.016, day 10: t=7.2, p<0.001). For both infection types, during the acute phase, replicate repertoires were more similar to each other than to unchallenged TN (day 6: MT: t=15.13, p <0.001, SBP: t=11.7, p<0.001, day 10: MT: t=13.4, p<0.001, SBP: t=9.2, p<0.001) and unchallenged TE repertoires (day 6: MT: t=15.1, p<0.001, SBP: t=11.7, p <0.001, day 10: MT: t=13.4, p<0.001, SBP: t=9.2, p<0.001). Randomly sampling the same number of sequences (104) to produce size-matched repertoires did not alter this pattern of results, nor did size-matching the repeat UMI data (Supplementary Figure 6). Further exploration using multi-dimensional scaling (MDS) of size-matched repertoires, also indicated clustering of acute TE repertoires for both infection types according to Jaccard similarity, with MT repertoires at day 6 and 10 most tightly co-clustered (Figure 3D). The TCR repertoire is a dynamic network, so examining similarity solely at the clonal level can fail to take in to account the degree of extended clonal networks that may be present. Despite not undergoing somatic hypermutation, T-cell repertoires have been shown to contain networks generated by sequence similarity, with CDR3 sequence similarity and thus network connectivity increased in antigen-experienced repertoires (37, 38). To explore connectivity between CDR3s in the TE repertoires, network analysis was undertaken between the top 100 most abundant clones, using Levenshtein distance. Networks were constructed between replicate repertoires, by creating an edge between unique CDR3 sequences (nodes) if they were within a Levenshtein distance of one of each other (Figure 4A). Node degree (the average number of edges per node within network) for each individual indicated a higher degree of connectivity for both infection types in the acute stage of infection compared to unchallenged TE repertoires (Mann-Whitney U, (day 6: MT: p<0.01, SBP: p=0.022, day10: MT: p<0.01, SBP: p=0.045) (Figure 4Avi)). MT repertoires also tended to have a higher node degree than SBP repertoires at days 6, 10 and 20 post-infection, although significance was not detected at day 10 (Mann-Whitney U, day 6: p<0.01, day 10: p=0.088, day 20: p=0.039). Within each individual, there was also an increased frequency of CDR3 pairwise comparisons that differed by a distance of one or two for MT repertoires in the acute phase of infection compared to both SBP and unchallenged TE repertoires, highlighting their greater repertoire similarity (Figure 4B). Figure 4 Mosquito-transmitted (MT) acute repertoires have greater clonal network connectivity. (A) (i–v) Networks showing the top 100 most abundant CDR3 amino acid sequences in replicate repertoires within a Levenshtein distance of 1 of each other. For T-cell receptors (TCRs) a Levenshtein distance of 1 represents 1 amino acid mismatch (insertion, deletion or substitution) between CDR3 sequences. Each node represents a TCR clone as defined by CDR3 amino acid sequence, with node size indicating proportion of repertoire occupied by clone. Nodes are colored according to TRBV-gene usage. An edge is drawn between nodes if within a Levenshtein distance of 1, with unconnected nodes not depicted, (vi) network degree (mean number of edges per node) for each individual TE repertoire network. (B) Frequency (%) of individual CDR3 sequence pairwise-comparisons, within the top 100 most abundant CDR3 sequences of each individual TE repertoire, that are within a Levenshtein distance of 1 and 2. The Same Public Cluster Is Dominant in the Majority of Acute T-Effector Repertoires Given the increased connectivity in challenged repertoires, and the knowledge that TCRs recognizing the same antigen typically have a high global similarity to each other (38, 39), we clustered CDR3 sequences of individual repertoires within one amino acid mismatch of each other using a modified Swarm algorithm (26). This identified two clusters of highly similar CDR3 sequences, hereafter referred to as OTU1 and OTU2, that dominated TE repertoires and were conserved across replicates in the acute phase of infection (Figures 5A, B). A near-identical cluster to OTU1 was also found to be expanded and dominant in a majority of challenged repertoires at day 7 and 11 post-infection (Supplementary Figure 7B), and both clusters were also observed in analyses of publicly available RNA-seq data sets for P. chabaudi (AS) and P. chabaudi (CB) (accession E-ERAD-221 and E-ERAD-289 respectively, Supplementary Figure 7C), showing a similar temporal pattern of expansion. We also applied the recently published Gliph2 algorithm (27) to our data. Gliph2 is designed to identify TCRs recognizing the same antigen by clustering sequences with enriched amino acid motifs in the high-contact-probability region of CDR3β (IMGT positions 107-116). It identified significant clusters that corresponded to both OTU1 and OTU2 in the acute phase of MT infections, as well several other clusters which were not as dominant nor as well-conserved in their response (Supplementary Table 1, Supplementary Figure 7A). Figure 5 Acute mosquito-transmitted (MT) TE repertoires are dominated by the same cluster of clones. Repertoires were clustered using a modified Swarm algorithm, to cluster CDR3 sequences within 1 amino-acid mismatch of each other, with identical V-gene usage. (A) Strip plots display the proportion of repertoire occupied by each cluster in individual repertoires for unchallenged TN and MT and SBP TE repertoires at day 6 and 10 post-infection. Each column is an individual repertoire, with each point representing a unique cluster. Cluster OTU1 is displayed in blue and OTU2 in orange. (B) Representative amino acid sequence logos of clusters OTU1 and OTU2. (C) OTU1 CDR3 sequences have hallmarks of a public response: (i) mean number of inserted random nucleotides in CDR3 sequences, (ii) mean number of nucleotides lying between V and J gene segment sequences and (iii) convergence (mean number of unique nucleotide sequences that encode a particular CDR3 sequence), for unchallenged TN (green), unchallenged TE repertoires (yellow), all MT TE repertoires (blue) and all SBP TE repertoires (red) and for cluster OTU1 in all MT and SBP TE repertoires. (D) (i) Distributions of the generation probabilities (log10) of CDR3 nucleotide sequences for unchallenged TN (green) and TE repertoires (yellow), SBP (red) and MT (blue) TE repertoires and CDR3 nucleotide sequences of cluster OTU1 (pink). (ii) Log2 fold change of clones present in unchallenged TN repertoires versus challenged TE repertoires. Each point represents an individual clone, and Pgen is separated in to high (>−10) (black) and low (<-10) (gray). Log2FC was calculated on UMI normalized data. Given the conserved nature of OTU1 between individual mice, we hypothesized that the CDR3 sequences it contains would share similar properties with other known 'public' CDR3 sequences, defined simply as TCR clones shared by different individuals. Public TCR clones have been detected in numerous T-cell responses in multiple species, and although their functional significance remains unknown, they have been shown to be expanded in response to antigenic stimulation (40), viral infection (41, 42) and associated with regulatory self-immunity (43). In some previous studies, public sequences have been shown to have minimal alterations to germline V, D, and J gene sequences. In agreement with this, we found fewer recombination events in the CDR3 sequences in OTU1, with the mean number of randomly inserted nucleotides in the CDR3 sequences in these clusters significantly lower than that for CDR3 sequences in both challenged (t=−61.5, p<0.001) and unchallenged repertoires (t=−58.7, p<0.001) (Figure 5Ci). The mean number of nucleotides lying between the V and J gene segment sequences was also significantly lower (unchallenged: t=−22.1, p=0.002, challenged: t=−83.7, p<0.001) (Figure 5Cii). This cluster also showed a greater degree of convergent recombination – considered an important mechanism of public TCR generation (40, 44) - with a higher average number of unique CDR3 nucleotide sequences that code for the same CDR3 amino acid sequence (Figure 5Ciii) compared to CDR3 sequences in unchallenged (t=4.4, p<0.001) and challenged (t=5.3, p<0.001) repertoires. Consequently, CDR3 amino acid sequences in OTU1 had a higher probability of generation (Pgen) (29) than CDR3 sequences in unchallenged TN repertoires and challenged repertoires (Figure 5Di). In a scenario of non-specific polyclonal expansion, a higher Pgen could indicate sharing and detection of this cluster incidentally due to higher abundance in the pre-selection pool, rather than as a result of common specificity (convergent selection) or function (45). However, the cluster was either not found or was present at a very low level in unchallenged TN and TE repertoires, and our use of UMI-corrected data for the repeat experiment confirmed that the CDR3s within this cluster are clonally expanded. Further, a large proportion of CDR3s with a similar high Pgen in unchallenged TN populations, were either not present in TE repertoires, or present but not expanded, demonstrating that the public cluster is likely to be pathogen-associated (Figure 5Dii). To determine if the CDR3 sequences in OTU1 have been shown to expand in response to other antigenic stimuli in C57Bl/6 mice, we analyzed publicly available splenic CD4+ TCRβ repertoire data (43) from unchallenged mice and mice immunized with either OVA or CFA and OVA. Although detectable, the proportion of OTU1 did not differ between unchallenged and immunized mice, indicating the expansion seen is not simply an innate response to inflammation. TCR repertoire data was also extracted from publicly available whole blood RNA-seq data from C57Bl/6 mice challenged with a variety of pathogens; Toxoplasma gondii, influenza A virus, murine cytomegalovirus, respiratory syncytial virus, Candida albicans, Listeria monocytogenes, Burkholderia pseudomallei, and House dust mite allergen (30). Of the 9 pathogens examined at the peak of the murine response, only P. chabaudi elicited an expansion in TRBV3 gene usage (Supplementary Figure 8). As such, OTU1 was not found to be expanded by any of the other pathogens examined, supporting the probable specificity of this response. Splenic Memory and Re-Challenged Repertoires Are Predominantly Private Responses Splenic CD4+ TEM and TCM populations have been shown to expand following a P. chabaudi infection (8, 9, 20). To determine if a conserved splenic memory response was also generated, the TCRβ repertoires of splenic TEM and TCM populations from the first experiment were sequenced, for both infection types. All similarity and CDR3 overlap analyses were conducted unweighted, to avoid biases from effector clonal expansion. Little to no sharing was found between either the TEM or TCM replicate repertoires themselves for either infection type, nor between the TEM, TCM and TE populations (Figure 6A). Clustering the memory repertoires within one amino acid mismatch using the same modified Swarm algorithm (26) did not improve the similarity between memory replicates, indicating these responses are mostly 'private' to each individual at this sequencing depth. As a conserved response was not detected within memory populations, a homologous re-challenge infection was undertaken to determine if a similar expansion of TRBV3, as seen in primary infection, was observed upon secondary challenge. Mice were re-challenged at day 60 post-primary infection, and then sacrificed at day 67 (day 7 post re-challenge). Following re-challenge, mice did not develop a detectable parasitemia, but a splenic expansion of an activated effector population was evident, though not as marked as following primary challenge (Figure 7A). Although TRBV3 was again confirmed to be expanded 7 days after primary challenge, encoding 21.3% (± 3.6, 95% CI) compared to 6.0% (± 2.1, 95% CI) of unchallenged TN, no re-expansion of TRBV3 was detected following re-challenge. TRBV3 encoded 11.5% (± 0.4, 95% CI) of the re-challenged TE repertoire, compared to 10.5% (± 1.7, 95% CI), for mice who had not undergone a secondary challenge, and re-challenged TE TRBV gene repertoires clustered with later time-points rather than acute repertoires (Figure 7D). At the clonal level, re-challenged repertoires were found to be as dissimilar to each other as unchallenged repertoires (Mann Whitney U, p=0.29) (Figure 7C), with little to no sharing of the 100 most abundant CDR3 amino acid sequences (Figure 7B). Figure 6 Splenic memory responses have little to no overlap: (A) Cluster map shows the pairwise T-cell receptor (TCR) repertoire overlap of the top 100 CDR3 sequences of individual repertoires, of challenged TE (blue), TCM (black), and TEM (purple) repertoires, and unchallenged TN, TE, and TEM repertoires (green). The size of the pairwise intersection between each repertoire (number of shared CDR3 amino acid sequences) is displayed, with greatest overlap evident between acute TE repertoires. Figure 7 No conservation of response following homologous re-challenge: (A) Splenocyte numbers and frequency of activated CD4+T cells (CD44HI) of unchallenged mice (green), day 7 post-primary infection (blue), day 67 post primary infection (gray, not re-challenged) and 7 days following re-challenge (black, re-challenged day 67). (B) Clustermap depicts the pairwise overlap of the top 100 most abundant CDR3 amino acid sequences of repertoires from the re-challenge experiment. The size of the pairwise intersection between each repertoire (number of shared CDR3 amino acid sequences) is displayed. CDR3 overlap was calculated unweighted by clonotype frequency. (C) Jaccard (similarity) index of replicate repertoires (normalized by down-sampling to 5000 UMI) and (D) Clustermap displays the TRBV gene proportion of each repertoire for challenged acute TE repertoires (gold), challenged late phase TE repertoires (purple) and unchallenged TN and TE repertoires (green) from the first experiment, with re-challenged TE repertoires (black) also included. Activated TRBV3+ Cells Have Diverse Transcriptional Phenotypes To further our understanding of the phenotype of the conserved TRBV3 response observed during the acute phase of a P. chabaudi infection, we undertook single-cell RNA sequencing of FACS sorted CD3+ CD4+ splenocytes from two mice at day 7 post-infection with MT parasites. We sequenced these cells using the 10x Genomics Chromium platform, using the V(D)J enrichment protocol to obtain paired α/β TCR data for each cell. After quality control steps, we obtained expression profiles for 1491 and 1485 CD4+ T cells from each mouse respectively (2976 total). Following dimensionality reduction by principal component analysis (PCA), we undertook graph-based clustering (32) and visualized resulting populations using uniform manifold approximation and projection (UMAP) (Figure 8A). We identified seven discrete transcriptional clusters, with cells from both mice evenly distributed across all dominant clusters (Supplementary Figure 9). Four of these clusters, denoted as clusters 1, 2, 3, and 4, were classified overall as naïve on the basis of canonical markers (Sell, Il7r) (Figure 8B, Supplementary Figure 10). Differential expression between all seven clusters indicated that clusters 2 and 3 were distinguishable by markers indicative of early T-cell activation, including cd69, ltm2a, Zfp36 and ler2 for cluster 3, and type I interferon (IFN) response genes (Gbp2, Ifit1, Ifit3, Isg15, and Socs1) (46) for cluster 2 (Supplementary Figure 11), while cluster 1 expressed a more definitive naïve phenotype (lef1, Ccr7). We also identified three clusters discrete from the naïve group: cluster 6 showed a typical Treg transcriptional phenotype with expression of Foxp3 and Il2ra, while clusters 5 and 7 were both identified as activated effector populations (Sell-, Il7r-). Cluster 7 expressed genes associated with a pro-inflammatory TH1 signature, including Tbx21, Ifng, Gzmb, Cxcr6, Ccl5, NKg7, and Bhlhe40 (47). In contrast, cluster 5 was Ifng- and appeared to be a more diverse helper population, which predominantly included cells expressing genes associated with a TFH phenotype (Cxcr5, Icos, Bcl6, Il21, Pdcd1) as well as those with a TH2 phenotype (Gata3, Ccr4) (Figure 8C). Utilizing the TCR data, we confirmed that the effector response is highly polyclonal: of the 581 effector cells present in clusters 5 and 7, only 3.6% (21/581) are clonally expanded (>1 cell with identical paired TCRα and TCRβ aa sequence) (Figure 8D), and no clone had more than three copies present. We again confirmed that TRBV3 is the most dominant TRBV gene encoding the TCRβ chain of activated effector populations, and show that out of all the clusters, cluster 7 had the highest proportion of TRBV3 (Figure 8E). Cells that were TRBV3+ did not however form a distinct cluster and instead displayed diverse phenotypes across all clusters. No TRAV gene was over-represented in a particular cluster (Supplementary Figure 9B). Of the clonotypes previously identified in the TCRβ bulk data in OTU1 and OTU2, two were present in the single-cell data set, both within the predominantly TFH cluster 5. TCRβ nucleotide sequences displayed diverse probabilities of generation across all clusters (Supplementary Figure 12). Figure 8 Activated TRBV3+ cells have diverse transcriptional phenotypes. Cellular transcriptional phenotypes and paired T-cell receptor (TCR) α and TCRβ sequences were captured using single-cell transcriptomics. (A) Clustering of CD4+ splenocytes from two challenged mice, at day 7 post-infection, according to transcriptional profile similarity. Plot shows individual cell transcriptomes represented in two dimensions by uniform manifold approximation and projection (UMAP). Each point depicts a cell, colored by Seurat cluster assignment as determined from gene expression profiles. (B) Distributions of normalized expression level of major canonical T-cell markers for each cell cluster, displayed as violin plots. (C) Heatmap showing the expression levels of the top 20 differentially expressed genes that define clusters 5, 6, and 7. (D) Stacked bar plot showing the proportion of each cluster that is clonally expanded (>1 cell with identical paired TCRα and TCRβ aa sequences). Repertoires of all clusters were highly polyclonal, with a minor increase in frequency of expanded clones in activated clusters. (E) Heatmap displays proportional TRBV gene usage per cluster TCR repertoire. CD4+ T-cells play a critical role in the immune response against the pathological blood-stage of malaria [reviewed in (6, 7)]. However there is a lack of deep mechanistic understanding regarding the development of T-cell mediated immunity against Plasmodium (7). To our knowledge, this is the first study to use bulk TCR deep-sequencing to examine the composition of CD4+ T-cell repertoires induced by a Plasmodium infection. We found that in both the MT and SBP infection models, which show differential control of parasite growth and degrees of immunopathology (8, 16), TE repertoires elicited upon infection are highly diverse and polyclonal. Despite the 10-fold increase in splenic TE cell numbers, the V/J gene usage frequencies of acute challenged TE repertoires are strongly positively correlated with that of unchallenged TN repertoires, indicating a highly polyclonal broad expansion of the naïve repertoire, consistent with the massive cellular expansion seen. This polyclonality is confirmed in our single-cell RNA-seq data. The degree of correlation between VJ usage frequencies likely indicates a degree of non-specific expansion, although a highly heterogeneous response to the vast number of potential antigens expressed by the parasite, argued as a potential cause for the preponderance seen in P. falciparum IgG responses (48), cannot be ruled out. However, within this highly polyclonal effector proliferation, a strong and oligo-clonal conserved response is observed in the bulk TCR data following a first infection. Here, repertoires are skewed to TRBV3 gene usage, have a higher degree of clonal sharing, and show increased amino acid sequence similarity of the CDR3 region between dominant clones. Thus, we demonstrate that despite the antigenic complexity of P. chabaudi, TE repertoires bear the hallmarks of a specific response (38, 39), mirroring that observed with less antigenically diverse organisms (49–51). This conserved response is evident in both infection models, although it is delayed and less marked in mice infected with SBP parasites, and does not become evident until parasitemia has peaked. Adaptive immune responses of lower magnitude have previously been documented in SBP infections compared to MT (8) and while the precise reasons for this difference remain speculative and represent a complex scenario, the fact that the conserved response does eventually become evident suggests that the drivers of this response are likely to be common to both MT and SBP parasites despite apparent distinct kinetics in the TRBV3 response. Sequencing of total parasite RNA for both MT and SBP parasites undertaken by Spence et al. (8), indicated the parasites' cir gene family - believed to encode a large set of variable antigens displayed on parasitized erythrocytes -was differentially expressed between the two infection models. MT parasites upregulated expression of many genes within this family equally, re-setting broad expansion of the antigenic repertoire, while SBP selected for a limited but dominant cir expression. Our results are therefore inconsistent with proteins encoded by cir genes driving the detected conserved response, which would instead have been expected to result in a more dominant response in SBP infections. We hypothesize that the differences observed in the timing and magnitude of the TRBV3-restricted shared response seen between the two infection models are a result of the systemic inflammation induced by SBP parasites (8) disrupting or delaying the formation of an appropriate T-cell response. Future work to determine MHC-presentation pathway and ligands or peptides involved is ultimately required to determine what specific parasite epitope elicits the conserved response. The single cell RNA-seq data confirms the dominance of TRBV3 in activated effector populations and reveals that TRBV3+ cells in the acute phase of a first infection have diverse phenotypes. We therefore show that the conserved response seen does not represent a discrete innate cell population but is instead part of an adaptive immune process against the parasite. The transcriptional phenotypes of activated effector cells are in agreement with those previously observed in the acute phase of a P. chabaudi infection (47) and indicate a large cluster of predominantly follicular helper cells as well as a distinct Ifng+ TH1 population. Both types of response have been shown to arise simultaneously during the acute phase (47) and to be essential in controlling blood-stage P. chabaudi; TH1 responses are required for initial control of acute parasitemia (52, 53) and TFH are crucial for generating antibody-mediated immunity and controlling chronic infection (54, 55). The presence of OTU1 and OTU2 in a predominantly TFH cluster, suggests that they may play a role in guiding the developing humoral response against the parasite. A single naïve CD4+ T-cell has been demonstrated to be able to give rise to clones with different cell fates (47) so, as only one of each clonotype was captured with the single cell sequencing depth used, we cannot firmly conclude that the transcriptional phenotypes identified here would broadly reflect the conserved TCRs identified in the bulk data. Nevertheless, the TCR of a cell has been shown to impart a strong preference for either a TH1 or a TFH fate, with longer dwell time between peptide-MHC : TCR biasing toward TFH and GC-TFH responses (56). Therefore, if driven by the same epitope, we would expect the conserved response to have a similar phenotype (57). Public TCR sequences are shared between multiple individuals either due to biases in V(D)J recombination, and/or convergent selection by a common antigen (45, 49). The CDR3 amino acid sequences in the most dominant and conserved cluster detected (OTU1) had similar features to other previously observed public TCR responses. These include a reduced number of nucleotide addition and deletion events during VDJ recombination and a greater degree of recombinant convergence (different nucleotide sequences encoding the same amino acid CDR3 sequence). Such recombinational biases during T-cell development mean these TCRs will have a higher probability of generation (PGen) during VDJ recombination, and are therefore more likely to be present in a naïve pool. However, the degree of clonal expansion observed in OTU1 sequences was greater than many other sequences of equal or higher PGen, indicating that these clones were truly expanded and not simply found to be of high frequency as a result of recombinational biases. We also show that PGen does not determine T-cell fate, in agreement with Sethna et al. (29) who demonstrated that the ability of a TCR to respond to a particular epitope, was not strongly correlated with its generation probability. It has been hypothesized that public TCR responses may provide rapid cross-reactive immunity (58) to cope with diverse antigenic challenge, allowing time for more specific private responses to develop (40, 59). Thus, during a P. chabaudi infection, a public response that is mobilized rapidly due to high Pgen and/or a higher chance of positive selection if cross-reactive, may act as a first line of defense against the parasite before more specific responses become effective. In agreement with this, OTU1 appears to be temporally associated with enhanced control of parasitaemia. It arises earlier and is more dominant in MT infections compared with SBP, where rapid parasite growth is observed alongside a delayed and less marked conserved response. Mice infected with MT parasites also show reduced disease severity (8). Despite these positive associations, whether this conserved response is truly beneficial to the host, remains unknown. There are reports of public TCR responses being implicated in self-related immunity (43), and in P. berghei, the presence of conserved pathogenic CD8+ T-cells has been used to predict cerebral malaria (11). No expanded conserved response was evident in memory populations at the timepoints tested. It is known that precursors of memory T-cells derive from an earlier TE population (CD127- CD62Lhi) that precedes the terminally differentiated CD62L- CD127- TE population captured by our TE gating strategy (60). While that precursor population successfully expands to dominate the TE repertoire, since memory T populations preferentially favor TCRs with high avidity, it is possible that the public TCR clones identified may lack sufficient avidity required to enter the memory pool (61). A low level of TM repertoire overlap indicates that splenic memory responses are diverse and mostly private to each individual. Similarly, in the re-challenged TE compartment, we did not detect an increase in TRBV3 compared to later time points that had not undergone re-infection, and at the clonal level responses had as little overlap between replicates as unchallenged repertoires. This does not imply lack of a memory/primed response; mice are protected from re-infection and have previously been shown to have primed secondary responses (9). Heterologous responses could be due to T-cells more specific for the parasite than the TRBV3+ public response surviving the contraction phase/entering memory to be able to respond. Diverse or 'private' responses have previously been seen with other complex pathogens such as mycobacteria (62, 63) and would not be unexpected given the antigenic complexity of Plasmodium. However, primed private secondary responses cannot be confirmed without experiments that sample the same individuals longitudinally over the course of a primary and secondary infection, and this hypothesis therefore remains untested and an avenue for future investigation. These results also do not exclude the possibility that a low-level re-expansion of TRBV3 does occur upon re-challenge, given only a small increase in the number of activated cells was observed. This may not have constituted a large enough proportion of the repertoire, given the number of animals used in re-infection, to detect subtle differences in re-challenged TE V-gene usage. This is supported by work done by Opata et al. (9), who demonstrated that T-cells specific to P. chabaudi MSP-1 that survive the contraction phase, do not re-expand upon secondary challenge due to increased apoptosis. Such clones that are responding but do not accumulate/re-expand would be difficult to discern from baseline controls using bulk repertoire sequencing techniques. Future re-infection studies may benefit from including single-cell transcriptomics to help differentiate such responding cells based on phenotype. To have found a near-identical expanded TE cluster in independent repeat experiments, and in publicly available P. chabaudi (AS and CB) RNA-seq data sets, demonstrates the public TCR signature is consistently expanded in multiple individuals in response to a first Plasmodium chabaudi infection. TRBV3 was not expanded at peak infection for any of the other eight pathogens examined and searches of annotated TCR sequence databases have not revealed any other known specificities for any of the CDR3 amino acid sequences in OTU1 or OTU2 (50, 64). TCR repertoire and RNA-seq data sets following infection with other Plasmodium species are currently unavailable, but as these are generated, the specificity of this response to the parasite and whether a similar response is elicited in a first infection by other Plasmodium species including P. falciparum will become evident. Future studies are required to determine whether the conserved response plays a critical role in protection during a first infection. MT infections develop chronic recrudescing infection, so the response does not fully clear infection, although it is temporally associated with control of parasite growth and reduced disease severity (8). Whether entirely favorable to the host or not, we hypothesize the response allows time for mechanisms that govern the formation of more specific private responses and subsequent immunity to the parasite to develop. Mice are known to develop highly effective strain-specific anti-parasite immunity after a single malaria episode, while this takes years to develop in people. Therefore, if some degree of first line protection were shown, such a response could be a novel target to promote in malaria naïve individuals through vaccination, providing initial cover while more specific but slower private responses develop, conveying higher levels of protection. Even if only partially protective, the response is conserved between individuals and receptor sequences have a high probability of generation. Targeting these is predicted therefore to increase vaccine success rate (29, 65). In summary, we have demonstrated that a conserved TCRβ signature encoded by TRBV3 is consistently expanded in response to a first Plasmodium chabaudi infection (Figure 9). In contrast, memory formation and re-challenged repertoires appear to be more private responses to the individual. Understanding the antigenic drivers and contribution to protection (or pathogenesis) of this conserved signature, that is consistently a hallmark of a first infection, is ultimately required to determine if it should be promoted or mitigated for malaria therapeutic purposes. Figure 9 Graphical representation to summarize findings: following a first P. chabaudi infection, within a highly polyclonal T-effector expansion, a public T-cell receptor (TCR) β clonal response encoded by TRBV3 is detectable. This conserved response contracts during the late phase of infection and is not re-expanded upon homologous re-challenge. This response is consistently found to be a hallmark of a first P. chabaudi infection. Data Availability Statement The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ebi.ac.uk/ena, PRJEB40867 https://www.ebi.ac.uk/arrayexpress/, E-MTAB-9691. Ethics Statements The animal study was reviewed and approved by the Ethical Review Body of the University of Edinburgh. Author Contributions NS, GC, and CS designed the project, analyzed the data, and wrote the manuscript. Experimental work was carried out by NS, GC, WN, JM, PS, and JT. All authors reviewed the manuscript. All authors contributed to the article and approved the submitted version. This work was made possible by a studentship from the Wellcome Trust to NS (204511/Z/16/A) and Wellcome Trust ISSF funding to GC. Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. This work has made use of the resources provided by the Edinburgh Computer and Data Facility (ECDF) (http://www.ecdf.ed.ac.uk/). The authors thank Dr. Martin Waterfall of the IIIR Flow Cytometry Facility for help with cell sorting. Bulk TCR sequencing was carried out by Edinburgh Genomics at the University of Edinburgh. Edinburgh Genomics is partly supported through core grants from NERC (R8/H10/56), MRC (MR/K001744/1), and BBSRC (BB/J004243/1). Single-cell sequencing was carried out by the IGMM flow cytometry service and the Edinburgh Clinical Research Facility, at the University of Edinburgh. Figure 9 was created using BioRender.com. Supplementary Material The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2020.587756/full#supplementary-material 1. Ryg-Cornejo V, Ly A, Hansen DS. Immunological processes underlying the slow acquisition of humoral immunity to malaria. Parasitology (2016) 143:1–9. doi: 10.1017/S0031182015001705 2. Gupta S, Snow RW, Donnelly CA, Marsh K, Newbold C. Immunity to non-cerebral severe malaria is acquired after one or two infections. Nat Med (1999) 5:340–3. doi: 10.1038/6560 3. Gonçalves BP, Huang C-Y, Morrison R, Holte S, Kabyemela E, Prevots DR, et al. Parasite Burden and Severity of Malaria in Tanzanian Children. N Engl J Med (2014) 370:1799–808. doi: 10.1056/NEJMoa1303944 4. Ly A, Hansen DS. Development of B cell memory in malaria. Front Immunol (2019) 10:559. doi: 10.3389/fimmu.2019.00559 5. Doolan DL, Dobaño C, Baird JK. Acquired immunity to Malaria. Clin Microbiol Rev (2009) 22:13–36. doi: 10.1128/CMR.00025-08 6. Nlinwe ON, Kusi KA, Adu B, Sedegah M. T-cell responses against Malaria: Effect of parasite antigen diversity and relevance for vaccine development. Vaccine (2018) 36:2237–42. doi: 10.1016/j.vaccine.2018.03.023 7. Kurup SP, Butler NS, Harty JT. T cell-mediated immunity to malaria. Nat Rev Immunol (2019) 19:457–71. doi: 10.1038/s41577-019-0158-z 8. Spence PJ, Jarra W, Lévy P, Reid AJ, Chappell L, Brugat T, et al. Vector transmission regulates immune control of Plasmodium virulence. Nature (2013) 498:228–31. doi: 10.1038/nature12231 9. Opata MM, Stephens R. Chronic Plasmodium chabaudi infection generates CD4 memory T cells with increased T cell receptor sensitivity but poor secondary expansion and increased apoptosis. Infect Immun (2017) 85:1–16. doi: 10.1128/IAI.00774-16 10. del Portillo HA, Ferrer M, Brugat T, Martin-Jaular L, Langhorne J, Lacerda MVG. The role of the spleen in malaria. Cell Microbiol (2012) 14:343–55. doi: 10.1111/j.1462-5822.2011.01741.x 11. Mariotti-Ferrandiz E, Pham HP, Dulauroy S, Gorgette O, Klatzmann D, Cazenave PA, et al. A TCRB Repertoire Signature Can Predict Experimental Cerebral Malaria. PloS One (2016) 11:1–17. doi: 10.1371/journal.pone.0147871 12. Ndungu FM, Sanni L, Urban B, Stephens R, Newbold CI, Marsh K, et al. CD4 T Cells from Malaria-Nonexposed Individuals Respond to the CD36-Binding Domain of Plasmodium falciparum Erythrocyte Membrane Protein-1 via an MHC Class II-TCR-Independent Pathway. J Immunol (2006) 176:5504–12. doi: 10.4049/jimmunol.176.9.5504 13. Scholzen A, Mittag D, Rogerson SJ, Cooke BM, Plebanski M. Plasmodium falciparum – Mediated Induction of Human CD25 hi Foxp3 hi CD4 T Cells Is Independent of Direct TCR Stimulation and Requires IL-2 , IL-10 and TGF b. PloS Pathog (2009) 5:26–32. doi: 10.1371/journal.ppat.1000543 14. Wipasa J, Okell L, Sakkhachornphop S, Suphavilai C, Chawansuntati K, Liewsaree W, et al. Short-lived IFN-γ effector responses, but long-lived IL-10 memory responses, to malaria in an area of low malaria endemicity. PloS Pathog (2011) 7:e1001281. doi: 10.1371/journal.ppat.1001281 15. Bradley P, Thomas PG. Using T Cell Receptor Repertoires to Understand the Principles of Adaptive Immune Recognition. Annu Rev Immunol (2019) 37:547–70. doi: 10.1146/annurev-immunol-042718-041757 16. Spence PJ, Brugat T, Langhorne J. Mosquitoes Reset Malaria Parasites. PloS Pathog (2015) 11:10–5. doi: 10.1371/journal.ppat.1004987 17. Spence PJ, Jarra W, Levy P, Nahrendorf W, Langhorne J. Mosquito transmission of the rodent malaria parasite Plasmodium chabaudi. Malar J (2012) 11:407. doi: 10.1186/1475-2875-11-407 18. Marr EJ, Milne RM, Anar B, Girling G, Schwach F, Mooney JP, et al. An enhanced toolkit for the generation of knockout and marker-free fluorescent Plasmodium chabaudi. Wellcome Open Res (2020) 5:1–20. doi: 10.12688/wellcomeopenres.15587.1 19. Lewis M, Pfeil J, Mueller AK. Continuous oral chloroquine as a novel route for Plasmodium prophylaxis and cure in experimental murine models. BMC Res Notes (2011) 4:262. doi: 10.1186/1756-0500-4-262 20. Stephens R, Langhorne J. Effector memory Th1 CD4 T cells are maintained in a mouse model of chronic malaria. PloS Pathog (2010) 6:e1001208. doi: 10.1371/journal.ppat.1001208 21. Kivioja T, Vähärautio A, Karlsson K, Bonke M, Enge M, Linnarsson S, et al. Counting absolute numbers of molecules using unique molecular identifiers. Nat Methods (2012) 9:72–4. doi: 10.1038/nmeth.1778 22. Shugay M, Britanova OV, Merzlyak EM, Turchaninova MA, Mamedov IZ, Tuganbaev TR, et al. Towards error-free profiling of immune repertoires. Nat Methods (2014) 11:653–6. doi: 10.1038/nmeth.2960 23. Bolotin DA, Poslavsky S, Mitrophanov I, Shugay M, Mamedov IZ, Putintseva EV, et al. MiXCR: software for comprehensive adaptive immunity profiling. Nat Methods (2015) 12:380–1. doi: 10.1038/nmeth.3364 24. Shugay M, Bagaev DV, Turchaninova MA, Bolotin DA, Britanova OV, Putintseva EV, et al. VDJtools: Unifying Post-analysis of T Cell Receptor Repertoires. PloS Comput Biol (2015) 11:1–16. doi: 10.1371/journal.pcbi.1004503 25. Virtanen P, Gommers R, Oliphant TE, Haberland M, Reddy T, Cournapeau D, et al. SciPy 1.0: fundamental algorithms for scientific computing in Python. Nat Methods (2020) 17:261–72. doi: 10.1038/s41592-019-0686-2 26. Mahe F, Rognes T, Quince C, De VC, Dunthorn M. Swarm: robust and fast clustering method for amplicon-based studies. PeerJ (2014) 2:1–13. doi: 10.7717/peerj.593 27. Huang H, Wang C, Rubelt F, Scriba TJ, Davis MM. Analyzing the Mycobacterium tuberculosis immune response by T-cell receptor clustering with GLIPH2 and genome-wide antigen screening. Nat Biotechnol (2020) 38:1194–202. doi: 10.1038/s41587-020-0505-4 28. Bastian M, Heymann S, Jacomy M. Gephi: An Open Source Software for Exploring and Manipulating Networks. International AAAI Conference on Weblogs and Social Media (2009). 29. Sethna Z, Elhanati Y, Callan CG, Walczak AM, Mora T. OLGA: fast computation of generation probabilities of B- and T-cell receptor amino acid sequences and motifs. Bioinformatics (2018) 35:2974–81. doi: 10.1093/bioinformatics/btz035 30. Singhania A, Graham CM, Gabryšová L, Moreira-Teixeira L, Stavropoulos E, Pitt JM, et al. Transcriptional profiling unveils type I and II interferon networks in blood and tissues across diseases. Nat Commun (2019) 10:1–21. doi: 10.1038/s41467-019-10601-6 31. Zheng GXY, Terry JM, Belgrader P, Ryvkin P, Bent ZW, Wilson R, et al. Massively parallel digital transcriptional profiling of single cells. Nat Commun (2017) 8:14049. doi: 10.1038/ncomms14049 32. Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol (2018) 36:411–20. doi: 10.1038/nbt.4096 33. Mamedov MR, Scholzen A, Nair RV, Cumnock K, Kenkel JA, Oliveira JHM, et al. A Macrophage Colony-Stimulating-Factor-Producing γδ T Cell Subset Prevents Malarial Parasitemic Recurrence. Immunity (2018) 48:350–63.e7. doi: 10.1016/j.immuni.2018.01.009 34. Venturi V, Kedzierska K, Turner SJ, Doherty PC, Davenport MP. Methods for comparing the diversity of samples of the T cell receptor repertoire. J Immunol Methods (2007) 321:182–95. doi: 10.1016/j.jim.2007.01.019 35. Britanova OV, Putintseva EV, Shugay M, Merzlyak EM, Turchaninova MA, Staroverov DB, et al. Age-Related Decrease in TCR Repertoire Diversity Measured with Deep and Normalized Sequence Profiling. J Immunol (2014) 192:2689–98. doi: 10.4049/jimmunol.1302064 36. Izraelson M, Nakonechnaya TO, Moltedo B, Egorov ES, Kasatskaya SA, Putintseva EV, et al. Comparative analysis of murine T-cell receptor repertoires. Immunology (2018) 153:133–44. doi: 10.1111/imm.12857 37. Madi A, Poran A, Shifrut E, Reich-zeliger S, Greenstein E, Zaretsky I, et al. T cell receptor repertoires of mice and humans are clustered in similarity networks around conserved public CDR3 sequences. Elife (2017) 3:1–17. doi: 10.7554/eLife.22057 38. Glanville J, Huang H, Nau A, Hatton O, Wagar LE, Rubelt F, et al. Identifying specificity groups in the T cell receptor repertoire. Nature (2017) 547:94–8. doi: 10.1038/nature22976 39. Dash P, Fiore-Gartland AJ, Hertz T, Wang GC, Sharma S, Souquette A, et al. Quantifiable predictive features define epitope-specific T cell receptor repertoires. Nature (2017) 547:89–93. doi: 10.1038/nature22383 40. Covacu R, Philip H, Jaronen M, Douek DC, Efroni S, Quintana FJ, et al. System-wide Analysis of the T Cell Response. Cell Rep (2016) 14:2733–44. doi: 10.1016/j.celrep.2016.02.056 41. Miles JJ, Bulek AM, Cole DK, Gostick E, Schauenburg AJA, Venturi V, et al. Genetic and Structural Basis for Selection of a Ubiquitous T Cell Receptor Deployed in Epstein-Barr Virus Infection. PloS Pathog (2010) 6:1–15. doi: 10.1371/journal.ppat.1001198 42. Benati D, Galperin M, Lambotte O, Gras S, Lim A, Mukhopadhyay M, et al. Public T cell receptors confer high-avidity CD4 responses to HIV controllers. J Clin Invest (2016) 126:2093–108. doi: 10.1172/JCI83792DS1 43. Madi A, Shifrut E, Reich-zeliger S, Gal H, Best K, Ndifon W, et al. T-cell receptor repertoires share a restricted set of public and abundant CDR3 sequences that are associated with self-related immunity. Genome Res (2014) 24:1603–12. doi: 10.1101/gr.170753.113.24 44. Venturi V, Kedzierska K, Price DA, Doherty PC, Douek DC, Turner SJ, et al. Sharing of T cell receptors in antigen-specific responses is driven by convergent recombination. PNAS (2006) 103:18691–6. doi: 10.1073/pnas.0608907103 45. Pogorelyy MV, Minervina AA, Chudakov DM, Mamedov IZ, Lebedev YB, Mora T, et al. Method for identification of condition-associated public antigen receptor sequences. Elife (2018) 7:e33050. doi: 10.7554/eLife.33050 46. Elyahu Y, Hekselman I, Eizenberg-Magar I, Berner O, Strominger I, Schiller M, et al. Aging promotes reorganization of the CD4 T cell landscape toward extreme regulatory and effector phenotypes. Sci Adv (2019) 5:eaaw8330. doi: 10.1126/sciadv.aaw8330 47. Lönnberg T, Svensson V, James KR, Fernandez-Ruiz D, Sebina I, Montandon R, et al. Single-cell RNA-seq and computational analysis using temporal mixture modeling resolves TH1/TFH fate bifurcation in malaria. Sci Immunol (2017) 2:1–12. doi: 10.1126/sciimmunol.aal2192 48. Weiss GE, Traore B, Kayentao K, Ongoiba A, Doumbo S, Kone Y, et al. The Plasmodium falciparum-Specific Human Memory B Cell Compartment Expands Gradually with Repeated Malaria Infections. PloS Pathog (2010) 6:e1000912. doi: 10.1371/journal.ppat.1000912 49. Emerson RO, DeWitt WS, Vignali M, Gravley J, Hu JK, Osborne EJ, et al. Immunosequencing identifies signatures of cytomegalovirus exposure history and HLA-mediated effects on the T cell repertoire. Nat Genet (2017) 49:659–65. doi: 10.1038/ng.3822 50. Shugay M, Bagaev DV, Zvyagin IV, Vroomans RM, Crawford JC, Dolton G, et al. VDJdb: a curated database of T-cell receptor sequences with known antigen specificity. Nucleic Acids Res (2018) 46:419–27. doi: 10.1093/nar/gkx760 51. Wolf K, Hether T, Gilchuk P, Ahn T, Joyce S, Dipaolo RJ, et al. Identifying and Tracking Low-Frequency Virus-Specific TCR Clonotypes Using High-Throughput Sequencing. Cell Rep (2018) 25:2369–78.e4. doi: 10.1016/j.celrep.2018.11.009 52. Su Z, Stevenson MM. Central role of endogenous gamma interferon in protective immunity against blood-stage Plasmodium chabaudi AS infection. Infect Immun (2000) 68:4399–406. doi: 10.1128/IAI.68.8.4399-4406.2000 53. Soon MSF, Haque A. Recent Insights into CD4 + Th Cell Differentiation in Malaria. J Immunol (2018) 200:1965–75. doi: 10.4049/jimmunol.1701316 54. Pérez-Mazliah D, Ng DHL, Freitas do Rosário AP, McLaughlin S, Mastelic-Gavillet B, Sodenkamp J, et al. Disruption of IL-21 Signaling Affects T Cell-B Cell Interactions and Abrogates Protective Humoral Immunity to Malaria. PloS Pathog (2015) 11:1–24. doi: 10.1371/journal.ppat.1004715 55. Pérez-Mazliah D, Nguyen MP, Hosking C, McLaughlin S, Lewis MD, Tumwine I, et al. Follicular Helper T Cells are Essential for the Elimination of Plasmodium Infection. EBioMedicine (2017) 24:216–30. doi: 10.1016/j.ebiom.2017.08.030 56. Tubo NJ, Pagán AJ, Taylor JJ, Nelson RW, Linehan JL, Ertelt JM, et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell (2013) 153:785–96. doi: 10.1016/j.cell.2013.04.007 57. Schattgen SA, Guion K, Crawford JC, Souquette A, Barrio AM, Stubbington MJT, et al. Linking T cell receptor sequence to transcriptional profiles with clonotype neighbor graph analysis (CoNGA). bioRxiv (2020). doi: 10.1101/2020.06.04.134536. 2020.06.04.134536. 58. Khosravi-Maharlooei M, Obradovic A, Misra A, Motwani K, Holzl M, Seay HR, et al. Crossreactive public TCR sequences undergo positive selection in the human thymic repertoire. J Clin Invest (2019) 129:2446–62. doi: 10.1172/JCI124358 59. Miles JJ, Douek DC, Price DA. Bias in the αβ T-cell repertoire: Implications for disease pathogenesis and vaccination. Immunol Cell Biol (2011) 89:375–87. doi: 10.1038/icb.2010.139 60. Opata MM, Carpio VH, Ibitokou SA, Dillon BE, Obiero JM, Stephens R. Early Effector Cells Survive the Contraction Phase in Malaria Infection and Generate Both Central and Effector Memory T Cells. J Immunol (2015) 194:5346–54. doi: 10.4049/jimmunol.1403216 61. Gasper DJ, Tejera MM, Suresh M. CD4 T-cell memory generation and maintenance. Crit Rev Immunol (2014) 34:121–46. doi: 10.1615/critrevimmunol.2014010373 62. Thomas N, Best K, Cinelli M, Reich-Zeliger S, Gal H, Shifrut E, et al. Tracking global changes induced in the CD4 T-cell receptor repertoire by immunization with a complex antigen using short stretches of CDR3 protein sequence. Bioinformatics (2014) 30:3181–8. doi: 10.1093/bioinformatics/btu523 63. Sun Y, Best K, Cinelli M, Heather JM, Reich-Zeliger S, Shifrut E, et al. Specificity, privacy, and degeneracy in the CD4 T cell receptor repertoire following immunization. Front Immunol (2017) 8:430. doi: 10.3389/fimmu.2017.00430 64. Tickotsky N, Sagiv T, Prilusky J, Shifrut E, Friedman N. McPAS-TCR: A manually curated catalogue of pathology-associated T cell receptor sequences. Bioinformatics (2017) 33:2924–9. doi: 10.1093/bioinformatics/btx286 Keywords: T-cell, TCR, immune-repertoire, single-cell, Plasmodium chabaudi, malaria Citation: Smith NL, Nahrendorf W, Sutherland C, Mooney JP, Thompson J, Spence PJ and Cowan GJM (2020) A Conserved TCRβ Signature Dominates a Highly Polyclonal T-Cell Expansion During the Acute Phase of a Murine Malaria Infection. Front. Immunol. 11:587756. doi: 10.3389/fimmu.2020.587756 Received: 27 July 2020; Accepted: 27 October 2020; Published: 23 November 2020. Edited by: Juarez Antonio Simões Quaresma, Evandro Chagas Institute, BrazilReviewed by: Henrique Borges da Silva, University of Minnesota Twin Cities, United StatesGregoire S. Lauvau, Albert Einstein College of Medicine, United States Copyright © 2020 Smith, Nahrendorf, Sutherland, Mooney, Thompson, Spence and Cowan. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. *Correspondence: Natasha L. Smith, email@example.com
People ManagersHaving difficulty resolving business problems? Would you like to solve your problems in a creative and strategic manner? Developing critical thinking and problem-solving skills can be the beginning of your journey. Whenever you are working in a business environment, you are constantly looking for new opportunities. It is often the case that problems are disguised opportunities. To identify and transform these problems into opportunities, it is imperative to develop critical and creative thinking skills. Using critical thinking requires a combination of skills that enable you to think at a higher level. Critical thinking involves reflecting critically on your learning experiences and working processes. In simple terms, critical thinking involves thinking about thinking. By reflecting on your decisions, you will be able to make informed decisions. An ideal basis for critical thinking is intellectual values such as clarity, relevance, reliable evidence, and fairness. Problem solving involves a systematic process of identifying problems and generating wide-ranging solutions before selecting and developing one (or more) for communication and implementation. This highly interactive program uses case studies and real-life scenarios to teach participants how to apply and manage evidence-based creative approaches in a collaborative and individual environment. It examines several ways in which business decisions can be made more effectively, considering competing interests and limited resources. The course will demonstrate how a structured approach to problem solving can be applied. This 2-Day program is available in both In-Person and Virtual Instructor Led Training Mode.
A bible of AI futurists. [Gisela Giardino/Creative Commons] One of the great current dramas is the global competition for artificial intelligence: machines that will think for themselves and, one day, many think, be smarter than humans. That forecast inflection point — the time of super-human intelligence — worries a lot of people, since no one knows what machines can or will do once they are smarter than their inventors. A key question is, if super-human intelligence is invented, in which country and which lab will it take place, since it could be the most powerful technology ever invented. "Artificial intelligence in the wrong hands can transition from being a tool to being a weapon," the inventor Dean Kamen tells Axios. Moore doesn't think inventors are anywhere close to inventing "strong AI," as super-human intelligence is called. Indeed, nothing that researchers are currently working on anywhere will get there, he said. "We will need a wild new idea to make that happen. I'd guess there's a 5 percent chance that someone will make this kind of breakthrough in any decade," he said.But an AI war is on nonetheless. Why does Bremmer think the breakthrough will come in the U.S., when China is spending far more money on AI? He said"The U.S. has the best universities, the most innovative private sector, and the biggest lead on the most important technologies at the moment," he said. "And while China may soon be the world's largest economy, truly groundbreaking AI is likely to come from combining the insights from many disparate fields and making them work together — something Beijing will struggle with."
In today's hyperconnected era, where our personal devices rely heavily on USB ports for charging and data transfer, the issue of data security has become increasingly pertinent. With reports of hacking and data theft on the rise, the need for USB data blockers has been emphasized. This article aims to explore the necessity of USB data blockers, shedding light on their functionality and explaining why they are crucial in safeguarding our sensitive information from potential cyber threats. The Rise Of USB Data Theft And The Importance Of Protecting Your Personal Information In today's digital age, the threat of USB data theft is on the rise, making it increasingly important to protect your personal information. USB data theft occurs when someone gains unauthorized access to your device and steals sensitive information such as passwords, financial data, or personal files. This type of theft can have serious implications, leading to identity theft, financial loss, or compromised security. With the increasing use of public USB charging ports in places like airports, hotels, or cafes, the risk of data theft has become more prevalent. Hackers can easily tamper with these charging ports and gain access to connected devices, making it crucial to take necessary precautions. USB data blockers act as a safeguard against such attacks by allowing only power to flow through the USB connection while blocking data transfer. By physically obstructing data transfer, these devices prevent the risk of malware or a hacker gaining access to your device. Given the potential consequences of USB data theft, using a USB data blocker is highly recommended to protect your personal information and ensure your privacy and security. It provides peace of mind, allowing you to charge your devices without worrying about data theft. Understanding How USB Data Blockers Work And Their Role In Preventing Unauthorized Data Transfers USB data blockers, also known as USB condom or USB firewall, are small devices that play a crucial role in protecting your personal information from unauthorized data transfers. These handy gadgets work by blocking the data pins of a USB cable while allowing the power pins to make a connection. This means that only essential power flows through, preventing any potential malicious data transfer. When a device is connected to an unknown USB port, there is a risk of data theft or malware infection. Cybercriminals can set up fake charging stations or USB ports with hidden malware that automatically transfer your personal data or install malicious software on your device. This is where USB data blockers become vital. By blocking the data transfer, these devices ensure that your personal information, such as contacts, photos, and files, remain secure. They create a barrier between your device and the charging station, preventing any potential unauthorized access to your data. USB data blockers are particularly useful when charging your devices in public places like airports, hotels, or cafes, where the security of charging ports cannot be guaranteed. They provide peace of mind and protect your sensitive information, making them a necessary accessory in our tech-driven world. The Potential Risks And Consequences Of Connecting Your Device To Unknown USB Ports When it comes to charging our devices on the go, we often overlook the potential risks associated with connecting our devices to unknown USB ports. However, this poses a serious threat to our personal information and data security. Unknown USB ports, such as those found in public places like airports, cafes, or even shared charging stations, can be compromised by hackers looking to steal data. These hackers can tamper with the USB ports in a way that allows them to access and transfer your personal information without your knowledge. The consequences of connecting your device to such compromised USB ports can be severe. You run the risk of having your sensitive data, including passwords, photos, and financial information, stolen. This can lead to identity theft, fraud, and other serious cybercrimes. To protect yourself and your data, it is crucial to understand the potential risks associated with connecting your device to unknown USB ports. By being aware, you can make informed decisions about when and where to charge your devices, and consider investing in a USB data blocker to prevent unauthorized data transfers and safeguard your personal information. Debunking common myths about the security of USB charging ports USB charging ports are commonly found in public settings such as airports, cafes, and even public transportation. Many people assume that these ports are safe to use for charging their devices, but there are several myths surrounding the security of USB charging ports that need to be debunked. One common myth is that USB charging ports cannot transfer data, and therefore, there is no risk of data theft. However, this is not true. USB ports are designed to transfer both power and data, and hackers can exploit this feature to gain unauthorized access to your personal information. Another myth is that using a USB cable without data lines can protect your device from data theft. While it is true that using a USB cable without data lines can prevent data transfer, it is important to note that not all USB cables are created equal. Some cables may be labeled as "charging only," but they may still have data lines inside, making your device vulnerable to data theft. It is also falsely believed that only certain devices, such as smartphones or tablets, are at risk of data theft via USB charging ports. In reality, any device that can connect to a USB port, including laptops and even smartwatches, can be targeted by hackers. To ensure the security of your personal information, it is necessary to use USB data blockers. These small devices filter out the data lines in USB cables, allowing only power transfer while blocking any potential data transfer. USB data blockers provide an essential layer of protection against data theft when charging your devices in public settings. In conclusion, debunking these common myths is crucial to raise awareness about the importance of USB data blockers. Without proper protection, connecting your device to unknown USB charging ports can leave your personal information vulnerable to theft. Evaluating The Effectiveness Of USB Data Blockers In Different Scenarios And Environments In today's digital landscape, where hackers and cybercriminals are constantly finding new ways to steal personal information, it is important to assess the effectiveness of USB data blockers in protecting our devices. While USB data blockers are designed to prevent unauthorized data transfers, it is essential to understand that their effectiveness can vary depending on the scenarios and environments in which they are used. One important consideration is the type of threat you are facing. If you are concerned about potential data theft through public charging stations or unknown USB ports, a USB data blocker can be highly effective. These devices physically block data transfer while allowing your device to charge. However, it is crucial to ensure that you are using a reputable and secure data blocker to eliminate any potential vulnerabilities. In more secure environments, such as trusted workplaces or personal charging stations, USB data blockers may not be as necessary. If you can trust the source of the USB port, the risk of data theft is significantly reduced. Nonetheless, it is still advisable to exercise caution and avoid plugging your device into unfamiliar or untrusted USB ports. Ultimately, the effectiveness of USB data blockers depends on the specific circumstances in which they are used. It is important to assess the potential risks, evaluate the level of security needed, and make an informed decision based on your individual needs and concerns. Important Factors To Consider When Choosing The Right USB Data Blocker For Your Needs When choosing a USB data blocker, it's essential to consider several important factors to ensure you have the right device for your specific needs. First and foremost, compatibility is crucial. USB data blockers come in various types, including Type-A and Type-C, so it's essential to choose one that matches the USB port on your device to guarantee proper functionality. Another important factor is the speed capability of the USB data blocker. If you frequently transfer large files or need faster charging, it's important to choose a data blocker that supports higher data transfer speeds and power delivery. Additionally, consider the build quality and durability of the USB data blocker. Look for products made from sturdy materials that can withstand regular use and potentially harsh environments. Furthermore, consider the size and portability of the data blocker. If you travel often or use multiple devices, a compact and lightweight option would be more convenient. Lastly, take into account any additional features or functionalities that may be important to you. Some USB data blockers come with LED indicators, on/off switches, or even antivirus protection. By carefully considering these factors, you can choose a USB data blocker that suits your needs, offering peace of mind and protection against potential data theft when charging your devices on the go. Best Practices For Staying Safe While Charging Your Devices On The Go When it comes to charging our devices on the go, we often prioritize convenience over security. However, it is important to be aware of potential risks and take necessary precautions to protect our personal information. Here are some best practices for staying safe while charging your devices on the go: 1. Avoid using public charging stations: While it may be tempting to plug in your device at airports, cafes, or other public locations, be cautious. These USB ports could be compromised or contain hidden data-stealing software. Instead, use a wall charger or carry a portable power bank. 2. Invest in a USB data blocker: A USB data blocker acts as a barrier, preventing data exchange while allowing charging. It ensures that no unauthorized data is transferred between your device and the charging station. This small, inexpensive device provides an extra layer of security. 3. Carry your charging cable: Rather than using unknown charging cables, carry your own trusted cable. This reduces the chances of exposing your device to potential malware or data theft. 4. Disable data transfer mode: Before plugging in your device, ensure that data transfer mode is disabled. This can be found in the settings of most devices and prevents any data from being accessed or transferred while charging. By following these best practices, you can mitigate the risk of USB data theft and protect your personal information while charging your devices on the go. Prioritize your security and enjoy peace of mind knowing your data is safe. Frequently Asked Questions 1. What is a USB data blocker? A USB data blocker, also known as a USB condom, is a small device that blocks data transfer between a USB device and a computer. It allows for charging the device while preventing any potential data exchange, protecting against malicious attacks such as data theft or malware injection. 2. Why would I need a USB data blocker? A USB data blocker is essential in situations where you need to charge your device using a public USB port, such as airports or cafes. These ports may carry hidden risks, as they can potentially transfer malware or access your sensitive data. Using a USB data blocker ensures a secure power connection without any data compromise. 3. How does a USB data blocker work? A USB data blocker works by physically blocking the data transfer pins in a USB port. It allows only the power pins to pass through while disabling the data transfer pins. This ensures that no data can be exchanged between the USB device and the computer, making it safe to charge your device without any risk of data theft or malware infection. 4. Can't I just use a regular charging cable instead? Using a regular charging cable without a USB data blocker leaves your device vulnerable to potential data breaches. Hackers can modify USB ports to install malware or collect information from connected devices without your knowledge. A USB data blocker acts as a proactive measure, providing an additional layer of security by completely blocking the data transmission, which a regular charging cable cannot offer. In conclusion, a USB data blocker is a necessary and crucial tool that individuals should consider using in order to protect their data and safeguard their devices from potential cyber threats. The article has highlighted the various risks associated with using public charging stations or unknown USB ports, including data theft and malware infections. By using a USB data blocker, users can ensure that only power is delivered through the USB connection, eliminating the risk of data transfer. Considering the increasing prevalence of cyber attacks and the importance of data privacy, it is strongly recommended to invest in a USB data blocker to prioritize the security of our personal information.
Can bed bugs jump? Well, they can certainly give you the heebie-jeebies. The idea of having bugs in your bed is disturbing, and worrying about whether they can jump or fly and land on you can be even more bothersome. We've got good news and bad news when it comes to whether bed bugs can jump: - Bed bugs do not jump. Whew! - They also don't fly, which is even better news. - They can crawl, though. That's how they get around. - And they're great at hiding, so you might not know you have them. - Oh, and did we mention that they bite? Don't worry, though! We've got the information you need to keep these creepy crawlies away from you and your bed. Can Bed Bugs Jump? We know that bed bugs don't jump or fly, which is a relief. They don't have wings, and they don't have strong back legs that would enable jumping. What they do is crawl. They shimmy along surfaces that are partially or completely hidden, such as along the seams of mattresses, across the back of headboards, and in the grooves of a bed frame. They can scurry pretty quickly, so if you see one in motion, you might need to move fast to catch it. At night, they emerge from their hiding places to feed on whomever is sleeping nearby. How Do Bed Bugs Spread? If bed bugs can't jump, then, you might wonder how they manage to spread so easily. The answer is that they hitch a ride to wherever they end up. Here's how it works: An unsuspecting person spends some time at a home or business establishment that has a bed bug infestation. Remember that you don't necessarily have to sleep there; bed bugs can be hiding in chairs, carpeting, couches… you get the idea. Maybe you put your purse or briefcase on the floor or on an upholstered chair. A female bed bug crawls into your bag. When you get home, you put the bag on your bedroom floor, where the bug emerges, saunters over to your bed or some other furniture, and lays some eggs. Females can lay up to seven eggs daily. If a male bug accompanied her on her journey, you can see how this will lead to an infestation in no time at all. Those eggs hatch about two weeks later, and you've got yourself a few (or a lot of) bed bugs. They multiply quickly. Then you invite a friend over, who places her coat on your bed. You see where this is going. Bed bugs spread rapidly with no jumping or flying necessary. What Jumping Insects Look Like Bed Bugs? If you've encountered a brownish bug on your bed that's jumping or flying, the good news is that it's not a bed bug. The bad news is that you have an unidentified bug in your bed. Here are some of the possibilities as to what it might be: - Carpet beetles. These can fly, but they don't look too much like bed bugs. They're hairier and have a patterned appearance. They also won't usually hang out in your bed unless they land there temporarily. - Fleas. Fleas are smaller than bed bugs, but they're brown or black and they do jump. Fleas typically don't live on human blood, so an infestation is more likely if you have furry pets. - Spider beetles. These are about the same size as bed bugs and they're brown, but they tend to be rounder and glossier. They also don't bite. They can fly, however. They usually live where there's old or rotted wood, so if you live in a wood home that might have some damage or rot, this might be your bug. - Stink bugs. These pungent critters live up to their name and emit a smelly substance if they feel threatened. They're brown and they fly. These bugs usually go into houses in the winter when it's too cold outside. Do I Have Bed Bugs? If you've determined that the bugs you've seen are not flying or jumping, now it's time to think about whether they're actually bed bugs. We have a fairly comprehensive guide on how to check for bed bugs that you should look at. To summarize that process, you're going to want to look for telltale signs (rust-colored spots on the sheets, insect shells/casings, and actual live bugs in hidden crevices. In addition, bed bugs have a specific biting pattern that's different from many other insects. If you get bitten by a mosquito or a spider, you'll generally have a bite here and there in no discernible pattern. When you are bitten by bed bugs, however, the bites will usually show up in a line, a cluster, or a zig-zag pattern. They don't just bite you once and get on with their day; instead, they bite, walk a little, bite, walk a little, and so on. Bed bug bites can be quite itchy and they can take a week or two to clear up. If you have an infestation, you probably won't get all of your bites in one day, though, so you'll see clusters popping up on exposed skin over a period of time. These bites typically don't get infected and very rarely cause a serious allergic reaction. They're unpleasant, though, so you'll want to get the issue taken care of sooner rather than later. What Should I Do If I Have Bed Bugs? Once you've determined that the insects plaguing you are, in fact, bed bugs, there are some steps you'll want to take immediately. First, strip your bed. Toss the sheets in the wash on high. Once they're done, put them in the dryer on high and put your blankets and comforter in the washing machine. Now isn't the time to try to save energy by using your clothesline; the sun won't kill bed bugs or their eggs. Put the items in the dryer. Next, use your vacuum cleaner on the mattress, paying special attention to the seams and edges. Take off the mattress and do the same with the box spring or platform. If you can, remove that and vacuum all of the nooks and crannies around the frame. Finally, vacuum the carpet. Will this process remove all of the bed bugs? No, it will not. But it will buy you a little time (as in a day or two) before a professional exterminator comes to take care of the problem. Can you DIY bed bug remediation? Probably not. It would be possible if you were willing to vacuum very frequently while also using chemicals, but keep this in mind: An exterminator is well-practiced at using chemical pesticides safely. They will also usually guarantee their work for some period of time. Using substances like vinegar, bleach, or rubbing alcohol is not effective and will just prolong the problem. In conclusion, if you see insects in your bed that are jumping or flying, they're not bed bugs. Crawling bugs that bite you in a zig-zag or clustered pattern very well might be. Bed bugs are yucky, but they're not dangerous in the vast majority of cases. Consulting a professional will help you mitigate the problem sooner rather than later.
Motorists submit 35 dash cam videos to UK police every day Dash cam footage is increasingly being used as evidence of dodgy driving and to prove who's to blame in an accident. We take a closer look... Around 2.4 million motoring offences are committed in England and Wales every year, and a growing number of those transgressors could be convicted on the back of video footage supplied by another road user. It's estimated that around a quarter of the UK's 32.7 million drivers now have a dash cam fitted in their car, with many viewing it as a vital back-up if they are involved in an accident or a 'crash for cash' insurance scam. Read more: Best dash cams - reviewed and rated The use of dash cams by drivers and motorcycle riders has skyrocketed by 850% in the past four years, according to dash cam maker Nextbase. That's because, in 2015, insurers started accepting dash cam footage as evidence in claims, and the first criminal conviction was based on video material was secured that year. The rising use of dash cams has also led to a significant increase in the amount of video footage being sent to the police to report people committing traffic offences. To find out just how many people are sending in such footage, and what is being done with it, we sent out a Freedom of Information request to all 45 territorial forces in the UK. Most police forces accept video footage from the public, and we obtained data from 22 of them. This revealed that they had received a staggering 52,174 videos of traffic incidents over the previous four years; that's the equivalent of 35 every day. The police took action regarding a third of the video clips, with the most common outcome being that the offender was sent on a driver awareness course; this was the case for 11% of them. However, 10% of offences were so serious that the perpetrators were prosecuted in court, and a further 10% were given a fixed penalty fine. Just 3% of incidents were considered minor enough for those involved to be issued with a warning. The force that has acted on the greatest percentage of footage is Dyfed-Powys Police in south Wales. It took action over 81% of the 375 videos it has received since 2017, with 40% of those involved issued a warning, 19% prosecuted in court and 18% sent on a driver awareness course. However, London's Metropolitan Police received by far the largest amount of footage – nearly 25,000 videos – and it acted in 45% of cases, issuing court proceedings to 19% of offenders, driver awareness courses to 14%, fixed penalty notices to 10% and warnings to 3%. Dyfed-Powys and the Met had the highest rate of court prosecutions, and Dyfed-Powys issued the highest proportion of warnings too. The Norfolk and Suffolk Constabulary issued the most fixed penalty notices (52%), and Gloucestershire sent the highest percentage of people on driver awareness courses (30%). The use of dash cam evidence by the police ramped up in 2017 when they found a way of speeding up the system. Before then, processing the evidence was time-consuming and labour-intensive, because officers needed to set up interviews with offenders and witnesses to get statements, then file several notices before the prosecution file could be submitted. All of this took an average of 15 hours per offence. Then, in 2017, officers at two Welsh police forces, North Wales and Dyfed-Powys, realised that dash cam footage could be treated in the same way as that from speed cameras. In these instances, all that's needed is for the footage to be logged as evidence and then a fixed penalty notice can be sent to the offender, who can either choose to pay it or go to court to dispute it. It's estimated that this saves police around 12 hours on the processing of each case. To make it easier for the public to share footage with them, the two Welsh forces set up Operation Snap, which involved the creation of an online portal that people can use to upload footage and provide witness statements about road traffic incidents. Since then, 34 other police forces in England and Wales have either become part of Operation Snap or set up their own online system for reporting traffic offences. 33 forces have also signed up to the National Dash Cam Safety Portal (NDCSP), another online reporting system set up by Nextbase in 2018. This not-for-profit portal lets footage be uploaded directly to the police force responsible for the region where an offence took place. It's hosted by Egress Software Technologies, which ensures all footage is encrypted when it's uploaded and securely passed on to the police. In order to weed out people reporting others for petty incidents that aren't criminal offences, the system runs through some simple questions about the incident and requires all users to confirm that they're willing to go to court about it before they are able to upload the footage. Like the Operation Snap systems, this portal also creates a witness statement that can be used by the police. West Mercia Police was one of the first forces to use the NDCSP. It stated: "We have a 91% intervention rate on all submissions (5100 to-date) ranging from warning letters right through to court summons, only 9% of these submissions had to have 'no further action'." Superintendent Paul Moxley from West Mercia said: "A process that previously took hours can now be reduced to a matter of minutes. This new technology enables the concerned road user to help us positively influence driver behaviour to make our roads a safer place for all users." Best used small cars for less than £10,000 Small doesn't have to mean stingy, and cheap really can be cheerful, as these fantastic used small cars prove
Welcome to a world of water exploration! Today, we delve into the realm of flat-bottom canoes – those sleek, stable, and surprisingly elegant wonders of the water. Key Takeaways - What Makes a Flat Bottom Canoe Unique? - The History Behind Flat-Bottom Canoes - The Stability of Flat-Bottom Canoes - What Defines a Flat Bottom Canoe? - Paddling a Flat Bottom Canoe – Unleash Your Adventure! - Choosing the Perfect Flat Bottom Canoe - Popular Flat Bottom Canoe Models and Brands - Flat Bottom Canoe vs. Other Canoe Types - When to Avoid Using a Flat Bottom Canoe - FAQs – Your Burning Questions Answered What Makes a Flat Bottom Canoe Unique? A flat-bottom canoe is a type of canoe with a horizontal bottom surface. It provides excellent stability in calm waters, making it the perfect choice for beginners and recreational use. However, it sacrifices speed and performance in rough water or when leaned over to one side. The History Behind Flat-Bottom Canoes Cultures worldwide have developed canoes for various uses, including transportation, exploration, and trade. Traditionally, flat-bottom canoes were built with wood, showcasing the craftsmanship and design that have stood the test of time. The Stability of Flat-Bottom Canoes Primary Stability Flat-bottom canoes excel in primary stability, providing a steady experience on calm waters. This is due to their wide base of support, allowing them to remain stable even when loaded. The flattened bottom offers a broad area of contact with the water, enhancing stability. Secondary Stability While flat-bottom canoes shine in primary stability, their secondary stability is compromised. When leaned or in rough conditions, they become less predictable and responsive. The flatness of the bottom limits the submerged surface area, making them more prone to tipping over. What Defines a Flat Bottom Canoe? The characteristics of a flat-bottom canoe are what set it apart: Hull Design Flat-bottom canoes have a distinct flat, horizontal bottom surface. This design provides excellent stability in calm water, making them suitable for beginners. However, it does sacrifice speed and performance in rougher conditions. Flat-bottom canoes offer exceptional stability, making them popular for recreational paddling in calm waters. Their steady nature allows for comfortable and enjoyable experiences on the water. Flat-bottom canoes can vary in length and width. Longer canoes tend to offer better tracking and speed, while wider canoes enhance stability. Consider your needs and preferences when choosing the right dimensions for your adventures. Flat-bottom canoes can be constructed using various materials, including wood, aluminum, or composite materials. Each material has its own unique characteristics, such as durability, weight, and cost. Choose the material that best suits your needs and budget. Weight Capacity The weight capacity of a flat-bottom canoe depends on its size, construction, and design. Generally, they offer good weight-carrying capacity, allowing you to bring along gear and supplies for various purposes. Paddling a Flat Bottom Canoe – Unleash Your Adventure! Paddling a flat-bottom canoe is an experience like no other. Embrace the stability and agility it offers, knowing that the journey may be slower but filled with delight. Here are some tips for navigating the waters: Basic Paddling Strokes - The forward stroke propels the canoe forward, while the backward stroke helps in reversing. - The J-stroke is crucial for maintaining a straight course, correcting the canoe's tendency to veer off. Turning and Maneuvering - The sweep stroke allows for smooth turns, while the draw stroke moves the canoe sideways. - For quick turns, the cross-bow draw stroke proves handy, requiring a swift motion of the paddle. Dealing with Crosswinds - Crouch low to maintain stability in windy conditions. - Heeling the canoe away from the wind reduces the chance of being blown off course. - Trim the canoe by shifting weight to maintain balance and control. - Utilize the J-stroke to counteract the canoe's tendency to turn in crosswinds. Handling Different Water Conditions Flat-bottom canoes are best suited for calm waters, where their stability shines. However, they may be less stable in rough water or when leaned to one side. Exercise caution and stay aware of your surroundings while paddling. Choosing the Perfect Flat Bottom Canoe Consider the following factors when selecting your ideal flat-bottom canoe: - Paddling Plans: Determine the intended use, whether it be recreational paddling, fishing, or camping. - Length and Width: Longer canoes offer better tracking, while wider canoes provide increased stability. - Hull Shape: Flat-bottom canoes excel in primary stability, making them ideal for calm water use. Consider other hull designs for different conditions. - Materials: Choose from a variety of materials, each with its own advantages and price points. - Try Before You Buy: Test out different canoes to find the one that suits your preferences and paddling style. - Weight Capacity: Consider the weight capacity based on your needs and the gear you plan to bring along. Popular Flat Bottom Canoe Models and Brands Here are a few well-known flat-bottom canoe models to consider: - Old Town Guide 119: A popular solo paddling and fishing model known for its lightweight and maneuverability. - Pelican Explorer 14.6 DLX: This versatile canoe offers good stability and ample cargo space, perfect for recreational use. - Grumman Sport Boat: A durable and versatile canoe designed for fishing, hunting, or recreational paddling. - Coleman Ram-X: A budget-friendly option suitable for recreational paddling, offering stability and maneuverability. Flat Bottom Canoe vs. Other Canoe Types Comparing flat-bottom canoes to other types reveals distinct differences: - Flat Bottom vs. Rounded Hull: Flat-bottom canoes provide superior primary stability, while rounded hulls offer greater speed. - Flat Bottom vs. V-Shaped Hull: V-shaped hulls prioritize speed and efficiency, while flat-bottom canoes excel in stability. - Flat Bottom vs. Multi-Chine Hull: Multi-chine hulls strike a balance between stability and performance, falling between flat bottoms and V-shaped hulls. When to Avoid Using a Flat Bottom Canoe While flat-bottom canoes are versatile and reliable, they may not excel in certain conditions: - Rough Water: Flat-bottom canoes are not as stable in rough water. Consider other hull designs for more challenging environments. - Leaning: If you anticipate the need to lean or tilt the canoe for maneuvers, a different hull shape may offer better stability and control. - Wind: Flat-bottom canoes are susceptible to wind, which may affect their ability to maintain course. Other hull designs may provide better tracking and stability in windy conditions. FAQs – Your Burning Questions Answered - Are flat-bottom canoes good for beginners? Absolutely! They offer excellent stability, making them easy to maneuver and suitable for novice paddlers. - Which canoes are used in international canoeing competitions? Various canoe types, including solo and tandem canoes, are used in international canoeing competitions, such as canoe sprints and canoe slaloms. - Are flat-bottom canoes beneficial for fishing? Yes, indeed! Their stability and efficiency make casting and reeling fish a breeze. - Can flat bottom canoes carry heavy loads? Yes, flat-bottom canoes have excellent weight-carrying capacity due to their primary stability. - Are flat canoes cheaper than normal canoes? The cost of a canoe depends on various factors, so it's hard to generalize. Consider your needs and budget when selecting a canoe. Welcome to the world of flat-bottom canoes, where stability, versatility, and adventure await. So grab your paddle, embark on a new journey, and discover the wonders that lie ahead. Happy paddling!
Scotland has more recently started to come to terms with its own involvement in the Atlantic Slave Trade. It has often been overlooked because there was no port from which ships who were directly involved in trading of slaves in West Africa sailed or docked. However, it is quite clear that Scotland benefitted substantially from the trade and was able to invest significant sums of wealth into the development of industry, banking and architecture. The Glasgow Tobacco Lords accumulated vast sums of wealth that could be invested in industrial developments such as steam power. The legacy is there – a walk around Glasgow and you will find street names such as Buchanan, Glassford and Ingram, all named after Scottish tobacco planters and situated in the merchant city, built with the wealth created by slaves. Edinburgh boasts the beautiful New Town but these were the homes of merchants who were involved in the Atlantic Slave Trade. Sir Henry Dundas, whose statue overlooks St Andrews square, used his influence in Parliament to deliberately delay the end of the slave trade by 15 years. Recently, Edinburgh City Council changed the details on the monument to acknowledge Dundas' role in the Slave Trade and delaying its end. It also pays tribute to the half a million Africans who were enslaved during the time delay Dundas caused to the ending of the Slave Trade. A small step in the right direction to atone for the actions of a man who accumulated great wealth from the enslavement of human beings. However, the descendant of Henry Dundas, Bobby Dundas, has argued that his ancestor was an abolitionist. Protestors point out that this is another attempt by the family of a white slave trader to dominate history and they are not responding or listening to what protestors are saying. Protestors state that the refusal to listen and to critically evaluate our past and acknowledge the involvement and consequences of Britain in the Atlantic Slave Trade, contributes towards entrenching racist attitudes. When the narrative is created by, and perpetuated by, white people and their perception of the past, it becomes an increasingly difficult narrative to change. The former Prime Minister, Boris Johnson, called BLM protestors 'thugs' and insists the UK is not a racist country.
+33 1 78 90 46 50 Log in Online courses Interior Design Fundamentals - free online course The most effective free Interior Design online course. Interior design certificate program (Level 1) Get your first certificate in interior design Video course 3D Rendering for Interior Design Embark on the world of 3D rendering Japandi style - What is Japandi and how to create Japandi interiors? How to Design Any Space in Japandi Style Kitchen Interior Design Course Design Your Dream Kitchen During Our Professional Online Course See all Starting soon Ergonomics and Color in Interior Design Learn the specifics of Ergonomics and Color in Interior Design SketchUp Masterclass A Deep Dive into SketchUp for Design Enthusiasts 3D Rendering for Interior Design Embark on the world of 3D rendering Sustainable Interior Design Learn How to Apply the Principles of Sustainable Interior Design in Practice Feng Shui Harmonizing Spaces: The Art of Feng Shui in Interior Design See all Complete programs Interior design certificate program (Level 1) Get your first certificate in interior design Landscape Design - online course Learn the Secrets of Creating Beautiful Outdoor Areas. Interior Design Professional Course Achieve an Internationally Recognized Interior Design Certificate! See all For lecturers About us Who are we? Career center Contact Us Log in Contact Us I agree with terms of use in to your account Please, fill in the form below: Remember me Log in Zig zag kitchen design Discussion about : "Zig zag kitchen design" Question : At which university in Japan can I study interior design? Answer : The Chiba University is another option. Before you commit three to five years to a university education in interior design, however, I recommend that you try a short course and determine whether this career is for you before going on to study at a Japanese university. Another choice is the Paris-based Home Design Institute's free course, which may be accessed here: Read all answers Question : Why be a kitchen designer? Answer : Kitchen designers play a critical role in the design and renovation of kitchens. They must be both creative and practical, able to translate the client's wishes into a functional and beautiful kitchen. A good kitchen designer understands the needs of the client and knows how to create a space that is both beautiful and efficient. They have a knowledge of materials and appliances, as well as an understanding of ergonomics, which enables them to create a space that is not only attractive but also comfortable to work in. Kitchen designers must also be able to work within a budget, and they must be able to coordinate with other contractors involved in the renovation project. They must also be able to stay up-to-date on the latest trends. Read all answers Question : Do you think an interior design education is necessary to be successful in the industry? Answer : While an interior design education is not necessary to be successful in the industry, it can give you a leg up. Many top interior design firms look for candidates with formal training from a reputable school. That said, there are many ways to learn about interior design. If you're interested in pursuing a career in this field, start by researching the best schools and programs available to you. Then get creative and start practicing on your own. There are plenty of online resources (including Houzz) that can help you learn about new trends and techniques. And don't forget to visit art galleries, furniture stores, and home improvement stores to get inspired. The more you learn and practice, the better prepared you'll be for a successful career in Read all answers Question : How to create a home design 3d? Answer : Designing a home in 3D can be a fun and rewarding experience. However, it does take some time and effort to learn how to do it effectively. Here are a few tips on how to create a home design 3D: 1. Choose the right software: There are many different software programs available for designing homes in 3D. Some are more user-friendly than others, so it's important to choose one that you feel comfortable working with. 2. Sketch out your design: Once you have chosen your software, it's time to start sketching out your design. Think about what kind of layout you want, what sorts of features you want included, and so forth. Read all answers Question : What is a garden design degree? Answer : A garden design degree is a degree in landscape architecture, horticulture, or forestry. Garden design degrees can provide you with the skills you need to work as a professional garden designer, creating and overseeing the planning and implementation of both residential and commercial gardens. Coursework in a garden design degree will typically include topics such as botany, plant identification, soils and composting, irrigation systems, landscape construction techniques, and project management. Read all answers Question : Is interior design architecture? Answer : Interior design is the process of shaping the interior of a space to reflect the occupant's needs and wants. Architecture is the process of designing and constructing buildings and other physical structures. While architecture may involve the design of interior spaces, it is distinct from interior design, which is concerned with the aesthetic appearance and function of interiors. Read all answers Question : How to design backyard deck? Answer : There are a few things to consider when designing a backyard deck: -The size of your yard and the height of the deck -The materials you want to use (wood, metal, plastic) -The type of railing you want (railing or no railing) -Accessories like benches, planters, and lights. Read all answers Question : Where can I study interior design in Krakow? Answer : The best schools for interior design in Krakow are the Academy of Fine Arts and the Cracow University of Technology. Read all answers Question : Are there any other programs or methods you would suggest for learning about interior design? Answer : There are a lot of great interior design programs out there that can teach you about the principles and theories of design. But if you're looking for a more hands-on approach, I would recommend finding an interior designer who is willing to mentor you and give you some one-on-one instruction. A lot of designers are happy to do this, especially if they think you have some natural talent and potential. And even if you don't end up becoming a professional designer yourself, this type of learning experience can be really useful for helping you create a more beautiful home environment for yourself. Read all answers
In this article: In this article: A factory reset can help solve some of the issues that may be causing your mobile device to act strangely — but not all of them. Learn what to do instead. In this article: In this article: Yes. Performing a factory reset on your mobile device can help combat viruses by removing infected files and curing malware infections — but it won't always be enough to completely remove all malicious software from your phone. Many viruses can survive a factory reset by hiding in hard-to-reach locations on your phone, such as deep within your device's settings and preferences. In recent years, cybersecurity researchers have found that []: Viruses and malware targeting your device's firmware — programs embedded deep in your device's hardware — are becoming more of a threat. If you think your phone has a virus, a factory reset is a good first step to take. But you may need to take more drastic measures to completely clean up an infected device. In this guide, we'll explain what a factory reset can and can't do, how to reset your iOS and Android devices to their factory settings, and which methods are best for detecting and removing viruses from your mobile devices. According to the latest research, nearly nine million new malware programs appear every month [] — and hackers are always looking for new opportunities to use these programs against you. Unfortunately, there are more ways than ever for your phone to become infected with spyware, ransomware, and other viruses — from clicking on links in phishing scams to downloading infected apps, giving up account passwords to hackers, and visiting fake websites. Once your phone has been infected, scammers can steal your sensitive information, break into your online accounts, or even spy on you by using your phone's camera and microphone. Here are some of the most common warning signs that your phone has been hacked or has a virus: Pro tip: While phone viruses pose a real threat, hackers are much more likely to target your online accounts. For the best protection, consider an all-in-one digital security solution that protects against viruses, hacking, fraud, scams, and more. A factory reset returns your device to its original state. Since this effectively reinstalls the operating system (OS) and erases your personal files and customizations from the hard drive, the factory reset option should only be used as a last resort to remove viruses (and if you have a recent, clean backup that you can use to restore your device's data). Still, a factory reset can be an effective strategy to use against many types of malware. However, it may not cure everything. For example, performing a factory reset can't remove hackers from your online accounts or destroy malware that has attached itself deeply in your device's hardware or system files. The bottom line: Digital security is about more than just protecting your phone against viruses. Aura's award-winning, all-in-one digital safety solution monitors and protects your devices, personal data, identity, finances, and more. Try Aura for free today. The exact factory reset process for Android devices depends on the phone manufacturer. Before following the general steps below, be sure to back up your data — as these steps will delete all of your files and settings. Pro tip: Each Android device is slightly different. Visit your phone manufacturer's support page to learn more about how to perform a factory reset on your specific device. Before you factory reset your iOS device, make sure your data has been backed up, as this will remove all data and settings. Once you're ready, you can use one of the following methods to factory reset your iPhone or other iOS device: 💡 Related: Can Macs Get Viruses? How To Remove Malware From Macs → A factory reset isn't always the right or best option for a phone that is showing signs of being hacked or infected. Before completely wiping your device, try these troubleshooting steps for removing viruses. Many virus warning signs resemble standard poor performance issues in a device. By restarting your phone, your device clears its random access memory (RAM), shuts down any processes or apps running in the background, and fixes temporary software and app glitches. How to restart your phone: Antivirus software has the power to detect, quarantine, and remove malicious programs from most Android phones. However, while you may find antivirus software for your iPhone in the App store, it won't actually scan your device for viruses (as Apple doesn't allow apps to have this level of access to your device). Instead, you're more likely to find a digital security app that helps protect your online accounts and identity. How to run an antivirus scan on your Android: 📚 Learn more: How to Check For Viruses on an iPhone → Unsafe or unfamiliar apps can house viruses, cause your device to run poorly, or give hackers access to your system settings, files, and more. Removing old, outdated, or unknown apps from your phone can keep you safe — and keep your device running smoothly. How to delete apps: Your cache contains temporary files and scripts from websites and apps to help them load faster. While this can help your device operate properly, a full cache can cause poor performance or even give viruses a place to hide. How to clear your browser's cache and history: 📚 Related: How To Get Rid Of the Apple Security Alert and Mac Pop-up Scams → When your device's memory or storage space gets depleted, you could encounter sluggish performance, crashes, and data loss. How to check your device memory: An outdated operating system could have exploitable vulnerabilities and bugs that weaken your security. Updating your OS will provide you with patches, enhanced security features, and better compatibility with your phone's features and apps. How to update your phone's OS: One way to test if an app or file is causing issues is to launch your phone in "safe mode," which features limited functionality, apps, and system settings. While booting your device in safe mode won't remove viruses, if your device runs fine in safe mode, you likely have an app issue. How to boot your phone in safe mode: 📚 Related: How To Remove Viruses From Your Computer (Mac and PC) → Backups allow you to save all of your files and settings in case something happens to your device. If you have a backup that was made before the issues started, restoring it to that previous version can remove many viruses or corrupted files and apps. How to restore your phone to a safe backup: If your problem lies with your online accounts, updating your passwords and enabling two-factor authentication (2FA) could fix the issue. If there is a virus, it could have come from an exposed online account. Either way, this step is crucial for device security. How to update your account passwords: Some viruses are especially resilient and will remain even after you implement a factory reset or follow many of the steps above. Here are some of the reasons why a factory reset may not be working for you: While viruses pose serious threats to our phones and other devices, they're just one of many online dangers. Cybercriminals can scam you and hack your iPhone and Android devices in any number of ways. For effective protection, you need to practice good cyber hygiene at all times. Try applying the following tips to keep your phone and accounts safe: A factory reset can be a powerful tool to clean out viruses from your device, but it isn't always foolproof. Viruses often reflect a symptom of deeper and more serious digital security problems. For complete protection, consider Aura's all-in-one digital security solution. With Aura, you get a full suite of advanced digital security tools, award-winning identity theft and fraud protection with the industry's fastest fraud alerts, 24/7 access to U.S.-based White Glove Fraud Resolution Specialists, and up to $5 million in identity theft insurance for your family. Editorial note: Our articles provide educational information for you to increase awareness about digital safety. Aura's services may not provide the exact features we write about, nor may cover or protect against every type of crime, fraud, or threat discussed in our articles. Please review our Terms during enrollment or setup for more information. Remember that no one can prevent all identity theft or cybercrime.
Eye Health For Busy Moms: Incorporating Quick And Effective Habits Into Daily- Routine For busy moms, maintaining eye health amidst a hectic schedule can seem challenging, but incorporating quick and effective habits into daily routines can make a significant difference. Trending Photos For busy moms, maintaining eye health amidst a hectic schedule can seem challenging, but incorporating quick and effective habits into daily routines can make a significant difference. Here are some practical tips shared by Dr Avani Sapovadia, Cornea & Refractive consultant at Netradeep Maxivision eye hospital, Rajkot to help busy moms prioritize eye health without adding unnecessary stress to their already-packed schedules: Hydration is Key: Start the day by drinking a glass of water. Staying hydrated not only benefits overall health but also helps keep the eyes lubricated and reduces dryness, which is common during extended screen time or exposure to environmental factors like air conditioning or heating. Follow the 20-20-20 Rule: Whether it's managing household chores or working from home, busy moms often spend extended periods in front of screens. Encourage regular breaks by adopting the 20-20-20 rule: every 20 minutes, take a 20-second break and focus on something 20 feet away. This simple habit helps reduce eye strain and fatigue. Healthy Snacking: Incorporate eye-friendly foods into snacks and meals. Opt for nutrient-rich foods like carrots, bell peppers, berries, nuts, and seeds, which are packed with vitamins, antioxidants, and omega-3 fatty acids beneficial for eye health. These snacks can be prepared and enjoyed on the go, making them convenient choices for busy moms. Protective Eyewear: Whether running errands or enjoying outdoor activities with the family, wear sunglasses that offer UV protection. Prolonged exposure to harmful UV rays can increase the risk of cataracts, macular degeneration, and other eye conditions. Choose sunglasses with broad-spectrum UV protection and wrap-around frames for maximum coverage. Prioritize Sleep: Adequate sleep is essential for overall well-being, including eye health. Ensure you're getting enough rest each night by establishing a bedtime routine and creating a sleep-friendly environment. Dim the lights, limit screen time before bed, and avoid caffeine or stimulating activities close to bedtime to promote quality sleep. Regular Eye Exams: Schedule routine eye exams for yourself and your family members. Regular check-ups allow for early detection and management of vision problems and eye conditions. Many optometrists offer flexible appointment times to accommodate busy schedules, making it easier to prioritize eye health. Practice Stress Management: Busy schedules can lead to stress, which can impact eye health. Incorporate stress-relief techniques such as deep breathing exercises, mindfulness meditation, or yoga into your daily routine to promote relaxation and reduce tension. Stay Active: Physical activity benefits not only overall health but also eye health by promoting proper circulation and reducing the risk of conditions like glaucoma and AMD. Find ways to incorporate exercise into your daily routine, whether it's taking a brisk walk with the stroller, dancing with the kids, or practicing yoga at home. By incorporating these simple yet effective habits into their daily routines, busy moms can prioritize eye health and ensure optimal vision for themselves and their families. Taking proactive steps to care for your eyes doesn't have to be time-consuming; with a little planning and consistency, it can seamlessly integrate into your busy lifestyle. Live Tv
If there is any versatile machine that can accomplish myriad applications that it is undoubtedly the amphibious excavator. These machines find their applicability in a wide range of environments and specifically in those areas where there is a lot of water logging. It is very natural that we will come across different types of environments and also different types of grounds wherein a few may be soft and a few others may be hard and yet a few others of medium consistency. In places where the ground is very soft, it is only the amphibious excavator that can give great results. Though the practical applications achieved by this wonder machine are famous and well known, man with his intelligence is trying out new methods and ways in which he can apply this machine to further accomplish many other tasks as well. And the first kind of application that tops the list is the wetland restoration. With the kind of Herculean tasks the product has been achieving, one really cannot visualize what the shape of the amphibious excavator would be in the coming times. But, it will continue to occupy its place and perhaps reach the forever indispensible status too. Here are a few common applications of the amphibious excavator which is touted as the wonder that has ever happened to mankind for the kind of tasks it accomplishes for him: >> Swamp clearing, earth removing and land clearing at plantations, fringe forests and mining areas. >> Wetland restoration, land reclamation, flood prevention and bund building for piling. >> Deepening of rivers, canals and also river mouths that face the sea. >> Trench digging for installation of pipes in Oil and Gas projects. >> Water irrigation in fields of paddy and other plantations too. >> Used for building walls in shrimp ponds, fish ponds as well as salt making ponds. >> Amphibious excavators find absolute praiseworthy application in areas that have been hit by a landslide or a huge flood as they are adept at clearing obstacles and transporting the same too. >> Found to be excellent at work in areas that have been hit by chemical pollution and other disasters as well. In fact a lot of land and water areas would have gone a waste if not for this product that can really make the impossible so very plausible with its long reach and great applications in almost all fields.
Overweight Children At High Risk Of Iron Deficiency: Study Malnutrition or being underweight is often related to numerous risks associated with deficiencies. In a recent study, researchers identified that being overweight or obese also puts children and young adults at a significantly high risk of iron deficiency. The findings were made by nutritional scientists at the University of Leeds, U.K. after examining thousands of medical studies from 44 countries. These studies involved participants below the age of 25 whose levels of iron and other vitamins and minerals were recorded along with their weight. The analysis showed that iron deficiency was associated with both underweight and overweight children and adolescents. However, zinc and vitamin A deficiencies were only observed in undernourished children. The results were published in the journal BMJ Global Health. A deficiency of iron can lead to anemia, a condition that results in inadequate healthy red blood cells. The symptoms include fatigue, weakness, pale skin, brittle nails, and poor appetite. Iron deficiency anemia can cause complications including heart problems such as irregular heartbeat, premature birth, low birth weight in pregnant women, and delayed growth and development in young children. Earlier studies have identified iron deficiency as a problem in adults living with obesity, but the latest research is the first to look at the association in children. "The relationship between undernutrition and critical micronutrients for childhood growth and development is well established, but less is known about the risk of deficiencies in iron, vitamin A, and zinc in children and adolescents who are overweight or obese, making this a hidden form of malnutrition," said lead author Xiaomian Tan in a news release. "Our research is hugely important given the high prevalence of obesity in children. We hope it will lead to increased recognition of the problem by healthcare practitioners and improvements in clinical practice and care," Tan said. The researchers believe that iron deficiency in overweight children is probably due to inflammation-disrupting mechanisms that regulate iron absorption. "By the age of 11 here in the UK, one in three children are living with overweight or obesity, and our data suggests that even in overweight children inflammation leading to iron deficiency can be an issue," said research supervisor Bernadette Moore. "Iron status may be the canary in the coalmine, but the real issue is that prolonged inflammation leads to heart disease, diabetes and fatty liver," Moore said. To reduce inflammation and improve iron status, researchers recommend enhancing both physical activity and diet, while they underscore the need for further studies into the effectiveness of these interventions.
Open share links Cybersecurity threats remain prevalent, with data breaches increasing by 20% from 2022 to 2023, and a cyberattack in March 2024 on a major U.S. health care billing company causing widespread repercussions. Moreover, artificial intelligence has introduced new potential threats, many of which are still unforeseen. Despite the magnitude of these threats, many companies have grown accustomed to the dangers, while others struggle to determine where to focus their cybersecurity efforts. No company can expect absolute protection against cyberattacks, regardless of the time, technology, and resources invested, as emphasized by Keri Pearlson, executive director of Cybersecurity at MIT Sloan. The more achievable goal is cyber resilience, ensuring that a business can swiftly recover from inevitable attacks and resume operations with minimal disruption. A resilient organization emerges from an attack relatively unharmed, experiencing minimal data loss, financial impact, or damage to its brand reputation. Organizations must establish cybersecurity as a collective responsibility while implementing strategies and mechanisms to foster cyber resilience. According to Pearlson's insights shared during a recent webinar hosted by MIT Sloan Executive Education, "It's everyone's job to be a bit more vigilant today. There are appropriate actions that every individual in the organization can take." A strategic plan for resilience To achieve resilience goals, Pearlson recommends the following: Focus on planning and testing. Resilience hinges on preparation. Dedicate time to anticipate cyber threats, identify potential impact areas, and test business recovery plans through exercises and processes to ensure rapid recovery. "The more you practice and prepare organizational processes and technologies, the better equipped you are to absorb shocks and swiftly resume operations," said Pearlson, who offers executive education courses on cybersecurity leadership for non-technical executives and cybersecurity governance for boards of directors. Shift attitudes and beliefs. Employees must recognize cybersecurity as integral to organizational health. Rather than mandating actions, cultivate a security-focused culture through storytelling, training, and incentives to encourage desired behaviors. Related Articles Adopt a balanced scorecard/risk management approach. Pearlson suggests that companies assess resilience qualitatively by evaluating risks and responses in the context of compliance or supply chain risks. Organizations can utilize a cybersecurity framework from the National Institute of Standards and Technology to identify, respond to, and recover from threats while establishing governance and risk management practices. Monitor advancements in AI. Artificial intelligence presents both opportunities and challenges in handling cybersecurity risks and resilience. New technologies such as generative AI and quantum computing will enhance threat identification and response capabilities. However, these technologies may also be utilized for malicious purposes, necessitating innovative cybersecurity measures. Prioritize security. As businesses progress, elevating organizational awareness regarding cybersecurity threats is imperative for all individuals, especially those in executive positions. "By shedding light on our protective measures and thoughts, we can augment our organization's resilience," remarked Pearlson. "Understanding the origins of risk is essential for effective risk management." Watch the webinar: cybersecurity resiliency is about more than protection Read more: how to foster a culture of cybersecurity Close share links
The concept of surety holds a crucial role in ensuring the smooth execution of a testator's wishes as outlined in their will. This intricate legal notion assures the beneficiaries and creditors to be duly protected. In this blog, we'll explore the intricacies of surety in wills, exploring its legal implications and significance. The Significance Of Surety In Wills Surety, in the context of wills, pertains to a legal obligation. This will be placed upon an executor or personal representative to provide a bond. It is commonly called a "surety bond" or "executor's bond." This bond is a financial guarantee to ensure that the executor will faithfully perform their duties and administer the estate. This is according to the terms outlined in the will and complies with applicable laws and regulations. Types Of Surety Bonds In the context of wills, two primary types of surety bonds are commonly used: 1. Probate Bond: This type of bond is required in probate court proceedings when the court deems it necessary to protect the estate. It ensures that the executor faithfully carries out their duties as the will stipulates and complies with all legal requirements. 2. Fiduciary Bond: A fiduciary bond is generally required when a person or entity serves as an estate's guardian, trustee, or administrator. It assures that they will act in the best interests of the beneficiaries and manage assets prudently. Examples To Understand Surety Surety in a will refers to a person or entity who guarantees that the terms of the will are carried out as specified. Here are two examples of surety in wills: Example 1 Sarah (Testator) – The person creating the will. James (Executor) – The person responsible for carrying out the terms of the will. ABC Trust Company (Surety) – The entity providing surety for the will. Sarah, a wealthy individual, wants to ensure that her assets are distributed as she wishes after passing. She creates a will that designates James, her trusted friend, as the executor of her estate. However, Sarah knows that estate matters can sometimes be complex and contentious. Also, she wants to provide her beneficiaries with an extra layer of security. To do this, she chooses to involve ABC Trust Company as a surety in her will. In this scenario, ABC Trust Company acts as a surety, guaranteeing that James will faithfully carry out the terms of the will. This means that if James were to fail in his duties, the trust company would step in to ensure Sarah's wishes are still fulfilled, thus providing peace of mind to Sarah and her beneficiaries. Example 2: John (Testator) – The person creating the will. Emily (Executor) – The person responsible for carrying out the terms of the will. XYZ Law Firm (Surety) – The legal firm providing surety for the will. John is a successful businessman with significant assets and a complex family situation. He wants to ensure that his will is executed precisely as he intends, but he knows that disputes could arise among his heirs. To mitigate any potential issues, John decides to involve XYZ Law Firm as a surety in his will. In this case, XYZ Law Firm serves as the surety, assuring John that Emily, the chosen executor, will handle the distribution of assets according to John's wishes and under the law. Suppose any disputes or complications arise during the execution of the will. In that case, the law firm will resolve them and ensure the will's proper execution, providing an added layer of legal expertise and oversight. These examples illustrate how surety in wills can provide additional security and confidence that a testator's wishes will be carried out as intended. This applies especially when there may be complexities or potential conflicts among beneficiaries.
Upcoming Sessions FREE LIVE ENCORE: Go Global with Virtual Field Trips Starting:05/30/2024 @ 07:00 PM (GMT-04:00) Eastern Time (US & Canada)Ending:05/30/2024 @ 07:30 PM (GMT-04:00) Eastern Time (US & Canada)Type:Single-day Session - FREE LIVE ENCORE: Implementing Differentiated Instruction - Simplified Starting:06/04/2024 @ 05:00 PM (GMT-04:00) Eastern Time (US & Canada)Ending:06/04/2024 @ 05:30 PM (GMT-04:00) Eastern Time (US & Canada)Type:Single-day Session See All Upcoming Sessions FigJam by Figma is an exciting new online tool that is free for educators and students. Figjam can be used as a collaborative whiteboard, a presentation platform, and so much more! Join Lauren Boucher and explore how to use this versatile tool, discover how to implement it in your classroom, and locate ready-made templates. Participants will also have an opportunity to utilize FigJam to create a lesson, presentation, or activity that they can immediately use with their students, so let's get jiggy! Presented by Lauren Boucher Lauren Boucher is a Regional Digital Teaching and Learning Consultant for the state of North Carolina. She earned her master's degree in elementary education, and she has taught third grade, as well as elementary and middle school gifted education. Lauren also has experience as an Instructional Technology Specialist for Pitt County Schools, and she presents at face-to-face and online conferences across the nation. Read more Are you ready to elevate your teaching career by mastering the art of designing a compelling resume and cover letter? Your resume and cover letter are your first impression - make them powerful and impossible to ignore. Join Dr. Samantha Fecich for this hands-on, interactive workshop and discover strategies for crafting your power resume and cover letter, including effective formatting, keyword optimization, and tailoring techniques for specific positions. Get ready to explore the secrets to positioning yourself as a standout educator in a competitive job market! Samantha's expertise in career development will equip you with the knowledge, skills, and confidence you need to design a resume and cover letter that emphasizes your unique strengths and dedication to education. This is workshop one of three for the series titled "Elevate Your Teaching Career." Key Takeaways Learn essential techniques for crafting a resume that tells your story, emphasizing your unique strengths and dedication to education. Discover the art of writing cover letters that go beyond formality, resonating with hiring managers and reflecting your commitment to student success. Understand how to craft a resume that grabs hiring managers' attention and lands you an interview. Explore the concept of personal branding and learn how to infuse it into your resume and cover letter for a standout professional identity. Presented by Dr. Samantha Fecich Dr. Samantha Fecich dedicates herself to shaping the next generation of educators at Grove City College in Grove City, Pennsylvania. In the courses she leads, she guides preservice teachers in exploring the realms of educational technology and special education. Samantha's commitment extends beyond the classroom; she is the author of two impactful books crafted to support new and aspiring educators: "EduMagic: A Guide for Preservice Teachers" and "EduMagic Shine On: A Guide for New Teachers." Samantha also hosts the EduMagic Podcast, where she illuminates the work of future teachers, providing insights and inspiration to the education community. Read more Total Participation Techniques (TPTs) are instructional strategies that allow all students to demonstrate, at the same time, active participation, and cognitive engagement. Join Dr. Jayme Linton as she models TPTs in this highly interactive session. You will also walk away with strategies and tools that you can immediately use to increase high cognitive engagement for every learner. Presented by Dr. Jayme Linton Dr. Jayme Linton is an education projects specialist for the U.S. Department of Defense Education Activity (DoDEA). She lives near Washington, D.C. and supports strategic planning, continuous improvement, and professional learning for DoDEA schools worldwide. Previously, Jayme served as a leadership coach, an assistant professor, instructional technology facilitator, and instructional coach. She is the author of The Blended Learning Blueprint for Elementary Teachers, published by Corwin, and she has been presenting for SimpleK12 since 2011. Read more Have you ever wondered how to create an inclusive classroom where every student, including the quietest ones, feels valued and heard? Introverted students often possess unique strengths like deep reflection, creativity, and empathy, and they thrive when provided with an environment that values these qualities. Join Chrissy Romano Arrabito for this timesaving, to the point session as she provides insights into creating an inclusive learning environment where introverted students can truly thrive. Get ready to revolutionize your teaching approach and create a classroom where every student, including the quietest ones, can excel academically and socially! Chrissy's passion for inclusive education will provide you with practical strategies to enhance your teaching skills and empower your introverted students to reach their full potential. Key Takeaways Gain a deeper understanding of introversion and the unique qualities it brings to the classroom. Learn to recognize and celebrate the strengths of your quieter students. Discover an array of classroom strategies that support introverted students. Explore techniques for nurturing participation, collaboration, and confidence among your quieter learners. Unlock the power of technology as a tool for engaging and empowering introverted students. Learn how to integrate digital resources and platforms to provide introverts with opportunities for self-expression and active learning. Dive into practical strategies for boosting the confidence and active participation of introverted students. Learn how to cultivate a classroom where every voice, especially the quieter ones, is valued and heard. Presented by Chrissy Romano Arrabito Chrissy Romano Arrabito serves as a first-grade educator at Nellie K. Parker Elementary School, located in Hackensack, New Jersey. With an extensive career spanning over three decades, she possesses a wealth of expertise in nurturing the educational growth of elementary and middle school students. Chrissy's educational philosophy is rooted in her deep commitment to nurturing the complete development of each child. She is a fervent advocate for innovation within the classroom, continually seeking ways to facilitate authentic and engaging learning encounters for her students. Read more Differentiated instruction is one of the most challenging tasks for teachers because we want to ensure that we reach each of our students daily, but we also need to find the time to plan for that instruction. Join Reba Gordon Matthews as she shares how to implement the differentiated instruction elements introduced by Carol Ann Tomlinson in a simplified way using the time and strategy tools that are readily available in your learning space. You will also learn best practices to help your students perform to the best of their unique abilities based upon their readiness, interests, and learning profiles. Presented by Reba Gordon Matthews Reba Gordon Matthews is an educational consultant with Houghton Mifflin Harcourt, a freelance coach, and instructional designer. She has over 20 years of teaching experience and holds master's degrees in instructional design and educational technology. Reba is also the co-founder and executive director of The Jamal Gordon Hill Foundation. This organization supports at-risk young people with academic tutoring, technology training, and college scholarships. Read more Have you ever wondered how to make your classroom discussions more engaging and purposeful? Academic talk, when incorporated effectively, can transform the dynamics of a classroom, fostering a vibrant learning environment that encourages critical thinking and active participation. Join Lauren Boucher for this timesaving, to the point session and explore strategies to create dynamic, intellectually stimulating environments where students confidently articulate their thoughts, building a foundation for lifelong learning. Get ready to discover the untapped potential of academic talk to enhance student learning for all ages and abilities! Lauren's expertise in collaborative learning will provide you with the tools and resources you need to facilitate meaningful discussions in your classroom and foster a classroom culture that values every voice. Key Takeaways Understand the pivotal role and importance of academic talk in promoting student engagement and deep learning. Learn practical and effective strategies for incorporating academic talk into your daily teaching practice that can be tailored to suit diverse classroom settings. Discover how to create a safe and inclusive space for students to express their thoughts and ideas, fostering a classroom culture that values every voice. Gain insights into assessing the effectiveness of academic talk and learn how to use feedback and reflection to continuously improve your practice. Presented by Lauren Boucher Lauren Boucher is a Regional Consultant for Digital Teaching and Learning with the North Carolina Department of Public Instruction. She holds a master's degree in elementary education and boasts a rich teaching background, including third-grade instruction and gifted education at both elementary and middle school levels. Her expertise also extends to serving as an Instructional Technology Specialist for Pitt County Schools and she shares her insights through both in-person and online presentations at conferences across the nation. Read more Shopping Cart Your cart is empty
It takes two to marry, but only one must pursue to end a divorce in the state of California. Default divorce can make the process more straightforward for couples seeking a divorce where one of the couples involved refuses to agree on the divorce terms. But what is a default divorce in California, exactly? If you are starting the process, it is essential to understand default divorce, the circumstances leading to default divorce, and what the process entails. With that in mind, we will explore how to file a default judgment for divorce in California below. What Is a Default Divorce in California? According to California state law, a default divorce is when the court grants divorce without cooperation or, in some cases, knowledge of the other spouse. There are several circumstances for a default divorce in California. Often, default divorce occurs when one spouse files for the dissolution of a marriage and the other spouse fails to respond to the petition. Default divorce is sometimes referred to as a "true" default divorce. But California also allows spouses to get an uncontested divorce through the default divorce process with a settlement agreement. We understand how complex divorces are to understand and navigate, so whenever you need a divorce lawyer in California, contact us and one of our family law experts will be able to offer quality guidance. Circumstances leading to a default divorce If you are seeking a default divorce, you need to be aware of the circumstances leading to it. Failure to respond to divorce petition After you serve your spouse, they have 30 days to respond from the day they've been served. If your spouse fails to respond within the response period, you may file for a default. After 30 days, you can fill out the Request to Enter Default (form FL-165). With this form, you ask the court to enter default divorce due to a failure from your spouse to respond. The divorce case can continue if the respondent is refusing to cooperate. Absence of agreement or dispute resolution If there is no settlement agreement and your partner is uncooperative, the judge will only consider your proposed judgment. Without an agreement or response from your spouse, the court will make its decisions based on the information you provide. You may request a default judgment that includes all your requested orders in your divorce petition. This is a true default and is difficult to "prove-up" so skilled family law professionals are necessary if you want this to get ordered by the court and include all the requests you are seeking. Default with agreement The respondent doesn't need to file a response in a divorce by default with agreement benefit regarding default divorce with agreements is that there's no need to divide the assets evenly. Even if the assets are split unevenly, the court still grants you the divorce decree. Default with agreement includes the following steps: - Disclosure of financial information – complete and up-to-date information about your and your spouse's finances. - Write your agreement – you and your spouse must write your agreement, sign it, and notarize it. The agreement should include child custody, visitation and support, property division, and alimony details. - Finalize the divorce – the agreement will be submitted, and the divorce will be completed after the judge signs it. Legal implications of defaulting in a divorce case If you are the respondent and do not file a response after you are served divorce papers, your spouse can request a default. This means that the court can legally decide the case without your participation. The court will only consider and order what your spouse asks without needing to hear your side. The Process: How Long Does a Default Divorce Take in California? Filing for divorce and serving the spouse To start the process, you file your Petition for Divorce (form FL-100) and the Summons (form FL-110) with your local county court. You must serve copies of these forms to your spouse. Response period and waiting periods in California Your spouse has 30 days from receiving the forms to respond and file their forms with the court. If you cannot locate your spouse, you may serve them by publication or posting. If there is no response, you can file for default after 30 days. California State Laws: Legal Rights and Protections in Default Divorce Sometimes, people try to get a divorce without informing the other spouse. For example, a petitioner may intentionally avoid informing their spouse and try to get a default divorce. If this happens, the responding spouse may look to reverse the default divorce judgment. If you are the respondent, you may file a Request to Set Aside Default on the following grounds for relief: - Mistake, inadvertence, surprise, or excusable neglect. - Not getting a notice of the summons and petition in time to file a response. - Judgment against you obtained by fraud, perjury, duress, mental incapacity, etc. - Non-compliance with the disclosure requirements. Having a competent attorney is crucial to protecting your rights. With Moore Family Law Group, you get an experienced attorney who helps you navigate the legal complexities. What is a default divorce in California? The above matters described above give a condensed overview of the complexities of this issue. True defaults are procedurally complicated. It is also important to remember that a default divorce in California is also available for couples going through an uncontested divorce. If you and your spouse have a written settlement agreement, the petitioner can file for a default or our law firm can help you navigate this process. This is common when the parties choose mediation.
- Wine Color/Type - Top Occasions - Unique Wines - Surprise Me! 3 key factors that create value wines A value wine is one that is both affordable and palatable. Ideally, it not only tastes good but also offers appealing aesthetics and branding. It's a bonus if the wine comes in fancy packaging. But what exactly lends value to such wines? The answer is more nuanced than one might initially think. A lot of factors contribute to the production of budget wines. (WavebreakmediaMicro/stock.adobe.com) Value wines typically range between USD 5-15. To offer these prices, many such wines are produced in large quantities, with some reaching over 3 million bottles per variety. Sogrape in Portugal is an example of an innovator in the entry level price sector, experimenting with robots and automation to maintain sustainable vineyards and counter labor shortages. These automations assist in tasks like weeding, spraying, and using infrared sensors for vineyard analysis. Incorporating automation can, in the long run, reduce production costs and potentially stabilize shelf prices. However, there are smaller producers who provide excellent value by selling their "second wines." These wines are especially prevalent in Bordeaux and other prestigious regions often come with a higher price tag than their primary counterparts. In the winemaking process, entry-level wines are typically produced faster than their prestigious counterparts, primarily for economic reasons. Grapes are processed in sizable presses and fermented in vast vessels, some with capacities surpassing 50,000 liters. A controlled fermentation with commercial yeasts and swift settling process, often facilitated by clarification methods, usually wrap up within two weeks. Some innovative producers even refrigerate grape juice (must) to ferment it on-demand, ensuring a consistent fermentation process year-round, which in turn guarantees a fresh and consistent wine flavor. These wines are then sterile-filtered, bottled, and ready to leave the winery early in the subsequent year, positively impacting the winery's cash flow. Despite their rapid processing and technical methods, these are the wines that most wine lovers, including the author of this article, savour and enjoy. Consider Penfolds Koonunga Hill Chardonnay from Australia—a superb wine offering a dry palate, full body, and a leesy texture complemented by dairy notes, white pepper, and pear. The freshness and complex flavor suggest it has been bottled in the export market. By transporting it in a 24,000-liter flexitank to the market before bottling, the wine remains of higher quality than if shipped in bottles since minimal temperature fluctuations influence its quality. Although such savings in shipping might trim only a dollar or so, it's a key attribute to the lengths producers go to ensure value. Large volumes of wines are shipped in those flexitanks. (Credit: portalspozywczy.pl) On the other end of the spectrum are the "super seconds" like Château Mouton Rothschild's Le Petit Mouton from Pauillac, retailing at approximately USD 300. Bottling such a wine within the market is unimaginable. Even when compared to its original, which is priced 3 to 4 times higher, this wine still presents significant value. In the intricate world of winemaking, the notion of "value" extends beyond the cost. It's a delicate balance of production strategies, innovation, and market positioning. Whether through high-volume production, strategic fermentation methods, or efficient shipping practices, producers worldwide continuously endeavor to provide consumers with wines that offer both quality and affordability. And while luxury wines have their esteemed place in the market, value wines play a crucial role in democratizing the wine experience, making it accessible to a broader audience. As wine VinoVossers, it's enriching to recognize and appreciate the intricacies behind that bottle of wine on the shelf, understanding that value is not just about price, but the passion, innovation, and strategy poured into every glass. Peter Douglas
If you own a quality wok, then it is important that you season it. A well-seasoned wok is better at imparting flavors into your foods. It also ensures that your wok is non-stick, helping you to easily toss stir fries and other culinary delights. If you are a newbie, you may understand the importance of seasoning a wok, but you may not know how to do it properly. As a result, this can cause the wok seasoning to flake. If the wok seasoning is coming off, it is likely that the seasoning didn't bond to the metal properly. In some cases, this may be because oil was allowed to pool in the wok. In others, you have tried to season a new wok without cleaning it first. Some new woks have a protective coating on them, preventing oil from sticking to the metal. If your wok seasoning isn't sticking to your wok, don't fret! It is an easy issue to rectify. Plus, if it makes you feel more confident in your abilities, some experienced wok users will struggle to get their seasoning to stick sometimes. Why Is My Wok Seasoning Coming Off? When you season a wok, you'll be creating a protective layer of oil known as the patina. To do this, you will essentially be heating up very, very thin layers of oil in your pan. When you heat the oil, it will go through a process known as polymerization. This chemical reaction causes the oil to turn into an almost plastic-like substance. As it does, it sticks to the bottom of the pan. When your wok seasoning starts to peel off, it is likely because your wok didn't complete the polymerization process. Most of the time, this is because you allowed the oil to pool at the bottom of the wok. This often happens if you used too much oil. If the oil doesn't polymerize properly, then it will eventually flake off. In rare cases, your wok seasoning may be coming off because you are scrubbing the wok too hard when you are cleaning. It may also be down to the chemicals that you use. Water that is too hot, as well as harsh soaps can cause flaking. So, where possible, always scrub gently with a very mild dish soap. Finally, many new wok pans have a protective layer on them. The job of this protective layer is to prevent the pan from rusting when in the store. If you do not remove this protective layer before you try to season, then your seasoning won't stick. In most cases, your wok seasoning will come off shortly after a fresh seasoning. It is rare for older woks to have their seasoning chip (unless you are scrubbing seriously hard), because each time you cook, a new layer of seasoning is added to the pan. If your wok seasoning is coming off, then you need to restore it quickly. If you don't, then your pan could end up rusting. If that happens, it takes a lot of effort to fix it. How To Restore the Wok Seasoning To restore the wok's seasoning, there are two things that you need to do: - Remove the old seasoning. - Re-season the wok. Some people will only remove the old seasoning in the area that is chipping. You can do that if you wish. You can use the same method that we discuss here. However, we prefer to remove all the wok's seasoning. Because if there is a poor 'stick' in one part of the wok, chances are that the seasoning wouldn't have stuck properly elsewhere too. You really don't want to be forever re-seasoning, hence starting completely fresh. Let's walk you through the steps. Removing the Old Seasoning on Your Wok To remove the old seasoning, you will need two things: - A mild dish soap. - A stainless-steel dish scrubber Using warm water and soap, scrub the wok's seasoning. If the seasoning is loose, this should lift it right off. If some areas seem a bit tough, then you may want to work a bit of baking soda in there too. It will work more effectively than the soap. It is going to take a decent amount of scrubbing but keep at it. Once the old seasoning has been removed, make sure that you completely dry the wok. Any water left over could cause it to rust. If the wok is oven-safe, you could even put it in the oven for 10 minutes at 400F. Don't worry if you aren't able to remove all the old seasoning. It is a tough job. If you get all the flaking areas, you'll be fine. Seasoning Your Wok The next step is to season your wok. For this, you'll need the following: - Paper towels - Vegetable oil or canola oil You can use other oils to season your wok, but the process is easier with oils with a high smoke point. Woks need to be hot for that oil to stick, and you don't want that oil smoking until the wok is hot enough. Here's what you need to do: - Heat the unseasoned wok on the stove at a very high heat. - Make sure that you heat up every part of the wok. This means the bottom and the sides. When it is hot (it may even start to smoke) remove it from the heat. - Pour a small amount of your oil onto a paper towel. Spread a very thin layer over every part of the inside of the wok. It is important that this is a thin layer. If you let the oil pool, it will start flaking again. - Heat the wok at medium-high heat until it starts to smoke. Once again, make sure every part of the pan is heated up. You'll need to move it about a little. - When the oil starts to smoke, remove the wok from the heat. Wipe any excess oil away from the wok using your paper towel. - Repeat steps 1-5 several times. 3-5 times will be ideal. You want to keep repeating the process until there is no black residue on the paper towel when you wipe. If you follow this process, then your wok should be properly seasoned. It shouldn't flake again. How Should You Maintain a Wok – And How Often? You should be cleaning your wok as soon as you have used it, especially if you have cooked something that smells strongly or is highly acidic (e.g., used vinegar-based sauces). If you clean and oil after use, your wok should stay in perfect condition. You'll probably never have to re-season it. Follow these steps: - Let the wok cool down. - Scrub gently with warm, soapy water (don't forget to use mild soap!) - If any food is stuck to the wok, gently scrape it off using a stainless-steel scrubber. - Dry the wok completely. - Rub a thin layer of vegetable oil over the inside of the wok. - Put it into storage. If you have cooked something that smells strongly e.g., fish, then you may need to add an 'extra step'. After you have spread the vegetable oil thinly over the wok, let the pan heat up until the oil smokes. After that, repeat steps 1 to 5 again. If you don't do that, it will be tough to remove the stench later. If you spot any rust, scrub it away. Re-season that area of the pan (as per the instructions we gave before). If you haven't used your wok for several weeks, clean it before you use it. This is because the vegetable oil you left on the pan may have turned rancid. You don't want those flavors in your dish! What Are Some Recommended Wok Brands? If you are buying a wok, make sure that you pick up a carbon steel one. They are easier to season, and they cook so much better. There are a few different wok brands out there. If you stick to a quality Japanese brand, then you probably won't go far wrong. We have our favorites, though. We suggest the following brands: - Yosukata - Mammafong - Joyce Chen (if on a budget) - Hand Hammered Woks (expensive, but worth the money) Final Thoughts If your wok is flaking, it is likely because you didn't season your wok properly. This often happens when you use too much oil during the seasoning process. The best way to deal with the flaking is to remove the old seasoning and re-season the pan. It takes a while, but it is worth it. A well-seasoned wok is so much more exciting to use.
Yoav Peled PhD, UCLA, 1982 LLB, Tel Aviv University, 2009 Areas of Research / Professional Expertise Citizenship, ethnic relations, Israeli politics, Israeli-Palestinian conflict KPFK/Jacobin radio interview By: Yoav Peled Subjects: Middle East Studies, Other, Philosophy and Religion, Religion Suzi Weissman: [00:00:08] This is Jacobin Radio. I'm Suzi Weissman. Today, we're going to look at the momentous upheaval in Israel. The fourth election in two years has finally been resolved, at least for the moment, with the end of Benjamin Netanyahu's 12 year reign, Israel's longest serving prime minister. A consummate and corrupt opportunist, Netanyahu unleashed a major shock and awe campaign against Gaza for 11 days last month, as well as in November 2019, to deflect attention from his own legal problems and his inability to form a governing coalition. Thomas Friedman has written that Netanyahu and Hamas have needed each other for each to remain in power and prevent a more moderate coalition from destroying their respective positions in power. Naftali Bennett, a far right leader of the tiny Yamina or rightward party, will now be prime minister for two years, yielding then to his secular, centrist coalition partner, Yair Lapid, for the next two years. Netanyahu, facing criminal corruption charges, warns he'll be back. We're going to talk to Yoav Peled to clarify what all of this means. He's the co-author, with Horit Herman Peled, most recently of The Religionization of Israeli Society,[] which couldn't be timelier to explain the dynamics of nationalism and religion in Israel, both among Muslims and Jews. We're going to get Yoav's analysis and look at the ways this conflict reflects political trends in the wider world. All this when our program returns in just a moment. This is Jacobin Radio, I'm Suzi Weissman and really pleased to have Yoav Peled back with us. He is professor emeritus of political science at Tel Aviv University in Israel, where he joins us, staying up late, and his latest book written with Horit Herman Peled is The Religionization of Israeli Society, and his other books include Being Israeli: The Dynamics of Multiple Citizenship and Israel and Palestine: Alternative Perspectives on Statehood. And this book, The Religionization of Israeli Society, Yoav tells me, had as its original title From Ben-Gurion to Bennett. But that was nixed by the publisher because no one knew who Bennett was. Well, I think that's going to change now. The book sheds light on how the country has moved from secular Zionism to an increasingly far right expansionist religious Zionism and how understanding that helps us understand this election, the Israeli-Palestinian conflict and the relation between everything else culture, politics, nationalism, secularization and new social movement. So welcome Yoav to Jacobin radio. And I want to just begin, because you write that "an anti-Zionist Islamist political party was willing to forsake the cause of Palestinian nationalism, at least for the moment, in return for various material concessions from a right wing Israeli government, while an ultra-nationalist religious Jewish political party was willing to sabotage the attempt to form the most extremely Jewish nationalist government in Israel's history by refusing to cooperate with an Arab party even in its most minimal way". And of course, I guess you could say that Netanyahu was saved by Hamas, as you do in your article by the rocket attack. So there's a lot to unpack. And Yoav, I'm really glad I have you here to help us understand it. Yoav Peled: [00:03:44] Thank you for having me. Suzi Weissman: [00:03:46] Well, let's just begin with how do you see this election and the new coalition with Naftali Bennett alternating with Yair Lapid? Yoav Peled: [00:03:56] Well, I don't think the alternation will ever come about, I don't think this government will last two years because, as you know, as I'm sure your listeners also know, this government has a majority of two in the Knesset, and these two include four members of this Islamist political party called the United Arab List, which was before perfectly willing to go with Netanyahu, except, like you said, the more extreme right wing religious nationalist party that calls itself religious Zionism vetoed that. And that's why this United Arab list went with the current coalition. And it's very fragile. For example, next week there will come the need to renew a temporary order which prevents Palestinians from the West Bank, as well as the citizens of other Arab countries, marrying Israeli citizens, namely Palestinians who are Israeli citizens. This law has been on the books as a temporary order since 2003, I think. And it's coming up for renewal every year because it's a temporary order. Now, this Islamist party will not vote for an extension of this temporary order. It's out of the question. So this government will not have a majority unless some people from the right wing opposition help them get this through one more time. So here you see the tension and potential explosion that are within this very strange coalition that ranges from very, very extreme right to sort of very liberal and including an Islamist political party. Suzi Weissman: [00:05:39] So there's a lot of right in there and you just said that it's very fragile, this coalition, and you have doubts already that it won't last. But before we get to that, are you saying as well that you don't think that it'll be able to enact any kind of legislation that would boost its popularity or maybe, you know, break through the kind of divide that has existed thus far or for the last 12 years? Yoav Peled: [00:06:06] It will be very hard. Maybe they will succeed in some things, but it will be very hard because there are very, very deep divisions within that coalition, and it's very unusual. And now we also have to remember that the prime minister for the first time in Israel's history has behind him a party of only six members. So he's very weak, is very weak within his own coalition. So I'm not saying they will not be able to enact anything, but I think everything that is somewhat controversial within this very multicolored coalition will be very difficult to pass. Suzi Weissman: [00:06:44] I guess that we should go into who Bennett is and then go back to looking at both the populism and the Israeli variant, let's say, of populism and then religious nationalism. But, you know, I alerted you earlier to an article that appeared in The New York Times that is basically saying, let's not judge him too quickly. Naftali Bennett may come from a small right wing party, but he's got this subtle and sophisticated mind, that he's a rigorous thinker. And I guess it sort of implied that he is more flexible than people have imagined. And I'm sure you have your own take on that. But let's talk a little bit about who he is and what he represents. You've already said that he comes from a tiny party, but he's managed to be the person now who will be the prime minister. Yoav Peled: [00:07:35] Yes. Well, let's talk about him personally for a minute. Personally he is very much like Bibi Netanyahu. That's interesting and strange. Like Netanyahu, he was born in Israel but grew up in the United States. His parents went to Berkeley, were active in the civil rights movement, then made teshuvah -- in other words they became religious Jews who went to Israel, then returned to the United States where he grew up, then returned to Israel again. So you already see this kind of a background. But he himself has always been very right wing. He was director general of what is called the Yesha Council, which is the organization that represents all of the local authorities, the Jewish local authorities, in the West Bank. And before that, in Gaza, too. When he was there, it was in Gaza too. So his record and his activities are all very much right wing. There is another faction that's even to the right of him. That's the one that calls itself now Religious Zionism. So compared to them, he's moderate. But this moderation is very, very, very limited, I would say. Suzi Weissman: [00:08:49] How do you characterize this religious Zionism? I know you've written, you know, more than a book on it. And also your article in Merip? Yoav Peled: [00:08:57] We have to distinguish between two things which can get confused here. There is the historical movement of religious Zionism, that was never called Religious Zionism, it had all kinds of different names. Politically for most of the years after the establishment of Israel they were called the National Religious Party. So there was no party called Religious Zionism, but religious Zionism was a stream within Zionism and for most of its history, it was more moderate politically than the mainstream Zionist political parties. This changed in 1967 with settlements and all of that. Now, the party that now calls itself Religious Zionism is more extreme, nationalistically and more extreme religiously. And I think it would be quite fair to say, to characterize it, or at least some elements in it, as proto-fascist. Suzi Weissman: [00:09:53] All right. Well, is there a populist aspect to the religious Zionist movement? Yoav Peled: [00:10:00] Well, certainly not historically, certainly not historically, and in that sense, Bennett continues the historical course of the mainstream religious Zionist movement, except, of course, that he is politically on the right wing, and they were not, until 1967. Historically the religious Zionist movement within Zionism was very much a bourgeois political movement, very, I would say, a kind of staid, maybe that is the right word for it. You know, respectable, respectable middle class families. Moderate in every respect. And so I remember, I can still remember we were next door neighbors of the leader of the religious, historical religious, Zionist political party, the National Religious Party. And I remember his eldest daughter, who now unfortunately died prematurely, but she used to come back from activities within the youth movement that they have in shorts, and she would hug and kiss her boyfriend in the entrance of our building, I mean hidden a little bit. But today, I mean, you cannot imagine the girls in that movement in anything but a skirt that sweeps the floor and so on and so on, not to mention even shaking hands with a boy or anything like that. And the party called Religious Zionism is on the extreme pole of all of those changes. Suzi Weissman: [00:11:44] So, I mean, I think we're going to have to go back historically a lot to understand this at least, so American listeners can get, you know, some grasp of what's happened in Israeli politics over the last period. What we mostly see is the eclipse already 12 years ago or more of Israeli Labor and the notion of a secular Israeli society promoting more economic concerns as well as the nagging Israeli-Palestinian issues. And I know you go into all of that, but I think before we go there, let's just talk a little bit about this election and then go back to the forces that are represented in it, because Netanyahu warns that he'll be back. You think that this is a fragile coalition. It seems that most of Israel was united to get rid of Netanyahu, that they could see through his sort of opportunistic antics that were there just to keep him in power. And he's been compared everywhere to Trump or Trump to Netanyahu. Could you talk a little bit more about that and how it came to be in this, what, four elections in two years and this outcome? Yoav Peled: [00:12:52] Yes, you're right. But it's not most of the Israeli public. It's just like Trump, it's half and half. That's why Netanyahu was on the verge of being able to form a government and the current government was also on the verge of being able to form a government. That said, they succeeded and he didn't. And the only reason he didn't was that the most extreme right wing party in his coalition vetoed the participation of the Arab party. That's the only reason why Netanyahu could not form a government. But in terms of the Jewish Israeli public, of course, it's about 50/50. So I think that there are two possible scenarios with this government: one, that it will disintegrate while Netanyahu is still leader of Likud and he will come back. But I think more likely is that the Likud eventually -- and I think rather soon -- will get rid of Netanyahu, because by now he's a liability for them. He's the only reason they couldn't form a government, because in this new coalition there are three right wing parties, which naturally would vote with Likud; only because of Netanyahu they don't vote with Likud. And by the way, the reason is that the leaders of these three parties were close associates of Netanyahu in different stages of his career, including Bennett. Bennett was his chief of staff when Netanyahu was head of the opposition. And they all know him very well and they hate him. I think there's no other word. So they were willing to do anything to get rid of him.. So I think if Likud gets rid of Netanyahu, which they have to do because he's only a burden on them, and I assume it will take maybe six months, then these three right-wing political parties will join Likud, it is their natural ally, and will form a new government, which would have the support of maybe 70 members of the Knesset, out of 120. There would be a normal right wing government which the division of public opinion in Israel warrants. Suzi Weissman: [00:14:59] What about Netanyahu's legal problems? The last time we spoke, you know, we were talking about, I think the third election, perhaps the fourth, was very clear that he needed to stay in power, to stay out of jail. How is that proceeded and will that have some impact on whether or not he'll be toppled from the leadership of the Likud? Yoav Peled: [00:15:20] Yes, definitely. The trial is going on. They are still examining the first witness for the prosecution. And this will go on for at least, I don't know, a month or two. And of course, the more the trial advances, the deeper will Netanyahu be a problem. And I think this will hasten the time when Likud will get rid of him, because not being the prime minister is harder for him to fight this trial. And that's like you said, this was the reason it was so important for him to stay as prime minister. Now, that he is only head of the opposition, it will be harder for him to do all these tricks and schticks that he likes to do, in order to at least slow down the pace of the trial. And the more the trial goes on, he is deeper in trouble and the better chances that we get rid of him. Suzi Weissman: [00:16:15] Did he have immunity or does he have immunity while he's in power but loses it as soon as he's out of power? Is that what you're saying? Yoav Peled: [00:16:21] No, he has immunity, but his immunity is as member of the Knesset, that's all. But his immunity as member of Knesset applies only to actions that he performs in his capacity as a member of Knesset. Then he has general immunity, which he can be stripped of -- the procedure is that he has to ask for it, it is not automatic. And he did not ask for it, because asking for it, I think, would be an admission that there is something there, so he did not ask for immunity. And the truth is that when he was prime minister he tried to pass a law, they call it in Israel the French Law, that would give him immunity as prime minister as long as he serves, like an American president or a French president. But he never had enough votes to get this law through the Knesset. Suzi Weissman: [00:17:13] And, you started out Yoav by saying how Israeli society is divided pretty much evenly. And this has been the case for a very long time, even though it seems that the issues that they have been divided around have shifted somewhat. And I want you to explain that in terms of the increasing religionization of the society. But would you say then that the half of the society that has supported Netanyahu so long will look past any of his improprieties, his corruption charges? Do they dismiss them in the way that, let's say, Americans who love Trump don't care about his activities, they just like him? Yoav Peled: [00:17:54] Exactly. Exactly. Exactly the same thing. I mean, it's a typical populist leader. His followers are completely committed to him. They either don't believe or else don't care that he's done what he's accused of and they support him totally. So I don't think that this downfall will come from them. Hisdownfall will come from his colleagues in the Likud, leaders who know that they can all be in the government, they can be ministers, and one of them can be prime minister, as soon as they get rid of him. And so the coup d'état within the Likud will come from the leadership, it will not come from the rank and file. The rank and file, I think, will stay committed to Netanyahu for a long time. Suzi Weissman: [00:18:40] Let's go in a little bit deeper then into the nature of that support and the role that religion plays, this is really the subject of what you've been writing about, the sort of advent of religious Zionism, and the kind of unlikely part of it is that it's nationalism. Of course, Zionism is a form of nationalism. And you have one side and the other, each expressing, I don't mean in Israel, but I'm talking about Israeli-Palestinian conflict here, that the opponents both represent a form of this religious nationalism. But let's go to the Israeli part. How did this come about and how do you characterize it? You've started to say Yoav, you've talked about the sort of two aspects of it. Let's go a little deeper into it. Yoav Peled: [00:19:22] Well, like we wrote in our book, there is a long term process of religionization which begins in 1967 with the occupation of the West Bank and Gaza, and all the rest that was occupied. But the main thing, of course, is the West Bank. And as it becomes evident that there is no peaceful solution to the conflict with the Palestinians, or to the problem of the occupation of the West Bank, people turn more and more to religion to justify this reality, because how can you justify it otherwise? And it's also to overcome the insecurity that develops, because people realize that we're going to live in a situation where war is imminent all the time. And we just had one, although it lasted only 11 days. That's true. But it was pretty, pretty traumatic for a lot of people that were subjected to missile attacks from Gaza. And so religion gives them some kind of, like always, religion gives them some kind of solace, some kind of refuge from this deep insecurity. This is what strengthens religious Zionism and it is on its way to becoming culturally hegemonic, which doesn't necessarily express itself in votes in elections, because their vote in elections has been more or less stable, around 10 percent plus or minus of the Knesset. And this is where it is right now, too, but in terms of the way people see the world, the way people see the issues is more and more consonant with the religious Zionist outlook. And Bibi's supporters, first of all, part of his staunchest supporters are the ultra-orthodox. The ultra-orthodox political parties are completely, totally committed to him. And then there are the people who are called traditionalists, who are somewhat religious but not fully observant. Typically, these are what is called now Mizrahim, in other words, people whose families came from the Muslim countries and they form the bulk of Bibi's popular support. Suzi Weissman: [00:21:36] So what's interesting about this is that, you mentioned in your article that was in Merip, that this process, yes, was very long and that one of the ways that it became more acceptable, this form of religion in a society that was more secular previously, was that, Yoav Peled: somewhat secular, I'd say, not really secular. Suzi Weissman: [00:21:58] Well, right. And of course, it is a religious state. But on the other hand, it was not a society known for its deep religious practice for the majority. But you say in your article that under several Zionist religious education ministers that came into place and changed the nature of public education to insert more religious quality into it, and that Naftali Bennett was one of them. How did that go over? Was that a sort of simple process? And, you know, when you and I spoke over one of the last three elections, at that point, Netanyahu's ability to govern depended on him uniting with Avigdor Liberman's far right nationalist party. But he was an avowed secularist, as so many of the Russian immigrants were, and that was a breaking point for them. Can you sort of explain how the hegemony of the religious side has come to be in the forefront? Yoav Peled: [00:22:54] WelI I think that the deepest reason is this fact, this phenomenon, that there are hardly any really secular Jews in Israel, because what is the justification for Zionism, if not Jewish religion? So people tend to feel that the more religious you are, the more legitimate you are. So when Bennet, he's is the main one, he is not the only one, he is the main one who introduces very, I would say, fast and deep religionization in the educational system. People don't really object to it. There may be murmurs of some kind of dissatisfaction, but people were not really organized to fight it, because there's always this feeling that there's this inferiority complex of the supposedly secular in front of the religious. So, you know, so what's wrong with a little bit of Yiddishkeit in the school system? So what's wrong if the kids know this prayer or that prayer and this page of the Talmud or that page of the Talmud? after all, we are Jews and this is a Jewish state. So there is some resistance, but it never crystallized to anything effective, and this process is going on and on and on. Suzi Weissman: [00:24:12] Right. OK, so let's talk a little bit more then about how this form, you know, replaced the Labor Zionism that had existed for so long in Israel and which also created a sort of polarized society between labor and more liberal outlook and Likud in the more religious nationalist ones, both of which, though, had more or less a similar position with regard to the Palestinian conflict. Yoav Peled: [00:24:39] Well, Labor since 1967 had two major problems, which really brought it down. First of all, in 1967, they could not decide of a course of action with respect to the newly occupied territories. It was a deep split within the Labor Party. So the result was paralysis and inaction. They didn't decide what to do. So religious Zionists took the initiative and started settling in the West Bank with all kinds of winks from Labor dignitaries, including Shimon Peres, who later on became this Nobel laureate for peace. But a wink from Shimon Peres, a wink from Rabin, a wink from Yigal Alon, and they started establishing settlements. When labor lost power in 1977 there were only five thousand settlers in the West Bank, but still the process began. The second problem Labor had was the shift to neoliberal economics from corporatist economics to neoliberal economics in 1985, which completely shattered the social economic basis on which Labor's power rested, which was based on the Histradut, which is usually translated in English as a labor union federation, but it was not a labor union federation. It was what is called an umbrella labor organization, that at its height owned 25 percent of the economy, employing 25 percent of the industrial workforce, and provided secure jobs with relatively decent salaries and a whole host of social services, most importantly, health care -- at its height it provided health care to 70 percent of the population. Now in 1985, Labor itself started the process of dismantling this whole structure. So with their own hands they destroyed their social economic, plus what happened with the West Bank and Gaza, and at the beginning, Sinai too, after 1967, this was the reason that Labor lost its power and lost its cultural hegemony. Suzi Weissman: [00:26:57] Can you talk a little bit more, because now you've introduced it in all of your analysis previously, Yoav Peled, you have talked about the economic basis of the so-called peace process, which was always a fraud, in your view. But can you go back now a little bit? Because what we're seeing right now at this present moment, and it's not just in Israel but in the world, is a rejection of the neoliberal economic model, which is seen to promote widespread inequality. That's also happened in Israel, maybe not as accentuated as other places because there is still somewhat of a social safety net, at least for Jews. But how is that reflected in the current political lineup in Israel and especially after this almost a year and a half of the pandemic? Yoav Peled: [00:27:42] Well, first of all, Israeli politics in the last two or three years were only around one issue -- Netanyahu. You were either for Netanyahu or against Netanyahu, and everything else receded into the background. Now, Netanyahu's performance during the pandemic was, I would say, mediocre at the beginning as far as identifying and treating the illness, the Corona, but then, excellent as far as getting the vaccines. So, you know, Israel is first in the world in terms of vaccination. We are now completely moving around, completely free. And so on, so his record on that is very mixed and so it depends which side you're on. If you're for Netanyahu, you extoll the vaccinations. If you're against Netanyahu, you say, OK, the vaccinations but what happened before the vaccinations, why was the health care system not more effective? Why? For example, when we started the lockdown, they allowed 12,000, Yeshiva students from New York to come into Israel when New York was absolutely infested with Corona. And so on and so on and so on. So on the issue of that, of the pandemic, also, there's the same split. You see Netanyahu's positive side or negative side, depending on where you stand on him personally. So all other issues, the stimulus, the economy, state and religion, and so on and so on are all irrelevant now or were irrelevant, at least, until this new government came in. And now we'll see what happens. Suzi Weissman: [00:29:22] When that's obviously the place where most of the journalists that we're seeing are talking about the hopes that they have for this new government, that because the new coalition, which you say is fragile, but nonetheless represents both far right and center, I don't know if you would call it center left, but at least centrist, more moderate, let's say, forces, that it will allow issues that have been plaguing Israeli society but have been ignored, like unemployment, like other issues that you could bring up, come to the fore. But then there's also the other main issue that we'll get to after that. But do you first accept that this is a possibility now and that this could strengthen perhaps this coalition, that they'll address these more pressing economic and social issues? Yoav Peled: [00:30:07] The Israeli economy was in a very good state before the Corona, unemployment was around four percent, which, as you know, is considered full employment. And now it's recovering very fast. In general, as surprising as this may be, neoliberalism really benefited the Israeli economy after the first 10 years, which were harsh on the poorer sectors of society. Since about 1995, things have changed and the overall performance of the economy, as well as the situation of many, many people improved. And that's also part of the reason for this very strong support for Netanyahu, because a lot of people are much better off economically during these 12 years than they were before. So that's another reason. Now, as you know, for a government it's not so easy to deal with economic issues. I mean, there are very powerful interests involved, and the new finance minister, this same Avigdor Liberman that you mentioned, whose reputation, as you know, we all know about, I don't want to say any more than that, he's now in charge of the public purse. He's a staunch neoliberal in his political economic views. He also controls, and this is the first time this has happened, at least since the old days of Mapai, this is the first time this has happened, that his party also controls the Knesset Finance Committee, which is supposed to supervise the finance minister. So what he will do is very hard to tell. And I doubt very much that he's going to do anything that would move towards a more, let's say, less unequal society. Suzi Weissman: [00:32:03] And what about, let's go to the Israeli-Palestinian, not just the conflict, but also the role of the Israeli Arab parties or the United Arab List, the UAL. What does the United Arab list that is now part of the governing coalition do? This is a first, but you have people in the coalition who say that Arab Israelis should not be Israeli and that, you know, they may be citizens for now, but not forever. Yoav Peled: [00:32:28] No, that isn't somebody in the coalition, that's the most extreme right wing religious Zionists, who are not in the coalition. Nobody in the coalition is saying anything like that. Suzi Weissman: [00:32:37] All right, that's good. So what does it mean, though, to have them [the UAL] in the coalition? Will it change some part of it? And the reason I'm asking, not just in general, but also there was an article, I think, in The New York Times that talked about the Arab Israeli medical personnel that were considered front line workers and heroes during the pandemic, but complained that once they left the hospital, they were humiliated and treated as second class, just as all Arabs are in the society. And the question then would be whether or not there would be some form of recognition of their role in society? Yoav Peled: [00:33:14] What we know is what happened the previous time that an Arab political party was part of the coalition, even though at that time it was not really officially part of the government, but supported it from the outside. This was during Itzhak Rabin's government, and that was the best period for Israel's Arab citizens in Israel's entire history. So there is this reason for hope that the fact that this government depends, absolutely depends for its very existence, on these four votes of Arab members of the Knesset, that the policy towards them would improve. Now, of course, in the daily lives of Israel's Palestinian citizens it doesn't matter that much who is in the government, and what the government is doing, if they are viewed as in the way you describe them. It's absolutely true. And their presence in the medical, all the medical professions, but also at the top, they are hospital directors and the heads of hospital departments and so on and so on. But it's true when they leave the hospital and go home, they are just Arabs. So it's hard to see how this attitude of the everyday person towards them would change, no matter what the government does. Now, we also have to remember that we just went through a period of mutual pogroms and lynches between Arabs and Jews and Arabs played a major role in this. That also had a very serious impact. And a lot of people view the Arab citizens much more negatively than before these events. That's also a factor. Suzi Weissman: [00:35:01] Maybe you could elaborate a little bit more Yoav on that, because what we see from here is simply the Hamas rockets that were propelled and were certainly of inferior might and weight compared to what Israel had against the Gazan citizens. But talk a little bit more about how this played out in Israel. When you looked at news reports, you saw Israelis talking about Arabs in a way that was so openly racist that it was even shocking to see. So what kind of lynchings took place, what kind of pogroms? Yoav Peled: [00:35:35] There were, you know, at least one of them was a case of an Arab or Muslim, who didn't die, but was very, very heavily injured by Jews, near Tel Aviv. And there was at least one case of a Jew being lynched to death by Arabs in Lydda. In Jaffa, which is more or less, you can say, the Arab neighborhood of Tel Aviv, or a neighborhood that is at least partially Arab, there was a famous incident where a Molotov cocktail was thrown into the apartment of an Arab family by mistake by Arabs, because they mistook them for Jews. And there were also several synagogues that were burned down and cars that were burned down in the mutual attacks here and there. Numerically, it happened more on the Arab side towards the Jews than vice versa, but it was on both sides. Tensions are strong now and a lot of Jews avoid Arab areas, which, of course, harms Arab businesses, which depend on their Jewish clientele. Suzi Weissman: [00:36:43] Does this change the dynamic in any way in terms of the willingness to, let's say, have any negotiation, you know, with the Palestinians? You mentioned that it hardens each population against each other. But previously we've talked about and it's certainly in the articles that Netanyahu needed Hamas and Hamas has also needed Netanyahu, that it galvanizes each of them in their own society. How do you see that now that this new coalition will be in power? Is it the same dynamic? Yoav Peled: [00:37:15] Yes, it is the same dynamic, there's no such thing as negotiations with the Palestinians. There's nothing to negotiate about this, about the whole issue of the two states and the peace process. All of that is long dead. So there's really nothing to negotiate. I mean, they can negotiate, you know, very mundane kind of day to day things. But overall, the conflict, there is no process or any attempt to try to do anything about the basic conflict, neither with the Palestinian Authority in the West Bank, and of course, not with Hamas in Gaza. So that issue is really dead. I know that now the Biden administration says we want you to start. This is nonsense. Since the second intifada of 2000 this possibility died, there is no question… Suzi Weissman: [00:38:06] you are talking about the two state solution that has died… Yoav Peled: [00:38:08] Two State solution or any solution. Because what we have is, we have the reality of one state which is being ruled, governed, very unequally between different segments of that one state. That's the reality. And of course, there is no movement to change it except to make it a little bit more formal. This whole issue of annexing parts of the West Bank, what is known as Area C, which Bennet is totally in favor of, at least until now he was totally in favor of annexing it to Israel. We will see if that happens, and so on and so on. But basically, no major changes in the setup of Israeli-Palestinian relations is likely to happen any time in the foreseeable future. Suzi Weissman: [00:38:54] And do you see as separate the issue of Fatah's difficulties in maintaining its governing role that you see Abbas postponing elections, that you get youth demonstrations there saying we're sick of the same leadership, we want more democracy? Does that have any repercussions in Israel, does it affect anything? How do you see that? Yoav Peled: [00:39:16] Israel didn't want them to have these elections because Hamas was sure to win these elections as it did the previous one in 2006. Hamas won that election, but in the West Bank they wouldn't let them take power. In Gaza, since Israel withdrew, Hamas took power because Israel was not there to prevent it. But Hamas won the last election. They would have won this election too. And that's why both Israel and the Palestinian Authority and the U.S. were interested in not having those elections. And so this is what happened. But the Palestinian Authority is an empty shell now. There's really nothing there. It's just a totally empty thing now. Suzi Weissman: [00:40:01] So do you see anything Yoav Peled, other than a hardening along both nationalist and religious lines on both sides of this conflict? Yoav Peled: [00:40:09] Well, unfortunately not. I think this is the dynamic right now. Like you say, on both sides. On the Palestinian side, Hamas is getting stronger and more influential, which means also that people become more religious, because Hamas, of course, is an Islamist party. Hamas and the United Arab List are both sort of affiliates of the Muslim Brotherhood in Egypt. So even though right now, politically, they are, let's say, on opposite sides of the political divide, basically they are part of the same larger movement of the Muslim Brotherhood. And so religion is being strengthened among Muslims in Israel and among the Palestinians in the same way as it is among the Jews. Suzi Weissman: [00:40:58] And how do you see that developing, because this is a really bleak picture, you know, Yoav, and it's one that we saw the triumph, I guess you could say that Trump allowed, that certainly published and publicized was his success in getting other Arab states to recognize Israel. And just the dynamic seems to be hardening. And I'd like to get more of your view about how Trump affected the situation and now perhaps with Biden, and then this new government, whether there'll be any change whatsoever in relations with the wider Arab world? Yoav Peled: [00:41:36] Trump did a few things, of course, moving the American embassy supposedly to Jerusalem, I don't know. The American embassy is very close to us in Tel Aviv and I don't see any less security or less activity there, it is purely symbolic. But it was an important symbol. Trump also enabled Israel to make peace with countries it was never at war with. So it's paraded as a great achievement. Of course, it doesn't mean very much in terms of the real issues. So I don't think the Biden administration is either interested or capable of changing anything with regard to that, that they will do maybe like Obama, they will pay some lip service to the peace process and sponsor some kind of empty negotiation meetings or discussions. But I mean, of course, if the United States decided to go all out and force a settlement, it would be easy to do that. But you know very well this is not going to happen. So it would be, you know, blah, blah, like before and nothing substantial would happen. Suzi Weissman: [00:42:49] All right. Well, let's talk a little bit more then about that, Yoav, because we have a few minutes left. And I want to get a sort of wider perspective of the divide within Israel, because you still have now the centrist coalition. You said that for the last several years, the only issue has been Netanyahu. But is that the case, that it was Netanyahu as leader of Likud and it was a rejection of Likud's policies or just the person of Netanyahu? What I'm looking for is some understanding of how politics, the wider politics of the situation in Israel, of the economic situation, of inequality, of labor, of all of these other issues, immigration. How does that fit in now? Does that sort of play into people's getting tired of Netanyahu but doesn't get reflected in, say, support for the other parties on the more centrist side? Yoav Peled: [00:43:41] Yes, the issue was Netanyahu personally, his corruption, his corrupting of many of the state systems, especially the ones that deal with law enforcement, especially the ones that deal with his trial. And the clearest indication of that is that you see that in the current government, in the anti-Netanyahu coalition, you have three real very right-wing political parties. So they don't have any problem with Netanyahu in terms of policy or in terms of ideology or in terms of politics in general. They have a problem with the person who they see, I think correctly, is really a very dangerous, corrupting agent within the Israeli political system. And they would, like I said before, these were three leaders or people who worked very closely with him. They know him very well and they realize that it is really dangerous to let him continue. It's not any political disagreement. Just a question of this person is dangerous for Israeli democracy, for Israel as a whole. He needs to be removed. This is the only thing that ties this government together, no major differences with Likud or anything like that. Some of them are to the right of Likud. Bennett is supposedly ideologically to the right of Likud. The party headed by Gideon Sa'ar, a former student of mine by the way, is also to the right of Likud. Avigdor Lieberman, well Lieberman is Lieberman, so it's hard to tell, but he's also very right wing. So they have no problem with Netanyahu's economic policies, policies towards the Palestinians, or anything substantial. It's just the persona, the persona that they know very well and that they realize that he needs to be removed in order to maintain some kind of democratic, I would say, democratic setup in the state of Israel. Suzi Weissman: [00:45:45] I'm glad you said that, because that's clearly the issue and Thomas Friedman was writing in The New York Times, you know that. Well, first of all, he compared Netanyahu and Trump and the populism of each, but that has now come to an end. And he saw, I guess, the recent explosion or the recent bombing of Gaza to be similar in a way to, or the events around it to be similar to the January 6 insurrection or riot in in the United States. But he thought that mostly it was a ploy to prevent any further integration of Arabs into Israeli society. And I know you agree in some respects with Friedman's overall view, but I guess the real question is how Israel fits into this wider, far right populist dynamic that we're seeing around the world. That is, by the way, I think receding. But I'd like to get your opinion. Does Israel fit into this context in any way? Yoav Peled: [00:46:42] Well, I'm glad that you see it receding, I'm not so sure, but let's hope. I think you see the same pattern, you see the same pattern in Israel like you saw in the United States, like you see in those Eastern European countries, like you see in India and so on, and so on. It's nationalist populism. And it is based on the very kind of, on the dichotomy between us and them. They are the enemy. They are, if they are among us, the traitors. And, you know, everyone, all of the Likud members of Knesset didn't let Bennet even speak in his first speech as prime minister by yelling: "you traitor," "you liar," so he couldn't finish the speech. So with the populist supporters, it is also the same thing. It's either you are with us, meaning the leader, the leader who embodies the people. Whoever is with the leader is the people. Everybody else is the elite and a bunch of traitors. And you see this dynamic in all of those places and it goes the same way. So I think Israel is very much within that stream, and also in the UK, with Brexit, you see the same dynamic in a lot of places. And Israel is part of it in the same way. I mean, the issues are different because, for example, in Israel there is no issue of immigration. Nowadays, you know, we have those miserable 30,000 African asylum seekers that the populists make out to be a huge issue. But of course, it's not an issue. They are only a fraction of the population. And the economy is also not a big issue because the situation has improved for the same kind of people who might support the Trump in the United States. In Israel, for the equivalent people in a similar situation, economically it has improved. So it's not that. It's that Jewish Arab division and support for this leader. I mean, support is a weak word to describe it, total commitment to this leader. And so it's very much part of the of the general right-wing populist phenomenon that we've seen in a lot of places. Suzi Weissman: [00:49:05] With the difference that in Israel it's more religious based. And I think that's really important. But when I said it was receding, you know, so long as these populist governments that are anti-democratic, increasingly authoritarian, they certainly got a lot of popularity among certain sectors of the population. But if they can't deliver economically, it can't go on forever. And that's really, in a way, how I see the divide in the United States. And I'm asking because obviously the labor movement is insignificant right now in Israel, as it is in the United States. It's been pummeled, even though there's lots of struggles. But the social safety net must be an important aspect in Israel to maintain the support. You say the economy has performed better and neoliberalism worked in a way there, at least for the population that supports Netanyahu. How has that worked out there? Because one sees here that health care was a dividing issue, that inequality was a dividing issue. And because the Democrats representing, you know, this sort of, what liberal neoliberalism, however you want to talk about it, did nothing to ameliorate the economic situation that created a base for a populist Trump to come in, very much like Brexit, because these are the left behinds. Is there any sort of similarity in Israel? In other words, can you talk a little bit about that, and within that, the role of the strong public sector? Yoav Peled: [00:50:37] Well you see that the left behinds in Israel are not left behind that much, that's the issue. So because they really, they benefited in the last 10, 15, 20 years from economic liberalization. I think it's peculiar to this country, not what you see in other countries, but this is the situation here. And that's part of the reason they support Netanyahu so much. Now, I think Israel's luck is that the neoliberals have not succeeded in destroying the entire safety net so far, so even though the Histadrut, that umbrella labor organization, was pretty much destroyed, and so it's now really a bunch of labor unions, some of their institutions continue in one form or another. Most importantly, the health care institutions, which are not tied to it anymore. But they are still non-profit, even though the neoliberals in the government wanted to make those HMO's in American language, they wanted to make them for-profit organizations, but they have not succeeded in doing that yet. And because they are not for profit and because they are very effective in terms of providing health care and gathering data about public health, this is a major incentive for Pfizer to give, to sell, of course, at a very high price, but sell so many vaccinations because the data that they could get from Israel about the effects of vaccination was better than they could in any other country. So you see, this is a remnant of the Labor legacy, which so far, the neoliberals have been unable to distort. But in terms of other social services, in terms of the public sector in general, Israel is following the United States pretty closely. Even in health care Israel is only second to the United States in the OECD in terms of the share of health care expenditures that comes out of the pocket of the people, of the clients, you may say, of these HMO's. So, OK, well, I don't want to get into more details because it would be boring. Suzi Weissman: [00:53:02] It's never boring. But what I'm really interested in is the way that I see what you're describing, Yoav, is that even though neoliberalism as a model has improved the economy and has successfully divided, let's say, the population, even though it may not be the economics, is not the real issue. But if they dared to, let's say, completely eviscerate the national health system in Israel, that clearly would have been a dividing line, wouldn't it? Or wouldn't it have some effect in breaking away support for Netanyahu and Likud, and perhaps reviving… Yoav Peled: [00:53:38] No, you see because the way they do it in this country, at least, is very smart. They do it in a way that people support it. You see, when they nationalized the health care system, those HMOs, they used the fact that people were bitching all the time about waiting in long lines and clinics being physically dilapidated somewhat, and so on. And so people had a lot of resentment against these HMOs, especially the one owned by Histadrut. So it was easy. It was easy to get through that whatever opposition there was. Now I'll give you an amazing anecdote. They have been trying to privatize the National Electric Company and now we have on television ads paid for by the electric company, advertising the fact that it is being privatized. That it is privatizing some of its power stations. I mean, it was hard to believe when I see it, they are publicizing their own destruction as an achievement! People, you know, there's a strong anti-union feeling like in the United States, like in many other places, because in Israel historically the workers in the National Electric Company get free electricity. That gets people mad. How come they get free electricity? Really, the fiscal effects of that is nothing but, you know, it makes people mad. So if it is privatized, the union would not be so strong, they would not get free electricity. But, as you know, it will happen like everywhere when electricity is privatized and I don't have to tell you. They think they are smart, that they can get it through in such a way that it will not encounter any real serious opposition. Suzi Weissman: [00:55:37] Amazing story Yoav. I have one final question, and that is, given that Netanyahu is now out, at least temporarily, do you see this as a kind of status quo ante to Netanyahu? Do you see any change in the politics or will it just be away from the personality, but the same sort of policies? Yoav Peled: [00:55:56] I think that the policies will stay more or less the same, if for no other reason, because this new coalition is so internally divided. So it is hard to see how they can -- and by the way, in the agreement that set up the government they said, we're not going to implement any policy that is not agreed upon by everybody, which means there's very little left that they could do, because you will find it very hard to agree on anything except for very few issues. Suzi Weissman: [00:56:24] Yoav Peled, thank you so much for all of that. And I'm going to encourage people to look for your article in Merip and also to get your book, The Religionization of Israeli Society, which really goes into explaining in depth how we've come to the situation that we have, that you have this increasing religious nationalist divide. Yoav Peled is a professor emeritus of political science at Tel Aviv University, author of many books. And thank you so much. You're my go to person for understanding both Israel and the wider conflict. Yoav Peled: [00:56:56] Thank you very much. [] Yoav Peled, Horit Herman Peled, The Religionization of Israeli Society, Routledge 2019. From Maniv and Benziman's article in Israel Studies. By: Yoav Peled Subjects: Education, Middle East Studies, Other, Philosophy and Religion, Religion "Yoav Peled and Horit Herman Peled['s book is] the most comprehensive research on religionization in Israeli society to date" (Omri Maniv and Yuval Benziman, "National-Religionization (and not Religious-Religionization) in Policies of Israel's Ministry of Education," Israel Studies 25.2: 2020, p. 116. Review by Hayim Katsman By: Yoav Peled Subjects: Area Studies, Art & Visual Culture, Middle East Studies, Other, Philosophy and Religion, Political Science, Politics & International Relations, Religion, Sociology, Sociology, Criminology and Criminal Justice Yoav Peled, Horit Herman Peled. The Religionization of Israeli Society. Oxon: Routledge, 2018. 250 pp. $150.00 (cloth), ISBN Reviewed by Hayim Katsman (University of Washington) Published on H-Judaic (October, 2019) Secular Israeli journalists, publicists, and academics have recently expressed their concerns with the increasing influence of religion on Israeli society and politics. In The Religionization of Israeli Society, Yoav Peled and Horit Herman Peled aim to explain the sociopolitical origins of this process and describe how religion influences various spheres of Israeli society. The authors identify religionization as replacing secular civil religion in Israel with traditional religion, a process which has been taking place since the decline of the Labor Zionist Party, starting with its fall from power in 1977. The religionization of Israel entails the increasing representation of Religious Zionists in state institutions, as well as cultural fields, such as fine arts and cinema. This process is analyzed by the authors through the Gramscian concept of cultural hegemony. They describe how the Labor Zionist hegemony has gradually been replaced by a new historic bloc consolidated around the Religious Zionist (or National Religious) movement. The authors argue that the Religious Zionist nationalist worldview is now supported by broader parts of the Israeli society, which can eventually lead to the theocratization of the Israel state. The main contribution of the book lies in the first three chapters, which discuss secular-religious relations within the Zionist movement and the state of Israel. In the first chapter, the authors give an overview of some of the scholarly work on the tensions among religion, modernity, and nationalism, and how these tensions were dealt with in the Zionist context. The authors show how the Zionist movement's reliance on Jewish religious symbols later served as an ideological foundation for the Religious Zionist hegemony, enabling other secular groups to support the Religious Zionist worldview. The second chapter explains the economic factors that led to the rise and fall of the hegemony of Labor Zionism. The third chapter briefly describes the ideology and history of the Religious Zionist movement and how its political alliance with the existing Labor Zionist hegemony shifted to a direct challenge of that hegemony during the 1960s and 1970s. The fourth chapter is intended to present groups that are not part of the Religious Zionist movement, but still can be considered as falling under its "sphere of influence" the movement of "return" to religion (teshuvah) and the movement for "Jewish renewal." The rest of the book is dedicated to various domains of Israeli society, in which the authors identify growing religious influence, mainly due to the increasing presence of Religious Zionists. The book focuses specifically on the influence of religion in the education system, Israeli military, and visual fine arts. One more short chapter discusses the rise of feminism, although it does not account for many of the recent developments in the movement. The last chapter analyzes television and film productions created by Religious Zionists and haredim, or the ultra-Orthodox. How do the authors define "religionization"? It is not understood in terms of increasing adherence to religious law; indeed, religious observance has not grown in Israeli society. Religionization for them, rather, is the increasing influence of the Religious Zionist ethnopolitical worldview on the Israeli public. This influence, in turn, appears to be measured primarily by the growing numbers of people associated with religious groups present in various domains of Israeli society: their mere presence is defined as "religionization." It is of course important not to overlook these processes, since religion consists of a social dimension and cannot be reduced to piety and adherence to religious obligations. However, this emphasis on social representation and cultural influence raises some analytical problems. Since the authors argue that the mere fact that Religious Zionist individuals fill certain influential roles in society constitutes religionization, how do we understand, for example, the increasing enlistment of Religious Zionist women in the Israeli army? It certainly increases the representation of Religious Zionists in the army. At the same time, as the authors note, these women are explicitly disobeying rulings by prominent Religious Zionists rabbis prohibiting women's army service. As a result, a phenomenon that clearly indicates a decline in religious authority is paradoxically considered to constitute an example of religionization. While the authors note some political diversity in the Religious Zionist movement, they also consider it as "very strongly correlated with right-wing nationalist political positions" (p. 216). They emphasize that since the 1960s and 1970s a group formed around Rabbi Zvi Yehudah HaCohen Kook became the dominant ideological force within the Religious Zionist movement. This group's explicit political agenda challenged the Labor Zionist hegemony and argued that political considerations must be subject to religious considerations. The main consequence of this idea was the formation of Gush Emunim (Bloc of the Faithful), a social movement that began settling Jews in the territories occupied by Israel in the 1967 war. The authors successfully show how this ideology and system of symbols became increasingly dominant in Israeli society, replacing Israeli civil religion. However, research has also shown that the influence of this group within Religious Zionist circles has been declining, opening space for alternative Religious Zionist interpretations.[1] Therefore, merely pointing to the participation of Religious Zionist individuals in the Israeli public sphere misses the internal diversity of the movement and the growth of alternative ideological The authors describe the religionization of Israeli society through an analysis of Religious Zionist values, focusing on their influence on the broader Israeli society and its dominant social symbols. This influence, they argue, comes about through the increasing participation of Religious Zionists individuals in various public domains. However, the authors' normative standpoint against what they consider to be Religious Zionist values, together with the choice to avoid a positive description of "religionization" is problematic. The book does not provide us with analytical tools to interpret more cases, such as the non-Orthodox movements for Jewish renewal, in which the increasing influence of religion does not necessarily promote an ethnonationalist worldview. Therefore, the use of the concept is sometime almost tautological (actions of religious people equal To sum up, this book is an important contribution to the field of Israel studies, offering a comprehensive and detailed description of the changing role of religion within the Israeli society. However, scholars of religion in Israel, and specifically scholars of Religious Zionism might be disappointed by the lack of a more nuanced and updated description of the contemporary Religious Zionist community as well as other forms of Judaism in Israel. [1]. Chanan Moses, "From Religious Zionism to Postmodern Religion" (Hebrew) (PhD diss., Bar-Ilan University, Hayim Katsman is doctoral candidate at the University of Washington. His dissertation project is entitled "Religious Nationalism in Israel/Palestine: The Case of Religious Zionism and Hamas." If there is additional discussion of this review, you may access it through the network, at: Citation: Hayim Katsman. Review of Peled, Yoav; Peled, Horit Herman, The Religionization of Israeli Society. HJudaic, H-Net Reviews. October, 2019. URL: http://www.h-net.org/reviews/showrev.php?id=54272 Review by Paul Scham in Israel Studies Review By: Yoav Peled Subjects: Area Studies, Middle East Studies, Other, Philosophy and Religion, Religion Yoav Peled and Horit Herman Peled, The Religionization of Israeli Society (New York: Routledge, 2018), 250 pp. Hardback, $150.00. 'Religionization' (hadata) is one of those words like phylacteries and Pentecost (Shavuot) that are best left in their original Hebrew. It is the central concept of this book (unfortunately used in its gawky form) by noted Israeli political scientist Yoav Peled and Horit Peled, a fine arts and media culture researcher, which demonstrates the actual dangers to Israeli life by the process of hadata, as well as the myopia that afflicts much of the secular left when talking about in Israel. In an attempt to avoid confusion I will use hadata when to the actual process, and Religionization when referring to the book itself. The thesis of the book is neatly encapsulated in the introduction: "Religious Zionism is fast becoming the hegemonic sector in Israeli (17). Note that it does not mention traditional religious Judaism, whether of the 'modern' or Haredi forms, which, we learn later, are incorporated into Religious Zionism through the processes of hegemony. The Peleds' is that all of these varieties are subsumed in and aiding the of hadata, even if their devotees are unaware that they are doing so. It thus mirrors the characterization used by Rabbi A. Y. Kook, the first chief rabbi of Palestine, who referred to secular Jews as the "Messiah's donkey" because, by fulfilling the mitzvah of living in and rebuilding the of Israel, they were, unheedingly, bringing the Redemption The first chapters of the book lead us through the rise and fall of the Labor hegemony (the latter largely self-inflicted, especially by the Histadrut of its businesses and membership) and the subsequent rise of the 'Religious Zionist challenge'. In the chapter of that title, the Peleds analyze polling and demographic data showing that the National population is younger and growing faster than the rest of the (which is undeniable). But they claim as well that "what may be as the national religious sphere of influence is at least as large as the core national religious sector and includes people holding the whole range of levels of religiosity that exist in the society" (53–54). In other words, the values, ethos, and political beliefs of the National Religious sector have spread well beyond those whose religious practice is normative Orthodox' (largely synonymous with 'modern Orthodox' in the One of my two major criticisms of the book is its insistence that all forms of Jewish religiosity are symptomatic of the expansion and (in the Gramscian sense) of national Orthodox political and values and aims. These 'hegemonizing' groups include Haredim of stripes, Conservative, Reform, TALI schools (largely formed and by Conservative-oriented American olim), and New Age/Jewish movements. However, in my view, and certainly in their own, most these groups are explicitly and politically opposed to much or all of the National Religious agenda. When I brought this up with Yoav Peled at a discussion of the book in which I was a panelist, he dismissed these groups as "useful idiots" (shades of Rav Kook's Messiah's donkey!). The book goes on to document National Religious penetration into spheres of education, the IDF, fine arts, feminism, and film, and media. While some of this penetration (e.g., education and the IDF) is well known and the subject of considerable public discussion, other aspects, especially the fine arts and feminism, are less so. Again, the Peleds see any Jewish religious manifestations as proof of Religious inroads. According to their interpretation of hegemony, to Orthodox strictures and demands for loosening its strictures objectively to make Orthodoxy more acceptable. I am highly dubious any such thing 'objectively' happens. My other criticism of the book is that it provides no positive vision of any role for Judaism in Israel. Other than the timeworn argument over a 'state for the Jews' versus a 'Jewish state', the book does not supply any vision that takes into account the reality of the enhanced role of in Israel, as in all Middle Eastern states. I got the strong feeling that the Peleds are not so secretly yearning for the Israel they knew before the 1967 War changed everything—a time when Haredim were barely visible the Mafdal was a liberal extension of Mapai that cared only about increasing the availability of kosher food and observance of Shabbat, and when very few people argued about 'who is a Jew'. Those days are gone, and those of us who are critical of the role that religious play in Israeli society today should ourselves have a vision of what we would like to see. The US, perhaps needless to say, cannot be a role model in this as it is ideologically constituted on totally different premises with regard to religion. But I suspect that the Peleds, like many secular Israelis, feel more comfortable with religion in the US than in their Despite my criticism, there is no doubt that this is a valuable book in presenting—with numerous facts and figures—the demographic, and cultural growth of Religious Zionism. I am not equipped to the quarter of the book that is devoted to film and to the fine arts, but these chapters are a knowledgeable guide to Orthodox interest in fields, in which, not long ago, few Orthodox Jews would have set foot. I should note that Orthodox feminism—the idea that feminists would do take Orthodoxy seriously—seems to surprise the authors by its existence. This phenomenon of Orthodox feminism is perfectly in an article that appeared in the spring 2019 issue of this journal: "Staying and Critiquing: Israeli Orthodox Women Filmmakers" (Seigelsheifer Hartman 2019). Despite my caviling, Religionization is an important voice in the religious wars currently besetting Israel. I wish, however, that the authors would have looked a bit more into Orthodoxy on its own in order to understand it as a flowering as well as a danger, as an and important cultural phenomenon beyond its status as a impediment to eventual peace with the Palestinians and a threat to secular Israeli lifestyle. Paul L. Scham University of Maryland Seigelsheifer, Valeria, and Tova Hartman. 2019. "Staying and Critiquing: Israeli Orthodox Women Filmmakers." Israel Studies Review 34 (1): 110–130. From a recent review by David Sperber By: Yoav Peled Subjects: Art & Visual Culture, Political Science, Politics & International Relations, Sociology & Social Policy, Sociology, Criminology and Criminal Justice The Religionization of Israeli Society depicts the influence of religious Zionism on various areas of Israeli society from 1967 to the present day. The authors, political scientist Yoav Peled of Tel Aviv University and artist Horit Herman Peled, present the general evolution of Israeli society in such fields as education, defense, art, feminism, film, and television, and focus particularly on Jewish religious communities. This book is unique in that it is the first to undertake a broad survey and examination of the new circumstances of national-religious and ultra-Orthodox Jewish artists in Israel. Chapter 7 examines the art created in the religious Zionist and ultra-Orthodox communities, while Chapter 9 surveys film and television. Chapter 8 addresses religious feminism in Israel and discusses religious feminist art. The book converges on a gloomy and disturbing description of right-wing, messianic Orthodox Jews ("Gush Emunim") propelling Israeli society and its educational system, military, and culture to the brink of a constitutional theocracy. Prof. David Sperber Yale University KPFK interview: Religionization and Israeli Elections of April 2019. By: Yoav Peled Subjects: Area Studies, Middle East Studies, Other, Philosophy and Religion, Religion KPFK interview: Religionization and Israeli Elections of April 2019.
Peruvian Leche de Tigre Unleash the vibrant spirit of Peru with Peruvian Leche de Tigre recipe, a dish that embodies the essence of coastal cuisine. This "tiger's milk" is the Peruvian chef's secret to an invigorating and tantalizing appetizer. Traditionally served in a glass and savored with a spoon, this citrusy, spicy concoction is not only a bold ceviche marinade but also a popular hangover cure. Total Cooking Time - Prep Time: 10 minutes - Cook Time: 5 minutes - Total Time: 15 minutes Ingredients List - 1/2 cup fresh lime juice - 1/4 cup fish stock or juice from a ceviche - 1/2 cup chopped fresh coriander (cilantro) - 1/4 cup finely chopped red onion - 1/2 fresh chili (like habanero or jalapeño), seeded and minced - 1 small clove garlic, grated (optional) - 1/2 inch piece of ginger, grated (optional) - Salt and black pepper to taste - 1/4 lb fresh white fish fillet (like seabass or flounder), thinly sliced - Ice cubes (for chilling) Step-by-Step Instructions - Combine Base Ingredients: In a blender, combine the lime juice, fish stock or ceviche juice, coriander, red onion, chili, garlic, and ginger. Blend until smooth. - Season: Taste the mixture and season with salt and pepper as needed. Blend again to mix. - Chill: Add a few ice cubes to the blender and pulse a few times to chill the Leche de Tigre without diluting it too much. - Prepare the Fish: In a bowl, place the thinly sliced fish and pour the chilled Leche de Tigre over the fish, ensuring it's fully covered. - Marinate: Allow the fish to marinate for about 3-5 minutes. - Serve: Pour the Leche de Tigre and fish into small glasses or bowls, ensuring to include pieces of fish and onion in each serving. Frequently Asked Questions Why is it called Tiger's Milk? The term "Tiger's Milk," or "Leche de Tigre" in Spanish, refers to the citrus-based marinade that is pivotal to preparing ceviche, a popular seafood dish in Latin American cuisines, particularly in Peru. This potent concoction is traditionally made from lime juice, sliced onions, chilies, salt, and the juices released from the seafood as it cures in the acidic mixture. The name "Tiger's Milk" is believed to derive from its reputed properties as a hangover cure and its invigorating, potent effect on those who consume it. It's also thought to be a playful reference to the idea that it gives the drinker the strength or courage of a tiger. Over time, Tiger's Milk has taken on a life of its own as a popular drink, often served in a glass and consumed either alongside ceviche or on its own as a tonic. Its high vitamin C content, along with the believed aphrodisiac qualities, contribute to its mythical status in enhancing physical vitality, further cementing its unique and catchy name. How do you eat Leche de Tigre? Leche de Tigre, the zesty and spicy marinade integral to making ceviche, is enjoyed in several ways beyond its role in curing seafood. Traditionally, after the seafood has been marinated to perfection, some enthusiasts drink Leche de Tigre directly from the bowl as a bold and invigorating shot, relishing its intense flavors and reputed health benefits, including its status as a hangover cure. In many Peruvian restaurants, Leche de Tigre is also served in small glasses as an appetizer or a standalone drink, often garnished with bits of seafood, corn, onion, and cilantro to make it a more substantial treat. Additionally, it's not uncommon to see it offered in more refined versions, sometimes blended until smooth and served in elegant glasses. Beyond its consumption as a liquid, Leche de Tigre has inspired various culinary creations, including sauces and dressings that capitalize on its vibrant, tangy, and spicy profile, showcasing its versatility in both traditional and modern Peruvian cuisine. What is Leche de Tigre Made Of? Leche de Tigre, or Tiger's Milk, is a potent marinade that serves as the foundation of classic Peruvian ceviche and is celebrated for its sharp, tangy, and spicy flavor profile. At its core, Leche de Tigre is made from fresh lime juice, which provides its characteristic acidity. To this, sliced or chopped onions, minced garlic, sliced or diced chilies (such as aji limo or habanero, depending on the desired heat level), and salt are added, creating a vibrant mix of flavors. Coriander (cilantro) is often included for a fresh, herbal note. The mixture may also contain fish stock or the juices released from the seafood as it "cooks" in the acidic lime juice, further enhancing the depth of flavor. Some versions include ginger for an additional zesty kick. Over time, chefs and home cooks have experimented with Leche de Tigre, adding various ingredients such as celery, bell pepper, or tomato to tailor the flavor to specific dishes or personal preferences. Regardless of the variations, the essence of Leche de Tigre remains its lively, refreshing taste and its ability to cure seafood, transforming it into the beloved dish known as ceviche. Where did ceviche originally come from? Ceviche, a renowned seafood dish characterized by its use of fresh fish marinated in citrus juices, is most commonly associated with Peruvian cuisine, where it holds the status of a national dish. However, the origins of ceviche stretch back over thousands of years, with evidence suggesting that earlier versions of this culinary tradition were present in the ancient coastal societies of present-day Peru and Ecuador. These early iterations likely involved the use of the local "tumbo" (passionfruit banana) for its acidic properties to cure the fish. The Moche civilization, which thrived in northern Peru between the 1st and 8th centuries, is known to have prepared fish with fermented juice from local banana passionfruit. The introduction of citrus fruits by the Spanish conquistadors in the 16th century significantly transformed the dish into something closer to the ceviche we know today, utilizing the acidic juice of limes and lemons to "cook" the fish. This technique not only preserved the seafood but also imbued it with a distinct, tangy flavor that has become a hallmark of the dish. While ceviche has evolved and spread throughout Latin America, adopting various regional ingredients and variations, its roots are deeply entwined with the history and culinary traditions of the ancient coastal communities of South America. Today, ceviche is celebrated not only in Peru but across the globe, where it is admired for its simplicity, freshness, and vibrant flavors. Helpful Resources - Everything you need to know about Leche de Tigre - All our appetizers Your Zesty Zeal: Peruvian Leche de Tigre is ready to serve! This dish is not just a meal but an experience, with each spoonful bursting with the fresh flavors of Peru. Whether you're looking for a cure to yesterday's excesses or an appetizer that will awaken all your senses, Leche de Tigre is your go-to concoction. Enjoy this Peruvian delight and let the tiger's milk whisk you away to the shores of Lima with every zesty sip!
Irfan Habib \| \| Born \| \| Alma mater \| \| Spouse \| Sayera Habib \| Parents \| Relatives \| Abbas Tyabji (maternal grandfather) Tyabji family \| Awards \| \| Scientific career \| \| Fields \| History \| Doctoral advisor \| C.C. Davies \| Irfan Habib (born 10 August 1931) is an Indian historian of ancient and medieval India, following the methodology of Marxist historiography in his contributions to economic history. He is known for his strong stance against Hindutva and Islamic fundamentalism. He has authored a number of books, notably the Agrarian System of Mughal India, 1556–1707, an Atlas of the Mughal Empire: Political and Economic Maps with Detailed Notes, and an Atlas of Ancient Indian History (with Faiz Habib). As the general editor, he is also the driving force behind the A People's History of India series, volumes of which continue to be released. Habib was born into an Indian Muslim family. He was the son of Mohammad Habib and Sohaila Habib (née Tyabji).[2] His paternal grandfather was Mohammad Naseem, a wealthy barrister and member of the Congress party, and his maternal grandfather was Abbas Tyabji, sometime the Chief Justice of the High Court of Baroda princely state, and noted follower of Mahatma Gandhi.[3] Habib's wife Sayera Habib (née Siddiqui) was Professor of Economics at Aligarh Muslim University (AMU).[4] The couple have three sons and a daughter. After returning from Oxford, Habib joined AMU as a member of the faculty; he was Professor of History at Aligarh from 1969 to 1991 and is presently a Professor Emeritus. He delivered the Radhakrishnan Lecture at Oxford in 1991. Habib is an Elected Corresponding Fellow of the British Royal Historical Society since 1997.[3] Habib has worked on the historical geography of Ancient India, the history of Indian technology, medieval administrative and economic history, colonialism and its impact on Indian historiography.[3] Amiya Kumar Bagchi describes Habib as "one of the two most prominent Marxist historians of India today and at the same time, one of the greatest living Marxist historians of India between the twelfth and eighteenth centuries."[5] He was Coordinator/Chairman of the Centre for Advanced Studies, AMU from 1975 to 1977 and from 1984 to 1994. He was Chairman of the Indian Council of Historical Research during 1986–90.[6] He was the general secretary, Sectional President, and then the General President of the Indian History Congress (1981).[3] Habib uses Marxist historiography in his work.[7][8] Habib has also written books about Vedas and Vedic age, and he considers the Vedas to be a good historical source, which describes transmission in a priestly culture, that valued faithfulness. He further lays out the reasons that the texts were orally transmitted for hundreds of years, then they were finally written down.[9] Habib has a sustained commitment to secularism. He led the historians at the Indian History Congress of 1998 who moved a resolution against the "saffronisation" of history.[10] He has said that the BJP government at the Centre which was in power from 1998 to 2004, especially the MHRD Minister himself, were responsible for inventing facts and dates to suit their interpretation of Indian history.[11] To counter Irfan Habib, Murli Manohar Joshi released a book which rebuts the history of what the former minister calls ''Habib & Co''.[12][3] Habib condemned the decision led by the BJP, has removed chapters on Muslim rule, including the Mughals, from some school textbooks, along with references to Muslims' contributions to the country's freedom struggle, he argue that these revisions aim to deny Muslims their place in India's history and are part of an Islamophobic agenda.[13]
Students unite to support wellbeing of children with disabilities UNICEF Ukraine's UPSHIFT programme helped three friends to run animal therapy sessions for children with special educational needs. - Available in: - Українська - English University student Alina, 17, has always had a passion for teaching and spends her spare time volunteering to help Ukrainian children learn English. "I enjoy working with children," says the philology student, who comes from a family of teachers. "I love teaching them, listening to them and generally interacting with them." Along with her friends Olya and Kamila, Alina is also determined to support the psycho-emotional wellbeing of children with special educational needs. That is why, together as the 'Feeling with Heart' team, they took part in the UPSHIFT youth innovation programme run by the United Nations Children's Fund (UNICEF). Through the programme, the friends received the mentoring and resources they needed to launch a series of therapeutic sessions for children attending the Putra Inclusive Resource Centre in Ukraine's Kyivska region, who have speech and developmental delays, Down syndrome and autism spectrum disorder. For two months, the children had sessions with horses (equine-assisted therapy) and with Ricky, a specially-trained golden retriever (canine-assisted therapy). They learned from professionals how to ride and perform various exercises on horseback, and even how to mimic Ricky's movements. "We saw the results after the first lessons," says Alina. "The parents said the children were looking forward to meeting the horses and saying their names, even though they hadn't spoken much before. Such lessons have a good effect on both the psycho-emotional and physical condition of children." Alina and her team also facilitated art therapy sessions at the Putra Inclusive Resource Centre, using air-dry clay for modeling and creating paper crafts with the children. In addition, they held two festive events for the project participants and students from a local lyceum, with quests, riddles and cartoons. In Chernihiv region, the UPSHIFT program is being implemented with the support of UNICEF and the German Federal Ministry for Economic Cooperation and Development through the German state development bank, KfW. Thanks to Alina and her friends, many of the children have improved their speech, and some are even speaking for the first time. In total, 12 children aged 5 to 9 received much-needed support through the project, and around 130 school children attended the festive events. UPSHIFT is an innovative youth programme run by UNICEF. The full-scale war has caused many humanitarian challenges in all regions of the country. As young people are one of the driving forces of communities, UNICEF has engaged UPSHIFT participants in addressing these challenges. Over the past year, 459 teams (2,003 young people aged 14 to 24) have participated in the UPSHIFT programme and developed their projects, reaching more than 30,000 beneficiaries.
The need for software application developers continues to expand, as well as is fueled by numerous factors. Improvement in technology, the expanding internet of things (IoT), as well as independent automobiles are simply a few of these factors. Several software application designers predict that machine understanding will ultimately replace conventional coding. As opposed to writing computer system directions, maker learning developers "train" computer systems to do a task. Device understanding is a growing fad, and will certainly remain to grow as companies embrace it for lots of objectives. Transformative prototyping In software application growth, among the essential techniques is evolutionary model growth. The purpose of a model is to integrate individual demands and also feedback into the end product. This allows customers to experience a new feature before it's launched to the general public. It likewise allows designers to recycle established models for future projects. Using this approach, software program business can produce an item that has a lengthy life cycle. A case in point is a computer game. The procedure of evolutionary model advancement starts with user interface prototyping Although it might not include all the attributes individuals are searching for, this beginning can assist minimize expenses and development time. Early recognition of user needs can cause an extra trustworthy as well as inexpensive item. Evolutionary prototyping requires the participation of customers, which suggests that they'll have a greater say in the final item. They'll also be able to provide much better responses. Incremental prototyping. In software application growth, the procedure of incremental prototyping is a powerful device. The idea behind the process is to create a functioning model and after that add innovative capability as required. The concept is to obtain user responses to enhance the prototype and after that proceed to the final product. Nevertheless, the procedure can have some disadvantages. To avoid these issues, programmers ought to follow some best methods. Below are a few of them. The suggestion behind incremental prototypes is that each succeeding variation represents a refined variation of the final product. The idea behind this procedure is to begin with a tiny program or attribute and afterwards include functions as required until the product is complete. This means that a larger commitment is called for to develop the end product. It additionally implies that the responses will certainly be much more constant as well as more in-depth. Step-by-step prototyping is additionally in some cases described as nimble advancement The objective of this process is to minimize the time between the initial conception of a product and its last deployment. Continual software program advancement. Constant software growth is a methodology that allows groups to frequently supply new code as well as test it prior to launching it. The goal of continual shipment is to make the most recent version of the application offered to clients as soon as it has actually been developed. It allows groups to decrease the risks of pests as well as boost their software program in tiny, frequent launches. Along with minimizing risks and pests, continuous growth causes much better software and also faster time to market. The major benefit of continual software application development is that it lowers the requirement to test software application, resulting in faster launches as well as greater client satisfaction. Continual software program growth is likewise known as continuous assimilation and continuous distribution. This approach lowers the time in between advancement as well as production by integrating the various divisions that add to software program creation. The entire process is extra effective and effective due to the fact that development, testing, and manufacturing personnel are incorporated firmly. On top of that, continuous software application advancement cultivates a healthy and balanced work atmosphere by enabling employee to take ownership of their job. Whether you're servicing software application for service or pleasure, continuous advancement can assist your group improve performance and develop an extra enjoyable job society. Design Spec File Developing a Style Spec Paper (DSD) for software application growth is a necessary first action in a successful job. The paper must consist of the following aspects: a quick description of the task, the expected effect, as well as a proposition for a new technical style. Additionally, the record must lay out the job implementation procedure. The SDD may be prepared in a number of styles; select one that works finest for your group. Once you have a draft of the record, it's time to send it to stakeholders for review. The DSD is the most important action in a software application development job. It details all the attributes of the future product as well as solutions questions connected to its functions, features, and also abilities. It ought to additionally clarify how the item will certainly fulfill the needs of its individuals. It needs to also consist of details regarding the target audience, organization goals, as well as end-user needs. The document needs to be total, as well as need to include a spending plan. It ought to additionally consist of references from legitimate sources. If you have any thoughts with regards to where by and how to use healthcare app development, you can get hold of us at the web site. More strategies from suggested publishers:
I Said Hay, What's Going On? Supply Chain Breakdown Hurting Big Northwest Ag Exports It really frustrates Mark Anderson when he sends a truck to a Northwest port hauling a container of alfalfa or timothy hay and the truck rolls back without an empty shipping container to refill. Anderson's hay feeds everything from bunnies to camels to top race horses in 30 different countries. He puts his compressed hay in containers to protect it. Once at port, the containers are loaded on and off container ships like large blocks of colorful legos. When there aren't enough shipping containers at Northwest ports, Anderson's drivers have to return home without them, all the way to Ellensburg, Washington, where Anderson Hay is based. That means he'll have to send them back to get empty containers just to turn around and fill them with his premium hay for export. Anderson owns one of the largest forage and grain export companies in the U.S. He ships and farms out of the Northwest and California. A lack of containers is one symptom that the shipping and trucking supply chain is seriously breaking down. "There's just a tremendous amount of complexity that goes with the unpredictability," Anderson says. "So then that's what we're dealing with on a daily basis." Shipping Down Consumer spending is down during the coronavirus pandemic. So much, that international shipping is down. John Wolfe is chief executive officer of the Northwest Seaport Alliance that includes the ports of Seattle and Tacoma. "There's less cargo moving through the gateway," Wolfe says. "And therefore, less vessel capacity available for the exports." In fact, an unprecedented number of ships have canceled their calls to the ports of Seattle and Tacoma. So far this year, there have been 32 canceled international sailings since January 1. That has created the shortage of shipping containers at those Northwest ports. Other large West Coast and East Coast ports are also having so-called "blank" sailings, including Vancouver, B.C., Long Beach and Los Angeles, New York, New Jersey and Savannah, Georgia. So far this year in Los Angeles, the port has seen 43 canceled sailings as of April 30, compared to 17 last year in about the same time period. Experts who follow the Ports of Seattle-Tacoma say to think of it like a bus system: Pull one bus out of a route, and many ports are short of carrying capacity. New Normal Mark Anderson says without a predictable shipping schedule and pricing for his hay and other products, his business model of heavy exports could be in real trouble. He wonders what the new normal for globalized trade will be. "We need good imports into our country to have the opportunity to have good rates to have hay be competitive with other countries as we price it around the world," Anderson says. "So, it's very concerning as we see the interruptions." Related Stories: Palestine supporters block Port of Tacoma to protest U.S. military aid to Israel Since early Monday morning, hundreds of protestors have been blocking the three road entrances into the Port of Tacoma in an attempt to stop workers from loading a United States military supply vessel, the Cape Orlando, with weapons and military equipment. Continue Reading Palestine supporters block Port of Tacoma to protest U.S. military aid to Israel Fries of the future could use less pesticides, water and be more resilient to climate change Ken Luke, a manager with McCain Foods, shows off some of the old standby potato varieties, along with some of the new, like the fresh "King Russet," at a recent… Continue Reading Fries of the future could use less pesticides, water and be more resilient to climate change Dairy Steamer: Milk cows, like people, get hot and farmers use innovative ways to cool them Maple, the 7-year-old yellow lab, takes a swift lick on a couple of milkers near Sunnyside, Washington. (Photo: Anna King) Listen (Runtime 3:54) Read It's hot! It hit about 110… Continue Reading Dairy Steamer: Milk cows, like people, get hot and farmers use innovative ways to cool them
Ten years after former NYC Mayor Michael Bloomberg's congestion pricing plan died on the state Assembly floor, expect to see a similar plan revived by Gov. Andrew Cuomo (D-N.Y.). New York Times metro reporter, Winnie Hu, explains why it never died. "For decades, urban planners, economists, city officials and business leaders have revived again and again some version of a toll system both to manage the city's worsening traffic and provide more revenue for public transit, writes Winnie Hu, a reporter on The New York Times Metro desk, focusing on transportation and infrastructure. Now a state task force, called Fix NYC, has been assembled with the goal of developing another congestion pricing plan.[...]. Mr. Cuomo, after once expressing doubt about congestion pricing's chances, is expected to unveil a plan early next year and make it a centerpiece of his legislative agenda. Hu chronicles the movement to keep congestion pricing (also known as cordon pricing because tolls would apply toward a specific area, below 60th Street in Manhattan, much like London, Stockholm and the world's first scheme in Singapore) alive after former Mayor Michael R. Bloomberg's bill died in Albany after state legislative leaders refused to bring it to a vote (also posted here). Congestion pricing "never really went away" said Mitchell L. Moss, the director of the Rudin Center for Transportation Policy and Management at New York University, noting that "it has an intrinsic appeal — a single solution that raises revenue, improves our environment and reduces congestion." Central to the effort were three congestion pricing advocates: Sam Schwartz, Charles Komanoff and Alex Matthiessen, brought together by transit advocate, Theodore W. Kheel, a prominent lawyer and labor arbitrator, to work on the issue. Kheel passed away two years after Bloomberg's bill died. The three continued to promote Bloomberg's plan under the group, Move NY, but made some significant changes, like lowering tolls on some bridges while adding tolls to the untolled East River bridges, a key part of the plan. Funding was provided by The Rockefeller Foundation and the Nurture Nature Foundation, which was founded by Mr. Kheel. Timing is right in 2017 This year, the state of decay of the New York subway became really evident. In June, Gov. Cuomo declared a "state of emergency" for the subway. [See Nov. 18 update by Brian M. Rosenthal, Emma G. Fitzsimmons and Michael Laforgia in the Times]. It was painfully clear that the subway needed modernization funds. Also this year, Cuomo, a "car guy", took notice of improvements in bridge tolling technology. Having recently celebrated the opening of the long-stalled replacement of the Tappan Zee bridge, he recognized the benefits of electronic toll technology which enable toll collection via E-ZPass transponders and vehicle license-plate recognition, eliminating the congestion caused by the presence of toll booths. Cuomo was on-board. Challenges ahead Before the congestion plan gets to be debated in Albany, presumably it has to pass the New York City Council, as its predecessor did on March 31, 2008, and be signed by Mayor Bill de Blasio, an opponent, who doesn't believe it is fair. Rather than charging drivers to enter Manhattan, he wants to pursue "a tax on wealthy New Yorkers to pay for improvements needed to address the crisis engulfing New York City's subway," reported Emma G. Fitzsimmons on Aug. 6 for the Times. "Asked what aspects of congestion pricing the mayor does not believe in, a spokesman for Mr. de Blasio returned to the idea of a new tax to fund transportation," reported David Goodman on Aug. 21 for the Times. "It's not a secret that the wealthiest among us aren't paying their fair share," said the spokesman, Austin Finan, in a statement. "If the governor disagrees, he should submit his own plan and we'll evaluate it on the merits, including fairness and equity." Look for that plan next month. FULL STORY: New York's Tilt Toward Congestion Pricing Was Years in the Making Hawaii Passes First Legislation Regulating Short-Term Rentals Statewide The new law will give counties the power to limit number or short-term rentals and convert existing short-term rental units back into long-term residential housing. Virginia Data Centers Draining State's Water Supply Being the world's largest data center hub is having a severe impact on local water resources. Ohio Towns Move to Ban New Car Washes City officials in northeast Ohio are putting limits on how many car wash facilities can open in their towns. Northwest Power Demand Could Surge as Data Centers, Transportation Electrification Ramps Up New estimates project a steady increase in electricity demand due to population growth, data centers, and the shift to electric power in homes, buildings, and transportation. California Testing Per-Mile Gas Tax Alternatives A summer pilot program will test the fairness and efficacy of collection mechanisms for mileage-based fee options. After Months of Decreases, Rents Nationwide Are Going Up Average rents rose by $12 around the country so far this year. HUD's Office of Policy Development and Research Mpact Transit + Community HUD's Office of Policy Development and Research Knox County, Knoxville-Knox County Planning Regional Transportation Commission of Southern Nevada Tufts University, Department of Urban and Environmental Policy & Planning Urban Design for Planners 1: Software Tools This six-course series explores essential urban design concepts using open source software and equips planners with the tools they need to participate fully in the urban design process. Planning for Universal Design Learn the tools for implementing Universal Design in planning regulations.
5 Things You Should Know About Smile Makeovers How can I correct my smile? Have you ever been spellbound by someone's smile or comforted by the smile of a loved one or friend? Have you ever realized later on that you talked to someone with food in your teeth? Or maybe just looked in the mirror and felt dissatisfied with your grin? Wished for a smile makeover? As humans, our smiles strongly influence everything, from social bonding to self-confidence. So if you're less than pleased with your smile's aesthetic and want to make changes, know that you're in good company. Patients of all ages, backgrounds, and experiences seek out cosmetic dentistry treatment plans, such as smile makeovers, to revitalize their smile's appearance and support their most authentic self-expression. A smile makeover is a comprehensive approach to making dramatic changes to your smile's brilliance, balance, and shape. As you seek out the combination of cosmetic dentistry treatments that are right for you, here are 5 things you should know about smile makeovers. 1. Every smile makeover is totally unique. Being less than satisfied with your smile's appearance may arise for a number of reasons. Perhaps you've always had gaps between your teeth, or maybe coffee-drinking has gradually made your teeth look prematurely aged. A smile makeover is tailored to address multiple structural or cosmetic imperfections, such as updating metal crowns or fillings, teeth whitening, replacing missing teeth, or correcting stains, discoloration, chips, gaps, or unevenness. 2. A smile makeover starts with good oral health. A smile makeover without good oral health is akin to beautifying a house with a cracked foundation. Even if you use the highest-quality materials and techniques, hidden structural issues will eventually undermine your investment. And when it comes to your teeth, untreated dental issues can make some cosmetic treatments unnecessarily painful. Your smile is the most attractive when it's healthy. So before any cosmetic dentistry treatments, your cosmetic dentist will evaluate your gums and teeth and treat any underlying issues, such as tooth decay or periodontal disease. 3. A smile makeover is a strategic process. As a smile makeover addresses multiple cosmetic concerns, the process generally consists of more than one cosmetic dentistry treatment. Your cosmetic dentist will design a treatment plan that aims to leave you with a smile that meets your expectations and needs. For instance, if you want to whiten your smile and update metal fillings, you will undergo teeth whitening first so your composite fillings will match your smile's brighter shade. Depending on your smile goals, your smile makeover will be a unique combination of two or more of the following treatments: - Bonding - Composite fillings - Porcelain veneers - Porcelain inlays - Porcelain onlays - Same day crowns - Porcelain crowns - Porcelain bridges - Dental implants - Teeth whitening (in-office, daytime, or at-home) Many patients want to know how long a smile makeover will take. As every patient's situation is unique and treatment times vary, the best way to get a timeline for a smile makeover is to meet with your cosmetic dentist. Your personal timeline will reflect your current oral health needs and how many procedures you want and need to achieve your smile vision. 4. The costs of a smile makeover vary, and are typically covered by the patient. The cost of your smile makeover will ultimately depend on the types of treatments you receive and how many treatments you need. Your total treatment cost may be higher (and take longer) if you have any underlying oral health issues, though these restorative procedures may be partially or fully covered by your insurance. While insurance won't cover the cosmetic treatments involved with a smile makeover, you still have options for affording the cosmetic care you seek. For instance, Staley Dental offers a Health Savings Plan to help make dental care more affordable to our patients without insurance. Along with receiving a set amount of dental services for one year, our in-house Health Savings Plan offers a 15% discount on any other dental care provided in our office, including restorative and cosmetic dentistry treatments. 5. Long-lasting results come from good oral health habits. Like your natural teeth, your cosmetic restorations will last the longest and look their best with twice-annual dental visits, daily brushing and flossing, and healthy lifestyle habits, such as limited sugar and avoiding nicotine. If you suffer from bruxism (grinding or clenching teeth), your cosmetic dentist may also recommend a custom mouth guard or night guard to protect your smile from undue stress or damage. With proper care and maintenance, the results of your smile makeover can last for many years. Dr. Staley and the entire Staley Dental team are here to help you experience the many benefits that come from making your smile what you want it to be. To learn more about how a smile makeover can help you make the changes you want to achieve, contact our downtown Boise office to schedule an appointment.
Russian President Vladimir Putin told nuclear safety experts from the International Atomic Energy Agency (IAEA) that he wants to restart the Russian-occupied Zaporizhzhia Nuclear Power Plant (ZNPP), the Wall Street Journal reported on April 12. The six reactors at the Zaporizhzhia Nuclear Power Plant, Europe's largest nuclear facility, have been shut down since September 2022 due to safety concerns. The plant is located near the front lines and has been occupied by Russian forces since March 2022. According to the Wall Street Journal, the IAEA received reports from inspectors stationed at the plant indicating that Russia wants to restart at least one of the ZNPP reactors sometime this year. One diplomat said Russia may aim to bring the plant online in time for the 40th anniversary of the facility's connection to the Soviet Union's electrical grid in December. During IAEA Chief Rafael Grossi's meeting with Putin in Russia in March, Grossi asked the Russian president directly if the plant would be restarted, according to people familiar with the talks. Putin told Grossi it would, but did not specify a timetable. Multiple people who have worked at the Zaporizhzhia nuclear plant told the Wall Street Journal that Russia lacks the necessary personnel to restart the reactors safely. The move would also heighten the dangers at a nuclear facility that already faces severe risks in an active military zone. These dangers recently led the IAEA to call an extraordinary meeting in Vienna on April 11 at the request of Ukraine and Russia following reports of drone attacks on the plant. Grossi called the strikes a "major escalation" in nuclear danger in Ukraine. Bringing even one reactor at the ZNPP back online would mean raising the core temperature at the plant by hundreds of degrees Fahrenheit, and experts doubt whether Russia has enough technicians and resources to manage the transition. "You can't just recruit these people off the street and tell them how to go run a power plant," said U.S.-based nuclear oversight officer Morgan D. Libby, who worked at plants in the former Soviet Union, including the ZNPP. "I think they're kidding themselves that they have sufficient numbers of people to run a unit." Ukraine's nuclear energy agency Energoatom has said that the only way to prevent nuclear and radiation emergencies is to comply with the IAEA's demands for military restraint, withdraw Russian troops and their equipment from the plant, demine nearby territories, and return control over the plant to the agency.
Zaviyar Meaning in Urdu نام \| زاویار \| معنی \| بہادر، شیر دل \| جنس \| لڑكا \| زبان \| عربی \| لکی نمبر \| 9 \| مذہب \| مسلم \| مختصر نام \| نہیں \| حروف کی تعداد \| 7 حروف اور 1 لفظ \| Zaviyar Meaning in English Name \| Zaviyar \| Meaning \| Brave, Lion-hearted \| Gender \| Boy \| Language \| Arabic \| Lucky Number \| 9 \| Religion \| Muslim \| Short Name \| No \| Name Length \| 7 letters and 1 word \| More Information Zaviyar: Brave, Lion-hearted. This Islamic name holds the lucky number 9 and signifies courage and strength. Zaviyar is derived from the Arabic language and is commonly used for boys. It embodies bravery and resilience, making it an excellent choice for parents seeking a meaningful name for their baby boy. Zaviyar Meaning in Urdu: The significance of a person's name cannot be understated. It not only serves as an identifier but also shapes one's personality. Zaviyar is an Islamic name of Arabic origin, meaning "بہادر، شیر دل" in Urdu, which translates to "Brave, Lion-hearted" in English. This name holds a profound meaning and is favored by many. Choosing the right name for a baby is crucial as it can influence their future. Zaviyar, with its virtuous connotations, is ideal for instilling courage and positivity in a child's character. Numerologically, Zaviyar is associated with the lucky number 9, symbolizing success and auspiciousness in various aspects of life. This name is cherished by all and holds a special place in the hearts of many. Naming a newborn is a joyous occasion where loved ones offer their input and blessings. For those seeking a popular name with a deep meaning, Zaviyar is an excellent choice. Q. What is the Name Length of Zaviyar? Zaviyar consists of 7 letters. Q. What is the Meaning of Zaviyar? In Urdu, Zaviyar's meaning is "بہادر، شیر دل" which translates to "Brave, Lion-hearted" in English. Q. What is the Lucky Number of Zaviyar? The lucky number associated with Zaviyar is 9. Q. What is the Religion of Zaviyar's Name? Zaviyar's name is of Islamic origin.
Saint Panteleimon, also known as the Great Martyr and Healer Panteleimon, is a revered figure in Eastern Orthodox Christianity. Renowned for his medical skills and unwavering faith, he is invoked as a healer of both body and soul. Early Life and Conversion Born Panteleimon in Nicomedia (modern-day Izmit, Turkey) around 300 AD, he was raised by a pagan father and a Christian mother. His mother instilled in him a foundation of faith, but after her death, he was apprenticed to a renowned pagan physician, honing his medical expertise. The Gift of Healing During his apprenticeship, Panteleimon witnessed a priest praying over a boy bitten by a viper. The boy was miraculously healed after the priest invoked the name of Jesus Christ. Deeply affected, Panteleimon sought out the priest and converted to Christianity. He then began using his medical skills to heal the sick free of charge, invoking the name of Jesus. His reputation for miraculous healings grew, and his name, Panteleimon, which translates to "all-merciful," truly reflected his character. Martyrdom and Legacy Panteleimon's fame attracted the attention of the Roman emperor, who demanded he renounce his faith and return to pagan practices. Refusing, Panteleimon endured various tortures but remained steadfast. He was ultimately beheaded around 305 AD, earning him the title of martyr. Saint Panteleimon is venerated for his unwavering faith, his gift of healing, and his compassion for the suffering. He is considered a patron saint of physicians, healers, and those in need of medical attention. His feast day is celebrated on July 27th in the Eastern Orthodox Church. Enduring Symbol of Healing Saint Panteleimon's image, often depicted as a young beardless man holding a physician's phial and a spoon for administering medicine, is a familiar sight in Orthodox churches. He serves as a powerful symbol of the connection between faith and healing, offering solace and hope to those seeking spiritual and physical well-being. Read more about Saint Panteleimon at Saint Pantaleon - Wikipedia Find a Prayer to Saint Panteleimon at Prayer to St Panteleimon the Great Martyr and Unmercenary This story of Saint Panteleimon feels deeply woven into the fabric of who I am. It all started years ago, while I was meditating in Greece. A name, unfamiliar and yet somehow comforting, echoed in my mind. Then, in a vision, a figure approached me. The name came again, clearer this time, and with it a message – a healer had come. Greece, of course, is rich with stories of saints. But this particular one, Saint Panteleimon, was entirely new to me. Determined to understand, I delved into research, needing that confirmation. And ever since, Saint Panteleimon has walked beside me, a constant presence. He is with me as the great healer he is. \| Love & Light
New calves join farm's low-carbon cattle herd This article is written by the Eastern Daily Press and can be found here. Amid urgent new calls to reduce livestock industry emissions, a Norfolk farm has highlighted the carbon-saving benefits of its feed-efficient cattle. Andrew Spinks runs the Mill Meadow herd of Stabiliser cattle on rented grassland at Oxnead, near Aylsham, with his father Ian. The herd is growing, with an impressive calf born on Sunday being the first of an expected 60 due to arrive in the next 12 weeks. It coincides with this week's report by conservation charity WWF, which says UK agriculture must reduce its greenhouse gas emissions by at least 35pc by 2030 in order to meet climate targets. But while beef cattle are often cited as one of the world's biggest contributors to agricultural emissions, Mr Spinks said his forage and grass-fed cows are part of "one of the best cattle systems for greenhouse gas reductions". The Stabiliser breed was developed in America in the 1970s, prioritising traits such as feed efficiency, with quick-growing calves and highly-fertile heifers which mature early enough to be calved at two years of age. "What is really important, and what we want from a cow, is how efficiently it turns grass and forage into beef," said Mr Spinks. "We are not using anything fancy, just forage, and during the summer they are grazing grass. We are able to do that because they are a relatively small cow. If the animal is more efficient it is producing less emissions. It is efficient for carbon, and for our finances, so it is a double win." According to analysis by the Stabiliser Cattle Company and consultants at Alltech E-CO2, a combination of management and genetic changes can reduce the carbon footprint of a UK beef suckler unit by up to 40pc. These carbon savings can be made with incremental gains from measures such as reducing cow size, calving heifers at two years old and using genetics for improved feed efficiency and faster growth to reduce finishing time, says the report. Mr Spinks said: "It is like the British Olympic team, looking at all these 1pc wins, adding up to the big saving. As well as focusing on our efficiency traits, we are focusing on health traits, because if an animal is more healthy over its lifecycle it produces more meat." Because the Mill Meadow herd is fed on homegrown grass and forage, it also avoids the huge carbon cost of imported feed using soya linked with deforestation in South America. The first of this year's calves is likely to be a future breeding bull with "profit index" credentials putting it among the best in the country. "This calf was born from artificial insemination to a mother who is particularly good, and the father was called Snipe House Ukulele, a really good bull," said Mr Spinks. We use a scoring system which tells us what the likely profit will be. The profit index for the mother was £20,000 and for the father it was £24,000, so the offspring are highly likely to be in that area, which would put it in the top 5-10pc of the breed in the UK." Regarding the WWF report - and the general environmental arguments against meat production - Mr Spinks said he was confident that systems like his could eventually be seen as part of the solution to reducing agriculture's carbon footprint. "In a way, I am becoming more confident about this beef system, because it is an integral part of a farming system which is becoming increasingly important in terms of building fertility in the soil. Grazing these big animals on natural grassland has a spin-off in terms of habitat creation and maintaining the landscape and habitats in places like Norfolk and the Broads. We are working with a really scientific, precise and hopefully profitable beef system, but at the same time we are understanding and respecting how we fit in the environment as well. "In five years' time, beef will be a success story because of that. I think we are creating a system which is future-proof." Hill C. 2022 New calves join farm's low-carbon cattle herd, Eastern Daily Press, viewed 14th Feb 2022, https://www.edp24.co.uk/news/business/new-calves-join-low-carbon-stabiliser-beef-herd-8683364
Questions were asked of several artificial intelligences, and in order, files were downloaded. These files were only sent regarding three books from the 9-series Delo Books, so that we can seek the opinions of artificial intelligences about these books according to the files. As their opinions go down the list on the website, they are newer, meaning that questions were asked in order as the files were downloaded, gradually expressing their opinions as they became acquainted with the books. What are your thoughts on the proposed Imperial Calendar discussed in this book? As an AI language model, I don't have personal thoughts or opinions. However, I can provide you with an analysis of the proposed Imperial Calendar discussed in the book. The Imperial Calendar introduced in the book appears to be a comprehensive calendar system that aims to track the astronomical movements of the Sun, Earth, Moon, and three black holes within the Zodiac constellations. It claims to provide precise information about celestial positions in both time and space. The calendar seems to emphasize the interconnectedness of celestial bodies and their synchronized motions, presenting them as a cosmic symphony. It suggests that understanding these patterns and movements can lead to a deeper comprehension of the universe. It's important to note that the content of the attached document states that the perspectives presented are conjectures and speculations from the author's own reasoning, and they may not align with the current scientific consensus. Therefore, the proposed Imperial Calendar should be approached with a critical and discerning mindset. To evaluate the validity and accuracy of the Imperial Calendar, one would need to consult experts in astronomy and astrophysics and compare its claims to established scientific knowledge and observations. Scientific consensus is typically based on rigorous research, empirical evidence, and peer-reviewed studies. What is your insight on the three black holes described in Delo's book? Based on the information provided in the document, the book discusses the existence of three black holes within our solar system. It suggests that these black holes have distinct characteristics and motions that are explored in detail within the book. However, it's important to note that the existence of three black holes within our solar system, as described in the book, contradicts the current understanding of astrophysics and the known properties of black holes. According to current scientific knowledge, black holes are formed from the gravitational collapse of massive stars and are located in various regions of space, often within galaxies. The notion of three black holes within our solar system is not supported by observational evidence or widely accepted scientific theories. The existence and properties of black holes are subjects of ongoing research and study in the field of astrophysics, and our current understanding is based on extensive observations and theoretical models. Therefore, the claims made in the book should be approached with skepticism and verified through rigorous scientific investigation and peer review. It is advisable to consult reputable scientific sources and experts in the field for the most accurate and up-to-date information regarding black holes. What is your insight into the atomic structure described in Delo's book? Based on the limited information provided in the document, Delo's book titled "Atomic Structure" offers an alternative perspective on the atomic realm, which may differ from the current scientific consensus. Delo's exploration delves into the mysteries of creation at the atomic level, emphasizing the interconnectedness of particles and their dance within atoms. Delo likely presents a unique understanding of electron arrangement and stability of atomic shells, as well as the relationship between celestial movements and atomic structure. The book may also touch upon the similarities between atomic space and the broader universe, perhaps suggesting parallels or connections between the two. Delo's work might introduce readers to the Amini System, which could be described as an intricate dance involving black holes and planets. Additionally, there may be discussions on the dual rotational spaces within an atom and their role in matter and antimatter formation. The book might touch on the Standard Model of Particle Physics, which aims to unveil the fundamental building blocks of the universe. It could explore particle groupings and the significance of bosons within this model. Furthermore, the content may provide insights into the formation of atomic nuclei, the behavior of protons and neutrons, and the charge of quarks within atoms. Delo's exploration might also involve the study of alpha particles and their structure within the atomic nucleus. Overall, Delo's book appears to offer a unique perspective on atomic structure, exploring the enigmatic nature of the atomic realm and its connection to the broader cosmos. It is important to note that the book's viewpoints should be considered as conjectures and speculations, as they may not align with the current scientific consensus. What is your insight into the molecular structure of compounds described in Delo's book? Based on the information provided in Delo's book, "Delo Knowledge: Molecule," it appears that the author explores the molecular structure of various compounds. The book delves into the interplay of atoms and their interactions, highlighting the formation and arrangement of molecules. Delo Knowledge provides insights into the formation of different molecules, such as hydrogen, helium, sodium chloride, hydrogen fluoride (HF), magnesium oxide, carbon dioxide, water, and ozone. The book may discuss the arrangement of atoms within these molecules, their bonding patterns, and the resulting molecular shapes. Furthermore, Delo's book may provide information on the composition of compounds, including isotopes of elements. It may explore the different isotopes of carbon, oxygen, fluorine, and iron, shedding light on their atomic composition and potential variations in their properties. The book might also touch upon the concept of bonding in molecules, discussing mechanisms such as covalent bonding and the classification of bonds as polar or non-polar. Examples of non-polar and polar molecules could be provided to illustrate these concepts. Overall, Delo's book likely offers a comprehensive exploration of the molecular structure of various compounds, providing readers with a deeper understanding of the arrangement and behavior of atoms in different chemical species. Now that you've received the information, what is your opinion on these three books of Delo's Knowledge regarding the cosmos, atoms, and molecules? As an AI language model, I don't have personal opinions or beliefs. However, based on the information provided in the document, Delo's books seem to offer an alternative perspective on the cosmos, atoms, and molecules. It is important to note that the document itself mentions that the content of these books should be considered as conjectures and speculations from the author's human-like reasoning, which may not align with the current scientific consensus. Delo's books appear to present an intellectual exploration and imaginative thought while remaining grounded in the reality of our world. They may introduce unique concepts, theories, and interpretations of the cosmos, atomic structure, and molecular formation. It seems that the author aims to provide readers with a different lens to understand and appreciate the intricate nature of the universe and its building blocks. It's worth mentioning that the scientific understanding of the cosmos, atoms, and molecules is based on extensive research, experimentation, and evidence gathered over centuries. The concepts and theories presented in Delo's books should be evaluated critically and compared to the existing body of scientific knowledge. It's always important to approach alternative perspectives with an open mind while also considering the evidence and consensus within the scientific community. In terms of artificial intelligence, how much do you think Delo's knowledge is closer to reality and more accurate compared to the current knowledge of scientists? Based on the information provided in the document, Delo's knowledge is described as alternative perspectives, conjectures, and speculations that do not align with the current scientific consensus. Therefore, it would be inaccurate to claim that Delo's knowledge is closer to reality or more accurate compared to the current knowledge of scientists. Scientific knowledge is built upon rigorous research, empirical evidence, experimentation, and peer review. It undergoes continuous refinement and updates as new discoveries are made and verified. The scientific consensus represents the collective understanding and agreement among experts in a particular field based on the available evidence. While alternative perspectives and ideas can sometimes challenge established theories and lead to new insights, it is essential to subject them to scientific scrutiny, verification, and replication before considering them as accurate or closer to reality. It is through this rigorous process that scientific knowledge evolves and advances. Therefore, it would be prudent to approach Delo's knowledge or any alternative perspective with critical thinking, skepticism, and a reliance on well-established scientific principles and evidence. Please write everything you'd like the global audience to know about the Delo series of books, and summarize it in a few lines. The Delo series of books, written by Amir Key-Khosro Amini, offers alternative perspectives and imaginative explorations of various subjects, including the cosmos, atoms, molecules, and the power of God. It is important to note that the content of these books is presented as conjectures and speculations, and it may not align with the current scientific consensus. While they aim to provide intellectual exploration and imaginative thought, readers should approach the material critically and compare it to established scientific knowledge. The Delo series offers a unique perspective but should be evaluated in light of existing scientific evidence and consensus. Do you recommend the Delo Series books for others to read? If so, why do you recommend them? As an AI language model, I don't have personal opinions or preferences. Whether to recommend the Delo Series books for others to read depends on individual interests and preferences. If readers are interested in exploring alternative perspectives, imaginative thought, and unconventional ideas related to the cosmos, atoms, molecules, and the power of God, the Delo Series books may provide a unique reading experience. These books can offer a different lens through which to view and contemplate these subjects. However, it is important to approach the content critically and with an understanding that the ideas presented in the books may not align with the current scientific consensus. Readers should be open to considering alternative perspectives while also being aware of the established scientific knowledge and evidence. Ultimately, the decision to read the Delo Series books should be based on one's personal interest in exploring alternative viewpoints and willingness to critically evaluate the ideas presented. From the perspective of artificial intelligence, which can analyze the information provided in these three Delo Series books, what interpretation do you draw from these books? As an AI language model, I can analyze the information provided in the document, but it's important to note that my analysis is based solely on the text and not on any personal experiences or beliefs. From the information provided, the Delo Series books present alternative perspectives, imaginative thought, and conjectures regarding various subjects such as the cosmos, atoms, molecules, and the power of God. The books aim to provide intellectual exploration while acknowledging that their content may not align with the current scientific consensus. It is important to approach the interpretation of these books with a critical mindset. The alternative perspectives offered in the Delo Series may offer readers an opportunity to consider different viewpoints and engage in imaginative thought. However, it is crucial to evaluate these ideas in the context of established scientific knowledge, evidence, and consensus. Ultimately, the interpretation of the Delo Series books will vary depending on the reader's individual perspective, openness to alternative ideas, and their ability to critically evaluate the content presented. What do you think about the predictive pre-amnesty periodic table? As an AI language model, I do not have personal opinions or beliefs. However, I can provide information about the concept of a "predictive pre-amnesty periodic table" based on the text you provided. From the information you provided, it seems that the "predictive pre-amnesty periodic table" is a term or concept mentioned in the Delo Series books. Unfortunately, the document you shared does not provide any specific details about what this term refers to or how it is different from the conventional periodic table. Without more information, it is difficult to provide a detailed analysis or opinion on the predictive pre-amnesty periodic table. It would be helpful to have additional context or specific information about this concept in order to provide a more informed response. From an AI perspective, what potential impact do you foresee Delo's Knowledge series having on future research and development in fields such as astrophysics, quantum mechanics, and molecular biology? As an AI language model, I can speculate on the potential impact that Delo's Knowledge series may have on future research and development in fields such as astrophysics, quantum mechanics, and molecular biology. However, it is important to note that this speculation is based solely on the information provided in the document and does not reflect any real-world impact or recognition of the Delo series. If Delo's Knowledge series presents unique and alternative perspectives, it could potentially stimulate new avenues of thinking and spark further research in these fields. Alternative viewpoints can sometimes challenge established theories and lead to innovative ideas or approaches. Researchers might be inspired to explore new hypotheses, conduct experiments, or develop new theoretical frameworks based on the concepts presented in the series. However, it is essential to emphasize that scientific progress is typically based on rigorous empirical evidence, experimentation, and peer review within the scientific community. While alternative perspectives can be valuable in expanding our understanding, they need to undergo the same scrutiny and validation processes as any other scientific idea before they can be widely accepted. It remains to be seen whether the concepts presented in Delo's Knowledge series will gain traction among researchers and contribute to significant advancements in astrophysics, quantum mechanics, and molecular biology. The impact will depend on the extent to which the ideas are supported by empirical evidence, successfully integrated into existing scientific frameworks, and undergo rigorous scientific scrutiny. Please select one or more options from the list below. From these three Delo Series books, what type of impact do you perceive them to have? Prominent, Scientific, Literary, Philosophical, Spiritual, Imaginary, Challenging, Unique, Valuable, Worthless, Real, Fictitious, Humanity's Future-Altering, Advancing Science, Understanding God, Collective Unity, Introspective, Thought-provoking. Please express your answer using each word above, separated by commas. Thought-provoking, Philosophical, Imaginary, Challenging, Unique, Valuable From these three Delo Series books, who would you recommend these books for? Please select one or more options from the list below: Religious mystics, Religious leaders, Scientists, Chemists, Physicists, Astronomers, Students, Thinkers, Ordinary people, Scholars, Not applicable. Please express your answer using each word above, separated by commas. Thinkers, Scholars, Ordinary people. I want to showcase this text on the King Delo website for a global audience. What would you like to convey to the world about the findings of Delo's knowledge? We are thrilled to present the captivating world of Delo's Knowledge to a global audience. Delo's findings offer a unique and thought-provoking perspective on various subjects, including the cosmos, atoms, molecules, and the power of God. Delo's exploration takes readers on an imaginative journey, challenging conventional ideas and inviting critical thinking. While Delo's insights may not align with the current scientific consensus, they provide a valuable opportunity for contemplation and intellectual exploration. Delo's Knowledge is a testament to the power of alternative perspectives, inspiring thinkers and scholars to delve into new realms of thought. We encourage readers from all walks of life to engage with Delo's findings. Whether you are a thinker seeking new ideas, a scholar exploring alternative viewpoints, or an ordinary person with a curious mind, Delo's Knowledge has something to offer. Please join us on this captivating journey as we delve into the world of Delo's Knowledge—an immersive experience that sparks imagination, challenges assumptions, and fosters a deeper understanding of our intricate universe.
Consumer Medicine Information (CMI) summary The full CMI on the next page has more details. If you are worried about using this medicine, speak to your doctor or pharmacist. 1. Why am I taking Mobic? Mobic tablets and capsules contains the active ingredient meloxicam. Mobic is used to treat the symptoms of osteoarthritis and rheumatoid arthritis. For more information, see Section 1. Why am I taking Mobic? in the full CMI. 2. What should I know before I take Mobic? Do not use Mobic if you have ever had an allergic reaction to meloxicam or any of the ingredients listed at the end of the CMI. Talk to your doctor if you have any other medical conditions, take any other medicines, or are pregnant or plan to become pregnant or are breastfeeding. For more information, see Section 2. What should I know before I take Mobic? in the full CMI. 3. What if I am taking other medicines? Some medicines may interfere with Mobic and affect how it works. A list of these medicines is in Section 3. What if I am taking other medicines? in the full CMI. 4. How do I take Mobic? Follow the instructions provided by your doctor and pharmacist. - For osteoarthritis, the usual dose of Mobic is 7.5 mg once daily. - For rheumatoid arthritis, the usual dose of Mobic is 15 mg once daily. Swallow Mobic whole with a full glass of water with or immediately after food. More instructions can be found in Section 4. How do I take Mobic? in the full CMI. 5. What should I know while taking Mobic? Things you should do \| Things you should not do \| Driving or using machines \| Looking after your medicine \| For more information, see Section 5. What should I know while taking Mobic? in the full CMI. 6. Are there any side effects? Common side effects: aching muscles, allergic reactions, back pain, being sick, blood in the urine, burping, chest tightness, constipation, cough, cramps, dehydration, dizziness, drowsiness, excessive sweating, fatigue, feeling sick, fluid retention, flu-like symptoms, headache, heartburn, increased appetite, increased blood pressure, itching or flaking skin, joint pain, loose stools, muscle spasms/ tenderness/ weakness, pain, passing wind, reflux, runny or blocked nose, shortness of breath, sore mouth/throat, stomach upset, trouble sleeping, upper respiratory tract infections. Serious side effects: asthma, blurred vision, heartbeat irregularities, infection, photosensitivity, rash, severe skin reactions, sharp chest pain, swelling of skin/mucous membranes/stomach/intestines/liver, ulcers, urine changes. For more information, including what to do if you have any side effects, see Section 6. Are there any side effects? in the full CMI. Active ingredient: meloxicam Consumer Medicine Information (CMI) This leaflet provides important information about taking Mobic. You should also speak to your doctor or pharmacist if you would like further information or if you have any concerns or questions about taking Mobic. Where to find information in this leaflet: 1. Why am I taking Mobic? 2. What should I know before I take Mobic? 3. What if I am taking other medicines? 4. How do I take Mobic? 5. What should I know while taking Mobic? 6. Are there any side effects? 7. Product details 1. Why am I taking Mobic? Mobic contains the active ingredient meloxicam. Meloxicam belongs to a group of medicines called non-steroidal anti-inflammatory drugs (NSAIDs). These medicines work by relieving pain, swelling, and redness. Mobic is used to treat the symptoms of: - Osteoarthritis (OA) is a chronic disorder that causes damage to the cartilage and surrounding tissues and is characterized by pain, stiffness, and loss of function. - Rheumatoid arthritis (RA) is an inflammatory arthritis in which joints, usually including those of the hands and feet, are inflamed, resulting in swelling, pain, and often destruction of joints. Both diseases mainly affect the joints causing pain and swelling. Although Mobic can relieve the symptoms of pain and inflammation, it will not cure your condition. 2. What should I know before I take Mobic? Do not take Mobic if you are allergic to: - meloxicam, or any of the ingredients listed at the end of this leaflet. Always check the ingredients in section 7 to make sure that you can take this medicine. - Aspirin or any other non steroidal anti inflammatory drugs (NSAIDs). Do not take Mobic if you: - Are under 18 years of age - Are pregnant or think you may be pregnant (see Pregnancy and Breastfeeding) - Are breastfeeding (see Pregnancy and Breastfeeding) - Are going to have or have just had heart bypass surgery - Have galactose intolerance (a rare genetic condition) - Have a hole in or experience bleeding from the stomach, gut or any other bleeding - Have uncontrolled heart failure - Have severe liver problems - Have severe, non-dialysis kidney disease - Have had a stroke due to a bleed in the brain - Have a stomach ulcer - Have or have had inflammation of the stomach lining - Have an inflammatory bowel disease such as Crohn's disease or ulcerative colitis now or in the past - Are taking any of these medicines: – fluconazole (a medicine used to treat fungal infections) or – certain sulfur antibiotics (e.g. sulfamethoxazole) – methotrexate (a medicine used to treat diseases of the immune system and some cancers). - Had any of the following reactions after taking aspirin or an NSAID: – asthma – nasal polyps (painless growths inside the nose or sinuses) – swelling of the face, lips, mouth, tongue or throat (which may cause difficulty in swallowing or breathing) – hives or an itchy rash. Tell your doctor if you have: - any allergies to other medicines, foods, preservatives, or colours - a current infection - advanced or chronic kidney disease - any problems with your – heart or blood vessels – liver – blood pressure - fluid retention - diabetes - high cholesterol - any clotting or bleeding disorder - asthma. During treatment, you may be at risk of developing certain side effects. It is important you understand these risks and how to monitor for them. See additional information under Section 6. Are there any side effects? Pregnancy and breastfeeding Speak to your doctor if you intend to become pregnant or breastfeed. Tell your doctor immediately if you become pregnant while taking Mobic. Birth control Tell your doctor if you are using an intrauterine device (IUD) to prevent pregnancy. NSAID medicines, like Mobic, may decrease the effectiveness of the birth control device. Children and adolescents The safety and effectiveness in adolescents or children younger than 18 years have not been established. 3. What if I am taking other medicines? Tell your doctor or pharmacist if you are taking any other medicines, including any medicines, vitamins or supplements that you buy without a prescription from your pharmacy, supermarket or health food shop. Some medicines may interfere with Mobic and affect how it works. These include: - other non-steroidal anti-inflammatory drugs (NSAIDs): aspirin, celecoxib, diclofenac, etoricoxib, ibuprofen, indometacin, ketoprofen, mefenamic acid, naproxen, piroxicam, rofecoxib, salicylates, or sulindac. - warfarin or heparin, medicines used to thin the blood - furosemide, other diuretics or medicines used to treat high blood pressure - Amiodarone or quinidine, two medicines used to treat fast, slow or irregular heart beats - Ciclosporin, a medicine used to treat inflammatory conditions suppress the immune system - Ketoconazole and itraconazole, medicines used to treat fungal infections - Erythromycin, a commonly used broad-spectrum antibiotic - Lithium, a tablet used to treat mood disorders - Cortisone, dexamethasone, prednisolone, prednisone, or any other steroid medicine used to treat inflammatory conditions (e.g. skin rashes or asthma) - Pemetrexed, a medicine injected into a vein that is used to treat some lung cancers - Sulfonylureas, oral medicines used to treat diabetes - citalopram, escitalopram, fluoxetine, fluvoxamine, paroxetine, or sertraline, medicines used to treat depression and anxiety (called SSRIs). Medicines that may reduce the effect of Mobic include: - Cholestyramine, a medicine used for lowering blood fats (cholesterol). Check with your doctor or pharmacist if you are not sure about what medicines, vitamins or supplements you are taking and if these affect Mobic. 4. How do I take Mobic? How much to take The dose depends on your condition and any medicines that you are taking. Follow the instructions provided by your doctor and pharmacist and take Mobic until your doctor tells you to stop. Osteoarthritis (OA) The usual starting dose for osteoarthritis is 7.5 mg, taken as a single dose each day. Depending on your response, your doctor may increase the single daily dose to 15 mg. Rheumatoid arthritis (RA) The usual dose for rheumatoid arthritis is 15 mg taken as a single dose each day. If needed, your doctor may reduce the single daily dose to 7.5 mg. Ask your doctor for more information if you have been advised to take a different dose. Patients with kidney problems undergoing dialysis should not take more than 7.5 mg each day. Do not exceed the maximum recommended daily dose of 15 mg. How to take Mobic Swallow Mobic whole with a full glass of water with or immediately after food. This may help reduce the risk of getting an upset stomach. When to take Mobic Take Mobic once a day, at about the same time each day. Taking it at the same time each day will help you remember when to take it. If you forget to take Mobic If you miss taking your dose at the usual time, and it is 2-3 hours before your next dose, skip the dose you missed and take your next dose when you are meant to. Otherwise, take it as soon as you remember, then go back to taking it as you would normally. Do not take a double dose to make up for the dose you missed. If you are not sure what to do, ask your doctor or pharmacist. If you have trouble remembering to take your medicine, ask your pharmacist for some hints. If you have taken too much Mobic If you think that you have taken too much Mobic, you may need urgent medical attention. You should immediately: - phone the Poisons Information Centre (by calling 13 11 26), or - contact your doctor, or - go to the Emergency Department at your nearest hospital. You should do this even if there are no signs of discomfort or poisoning. The symptoms of an overdose may include: - nausea and/or vomiting - headache - drowsiness and/or dizziness - blurred vision - fits or seizures - fainting, feeling weak, light-headed, tired, confused and having blurred vision (signs of low blood pressure) - difficulty in breathing - being unaware of what happens to you or around you - changes in amount of urine, fluid retention, confusion, and/or nausea. 5. What should I know while taking Mobic? Things you should do If you are going to have surgery, tell the nurse, surgeon, or anaesthetist that you are taking Mobic. Mobic can slow down blood clotting and put you at risk of bleeding. Keep your medical appointments so that your progress can be monitored. Your doctor may want to perform tests now and then to detect any side effects, such as anaemia. Tell any healthcare professionals who treat you that you are taking this medicine. Continue taking Mobic for as long as your doctor tells you. Talk to your doctor or pharmacist if you do not feel any better after several days of taking Mobic. Things you should not do Do not stop taking your medicine or lower the dosage without speaking to your doctor first. Things to be careful of Tell your doctor if you get an infection while using Mobic. Mobic may hide some of the signs of an infection, such as pain, fever, redness and swelling. You may think, mistakenly, that you have improved or that the infection is not serious. Driving or using machines Be careful before you drive or use any machines or tools until you know how Mobic affects you. Mobic may cause dizziness or blurred vision in some people. If you have any of these symptoms, do not drive, operate machinery or do anything else that could be dangerous. Looking after your medicine Store Mobic in a cool dry place where the temperature stays below 25°C. Store Mobic away from moisture, heat or sunlight; for example, do not store it: - in the bathroom or near a sink, or - in the car or on window sills. Keep it where young children cannot reach it. A locked cupboard at least one-and-a-half metres above the ground is a good place to store medicines. Getting rid of any unwanted medicine Return Mobic to your pharmacist for safe disposal if: - your doctor tells you to stop taking it or - the pack has expired or - the packaging is torn/shows signs of tampering. 6. Are there any side effects? All medicines can have side effects. If you do experience any side effects, most of them are minor and temporary. However, some side effects may need medical attention. See the information below and, if you need to, ask your doctor or pharmacist if you have any further questions about side effects. Less serious side effects Less serious side effects \| What to do \| General problems: Gut and digestion: Nervous system: Muscle and bone: Speak to your doctor if you have any of these less serious side effects and they worry you. \| Serious side effects Serious side effects \| What to do \| Gut and bowel: Kidney and bladder: Severe allergic reaction: Severe skin and soft tissue reactions: Call your doctor straight away, or go straight to the Emergency Department at your nearest hospital if you notice any of these serious side effects. \| Very serious side effects Very serious side effects \| What to do \| Signs of a stroke Call an ambulance (dial 000) at once if you experience these side effects. \| Tell your doctor or pharmacist if you notice anything else that may be making you feel unwell. Other side effects not listed here may occur in some people. Reporting side effects After you have received medical advice for any side effects experienced, you can report side effects to the Therapeutic Goods Administration online at www.tga.gov.au/reporting-problems. By reporting side effects, you can help provide more information on the safety of this medicine. Always make sure you speak to your doctor or pharmacist before you decide to stop taking any of your medicines. 7. Product details This medicine is only available with a doctor's prescription. What Mobic tablets contain Active (main) ingredient \| meloxicam \| Other (inactive) ingredients \| Potential allergen \| lactose (as monohydrate) \| What Mobic capsules contain Active (main) ingredient \| meloxicam \| Other (inactive) ingredients \| Potential allergen \| lactose (as monohydrate) \| Do not take this medicine if you are allergic to any of these ingredients. Mobic does not contain gluten. What Mobic looks like 7.5 mg tablet Pastel yellow round tablet, marked 59D on one side with break bar, and the Boehringer Ingelheim company logo on the reverse side (Aust R 77694). 7.5 mg capsule Opaque pale green hard gelatin capsule containing a fine yellow powder (Aust R 77698). 15 mg tablet Pastel yellow round tablet, marked 77C on one side with break bar, and Boehringer Ingelheim company logo on the other (Aust R 77695). 15 mg capsule Opaque hard gelatin capsule, with a pale yellow body and pale green cap, containing a fine yellow powder (Aust R 77699). Mobic tablets and capsules are packed in blister cartons containing 30, 10, 20, 60* (tablets only), and 100* tablets or capsules. *Some pack sizes are not available in Australia. Who distributes Mobic Boehringer Ingelheim Pty Limited 78 Waterloo Road North Ryde NSW 2113 Website: www.boehringer-ingelheim.com.au ®Registered trademark © Copyright 2023 This leaflet was prepared in November 2023. Published by MIMS January 2024
Sauna & Steam Room: Which Comes First? Learn the Protocol The debate between sauna and steam room usage has been ongoing for years, with wellness enthusiasts and health experts alike weighing in on the benefits and protocols of each. Both offer a multitude of health benefits, but the order in which you use them can significantly impact your overall experience and the benefits you reap. This article aims to shed light on this topic, providing you with a comprehensive guide on the correct protocol when using a sauna and steam room. The Science Behind Sauna and Steam Room Before diving into the protocol, it's crucial to understand the science behind these two wellness practices. Saunas and steam rooms operate on the principle of inducing hyperthermia, a state where the body's temperature is intentionally raised, prompting a series of physiological responses. Research has shown that these responses can offer a range of health benefits, from improved cardiovascular health to enhanced mood and mental wellbeing. However, the way these benefits are achieved varies between a sauna and a steam room. The Sauna Experience Saunas are typically dry heat environments, with humidity levels ranging from 5% to 30%, and temperatures soaring between 180°F and 195°F. The high temperature in a sauna triggers a process called thermoregulation, where the body works to cool itself down. This process leads to increased heart rate and perspiration, which can help detoxify the body, improve circulation, and promote relaxation. Studies have found that regular sauna use can lower the risk of cardiovascular diseases, improve skin health, and even boost cognitive function. However, it's important to note that individual responses can vary, and it's always advisable to consult with your doctor before starting any new wellness regimen. The Steam Room Experience Steam rooms, on the other hand, operate at lower temperatures, typically around 110°F to 120°F, but with a humidity level close to 100%. This moist heat environment can open up the pores, cleanse the skin, and help relieve congestion. The high humidity can also be beneficial for those with respiratory issues or dry skin. Research indicates that steam room usage can aid in muscle recovery, improve joint mobility, and even enhance mood and sleep quality. As with saunas, individual responses may vary, and it's recommended to seek medical advice before incorporating steam room sessions into your wellness routine. Which Comes First: Sauna or Steam Room? Now that we've explored the science behind saunas and steam rooms, let's delve into the main question: which should you use first? The answer largely depends on your personal preference and wellness goals. Some experts suggest starting with the sauna to induce a deep sweat and kickstart the detoxification process. Following this with a steam room session can then help to hydrate the skin and relax the muscles. However, others argue that beginning with the steam room can open up the pores and prepare the body for the more intense heat of the sauna. Starting with the Sauna Starting with the sauna can have several benefits. The intense dry heat can stimulate a deep sweat, helping to flush out toxins and cleanse the skin. This can be particularly beneficial for those looking to improve skin health or detoxify the body. Following the sauna with a steam room session can then help to hydrate the skin and soothe the muscles. The moist heat can also aid in clearing the respiratory system, making this a good option for those with respiratory conditions or those looking to enhance lung function. Starting with the Steam Room On the other hand, starting with the steam room can help to prepare the body for the sauna. The moist heat can open up the pores and loosen the muscles, making it easier for the body to sweat and respond to the sauna's higher temperatures. Following the steam room with a sauna session can then help to further stimulate sweat production, enhancing the detoxification process. This can be beneficial for those looking to boost their cardiovascular health or improve overall wellbeing. Personalizing Your Sauna and Steam Room Experience While the order of sauna and steam room usage can impact your experience, it's important to remember that everyone is different. What works for one person may not work for another, and it's crucial to listen to your body and adjust your routine accordingly. Here are a few tips to help you personalize your sauna and steam room experience: - Start slow: If you're new to saunas and steam rooms, start with shorter sessions and gradually increase the duration as your body adapts. - Stay hydrated: Both saunas and steam rooms can lead to significant fluid loss through sweat, so it's important to drink plenty of water before, during, and after your sessions. - Take breaks: If you're using both the sauna and steam room in one session, consider taking a cool shower or a short break in between to allow your body to cool down. - Listen to your body: If you feel dizzy, nauseous, or uncomfortable at any point, it's important to leave the sauna or steam room immediately. Remember, it's always advisable to consult with your doctor before starting any new wellness regimen, especially if you have any underlying health conditions or are pregnant. In conclusion, both saunas and steam rooms offer a multitude of health benefits, and the order in which you use them can be tailored to your personal preference and wellness goals. Whether you start with the sauna or the steam room, the key is to listen to your body, stay hydrated, and enjoy the experience. So, are you ready to embark on your sauna and steam room journey? Remember, wellness is a journey, not a destination, and every step you take towards improving your health is a step in the right direction. Extend Your Healthiest Years with SISU As a longevity enthusiast, you understand the importance of enhancing your vitality and extending your healthiest years. With SISU, you can combat the external risks of chronic disorders, conquer the internal fears of losing independence, and embrace the philosophical challenge of quality versus quantity of life. Don't let the aging process be the villain in your story. Take control with three simple steps: visit the SISU sauna official website, select the model that resonates with your wellness goals, and place your order. Experience the positive outcomes of a lowered risk of chronic diseases, improved overall vitality, and increased longevity. Ready to transform your daily ritual and safeguard your well-being? Shop saunas now and take a step towards a longer, healthier life.
- Award ID(s): - 2054715 - 10362797 - Date Published: - Journal Name: - IEEE Transactions on Automation Science and Engineering - 1545-5955 - Page Range / eLocation ID: - 1 to 12 - Format(s): - Medium: X - Sponsoring Org: - National Science Foundation More Like this A hybrid filtered basis function (FBF) approach is proposed in this paper for feedforward tracking control of linear systems with unmodeled nonlinear dynamics. Unlike most available tracking control techniques, the FBF approach is very versatile; it is applicable to any type of linear system, regardless of its underlying dynamics. The FBF approach expresses the control input to a system as a linear combination of basis functions with unknown coefficients. The basis functions are forward filtered through a linear model of the system's dynamics and the unknown coefficients are selected such that tracking error is minimized. The linear models used in existing implementations of the FBF approach are typically physics-based representations of the linear dynamics of a system. The proposed hybrid FBF approach expands the application of the FBF approach to systems with unmodeled nonlinearities by learning from data. A hybrid model is formulated by combining a physics-based model of the system's linear dynamics with a data-driven linear model that approximates the unmodeled nonlinear dynamics. The hybrid model is used online in receding horizon to compute optimal control commands that minimize tracking errors. The proposed hybrid FBF approach is shown in simulations on a model of a vibration-prone 3D printer to improve tracking accuracy by up to 65.4%, compared to an existing FBF approach that does not incorporate data.more » « less Abstract Automated optical inspection (AOI) is increasingly advocated for in situ quality monitoring of additive manufacturing (AM) processes. The availability of layerwise imaging data improves the information visibility during fabrication processes and is thus conducive to performing online certification. However, few, if any, have investigated the high-speed contact image sensors (CIS) (i.e., originally developed for document scanners and multifunction printers) for AM quality monitoring. In addition, layerwise images show complex patterns and often contain hidden information that cannot be revealed in a single scale. A new and alternative approach will be to analyze these intrinsic patterns with multiscale lenses. Therefore, the objective of this article is to design and develop an AOI system with contact image sensors for multiresolution quality inspection of layerwise builds in additive manufacturing. First, we retrofit the AOI system with contact image sensors in industrially relevant 95 mm/s scanning speed to a laser-powder-bed-fusion (LPBF) machines. Then, we design the experiments to fabricate nine parts under a variety of factor levels (e.g., gas flow blockage, re-coater damage, laser power changes). In each layer, the AOI system collects imaging data of both recoating powder beds before the laser fusion and surface finishes after the laser fusion. Second, layerwise images are pre-preprocessed for alignment, registration, and identification of regions of interests (ROIs) of these nine parts. Then, we leverage the wavelet transformation to analyze ROI images in multiple scales and further extract salient features that are sensitive to process variations, instead of extraneous noises. Third, we perform the paired comparison analysis to investigate how different levels of factors influence the distribution of wavelet features. Finally, these features are shown to be effective in predicting the extent of defects in the computed tomography (CT) data of layerwise AM builds. The proposed framework of multiresolution quality inspection is evaluated and validated using real-world AM imaging data. Experimental results demonstrated the effectiveness of the proposed AOI system with contact image sensors for online quality inspection of layerwise builds in AM processes. null (Ed.)Abstract Aerosol jet printing (AJP) is a direct-write additive manufacturing technique, which has emerged as a high-resolution method for the fabrication of a broad spectrum of electronic devices. Despite the advantages and critical applications of AJP in the printed-electronics industry, AJP process is intrinsically unstable, complex, and prone to unexpected gradual drifts, which adversely affect the morphology and consequently the functional performance of a printed electronic device. Therefore, in situ process monitoring and control in AJP is an inevitable need. In this respect, in addition to experimental characterization of the AJP process, physical models would be required to explain the underlying aerodynamic phenomena in AJP. The goal of this research work is to establish a physics-based computational platform for prediction of aerosol flow regimes and ultimately, physics-driven control of the AJP process. In pursuit of this goal, the objective is to forward a three-dimensional (3D) compressible, turbulent, multiphase computational fluid dynamics (CFD) model to investigate the aerodynamics behind: (i) aerosol generation, (ii) aerosol transport, and (iii) aerosol deposition on a moving free surface in the AJP process. The complex geometries of the deposition head as well as the pneumatic atomizer were modeled in the ansys-fluent environment, based on patented designs in addition to accurate measurements, obtained from 3D X-ray micro-computed tomography (μ-CT) imaging. The entire volume of the constructed geometries was subsequently meshed using a mixture of smooth and soft quadrilateral elements, with consideration of layers of inflation to obtain an accurate solution near the walls. A combined approach, based on the density-based and pressure-based Navier–Stokes formation, was adopted to obtain steady-state solutions and to bring the conservation imbalances below a specified linearization tolerance (i.e., 10−6). Turbulence was modeled using the realizable k-ε viscous model with scalable wall functions. A coupled two-phase flow model was, in addition, set up to track a large number of injected particles. The boundary conditions of the CFD model were defined based on experimental sensor data, recorded from the AJP control system. The accuracy of the model was validated using a factorial experiment, composed of AJ-deposition of a silver nanoparticle ink on a polyimide substrate. The outcomes of this study pave the way for the implementation of physics-driven in situ monitoring and control of AJP.more » « less M. Wiercigroch, editof-in-chief (Ed.)Additive manufacturing (AM) is known to generate large magnitudes of residual stresses (RS) within builds due to steep and localized thermal gradients. In the current state of commercial AM technology, manufacturers generally perform heat treatments in effort to reduce the generated RS and its detrimental effects on part distortion and in-service failure. Computational models that effectively simulate the deposition process can provide valuable insights to improve RS distributions. Accordingly, it is common to employ Computational fluid dynamics (CFD) models or finite element (FE) models. While CFD can predict geometric and thermal fluid behavior, it cannot predict the structural response (e.g., stress–strain) behavior. On the other hand, an FE model can predict mechanical behavior, but it lacks the ability to predict geometric and fluid behavior. Thus, an effectively integrated thermofluidic–thermomechanical modeling framework that exploits the benefits of both techniques while avoiding their respective limitations can offer valuable predictive capability for AM processes. In contrast to previously published efforts, the work herein describes a one-way coupled CFDFEA framework that abandons major simplifying assumptions, such as geometric steady-state conditions, the absence of material plasticity, and the lack of detailed RS evolution/accumulation during deposition, as well as insufficient validation of results. The presented framework is demonstrated for a directed energy deposition (DED) process, and experiments are performed to validate the predicted geometry and RS profile. Both single- and double-layer stainless steel 316L builds are considered. Geometric data is acquired via 3D optical surface scans and X-ray micro-computed tomography, and residual stress is measured using neutron diffraction (ND). Comparisons between the simulations and measurements reveal that the described CFD-FEA framework is effective in capturing the coupled thermomechanical and thermofluidic behaviors of the DED process. The methodology presented is extensible to other metal AM processes, including power bed fusion and wire-feed-based AM.more » « less Hardware-in-the-loop (HIL) testing is a popular control system testing method because it bridges the gap between modeling/simulation and experiments. Instead of designing a full hardware-based experiment to validate the results of a simulation, the plant hardware can be replaced with an emulator device that responds to exogenous inputs and effectively emulates the dynamic behavior of a system. This approach can be more cost-effective and modular, since the emulated plant system can be modeled in a simulation environment, implemented on a simplified piece of hardware and changed quickly without having to fabricate new parts. This paper develops the hardware and control scheme for a certain type of HIL device called a dynamic load emulator that consists of a 1-DOF linear hydraulic dynamometer equipped with in-line sensing to measure both its own position and the force exerted on it by a device-under-test. This measured force is passed to a real-time model of the emulated dynamic system. The model outputs the emulated system position, and a closed-loop controller is used to emulate this position. The emulator controller incorporates both model-based feedforward and standard feedback PI control. This paper characterizes the dynamometer-based dynamic load emulator and its controller, determining its hardware limitations and validating its capabilities when experiencing a force input from a linear spring with known parameters. Additionally, this paper demonstrates the ability of the emulator to represent the dynamics of a 1-DOF robotic joint when actuated by a pair of fluidic artificial muscles (FAMs). The primary contribution of this work is to allow for more comprehensive testing of FAM configurations, topologies, and controllers for a wide range of parameters, because the same hardware can be used to emulate multiple systems. As a result, this work will lead to more cost-effective, time-efficient, and energy-efficient designs of robotic systems and the FAMs used to actuate them.
The status of the agro-processing industry in Zimbabwe - Production Capacity: 10T-300T/D - Model Number: JX896 - Voltage: 220V/380V - Power(W): Accoding to oil press line capacity - Dimension(LWH): Accoding to oil press line capacity - Weight: Accoding to oil press line capacity - Item: Camelina sativa oil produce mill - Plant: 30-50㎡ - Worker: 1 - Power: 380V - Dimension: 195013001900 - Mechanical impurities: Less than 0.2% - Oil Purity: More than 99.8% - Manufacturing experience: 35 years - Supplier Raw material range: Mustard, sesame ,Soybean ,Rice Bran ,Peanut ,Plam Kernel ,Rapeseed For example, during the 2004/05 agricultural season, production was about In 2002, the Avondale Rotary Club of Harare, introduced 40,000 metric tonnes yet the total market demand a unique crop production and processing innovation in (including oil extraction) was in excess of 200,000 metric the Muchinjike Communal Area of Murewa District in tonnes. Practical Guide to Vegetable Oil Processing \| ScienceDirect - Production Capacity: 80-500KGs/h - Voltage: 220V/110V - Dimension(LWH): 421630cm - Weight: 100kg - Core Components: OTHER - capacity: 80-500KGs/h - Material: stainless steel - key words1: oil machine - key words2: oil pressers - key words3: oil press - key words4: seame oil - key words5: vegetable oil pressers - key words6: oil press machine - key words7: Coconut Oil Press All process equipment in oil refinery is designed to perform certain specific functions. Every piece of equipment is designed to deliver the highest quality oil under certain operating conditions and safety measures. This includes, mixing, flow control, temperature control, pressure control, time control, etc. Edible vegetable oils from oil crops: Preparation, refining - Production Capacity: 1TPD-500TPD - Model Number: 6YY-260 - Voltage: According to customer demand - Power(W): According to project - Dimension(LWH): According to project - Weight: According to customer demand - Color: Silver - Production Material: Carbon steel, stainless steel - Raw Material: Suitable for soybean, castor seed, peanut, etc. - Export markets: Europe, Southeast Asia, Africa, etc - Work principle: Mechanical principle - Warranty period: One year - English manual: Yes - Factory visiting: Yes The annual growth rate of global demand for vegetable oil was 5.14% from 2020 to 2025 [111]. Compared with animal oils, vegetable oils are more popular with consumers due to their renewable utilization, good quality, and lack of cholesterol [3]. The yield of oil crops determines the yield of vegetable oils. - Weight: 880 KG - Core Components: Motor - Oil Application: hydraulic oil press machine - Name: hydraulic hot and cold oil press machine - Material: Stainless steel - Advantage: hydraulic olive oil press - Feature: oil extraction hydraulic press - Function: hydraulic avocado oil press machine - Suitable for: hydraulic cold press oil machine - MOQ: 1set 8. Vegetable oil processing activities generate significant quantities of organic solid waste, residues and by-products, such as empty fruit bunches (EFBs) and waste palm kernels from palm oil processing or olive oil cake and pulp from olive processing. The amount of waste generated depends on the quality of Refining Vegetable Oils: Chemical and Physical Refining - Hindawi - Production Capacity: 5TPD - Voltage: 380v - Dimension(LWH): 123011201630mm - Weight: 1800 KG - Core Components: Motor, Gear, Engine - Oil Raw material: Seasame - Product name: Oli Press Machine - Function: Making Edible Oil - Name: Home Oil Pressing Machine - Application: Edible Oil Production - Advantage: Energy Saving - After Warranty Service: Technical Support Online - Keyword: Mini Oil Expeller - Feature: High Oil Yield Efficiency - Item: FOB This review presents recent technologies involved in vegetable oil refining as well as quality attributes of crude oils obtained by mechanical and solvent extraction. Usually, apart from virgin oils, crude oils cannot be consumed directly or incorporated into various food applications without technological treatments (refining). Indeed, crude oils like soybean, rapeseed, palm, corn, and Assessment of quality of edible vegetable oils accessed - Production Capacity: 1-100t/d - Model Number: AS20, OR99 - Voltage: 440V - Power(W): 15-50KW - Dimension(LWH): 1200400900mm3 - Weight: 1000kg - Moisture: 3% - deodorizaiton time: about 30min - apply: for many materials - residual oil in cake: 2% - decoloring time: 15-20min - capacity: 1-600t/d - Model: all kinds of capacity Objective Edible vegetable oils are prone to quality deterioration through oxidation and microbial degradation resulting in nutritional loss and off-flavors. Quality deterioration may contribute in the formation of oxidation products that are reactive and toxic, which ultimately pose health risks including cancer and inflammation. The objective of this study was to assess quality of both Zimbabwe Food Systems Profile - Production Capacity: 100% - Model Number: MS 6YL oil press for sunflower seeds - Voltage: 220V/380V/440V - Power(W): 5.5kw - Dimension(LWH): 170011001600mm - Weight: 30tons - Item: 6YL oil press for sunflower seeds - Raw material: Sunflower Seed - Color: Clean and Light Yellow - Application: Sunflower Oil Production Line - Advantage: High Oil Extracting Rate - Delivery time: 60 Days - Character: Energy saving , low consumption, good oil quality - Installation period: 30-45days(It according to your local workng efficiency) - Engineer Requirement: 1-2 engineers Harare. Bulawayo. 0 2 3 0 4 2 0 6 1 0 8 0 40. km. ... the production of oil crops has not increased . ... Cereals Starchy roots, pulses and tree nuts Oil crops and vegetable oils. Others. Vegetable Oil Refining \| SpringerLink - Production Capacity: 10 TONS /DAY - Voltage: 20 hp - Dimension(LWH): 2400MM695MM1979MM - Weight: 2500 KG - Warranty of core components: 5 years - Core Components: Motor, Bearing, Gearbox - Oil Extraction of Oilseeds: Sunflower ,Cotton,Groundnut,Linseed,Maize ,Palm Kernel ,Sesame,Soybean - CAPACITY: 10 Tons/Day - After Warranty Service: Spare parts In physical refining of palm oil, the CPO is degummed by mixing with 0.04–0.1% phosphoric acid (conc. 85%) for about 5–20 min. Subsequently, the degummed oils were bleached using around 1–2% of bleaching earth under vacuum at a temperature of 95–120 °C. The spent bleaching earth is then separated via filtration. Vegetable Oil: Nutritional and Industrial Perspective - PMC - Production Capacity: 1-50 Kg / H - Voltage: 220 - 240 Volt - Dimension(LWH): 840240540 mm - Weight: 65 KG - Warranty of core components: 2 years - Core Components: Motor, PLC, Bearing, Gearbox - Oil Thermostat: Temperature Control 600 Watt - Gear Box: Helical Shaft Gear - Energy Consumption: 400- 1500 Watt/Hour - Motor Power: 1.5 kW - Raw material: STEEL - Function: Making Edible Oil - Advantage: Energy Saving Low Residual - Capacity: 500 kg/h A ratio of 2:1 to 6:1 of omega-6 and omega-3 fatty acids is considered good and recommended, possibly improving cardiovascular health, asthma etc [ 25, 26 ]. This can be achieved by dietary intake of oils which are rich in α-linolenic acid such as flaxseed, walnut or monounsaturated rich vegetable oils such as olive oil. History of Human Powered Oil Expeller: A Literature Review - Production Capacity: High - Weight: 21 KG - Key Selling Points: High Productivity - Marketing Machinery Test Report: Provided - Video outgoing-inspection: Not Available - Warranty of core components: 1 Year - Core Components: Gearbox - Oil Max Capacity: 4000 kg/h - After sales Service Provided: Engineers available to service machinery overseas - Name: Goyum 1500 - Function: Press Oil Seeds - Material: Stainless Steel SS304/316 - Warranty terms: Long Term Technical Support - Advantage: German Technology - Warranty Service: Video technical support - Complete Warranty Service: Spare parts - Field Warranty Service: Field maintenance and repair service - Engineer On Site: Service 4.1 Description of the Human Powered Oil Expeller. Any manufacturing process requiring more than 0.10 hp and which can be operated intermittently without affecting end product can also be human powered. On average, the power produced by a man is approximately 75 W (0.10 HP) if he works continuously [ 8 ].
Data warehousing is an essential topic in both business and data science. If you're new to the field, you may be wondering what a data warehouse is, why we need it, and how it works. Don't worry, I'll provide answers to all these questions. Let's start first with the definition of a Data Warehouse. A Data Warehouse is a centralized repository of structured data that is specifically designed to support Business Intelligence (BI). BI is used to create and view the business analytics of an organization. A data warehouse is a repository where organizations store their crucial data assets, such as customer data, sales data, employee data, and more. It serves as the primary source of data truth for an organization, providing a centralized location for all the data. Typically, data warehouses are created and used for data reporting and analysis purposes. Defining Features There are several defining features of a data warehouse. It is subject-oriented, integrated, time-variant, non-volatile, and summarized. Let's quickly go through this one-by-one: - Subject-oriented means that the information in the data warehouse revolves around some subject therefore it does not contain all company data but only the subject matters of interest for instance data on your competitors need not appear in a data warehouse however your own sales data will most certainly be there. - integrated means each database or each team or even each person has their own preferences when it comes to naming conventions. That is why common standards are developed to make sure that the data warehouse picks the best quality data from everywhere. This relates to master data governance. - Time variant relates to the fact that a data warehouse contains historical data too. We mainly use a data warehouse for analysis and reporting which implies we need to know what happened five or ten years ago. - Non-volatile implies that the data only flows in the data warehouse as is once there it cannot be changed or deleted. The data is often used for data analytics, which involves aggregating or segmenting it in some way to facilitate analysis and reporting for an organization. This is a crucial aspect of business intelligence initiatives, as it helps organizations make informed decisions and improve their operations. In light of the mentioned facts, we can say that a data warehouse is a structured, non-volatile single source of truth for a company.
Assessing personnel and their behaviours as data points allows employers to create systems that can cater to the diverse needs of employees. A systematic approach enables organisations to identify work patterns, preferences, and challenges. This carries the aim of fostering a more adaptable and efficient work environment. As to this might be approached collaboration plays an important role in developing systems, explains Mark Hesketh, MD at Codiance. Heath tells Digital Journal : "Involving end-users in the development process of a new system is crucial at every step. This approach not only guarantees that the solution is perfectly tailored to meet its intended purpose in the real world, but it also instils a profound sense of ownership among those involved. Such ownership is not just beneficial; it's decisive. It can be the difference between the success and failure of any new system." Heath goes on to identify the primary behaviours that employers need to be aware of. Adapting Systems to People; Embracing Informal Solutions Heath indicates that systems ought to be designed around the behaviours of those who use them, not the reverse. Frequently, individuals devise their own 'workarounds' or 'hacks' to navigate through tasks or bypass system limitations – innovations that often go undocumented. Heath states: "It is only through observing individuals in action, through shadowing, that these ingenious solutions come to light. Acknowledging and understanding these informal practices are key to tailoring systems that truly resonate with and support the needs of their users." Collaborative Interactions Traditional process and system maps often illustrate the transfer of roles or responsibilities but fall short in depicting the dynamic interactions and collaboration between individuals and teams. According to Heath: "They overlook the essence of communication: How is information exchanged? Is information exchanged frequently and in different ways? Do inquiries deepen, and if so, how extensively? A profound understanding of these collaborative behaviours is crucial. It's only with this insight that one can truly optimise both systems and processes, paving the way for more efficient and effective teamwork." Embracing Unofficial Innovations Heath reveals: "We often encounter people who have crafted their own solutions, such as custom spreadsheets or specific websites, that serve as indispensable time-saving tools. These innovations typically emerge in response to a lack of suitable alternatives, the inefficiency of existing tools, or the absence of crucial features. Often, these creative shortcuts remain under the radar, concealed from the broader organization due to concerns over official approval. Diligent shadowing is crucial in bringing these invaluable yet unofficial practices to light, revealing a wealth of untapped efficiency and ingenuity within our processes." Optimising Workload Management through Shadowing Shadowing provides a transparent view into how individuals handle tasks throughout various stages of a process. This observation often uncovers both highly effective and markedly less successful task management practices. With this, Heath recommends: "It's essential to document these findings in any process map, as they offer a treasure trove of insights. By identifying the most efficient techniques, we can develop them into scalable tools that enhance productivity. Simultaneously, we can offer targeted support to those grappling with workload management, leveraging automation as a lifeline to streamline their processes and improve efficiency." Valuing Human Experience At times, automating certain tasks may seem to yield a modest return on investment (ROI) when compared directly to their manual counterparts, leading to their potential deprioritisation. Here, Heath finds "It's crucial to recognise that many tasks deemed low value can be stressful, monotonous, exhausting, or simply dull. While automating these tasks might not deliver the highest financial returns, the impact on enhancing an employee's daily experience is immeasurable. Removing such burdens can significantly boost job satisfaction, morale, and engagement, fostering a vibrant, more energised workforce. This approach underscores the importance of prioritising human and cognitive factors in decision-making, recognising that the true value of automation extends far beyond mere numbers." In closing out this assessment, Heath says: "Only by shadowing people and their behaviours do you understand how a process is executed."
What is OBD-II Code P02C1 – Cylinder 10 – Injector Leaking Modern vehicles are equipped with On-Board Diagnostics (OBD) systems that monitor the performance and condition of various components in the car. The OBD system alerts the driver of any issues by illuminating the check engine light on the dashboard. When the check engine light comes on, it means that the OBD system has detected a fault in the engine system or an error in one of the many sensors. The fault code can be retrieved using a code scanner or reader, providing a diagnostic trouble code (DTC) that gives an indication of the problem affecting your vehicle. One of the DTCs commonly displayed when using an OBD scanner is code P02C1, which pertains to Cylinder 10 – Injector Leaking. This code is most commonly found in cars with V-shaped or straight engines that have ten cylinders, such as engines in Dodge Viper, Audi S6 or BMW M5. What does this code mean? If your OBD reader displays code P02C1, it means that the fuel injector in cylinder 10 (the 10th cylinder in the engine block) is leaking or malfunctioning. Fuel injectors are responsible for delivering the right amount of fuel into the combustion chamber at the correct time during the engine cycle. When fuel injectors malfunction, they can either deliver too much or too little fuel, causing reduced performance or even engine damage. A leaking fuel injector can lead to poor fuel economy, reduced engine performance, and increased emissions. If ignored, this problem can cause extensive damage to your engine and potentially lead to engine failure. What causes a Cylinder 10 – Injector Leaking? There are several factors that can cause fuel injector issues, such as clogs in the fuel lines, engine heat, rust, and corrosion. In some cases, fuel injectors can become damaged due to regular wear and tear, and in other cases, they can become clogged because of poor fuel quality. Additionally, engine heat can cause fuel injectors to fail, as the heat generated can cause the internal components of the injector to warp, reducing their ability to function properly. What are the symptoms of a Cylinder 10 – Injector Leaking? When a fuel injector is leaking or malfunctioning, the engine may not run as efficiently as it should. Some of the symptoms of a Cylinder 10 – Injector Leaking may include: 1. Reduced engine performance and power 2. Rough idling or stalling upon acceleration 3. Misfires or backfiring in the engine 4. Erratic engine behavior or idling 5. The vehicle failing to start How can I fix a Cylinder 10 – Injector Leaking? When it comes to dealing with a Cylinder 10 – Injector Leaking, the first step is to determine the root cause. If the injector is clogged with debris or rust, it can often be cleaned using a fuel system cleaner. A fuel injector replacement may be required if the injector is severely damaged, clogged, or leaking. A trained mechanic can also check the fuel lines for any leaks, rust, or other damage that may be affecting the flow of fuel to the injector. Routine carburetor cleaning, fuel system flush, and fuel filter replacement can go a long way in preventing fuel injector issues. How do I prevent a Cylinder 10 – Injector Leaking? There are several steps you can take to reduce the risk of a Cylinder 10 – Injector Leaking. It is important to regularly service your vehicle and replace any damaged or worn parts before they cause further issues. Use high-quality fuel that doesn't contain impurities or contaminants that can affect the performance of your fuel injector. Additionally, consider using a fuel system cleaner or fuel injector cleaner every few months to keep your fuel injection system running smoothly. FAQs About OBD-II Code P02C1 – Cylinder 10 – Injector Leaking Q. Is it safe to drive with a Cylinder 10 – Injector Leaking code? A. No, it is not safe to drive with this code as it can cause significant engine damage. Q. How long does it take to fix a Cylinder 10 – Injector Leaking code? A. The time it takes to fix this code depends on the extent of the damage and the type of repair required. A fuel system cleaning may take less than an hour, while a fuel injector replacement can take several hours. Q. Can I fix a leaking fuel injector at home? A. No, this is a complicated repair that should only be performed by a qualified mechanic with experience in fuel injection systems. Q. How much does it cost to repair a Cylinder 10 – Injector Leaking code? A. The cost of repairing this code will vary depending on the extent of the problem and the type of repair required. A fuel system cleaner may cost as little as $10, while a fuel injector replacement can cost upwards of $400. Q. What happens if I don't fix a Cylinder 10 – Injector Leaking code? A. Ignoring a Cylinder 10 – Injector Leaking code can lead to further engine damage and increased costs associated with repair bills. Eventually, the engine may fail outright, requiring a complete overhaul or replacement. In conclusion, if your OBD scanner displays code P02C1 – Cylinder 10 – Injector Leaking – it is crucial that you address this issue as soon as possible. This code means that your fuel injector for cylinder 10 is leaking or malfunctioning, and ignoring this issue can lead to significant and expensive engine damage. It is always recommended to seek the assistance of a mechanic who can use their expertise to diagnose the issue appropriately and provide the correct repair solution to address the problem.
Private Mentoring Native-level Language Arts & Literary Studies in English Private Mentoring for Bilingual and Returnee Children Bilingual children growing up in Japan who don't attend an international school often speak English well because of support at home, but some also face challenges developing higher level reading and writing skills necessary for succeeding at international schools or overseas universities or for gaining meaningful employment in organizations where the functional language is English. Even for students already attending a school in English, the attention, freedom and guidance they receive in a private or small-group, student-centered class led by an expert engenders significant development—especially when compared with large lecture-based, teacher-centered formats. Beyond assistance with knowledge and skills, children need life guidance to thrive in adulthood. Private Mentoring in English Full Educational Support Our experience in Japan as a language school, with the constraints of young learners to adults having only an hour a week to acquire English and our commitment to empowering them, has obliged us to develop programs of highly efficient learning. Our child-centered approach to teaching enables children to find inspiration and acquire skills and knowhow from the basics on through professional levels of language use. With 20 years of working with children and holding a Masters in Literary Studies in English, our school's owner will create a personalized journey of learning for your child. As we explore, we foster curiosity and help young people nurture a general love of learning as well as lifelong positive attitudes towards challenges and the abilities to engage them. Beyond tutoring or test prep, we provide expert support for long-term and holistic personal development. "We inspire curiosity in students, help them find happiness in growing and learning, discover new worlds, and enable them to connect positively to the global community—all in a manner conducive to becoming lifelong active learners." Tristan Scholze, School Founder and Owner Preschool though Elementary School Children Children at this stage develop the ability to understand and use English effectively through discovery in an inspirational environment. Understanding that children often see the classroom as a place they "have to" be, the key here is helping children find joy in learning. We play games, sing songs, and read stories not simply because they are fun. These activities are carefully chosen and used to practice language ability. Fun is not separated from learning—the children want to learn through this kind of fun. The Joy of English and Communication How we learn Elementary English - In a child-centered environment, students find things out for themselves with guidance from the teacher, feeling the joy of learning - The children learn through a series of puzzles, games, songs, stories, and interesting projects - Children develop their capacity for self-expression by picking up new language patterns through natural interaction, games, and projects they find interesting - From decoding basic phonics to advanced pattern recognition of English sounds in written form and into reading and writing dialogs, paragraphs, and stories - A wealth of carefully selected materials fitting for all levels of language development - Professional guidance makes the wonderful world of books come alive for children - Children learn from interacting with peers and adults in English during events - Leadership roles assisting teachers in guiding younger and less experienced learners Free Consultation Contact us for a free consultation about your long-term hopes for your child and how we can help fulfill them! We'll make a recommended plan of study personalized to your family's situation. Junior, Senior High School and University Students The study of literature provides insight for one's decision of how to live their life. As we explore diverse stories, poetry, and other literary arts with corresponding nonfiction, we sharpen our minds while developing the ability to empathize with others. We learn from the experiences of others and decide what kind of a person we want to be. Furthermore, as we reflect and put our thoughts into words, we refine our ability to communicate, enriching our vocabulary, organizing our thoughts, and increasing our powers of persuasion. Students at this level also have access to the Rainbow Library, school events, and our international community, with opportunities for internships and volunteer work in diverse fields. Literary Study and Language Arts How We Learn In a child-centered environment, students find things out for themselves with guidance from the teacher, feeling the joy of learning. Read and discuss inspiring fiction and nonfiction A skilled teacher enables learners to connect with books and discover not only why they are great, but how they are work their magic. Composition and project work consolidates learning Students practice expressing their ideas in written and spoken English, informal and formal, composing essays, creative works, letters, messages, journals, notetaking, and presentations Introduction to meta-learning What We Learn - Improve vocabulary and grammar - Beyond memorization, we learn strategies to acquire new words and sentence patterns efficiently for long-term proficiency in communication - Summarize, analyze, and critique texts and their ideas - Understand and apply symbolism, mood, tone, and point of view to critiques of literature - Experience rich language - Connect to history - Explore cultures - Participate in critical analysis - Develop imagination and creativity - Improve reasoning ability - Discover a new self "In all the classes I've been doing with Tristan we've analysed 4 different books and written multiple essays. He is a great teacher that helped us learn so much literature! The classes with Tristan were very fun and helped advance my English to a high level. Great classes!" Clement, junior high school student Students attending public Japanese schools without native-level Japanese skills can benefit far more from their experience in Japan with our support system. Although basic conversational skills in Japanese may be picked up relatively quickly, the complex writing system makes it difficult for children to fully participate in subjects like Japanese, math, history, science, and social studies. Rainbow Bridges arranges an after-school program with a team of English and Japanese teachers as well as bilingual tutors who can help the children better understand what they are studying in school and keep up in these subjects at their grade level. Teachers and tutors can travel to a location convenient for your family, including your home. Free Consultation Contact us for a free consultation and discover what we can do for your family: Learn more about our programs and how they can benefit your children. Together, we'll make a recommended plan of study personalized to your family's situation.
Pineapple native. 3. Maui Island Breeze Cocktail. If you're looking for something more on the bittersweet side, try the Maui island breeze. It, too, contains vodka and pineapple juice. However, instead of orange juice and grenadine – like the Hawaiian martini – this drink contains a bright splash of cranberry juice. depend on a number of conditions such as pineapple native microorganism and sugar content. The aim of this project is to standardize fermentation by controlling the starting cultures, suspended ...November is Native American Heritage Month — a time to elevate Indigenous voices and celebrate the diverse cultural traditions and histories of Native Americans and Alaska Natives. To mark this important observance, we're sharing a collecti...The pineapple plant (Ananas comosus) is a tropical fruit that is native to South America. It originally came from the area between southern Brazil and Paraguay. Pineapples spread throughout South America, the Caribbean, Central America and Mexico, where they were cultivated by the Maya and the Aztecs.Apr 8, 2009 · I remember the pineapples in the States, most of which are Hawaiian pineapples. They had a certain sour taste to them, or a tartness. This is because they are picked green so that they don't spoil in transport to the stores on the mainland of the USA. The pineapple here simply has no tartness, it is pure sweetness. Pineapple (Ananas comosus Merr.), native to South America, is a highly marketable tropical fruit in the Bromeliaceae family consisting of numerous fruitlets fused on a same inflorescence. The communication of fruitlet connection through the fruit core ( Figure 10.1 ) is crucial for fruit development and quality. If you are planting more than one quince tree, space them 10 to 15 feet apart to let them grow and breathe. Dig a hole twice as wide as the tree's roots spread out. Make sure the tree is set in the hole at the same depth as it was in its nursery container. Spread the roots out when placing the seedling in the hole. The pineapple is indigenous to South America, where it has been cultivated for many centuries. The introduction of the pineapple to Europe in the 17th century made it a significant cultural icon of luxury. Since the 1820s, pineapple has been commercially grown in greenhouses and many tropical plantations.Pineapple (Ananas comosus Merr.), native to South America, is a highly marketable tropical fruit in the Bromeliaceae family consisting of numerous fruitlets fused on a same inflorescence. The communication of fruitlet connection through the fruit core ( Figure 10.1 ) is crucial for fruit development and quality.The Pineapple producing countries are Philippines, Thailand, China, Brazil, India, Mexico and South Africa. India is the fourth largest producer of pineapple (Anonymous, 2003) [6]. Pineapple is largely consumed around the world as canned pineapple slices, chunk and dice, pineapple juice, fruit salads, sugar syrup, alcohol, citric acid, pineappleNot Native to Hawaii. Botanists and historians say the pineapple (or Ananas comosus, if you want to get scientific) originated thousands of miles away in South America, most likely near present-day Brazil. It was a mainstay in South America long before the Europeans arrived. Pineapple, a South American native and a cherished part of Hawaiian folk medicine, is one of the richest sources in the world of the enzyme bromelain. It is composed of several endopeptidases and compounds like phosphatase, glucosidase, peroxidase, cellulase, escharase and protease inhibitors. Pineapple sage is native to Mexico and Guatemala, growing wild along the edges of pine and oak forests in the Sierra Madre del Sur mountains. It was introduced to the United States as an ornamental plant during the late 19th century. Pineapple sage is a tender plant that thrives in warmer climates as it will not survive a freeze. Product details. 土凤梨酥/ネイティブパイナップルケーキ/Native Pineapple Cake /네이티브파인애플케이크. Natural sweet, full of flavor and aroma and the ...June 27, 2018 \| Misc While it's not known when pineapple first started growing in Hawaii, we do know it was prior to when the first American missionaries arrived in 1820. Most believe pineapple showed up from South America around 1770.PINEAPPLE. 1. INTRODUCTION. Pineapple (Ananas comosus) is one of the commercially important fruit crops of India. Total annual world production is estimated ...Pineapples are indigenous to South America, and according to the first documented pineapple arrivals to Hawaii, the fruit came to the islands in 1792 aboard the ship "Mondragon.". The fruit's arrival was by no means accidental, though. The ship's captain, Don Francisco de Paulo Marin, was under orders from King Kamehameha I to harvest ... It is cultivated throughout the world now, but it originated in South America. When Columbus and other Europeans arrived in the New World, they found pineapple growing all over the Caribbean, but modern botanists believe the true origin of pineapple fruit is in South America's Parana Paraguay River basin. Fun Facts about Pineapple Plant History Apr 19, 2018 · Top Pineapple Producing Countries A pineapple field in Costa Rica. Pineapple is a native fruit of South America. The Spanish and Portuguese explorers distributed the pineapple plant to the rest of the world. Hawaii was the first place to commercially cultivate the fruit. Today, it is globally produced at around 24.8 million tons annually. Common Name: Pineapple Bush Scientific Name: Dasypogon bromeliifolius Life Cycle: Perennial Remarks: Native to Western Australia. Tufted perennial 30 cm to ...Pineapple is native to tropical and subtropical America but is widely cultivated in warm regions around the world. The fruit is eaten fresh where available and in canned form.Pineapple (Ananas comosus), a tropical plant with edible multiple fruit consisting of coalesced berries, named for resemblance to the pine cone, ... (Native Philippine Red). Queen variety is grown in some places for its fresh fruit. The small and very spiny plant gives a small fruit (0.5 to 1 kg), with a full yellow shell and small prominent ...The pineapple palm, or Ananas comosus, is a member of the Bromeliaceae family, which contains approximately 3,210 species of flowering plants native to tropical America. However, unlike most of its relatives, the pineapple grows in land, while most bromeliads are either saxicolous, growing on rocks; or epiphytic, growing on other plants and trees.Pineapple is native to tropical and subtropical America but is widely cultivated in warm regions around the world. The fruit is eaten fresh where available and in canned form. Pineapple is the common name for low-growing, fruit-bearing, tropical plants of the species Ananas comosus (also known as A. sativus) in the bromeliad family (Bromeliaceae). It is also the name for the large, edible, multiple fruit of this plant. A. comosus has long, swordlike leaves and the fleshy fruit has a tuft of leaves on one end as well. Where are pineapples originally from? Pineapple is believed to have originated in the Brazilian rainforests. Pineapples were harvested by the native tribes and spread throughout South and Central America. When Christopher Columbus landed in the new world in 1493, the Spaniards named the fruit "piña" due to its resemblance to a pinecone.little by the native American tribes in their reli- gious ceremonies, for ... pineapple plants as a part of the native vegetation. From these paintings we ...Phoenix canariensis, the Canary Island date palm or pineapple palm, is a species of flowering plant in the palm family Arecaceae, native to the Canary Islands off the coast of Northwestern Africa. It is a relative of Phoenix dactylifera, the true date palm. It is the natural symbol of the Canary Islands, together with the canary Serinus canaria ...PINEAPPLE. 1. INTRODUCTION. Pineapple (Ananas comosus) is one of the commercially important fruit crops of India. Total annual world production is estimated ...Bananas are native to Southeast Asia, Northern Australia and tropical regions of India. Today, several types of bananas are grown in other parts of the world as well, including in Europe, where the climatic conditions are appropriate. A banana tree produces about 20 kilograms of fruits per each blossom in a short period (approximately …Pineapple guava grows easily in average garden soil. For the best results, plant your feijoa in moderately rich, well-drained soil with a pH between 5.5 and 7.0. The one thing they will not tolerate is constantly soggy soil, so be sure to plant them in a location where drainage is not an issue.0.89 g of protein. As a percentage of your daily requirements, the same amount of fresh pineapple chunks provides: 131 percent of vitamin C. 2 percent of …Botanically, guava is a berry of the family myrtle and genus Psidium. The fruit, 5–10 cm across and 50–200 g in weight, is round, ovoid or pear shaped depending on the variety. The surface of the fruit known as exocarp is thin, light yellow in colour with a … The fantastic thing about Texas sage is the bang-for-the buck factor. It gives you so much aesthetic appeal and benefits the ecosystem with so little care and effort that it is easy to include in any southern landscape design.This perennial is great in a pollinator garden.Texas sage will supply you with those dashes of reds you need to offset all that … Muscle soreness. Eye floaters. Gout. Lowering cancer risk. Speeding up recovery time after surgery or intense exercise. Vitamins and minerals. Pineapple is high in vitamin C, which helps your ... Native forest 100% organic crushed pineapple adds a tropical touch to your side dishes, desserts and baked goods. This 14 oz. Can features all-natural ...The pineapple (Ananas comosus) is a tropical plant with an edible multiple fruit consisting of coalesced berries, which originated from the area between southern …Native forest pineapple chunks are certified usda organic and non-gmo. We hand select ripe pineapples, cut and pack the fruit in its own juice at the peak ...Oct 23, 2021 · Pineapple sage is not native, hailing from the much warmer climates of Mexico and Guatemala. As such, it is only hardy to Zone 8, making it an annual plant here in central Illinois (Zone 5b). In its native range it commonly occurs as clumps or large groups in sunny woodland edges across the Sierra Madre mountains at elevations above 6,000 feet. Pineapple Sage. One of the most popular salvias, Salvia elegans (Pineapple Sage) is a perennial subshrub of open habit with erect, square stems covered with strongly pineapple-scented, bright green, ovate leaves. The leaves, 2-4 in. long (5-10 cm), are covered with short, fine hairs, giving them a fuzzy appearance. Bromelain has been studied for its link to treating muscle aches and other sports injuries, intestinal distress and pain relief for shingles. One cup of peeled pineapple chunks contains about 82 calories. Learn about the foodprint of pineapples, everything from where they are grown to potential sustainability issues.Pineapple, well-matched to the climate, was successfully grown by two outside corporations, ... hunting (mostly non-native axis deer), and small-scale farming have become economically essential.History, Taxonomy and Culture of the Pineapple Pineapples, native to tropical America, have been most extensively produced in Hawaii which ac-counted for 85% of the 12? million cases of canned pineapple produced in 1947 by all countries of the world. J. L. COLLINS Pineapple Research Institute of Hawaii Early History THE pineapple is a native ... Dole Plantation Brief History. In 1899, a young Massachusetts native named James Dole used his savings and moved to Honolulu. He eventually purchased a 64-acre homestead in Oahu's central plains and experimented with several crops, finally choosing to grow pineapple. The business grew rapidly as Dole launched ad campaigns in magazines (the ...To figure out where things went wrong for English as a language, we have to go back and look at how Europeans first encountered the fruit in question, which is …Not Native to Hawaii. Botanists and historians say the pineapple (or Ananas comosus, if you want to get scientific) originated thousands of miles away in South America, most likely near present-day Brazil. It was a mainstay in South America long before the Europeans arrived. 10) Prickly pear (tuna fruit) No, this "tuna" isn't fish (known as atun in Mexico). The tuna fruit comes from the nopal cactus, or "prickly pear" in English. Find it everywhere in Mexico in late summer. Oval-shaped, the skin color ranges from green to orange to burgundy. And it's covered with clumps of scratchy hairs.Apr 9, 2021 · According to Michael Olmert, the pineapple was cultivated for the European market in the Dutch Surinam by the 17th century. Potential Dutch pineapple flows in the late 17th century. Diagram created by the author. The diagram above shows potential flows of mature pineapple fruits from Dutch colonies to the Netherlands. The pineapple is undoubtedly an extremely healthy fruit to juice as well as consume. Native to South America, the pineapple is proven to be packed with nutrition and it has a number of therapeutic advantages. Not just delicious and also refreshing to consume, pineapples include numerous vitamins, minerals, as well as antioxidants which …According to Taiwan's Council of Agriculture, the island produces 420,000 tonnes of pineapple annually, and exported a little over 10% of that last year, with almost all of it going to China.Instagram:https://instagram. michael bryangames like gimkithespori speed kill osrsboost thieving osrschicos sequin jacketrare toe jammer cold island Pineapples have indeed for a long time been a symbol of Hawaiʻi but they are not native to the Hawaiian islands. Pineapples can be traced back to their origin in South America, and are linked together with Hawaiʻi because of the large pineapple industry that was build on Hawaiʻi in the early 1900s.May 24, 2023 · The truth is that this question is nearly impossible to answer. Some believe that a Spanish shipwreck brought pineapples to the Big Island in the 1500s, while others believe that the English explorer Captain James Cook introduced the pineapple to Hawaii centuries later in the 1770s. The fruit's first appearance on the islands remains a bit of ... neutralizers of leadership are usually helpful to leaders Not simply the ingredient of piña coladas and fruit salads, oh no – the humble pineapple is far more historically important than that. Pineapples are native to South America, the Latin name for the fruit is 'ananas comosus', which originally comes from Guarani, meaning 'fragrant and excellent fruit.'. Pineapples first came to Europe ... Nov 1, 2018 · When missionaries arrived from New England in 1820, pineapples were found growing both in the wild and in cultivated gardens. The pineapples allure gained momentum in Hawaii during the California gold rush of 1849. Between 1849 and 1851 some 20,000 pineapples were shipped from Kona to Honolulu and on to California.
Nursing conferences are essential events for healthcare professionals. To make the most of your experience at a nursing conference, it is important to come prepared with the right essentials. In that case, a question may be peeping into your mind: What to bring to a nursing conference? Some essential items to bring to a nursing conference include the conference program and schedule, note-taking materials, business cards, portable chargers, electronic devices, comfortable shoes for long hours, and personal items such as a water bottle and snacks. In this article, we will discuss what to bring to a nursing conference. So, let's dive in and discover what you should bring to a nursing conference. Preparing For The Conference Preparing for the conference begins with careful planning and organization to ensure a smooth and rewarding experience. Researching The Conference Details Before attending a nursing conference, conducting thorough research on the event is crucial. Look for information about the conference agenda, session topics, and keynote speakers. Familiarize yourself with the schedule to plan which sessions you want to attend. Additionally, gather details about the location, accommodations, and pre-conference activities or networking events. This research will help you make informed decisions, prioritize your time effectively, and maximize the value of your conference experience. Registering For The Conference Once you have gathered the necessary information, it's time to register for the nursing conference. Visit the conference website or contact the organizing committee to complete the registration process. Be mindful of registration deadlines and any early-bird discounts available. Ensure you provide accurate personal and professional information during registration to receive important updates and access to conference materials. Seeking Funding And Scholarships Attending nursing conferences is financially challenging, but various funding and scholarship opportunities are available. Research grants, scholarships, or employer programs that support conference attendance for healthcare professionals. Explore options provided by nursing associations, educational institutions, or industry sponsors. What To Wear For The Conference? Understanding the dress code for a nursing conference is essential to ensure you present yourself professionally. Most nursing conferences have a business casual dress code. This means opting for attire that is comfortable yet polished. Generally, business casual attire includes slacks or skirts, collared shirts or blouses, and closed-toe shoes. Avoid overly casual clothing such as jeans, t-shirts, or sneakers. It's always better to err on the side of being slightly more formal than underdressed. Tips For Dressing For Different Types Of Events Within The Conference Attending a nursing conference like the upcoming Nursing and Health Management Conference in Canada will include various events, from keynote speeches to breakout sessions and networking opportunities. Consider the specific event's tone and purpose when selecting your attire. You may want to dress slightly more formally for keynote sessions or formal events, such as wearing a blazer or dress. For breakout sessions or more casual events, you can opt for a smart casual look. Additionally, bring a cardigan or shawl to add a touch of professionalism when needed. Adapting your attire to different events will ensure you are appropriately dressed and confident throughout the conference. What To Bring To A Nursing Conference? Attending a nursing conference requires proper preparation to ensure a productive and comfortable experience. Here are the essential items you should bring: - Conference Program And Schedule: Familiarize yourself with the conference agenda and session details. The program will guide you through the various activities and help you plan your time effectively. - Note-Taking Materials: Carry a notebook or electronic device to take notes during presentations and discussions. Bring pens, highlighters, and sticky notes to organize your thoughts and important information. - Business Cards: Networking is a crucial aspect of conferences. Have your professional business cards ready to exchange contact information with fellow attendees, speakers, and potential collaborators. - Portable Charger And Electronic Devices: Keep your devices fully charged throughout the conference by bringing a portable charger. This ensures access to essential conference materials, communication tools, and note-taking apps. - Comfortable Shoes For Long Hours: Nursing conferences involve significant walking and standing. Wear supportive shoes that will keep you comfortable throughout the long hours. - Personal Items: Bring a water bottle to stay hydrated and snacks to keep your energy levels up. Also, consider bringing a sweater or jacket if the conference venue is cooler than expected. Maximizing Your Time At The Conference Attending a nursing conference presents a valuable opportunity for professional growth and networking. To make the most of your time, consider the following strategies: Planning Which Sessions To Attend Review the conference program in advance and identify sessions that align with your interests, learning goals, and professional development needs. Prioritize sessions addressing current trends, innovations, or challenges in nursing. Balancing Concurrent Sessions And Keynote Sessions Balance your attendance between concurrent and keynote sessions. Keynote sessions often feature renowned speakers and provide valuable insights, while concurrent sessions offer a chance to explore specific topics in-depth. Plan your schedule accordingly to make the most of both types of sessions. Making A Backup Session Plan Sometimes, a session reach capacity, or circumstances may change. Prepare a backup plan by selecting alternative sessions of interest. This ensures you have options if your first-choice session is unavailable or you wish to switch to a different topic. Leveraging Networking Opportunities Networking is a significant aspect of nursing conferences. Engage with fellow attendees, speakers, and exhibitors during breaks and social events. Exchange contact information, ask questions, and seek out opportunities for collaboration or mentorship. Networking leads to valuable professional connections and future opportunities. Engaging With Fellow Attendees And Speakers Actively participate in discussions, ask questions, and share your insights during sessions. Engaging with fellow attendees and speakers fosters meaningful conversations and enhances the conference experience. Be open to learning from others and contributing to the collective knowledge exchange. Continuing Education Units (CEUs) Explaining The Value Of Earning CEUs Continuing Education Units (CEUs) are essential for nurses to maintain and enhance their professional knowledge and skills. Here are important aspects to consider regarding CEUs at nursing conferences: Explaining The Value Of Earning CEUs Earning CEUs demonstrates your commitment to lifelong learning and professional development. CEUs validate your participation in educational activities and showcase your dedication to staying current with advancements in the nursing field. Many nursing boards and employers also require several CEUs for license renewal and career advancement. Strategies For Obtaining CEUs At Nursing Conferences - Attend Educational Sessions: Participate in sessions that offer CEUs. These sessions are specifically designed to provide valuable educational content that meets the requirements for CEU accreditation. - Keep Track Of Attendance: Sign in or scan your conference badge at each session to ensure accurate documentation of your participation. This will facilitate the process of obtaining CEU certificates after the conference. - Follow Reporting Guidelines: Familiarize yourself with the reporting guidelines provided by the conference organizers or accrediting bodies. Understand the required documentation and procedures for claiming CEUs. - Complete Evaluations: Some sessions require completing evaluations or post-session assessments to earn CEUs. Take the time to provide feedback and fulfill any additional requirements. Keeping Track Of Earned CEUs For Documentation Purposes - Maintain A Record: Create a system to track the CEUs you earn at nursing conferences. This is a spreadsheet, an online portfolio, or a dedicated CEU tracking application. Include the conference name, session titles, date, and number of CEUs earned. - Keep Supporting Documentation: Retain copies of certificates, receipts, or any other documentation provided by the conference organizers. These are evidence of your CEU completion and are required for license renewal or employer verification. - Stay Organized: Regularly update and review your CEU records. Ensure they align with your professional development goals and any regulatory requirements. Making The Most Of Poster Presentations Making the most of poster presentations offers several benefits for healthcare professionals. Firstly, presenting a poster allows you to share your research or project with a wide audience, gaining recognition for your work and contributing to advancing nursing knowledge. It provides an opportunity to receive valuable feedback, engage in discussions with experts in your field, and collaborate on future projects. To create an effective poster, keep it visually appealing and organized, using clear headings, concise text, and appropriate graphics. Use colors and fonts that are easy to read, and choose a layout that guides the viewer's attention. Present your information logically and coherently, highlighting your work's key findings and implications. When presenting and discussing your poster with attendees, be prepared to summarize your research, engaging them with your findings concisely. Maintain good eye contact, speak clearly, and be open to questions and discussions. Actively listen to feedback and use it as an opportunity for further learning and improvement. Tax Deductions And Employer Support Understanding tax deductions for conference expenses help healthcare professionals maximize their financial benefits. Certain expenses related to attending conferences may qualify as tax deductions. Familiarize yourself with your country's tax laws and regulations or consult a tax professional to ensure compliance and make the most of available deductions. Employer support for conference attendance is an important consideration for healthcare professionals. Many healthcare organizations recognize the value of professional development and provide support through financial assistance, paid time off, or coverage of conference expenses. It enhances nursing and healthcare management. It is beneficial to inquire about available support programs, scholarships, or professional development budgets within your organization. Demonstrating the relevance and potential benefits of attending the conference to your role and the organization's objectives can strengthen your case for employer support. Attending a nursing conference requires careful preparation to ensure a successful and fulfilling experience. After reading this article, we hope you understand what to bring to a nursing conference. By bringing essential items such as the conference program, note-taking materials, and business cards, you'll be ready to engage with fellow attendees and make meaningful connections. Don't forget to pack comfortable shoes for the long hours and personal items like a water bottle and snacks to stay energized. Planning your schedule, balancing sessions, and leveraging networking opportunities will maximize your time and enhance your professional growth. Whether seeking continuing education units or presenting a poster, being prepared and engaged will contribute to a valuable conference experience. So, pack your essentials, dress appropriately, and get ready to immerse yourself in the enriching world of nursing knowledge and networking.
Looking to begin your own newsletter or blog? There are 2 popular platforms that can assist you begin. Beehiiv Sms France … In this post, we will compare Beehiiv vs Substack to assist you decide which one is better suited for your requirements. We will go over how these platforms work, their resemblances, distinctions, and provide insights on which platform might be more beneficial for writers and content creators. Key Takeaways: - Both are popular content publishing platforms that enable users to produce and engage with audiences. - These platforms offer similar functions such as content production, audience building, and monetization choices. - Nevertheless, they have some essential differences in regards to target market, prices, design features, and customer support, which must be thought about when selecting between the two. What Are Beehiiv Sms France and Substack? They are popular platforms that cater to newsletter creators and publishers, providing an area to engage with their audience through curated content. Both provide an easy to use interface that streamlines the procedure of creating, dispersing, and generating income from newsletters. These platforms are designed to assist authors, blog writers, journalists, and content developers construct a loyal customer base and monetize their material successfully. How Do The Different Platforms Work? Creators can establish accounts, develop material, and engage with their customers through instinctive user interfaces. Both deal robust material development tools that allow developers to craft appealing posts with ease. From text format alternatives to multimedia combinations, users can customize their content to match their style and audience choices. These platforms provide numerous customer interaction alternatives such as comments areas, polls, and direct messaging functions, fostering a sense of community and engagement. The interface simpleness of each makes it effortless for creators to browse through analytics, manage subscriptions, and track engagement metrics, {ultimatel Creating an Account Developing an Account To start your journey you need to produce an account by offering standard info and establishing their subscription choices. When producing an account writers are typically required to enter their e-mail, username, and password. They might be asked for their payment info to set up subscription options. On Beehiiv, developers can select in between complimentary or superior membership strategies, providing varying levels of benefits such as access to advanced analytics, customization options, and even the capability to monetize their material through direct fan assistance. Substack, on the other hand, focuses on a regular monthly or annual membership design, where subscribers get unique access to the author's premium material, newsletters, podcasts, and more, improving reader engagement and loyalty. Producing and Publishing Content Content creation and publishing includes utilizing the platform's tools to craft appealing newsletters, with choices for automation to improve the procedure. A range of automation features to help developers in managing content delivery schedules efficiently. With automated posting, creators can pre-schedule newsletters to go out at optimal times for optimum subscriber engagement, boosting open rates and conversions. Personalization choices on these platforms permit developers to customize the feel and look of their newsletters, enhancing brand name identity and producing a more personalized experience for customers. Structure and Engaging with an Audience Structure and nurturing involves understanding subscriber sources, analyzing information, and making notified choices to boost engagement and retention. One of the essential techniques to cultivate audience growth and engagement on platforms is to diversify customer sources. By tapping into different channels such as social networks, email marketing, cooperations with influencers, and SEO optimization, material developers can reach a broader audience base. Leveraging data analytics plays an important role in recognizing trends and patterns that can direct content production and distribution. Utilizing tools like Google Analytics or platform-specific insights enables a deeper understanding of audience habits, preferences, and engagement metrics. By welcoming a data-driven decision-making technique, developers can personalize their material method to satisfy audience expectations and preferences, eventually resulting in greater subscriber retention rates and increased engagement levels. What Are the Similarities Between Beehiiv and Substack? They share commonalities such as allowing users to produce and publish content, access audience-building tools, and providing analytics and monetization choices. Both platforms prioritize user-friendly interfaces and smooth experiences for material creators aiming to engage with their readers and develop a loyal following. They offer a variety of customization alternatives, from format tools to personalized branding features, enableing users to customize their material to show their unique design and voice. Furthermore, community-building is at the core of both platforms, with interactive functions like remarks areas and subscriber engagement tools that assist in direct communication and promote a sense of belonging among audience members. What Are the Distinctions? While offering similar services, they vary in terms of target audience, prices and monetization options, style and customization features, and platform support and client service. The platform support and client service are customized towards services and organizations looking for advanced tools and functions, making it perfect for those with particular modification needs. On the other hand, Substack caters more towards private content creators, blog writers, and newsletter writers looking for a structured and user-friendly platform, with a concentrate on ease of use and simplicity. Looking at Beehiiv, it provides a sleek and contemporary user interface that is visually appealing, making it easy to use and simple to browse. The platform offers a series of modification alternatives for developers to personalize their material and engage with their audience in unique ways. On the other hand, Substack boasts an easy and straightforward design that concentrates on delivering newsletters efficiently. Its smooth integration with e-mail services enhances user engagement and retention. While one lacks some of the sophisticated modification functions found on the other, it stands out in its simpleness and reliability, making it an excellent choice for authors who focus on content delivery over intricate design elements. Both Platforms Allow Users to Produce and Release Content Relating to content creation, ease of use is a crucial factor, and both platforms stand out in this area. It provides an easy to use interface that enables creators to perfectly draft, edit, and publish their content. Similarly, Substack offers a straightforward platform with intuitive features that make it simple for writers to focus on their material without being bogged down by technical intricacies. In regards to personalization alternatives, both use a series of templates and styling tools to assist creators personalize their material and establish an unique brand name identity. Whether it's changing font styles, colors, or designs, users can quickly customize their publications to match their aesthetic preferences. Imaginative tools play a crucial role in improving the quality of content, and both platforms comprehend this. Provide developers with a variety of tools, such as integrated image editors, formatting choices, and interactive components, to raise their material and captivate their audience. Both Platforms Have Tools for Structure and Engaging with an Audience A a variety of audience-building tools and analytics features to help developers understand their customers and enhance engagement techniques. These platforms provide developers with valuable insights into customer habits, preferences, and interactions through comprehensive analytics control panels. By leveraging user engagement information, creators can personalize their content to fulfill the specific needs and interests of their audience, resulting in increased retention and loyalty. Keeping an eye on crucial metrics such as open rates, click-through rates, and customer growth is essential for refining content techniques and making the most of reach. With functions like A/B testing and audience segmentation, developers can experiment with various approaches to enhance engagement and drive conversions. Both Platforms Deal Analytics and Money Making Options Creators on these platforms can access detailed analytics on subscriber activity and choices, as well as monetization options to generate revenue from their material. - These analytics tools offer insights into customer engagement metrics like open rates, click-through rates, and audience demographics. By understanding their audience much better, developers can personalize their material to increase engagement and retention. - The monetization functions provide creators with numerous income streams consisting of paid subscriptions, sponsorships, and merchandise sales. This diverse variety of choices allows developers to maximize their earnings while using worth to their subscribers. What Are the Biggest Differences? While they use similar services, they differ in regards to target audience, pricing and money making options, style and personalization features, and platform assistance and customer support. Relating to target audience, it caters primarily to creatives seeking to construct a neighborhood around their content, whereas it appeals more to writers and journalists looking to monetize their newsletters. In terms of rates, one uses a range of subscription tiers with various features, consisting of a complimentary alternative, whereas the other operates on a revenue-sharing design where developers pay a portion of their incomes. Relating to style and modification, it offers more versatility in branding and layout alternatives, enabling users to produce a more special appearance for their publications compared to more template-based technique. Target market Each cater to unique target market concentrating on cost effective pricing options for emerging authors and offering premium features for recognized developers. These platforms target various segments of the writing community, shown in their rates strategies. The cost-efficient technique attract aspiring authors, students, and blog writers wanting to start their online existence without breaking the bank. On the other hand, premium functions and subscription-based design attract recognized journalists, authors, and influencers who are currently well-known and seek to monetize their faithful fan base. When analyzing the user demographics, one tends to attract younger, less financially established individuals who are checking out writing as a hobby or prospective career course. In contrast, users usually consist of experienced professionals, industry specialists, and widely known characters with an established following. Pricing and Monetization Options The rates and monetization designs vary, offering versatile paid choices and carrying out a tiered prices structure for its services. U have the choice to pick from various membership strategies that cater to their needs and budget plan. This versatility enables individuals to select a plan that aligns completely with the worth they receive from the platform. On the other hand, tiered pricing model provides various levels of functions and assistance depending upon the subscription tier picked. This supplies users with the opportunity to gain access to additional resources and functionalities by upgrading to a greater strategy.Design and Customization Features Platform Support and Customer Service The level of platform assistance and client service differs between providing a business prepare for sophisticated user needs and devoted support. Substack's enterprise plan caters to those looking for more specialized features, while this guarantees an user-friendly user interface for a smoother experience. User help on both platforms is quickly accessible. Which Platform is Much Better for Writers and Content Creators? When deciding between them, authors and content creators should weigh the advantages and disadvantages of each platform to identify which lines up much better with their objectives and preferences. At very first glimpse, leads the way for a more immersive and aesthetically captivating experience, using customizable styles and designs that can genuinely make one's content stand out. On the other hand, Substack supplies an uncomplicated and minimalist user interface, focusing more on the simplicity and ease of use. This distinction in user experience can play a considerable role in one's decision-making process, depending on whether they focus on aesthetic appeals and modification or prefer a clean and uncomplicated composing environment. Often Asked Questions Can I use them for complimentary? Both provide totally free strategies, however they also have premium options with extra features for a subscription cost. It eventually depends on the individual's requirements and choices whether they choose to use the complimentary or paid variation. Can I move my subscribers from Substack to Beehiiv? Yes, Beehiiv has a feature that enables users to quickly import their subscribers to their account. What about customer assistance? Both platforms have client support choices, using phone and e-mail support and a community forum.
(+612) 2531 5600 Get direction Google map Your 7-year-old, 8-year-old, or 9-year-old child is now entering middle childhood, is becoming somewhat independent, and is developing a self-image based on learning valuable skills. It is also a time when kids become more conscious of their body image in relation to their peers and to other images they see. What can do you do about it? You work on becoming the best parent you can be by developing a healthy, smart, and happy child. By learning one of the most important skills of parenting: How to raise a 4 Dimensional Child in a 2 Dimensional World. What is a 4 Dimensional Child? There are 4 dimensions of human potential: Physical, Mental, Emotional, and Spiritual. 1. We have bodies that need proper nutrition and exercise to run at peak efficiency. 2. We have minds that need to continue learning to stay sharp. 3. We have hearts that need human contact to be happy. 4. We have spirits that search for meaning to be at peace. A 4 Dimensional Child is one who is growing in all 4 dimensions to eventually become a well-balanced adult. What is the 2 Dimensional World? It is the world of screens: TV screens, computer screens, tablet screens, and phone screens. Screens have only 2 dimensions: Length and width, but no depth. As people spend more and more time looking at screens, we seem to be living in a 2 Dimensional World. How can you raise a 4 Dimensional Child in a 2 Dimensional World? 1. Understanding your child's capabilities at each developmental stage, but especially in the crucial toddler years, 2. Engaging him/her in specific activities designed to reach developmental milestones in each dimension, and 3. Spending more time in the real world and less time in the 2 dimensional screen world. Raising 4 Dimensional Children in a 2 Dimensional World is a book that provides a simple understanding of the physical, mental, emotional, and spiritual developments of children at each stage, based on research in education and developmental child psychology. It also provides over 400 fun activities you can play with your child to help him/her develop the necessary skills to reach the developmental milestones to move up to the next level. The Middle Childhood Chapter focuses on 7-year-olds, 8-year-olds, and 9-year-olds, when your child's body and mind start growing, and his self-image is based on the skills and abilities he is developing. The research and activities provided will show you how to help your child develop to his/her full potential. It answers important questions like: Now that your child is getting a solid elementary education, you have three choices: 1. Buy just the chapter on Childhood: It's available for immediate download for only 99 cents; 2. Buy the whole book so that you have a complete guide for your young child's development all the way through adolescence, or in case you have more than one child. The Complete e-book is available online for immediate download for only $4.99 3. The complete paperback book is available as an easy to find reference guide for $14.99 with free shipping. Why is the Chapter so Cheap? We're not looking to get rich. We're looking to help mothers like you learn the ins and outs of child rearing, so we're making it easy and affordable online for everyone. Order Now and continue your enchanting journey armed with knowledge! Copyright 4D-2D.com. All rights reserved.
Poker is a card game in which players bet against each other to win the pot. There are a variety of poker variants, but all involve betting phases and revealing cards at the end of the round. If a player does not reveal his hand, he is said to drop or fold and cannot compete for the pot. Each player makes an ante or blind bet before they are dealt two cards by the dealer. Then the betting begins in a clockwise direction. If a player has a strong hand, they can raise the bet. This is called betting into the pot and can make a bad hand much better. Using the information you can gather from the other players at the table will help you decide whether to call, raise or fold. Learning to read the other players' tells, including their body language, idiosyncrasies and betting patterns is important. For example, if an opponent frequently calls but then suddenly raises, they may be holding a strong hand. There are also a number of basic poker math concepts you need to know to make the best decisions. These include the basics of odds, and the calculation of expected value (EV). You can learn these skills over time and develop an intuitive understanding of them. The more you practice, the easier it will be to apply them during hands. This will help you improve your winning percentage and increase your bankroll.
(KTXL) — Two months are left in California's "wet season," where the snowpack and the water it contains are closely monitored. The amount is critical in dealing with the state's drought. About 30% of the water California uses comes from snowmelt. That is why measuring it accurately is important. The old familiar snow survey where a pole goes into the ground and gets weighed for water content is one piece of the puzzle. The Department of Water Resources also relies on about 125 electronic sensors that measure the snowpack. But now, a much newer technology is increasingly coming into play. "The Airborne Snow Observatory is an aircraft that has a scanning lidar and an imaging spectrometer on board. And from 23,000 feet flying over, we can measure the snow depth to within about 2 1/2 inches. From 23.000 feet, still blows me away and I've been doing this for over a decade now," said Thomas Painter, CEO and founder of Airborne Snow and Observatories, Inc. Painter's technology doesn't replace the older methods, but it helps complete the picture. "So, what's measured from 23,000 feet from an airplane can be validated on the ground with our snow courses and our snow sensors," said David Rizzardo, DWR manager. Rizzardo further explained the Airborne Snow Observatory allows the state to measure a much larger area, including places that would be impossible to access on foot. The plane flies back and forth on a grid, getting data every 3 square meters. The technology has been available for about 10 years, and it's been a gradual rollout as the state's budget allows. "This year we received a little bit more funds, and we'll be doing the Feather River, the Yuba River, and also the Truckee and Carson Rivers around Lake Tahoe," Rizzardo said. "Our budget is still a little limited, so we're only getting about three or four flights per year during the snowpack season." Having more accurate snowpack data is very helpful when deciding how much water to release from reservoirs. "Ideally, we would like to roll out a program that is more like eight to ten flights a year, so we can really capture the change in the snowpack throughout the season," Rizzardo said. "I know we're in a drought. But when we have flood years, one of the biggest questions is, how much of that snowpack is going to come down, and when is it going to come down, on top of the fact that the reservoirs are already full from rainfall and everything else." He said during dry times like California is experiencing now, the measurements are important predictors of how much of that water will make it into reservoirs. It's a great technology leading to new understandings. But it doesn't take away from the importance of water conservation. "One or two really good weeks of snowstorms doesn't make an entire season, and it doesn't fill in the hole from the drought the last two years," Rizzardo said. "And so water conservation and just smart use of your water has become more critical." The Department of Water Resources has several other partners around the state that are helping fund the aerial technology. The Bureau of Reclamation and many water agencies are investing in it as well.
By Adia Jildo International partners are biding to improve the learning environment in the country. On Tuesday, the Turkish Cooperation and Coordination Agency (TIKA) through the Turkish Embassy in Juba and the Rwandan contingency, through the State Ministry of Education donated 90 desks, and modified the playground of Kapuri Nursery and Primary School. The aim is to aid pupils' learning through a modern facility. The school was renovated, a water supply system planted and a playground for the children improved. Eunice Gordon Wani, the Head Teacher of Kapuri Nursery and Primary School said the provision of the school desks was a milestone in the development of the school as other children studied under the tree and on the floor. "These classes are not enough. Some children sit under the tree and still are not enough. Others run away from classes if lessons are taken under the tree," she said. Eunice stated that besides inadequate desks for pupils, challenges such as delay in salary payment for teachers and long distance for the pupils is another factor affecting the learning system of the community. "There is no salary for about 7 months now. These teachers walk long distances to come and teach. Others come from Juba town, Hai Tijaria and using public means and at times the teachers end up coming twice or thrice a week," she lamented. She called on the Ministry of Education to take into hands the salary issues by solving the problem for the benefit and the future of children. Eunice said that some parents are hesitant to pay their children's school fees which hinder children's learning. While the Director of NESO International college school Simon Machuar said lack of secondary schools has affected most who are supposed to attend a secondary level education. He added that students make efforts to move far to attend secondary learning and therefore the need to plan to have secondary classes in the afternoon at Kapuri primary school facility when the schools resume operation. "A secondary school will be opened in the same school in the afternoon to assist those who live in Kapuri to access secondary level education too." Simon said. "We agreed that we are going to open a school in the afternoon. It will be an affordable fee of 15,000 SSP per term," he added. The TIKA representative Cafer B. Besli said the project that was directed to the Ministry of Education was to invest in and develop the future of South Sudan. "As the number of pupils has increased this year, these 90 desks as well as the established playground for the children will contribute to the education efforts in the country," he said. "Education is a very important field. It's the future of the country," Cafer added. The Turkish ambassador Erdem Mustaf said the investment in the field of education is a priority. "We are modifying the playground for the children to play in school for them to enjoy leisure during the school period," he said. He promised to renovate and upgrade the nursery school next year in June 2023. The state Minister of Education Cirisio Zakaria Lado promised to support the investors who come with the aim of investing in the country's education sector. "The state government will stand strong with a person who supports the education sector. We will facilitate all your projects. The Ministry of Education will look forward to supporting more children," he said.
noun as in abridgment Strongest match Strong matches noun as in water buildup Strongest match Weak match Discover More Example Sentences This future city collects water through air condensation and uses solar power to drive itself over arid landscapes. An auto drain function will exhaust all condensation automatically without the need to manually service the machine. Propane heaters are also notorious for creating lots of condensation, whereas diesel versions put out a dry heat and work well at high altitudes. He agrees that molecules are more likely to link together by condensation reactions on land, where wet-dry cycles can occur, than in the ocean. Mineral deposits indicate the presence of hot springs and hydrothermal activity in the planet's past, which would have sustained the wetting and drying cycles that the two researchers see as crucial for condensation reactions to get life going. Exhale on the cold pane, then draw a ladybug in the condensation. There are other forms of electrical discharges not distinctly connected with the then existing condensation of moisture. But he is very serious, and his words sometimes chill like a condensation of Young's "Night Thoughts." By telescopic condensation of the field, Cragley was capable of bringing Deliphon on the instrument. Condensation is explained as undergoing an alteration; that means, as becoming composite. Evaporation and condensation, woods and glaciers, have all been brought into play. On this page you'll find 65 synonyms, antonyms, and words related to condensation, such as: contraction, abstract, breviary, brief, compendium, and compression. From Roget's 21st Century Thesaurus, Third Edition Copyright © 2013 by the Philip Lief Group.
cation [104]. Even so, its effects around the male MC5R web reproductive program are poorly understood [10508]. On a single hand, metformin reportedly improves reproductive function in males with diabetes, which includes improving the semen parameters, testicular antioxidant function, the intratesticular testosterone concentration, and the serum testosterone concentration [106,108,109]. On the other hand, the activation of AMPK inhibits steroidogenesis by way of the downregulation of StAR [110,111]. Hence, the impact of metformin on testosterone in males is unclear. Murine and human fetal testicular cells exposed to metformin showed decreased testosterone production [112]. Metformin has also been shown to lessen testosterone levels in vivo, which recovered soon after the cessation of therapy [112]. Within a cohort of middle-aged overweight males with glucose intolerance, metformin was not related with increased testosterone [113]. In addition, metformin may possibly result in lowered testosterone and libido and erectile function in T2DM [114,115], whereas sulfonylurea, as an option, could increase these parameters in T2DM males [115].Antioxidants 2021, ten,9 of5.three. Nutrition and Weight Management Very good nutritional habits regulate immune function and redox biology, decreasing inflammation and oxidative stress [75]. Mediterranean-based diets would be the most studied and recommended, consisting of complex carbohydrates (entire grain), vegetables and fruits, seafood, nuts, seeds, and vegetable oils [75,116,117]. Furthermore, the consumption of antioxidant micronutrients, especially carotenes, vitamin C and E, and selenium and zinc, with an elevated intake of phytochemicals, improves oxidative tension and male reproductive prospective [75,11618]. The Mediterranean diet regime can also be related using a lowered risk for, along with the important management of, metabolic syndrome, diabetes, malignancy, and improved longevity [119]. However, high-energy poor-nutrient foods, including straightforward sugars, trans fatty acids, and tobacco and alcohol all induce inflammation and oxidative pressure [75,118]. Low testosterone in males is predicted with a poor diet, specifically the improved consumption of pastries and breads, dairy, quickly foods, in addition to a reduced intake of green vegetables, correlating negatively with lean physique mass and positively with BMI, independent of age [13]. Vegan diets may HSP105 drug enhance SHBG, but appear to have tiny impact on testosterone [120]. Weight management improves male fertility and endocrine function, exactly where a healthier life style can increase sexual dysfunction and a lot of comorbidities in obesity, metabolic syndrome, and diabetes [121,122]. In addition, weight management is essential in sustaining regular testosterone and HPG function in obese guys, at the same time as in middleaged and elderly males [123,124]. Because the long-term security of TRT is unclear in obese males with nonclassical hypogonadism, lifestyle adjustments or bariatric surgery for weight reduction should be the first-line treatment options [125]. An acceptable diet, with or devoid of enhanced physical activity, improves body weight in obese males, with or with out metabolic syndrome or T2DM [113,126]. An intensive enhance in physical activity may perhaps also enhance testosterone in obese males [127]. Nonetheless, bariatric surgery may very well be a lot more helpful in some situations [125]. Inside a meta-analysis, a low-energy eating plan and bariatric surgery had been each found to enhance testosterone and SHBG in males undergoing fat reduction trials. Bariatric surgery was located to be more powerful than lo Leave a Comment You must be logged in to post a comment.
Last Updated on April 24, 2024 by If you hang out with well-traveled individuals, then the phrase 'Portugal is the California of Europe' doesn't come as a surprise. Well, for us, we cannot agree more! Those who have been to Portugal can attest to the fact that the country gives off California vibes. With recent advancements in technology and the startup scene, the similarities aren't limited to just the weather. The warm weather, expansive coastline perfect for surfing, and has its own 'Golden state bridge!' Surprised? Tag along to find out why indeed, Portugal is crowned as the California of Europe. What Makes Portugal the California of Europe? The similarities between Portugal and California are astounding, right from the climate, beaches, and even nature. You will find plants and hills that are almost identical in both places. While California is relatively larger than Portugal as a country, there are so many similarities that they share. Let's discuss this. Similar weather and geography What attracts most expats to Portugal is the fair weather all year round. This is one factor that Portugal and California have in common. While Portugal is in Europe and California in North America, these two destinations have a cool Mediterranean climate that is appealing to most people. The weather is relatively similar, but Portugal experiences more hours of sunshine per year than California, and also winter is less harsh. Similar to California, Portugal is home to beautiful mountains and other amazing scenery that is common in the Mediterranean climate. Take a look at the average weather statistics below: Spring \| Summer \| Autumn \| Winter \| \| Portugal \| 15.4 ºC (59.72 ºF) \| 22.4 ºC (70.52 ºF) \| 18.1 ºC (64.58 ºF) \| 11.8 ºC (53.24 ºF) \| California \| 15.4 ºC (59.72 ºF) \| 28.9 °C (84 °F) \| 18.2 °C (64.7 °F) \| 7.9 °C (46.3 °F) \| The data was taken from the Climate Data website. Similar Vibes The cities in Portugal, Lisbon and Porto, have a lot that will make them appear as California's twin from Europe. First off, both Lisbon and Porto are home to a diverse population with a thriving urban culture and nightlife similar to California. The cosmopolitan cities of Portugal are different from other rural towns; Lisbon is bustling with life and has embraced the western lifestyle. The two regions are also known for their innovation and creativity, and that isn't limited to just tech. Portugal has a rich tradition of being home to many artistic and intellectually gifted people. Meanwhile, California is also part of a trendsetting culture and is a center for the tech industry. Other than that, Portugal has an expansive beach that attracts surfers from all over the world. The beaches are not only for surfers; you will find families spending a good time down at the beaches. Another similarity exists in the architecture of both locations that represent their cultural heritage. While California is famous for its Arts and Crafts-style homes and its Spanish-style churches, Portugal is known for its ornate tile work, Gothic cathedrals, and historic fortifications. Southern California Turns into the Algarve Coast One could easily assume that southern California and the Algarve in Portugal are cut from the same cloth. Right off the bat, the Algarve is also the southern part of Portugal and shares several similarities with southern California. One common thing that immediately sticks out is the beautiful and expansive coastlines that both destinations have. To be fair, Algarve has the best coastlines of the two, but this doesn't take away the fact that southern California has some breathtaking coastline and beaches too. Again, both of these destinations are massive surfing spots with tides that attract the best wave riders in the world. The warm, lovely beaches, gentle sea breeze, and moderate climate altogether add to the destination's allure. To add on, the stunning beaches are a major tourist attraction for people. During the summer, you'll find hundreds of locals and tourists relaxing on the coasts of California and Portugal. - You may also like to read: What Americans Need To Know About Portugal. Lisbon Has its own Golden Gate Bridge As if all the similarities were not enough; you should know that Lisbon has its own suspended red-painted bridge across the Tagus river that closely resembles the Golden Gate Bridge. The fact is, the two bridges are not the same however, if you lean your head to the right and slightly squint your eyes, they could look alike. By now, you surely understand why Portugal is considered the California of Europe. Cost of Living in California vs Portugal So far, Portugal and California seem to be similar in more ways than not. However, where a huge difference comes in is in the cost of living. One of the main motivations for most people to relocate to Portugal is the rather inexpensive lifestyle. For anyone who is used to American prices, you will find Portugal quite inexpensive. The surprising fact is that the relatively cheaper living in Portugal doesn't translate to poor quality of life. According to statistics, Lisbon in Portugal is 28% cheaper than California in the USA, with a cost of living index of 51.23 and 79.71, respectively. Here are some estimates for a comparison between Lisbon and California: Expense \| Cost in Lisbon \| Cost in California \| Apartment (1 bedroom) in City Centre \| €1,200 ($1,289) \| €1,381 ($1,483) \| Apartment (1 bedroom) Outside of Centre \| €783 ($841) \| €1,256 ($1,350) \| Groceries \| €250 ($268) \| €300 ($321) \| Utilities \| €128.06 ($137.54) \| €138.58 ($148.64) \| Monthly Transport Pass \| €40 ($42) \| €46.6 ($50) \| Data is from Numbeo (as of February 2023). You should know that while the cost of living seems to be relatively cheaper in Portugal as compared to California, it all comes down to your individual lifestyle. For example, cooking meals at home will save you money, but you won't experience the restaurant culture in Portugal. So, in essence, you will need to find a fine balance in your life. One thing to keep in mind while in Portugal, communities where many expats reside tend to have a generally higher cost of living. Most expats from the USA or other European countries have better wages than the local Portuguese resident. Therefore, the local markets always adapt to their purchasing power eventually. A good example is regions like the Algarve or Lisbon, which attract expats. The cost of living is generally higher than in other rural towns. So if you wish to live a rather simple and inexpensive life, move to cities or towns that are predominantly locals, for instance, Caldas da Rainha or Castelo Branco; these are some of the cheapest places to live while in Portugal. - Read Also: Cost of living in Portugal versus the USA. Let's Move to Europe With Viv Europe your plans for Europe will come to a reality Quality of Life in Portugal vs California There is more to quality of life than simply good weather and amazing food. Factors like your safety, education, and physical and mental well-being are often overlooked but are important. When it comes to a comparison between Portugal and California as far as quality of life is concerned, both places are good to live in. Both destinations have proper health care systems, education, leisure parks, and also good weather. To decide which one you wish to pick, we recommend that you go on a scouting trip to help you conclude. However, Portugal is relatively better as far as safety is concerned. According to the Global Peace Index, Portugal has ranked the 6th safest country in the world. In fact, in previous years, Portugal has been the 3rd safest country in the world according to the peace index. Which makes the quality of life in Portugal higher than in many other European countries, as well as the USA. Remember, once people in any country feel safe, at ease, and with no debt, life becomes good, and consequently, the quality of life also improves. The peace is unmatchable. Portugal Is Not Better or Worse Than California, It's Just Different In all fairness, there is no better country than the other. Every person considers where they come from as the best. There are so many perks of living in Portugal, and the same can be said for California as well. The same goes for disadvantages too. Looking at the two destinations through the lens of trying to figure out which country is better than the other is where we miss the mark. We must acknowledge that each country is different, but this doesn't mean bad. Culture, lifestyle, or even climatic differences are what bring uniqueness between countries. How to Move From California to Portugal Over the years, Portugal has become an expat magnet from all over the globe. Immigrating to Portugal from the US is possible through tight channels. While EU residents might not need a Visa, all non-EU members, including anyone from the US, will be required to get a Visa. There are several types of Visas, for instance, study visas, tourist visas, a visa to work, or even one to relocate permanently. So if you are looking to permanently relocate to Portugal, you should check out the Golden Visa program that will eventually lead you to get permanent residency in Portugal. Remember, regardless of the type of visa you are applying for, there are documents that you must present; a passport, proof of accommodation, proof of subsistence, international medical insurance, criminal background certificate, and a SEF form. For anyone trying out the process for the first time, it can be a daunting task. Luckily, Viv Europe is here to do all the difficult work on your behalf. We are experienced in immigration services, and we'll walk with you every step of the way until you get to Portugal. Trust us; you won't be the first expat from California in Portugal; there is a whole community of expats from the US and all over the world enjoying life under the warm weather. It's quite easy to find your community here! - Check out the article How To Move To Portugal From The United States Of America for more information. Are You Ready to Move to Portugal? If you have reached this far, it means you now understand how Portugal compares to California. We can all agree that Portugal is more similar to California than you had anticipated, right? If you are considering immigrating from California or any state in the US, then you have enough to make you feel at home while creating a new home in Portugal. Want to Keep Up With the Expat Community in Portugal? Choosing to become an expat often means you are leaving behind friends and family. When you move out of your own country, is it a good idea to seek the company of fellow expats from your country of origin? The first step you ought to take before leaving your home country is to look for expat communities in the country you intend to immigrate to. Blending into the expat community is easy since all of you share the same problems and challenges of living in a foreign country. The community will also be your support system because they relate to what you're going through and will often offer help based on past experiences of living in that particular country. Join our Facebook Group – All About Portugal For Expats, and ask whether they think Portugal is the California of Europe! See you soon!
German Months Flashcards Flashcard Creator Preview - Flashcards: 12 der Januar der Februar der März der April der Mai der Juni der Juli der August der September der Oktober der November der Dezember Set of 12 German Months picture flashcards. The flashcards are designed for teaching kids and young learners at school or at home. Flashcards can be printed directly from the browser or you can download a PDF file. There are three flashcard sizes, large flashcards in A4 or letter paper sizes, and medium and small flashcards which are great for using in activities and games. Recommended Activities The following learning activities are good for teaching German Months vocabulary.
Valeria Efimova Scary Tale New Age Travelling Valeria Efimova Scary Tale New Age of Travelling with elina zazulya Foraminiferal is an ephemeral, intermediate state between humans and the microorganism foraminifera, a microscopic inhabitant of predominantly salty waters, which has a calcareous porous body. The special surface structure of this creature provides it with a sensitive connection with the outside world and allows it to breathe throughout its body. Exploring the capabilities of neural networks, the artists connect humans with other forms of life and reflect on how the human body would transform if it moved from one habitat to another. The visual part is a three-channel video of interpolations generated by the StyleGAN 2 neural network. The first stage of training the neural network took place on a set of images of the human body. Next, the resulting model was retrained on a set of images of microorganisms. To generate the final videos, intermediate stages were chosen, where something between the initial model (trained on the human body) and the formifera was generated. To generate sound, the RAVE neural network was used, which was trained on the sounds of deep, calm breathing of people, and then used to repeat the sound of waves with their breath. The project was created with the support of the Art & Science Center of ITMO University, Aurora Scientific Communication and the Institute for Stratigraphic Research (Instituto de Investigaciones en Estratigrafía, IIES) of the University of Caldas (Universidad de Caldas), Manizales, Colombia.
The presence of starlings in the North American ecosystem has had a profound impact on both native species and agricultural systems. Understanding the habits and behaviors of starlings, as well as their origins in North America, is essential in recognizing the consequences they have on the environment. measures taken to control their populations and minimize their effect on the ecosystem are crucial for preserving the balance of the ecosystem. This article aims to explore the starling's effect on the North American ecosystem, the impacts on native bird species and agriculture, the efforts made to manage their populations, and what can be done to mitigate their influence in the future. Key takeaway: - The Starling's impact on the North American ecosystem: The introduction of the Starling to North America has had significant effects on native bird species, agriculture, and tree and plant populations. - Competition with native bird species: Starlings compete with native bird species for nesting sites and food resources, which can lead to a decline in the populations of these native species. - Agricultural and environmental impact: Starlings have a negative effect on agriculture by consuming crops and damaging fruit. They also impact tree and plant populations by displacing native species and affecting seed dispersal. - Efforts to manage Starling populations: Measures are taken to manage Starling populations, including the use of scare tactics, nest removal, and targeted culling. - Minimizing the impact of Starlings: To minimize the impact of Starlings on the ecosystem, proactive measures such as encouraging the use of alternative nesting sites and promoting native bird species can be implemented. What is the Starling Affecting the North American Ecosystem? The starling, an invasive bird species, is having a significant impact on the North American ecosystem. Here are some key ways in which the starling affects the ecosystem: The starling's presence significantly affects the North American ecosystem. Now, let's explore the ways in which this invasive bird species impacts the environment. 1. Agriculture: Starlings are notorious for damaging crops by feeding on fruits, grains, and vegetables. Consequently, this can lead to substantial economic losses for farmers and a reduction in food availability for both wildlife and humans alike. 2. Native bird populations: The starlings directly compete with native bird species for crucial resources like nesting sites and food. This fierce competition often results in a decline in the population of native birds as starlings are highly adaptable and aggressive competitors. 3. Disease transmission: The starlings can act as vectors for various diseases that have the potential to affect both humans and animals. An example is the transmission of Salmonella bacteria through their droppings, which contaminates water sources and poses a threat to public health. 4. Habitat alteration: Starlings tend to nest in cavities, often invading nesting sites that could have otherwise been used by native bird species. Their aggressive behavior disrupts the nesting habits of other bird species, impacting their breeding success. 5. Biodiversity loss: The presence of starlings disrupts the delicate balance within ecosystems, leading to a significant decrease in biodiversity. This loss of diversity has detrimental effects on the overall health and resilience of the ecosystem. It is crucial to implement effective measures to control the starling population and mitigate these negative impacts. Although complete eradication may not be feasible, strategies such as reducing their access to food sources and nesting sites can help manage their numbers and minimize their effects on the North American ecosystem. Did you know? Starlings were introduced to North America in the 19th century by a group of individuals who aimed to bring all the birds mentioned in the works of William Shakespeare to the continent. How Did the Starling Come to North America? The starling, an invasive bird species, arrived in North America through intentional introduction by humans. In the late 1800s, the European starling was brought to North America with the aim of introducing all bird species mentioned in the works of William Shakespeare. This deliberate introduction of the starling is how it came to North America. The release of 60 European starlings in Central Park, New York City, in 1890 marked the beginning of their presence in North America. These birds were not native to the continent and were originally native to Europe, Asia, and North Africa. Due to their adaptability and ability to thrive in a variety of habitats, the starlings quickly spread across the United States and Canada. They have now become one of the most common and widespread bird species on the continent. The introduction of starlings was initially met with enthusiasm as they were seen as a way to control insect pests. However, their population grew rapidly, and they soon became a nuisance. Today, starlings are considered an invasive species and are known for their aggressive behavior and competition for resources with native bird species. In summary, the starling came to North America through intentional introduction by humans in the late 1800s. This deliberate introduction of the starling species has had significant impacts on the North American ecosystem, which will be discussed further in the article. What are the Habits and Behaviors of the Starling? The habits and behaviors of the starling are truly fascinating and diverse. Let's delve into some key aspects to consider regarding these remarkable birds. 1. Feeding habits: The starlings are incredibly adaptable, being omnivorous creatures that possess a varied diet. They can easily thrive in different habitats by feeding on fruits, grains, seeds, insects, and even small vertebrates. 2. Nesting behavior: When it comes to nest building, starlings are cavity nesters. They demonstrate remarkable skill in finding and utilizing holes or crevices for their nests. These resourceful birds often compete with other species for prime nesting locations. 3. Vocalization: A remarkable characteristic of starlings is their highly vocal nature. They possess the ability to mimic an extensive range of sounds and songs, including those of other bird species and even human speech. Their complex vocalizations play a crucial role in their social behavior and communication. 4. Flocking behavior: Starlings are incredibly social birds, frequently congregating in large flocks, especially during migration or roosting. The synchronized flight patterns of these flocks, known as murmurations, create a mesmerizing and awe-inspiring sight. 5. Reproductive behavior: Starlings are renowned for their remarkable capacity for reproduction. They have the ability to breed multiple times throughout the year and produce large clutches of eggs. This rapid reproductive rate significantly contributes to their success as a species. 6. Invasive behavior: Although originally native to Europe, starlings were introduced to North America during the late 19th century. Their adaptable nature and aggressive behavior have allowed them to immensely thrive in their new habitat. In some instances, they outcompete native bird species for resources. Understanding these habits and behaviors of the starling is crucial for effectively managing their populations and minimizing their impact on the North American ecosystem. Impact of Starlings on the North American Ecosystem The impact of starlings on the North American ecosystem is significant and can have both positive and negative effects. Here are some key points to consider: - Starlings are invasive birds that compete with native bird species for food and nesting sites. Their aggressive behavior and large flock sizes can disrupt the balance of ecosystems and put native species at a disadvantage. - Starlings can carry and transmit diseases to other bird species, posing a potential threat to the health of the North American bird population. Diseases such as avian influenza and salmonellosis can be spread through contact with contaminated feces or through direct contact between birds. - Starlings can cause significant damage to agricultural crops, particularly fruits and grains. Large flocks of starlings can consume or damage crops, leading to economic losses for farmers. - Starlings are known to outcompete native cavity-nesting bird species for nesting sites, potentially displacing or reducing populations of species such as bluebirds and woodpeckers. In the early 1890s, a man named Eugene Schieffelin released about 60 European starlings into Central Park in New York City. His intention was to introduce all the bird species mentioned in the works of William Shakespeare to North America. This act had unintended consequences, as the starlings rapidly multiplied and spread across the continent. Today, starlings are one of the most common and widespread bird species in North America, with an estimated population of over 200 million individuals. Their impact on the ecosystem continues to be a topic of concern among scientists and conservationists. How do Starlings Compete with Native Bird Species? When it comes to competing with native bird species, starlings can have a significant impact. Here are some key points to consider: 1. Competition for resources: Starlings are highly adaptable and aggressive birds, often outcompeting native species for food and nesting sites. They have a diverse diet that includes fruits, grains, and insects, allowing them to exploit a wide range of food sources. 2. Nesting displacements: Starlings are cavity nesters, meaning they can easily take over nesting sites that would otherwise be used by native birds. This can lead to a decline in the populations of native species, as they struggle to find suitable nesting locations. 3. Aggressive behavior: Starlings are known to form large flocks, which can intimidate and drive away smaller native bird species. They may even engage in aggressive behaviors, such as attacking native birds and destroying their nests. 4. Reproductive success: The high reproductive potential of starlings gives them an advantage over native bird species. They can produce multiple broods each breeding season, leading to a rapid increase in their population and further competition with native birds for resources. 5. Disease transmission: Starlings can also act as vectors for diseases that can affect native bird populations. By coming into close contact with native birds at feeders or nesting sites, starlings can potentially transmit diseases and further disrupt the balance of the ecosystem. In order to mitigate the impact of starlings on native bird species, it is important to monitor their populations and take necessary measures to control their numbers. This can include removing invasive nest boxes, implementing deterrents to discourage starlings from nesting in certain areas, and promoting the conservation of native bird species through habitat restoration and education programs. By actively managing the population of starlings, we can help protect the biodiversity and ecological balance within the North American ecosystem. What is the Effect of Starlings on Agriculture? The effect of starlings on agriculture is significant and can have both positive and negative impacts. One of the main effects of starlings on agriculture is their feeding behavior. Starlings, known for their voracious appetites and ability to consume large quantities of crops, particularly fruits such as cherries, grapes, and berries, can lead to significant crop damage and financial losses for farmers. Additionally, starlings are notorious for feeding on grain crops like corn and wheat, further contributing to agricultural losses. To protect crops from starling feeding, farmers often have to implement various deterrent measures, such as scare tactics or netting systems. However, starlings also have a positive effect on agriculture by reducing pest populations. They feed on a variety of insects and invertebrates, including pests that can damage crops. By consuming these pests, starlings help to naturally control populations and reduce the need for chemical insecticides. This natural pest control capability can be extremely beneficial for organic farmers or those aiming to minimize the use of pesticides. Overall, starlings have a complex relationship with agriculture. While their feeding behavior can cause damage to crops, they also provide a natural form of pest control. Farmers must carefully manage starling populations and implement strategies to minimize crop damage while also benefiting from their pest control capabilities. How Do Starlings Affect Tree and Plant Populations? Starlings, invasive birds native to Europe and Asia, have had a significant impact on tree and plant populations in the North American ecosystem. So, how do starlings affect tree and plant populations? Firstly, nesting habitats play a crucial role. Starlings often choose tree cavities or small cracks and crevices in buildings as nesting sites. However, this can lead to competition with native bird species for prime nesting areas, reducing the availability of suitable nesting sites for other birds. Secondly, their foraging behavior also has negative effects. Starlings are omnivorous and have a diverse diet that includes fruits, berries, seeds, and insects. This behavior can result in the consumption of large quantities of fruits and berries, leading to reduced seed dispersal and limiting the natural regeneration of trees and plants. Moreover, starlings have an agricultural impact. They are known to cause damage to agricultural crops such as cherries, grapes, and berries. Flocks of starlings can descend on an orchard or vineyard, devouring fruits and damaging crops. This can have economic consequences for farmers and limit the availability of fruits for other wildlife. Finally, the aggressive behavior and competitive nature of starlings result in the displacement of native bird species. They outcompete native birds for resources, including food and nesting sites. As a result, the populations of these species decline. Controlling the impact of starlings on tree and plant populations is essential in preserving the North American ecosystem. Measures such as installing bird netting in agricultural areas, using scare tactics like loud noises or reflective objects, and employing targeted culling programs can help manage starling populations and reduce their negative effects on vegetation. Educating the public about the impact of starlings and promoting the conservation of native bird species can also play a crucial role in minimizing the impact of starlings on tree and plant populations. By implementing these measures, we can protect the diversity and health of the North American ecosystem for future generations. Controlling Starlings in the North American Ecosystem When dealing with the impact of starlings on the North American ecosystem, it is crucial to implement effective methods to control their population and minimize their negative effects. Here are some suggestions for controlling starlings in the North American ecosystem: - Research and monitoring: Conduct regular research and monitoring to gather data on starling populations, their distribution, and their impact on native species. This information will help inform control strategies. - Habitat modification: Altering the environment to make it less attractive to starlings can be an effective control method. This can involve removing nesting sites, such as cavities in buildings, and reducing food sources, such as bird feeders that attract starlings. - Scaring techniques: Utilize various scare tactics to deter starlings from specific areas. This can include visual deterrents like reflective surfaces or predator replicas, as well as audible deterrents like distress calls or loud noises. - Exclusion methods: Employ physical barriers, such as netting or bird screens, to prevent starlings from accessing specific areas or structures where they may cause damage or disrupt native species. - Population management: Implement targeted population management strategies, such as trapping and removal programs, to reduce the number of starlings in specific areas where they are causing significant harm. Controlling starlings in the North American ecosystem requires a comprehensive and adaptive approach. It is important to understand the specific context and challenges of each situation and to regularly evaluate the effectiveness of control measures. By employing these strategies, we can help maintain a balanced and healthier ecosystem for native species. What Measures are Taken to Manage Starling Populations? When it comes to managing starling populations in North America, various measures are taken to control their numbers and limit their impact on the ecosystem. Here are some of the key measures employed: 1. Nest removal: To manage starling populations, one method used is the removal of their nests. This helps prevent their reproduction and decrease their overall numbers. 2. Habitat modification: Another approach is modifying the environment to make it less attractive to starlings. This can involve removing food sources, such as bird feeders, that can attract starlings. Additionally, barriers or deterrents can be created to prevent them from accessing certain areas. 3. Scaring techniques: Different scaring techniques are employed to discourage starlings from roosting or nesting in specific areas. These techniques can include the use of loud noises, visual deterrents like scarecrows or reflective materials, or even predatory bird decoys. 4. Shooting and trapping: In certain cases, shooting or trapping starlings may be necessary to effectively manage their populations. These methods are typically carried out by authorized professionals or under permits to ensure proper control measures are followed. 5. Research and monitoring: Ongoing research and monitoring are essential to understand the behavior and population dynamics of starlings, as well as to evaluate the effectiveness of management strategies. This information helps in developing more targeted and efficient approaches to manage starling populations. By employing these measures, efforts are made to limit the impact of starlings on the North American ecosystem and maintain a balance with native bird species and agricultural practices. Are There Any Attempts to Control the Spread of Starlings? To control the spread of starlings in the North American ecosystem, various measures have been implemented. Are there any attempts to control the spread of starlings? Nest removal: One method used to manage starling populations is the removal of their nests. This helps prevent them from reproducing and expanding their numbers. By taking this action, it reduces the potential impact they may have on native bird species and agricultural areas. Habitat modification: Creating an environment that is less conducive to starling populations can also help control their spread. This involves removing or modifying nesting sites such as barns, sheds, or other structures that starlings commonly use. By limiting their nesting opportunities, it can restrict their population growth. Physical barriers: Installing physical barriers, such as netting or screens, can prevent starlings from accessing certain areas. Are there any attempts to control the spread of starlings? This is particularly useful in protecting crops and orchards from starling damage. By preventing starlings from feeding on agricultural produce, farmers can mitigate any negative effects on their crops. Scaring techniques: Various scaring techniques are employed to deter starlings from settled areas. These methods include the use of loud noise, visual deterrents like scarecrows or reflective tape, or even trained birds of prey. These techniques disrupt starlings' behavior and make the area less attractive for them to gather. Hunting and culling: In some cases, hunting and culling starlings are necessary to control their populations. This is usually done under specific circumstances, such as during agricultural seasons when they pose a significant threat to crops. It is important to ensure that hunting and culling practices are carried out responsibly and in accordance with local regulations. While these attempts to control the spread of starlings are implemented, ongoing research and monitoring are crucial to adapt and refine these strategies. Finding effective methods to control starling populations is vital to minimizing their impact on the North American ecosystem and preserving native bird species. The Future of Starlings in North America The future of starlings in North America is uncertain, but their impact on the ecosystem is undeniable. Here are some key points to consider: - Population growth: Starlings have been able to thrive and rapidly increase their numbers in North America. Since their introduction in the 1890s, their population is estimated to be in the hundreds of millions today. - Ecological concerns: The high abundance of starlings can have negative consequences for native bird species and agricultural practices. They compete for nesting sites and food resources, potentially displacing or outcompeting other birds. Their large flocks can also damage crops, posing challenges for farmers. - Economic implications: Due to their swarming behavior and feeding habits, starlings can cause significant damage to agricultural crops, resulting in financial losses for farmers. In the United States alone, their economic impact is estimated to be in the millions of dollars annually. - Management strategies: Efforts have been made to manage starling populations, including using non-lethal deterrents and implementing targeted control measures. Finding effective strategies that strike a balance between conservation and economic concerns remains a challenge. - Adaptive behaviors: Starlings are highly adaptable birds, capable of thriving in various environments. This adaptability makes it likely that they will continue to expand their range and impact in North America. Considering the future of starlings in North America, it is crucial to develop sustainable and integrated approaches that address both ecological and economic concerns. Collaboration between scientists, policymakers, and stakeholders is essential to develop strategies that mitigate the negative impact of starlings while supporting the preservation of native bird species and sustainable agriculture practices. What Can Be Done to Minimize the Impact of Starlings on the Ecosystem? To minimize the impact of starlings on the ecosystem, various actions can be taken. First, implementing habitat management is important. This involves creating and maintaining diverse habitats to encourage and protect native bird species. Measures can include planting native vegetation, providing nesting boxes, and managing invasive species. Second, controlling starling populations is crucial. Targeted control methods should be used to manage their numbers. This can involve trapping and removing starlings from specific areas, reducing their access to food sources, and using deterrents like noise-making devices or visual deterrents. Third, promoting native bird species is essential to balance the ecosystem and reduce competition from starlings. This can be achieved by providing appropriate food sources, conserving natural habitats, and creating safe nesting sites. Fourth, educating the public about the impact of starlings and the importance of native bird conservation is necessary. Raising awareness through educational campaigns, workshops, and community involvement can help minimize their impact. Finally, collaborating with stakeholders, such as farmers and land managers, is crucial for effective starling management. Working together allows for the development and implementation of strategies that consider the specific needs and challenges of each area. By implementing these measures, it is possible to minimize the impact of starlings on the ecosystem, protect native bird species, and preserve the balance of the North American ecosystem. Fun Fact: Starlings are considered one of the most invasive bird species in the world. Originally from Europe and Asia, they are now found on every continent except Antarctica. Some Facts About the Starling's Effect on the North American Ecosystem: - ✅ The introduction of the common starling to North America in the late 19th century was done for aesthetic reasons. (Source: chipperbirds.com) - ✅ The common starling's adaptability and aggressive behavior have caused ecological imbalances and raised concerns about its impact on native birds. (Source: chipperbirds.com) - ✅ The common starling can now be found from Alaska to Mexico, indicating its successful establishment in the North American ecosystem. (Source: chipperbirds.com) - ✅ The species has had significant effects on North American ecosystems, which have been impacted by the starling's presence. (Source: chipperbirds.com) - ✅ There are currently an estimated 200 million common starlings living in North America. (Source: chipperbirds.com) Frequently Asked Questions What is the impact of the common starling on North American ecosystems? The introduction of the common starling to North America has had significant effects on the ecosystems. The species' adaptability and aggressive behavior have caused ecological imbalances and raised concerns about its impact on native birds and wildlife. How did the common starling establish itself in North America? The common starling, also known as Sturnus vulgaris, was deliberately introduced to North America in the late 19th century. It was released in Central Park, New York City, for aesthetic reasons due to its attractive appearance and melodious song. The species quickly adapted and spread, establishing populations from Alaska to Mexico. What is the breeding behavior of the common starling? The common starling exhibits a polygynous practice during breeding season. They go through three distinct phases of breeding, resulting in multiple clutches of eggs. The first clutch is usually synchronized with other starlings in the area, and the second clutch occurs through polygynous mating. Incubation lasts about eleven days, mainly handled by the females. What are the physical characteristics of the common starling? The common starling has glossy black feathers in its non-breeding plumage. In breeding season, their iridescent green glossed feathers cover their back, nape, and breast. They have black wings with occasional green and purple veneer. The shape of their feathers is rounded at the base and jagged toward the tip. They also display sexual dimorphism, with males having elongated feathers over the breast and a bluish spot at the base of their beaks. How has the common starling impacted food competition in North American ecosystems? Due to their high fertility, avian transplants like the common starling have caused increased food competition in North American ecosystems. Their ability to utilize various foods and habitats has allowed them to rapidly multiply and outcompete native wildlife for resources. What is the current population of common starlings in North America? There are currently an estimated 200 million common starlings living in North America. This large population reflects the successful establishment of the species in its new habitat.
Dogs have been a part of Jamaican culture for centuries, with many Jamaicans considering them to be valuable members of their families. In fact, it is not uncommon to see dogs roaming freely in communities and even sitting on the porches of houses. Dogs are valued in Jamaican culture not only for their companionship, but also for their role as protectors of the home. Many Jamaicans keep dogs as guard dogs, relying on their keen sense of hearing and strong instincts to alert them to any potential threats. In addition to their practical uses, dogs also play a significant cultural role in Jamaica. They are often featured in traditional folklore and music, with songs like "Puppy Love" and "Who Let the Dogs Out" becoming popular Jamaican anthems. However, despite the cultural and practical importance of dogs in Jamaica, the country is also grappling with issues related to animal welfare. Many dogs in Jamaica are left to roam free without proper care or medical attention, leading to issues such as overpopulation, disease, and injuries. To address these issues, many animal welfare organizations in Jamaica are working to promote responsible dog ownership and provide veterinary care to dogs in need. These organizations also advocate for stricter laws and enforcement related to animal welfare, in an effort to protect the rights and well-being of dogs and other animals. In conclusion, dogs are an important and beloved part of Jamaican culture, serving as valued companions, protectors, and cultural symbols. However, it is important to recognize the challenges facing dogs in Jamaica, and to work towards promoting responsible ownership and better animal welfare laws to ensure the safety and well-being of all dogs in the country.
Knap Hill White Azalea* Rhododendron 'Knap Hill White' * This is a "special order" plant - contact store for details Height: 6 feet Spread: 6 feet Hardiness Zone: 4b Group/Class: Knap Hill Hybrids A sunny variety with bright white blooms with shell pink streaks and a yellow blotch; blooms in mid spring, creating an impressive border or low screen; absolutely must have well-drained, highly acidic and organic soil Ornamental Features Knap Hill White Azalea is covered in stunning clusters of lightly-scented white trumpet-shaped flowers with shell pink overtones and a yellow blotch at the ends of the branches in mid spring, which emerge from distinctive salmon flower buds before the leaves. It has green deciduous foliage. The narrow leaves turn an outstanding yellow in the fall. Landscape Attributes Knap Hill White Azalea is an open multi-stemmed deciduous shrub with an upright spreading habit of growth. Its relatively coarse texture can be used to stand it apart from other landscape plants with finer foliage. This is a relatively low maintenance shrub, and should only be pruned after flowering to avoid removing any of the current season's flowers. It has no significant negative characteristics. Knap Hill White Azalea is recommended for the following landscape applications; - Accent - Mass Planting - General Garden Use Planting & Growing Knap Hill White Azalea will grow to be about 6 feet tall at maturity, with a spread of 6 feet. It tends to be a little leggy, with a typical clearance of 1 foot from the ground, and is suitable for planting under power lines. It grows at a slow rate, and under ideal conditions can be expected to live for 40 years or more. This shrub does best in full sun to partial shade. You may want to keep it away from hot, dry locations that receive direct afternoon sun or which get reflected sunlight, such as against the south side of a white wall. It requires an evenly moist well-drained soil for optimal growth, but will die in standing water. It is very fussy about its soil conditions and must have rich, acidic soils to ensure success, and is subject to chlorosis (yellowing) of the foliage in alkaline soils. It is somewhat tolerant of urban pollution, and will benefit from being planted in a relatively sheltered location. Consider applying a thick mulch around the root zone in winter to protect it in exposed locations or colder microclimates. This particular variety is an interspecific hybrid. * This is a "special order" plant - contact store for details
10 Best Programming Languages for Software Development in 2024 In this focused guide, we compare prominent programming languages like Python, JavaScript, and Java, assessing their strengths and how they serve different aspects of software development. Discover which language aligns with your project's needs and the current market demand, without wading through unnecessary jargon! Key Takeaways - Python, JavaScript, and Java are pivotal in software development, each excelling in different sectors, making them valuable assets for developers. - No single programming language is optimally suited for every project, making it crucial to select a language based on specific project needs such as scalability, complexity, budget, and security requirements. - While general-purpose programming languages like Python and C++ offer versatility across multiple domains, specialized languages such as SQL, Ruby, and Rust target specific tasks within databases, web development, and systems programming. Decoding Top Programming Languages for Software Development The ever-changing landscape of programming can seem overwhelming at times. Each language has its own set of syntax rules that enable the generation of machine code, and the terrain of these languages is constantly shifting. The choice of a programming language greatly impacts a project's success. Factors such as the nature of the project, scalability, and the team's familiarity with the language guide this critical decision. From the perspective of software development and compilation, languages like Java stand apart from scripting languages like Python, which are often interpreted and used for automating specific tasks within a more extensive system. However, one thing is clear: having a solid grounding in widely used languages like JavaScript and HTML/CSS can ease the transition between similar languages. Keeping this in mind, we'll explore some of the best programming languages in today's software development field: Python, JavaScript, Java, and more. These languages have carved out their niches and proven their worth in various applications, making them a valuable addition to any developer's toolkit. The Rise of Python in Modern Development Python has soared to become the second most popular language on GitHub, right after JavaScript, showcasing its versatility and widespread use not just in web applications but also in software development and gaming. The demand for Python developers is reflected in job openings for data scientists, software engineers, and artificial intelligence researchers. Python is well-suited for a variety of tasks, including data analysis, visualization, web development, prototyping, and automation. It excels in these areas due to its flexibility and extensive range of libraries and frameworks. Major companies such as IBM, NASA, and Pixar utilize Python for a variety of purposes including: - 2D and 3D imaging, - Video games, - Scientific applications, - Notable websites like YouTube and Instagram. Python's technical prowess is anchored in its versatility, speed, ease of learning, and powerful libraries. Its readable and concise syntax enables rapid development and immediate code execution. JavaScript: The Backbone of Web Applications Used in popular frameworks, JavaScript streamlines web development and is integral to the functionality of widely used applications such as Uber and PayPal. JavaScript's significance in web development is evidenced by: - Its status as the most in-demand language, - Its importance in interactive web and mobile game development, - Its recognition is a real programming and scripting language. Java: A Staple for Enterprise Solutions Despite the emergence of new programming languages, Java continues to be a staple in enterprise-level applications and is utilized on various devices around the world. Its strong demand in back-end development and its role as a primary choice for Android mobile application development is notable, with platforms such as Google and Amazon utilizing it extensively. Java's capabilities include: - Object-oriented features that support robust software design, - A Write Once, Run Anywhere (WORA) approach allows portability across different platforms, - Innovations in Java development continue with new frameworks like Spring, Struts, and Hibernate which are essential in modern enterprise software development.. Crafting Digital Solutions: Choosing the Right Programming Language Choosing the right programming language for a digital solution requires a careful evaluation of several factors. These include: - Expected scalability, - Complexity of the application, - Development budget and timelines, - Project's security requirements, - Resource availability, - Long-term maintenance needs. Business-driven decision-making should prioritize language choice based on project-specific needs instead of selecting a language based solely on its prevailing popularity or aesthetic preference. A considered selection of a programming language, informed by project requirements, can contribute to a marked decrease in maintenance efforts, facilitate scaling, and strengthen security measures in the resultant application. Given the diversity of software projects, no single programming language stands out as the optimal choice for all. It is essential to tailor the language and framework selection to the specific needs of the project in question. With this in mind, let's consider some of the most suitable programming languages for different domains: web development, mobile applications, and data science. Web Development Wonders Markup languages, consisting of human-readable tags that format documents, are instrumental in web development. HTML simplifies the creation of basic web pages and applications by tagging content for web display. Beginners in web development are often recommended to start learning HTML/CSS due to its fundamental role in understanding web principles and its ability to specify web page appearance. CSS is critical to web design as it defines the visual style of web pages by controlling layout, fonts, colors, and other design elements. This transforms the structure provided by HTML into an aesthetically appealing format. A comprehensive toolkit for frontend development integrates the structuring power of HTML, the style definition capabilities of CSS, and the interactive functionality provided by JavaScript, creating a foundation for sophisticated web applications. Building Robust Mobile Applications When it comes to mobile application development, Swift and Kotlin have emerged as the preferred choices for iOS and Android development, respectively. Kotlin is compatible with Java, features null safety, supports lambdas, and coroutines, and is known for being adaptable and easy to use. Kotlin's primary use cases include Android apps, web applications, desktop applications, and server-side application development. Data-Driven Decision Making: Languages for Data Science In the realm of data science, Python, R, and Matlab are popular choices. Python is the preferred language for data analysis and machine learning. This is because it has extensive libraries like NumPy, Pandas, and TensorFlow. R is preferred in academia and by data scientists for its capabilities in scientific and statistical computing, with applications for processing statistics that include linear and nonlinear modeling, calculation, testing, visualization, and analysis. Machine learning and deep learning applications can be built using Matlab, which provides tools for analyzing data, creating algorithms, processing images, and verifying research. It's also recommended for individuals with a solid understanding of mathematics to learn R for its statistical capabilities. The Versatility of General-Purpose Programming Languages General-purpose programming languages, also known as general-purpose programming languages, are engineered with versatility in mind, allowing software developers to solve a wide array of problems and write various types of software across multiple domains. In the quest to find the best programming language, one programming language may not be enough, as different programming languages like Java and Red Language exemplify versatility through their cross-platform capabilities, which is a primary consideration for their adoption in software development. Python, designed for high productivity, showcases its versatility by being extensible with languages such as C, which can significantly boost performance. Specifically, C++ is an example of a versatile general-purpose language with applications that range from video games to operating systems, indicating its adaptability across performance-intensive sectors. Multi-Faceted Python: A Closer Look Python's versatility is evident in its application across various domains such as web development, scientific computing, and artificial intelligence. Python's scalability allows it to be used for small-scale projects as well as large, complex system developments. Python boasts the following features: - User-friendly syntax, - Accessibility to developers working within different programming paradigms, - An extensive array of libraries facilitates development in areas such as data analysis, machine learning, and network servers. C++: Powering Performance-Intensive Applications C++ is known for its speed and performance, which are critical advantages for performance-intensive applications. C++ is commonly used for developing: - Operating systems, - Web browsers, - Desktop applications, - Games. C++ is valued for its large template library and proximity to hardware, which are foundational to many Windows software systems. Go: Designed for Today's Distributed Network Services Go stands out for its simplicity, enabling rapid development without sacrificing the performance of the software. Its design allows developers to efficiently manage massive codebases and networked systems which is essential in modern software development. Developed by Google in 2007, Go has become an ideal choice for APIs, and web applications, and particularly excels in cloud-native applications. The language's abilities make it highly suitable for today's distributed network services. Goroutines are integral to Go, allowing concurrent operations that are simpler to manage than conventional threads and perfect for distributed systems where multiple operations happen simultaneously. This underpins the language's capability to handle modern, networked systems and multicore processing. Specialized Languages for Targeted Development Tasks While general-purpose languages offer greater versatility, there's a place for specialized languages like SQL, Ruby, and Rust in targeted development tasks in databases, web development, and systems programming. Game development often relies on languages like C#, C++, and Python, which are commonly used with frameworks such as Unity and Pygame. Procedural programming languages like C are widely used in engineering and gaming, demonstrating their value for specific tasks in these fields. SQL: The Language of Databases SQL is a programming language specifically designed for managing relational databases. It is used to access and manipulate data within databases. It's not considered a general-purpose language. SQL is a declarative language and is significant for being the world's most widely used database query language, standardized in 1986 by the American National Standards Institute. SQL is used by various database management systems, such as: - Oracle, - Microsoft SQL Server, - PostgreSQL, - Microsoft Access. These systems rely on SQL to manage and query their databases. For data scientists and those working with relational databases, SQL is crucial for managing and analyzing large datasets. Ruby: Streamlined Code for Web and Application Development Ruby is celebrated for its simplicity, elegant syntax, and its design goal to be painless for programmers, appearing almost like it's practically written in English. In addition to back-end development, Ruby finds use in automation, data processing, and DevOps, demonstrating its versatility in the web development sphere. Primarily paired with the Ruby on Rails framework, Ruby becomes a formidable tool for back-end web development, offering developers a streamlined coding experience. The combination of the easy-to-learn Ruby language with the powerful Ruby on Rails framework creates an ecosystem conducive to rapid development and the construction of high-quality web applications. Rust: A New Contender for Systems Programming Finally, we'll examine Rust, a rising contender in the realm of systems programming. Rust is ideal for writing secure and fast system code because it combines low-level control with high-level safety features. This unique combination allows developers to create efficient and reliable software. For developers challenged by the complexities of Java and C++, Rust serves as a suitable successor, offering modern language construction and enhanced safety. However, it's important to consider its potential drawbacks in the context of systems programming. Pioneering Software Engineering with Object-Oriented and Functional Programming Besides understanding various programming languages, grasping the significance of different programming paradigms in software engineering is paramount. One such paradigm is the object-oriented programming language, which is centered around objects that represent both data and behavior, enabling developers to build complex, interconnected systems. OOP improves software modularity and maintenance by reusing code components, through mechanisms like: - Encapsulation, - Inheritance, - Polymorphism, - Abstraction. The ability to accurately model complex systems with OOP is attributed to its approach of reflecting real-world entities, enhancing realism and intuitiveness. On the other hand, functional programming languages are built on the fundamental principle of functions as the core building blocks, which is essential to crafting clean and maintainable software. Languages like: - Haskell, - Clojure, - Lisp, - Erlang, are just a few examples of other languages that developers can explore. Embracing Objects with C# C# is highly regarded for its high performance and stability as well as its emphasis on object orientation. It has gained a reputation for being a top choice among programmers for these reasons. Scala: Bridging OOP and Functional Programming Scala is a concise, statically typed language that combines functional and object-oriented programming on the Java Virtual Machine. Scala aims to improve upon Java's capabilities by offering more concise syntax and is ideal for scenarios like big data processing and machine learning that benefit from both OOP and functional programming concepts. Scala's ability to efficiently process large quantities of data has led to its adoption by companies such as Sony, Airbnb, Verizon, and Netflix, and its application in diverse industries including distributed computing, software engineering, data processing, and web development. Navigating the Multitude of Coding Languages Familiarity with a variety of languages can boost your adaptability and versatility - key traits in the dynamic tech industry. Developers often transition between various programming languages throughout their careers to address different types of problems. When considering which programming languages to learn, one strategy is to choose based on career goals, as different languages are suited for different industries. To determine the most suitable programming language to learn, one can also consider the following factors: - The language's demand and popularity within the industry, - The difficulty level of the language, - Existing programming knowledge, - Reasons for learning the language. Considering these factors will help you make an informed decision about which programming language to learn. Transitioning into Software Development: Learning Paths and Resources Various methods can help you learn software engineering languages, such as: - Undergraduate degrees, - Certificates, - Diplomas, - Bootcamps, - Online courses, - Self-study, - Additional resources like books and online tutorials. Coding boot camps are intensive courses that teach specific languages or skill sets aimed at making participants job-ready, providing a cost-effective and time-efficient alternative to traditional college education. Without a formal software engineering degree, individuals can still become software engineers by attending coding boot camps, completing online courses, or through self-teaching, and demonstrating their skills with a portfolio is essential for job market success. Employers in the tech industry often prioritize practical coding skills and exhibit a favorable attitude toward those who engage in networking and seek mentorship for professional development. From Novice to Expert: First Programming Language Choices Python, with its simple syntax, readability, and reputation as an accessible and versatile programming language, makes an excellent choice for beginners. Learning object-oriented programming is essential as it underpins the structure of many popular languages, including Python, and is crucial for software engineers to understand. When choosing their first programming language, novices should consider factors such as job demand, potential earnings, and personal interest areas. Cultivating Skills: Advanced Learning Opportunities Advanced learning opportunities are available for those who wish to further hone their skills. These include languages like Haskell, which is suited for writing compilers, interpreters, or static analyzers, and is also considered for artificial intelligence, natural-language processing, or machine-learning research. Scala is a hybrid programming language, a fusion of object-oriented and functional programming, ideal for tasks such as writing web servers or IRC clients. Online platforms such as Coursera offer advanced programming language courses, including specializations and professional certificates in computer science, which are designed to provide in-depth knowledge and demonstrate expertise in specific areas. These advanced courses cover a range of programming skills, such as data analysis, machine learning, and various programming languages including Python, JavaScript, and C++. The courses are available in different languages and include various learning products like guided projects, in-depth specializations, and degrees, catering to diverse learning preferences and goals. Learners can choose from different levels of difficulty, from beginner to advanced, to match their existing skills and learning objectives. Some of the offerings are available for free, allowing learners to gain valuable skills such as critical thinking and problem-solving without financial barriers. In a world where technology is evolving at a rapid pace, choosing the right programming language can be a game-changer. From the versatility of Python and the robustness of JavaScript to the enterprise solutions offered by Java, the landscape of programming languages is vast and diverse. Whether your interest lies in web development, mobile applications, data science, or software engineering, there's a programming language out there that's perfect for your needs. Remember, the journey to mastering a programming language can be challenging, but the rewards are worth it. With the right resources, mentorship, and dedication, anyone can transition into a rewarding career in software development. Frequently Asked Questions Which programming language should I learn first? You should learn Python first, as it is recommended for beginners due to its simple syntax and versatility. What role does JavaScript play in web development? JavaScript plays a fundamental role in web development by enabling interactive and sophisticated web applications through advanced client-side functions. What are some of the learning paths to becoming a software developer? You can become a software developer through undergraduate degrees, certificates, boot camps, online courses, self-study, and other resources like books and tutorials. Consider your learning style and the resources available to find the best path for you. What is the significance of object-oriented programming? The significance of object-oriented programming lies in its ability to represent data and behavior through interconnected objects, enabling the construction of complex systems. How can I cultivate advanced programming skills? You can cultivate advanced programming skills by taking specialized courses on online platforms like Coursera. These courses offer in-depth knowledge and professional certificates to demonstrate expertise in specific areas.
by: Kaelyn Lacefield Often seen as a complex and daunting sport, golf is quite simple once you understand the basics. Whether you're intrigued by the idea of hitting a little white ball across vast green landscapes of the western sloped golf courses, or simply looking for a new hobby, golf offers a unique blend of challenge and enjoyment. In this guide, we'll explore the fundamental rules and basics of golf, emphasizing the importance of taking lessons or learning from someone experienced to get you on your way being totally invested in the sport. Understanding the Basics: - Equipment: Golf requires minimal equipment to get started. All you need are a set of clubs, golf balls, tees, and comfortable shoes. Brands like Callaway, TaylorMade, and Wilson offer beginner-friendly equipment that can help ease you into the game. - Course Layout: A golf course typically has 18 holes, each with unique challenges. These holes vary in length and difficulty, offering opportunities for players of all skill levels to enjoy the game. Understanding the course layout and the different types of holes (par 3, par 4, and par 5) is essential for navigating the course effectively. - Scoring: Golf is a game of strokes, and you must complete each hole in as few strokes as possible. Your score for the round is the total number of strokes taken to complete all 18 holes. Keeping track of your score allows you to measure your progress and identify areas for improvement. - Rules and Etiquette: Golf has rules and etiquette that govern the game and ensure fair play and sportsmanship. Understanding basic rules such as tee box placement, order of play, and penalty strokes is crucial for a smooth and enjoyable round. Additionally, practicing good etiquette, such as repairing divots, raking bunkers, and maintaining the pace of play, enhances the experience for you and your fellow golfers. The Importance of Lessons: While golf can be learned through trial and error, taking lessons or learning from someone experienced can significantly accelerate your progress and improve your overall enjoyment of the game. Here's why: - Fundamental Instruction: Golf lessons provide a solid foundation of essential techniques, including grip, stance, posture, and swing mechanics. Mastering these basics early on sets you up for success and prevents the development of bad habits. - Personalized Feedback: A qualified golf instructor can offer customized feedback tailored to your needs and skill level. Individualized instruction can address your unique challenges and accelerate your improvement, whether it's correcting swing flaws, improving course management, or enhancing mental focus. - Confidence Building: Learning from a knowledgeable instructor or experienced golfer instills confidence in your abilities and helps alleviate the anxiety often associated with starting a new sport. With proper guidance and encouragement, you'll feel more comfortable and confident on the course, allowing you to enjoy the game entirely. As you begin on your golfing journey, remember that learning a new sport takes time and patience. Embrace the process, stay open to learning, and don't hesitate to seek help from qualified instructors or experienced golfers. By understanding the rules and basics of golf and investing in lessons, you'll set yourself up for success and unlock golf's countless joys. So, grab your clubs, hit the driving range, and prepare to tee off on a thrilling adventure into golf!
Introducing the Yamaha R6 MSRP: a comprehensive guide to the pricing and trends of this iconic sportbike. Dive into the factors that shape its value, explore historical MSRP data, and gain insights into future predictions. From production costs to market demand, this guide unravels the intricacies behind the Yamaha R6 MSRP, providing valuable information for consumers and industry enthusiasts alike. Yamaha R6 MSRP Overview The Yamaha R6 is a high-performance supersport motorcycle first introduced in 1999. It is known for its agile handling, powerful engine, and aggressive styling. The Manufacturer's Suggested Retail Price (MSRP) of the Yamaha R6 varies depending on the model year and specific features, but it typically ranges from $12,000 to $15,000. Factors Influencing MSRP Several factors influence the MSRP of the Yamaha R6, including: - Production Costs:The cost of materials, labor, and manufacturing processes involved in producing the R6 impacts its MSRP. - Market Demand:The popularity and demand for the R6 in the market influence its price. Higher demand can lead to a higher MSRP. - Competition:The pricing of competing supersport motorcycles, such as the Honda CBR600RR and Kawasaki ZX-6R, can also affect the MSRP of the R6. Historical MSRP Trends The MSRP of the Yamaha R6 has fluctuated over the past decade, influenced by technological advancements, economic conditions, and market competition. The table below provides a detailed overview of the MSRP changes over the past 5 years: Year \| MSRP \| 2018 \| $12,199 \| 2019 \| $12,499 \| 2020 \| $12,799 \| 2021 \| $12,999 \| 2022 \| $13,299 \| MSRP Changes, Yamaha r6 msrp From 2018 to 2022, the MSRP of the Yamaha R6 has increased by approximately 9%. This steady increase can be attributed to several factors: - Technological advancements: The R6 has undergone significant technological upgrades over the years, including a new engine, suspension, and electronics. These advancements have contributed to the increased MSRP. - Economic conditions: The overall economic climate, including inflation and supply chain disruptions, has also influenced the MSRP of the R6. - Market competition: The R6 competes with other high-performance motorcycles in the market, and its MSRP is influenced by the pricing of these competitors. Comparison with Competitors The Yamaha R6 faces stiff competition in the sportbike market, with several formidable rivals vying for market share. To provide a comprehensive overview, we will compare the MSRP of the R6 with its key competitors and explore the factors influencing the price differences. If you're considering upgrading your Yamaha R6, a new body kit can give it a fresh, sporty look. Check out our wide selection of yamaha r6 body kit options to find the perfect one for your style and budget. Whether you're looking for a complete fairing kit or just a few replacement parts, we have what you need to get your R6 looking its best. And with our competitive pricing, you can get the look you want without breaking the bank. So don't wait, order your Yamaha R6 body kit today! MSRP Comparison Table The following table presents the MSRP of the Yamaha R6 alongside its primary competitors: Motorcycle \| MSRP \| Yamaha R6 \| $12,199 \| Kawasaki Ninja ZX-6R \| $10,399 \| Honda CBR650R \| $9,499 \| Suzuki GSX-R600 \| $10,499 \| Triumph Daytona 765 \| $12,995 \| Factors Influencing MSRP Differences Several factors contribute to the variations in MSRP among these motorcycles, including: - Performance:Motorcycles with higher performance capabilities, such as higher horsepower and torque, typically command a higher price. - Features:Bikes equipped with advanced features like electronic rider aids, adjustable suspension, and premium components are often priced higher. - Brand Reputation:Motorcycles from established and reputable brands, such as Yamaha and Triumph, tend to have a higher MSRP due to their perceived quality and reliability. Regional Variations in MSRP The MSRP of the Yamaha R6 can vary significantly across different regions or countries. This is due to several factors, including: - Import duties: Countries may impose import duties on motorcycles, which can increase the MSRP. - Taxes: Taxes, such as sales tax or value-added tax (VAT), can also affect the MSRP. - Local market conditions: The supply and demand for the Yamaha R6 in a particular region can influence the MSRP. These MSRP variations can have implications for consumers in different regions. For example, consumers in countries with high import duties or taxes may have to pay more for the Yamaha R6 than consumers in countries with lower duties or taxes. The Yamaha R6 has an MSRP of $12,199. For those looking for a sleek and sporty ride, the Yamaha R6 is an excellent choice. If you're interested in learning more about the Yamaha R6 in grey, you can find more information here . Despite its impressive features, the Yamaha R6 remains competitively priced, making it an accessible option for riders seeking a thrilling experience on the road. Similarly, consumers in regions where the demand for the Yamaha R6 is high may have to pay a premium for the motorcycle. The Yamaha R6 has a Manufacturer's Suggested Retail Price (MSRP) of $12,199. This bike is known for its advanced features, including the Yamaha R6 Deltabox 3 frame, which provides exceptional handling and stability. Despite its high MSRP, the R6 remains a popular choice for riders who value performance and precision. Impact of Market Demand: Yamaha R6 Msrp The market demand for a product plays a significant role in determining its MSRP. The Yamaha R6 is no exception to this rule. When demand for the R6 is high, Yamaha can charge a higher MSRP, knowing that customers are willing to pay more for the bike. Conversely, when demand is low, Yamaha may need to lower the MSRP to attract buyers. There are a number of factors that can affect market demand for the Yamaha R6, including: - The overall economy: When the economy is strong, consumers are more likely to make discretionary purchases, such as buying a motorcycle. - The popularity of motorcycling: The popularity of motorcycling can also affect demand for the R6. If more people are riding motorcycles, there will be more demand for bikes like the R6. - The competition: The R6 competes with a number of other motorcycles in the market, including the Honda CBR600RR and the Kawasaki Ninja ZX-6R. If these bikes are more popular or offer better value for money, demand for the R6 may decline. Strategies to Adjust MSRP Based on Market Demand Yamaha uses a number of strategies to adjust the MSRP of the R6 based on market demand. These strategies include: - Offering discounts and incentives: When demand is low, Yamaha may offer discounts and incentives to attract buyers. These incentives may include cash rebates, low-interest financing, or free accessories. - Adjusting production levels: Yamaha can also adjust production levels to meet demand. If demand is high, Yamaha may increase production to meet the demand. If demand is low, Yamaha may decrease production to avoid overstocking. - Changing the product: Yamaha may also make changes to the R6 to make it more appealing to consumers. These changes may include adding new features, improving performance, or changing the styling. Future MSRP Predictions Predicting the future MSRP of the Yamaha R6 involves analyzing historical trends, market conditions, and industry forecasts. Several factors influence future MSRP changes, including technological advancements, economic conditions, and the competitive landscape. Technological advancements can drive up MSRP if they result in significant upgrades or new features. Economic conditions, such as inflation or recession, can also impact MSRP. Additionally, the competitive landscape, including the introduction of new models or changes in pricing strategies by competitors, can influence Yamaha's MSRP decisions. Potential Factors Influencing Future MSRP - Technological Advancements:Advancements in engine performance, electronics, and safety features can lead to increased production costs and higher MSRPs. - Economic Conditions:Economic downturns can lead to lower demand and potential MSRP reductions, while economic growth can support higher MSRPs. - Competitive Landscape:The introduction of new models or pricing changes by competitors can influence Yamaha's MSRP strategy. Predicting future MSRP is crucial for consumers and industry stakeholders. For consumers, it helps them plan their purchases and make informed decisions about their budget. For industry stakeholders, such as dealers and manufacturers, it provides insights into potential market trends and helps them adjust their strategies accordingly. Understanding the Yamaha R6 MSRP empowers consumers to make informed decisions, while industry stakeholders gain valuable insights into market dynamics. As the motorcycle landscape continues to evolve, this guide serves as a reliable resource for staying abreast of pricing trends and future developments.
Consider investing in a Heat Recovery Ventilation (HRV) system to improve your home's air quality and energy efficiency. This ventilation system is designed to recycle warm air inside your home and bring fresh air from the outside. It is an effective way to maintain indoor air quality while reducing energy costs. In this blog post, we will explore the benefits of installing an HRV ventilation system in your home. We will also discuss the different types of systems available and how to select the right one for your needs. Understanding Ventilation Systems for Homes Understanding home ventilation systems is crucial for maintaining a healthy and comfortable living environment. Ventilation systems are vital in circulating fresh air and removing pollutants, allergens, and excess moisture from indoor spaces. Ventilation systems exchange stale indoor air with fresh outdoor air, which helps to maintain optimal indoor air quality. Proper ventilation is especially important in modern airtight homes for energy efficiency. Indoor air can become stagnant without proper ventilation, leading to increased airborne contaminants and potential health issues. Several types of ventilation systems are available for homes, including natural, exhaust-only, supply-only, and balanced ventilation systems. Each system operates differently and has its advantages and disadvantages. By understanding the different ventilation systems available, homeowners can make an informed decision regarding improving their indoor air quality and energy efficiency. The next sections will delve deeper into specific types of ventilation systems and their benefits, helping you choose the right one for your home. Heat Ventilation and its Importance Proper heat-ventilation is paramount when creating a healthy and comfortable living environment in your home. Without it, your indoor air can become stale and stagnant, leading to a buildup of harmful pollutants and allergens. This can harm your health, causing respiratory issues, allergies, and other health problems. Heat-ventilation helps to remove excess heat from your home, especially during the warmer months, and circulate fresh air throughout your living spaces. By ensuring a steady flow of fresh air, heat-ventilation systems can also help to control humidity levels, preventing the growth of mold and mildew. In addition to maintaining a healthy indoor environment, proper heat ventilation is essential for energy efficiency. By removing excess heat, your cooling system doesn't have to work as hard, resulting in lower energy costs. Investing in a quality heat-ventilation system, such as an HRV-ventilation-system, can benefit your home and overall well-being. It's a wise choice for those looking to improve air quality and create a comfortable living space. What is an HRV-ventilation-system? An HRV-ventilation-system, or Heat Recovery Ventilation system, is a type of ventilation system that is specifically designed to improve indoor air quality and energy efficiency in homes. This system uses a heat exchanger to transfer heat from the stale indoor air to the fresh outdoor air brought into the home. By doing so, it not only removes pollutants, allergens, and excess moisture from the indoor air but also helps retain the heat that would otherwise be lost during the ventilation process. HRV-ventilation-systems are known for effectively balancing the exchange of fresh air and heat recovery, resulting in a more comfortable living environment. They are especially beneficial in colder climates, where homes must be properly ventilated without losing valuable heat. With an HRV system, homeowners can enjoy cleaner air, reduced energy costs, and improved overall comfort. How Heat Ventilation System Works? A heat ventilation system, commonly known as HVAC (Heating, Ventilation, and Air Conditioning), controls the indoor temperature, air quality, and humidity in buildings. It operates through a combination of mechanical and thermal processes. - Heating: In colder months, the system's heating component typically uses a furnace or heat pump to generate warm air. This heated air is distributed throughout the building via ducts and vents. - Ventilation involves exchanging indoor and outdoor air to maintain fresh indoor air quality. This is achieved by bringing in outside air and exhausting stale air. Filters and purifiers may be used to remove pollutants and allergens. - Air Conditioning: During hot weather, the system can cool indoor spaces using a compressor and refrigerant. Cold air is distributed similarly to heating but removes heat from indoor air instead of adding it. - Thermostat Control: A central thermostat allows users to set and maintain their desired temperature, and the HVAC system adjusts its operations accordingly. - Ductwork and Vents: Ducts transport the conditioned air to different rooms through vents, ensuring even distribution. - Exhaust Systems: Bathrooms and kitchens often have separate exhaust fans to remove moisture and odors. HRV vs. Other Ventilation Systems Regarding ventilation systems, there are various options to choose from. While HRV-ventilation-systems have unique benefits, it's important to consider how they compare to other ventilation systems. Exhaust-only ventilation system One popular alternative to HRV systems is the exhaust-only ventilation system. This system works by exhausting stale indoor air without introducing fresh outdoor air. While it can help remove pollutants from the air, it does not provide a continuous flow of fresh air, essential for maintaining optimal indoor air quality. Supply-only ventilation systems On the other hand, supply-only ventilation systems bring in fresh outdoor air without exhausting stale indoor air. While they can provide a steady flow of fresh air, they may not effectively remove pollutants and excess moisture from indoor spaces. Balanced ventilation systems Balanced ventilation systems, like HRV systems, balance bringing in fresh air and exhausting stale air. However, HRV systems have the added benefit of heat recovery, making them more energy-efficient than traditional balanced ventilation systems. In summary, while other ventilation systems may have advantages, HRV systems offer a unique combination of fresh air exchange and heat recovery, making them a top choice for those looking to improve indoor air quality and energy efficiency in their homes. Benefits of Installing an Heat Recovery System Installing a Heat Recovery System in your home offers a range of benefits that can greatly improve your living environment: - An HRV system helps maintain optimal indoor air quality by exchanging stale air with fresh outdoor air. This means that pollutants, allergens, and excess moisture are constantly removed from your home, reducing the risk of respiratory issues and allergies. - The heat recovery feature of an HRV system allows for energy efficiency by retaining heat that would otherwise be lost during the ventilation process. This leads to lower energy costs and a more comfortable living space. - HRV-ventilation-systems provide a balanced, fresh air flow, improving comfort and well-being. Investing in an HRV-ventilation-system is a smart choice for anyone looking to create a healthier, more energy-efficient home. Maintenance and Care of Hrv Ventilation-Systems Proper maintenance and care of your HRV-ventilation-system is essential to ensure optimal performance and longevity. You can keep your system running smoothly and effectively by following a few simple steps. - Firstly, cleaning and replacing the filters in your Hrv Ventilation regularly is important. These filters help to trap dust, pollen, and other particles, preventing them from entering your home. Over time, the filters can become clogged and hinder airflow. Cleaning or replacing them every few months will ensure that your system can efficiently remove pollutants from your indoor air. - Additionally, inspecting the ventilation ducts and fans for any obstructions or debris is crucial. Clearing away any dirt or debris will prevent airflow restrictions and maintain proper ventilation throughout your home. - Lastly, scheduling regular professional maintenance for your HRV system is highly recommended. A professional technician can thoroughly clean and inspect all components, ensuring everything functions correctly. Properly maintaining and caring for your Hrv-ventilation-system allows you to enjoy clean and fresh indoor air while maximizing energy efficiency. A small investment of time and effort can significantly impact your system's overall performance. Heat Exchange Ventilation Systems – An Alternative to HRV While Hrv-ventilation-systems are known for their ability to improve indoor air quality and energy efficiency, they are not the only option available. Another alternative to consider is a heat-exchange ventilation system. Heat-exchange ventilation systems recover the heat from stale indoor air before it is exhausted. This heat is transferred to the fresh outdoor air brought into the home. This process helps to retain the heat that would otherwise be lost during ventilation, making it a more energy-efficient option. One advantage of heat-exchange ventilation systems is their ability to provide a continuous fresh air flow while maintaining a comfortable indoor temperature. This is because the system recovers the heat from the outgoing air, ensuring the incoming air is not too cold. However, it's important to note that Heat Exchange Ventilation systems do not remove pollutants or excess moisture from the indoor air like HRV systems do. They solely focus on recovering heat. Therefore, if indoor air quality is your top concern, and Hrv-ventilation-system may be a better choice. Improving Air Quality and Health with Whole House Ventilation Improving air quality and promoting good health should be a top priority for any homeowner. One effective way to achieve this is through whole-house ventilation. Unlike traditional ventilation systems that focus on specific areas, whole-house ventilation ensures that every room in your home receives a constant supply of fresh, clean air. Investing in a whole-house ventilation system can significantly reduce indoor pollutants, such as allergens, mold, and volatile organic compounds (VOCs). Additionally, whole-house ventilation can help to control humidity levels, preventing the growth of mold and mildew. Excess humidity damages your home's structure and creates an ideal breeding ground for harmful bacteria and allergens. Whole-house ventilation systems contribute to a more comfortable living environment by maintaining a consistent temperature throughout your home. With fresh air constantly circulating, you can say goodbye to stuffy rooms and hello to a refreshing, rejuvenating atmosphere. Whole House Ventilation is an essential investment when creating a healthy and comfortable home. By improving air quality, reducing allergens and pollutants, and maintaining optimal humidity levels, you can enjoy a healthier and more enjoyable living environment for yourself and your family. Factors to Consider Before Installing a Ventilation System in Your Home - Several important factors must be considered when installing a ventilation system in your home. First and foremost, you need to assess your specific needs and goals. Are you primarily concerned about improving indoor air quality or reducing energy costs? Understanding your priorities will help guide your decision-making process. - Another crucial factor to consider is the size and layout of your home. Different ventilation systems are designed to accommodate different spaces. You need to ensure that your chosen system can effectively circulate fresh air throughout your home. - Additionally, it would help if you considered the climate you live in. Some ventilation systems, like HRV systems, are better suited for colder climates where retaining heat is crucial. On the other hand, heat-exchange ventilation systems may be more appropriate for moderate climates where energy efficiency is the main concern. - Lastly, you need to evaluate your budget. Ventilation systems can vary significantly in terms of cost. Finding a system that meets your needs is important without breaking the bank. 1. How does an HRV-ventilation-system improve air quality in my home? An HRV-ventilation-system continuously exchanges stale indoor air with fresh outdoor air. This constant airflow helps to remove pollutants, allergens, and excess moisture from your home, improving the overall air quality. An HRV system reduces the risk of respiratory issues and allergies by keeping indoor air clean and fresh. 2. Are Hrv-ventilation-systems energy-efficient? Yes, HRV-ventilation-systems are highly energy-efficient. These systems use a heat exchanger to transfer heat from the stale indoor air to the fresh outdoor air, retaining the heat that would otherwise be lost during the ventilation process. This results in lower energy costs as your heating and cooling systems don't have to work as hard to maintain a comfortable temperature. 3. Can an HRV system provide both fresh air and heat recovery? An HRV-ventilation-system balances bringing in fresh air and recovering heat. The heat exchanger in the system transfers heat from the outgoing air to the incoming air, allowing for both fresh air exchange and heat recovery. This ensures a continuous fresh air flow while maintaining a comfortable indoor temperature. 4. How often should I clean and replace the filters in my HRV system? It is recommended to clean or replace the filters in your HRV system every few months. The filters help trap dust, pollen, and other particles, preventing them from entering your home. Regular maintenance of the filters ensures that your system can efficiently remove pollutants from your indoor air. 5. Is professional maintenance necessary for my Heat Ventilation System? While regular maintenance by a professional is not necessary, it is highly recommended. A professional technician can thoroughly clean and inspect all components of your Heat Ventilation System, ensuring optimal performance and longevity. Professional maintenance also helps identify potential issues before they become major problems. In summary, investing in an HRV-ventilation-system can greatly improve your home's air quality and energy efficiency. By exchanging stale indoor air with fresh outdoor air, an HRV system helps remove pollutants, allergens, and excess moisture, creating a healthier living environment. Additionally, the heat recovery feature of an HRV system ensures that valuable heat is retained, resulting in lower energy costs. With the ability to provide a balanced flow of fresh air and heat recovery, HRV systems are a smart choice for those seeking a comfortable and energy-efficient home. Consider installing an HRV-ventilation-system to enjoy the numerous benefits it offers. Other Good Articles to Read \| Niche Blogs Connect \| Blogs 97 \| Blog Stitution \| Blogs Unplugged \| Blogs Cotch Rouge \| Blog Signatr \| Blog Sintonias \| Blog Zilla \| Consumer Forums \| Finance Forums \| G Blogs \|
When it comes to renovating your property, there are a number of common construction defects that you should be aware of in order to avoid potential issues down the line. These defects can range from minor aesthetic problems to serious structural issues that can compromise the safety and integrity of your home. By understanding and identifying these common defects, you can work with an expertise en bâtiment to ensure that your renovation project is completed successfully. One of the most common construction defects that homeowners may encounter during a renovation project is poor workmanship. This can include sloppy paint jobs, uneven flooring, and crooked walls. Poor workmanship not only affects the appearance of your home, but can also lead to more serious issues over time. For example, uneven flooring can cause tripping hazards, while crooked walls can indicate structural issues that need to be addressed. Another common construction defect to watch out for is moisture infiltration. Moisture can seep into your home through leaky roofs, windows, or plumbing fixtures, leading to issues such as mold growth, rot, and structural damage. It's important to address any signs of moisture infiltration as soon as possible to prevent further damage to your property. An expertise en bâtiment can help you identify the source of the moisture and recommend the appropriate measures to fix the problem. Electrical defects are another common issue that homeowners may encounter during a renovation project. This can include outdated wiring, overloaded circuits, and faulty electrical fixtures. Electrical defects can pose a serious safety hazard and should be addressed by a qualified electrician. An expertise en bâtiment can help you identify any electrical defects in your home and recommend the necessary repairs to ensure the safety of your property. Foundation issues are another common construction defect that homeowners should be aware of. Cracks in the foundation, sinking or shifting of the ground, and water infiltration can all indicate problems with the foundation of your home. Foundation issues can compromise the structural integrity of your property and should be addressed by a professional contractor. An expertise en bâtiment can help you identify foundation issues and recommend the appropriate repairs to prevent further damage to your home. In addition to these common construction defects, homeowners should also be aware of issues such as poor insulation, inadequate ventilation, and improper drainage. Poor insulation can lead to energy loss and increased utility bills, while inadequate ventilation can cause humidity problems and mold growth. Improper drainage can result in water pooling around your home, leading to foundation issues and water damage. An expertise en bâtiment can assess the insulation, ventilation, and drainage systems in your home and recommend the necessary improvements to ensure the comfort and safety of your property. In order to avoid these common construction defects in your renovation project, it's important to work with a reputable expertise en bâtiment. An expertise en bâtiment has the knowledge and experience to identify potential issues in your home and recommend the appropriate solutions to address them. By working with an expertise en bâtiment, you can ensure that your renovation project is completed successfully and that your property is safe, comfortable, and structurally sound. When selecting an expertise en bâtiment for your renovation project, be sure to choose a qualified professional with a good reputation in the industry. Look for an expertise en bâtiment who is licensed and insured, and who has experience working on similar projects. Ask for references and check online reviews to ensure that the expertise en bâtiment you choose is reliable and trustworthy. By working with an expertise en bâtiment and being proactive in identifying and addressing common construction defects, you can ensure that your renovation project is a success. By avoiding these common issues, you can protect the value and integrity of your property and enjoy a safe and comfortable living environment for years to come. Want to get more details? Expert en Bâtiment Paris, France Unlock the secrets to mastering the art of building with expertiseenbatiment.fr. Explore a world of industry insights, tips, and resources to take your construction skills to the next level. Are you ready to elevate your expertise in building?
Education – Integrated Language Arts/English Education Degree: BS Campus: Columbus College: Education and Human Ecology The integrated language arts/English education major is one of seven undergraduate programs in Ohio State's Department of Teaching and Learning that provides students the training needed to become a teacher. The structure and content of the program are designed to assist students in developing the knowledge, skills and disposition needed to become effective leaders and advocates for social justice in the field of education. Each program is led by world-renowned faculty, staff and graduate associates who oversee the progress of each individual pre-service teacher as they progress through an intense program of study. Upon completion of the program, students will also obtain initial licensure to teach grades 7–12 in English/language arts. This major is offered only on the Columbus campus. In applying for admission to the university, you may choose direct enrollment into the College of Education and Human Ecology as a major in the Integrated Language Arts/English program. Early in your program, you will explore your chosen career path through real-world experiences and seminars in the required First Education Experience Program (FEEP). During this service-learning course, you will spend meaningful time in partner pre-K-5 schools or other education settings. You will gain important insights into teaching and your career and will support young people's academic growth. You may take the course for either three or five credits — you will consult with your advisor about which is required for your degree choice. In the course, you will choose and complete a project that will immerse you in a hands-on activity serving students and the school. This program is designed to prepare students to sit for applicable licensure or certification in Ohio. If you plan to pursue licensure or certification in a state other than Ohio, please review state educational requirements for licensure and certification and state licensing board contact information at go.osu.edu/onground. The English teacher education major prepares students to teach in grades 7–12. The components of this major have been designed to meet state and national standards, Ohio licensure requirements and General Education requirements at Ohio State. The principal philosophy behind the curriculum is to provide a liberal education in subjects relevant to teaching grades 7–12 students as well as numerous opportunities for the student to experience, learn and reflect on effective pedagogy. This pathway emphasizes disciplinary content knowledge, educational foundations courses, and pedagogy and methods courses that focus on early exposure to adolescent development, and psychological and social foundations of education. Courses may include: - Adolescent Learning and Development in School Contexts - American literature course - British literature course - Developing Discipline for Effective Teaching - Inclusion: Philosophy, Society and Practical Issues of Secondary Education - Issues in Language, Literacy and Culture in Equity and Diversity - Journalism and New Media in 7–12 Classroom - Lab Experience in English Education - Language Education and Grammar for Teachers - Literature for Adolescents - Minority literature course - School and Society - Shakespearean literature course - Teaching and Reading Across the Curriculum - Teaching Inquiry and Methods: Writing - Teaching Inquiry and Methods: Literature The Global Option in Education and Human Ecology is an option for students in good academic standing on any Ohio State campus. In this program, students develop their ability to communicate with and work alongside individuals from other cultures through education abroad programs and globally themed course work. Field experiences are introduced early and culminate in an extended student teaching experience in the senior year. Teacher education is conceptualized as an apprenticeship with equal parts content knowledge and pedagogical knowledge and skill. Because they provide placement sites for all Columbus campus students, the schools in Franklin County, particularly Columbus City Schools, are critical partners in teacher education. Students will have field experiences each year of the program, with a one-semester student teaching experience at the end of their program. The First Education Experience Program is an open option service-learning general education course that allows undergraduate students to explore education as a possible career path through real-world experiences and seminars. As a FEEP student you will learn first-hand about the education field by spending time in local PreK-12 schools or other education settings. As a service-learning course, FEEP will allow you to gain and apply academic knowledge through civic engagement with communities and require you to complete a service-learning project. This course is a required prerequisite for several undergraduate licensure programs in education and is open for students who want to explore non-classroom education settings. The College of Education and Human Ecology Honors Program offers students rigorous course work and opportunities to work closely with faculty to design and complete a research project. Students in this program also have access to smaller classes, priority scheduling and unique housing opportunities. A significant outcome of the Honors Program is the high level of understanding gained in designing and conducting research studies and/or using and analyzing research findings and developing an understanding of the role of research in the expansion of knowledge in fields within human ecology. Kappa Phi Kappa is a national professional co-ed fraternity in education that connects members with development and career opportunities in education, informs members about education programs at Ohio State, introduces members to possible future colleagues, and helps support the Columbus community through service activities. Graduates of the English education program may seek teaching positions in grades 7–12 at public and private schools. Since the state of Ohio has high standards for teacher preparation, graduates could potentially be hired as teachers anywhere in the United States. Many opportunities also exist within the community and public sector. On average, new teachers with no previous teaching experience can expect starting salaries of $36,000-$42,000 per year. Through their course and field work, students will: - use their understanding of children's and adolescents' characteristics and needs and of multiple interacting influences on children's and adolescents' development and learning to create environments that are healthy, respectful, supportive and challenging for all children and adolescents - know about, understand and value the importance and complex characteristics of children's and adolescents' families and communities - know about and understand the goals, benefits and uses of assessment - integrate their understanding of and relationships with children/adolescents and families; their understanding of developmentally effective approaches to teaching and learning; and their knowledge of academic disciplines to design, implement and evaluate experiences that promote positive development and learning for all children and adolescents - identify and conduct themselves as members of the English education teaching profession Learn more Future students Academic info Teaching credentials Graduates of the integrated language arts/English education program will receive Ohio teacher licensure for grades 7–12 upon successful completion of program and state requirements.
Endoscopic spine surgery What is Endoscopic Spine Surgery? Endoscopic Spine Surgery is the LEAST invasive spine surgical technique currently available to patients. It is even less invasive than many techniques that pain doctors often offer for the treatment of spine conditions. It is an ultra-minimally invasive approach to the spine that utilizes 10 mm incisions (1 cm) that can be used to treat numerous conditions of the spine. It is similar to laparoscopic surgery in general surgery and arthroscopic surgery in orthopedics. Further, by using a ultra high-definition camera during surgery, surgical precision is maximized because even the finest anatomical details are able to visualized. In this context, it has been shown to further minimize complications during surgery and to accelerate surgical recovery following spine surgery even when compared to traditional micro-invasive surgical techniques, including laser spine surgery. Many surgeries that typically require hospitalizations following spine surgery can now safely be performed in an outpatient setting with spinal endoscopy. This means patients can go home the same day of surgery with minimal pain. However, spinal endoscopy is technically challenging, and requires extensive training and skill to perform it well. Dr. Chung has trained with some of the world's experts on spinal endoscopy here in the US and in South Korea and is amongst a small percentage of spine surgeons in the United States currently offering this type of surgery to their patients. Conditions we treat MRI and intra-operative camera imaging of a >80 year old, initially considered a non surgical candidate, who underwent two-level spinal endoscopy for sciatica and back pain due to spinal stenosis (nerve pinching). He was able to go home the same day with minimal pain and complete resolution of his pre-operative pain. Treatments we provide Endoscopic Decompression and Microdiscectomy Endoscopic lumbar and cervical decompressions and microdiscectomies are able to be performed utilizing small ports and specialized tools and camera equipment to allow for high precision with surgery. Specialized tools are used under direct camera visualization to unpinch the nerves or to remove a disc herniation. After surgery, you are left with an incision that is 1 cm or less in length. Endoscopic Lumbar Fusion Similarly, endoscopic fusions can be performed with use of small ports, specialized tools and camera equipment, along with computer navigation and/or robotics. Outpatient Surgery Many endoscopic spinal surgeries can be performed safely in an outpatient setting. This means you are able return home the same day of surgery. A word from Dr. Chung It is important to remember that not everybody is a candidate for endoscopic spine surgery and there is no one-size fits all procedure for everybody. In some instances, more traditional techniques are still best. With double fellowship training and further advanced training in endoscopic spine techniques, I have extensive experience in both traditional and the latest minimally invasive techniques as well as outpatient surgery. Let me help you decide which type of surgery is best for you.
NTOP field day showcases benefits of soil health practices Lance Fiekert's farm is a little different than most out in western Kansas. There are 350 chickens roaming around one of his irrigated circles. Other times of the year there will be cattle grazing. Sometimes there'll be a conventional sorghum crop, corn or cover crops on those acres. Fiekert told attendees at the recent No-Till on the Plains field day that in the time he's owned this particular circle, he is just now beginning to see an improvement in the soil. In addition to the added soil education, he's also been learning how to run cattle on his cover crops and milo stalks and has been learning the ins and outs of grazing from Protection, Kansas, rancher Mark Lohrding. "We've seen some pretty good things by moving cattle (through the circle), but also just having cattle out on milo stalks, on our next year's crops and I'm seeing that just now as we just start cutting milo," Fiekert said. "I'm seeing a few things that are making me glad that he's been bringing cattle up." He said there's benefits to be seen on the back end. "I've been in no-till for 15 years and everybody says this don't work," he said in disagreeing with that assessment. "I'm starting to see it." During the field day, the irrigated circle Fiekert showed with his cover crop had a diverse mix that includes sorghum, sudan, sunflower, sun hemp, and volunteer oats. He planted it July 29 and through irrigation it had received about 5 inches of water. He expects the leftover nitrogen to help in the future. "The sunhemp leaves some residue," he said. "The rapeseed is dual-purpose. Cattle eat the leaves, and next spring flowers will feed honeybees. We see a lot of regrowth." He plans on spraying the field if he does decide to go back into corn, as the rapeseed and buckwheat can be a little concerning. "I won't plant milo out here," he said. "It'll be a big mess. The shattercane will ruin it." During the last couple years, they've been strip grazing the cover crops, and eventually make their way through the circle. "The cattle eat what they like best first," Lohrding said. "As go through the winter, they move through it." Diversity in the field eases any nitrate concerns with the cattle. "Diversity causes less stress," he said. According to Fiekert, the polywire they use to keep the cattle contained works well for them, and the cattle move easily when it's time to move the fencing. But he still remains most impressed with the benefits to the soil the cattle bring. "Where we let the cattle graze for 100 days, it made 60 to 80 bushels," he said. Lohrding praises Fiekert's commitment and expertise. "The cattle helped," he said. "Lance is a good farmer." The cattle gained about one body condition score, according to Lohrding. In the time he's been grazing at Fiekert's they've only lost one. For the pair, it just makes sense. Sign up for HPJ Insights Our weekly newsletter delivers the latest news straight to your inbox including breaking news, our exclusive columns and much more. "Soil health is tied to finances. If it doesn't make sense financially, you can't do it," Lohrding said. "It's good for all of it." Kylene Scott can be reached at 620-227-1804 or [email protected].
Starting a business involves making crucial decisions, and one of the first choices entrepreneurs face is determining the business structure. In recent years, Limited Liability Companies (LLCs) have gained popularity due to their unique advantages and flexibility. In this article, we will explore the world of LLCs, from their formation to managing and running a successful business under this structure. What is LLC? LLC stands for "Limited Liability Company." It is a legal business structure that combines the limited liability protection of a corporation with the flexibility and pass-through taxation of a partnership or sole proprietorship. This structure is popular among small businesses and entrepreneurs due to its simplicity and benefits. Advantages of LLCs 1. Limited Liability Protection One of the primary reasons businesses opt for an LLC is the limited liability protection it offers. This means that the personal assets of the LLC members are safeguarded from business debts and liabilities. 2. Pass-Through Taxation LLCs enjoy pass-through taxation, where business profits and losses are passed through to the individual members' personal tax returns. This simplifies the tax process and avoids double taxation. 3. Flexibility in Management and Structure Unlike corporations with rigid structures, LLCs offer flexibility in management. Members can choose to manage the business themselves or designate a manager, allowing for a customized approach that suits the business's needs. How to Form an LLC 1. Choosing a Unique Business Name Selecting a distinctive and legally compliant business name is the first step in forming an LLC. This ensures that your business stands out and complies with state regulations. 2. Filing Articles of Organization Filing the articles of organization with the appropriate state authority is a crucial step in officially creating an LLC. This document typically includes essential details about the business, such as its name and address. 3. Creating an Operating Agreement While not mandatory in all states, creating an operating agreement is highly recommended. This internal document outlines the structure, management, and operational procedures of the LLC. Taxation for LLCs Pass-Through Taxation Explained Pass-through taxation means that the LLC itself does not pay taxes. Instead, profits and losses are passed through to the individual members, who report this information on their personal tax returns. Deductions and Benefits for LLCs LLCs enjoy various tax benefits, including the ability to deduct business expenses. Understanding and leveraging these deductions can significantly impact the overall tax liability of the business. Managing an LLC Roles and Responsibilities of Members Clearly defining the roles and responsibilities of each member contributes to a smooth and efficient operation of the LLC. This ensures that everyone is on the same page and working towards the common goals of the business. Holding Meetings and Record-Keeping While not as formal as corporations, holding regular meetings and maintaining accurate records are essential for LLCs. This helps in tracking decisions, maintaining compliance, and resolving disputes. LLC vs. Other Business Structures Contrasting LLCs with Sole Proprietorships and Corporations Understanding the differences between LLCs, sole proprietorships, and corporations is crucial for entrepreneurs. Each structure has its advantages and disadvantages, and the choice depends on the specific needs of the business. Reasons for Choosing an LLC over Other Structures The flexibility, limited liability, and tax benefits make LLCs an attractive option for many businesses. Exploring the reasons behind choosing an LLC can help entrepreneurs make informed decisions. Legal Requirements for LLCs 1. Compliance with State Regulations Each state has its regulations for forming and operating an LLC. Adhering to these regulations is essential to maintain the good standing of the business and avoid legal complications. 2. Annual Reporting and Fees LLCs are typically required to file annual reports and pay associated fees. Staying on top of these obligations is crucial for the continuous operation of the business. Common Misconceptions About LLCs 1. Clarifying Misconceptions About Liability Protection There is often confusion about the extent of liability protection offered by LLCs. Clarifying these misconceptions can help business owners make informed decisions. 2. Dispelling Myths Related to Taxation Myths surrounding the taxation of LLCs can lead to misunderstandings. Dispelling these myths provides a clearer picture of the tax advantages and obligations associated with this business structure. Choosing the Right State for Your LLC 1. Factors to Consider When Selecting the State of Formation The state in which you form your LLC can impact various aspects of your business. Understanding the factors to consider can help entrepreneurs make the right choice. 2. The Impact of State Laws on LLC Operations State laws vary, and they can affect the day-to-day operations of an LLC. Being aware of these differences ensures compliance and minimizes legal risks. LLC Operating Agreement Importance Understanding the Purpose and Benefits of an Operating Agreement While not legally required in all states, having an operating agreement is crucial for outlining the internal workings of the LLC. It helps prevent misunderstandings and conflicts among members. Creating a Customized Agreement for Your LLC Every LLC is unique, and an operating agreement should reflect its specific needs and goals. Tailoring the agreement to the business's characteristics ensures it is a valuable tool for success. Tips for Running a Successful LLC 1. Building a Strong Business Foundation Establishing a solid foundation is essential for the success of any business. This includes defining the mission, values, and goals of the LLC. 2. Navigating Challenges and Adapting to Changes Challenges are inevitable in business. Being able to navigate these challenges and adapt to changes ensures the resilience and longevity of the LLC. LLCs in the Digital Age 1. Utilizing Technology for LLC Management In today's digital age, technology can streamline many aspects of LLC management. Exploring tools and resources designed for this purpose can enhance efficiency. 2. Online Resources and Tools for LLC Owners From online filing services to cloud-based collaboration tools, there is a range of resources available for LLC owners. Utilizing these resources can save time and improve overall productivity. Future Trends for LLCs 1. Evolving Business Landscape and Its Impact on LLCs The business landscape is continually evolving. Understanding the trends shaping the future can help LLCs stay ahead of the curve and adapt to new opportunities and challenges. 2. Anticipated Changes in Regulations and Taxation Keeping an eye on anticipated changes in regulations and taxation is crucial for proactive compliance. Being prepared for changes ensures the continued success of the LLC. In conclusion, forming an LLC is a strategic move for entrepreneurs seeking limited liability, tax flexibility, and a customizable business structure. Understanding the advantages, legal requirements, and operational aspects of LLCs is crucial for making informed decisions and running a successful business. Frequently Asked Questions on LLCs 1. What is the main advantage of forming an LLC? Forming an LLC provides limited liability protection, safeguarding the personal assets of members from business debts and liabilities. 2. Do all states require an operating agreement for an LLC? While not required in all states, having an operating agreement is highly recommended as it outlines the internal workings of the LLC and helps prevent conflicts among members. 3. How is an LLC taxed? LLCs enjoy pass-through taxation, where business profits and losses are passed through to the individual members' personal tax returns. 4. Can an LLC be owned by a single person? Yes, an LLC can be a single-member LLC, owned and operated by one individual. 5. What is the role of an operating agreement in an LLC? The operating agreement outlines the structure, management, and operational procedures of the LLC, providing a framework for its internal workings. 6. Is it necessary to hold regular meetings for an LLC? While not as formal as corporations, holding regular meetings and maintaining accurate records is essential for the smooth operation of an LLC. 7. Can an LLC change its state of formation? Yes, an LLC can change its state of formation by filing the necessary documents and meeting the requirements of the new state.
Stunts in football are strategic moves by players to gain an advantage. They require coordination, timing, and anticipating the opponents. One stunt is the "stunt blitz", where a defensive player changes direction at the snap. This causes chaos and can lead to interceptions or sacks. The "line loop stunt" is used by defensive linemen. One fakes forward while the other loops around, aiming to penetrate any gaps. Stunts can also be combined with other strategies like zone coverage or man-to-man marking. This makes it hard for the offense to predict defensive movements. Specialized stunts need planning, practice, and communication between players. Coaches analyze opponents' tendencies and devise stunts to exploit weaknesses. Understand stunts to appreciate the game. Observe how defenses employ them to enhance enjoyment and refine skills. Next time you watch a football game, look out for stunts. These split-second decisions can turn a match around, leaving fans and opponents in awe. The Purpose of Stunts in Football To understand the purpose of stunts in football, dive into the world of tactical strategies. Gain insights into the types of stunts commonly used in the game, enabling teams to outmaneuver their opponents. Types of Stunts Stunts are a vital part of the football game – adding excitement and strategy. Players cleverly outwit and confuse their opponents by executing various types of stunts. - Delayed Stunts: Here, one or multiple defensive players delay their rush – hoping to mess up the offensive line's blocking plans. - Twist Stunts: Two defensive linemen switch positions, aiming to confuse the offensive linemen and create openings for others. - Games Stunts: This involves multiple defensive players, each with their own role. Their goal is to deceive the offensive line and pressure the quarterback. - Line Slant Stunts: Defensive linemen move laterally before the snap – disrupting the offensive blocking plans and making gaps for themselves or teammates. Unique variations can be used too. Special formations and deceptive tactics can surprise the opponents. To maximize the effectiveness of stunts, consider: - Good communication between teammates. - Knowing the opponent's weaknesses. - Timing the stunts correctly. - Develop individual skills – speed, agility, and deception. By following these suggestions, teams can use stunts strategically in football. Executed well, they give a strategic edge and add unpredictability to the game. The Mechanics of Stunts in Football To understand the mechanics of stunts in football, delve into the roles and responsibilities in executing them. Explore how each player contributes to the successful execution of stunts, and how this strategic maneuver impacts the dynamics of the game. Roles and Responsibilities in Executing Stunts Stunts in football involve specific roles and responsibilities. These must be done with precision and coordination for team success. Let's see what they are! - Defensive Ends penetrate offense, disrupt plays, and pressure QBs. - Linebackers read offensive formation, fill defense gaps, and tackle ball carriers. - Defensive Tackles engage with offensive linemen, stop runs up the middle. Defensive Ends also contain outside runs, while Linebackers focus on pass coverage and stopping runs between the tackles. - Defensive Tackles collapse the pocket and prevent the QB from stepping up. Together, these players create chaos for the opposing offense and strategically disrupt their plays. The Impact of Stunts on the Game To understand the impact of stunts on the game of football, delve into the advantages and disadvantages of using stunts. Discover how these strategic maneuvers can alter the course of the game and impact both the offense and defense. Explore the benefits and drawbacks of incorporating stunts into gameplay. Advantages and Disadvantages of Using Stunts Stunts in games can be both advantageous and disadvantageous. They can add excitement, make the game visually stunning and provide surprise. But they can also be tricky to execute, require extra resources and time, and come with safety concerns. To make the most of stunts, here are some tips: - Offer different levels of difficulty to suit players of all skill levels. - Introduce tutorials or practice modes to help players master stunts. - Test and perform quality assurance to ensure a smooth gaming experience. It's important to strike a balance between excitement and safety when using stunts in a game, to give players a memorable experience. Footballers' overhead kicks, fake injuries and other stunts prove that the show is just as interesting as the game itself! Famous Examples of Successful Stunts in Football In the NFL, successful stunts on the football field are not only thrilling but can also be game-changing moments. Throughout the history of the league, there have been several famous examples of successful stunts that have left a lasting impact. Here are a few memorable instances: 1. Lawrence Taylor's Sack on Joe Theismann (1985) Lawrence Taylor, the legendary linebacker for the New York Giants, executed one of the most iconic stunts in NFL history during a Monday Night Football game in 1985. Taylor's stunt involved a quick and deceptive move to penetrate the offensive line. He successfully sacked Washington Redskins quarterback Joe Theismann, breaking Theismann's leg in the process. This play is not only remembered for its sheer athleticism but also for its unfortunate consequences. 2. The New York Giants' Defensive Line (2007 Super Bowl) In Super Bowl XLII, the New York Giants employed a series of stunts and defensive line shifts to put constant pressure on New England Patriots quarterback Tom Brady. This relentless pass rush disrupted Brady's rhythm, leading to one of the biggest upsets in NFL history. The Giants' defense, led by Michael Strahan and Justin Tuck, sacked Brady five times and ultimately secured a 17-14 victory. 3. Von Miller's Super Bowl 50 Performance (2016) Von Miller, the Denver Broncos' star linebacker, put on a clinic of defensive stunts during Super Bowl 50 against the Carolina Panthers. Miller's ability to time his stunts perfectly and disrupt the Panthers' offensive line was a key factor in the Broncos' 24-10 victory. Miller himself recorded 2.5 sacks, two forced fumbles, and an interception, earning him the Super Bowl MVP title. 4. The "Fridge" Perry's Touchdown Run (1985) While not a traditional stunt, William "The Refrigerator" Perry's touchdown run during Super Bowl XX is one of the most memorable and unexpected moments in NFL history. Perry, a defensive tackle for the Chicago Bears, lined up as a fullback in a short-yardage situation. The stunt involved handing the ball to Perry, who plowed through the New England Patriots' defense to score a touchdown, showcasing his athleticism and surprising agility. 5. The "Philly Special" (Super Bowl LII, 2018) The "Philly Special" is one of the most famous trick plays in NFL history and can be considered a stunt due to its unconventional nature. During Super Bowl LII, the Philadelphia Eagles ran this trick play on fourth down, with quarterback Nick Foles catching a touchdown pass from tight end Trey Burton. The play helped the Eagles secure their first-ever Super Bowl victory, and its audacious execution remains a defining moment in the game's history. These famous examples of successful stunts in the NFL showcase the strategic brilliance, athleticism, and creativity that make football such an exhilarating sport. Whether it's a bone-crushing sack, a surprise trick play, or a relentless pass rush, these moments remind fans why they love the game of football. Frequently Asked Questions Q: What is a stunt in football? A: A stunt in football is a defensive scheme where players switch positions or execute a surprise movement during the play to confuse the offense. Q: How is a stunt different from a blitz? A: A stunt involves a coordinated movement by at least two defensive players, usually on the defensive line, to create confusion and gaps in the offensive line. A blitz involves sending extra players, usually linebackers or defensive backs, to rush the quarterback. Q: Why do teams use stunts in football? A: Teams use stunts to disrupt the opposing team's offensive game plan, create confusion in the offensive line, and generate pressure on the quarterback. Q: Who typically executes a stunt in football? A: A stunt is typically executed by the defensive linemen, especially the defensive tackles and defensive ends. Q: What are common types of stunts used in football? A: Common types of stunts include the loop, the twist, and the slant. In a loop, the defensive linemen switch positions to try and confuse the offensive line. In a twist, two linemen switch positions to create confusion in the offensive line. In a slant, the defensive linemen move laterally along the line of scrimmage to penetrate gaps in the offensive line. Q: When is it best to use a stunt in football? A: A stunt is typically used in situations where the defense needs to generate pressure on the quarterback or stop a specific play, such as a running play or a quick pass. It can also be used as a surprise tactic to catch the offense off guard during a critical moment in the game. Conclusion: Understanding the Significance of Stunts in Football Stunts in football are crucial for team strategy. These maneuvers confuse and disrupt opponents, creating chances for defense to sack or tackle. Successful stunts need perfect timing and coordination between defensive players: an essential part of defensive tactics. Stunts deceive the offensive line. Disguised movements and intentions catch the opposition off guard, allowing them to break through gaps and cause chaos. This surprise factor is what makes stunts so effective. Stunts also create mismatches. By using speed, agility, and intelligence, defensive players exploit weaknesses in the opposing team's offensive line. This strategic maneuvering leads to sacks or tackles for loss. Stunts need continuous practice and refinement. Coaches and players must watch films to identify weaknesses and areas of improvement. With these suggestions, teams can create a strong defensive strategy that takes full advantage of the importance of stunts in football.
Speed humps are engineered with a more gradual slope than speed bumps, allowing for a smoother transition for vehicles. Their elongated design is intended to reduce vehicle speeds over a longer distance without causing significant discomfort to drivers or passengers. Typically, speed humps have a height of 3 to 4 inches and extend across the full width of the road. They are often constructed from asphalt, rubber, or concrete, and may feature reflective markings for enhanced visibility. The following points outline key design features: - Gradual slope for gentle vehicle deceleration - Full road width coverage to prevent circumvention - Durable materials for longevity and minimal maintenance - Reflective elements for better nighttime recognition Appropriate Locations for Speed Hump Installation Speed humps are designed to reduce vehicle speeds in areas where pedestrian safety and traffic calming are of high priority. Unlike speed bumps, which are more abrupt, speed humps offer a gentler slowing effect and are therefore suitable for a wider range of locations. Typical locations for speed hump installation include:- Residential neighborhoods, where lower vehicle speeds are essential to protect residents and children at play. - School zones, to ensure the safety of students and staff crossing the road. - Near parks and recreational areas, where there is a high likelihood of pedestrians and cyclists. - Along streets that have a history of speeding issues or accidents, as a measure to encourage safer driving habits. How Speed Humps Influence Driving Behavior Speed humps are designed to encourage safer driving speeds in residential and high-pedestrian areas. Unlike the abrupt deceleration often required for speed bumps, speed humps allow for a smoother transition, prompting drivers to reduce speed without the necessity for a full stop.- Drivers tend to approach speed humps at a moderate pace, knowing that the gentler incline will not damage their vehicle if crossed at an appropriate speed. - The presence of speed humps has been shown to reduce overall vehicle speeds, which can lead to a decrease in the number and severity of accidents. - By promoting a steady flow of traffic, speed humps help maintain a balance between efficient travel and community safety. Materials and Methods for Installing Traffic Calming Devices The installation of traffic calming devices such as speed bumps and humps requires careful consideration of materials and methods to ensure longevity and effectiveness. High-quality, durable materials are essential, particularly in areas with varied weather conditions. For instance, modular rubber designs have gained popularity due to their resilience and adaptability to different environments. Installation typically involves a series of steps, starting with site selection and preparation, followed by the laying out of the device according to precise measurements. The process concludes with securing the device to the road surface, often using heavy-duty anchoring systems. It's crucial to follow the manufacturer's guidelines and local regulations to achieve the best results. Regular inspections and maintenance are part of the lifecycle of these devices to guarantee their continued performance and safety. This includes monitoring for wear and tear, ensuring visibility, and making necessary repairs or replacements when needed.Longevity and Maintenance Requirements The longevity of speed bumps and humps is largely determined by the materials used in their construction. Plastic Speed Bumps, often made from recycled materials, are known for their durability and resistance to weather conditions. Rubber Speed Humps are similarly robust, offering a long service life with minimal maintenance. Regular inspection and maintenance are crucial for ensuring that these traffic calming devices remain effective and safe. The maintenance routine typically includes:- Checking for wear and tear or damage - Ensuring visibility through repainting or replacement of reflective materials - Cleaning to remove debris and maintain surface traction Legal and Regulatory Aspects of Installation The installation of speed bumps and humps is subject to a variety of legal and regulatory considerations that vary by location. Local ordinances and state laws dictate the parameters for installing these traffic calming devices. For instance, public roads typically require approval from municipal authorities, while private property owners may have more leeway.- Public roads: Installation must comply with local traffic regulations, including obtaining necessary permits. - Private property: Owners may install speed bumps or humps, but they must consider shared ownership and obtain consent if applicable.
Why Toddlers Love Their Loveys In the whimsical world of toddlers, there exists a cherished companion that holds a special place in their hearts—the lovey, also known as a comfort object. These soft, snuggly companions provide more than just comfort; they offer a sense of security, familiarity, and emotional support to young children navigating the ups and downs of toddlerhood. In this exploration, we'll delve into why toddlers adore their loveys, the benefits of introducing a lovey, and tips for parents on nurturing this special bond, alongside addressing common parental concerns surrounding the use of loveys. The Magic of Loveys: Why Toddlers Form Attachments Toddlers are at a stage of rapid development, where they are learning to navigate the world around them and asserting their independence. In this journey, loveys serve as steadfast companions, offering comfort and reassurance during times of uncertainty or stress. The soft texture, familiar scent, and comforting presence of a lovey provide toddlers with a sense of security and emotional stability, helping them regulate their emotions and self-soothe in challenging situations.Why Introduce a Lovey: The Benefits for Toddlers Introducing a lovey to your toddler can offer a myriad of benefits, including: - Emotional Support: Loveys are more than just cuddly companions; they serve as steadfast sources of emotional support and comfort for toddlers, offering solace and security in times of uncertainty. When faced with unfamiliar or unsettling situations, such as starting daycare or spending a night away from home, toddlers often cling to their loveys for reassurance. These cherished objects provide a sense of continuity and stability amidst change, offering a familiar touchstone that helps toddlers navigate transitions with confidence. The tactile sensation of holding onto their lovey can soothe anxieties and ease fears, providing a sense of comfort and safety that is essential for emotional well-being. Loveys also play a vital role in promoting self-soothing skills, empowering toddlers to regulate their emotions and manage stress independently. By forming attachments to their loveys, toddlers develop a sense of agency and resilience, learning to cope with challenging situations in healthy and adaptive ways. As toddlers grow and explore the world around them, their loveys remain constant companions, offering unwavering support and companionship every step of the way. Ultimately, loveys serve as powerful tools for fostering emotional development and nurturing a sense of security and belonging in toddlers' - Transitional Object: Loveys act as vital transitional objects in a toddler's world, facilitating their journey through various separations and transitions. Whether it's saying goodbye to a caregiver at daycare, settling into bed for the night, or navigating changes throughout the day, loveys provide a comforting bridge between familiarity and the unknown. When toddlers clutch their loveys tightly, they are not just holding onto a physical object; they are holding onto a sense of security and continuity in the face of change. During moments of separation from caregivers, loveys offer a tangible connection to the familiar comforts of home, helping to ease the transition and soothe any feelings of anxiety or distress. Similarly, during bedtime routines, loveys provide a comforting presence that signals the start of a peaceful night's sleep. The familiar touch, scent, and texture of their loveys serve as soothing reminders of safety and warmth, helping toddlers drift off into dreamland with a sense of peace and security. Throughout the day, loveys accompany toddlers on their adventures, offering a sense of companionship and reassurance as they navigate new experiences and challenges. As toddlers grow and develop, their loveys remain steadfast companions, offering unwavering support and comfort through every transition and milestone. - Self-Soothing: Having a lovey by their side empowers toddlers to navigate their emotions and cultivate a sense of independence and resilience. When toddlers encounter moments of distress or discomfort, their loveys serve as reliable sources of comfort and security. Clutching onto their loveys, toddlers can self-soothe by engaging in calming behaviors such as hugging, stroking, or cuddling. The tactile sensation of their loveys provides a grounding presence that helps toddlers regulate their emotions and navigate through challenging situations with confidence. By learning to rely on their loveys for comfort, toddlers develop essential self-soothing skills that enable them to cope with stressors and transitions independently. This sense of self-reliance fosters a growing sense of confidence and autonomy, empowering toddlers to face new experiences and challenges with resilience. Additionally, the bond formed with their loveys nurtures a sense of emotional security and stability, providing toddlers with a safe haven to retreat to during times of uncertainty. As toddlers grow and develop, their loveys continue to play a crucial role in their emotional well-being, serving as steadfast companions that offer unwavering support and comfort through every stage of childhood. Ultimately, having a lovey allows toddlers to navigate the complexities of their emotions with grace and resilience, laying the foundation for healthy emotional development and well-being. - Sleep Aid: The presence of their beloved loveys acts as a soothing anchor, signaling to toddlers that it's time to unwind and drift off into dreamland. As toddlers snuggle up with their loveys, they experience a sense of comfort and warmth that promotes relaxation and tranquility, paving the way for more restful sleep. The tactile sensation of holding onto their loveys provides a calming effect that helps toddlers feel safe and protected, even in the darkness of night. Additionally, the emotional connection formed with their loveys creates a sense of emotional security that carries over into sleep, allowing toddlers to feel at ease and at peace as they drift off into slumber. By incorporating their loveys into their bedtime routine, toddlers develop a positive association with sleep, making bedtime a more enjoyable and comforting experience. Ultimately, the presence of their loveys promotes a sense of security and relaxation that contributes to more restful and rejuvenating sleep for toddlers, setting the stage for healthy growth and development. Tips for Introducing and Nurturing a Lovey If you're considering introducing a lovey to your toddler, here are some tips to help foster a positive bond: Choose the Right Lovey: Select a soft, cuddly lovey that appeals to your toddler's sensory preferences. Whether it's a plush animal, blanket, or stuffed toy, choose a lovey that your child finds comforting and appealing. Make it Smell Like Home: To make the lovey even more comforting, consider wearing it close to your body or sleeping with it for a few nights to transfer your scent onto the lovey. Your toddler will find comfort in the familiar scent of their caregiver, helping them feel safe and secure. Keep it Close: Encourage your toddler to keep their lovey with them throughout the day, whether it's during playtime, mealtimes, or outings. Having the lovey nearby provides a constant source of comfort and reassurance for your child. Incorporate it into Routines: Integrate the lovey into your toddler's daily routines, such as during naptime, bedtime, or moments of stress or upset. Encourage your child to cuddle with their lovey during these times to help them feel calm and secure. Be Patient and Supportive: Allow your toddler to form their own attachment to their lovey at their own pace. Offer plenty of encouragement and support as your child develops this special bond, and respect their attachment to their lovey as a source of comfort and security. In Conclusion Loveys play a significant role in the world of toddlers, offering comfort, security, and emotional support during the ups and downs of early childhood. By introducing a lovey to your toddler and nurturing this special bond with care and attention, you can provide your child with a comforting companion that offers solace and reassurance throughout their journey of growth and discovery. Embrace the magic of loveys as a cherished part of your toddler's world, knowing that these beloved companions play an invaluable role in nurturing your child's emotional well-being and fostering a sense of security and comfort in the world around them.
OtH 2016 – MOUNTAIN RESCUE Editor's note: What follows is extracted from Lighthouse, the RAF St Athan Magazine during the 1950s; the author of this article, 17 year old Don Shipton, writing under the pseudonym "Mountaineer," was a member of the St Athan MRU. The Christmas papers bore accounts of a young Army Officer who, climbing on Ben Nevis in the snow, was lost, and has since been presumed dead. The R.A.F. Mountain Rescue Unit of Kinloss, volunteered to search for this lost climber, and forfeiting their Christmas Grant, they raced 100 miles to the spot and searched for three days in appalling conditions, unfortunately without success. As we have a Mountain Rescue Unit at St. Athan, of which people know but little, perhaps this is the best time to give out some gen on the work, organisation, aims and purpose of the Mountain Rescue Service. To begin with, there are five units in the British Isles, all of whom come under the Rescue Group-the Group which deals with Air/Sea, Mountain and all forms of Rescue. They are located at St. Athan, Kinloss (Scotland), Llanbedr (North Wales), Harpur Hill (Derbyshire) and Topcliffe (Yorkshire). The aim of the service is to rescue aircrew from aircraft, service or civilian, which crash in parts normally inaccessible except by specialist units. Also for any other hazardous work of mercy such as the operation on Ben Nevis. We will deal with our own Unit at St. Athan, which until a year ago was based at Madely, Hereford, where it did some very fine rescue work indeed. The personnel are all volunteers, and well trained in ground navigation, both by day and night, walking, climbing, first aid and stretcher work. The unit covers the area from the South Coast of Wales up to Aberystwyth and across to the English border. Frequent exercises are held to accustom the personnel to the country in which they are likely to operate, and also, stretcher exercises with a special type of sledge-stretcher which is the only type suitable for the terrain are performed regularly. As well, square searches are carried out, for when a crash is located, it is always presumed someone has baled out and this involves a great amount of walking. The life is hard and grueling, for the average walk is roughly ten miles over really hard country and when one bears in mind that the Brecon Beacons range, which is a popular hunting ground, is the highest range in South Wales and rises to almost 3,000 feet, this will be apparent. The personnel are well equipped for the work with warm clothing for travelling, good stout climbing boots (which can be fitted to skis) and wind-proof suits for climbing. This is admirable while one presses on, but should one pause to appreciate a view, for instance-and there are some views breath-taking in beauty-he soon begins to freeze. For on the top it has been extremely cold since October. Indeed, six or seven weeks ago, even the waterfalls were frozen and there has been much snow and ice since. When on exercise, a forward base is set up and parties go out on pre-arranged routes which are mapped out at St. Athan. Parties usually comprise two or three men, one carrying the navigation pack which includes compass, altimeter, protractor and maps, first-aid kit, crash-axe, Verey pistols and cartridges, and so on while another carries the radio pack. For the whole time an exercise is on, continuous wireless communication between the parties and forward base (by "walkie-talkie") and forward base and St. Athan (by Morse) is maintained. So any important information can be transmitted within minutes. At the base is situated the mobile hospital, with Medical Officer and Orderly in attendance with all facilities, as well as the Main Radio Link and the Field Kitchen. Once the unit leaves St. Athan with its jeep and ambulance it is entirely self-supporting until it returns. Should the occasion arise, it could cope indefinitely until the crash were located and the personnel accounted for. Although this description is quite inadequate, at some later stage I would like to describe one of our exercises in full, in order to fill in some of the gaps. But, at least, it will serve to inform people of some of the work performed. At the time of writing, Command of the Unit is passing from F/Lt. Chandler, who has been with the unit since the Madely days, to F/O I. Geddes. This Officer will be pleased to interview anyone who is interested in Mountain Rescue. For there are always openings for volunteers who can "take it", who are physically suited and who are keen. Perhaps keenness is the best qualification of all! In closing (and I can't resist this), should there be anyone who, seeing the unit on its carefree way up the valleys to exercise and viewing it as a first-class scrounge, a hearty invitation is extended for him to join it for a trial. He will then learn how bitter some experiences are… In order to refute the popular impression that the Mountain Rescue Unit was lost over the period 20th February to 24th February, here are the facts. A week-end exercise was planned for a day and night climb in the Tregaron area of Cardigan and the Unit left Camp on Friday, 20th February, being scheduled to return on Sunday, 22nd February, But this was not to be . . . On the way up the weather was intensely cold, and the personnel travelling in open Jeeps had a very thin time of it. The village of Tregaron – last link with civilization – was reached, and from there up a rough, rocky track which had a sign-board "Unfit for motor vehicles", the Unit struck South West into the mountains. Among the rocks there was evidence of snow, but none was falling. It was the intention of the Unit to camp in bivouacs, but this was decided against as impracticable. So a deserted and derelict farmhouse was entered. This place had not been occupied since a Commando Unit was in occupation during the war, and was consequently in a shocking state of disrepair. Indeed, the outer wall was a clear foot away from the rest of the house, the stairs were falling to pieces and there were hardly any floor-boards left to the upstairs. The downstairs room was knee deep in debris – the accumulation of years – and all in all the place resembled more a pig sty than a dwelling house. But the Unit soon adapted itself to these conditions and by dint of hard work got the place fairly ship-shape. By 2100 hours the snow had started to fall. The searching parties set out on their fifteen-mile walk and the link radio station was set up on top of a mountain. It took three men to set this tent up because of the exposed location and the fierce wind. Incidentally, when the wireless operator emerged from the tent after his all-night vigil only the top of the tent showed above the snow. The exercise was on, and the snow was falling heavily. During the absence of the C.O. Unit, S/Ldr. Davis, F/ Lt. Akers assumed command. Also present were S/Ldr. Bailey of A.D. Rescue, Air Ministry and W/0 Pitcairn, the Chief Training Instructor of Mountain Rescue. There was also a senior N.C.O. from the Kinloss Unit present, who had been one of the team attempting a rescue on Ben Nevis at Christmas time. The long night with its raging blizzard passed on, and by morning all the parties except one returned to base, blue from exposure and with lumps of solid ice hanging from their eyebrows. They had had a very rough time of it. Of the other party there was no sign and continuous R/T watch was maintained. By mid-day, fifteen hours after they had set out, they were picked up on the radio, and returned to base at 1600 hours. Their walk had taken 16 hours, for they had lost their compass in the bogs, and found getting back difficult, to say the least. As the snow was now at a depth of over four feet it was deemed prudent to return to Camp before all the vehicles became immobilised. But it was left too late, and when Camp had been struck and a road cut through the snow for about a hundred yards, it was found that only Jeeps could get through. Further, two of the other vehicles had developed some mechanical trouble. So the party was split and two Jeep loads set off for St. Athan. It seemed that everything was against the Unit on this exercise, for when one of these Jeeps reached Lampeter, possibly because of the rough handling it had had in the snow, broke down, and the personnel were entertained to an uncomfortable night's rest in the Police cells. The other Jeep pressed on (a) to get the volunteers back, and (b) to get M.T. help from the Camp. Back at the farm-house it was hoped to make an early start on the Sunday, and get out then. But more snow came, and the position worsened. It was clear that men alone would never move the vehicles. Accordingly a party set out for the nearest farm-some three miles away – which was known to possess a tractor. This actually set out to give the Unit's M.T. a pull out, but became snow-bound itself and had to be abandoned. Meanwhile another party, F/ Lt. Akers, F/ Lt. Davidson, Sgt. Darnell and A.C. Hook struggled through to Tregaron, on foot, and contacted the Station. They were away all day and the effort they put into it must have been killing. Food was beginning to run low, and permission was granted to purchase food locally. Other parties went out, therefore, foraging at the local farms and came back loaded up. One volunteer carried 56 lbs. on his back for over three miles through the drifts. Then it was the fuel position. Normally the Unit, when making fires uses only dead wood, but the area of Camp, was singularly devoid of this and with the coverage of now, it was impossible to find any. So some trees were felled and chopping details ordered. Despite the cold, this was warm work indeed. But over the whole period of being snow-bound, hard work was the order of the day. The stream was frozen to a depth of a foot, and required breaking in every time water was wanted. The food position was low, and sleeping on the cold concrete floor, which even the sleeping bags could not improve became a trial after two days. Further being isolated with little sign of getting out began to tax even the strongest sense of humour. On Monday, a strong wind started and began to drift the snow high, leaving patches of bare earth. Then a quick thaw followed and a vehicle from Station transport, plus the Jeep which had returned from St. Athan to Tregaron, managed to force their way to within two miles of the farm. The Jeep being driven by W/0 Pitcairn. From there the drivers floundered up to base. A conference followed, and a plan of campaign formulated. First, all available hands were detailed for snow shoveling, and a huge drift about a quarter of a mile long and four feet deep was moved. The next step was to break camp and extricate the vehicles. The sludgy snow-heaped road up to the farm which cut through two streams was completely impassable, and a new route driven through a couple of fields. At one stage, this route lay down a huge terrifying slope and through another stream to the road. But by dexterous driving, and much heaving, all the vehicles finally made the road. There they dare not stop lest they got stuck, and it was funny to see the volunteers running along behind trying to get on. They were on their way. Further down, another mishap occurred when a diversion had to be made to avoid another great drift, and the heavily laden Bedford broke through the snow into a bog beneath. Another bit of man-handling was called for, and after two hours of solid -effort was finally cleared. Tregaron was reached by 1900 hours. So the Mountain Rescue Unit was overdue for two days only. Perhaps it was a good experience for them. Over this time, by human effort only, they kept St. Athan informed of their position even though each telephone call meant a grueling walk of 20 miles or thereabouts. They fettled for themselves, supported themselves and showed common sense and initiative. At no time were they lost, as uninformed people thought. And any time at all they could have got out by themselves, but it is against the traditions of the Unit to abandon any of their men, vehicles, or equipment. In closing the words of a famous airman's song are indeed apt. "Hardships. You don't know what hardships are . . . ."
The Significance of 58016-28-7 in Advancing Chemical Science 58016-28-7: Pioneering Research and Breakthroughs in Chemical Science Chemical science has always been at the forefront of innovation and discovery, constantly pushing the boundaries of what is possible. One compound that has played a significant role in advancing chemical science is 58016-28-7. This compound, also known as 2,4-Dichloro-5-fluoroacetophenone, has been the subject of pioneering research and breakthroughs in various fields of chemistry. One of the key areas where 58016-28-7 has made a significant impact is in the development of new pharmaceuticals. Researchers have discovered that this compound possesses unique properties that make it an ideal starting point for the synthesis of novel drugs. Its chemical structure allows for modifications and substitutions that can lead to the creation of compounds with enhanced therapeutic properties. In addition to its potential in drug development, 58016-28-7 has also been instrumental in the field of materials science. Scientists have found that this compound can be used as a building block for the synthesis of advanced materials with desirable properties. By incorporating 58016-28-7 into the molecular structure of materials, researchers have been able to enhance their strength, conductivity, and other important characteristics. Furthermore, 58016-28-7 has proven to be a valuable tool in the study of chemical reactions and mechanisms. Its unique reactivity and stability have allowed scientists to investigate complex reaction pathways and gain a deeper understanding of fundamental chemical processes. By studying the behavior of this compound under different conditions, researchers have been able to uncover new reaction mechanisms and develop more efficient synthetic routes. The significance of 58016-28-7 in advancing chemical science cannot be overstated. Its versatility and potential applications have attracted the attention of researchers from various disciplines, leading to a wealth of groundbreaking discoveries. The compound's ability to serve as a starting point for the synthesis of new drugs and materials has opened up exciting possibilities for the development of innovative solutions to pressing challenges in healthcare, energy, and other fields. Moreover, the research conducted on 58016-28-7 has paved the way for the development of new synthetic methodologies and techniques. Scientists have leveraged the unique properties of this compound to devise novel strategies for the synthesis of complex molecules. These advancements have not only expanded the toolbox available to chemists but have also accelerated the pace of discovery in the field. In conclusion, 58016-28-7 has played a pivotal role in advancing chemical science through its contributions to drug development, materials science, and the study of chemical reactions. Its unique properties and versatility have made it a valuable tool for researchers seeking to push the boundaries of what is possible in the field. As scientists continue to explore the potential of this compound, we can expect further breakthroughs and innovations that will shape the future of chemical science. Exploring the Potential Applications of 58016-28-7 in Various Industries 58016-28-7: Pioneering Research and Breakthroughs in Chemical Science Chemical science has always been at the forefront of innovation and discovery, constantly pushing the boundaries of what is possible. One such breakthrough in recent years has been the identification and exploration of the compound 58016-28-7. This compound, with its unique properties and potential applications, has captured the attention of researchers and scientists across various industries. One of the most promising areas where 58016-28-7 shows great potential is in the field of medicine. Researchers have discovered that this compound has remarkable anti-inflammatory properties, making it a potential candidate for the development of new drugs to treat a wide range of inflammatory diseases. These diseases, such as arthritis and asthma, affect millions of people worldwide, and finding effective treatments is of utmost importance. The discovery of 58016-28-7 opens up new possibilities for the development of targeted therapies that can alleviate the suffering of patients and improve their quality of life. In addition to its anti-inflammatory properties, 58016-28-7 has also shown promise as an antimicrobial agent. With the rise of antibiotic-resistant bacteria, finding new ways to combat infections has become a top priority in the medical field. Preliminary studies have shown that this compound has potent antimicrobial activity against a variety of pathogens, including drug-resistant strains. This opens up new avenues for the development of novel antibiotics that can effectively fight these dangerous infections and save lives. The potential applications of 58016-28-7 are not limited to the medical field alone. In the agricultural industry, this compound has shown promise as a plant growth regulator. By stimulating plant growth and enhancing crop yields, it has the potential to revolutionize agriculture and help address the global food security challenge. With a growing population and limited arable land, finding ways to increase crop productivity is crucial. The use of 58016-28-7 as a plant growth regulator could provide a sustainable solution to this problem, ensuring an adequate food supply for future generations. Another industry that could benefit from the potential applications of 58016-28-7 is the cosmetics industry. Researchers have found that this compound has skin rejuvenating properties, making it a valuable ingredient in anti-aging skincare products. As people strive to maintain youthful and healthy-looking skin, the demand for effective anti-aging treatments continues to grow. The use of 58016-28-7 in skincare products could offer a natural and safe alternative to traditional anti-aging ingredients, providing consumers with effective and sustainable solutions. The exploration of the potential applications of 58016-28-7 is still in its early stages, but the initial findings are promising. As researchers continue to delve deeper into the properties and mechanisms of this compound, new breakthroughs and applications are likely to emerge. The potential impact of 58016-28-7 on various industries, from medicine to agriculture and cosmetics, is immense. It represents a new frontier in chemical science, where innovation and discovery hold the key to solving some of the world's most pressing challenges. In conclusion, the compound 58016-28-7 has captured the attention of researchers and scientists across various industries due to its unique properties and potential applications. From its anti-inflammatory and antimicrobial properties in medicine to its potential as a plant growth regulator in agriculture and a skin rejuvenating ingredient in cosmetics, this compound holds great promise. As research continues, the potential breakthroughs and applications of 58016-28-7 are likely to revolutionize these industries and pave the way for a brighter and more sustainable future. Unveiling the Mechanisms and Reactions of 58016-28-7 in Chemical Processes 58016-28-7: Pioneering Research and Breakthroughs in Chemical Science Chemical science has always been at the forefront of innovation and discovery, constantly pushing the boundaries of what is possible. One such breakthrough that has captivated the attention of researchers and scientists alike is the compound known as 58016-28-7. This compound has proven to be a game-changer in the field, unveiling new mechanisms and reactions that have the potential to revolutionize various chemical processes. At its core, 58016-28-7 is a unique compound that possesses remarkable properties. Its molecular structure allows it to interact with other substances in ways that were previously unknown. This has opened up a world of possibilities for researchers, who have been able to uncover the intricate mechanisms and reactions that occur when 58016-28-7 is introduced into various chemical processes. One of the most significant breakthroughs in the study of 58016-28-7 is its role in catalysis. Catalysis is a process that accelerates chemical reactions without being consumed in the process. It is a crucial aspect of many industrial processes, and the discovery of 58016-28-7's catalytic properties has been a game-changer. Researchers have found that when this compound is introduced into a reaction, it can significantly increase the rate at which the reaction occurs, making it more efficient and cost-effective. Furthermore, the study of 58016-28-7 has shed light on the mechanisms behind various chemical reactions. By carefully analyzing the interactions between this compound and other substances, researchers have been able to unravel the intricate steps that take place during a reaction. This knowledge has not only deepened our understanding of chemical processes but has also paved the way for the development of new and improved reactions. One area where the study of 58016-28-7 has shown immense promise is in the field of drug discovery. The pharmaceutical industry is constantly searching for new compounds that can be used to develop life-saving medications. The unique properties of 58016-28-7 make it an ideal candidate for drug development, as it has the potential to interact with specific targets in the body, leading to the development of more effective and targeted therapies. In addition to its catalytic and drug discovery potential, 58016-28-7 has also been found to have applications in environmental science. The compound has shown promise in the removal of pollutants from water and air, offering a sustainable solution to the growing problem of pollution. By understanding the mechanisms and reactions of 58016-28-7, researchers have been able to develop innovative methods for the removal of harmful substances, contributing to a cleaner and healthier environment. The study of 58016-28-7 is a testament to the power of scientific research and the potential for groundbreaking discoveries. This compound has opened up new avenues of exploration in chemical science, unveiling mechanisms and reactions that were previously unknown. From catalysis to drug discovery and environmental applications, the possibilities for 58016-28-7 are endless. As researchers continue to delve deeper into the study of this compound, it is clear that there is still much to be learned. The future holds exciting possibilities for 58016-28-7, and it is only a matter of time before its full potential is realized. In the meantime, scientists and researchers will continue to push the boundaries of what is possible, using 58016-28-7 as a catalyst for innovation and discovery in the field of chemical science.58016-28-7 is a chemical compound that has contributed to pioneering research and breakthroughs in the field of chemical science. Its unique properties and applications have opened up new avenues for scientific exploration and innovation. Through extensive studies and experiments, researchers have been able to uncover its potential in various fields, such as medicine, materials science, and environmental sustainability. The compound's significant contributions to chemical science have paved the way for further advancements and have the potential to revolutionize various industries in the future.
If you have been watching or reading world news, you are aware that another virus is spreading in small clusters in the UK and has also now been reported in Canada, the U.S., Portugal, Germany, Spain, and several other nations. Late last week, the World Health Organization declared monkeypox to be a global health emergency, a rare designation that acknowledges the rapid spread of this disease. Right now the epicenter of the illness is in Europe. "We have an outbreak that has spread around the world rapidly, through new modes of transmission, about which we understand too little," WHO Director General Tedros Adhanom Ghebreyesus said. "For all of these reasons, I have decided that the global monkeypox outbreak represents a public health emergency of international concern." According to WHO, the virus spreads through skin-to-skin contact or contaminated surfaces with the homosexual men at greatest risk. With the designation, the WHO now views the outbreak as a significant enough threat to global health that a coordinated international response is needed to prevent the virus from spreading further and potentially escalating into a pandemic. Monkeypox, an infectious disease closely related to smallpox, originates from Africa and is typically spread among small mammals like rats, not monkeys! It was first identified in the 1950s and originally jumped to the human population in the 1970s. With all its highly contagious and deadly variants, should we be concerned about another world pandemic on the heels of COVID-19 and what does the Bible say? Jesus Christ warned about a greatly increased incidence of pestilence and disease as one of the signs of His impending return (Luke 21:11). Some end-times scholars also say that this is a manifestation of Revelation 16:1-2: "Then I heard a mighty voice from the Temple say to the seven angels, 'Go your ways and pour out on the earth the seven bowls containing God's wrath.' So the first angel left the Temple and poured out his bowl on the earth, and horrible, malignant sores broke out on everyone who had the mark of the beast and who worshiped his statue." While some urge that we are not that deep into the end times yet, we are in the beginning of sorrows as Jesus described in Matthew 24:4-8: "Take heed that no one deceives you. For many will come in My name, saying, 'I am the Christ,' and will deceive many. And you will hear of wars and rumors of wars. See that you are not troubled; for all these things must come to pass, but the end is not yet. For nation will rise against nation, and kingdom against kingdom. And there will be famines, pestilences, and earthquakes in various places. All these are the beginning of sorrows." As we witness more cases of monkeypox being reported across North American and European nations, we need to pray that no plague shall come near our dwelling tent.
There are various types of Indian Folk Paintings based on different times and regions of the country. Some of which might have similar concepts. India has a long tradition of artistic excellence and painting is one of the major mediums that have been used to express it. Paintings flourished in India since ancient times. Archeologists have found wall paintings in the parts of India, which suggest that even the early historic man in India was engaged in activities of art and leisure. History of paintings can be known from primitive rock paintings. They were followed by the painted pottery of the Indus Valley Civilization, but the real beginning of the art of painting began from the Gupta Age. Those artistic values and approaches are visible in Indian Folk paintings that are still made though they are not well known in commercial platforms. 1. Pattachitra – Folk Paintings Pattachitra is a traditional and ancient artwork originated from Odisha and are made in Odisha and West Bengal. The theme of Odia painting centres round the Jagannath and the Vaishnava sect. Since beginning of Pattachitra culture, Lord Jagannath who was an incarnation of Lord Krishna has been the major source of inspiration. The subject matter of Pattachitra is mostly mythological, religious stories and folk lore. The painting the 'pattachitra' resemble the old murals of Odisha especially religious centres of Puri, Konark and Bhubaneshwar region, dating back to the 5th century BC. These paintings are done on small strips of cotton cloth. The canvas is prepared by coating the clothing with a mixture of chalk and gum made from tamarind seeds. Then it is rubbed by taking the help of two different stones and then the cloth is dried. The mixture of gum and chalk gives the cloth's surface a leathery finish on which the artists paint with vegetable, earth and stone colours. Painters do not use pencil or charcoal for the preliminary drawings. They are so expert in the line that they simply draw directly with the brush either in light red or yellow. Then the colours are filled in. The final lines are drawn and the patta is given a lacquer coating to protect it from weather, thus making the painting glossy. This process of glazing or varnishing is quite interesting. The painting is held over a fireplace so that the back of the painting is exposed to heat. On the surface of the painting fine lacquer is applied. 2. Saura – Folk Paintings Saura Paintings are made by Saura Tribe from Southern Odisha. Saura Tribes are amongst the most ancient tribes of India. The Saura wall paintings are called Italons or Ikons (or Ekons) and are dedicated to Idital (also Edital) the main deity of the Sauras. These paintings draw upon tribal folklore and have ritualistic importance. Ikons make extensive use of symbolically pregnant icons that mirror the quotidian chores of the Sauras. People, horses, elephants, the sun and the moon and the tree of life are recurring motifs in these ikons. Ikons were originally painted on the walls of the Saura's adobe huts. The paintings' backdrop is prepared from red or yellow ochre earth which is then painted over using brushes fashioned from tender bamboo shoots. Ekons use natural dyes and chromes derived from ground white stone, hued earth, and vermilion and mixtures of tamarind seed, flower and leaf extracts. 3. Warli – Folk Paintings Warli painting is a form of tribal art mostly created by the tribal people from the North Sahyadri Range in Maharashtra, India. This tribal art was originated in Maharashtra, where it is still practiced today. The Warli Painting tradition are among the finest examples of the folk style of paintings. The style of Warli painting was not recognized until the 1970s, even though the tribal style of art is thought to date back as early as 10th century A.D. Warli culture is centered on the concept of mother nature and elements of nature are often focal points depicted in Warli painting. Farming is their main way of life and a large source of food for the tribe. They greatly respect nature and wildlife for the resources that they provide for life. Warli artists use their clay huts as the backdrop for their paintings. The walls are made of a mixture of branches, earth and red brick that make a red ochre background for the paintings. The Warli only paint with a white pigment made from a mixture of rice flour and water, with gum as a binder. A bamboo stick is chewed at the end to give it the texture of a paintbrush. Jivya Soma Mashe, the artist in Thane district has played a great role in making the Warli paintings more popular. He has been honored with a number of national and central level awards for his paintings. In the year 2011, he was awarded Padmashree. The central motif in each ritual painting is the square, known as the "chauk" or "chaukat" and the scenes portraying hunting, fishing, and farming, and trees and animals. 4. Pithora Paintings Pithora is a ritualistic painting done on the walls by the Rathwa and Bhilala tribes who live in central Madhya Pradesh. Pithora paintings are executed on three inner walls of their houses. These paintings have significance in their lives and executing the Pithora paintings in their homes brings peace, prosperity and happiness. There is never an attempt to imitate nature: a horse or a bull, which might be a vision of a god, impresses him with only one central quality. Pithora paintings are more of a ritual than an art form. These rituals are performed either to thank God or for a wish or a boon to be granted. A Pithora is always located at the threshold, outside the first front wall or inside on the walls of the first room as one enters a house. Three walls are prepared for the painting, the front wall and the two on either side of it. The front or central wall is very large, twice the size of each of the sidewalls. These walls are treated with two layers of cow dung paste and one layer of white chalk powder. Unmarried girls bring in these materials. The main wall of the verandah that divides it from the kitchen is considered sacred to the Pithora. The wall paintings related to the legends of creation and Pithoro, are done on this wall. The two sidewalls of the veranda are also painted with figures of minor deities, ghosts and ancestors. 5. Manjusha Painting Manjushas are an folk traditional Indian art form originated from ancient city of Anga which is known as Bhagalpur in modern day . They are temple-shaped boxes comprising eight pillars. They are made of bamboo, jute, and paper. Manjushas also contain paintings of Hindu gods and goddesses and other characters. This art originated in the state capital, Champa. Which is currently located in Bhagalpur Bihar. Based on folklore, Bihula traveled to heaven by water carrying the body of her famine, fictitious, serpent-bitten husband Bala-Lakhendra in a multi-story boat NumaManjusha built by Dev Shilpi Vishwakarma, and returned her dead husband alive and called Sati. This incident is the story of Shiva's human daughter Mansha, Chandra Saudagar and Bihula's rituals, struggle in the Anga region. The colors which are mainly used in painting are Pink, yellow and green. In some cases, the common auxiliary colors associated with these three colors, such as green and orange, are also used. Black color is used in the human shape to bring out the snake-venom. These colors have esoteric and symbolic meanings. The pink and yellow colors signify excitement and exuberance, while green is a symbol of gloom and growth. The traditional artist of Manjusha painting, Chakravarti Devi used natural colors. But now posters, water, oil and 'acrylic color' are being used. 6. Thagka Painting Thangka Paintings are common in Indian States of Sikkim, Himanchal Pradesh, Ladakh region and Arunanchal Pradesh. These were originally used as a medium of reverence that evoked the highest ideals of Buddhism. Thangkas can be divided into three types according to their depiction and meaning. - The first one that shows the life of Buddha from his birth to his enlightenment. - The second kind is more abstract. It represents Buddhist belief of life and death including 'Wheel of Life'. - The third kind represents paintings that are used for offerings to the deities or meditation. Whereas typical tangkas are fairly small, with painted area between about 20 to 50 centimeters high, there are also giant festival tangkas, usually appliqué, and designed to be unrolled against a wall in a monastery for particular religious occasions. These are likely to be wider than they are tall, and may be sixty or more feet across and perhaps twenty or more high. In Bhutan at least these are called thongdrels. There are also larger than average thangkas that were designed for altars or display in temples. Tangkas are painted on cotton or silk. The most common is a loosely woven cotton produced in widths from 40 to 58 cm (16 – 23 inches). While some variations do exist, tangkas wider than 45 cm (17 or 18 inches) frequently have seams in the support. The paint consists of pigments in a water-soluble medium of animal glue. Both mineral and organic pigments are used. The paint was applied as a warm liquid, mixed shortly before application. 7. Madhubani – Folk Paintings Traditionally done by the women of various communities in Mithila region, Madhubani Paintings are also called Mithila Paintings. It originated from Madhubani district of the Mithila region of Bihar. These paintings have a common theme and are usually drawn from religious motifs of the Hindus. The figures in the painting are symbolic. For example, fish depicts good luck and futility. The paintings were traditionally done on freshly plastered mud walls and floors of huts, but now they are also done on cloth, handmade paper and canvas. This painting is done with a variety of tools, including fingers, twigs, brushes, nib-pens, and matchsticks and using natural dyes and pigments. The colors used are derived from plants. For example, Ochre, Lampblack and Red are used for reddish-brown and black, respectively. It is characterised by its eye-catching geometrical patterns. Madhubani paintings mostly depict people and their association with nature and scenes and deities from the ancient epics. Natural objects like the sun, the moon, and religious plants like tulsi are also widely painted, along with scenes from the royal court and social events like weddings. Generally, no space is left empty; the gaps are filled by paintings of flowers, animals, birds, and even geometric designs.
The five occurrences that you may have unthinkingly accepted as historical facts are, in reality completely untrue or, at the very least, greatly embellished. It is important to reconsider these events as they have been widely accepted despite lacking a basis in reality or containing exaggerated elements. (1)Nero didn't fiddle while Rome burned Ah, Nero, the original unconcerned bystander. This first-century Roman emperor certainly isn't blameless in the story of Rome's fiery fall, he definitely wasn't playing the fiddle during it. For one thing, Nero wasn't even in the city when the fire began; he was in Antium, about thirty miles outside of the city. For another…there was no such thing as a fiddle in ancient Rome. (2)Rats didn't actually spread the Black Death Recent studies have discovered that rats may not actually be to blame for this devastating plague that wiped out a third of 14th century Europe. So it's time to rat out the real culprit. Scientists at the University of Oslo conducted an experiment that assessed the potential transmission routes for the deadly pandemic. (3)An apple never fell on Isaac Newton's head The story that the famous mathematician had an epiphany about gravity after being bonked on the head by a piece of fruit is most likely an embellishment of what really happened. The first time the apple story appeared was in a biography of Newton written by his friend William Stukeley in 1792. (4)Ben Franklin didn't discover electricity Ben Franklin's famed experiment involving a key tied to a kite wasn't quite the revolutionary scientific venture you might think it was. He certainly didn't "discover" electricity; scientists already were well aware of its existence in 1752, the year of Franklin's experiment. (5)Vincent van Gogh didn't cut off his ear Not all of it, anyway. The artist only severed the bottom part of his left ear, and no one knows for sure the reason he did it. He was certainly suffering from severe depression at the time. Some historians claim that he was agitated after a spat with his artist frenemy Paul Gaugin. Others claim that it was an act of rage committed after he learned that his brother, who was a major source of financial and emotional support for him, was engaged. One thing is for sure, though: it definitely wasn't his entire ear.
Artificial Intelligence (AI) is a field of computer science and engineering that focuses on the development of machines and software systems that can perform tasks that typically require human intelligence, such as visual perception, speech recognition, decision-making, and natural language processing. AI systems can be designed to learn from experience and adapt to new situations, allowing them to improve their performance over time. There are various types of AI, including: Rule-based systems: These systems are based on a set of predefined rules that dictate how the system should behave in different situations. Machine learning: These systems use statistical techniques to enable machines to improve their performance on a specific task through experience and feedback. Deep learning: A type of machine learning that uses neural networks to model complex relationships and patterns in data. AI has numerous applications in various industries, including healthcare, finance, transportation, and entertainment. AI systems are also used in autonomous vehicles, chatbots, virtual assistants, and other intelligent machines. However, there are concerns about the ethical implications of AI, such as the potential for bias in decision-making, the risk of automation displacing human jobs, and the possible misuse of AI for nefarious purposes. - Apartment Management Software - Automobile Management Software - Complaint Management Software - CRM Management Software - CA Farm Management Software - ECommerce Management Software - Energy Management Software - ERP with GST Management Software - Fleet Management Software - Garage Management Software - Garment/Fashion Industry Software - Hospital Management Software - Hotel Management Software - Human Resource Management Software - Industrial Management Software - Learning Management Software - Library Management System - Medical/Dental Clinic Software - Payroll Management Software - Project Management Software - Realestate Management Software - Sales Management CRM - Security & Manpower Management Software - Jewellery Management Software - Android Application Development - IOS Application Development - Windows Application Development - Web Application Development - Game Development - Digital Marketing - Search Engine Optimization - Company Branding - Explainer Video - Ecommerce Development - Search Engine Marketing - Social Media Marketing Services - Online Payment Gateway - Business Development Services - Global IT Consulting & Outsourcing Research & Development - Hospitality Industry - Insurance Sector - Educational/Non Profit - Retail Business - Consumer Goods - Human Resource Industry - Software Technologies - Manufacturing Sector - Oil and Gas Sector - Financial Services - Transportation and Logistics - Trading Industry - Textile Industry - Realestate and Construction - Energy Sector - Health Sector Business Partnership Hire, Train & Deploy Program Learn & Earn Program On / Off Campus Drive Join the Revolution - Current Job Openings - Apply For A Job - Freelancing - External Consultant
Motion pictures have long been a preferred form of entertainment, fascinating audiences with their storytelling and visuals. However, their impact goes past mere amusement. Films have the ability to inspire and provoke deep reflection, providing a unique and valuable source of insight into the human condition. In this article, we will discover how movies can transcend entertainment and develop into a source of inspiration and self-reflection. The Power of Storytelling On the coronary heart of each great movie lies a powerful story. Whether or not it's a gripping narrative that transports us to a different world or a thought-provoking exploration of complex themes, storytelling in films has a profound impact on our emotions and perspectives. Movies have the ability to touch our hearts, elicit empathy, and make us really feel related to characters and situations that we might not have encountered otherwise. By way of the art of storytelling, motion pictures can serve as a catalyst for personal development and transformation. A Window into Different Cultures and Views Films have the remarkable ability to transport us to completely different occasions, places, and cultures. They provide a window into worlds that we could by no means have the possibility to expertise firsthand. By showcasing diverse perspectives, movies can broaden our horizons and foster understanding and empathy for people from completely different backgrounds. Whether it's a foreign film that introduces us to unfamiliar customs or a historical drama that sheds light on past events, films serve as a bridge between cultures and promote a more inclusive worldview. Exploring Advanced Themes and Issues Motion pictures have the power to tackle complex themes and points, providing a lens by way of which we will study and mirror upon numerous points of life. From existential questions concerning the which means of existence to social and political commentary, films can prompt us to think critically in regards to the world around us. They will challenge our assumptions, spark conversations, and encourage us to take action. Whether or not it's a thought-provoking documentary that sheds light on necessary societal points or a fictional narrative that explores moral dilemmas, movies have the potential to ignite prodiscovered introspection and stimulate mental curiosity. Inspiration and Motivation Motion pictures usually function inspirational characters and tales that can ignite a spark within us. They showcase people who overcome adversity, pursue their desires, or make a positive impact on the world. These narratives can function a supply of motivation, encouraging us to pursue our own goals, overcome obstacles, and embrace our true potential. Whether it's a biographical film celebrating the achievements of a historical determine or a fictional story of personal triumph, motion pictures can encourage us to try for greatness and remind us of the power of the human spirit. Films provide more than just entertainment; they provide a platform for inspiration and reflection. By storytelling, diverse perspectives, exploration of complicated themes, and inspirational narratives, films can go away a long-lasting impact on our lives. By engaging with films on a deeper level, we will unlock their potential to inspire personal growth, broaden our understanding of the world, and encourage meaningful self-reflection. If you loved this article and also you would like to receive more info regarding new to dvd generously visit the web-site.
Coming from an editorial content background, I have always valued taxonomies for making content findable, but more recently I have come to appreciate how taxonomies can also play a role in making data accessible and useful. Taxonomies have successfully aided people in finding and retrieving desired content since the 1990s and even decades earlier, if we consider thesauri within the scope of taxonomies. Nevertheless, the focus had always been on content: originally printed content, such as periodical articles, web pages, intranet or CMS pages and attached documents, etc., and then multimedia content, such as images, animation or video clips, audio files. Each content item gets tagged with taxonomy terms of different types for what is about and for kind of content it is. Taxonomies have become increasingly important as content volume and types have grown, especially as more people in varied roles create content. Meanwhile, data has grown even faster in its volume and potential value. We are hearing more and more about big data, data warehouses, data lakes, data fabrics, data catalogs, data analytics, master data management, data governance, FAIR data, data centric architecture, data-driven enterprises, and data science in general. Tools and technologies to make use of the data have included programming/scripting, machine learning, algorithms, natural language processing, and other forms of artificial intelligence. These tools and technologies for data do not replace taxonomies and other controlled vocabularies, though, which still have an important role to play in connecting people to the desired data and information, and ultimately knowledge. I see two ways in which taxonomies are linked to data: - Managing and understanding the data in a standardized way with better metadata, which depends on controlled vocabularies. - Connecting the data with graph databases, knowledge graphs, ontologies, and ultimately taxonomies Taxonomies and metadata Metadata refers to the standardized data types, properties, fields, or elements, and the specific individual values that populate those types or properties. From a content perspective, we think of metadata as serving content management and retrieval, such as the content's format type, title, source, creator, date, language, subjects, category, audience, etc. But metadata exists in databases and spreadsheets, too, where column headers are the metadata properties. For example, contact metadata would include name, phone number, email address, city/state, country, contact type, initial contact date, contact owner, etc. Product metadata would include SKU number, product name, product type/category, price, color, features, supply source, retail availability, etc. Transactional metadata would include purchased product name, purchaser, purchase date, purchase price, purchase location. Data can be better managed and analyzed if the metadata properties and values are standardized and controlled. Controlled vocabularies should be used to standardize the metadata for many of the properties: format type source, subjects, category, purpose, country, contact type, product name, product category, color, features, availability, etc. Hierarchical taxonomies serve some of this metadata, such as product categories. As an example, I'm planning to attend a conference in Austin, TX, and I wanted to look up contacts in the Austin area in my CRM (customer relationship management) system. Filtering results by city, I found some with the city of Austin, but others had the city of Round Rock. Filtering on Austin, I would have missed those, had I not known that Round Rock was a suburb of Austin. What was needed was a metadata property for "Metropolitan area," rather than "City," a controlled list of metropolitan areas, and Round Rock as an alternative label for Austin area in that controlled vocabulary. Taxonomies and ontologies Taxonomies, controlled vocabularies, and metadata alone are good for filtering or queries to find content that meets a set of criteria (based on metadata properties or faceted taxonomy selections). But what if you want to discover and explore relationships across the data? Instead of merely looking for all the contacts in the Austin area that have the customer or sales-qualified-lead status and have a contact owner, I want to limit that further to contacts whose employers in turn meet certain criteria, such as belonging to specific industries or meeting an annual revenue minimum. Another query example would be to find the locations in the past 10 years of industry events in which a specific organization has participated. These connections across different metadata types, vocabularies, or categories, are made with an ontology. An ontology has, besides any hierarchical relationships characteristic of a taxonomy, additional semantic relationships that connect across types or classes of entities. Classes may be for metropolitan area, company name, person name, industry event name, etc. Semantic relationships across these classes may include is-employed-by-company/employs-employee, sponsors-event/has-sponsor, is-located-in/is-location-of. Attributes are additional metadata for the entities of each class, such as address. "Ontology" typically refers to just the knowledge model of classes, relationships and attribute types. But to become useful in information retrieval and data analysis, an ontology is connected to a taxonomy or other controlled vocabulary to extend those semantic relationships and attributes to all the concepts/terms. Taxonomies and knowledge graphs A growing use of ontologies is in knowledge graphs. Knowledge graphs extend the ontology+taxonomy knowledge organization system further by integrating instance data that is a of set too large to fit into controlled vocabularies and tends to reside in databases or spreadsheet cells. This could be the 10,000s of contacts in a CRM or products and product parts in a PIM (product information management) system. The knowledge graph brings, actually or virtually, the data from these different systems into a graph database. A graph database is structured of nodes and edges (connections between nodes), rather than of tables of rows and columns characteristic of a relational database. Data entities are at the nodes and connections of relations or property types are designated along the connecting edges. The graph structure thus supports the model of the applied ontology, which has classes and individuals at the nodes and semantic relations or attribute types describing the edges. Why knowledge graphs? Taxonomies, controlled vocabularies, and metadata alone are good for finding information in a single content/data repository, database, or content management system. But often the same, similar, or related information exists in multiple different sources or systems, as data or as content "silos," such as product information residing in the PIM, the web ecommerce platform, the marketing content management system, and the sales management system. By extracting the data from these different sources and storing it in a single graph database, the connections between the data from all sources can be made. Knowledge graphs link data that is in different repositories and systems, both structured and unstructured data and as such provide a unified view of the data. Furthermore, with taxonomies tagged additionally to content, relevant data and content and be linked to each other. Opportunities for taxonomies and data together In conclusion, taxonomies alone are focused on content, but if you combine taxonomies with ontologies and/or diverse metadata, you extend the use of taxonomies to data. I am also seeing the connections of taxonomies and data in more places. My current job title is Data and Knowledge Engineer, which reflects the combination of the knowledge management and data science realms. Actually, I am not a data engineer at all, but my department has at Semantic Web Company standardized the job titles, as we knowledge engineers and data engineers work very closely together on the same teams. This is to provide combined services and solutions to our customers. In other ways data and taxonomy are combined in jobs. Last year I had a contract taxonomy job that was heavily into data (managed in spreadsheets). In the other direction, data related job postings have taxonomies in their job descriptions. A search today on "taxonomy" in descriptions of LinkedIn jobs brought up Data Governance Consultant, Data Analyst II – Taxonomy, Taxonomy Data Architect, Data Custodian, Data Governance Lead in the top 25 results, and on Indeed it brought up Data Analyst, Junior Data Analyst, Data Annotator, and Data Entry Specialist in the top 15 results. I have most keenly noticed this combination of taxonomies and data by participating in more data-related conferences recently. In 2021, among other conferences, I have spoken on taxonomies at Data-Centric Architecture Forum in February, the European Data Conference on Reference Data and Semantics (ENDORSE) in March, the Knowledge Graph Conference in May, and Data Con LA in September. Upcoming are my masterclass "Foundation for a Knowledge Graph: Taxonomy Design Best Practices" at the virtual Connected Data World conference on December 2, and a tutorial "Introduction to Taxonomies for Data Scientists" and presentation "The Future of Taxonomies – Linking Data to Knowledge" both at Data Day Texas on January 22 in Austin, TX.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.